WorldWideScience

Sample records for highly conserved cis-regulatory

  1. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape.

    Science.gov (United States)

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; De Waele, Kathleen; De Schepper, Jean; François, Inge; Menten, Björn; Heath, Karen E; Gómez-Skarmeta, José Luis; De Baere, Elfride

    2015-12-03

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements.

  2. Global profiling of rice and poplar transcriptomes highlights key conserved circadian-controlled pathways and cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Sergei A Filichkin

    Full Text Available BACKGROUND: Circadian clocks provide an adaptive advantage through anticipation of daily and seasonal environmental changes. In plants, the central clock oscillator is regulated by several interlocking feedback loops. It was shown that a substantial proportion of the Arabidopsis genome cycles with phases of peak expression covering the entire day. Synchronized transcriptome cycling is driven through an extensive network of diurnal and clock-regulated transcription factors and their target cis-regulatory elements. Study of the cycling transcriptome in other plant species could thus help elucidate the similarities and differences and identify hubs of regulation common to monocot and dicot plants. METHODOLOGY/PRINCIPAL FINDINGS: Using a combination of oligonucleotide microarrays and data mining pipelines, we examined daily rhythms in gene expression in one monocotyledonous and one dicotyledonous plant, rice and poplar, respectively. Cycling transcriptomes were interrogated under different diurnal (driven and circadian (free running light and temperature conditions. Collectively, photocycles and thermocycles regulated about 60% of the expressed nuclear genes in rice and poplar. Depending on the condition tested, up to one third of oscillating Arabidopsis-poplar-rice orthologs were phased within three hours of each other suggesting a high degree of conservation in terms of rhythmic gene expression. We identified clusters of rhythmically co-expressed genes and searched their promoter sequences to identify phase-specific cis-elements, including elements that were conserved in the promoters of Arabidopsis, poplar, and rice. CONCLUSIONS/SIGNIFICANCE: Our results show that the cycling patterns of many circadian clock genes are highly conserved across poplar, rice, and Arabidopsis. The expression of many orthologous genes in key metabolic and regulatory pathways is diurnal and/or circadian regulated and phased to similar times of day. Our results confirm

  3. Extensive conservation of ancient microsynteny across metazoans due to cis-regulatory constraints.

    Science.gov (United States)

    Irimia, Manuel; Tena, Juan J; Alexis, Maria S; Fernandez-Miñan, Ana; Maeso, Ignacio; Bogdanovic, Ozren; de la Calle-Mustienes, Elisa; Roy, Scott W; Gómez-Skarmeta, José L; Fraser, Hunter B

    2012-12-01

    The order of genes in eukaryotic genomes has generally been assumed to be neutral, since gene order is largely scrambled over evolutionary time. Only a handful of exceptional examples are known, typically involving deeply conserved clusters of tandemly duplicated genes (e.g., Hox genes and histones). Here we report the first systematic survey of microsynteny conservation across metazoans, utilizing 17 genome sequences. We identified nearly 600 pairs of unrelated genes that have remained tightly physically linked in diverse lineages across over 600 million years of evolution. Integrating sequence conservation, gene expression data, gene function, epigenetic marks, and other genomic features, we provide extensive evidence that many conserved ancient linkages involve (1) the coordinated transcription of neighboring genes, or (2) genomic regulatory blocks (GRBs) in which transcriptional enhancers controlling developmental genes are contained within nearby bystander genes. In addition, we generated ChIP-seq data for key histone modifications in zebrafish embryos, which provided further evidence of putative GRBs in embryonic development. Finally, using chromosome conformation capture (3C) assays and stable transgenic experiments, we demonstrate that enhancers within bystander genes drive the expression of genes such as Otx and Islet, critical regulators of central nervous system development across bilaterians. These results suggest that ancient genomic functional associations are far more common than previously thought-involving ∼12% of the ancestral bilaterian genome-and that cis-regulatory constraints are crucial in determining metazoan genome architecture.

  4. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    Directory of Open Access Journals (Sweden)

    William A Rogers

    2013-08-01

    Full Text Available The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE, little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B and sex-determination (DSX transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  5. In silico identification of conserved intercoding sequences in Leishmania genomes: unraveling putative cis-regulatory elements.

    Science.gov (United States)

    Vasconcelos, E J R; Terrão, M C; Ruiz, J C; Vêncio, R Z N; Cruz, A K

    2012-06-01

    In silico analyses of Leishmania spp. genome data are a powerful resource to improve the understanding of these pathogens' biology. Trypanosomatids such as Leishmania spp. have their protein-coding genes grouped in long polycistronic units of functionally unrelated genes. The control of gene expression happens by a variety of posttranscriptional mechanisms. The high degree of synteny among Leishmania species is accompanied by highly conserved coding sequences (CDS) and poorly conserved intercoding untranslated sequences. To identify the elements involved in the control of gene expression, we conducted an in silico investigation to find conserved intercoding sequences (CICS) in the genomes of L. major, L. infantum, and L. braziliensis. We used a combination of computational tools, such as Linux-Shell, PERL and R languages, BLAST, MSPcrunch, SSAKE, and Pred-A-Term algorithms to construct a pipeline which was able to: (i) search for conservation in target-regions, (ii) eliminate CICS redundancy and mask repeat elements, (iii) predict the mRNA's extremities, (iv) analyze the distribution of orthologous genes within the generated LeishCICS-clusters, (v) assign GO terms to the LeishCICS-clusters, and (vi) provide statistical support for the gene-enrichment annotation. We associated the LeishCICS-cluster data, generated at the end of the pipeline, with the expression profile of L. donovani genes during promastigote-amastigote differentiation, as previously evaluated by others (GEO accession: GSE21936). A Pearson's correlation coefficient greater than 0.5 was observed for 730 LeishCICS-clusters containing from 2 to 17 genes. The designed computational pipeline is a useful tool and its application identified potential regulatory cis elements and putative regulons in Leishmania. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Identification of High-Impact cis-Regulatory Mutations Using Transcription Factor Specific Random Forest Models.

    Directory of Open Access Journals (Sweden)

    Dmitry Svetlichnyy

    2015-11-01

    Full Text Available Cancer genomes contain vast amounts of somatic mutations, many of which are passenger mutations not involved in oncogenesis. Whereas driver mutations in protein-coding genes can be distinguished from passenger mutations based on their recurrence, non-coding mutations are usually not recurrent at the same position. Therefore, it is still unclear how to identify cis-regulatory driver mutations, particularly when chromatin data from the same patient is not available, thus relying only on sequence and expression information. Here we use machine-learning methods to predict functional regulatory regions using sequence information alone, and compare the predicted activity of the mutated region with the reference sequence. This way we define the Predicted Regulatory Impact of a Mutation in an Enhancer (PRIME. We find that the recently identified driver mutation in the TAL1 enhancer has a high PRIME score, representing a "gain-of-target" for MYB, whereas the highly recurrent TERT promoter mutation has a surprisingly low PRIME score. We trained Random Forest models for 45 cancer-related transcription factors, and used these to score variations in the HeLa genome and somatic mutations across more than five hundred cancer genomes. Each model predicts only a small fraction of non-coding mutations with a potential impact on the function of the encompassing regulatory region. Nevertheless, as these few candidate driver mutations are often linked to gains in chromatin activity and gene expression, they may contribute to the oncogenic program by altering the expression levels of specific oncogenes and tumor suppressor genes.

  7. Network discovery pipeline elucidates conserved time-of-day-specific cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Todd P Michael

    2008-02-01

    Full Text Available Correct daily phasing of transcription confers an adaptive advantage to almost all organisms, including higher plants. In this study, we describe a hypothesis-driven network discovery pipeline that identifies biologically relevant patterns in genome-scale data. To demonstrate its utility, we analyzed a comprehensive matrix of time courses interrogating the nuclear transcriptome of Arabidopsis thaliana plants grown under different thermocycles, photocycles, and circadian conditions. We show that 89% of Arabidopsis transcripts cycle in at least one condition and that most genes have peak expression at a particular time of day, which shifts depending on the environment. Thermocycles alone can drive at least half of all transcripts critical for synchronizing internal processes such as cell cycle and protein synthesis. We identified at least three distinct transcription modules controlling phase-specific expression, including a new midnight specific module, PBX/TBX/SBX. We validated the network discovery pipeline, as well as the midnight specific module, by demonstrating that the PBX element was sufficient to drive diurnal and circadian condition-dependent expression. Moreover, we show that the three transcription modules are conserved across Arabidopsis, poplar, and rice. These results confirm the complex interplay between thermocycles, photocycles, and the circadian clock on the daily transcription program, and provide a comprehensive view of the conserved genomic targets for a transcriptional network key to successful adaptation.

  8. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  9. Cis-regulatory PLETHORA promoter elements directing root and nodule expression are conserved between Arabidopsis thaliana and Medicago truncatula.

    Science.gov (United States)

    Franssen, Henk J; Kulikova, Olga; Willemsen, Viola; Heidstra, Renze

    2017-02-01

    Nodules are unique organs formed on roots of legumes by soil-borne bacteria, collectively known as rhizobium. Recently, we have shown that orthologs of the AINTEGUMENTA-like (AIL) AP2 transcription factors PLETHORA (PLT) 1 to 4, that redundantly regulate Arabidopsis thaliana root development are involved in root and nodule growth in Medicago truncatula. Hence, it is conceivable that rhizobium has co-opted these genes for nodule development. Whether this co-option requires the presence of specific cis-elements in the promoters and/or specialization of PLT protein function is not clear. Here, we analyzed the qualitative expression patterns of the Arabidopsis PLT1 to 4 promoters in Medicago roots and nodules and compared these with the described expression patterns of the Medicago PLT genes. Our studies reveal that the expression patterns of the investigated promoters and their Medicago orthologs are very similar, indicating that at least all cis-elements regulating spatial PLT expression are conserved among the Arabidopsis and Medicago PLT1 to 4 promoters.

  10. Diverse Cis-Regulatory Mechanisms Contribute to Expression Evolution of Tandem Gene Duplicates.

    Science.gov (United States)

    Baudouin-Gonzalez, Luís; Santos, Marília A; Tempesta, Camille; Sucena, Élio; Roch, Fernando; Tanaka, Kohtaro

    2017-12-01

    Pairs of duplicated genes generally display a combination of conserved expression patterns inherited from their unduplicated ancestor and newly acquired domains. However, how the cis-regulatory architecture of duplicated loci evolves to produce these expression patterns is poorly understood. We have directly examined the gene-regulatory evolution of two tandem duplicates, the Drosophila Ly6 genes CG9336 and CG9338, which arose at the base of the drosophilids between 40 and 60 Ma. Comparing the expression patterns of the two paralogs in four Drosophila species with that of the unduplicated ortholog in the tephritid Ceratitis capitata, we show that they diverged from each other as well as from the unduplicated ortholog. Moreover, the expression divergence appears to have occurred close to the duplication event and also more recently in a lineage-specific manner. The comparison of the tissue-specific cis-regulatory modules (CRMs) controlling the paralog expression in the four Drosophila species indicates that diverse cis-regulatory mechanisms, including the novel tissue-specific enhancers, differential inactivation, and enhancer sharing, contributed to the expression evolution. Our analysis also reveals a surprisingly variable cis-regulatory architecture, in which the CRMs driving conserved expression domains change in number, location, and specificity. Altogether, this study provides a detailed historical account that uncovers a highly dynamic picture of how the paralog expression patterns and their underlying cis-regulatory landscape evolve. We argue that our findings will encourage studying cis-regulatory evolution at the whole-locus level to understand how interactions between enhancers and other regulatory levels shape the evolution of gene expression. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Abundant raw material for cis-regulatory evolution in humans

    Science.gov (United States)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (human phenotypic variation.

  12. Abundant raw material for cis-regulatory evolution in humans

    Science.gov (United States)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (<13,000), in part because of an overrepresentation among the former in multiallelic tandem repeat variation, especially (AC)(n) dinucleotide microsatellites. The role of microsatellites in gene expression variation may provide a larger store of heritable phenotypic variation, and a more rapid mutational input of such variation, than has been realized. Finally, we outline the distinctive consequences of cis-regulatory variation for the genotype-phenotype relationship, including ubiquitous epistasis and genotype-by-environment interactions, as well as underappreciated modes of pleiotropy and overdominance. Ordinary small-scale mutations contribute to pervasive variation in transcription rates and consequently to patterns of human phenotypic variation.

  13. CREME: Cis-Regulatory Module Explorer for the Human Genome

    Energy Technology Data Exchange (ETDEWEB)

    Loots, G G; Sharan, R; Ovcharenko, I; Ben-Hur, A

    2004-02-11

    The binding of transcription factors to specific regulatory sequence elements is a primary mechanism for controlling gene transcription. Eukaryotic genes are often regulated by several transcription factors, whose binding sites are tightly clustered and form cis-regulatory modules. In this paper we present a web-server, CREME, for identifying and visualizing cis-regulatory modules in the promoter regions of a given set of potentially co-regulated genes. CREME relies on a database of putative transcription factor binding sites that have been annotated across the human genome using a library of position weight matrices and evolutionary conservation with the mouse and rat genomes. A search algorithm is applied to this dataset to identify combinations of transcription factors whose binding sites tend to co-occur in close proximity in the promoter regions of the input gene set. The identified cis-regulatory modules are statistically scored and significant combinations are reported and graphically visualized. Our web-server is available at http://creme.dcode.org/.

  14. Exonic remnants of whole-genome duplication reveal cis-regulatory function of coding exons.

    Science.gov (United States)

    Dong, Xianjun; Navratilova, Pavla; Fredman, David; Drivenes, Øyvind; Becker, Thomas S; Lenhard, Boris

    2010-03-01

    Using a comparative genomics approach to reconstruct the fate of genomic regulatory blocks (GRBs) and identify exonic remnants that have survived the disappearance of their host genes after whole-genome duplication (WGD) in teleosts, we discover a set of 38 candidate cis-regulatory coding exons (RCEs) with predicted target genes. These elements demonstrate evolutionary separation of overlapping protein-coding and regulatory information after WGD in teleosts. We present evidence that the corresponding mammalian exons are still under both coding and non-coding selection pressure, are more conserved than other protein coding exons in the host gene and several control sets, and share key characteristics with highly conserved non-coding elements in the same regions. Their dual function is corroborated by existing experimental data. Additionally, we show examples of human exon remnants stemming from the vertebrate 2R WGD. Our findings suggest that long-range cis-regulatory inputs for developmental genes are not limited to non-coding regions, but can also overlap the coding sequence of unrelated genes. Thus, exonic regulatory elements in GRBs might be functionally equivalent to those in non-coding regions, calling for a re-evaluation of the sequence space in which to look for long-range regulatory elements and experimentally test their activity.

  15. A highly conserved cis-regulatory motif directs differential gonadal synexpression of Dmrt1 transcripts during gonad development

    National Research Council Canada - National Science Library

    Herpin, Amaury; Nakamura, Shuhei; Wagner, Toni U; Tanaka, Minoru; Schartl, Manfred

    2009-01-01

    ...′-UTR of dmrt1, a key gene that functions in gonad development and differentiation, an 11-bp protein-binding motif was identified that mediates gonad-specific mRNA localization during embryonic...

  16. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera

    Directory of Open Access Journals (Sweden)

    James J. Lewis

    2016-09-01

    Full Text Available Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  17. The role of cis regulatory evolution in maize domestication.

    Directory of Open Access Journals (Sweden)

    Zachary H Lemmon

    2014-11-01

    Full Text Available Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem. Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  18. Identification and functional characterization of cis-regulatory elements in the apicomplexan parasite Toxoplasma gondii.

    Science.gov (United States)

    Mullapudi, Nandita; Joseph, Sandeep J; Kissinger, Jessica C

    2009-01-01

    Toxoplasma gondii is a member of the phylum Apicomplexa, which consists entirely of parasitic organisms that cause several diseases of veterinary and human importance. Fundamental mechanisms of gene regulation in this group of protistan parasites remain largely uncharacterized. Owing to their medical and veterinary importance, genome sequences are available for several apicomplexan parasites. Their genome sequences reveal an apparent paucity of known transcription factors and the absence of canonical cis-regulatory elements. We have approached the question of gene regulation from a sequence perspective by mining the genomic sequence data to identify putative cis-regulatory elements using a de novo approach. We have identified putative cis-regulatory elements present upstream of functionally related groups of genes and subsequently characterized the function of some of these conserved elements using reporter assays in the parasite. We show a sequence-specific role in gene-expression for seven out of eight identified elements. This work demonstrates the power of pure sequence analysis in the absence of expression data or a priori knowledge of regulatory elements in eukaryotic organisms with compact genomes.

  19. Identification of a novel cis-regulatory element essential for immune tolerance

    Science.gov (United States)

    LaFlam, Taylor N.; Seumois, Grégory; Miller, Corey N.; Lwin, Wint; Fasano, Kayla J.; Waterfield, Michael; Proekt, Irina; Vijayanand, Pandurangan

    2015-01-01

    Thymic central tolerance is essential to preventing autoimmunity. In medullary thymic epithelial cells (mTECs), the Autoimmune regulator (Aire) gene plays an essential role in this process by driving the expression of a diverse set of tissue-specific antigens (TSAs), which are presented and help tolerize self-reactive thymocytes. Interestingly, Aire has a highly tissue-restricted pattern of expression, with only mTECs and peripheral extrathymic Aire-expressing cells (eTACs) known to express detectable levels in adults. Despite this high level of tissue specificity, the cis-regulatory elements that control Aire expression have remained obscure. Here, we identify a highly conserved noncoding DNA element that is essential for Aire expression. This element shows enrichment of enhancer-associated histone marks in mTECs and also has characteristics of being an NF-κB-responsive element. Finally, we find that this element is essential for Aire expression in vivo and necessary to prevent spontaneous autoimmunity, reflecting the importance of this regulatory DNA element in promoting immune tolerance. PMID:26527800

  20. Erroneous attribution of relevant transcription factor binding sites despite successful prediction of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Halfon Marc S

    2011-11-01

    Full Text Available Abstract Background Cis-regulatory modules are bound by transcription factors to regulate gene expression. Characterizing these DNA sequences is central to understanding gene regulatory networks and gaining insight into mechanisms of transcriptional regulation, but genome-scale regulatory module discovery remains a challenge. One popular approach is to scan the genome for clusters of transcription factor binding sites, especially those conserved in related species. When such approaches are successful, it is typically assumed that the activity of the modules is mediated by the identified binding sites and their cognate transcription factors. However, the validity of this assumption is often not assessed. Results We successfully predicted five new cis-regulatory modules by combining binding site identification with sequence conservation and compared these to unsuccessful predictions from a related approach not utilizing sequence conservation. Despite greatly improved predictive success, the positive set had similar degrees of sequence and binding site conservation as the negative set. We explored the reasons for this by mutagenizing putative binding sites in three cis-regulatory modules. A large proportion of the tested sites had little or no demonstrable role in mediating regulatory element activity. Examination of loss-of-function mutants also showed that some transcription factors supposedly binding to the modules are not required for their function. Conclusions Our results raise important questions about interpreting regulatory module predictions obtained by finding clusters of conserved binding sites. Attribution of function to these sites and their cognate transcription factors may be incorrect even when modules are successfully identified. Our study underscores the importance of empirical validation of computational results even when these results are in line with expectation.

  1. Unravelling cis-regulatory elements in the genome of the smallest photosynthetic eukaryote: phylogenetic footprinting in Ostreococcus.

    Science.gov (United States)

    Piganeau, Gwenael; Vandepoele, Klaas; Gourbière, Sébastien; Van de Peer, Yves; Moreau, Hervé

    2009-09-01

    We used a phylogenetic footprinting approach, adapted to high levels of divergence, to estimate the level of constraint in intergenic regions of the extremely gene dense Ostreococcus algae genomes (Chlorophyta, Prasinophyceae). We first benchmarked our method against the Saccharomyces sensu stricto genome data and found that the proportion of conserved non-coding sites was consistent with those obtained with methods using calibration by the neutral substitution rate. We then applied our method to the complete genomes of Ostreococcus tauri and O. lucimarinus, which are the most divergent species from the same genus sequenced so far. We found that 77% of intergenic regions in Ostreococcus still contain some phylogenetic footprints, as compared to 88% for Saccharomyces, corresponding to an average rate of constraint on intergenic region of 17% and 30%, respectively. A comparison with some known functional cis-regulatory elements enabled us to investigate whether some transcriptional regulatory pathways were conserved throughout the green lineage. Strikingly, the size of the phylogenetic footprints depends on gene orientation of neighboring genes, and appears to be genus-specific. In Ostreococcus, 5' intergenic regions contain four times more conserved sites than 3' intergenic regions, whereas in yeast a higher frequency of constrained sites in intergenic regions between genes on the same DNA strand suggests a higher frequency of bidirectional regulatory elements. The phylogenetic footprinting approach can be used despite high levels of divergence in the ultrasmall Ostreococcus algae, to decipher structure of constrained regulatory motifs, and identify putative regulatory pathways conserved within the green lineage.

  2. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  3. Genome-wide analysis of cis-regulatory element structure and discovery of motif-driven gene co-expression networks in grapevine.

    Science.gov (United States)

    Wong, Darren Chern Jan; Lopez Gutierrez, Rodrigo; Gambetta, Gregory Alan; Castellarin, Simone Diego

    2017-06-01

    Coordinated transcriptional and metabolic reprogramming ensures a plant's continued growth and survival under adverse environmental conditions. Transcription factors (TFs) act to modulate gene expression through complex cis-regulatory element (CRE) interactions. Genome-wide analysis of known plant CREs was performed for all currently predicted protein-coding gene promoters in grapevine (Vitis vinifera L.). Many CREs such as abscisic acid (ABA)-responsive, drought-responsive, auxin-responsive, and evening elements, exhibit bona fide CRE properties such as strong position bias towards the transcription start site (TSS) and over-representation when compared with random promoters. Genes containing these CREs are enriched in a large repertoire of plant biological pathways. Large-scale transcriptome analyses also show that these CREs are highly implicated in grapevine development and stress response. Numerous CRE-driven modules in condition-specific gene co-expression networks (GCNs) were identified and many of these modules were highly enriched for plant biological functions. Several modules corroborate known roles of CREs in drought response, pathogen defense, cell wall metabolism, and fruit ripening, whereas others reveal novel functions in plants. Comparisons with Arabidopsis suggest a general conservation in promoter architecture, gene expression dynamics, and GCN structure across species. Systems analyses of CREs provide insights into the grapevine cis-regulatory code and establish a foundation for future genomic studies in grapevine. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  5. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  6. Deciphering the cis-regulatory elements for XYR1 and CRE1 regulators in Trichoderma reesei.

    Directory of Open Access Journals (Sweden)

    Rafael Silva-Rocha

    Full Text Available In this work, we report the in silico identification of the cis-regulatory elements for XYR1 and CRE1 proteins in the filamentous fungus Trichoderma reesei, two regulators that play a central role in the expression of cellulase genes. Using four datasets of condition-dependent genes from RNA-seq and RT-qPCR experiments, we performed unsupervised motif discovery and found two short motifs resembling the proposed binding consensus for XYR1 and CRE1. Using these motifs, we analysed the presence and arrangement of putative cis-regulatory elements recognized by both regulators and found that shortly spaced sites were more associated with XYR1- and CRE1-dependent promoters than single, high-score sites. Furthermore, the approach used here allowed the identification of the previously reported XYR1-binding sites from cel7a and xyn1 promoters, and we also mapped the potential target sequence for this regulator at the cel6a promoter that has been suggested but not identified previously. Additionally, seven other promoters (for cel7b, cel61a, cel61b, cel3c, cel3d, xyn3 and swo genes presented a putative XYR1-binding site, and strong sites for CRE1 were found at the xyr1 and cel7b promoters. Using the cis-regulatory architectures nearly defined for XYR1 and CRE1, we performed genome-wide identification of potential targets for direct regulation by both proteins and important differences on their functional regulons were elucidated. Finally, we performed binding site mapping on the promoters of differentially expressed genes found in T. reesei mutant strains lacking xyr1 or cre1 and found that indirect regulation plays a key role on their signalling pathways. Taken together, the data provided here sheds new light on the mechanisms for signal integration mediated by XYR1 and CRE1 at cellulase promoters.

  7. Uncovering cis regulatory codes using synthetic promoter shuffling.

    Directory of Open Access Journals (Sweden)

    Ali Kinkhabwala

    Full Text Available Revealing the spectrum of combinatorial regulation of transcription at individual promoters is essential for understanding the complex structure of biological networks. However, the computations represented by the integration of various molecular signals at complex promoters are difficult to decipher in the absence of simple cis regulatory codes. Here we synthetically shuffle the regulatory architecture--operator sequences binding activators and repressors--of a canonical bacterial promoter. The resulting library of complex promoters allows for rapid exploration of promoter encoded logic regulation. Among all possible logic functions, NOR and ANDN promoter encoded logics predominate. A simple transcriptional cis regulatory code determines both logics, establishing a straightforward map between promoter structure and logic phenotype. The regulatory code is determined solely by the type of transcriptional regulation combinations: two repressors generate a NOR: NOT (a OR b whereas a repressor and an activator generate an ANDN: a AND NOT b. Three-input versions of both logics, having an additional repressor as an input, are also present in the library. The resulting complex promoters cover a wide dynamic range of transcriptional strengths. Synthetic promoter shuffling represents a fast and efficient method for exploring the spectrum of complex regulatory functions that can be encoded by complex promoters. From an engineering point of view, synthetic promoter shuffling enables the experimental testing of the functional properties of complex promoters that cannot necessarily be inferred ab initio from the known properties of the individual genetic components. Synthetic promoter shuffling may provide a useful experimental tool for studying naturally occurring promoter shuffling.

  8. Redundancy and the evolution of cis-regulatory element multiplicity.

    Directory of Open Access Journals (Sweden)

    Tiago Paixão

    Full Text Available The promoter regions of many genes contain multiple binding sites for the same transcription factor (TF. One possibility is that this multiplicity evolved through transitional forms showing redundant cis-regulation. To evaluate this hypothesis, we must disentangle the relative contributions of different evolutionary mechanisms to the evolution of binding site multiplicity. Here, we attempt to do this using a model of binding site evolution. Our model considers binding sequences and their interactions with TFs explicitly, and allows us to cast the evolution of gene networks into a neutral network framework. We then test some of the model's predictions using data from yeast. Analysis of the model suggested three candidate nonadaptive processes favoring the evolution of cis-regulatory element redundancy and multiplicity: neutral evolution in long promoters, recombination and TF promiscuity. We find that recombination rate is positively associated with binding site multiplicity in yeast. Our model also indicated that weak direct selection for multiplicity (partial redundancy can play a major role in organisms with large populations. Our data suggest that selection for changes in gene expression level may have contributed to the evolution of multiple binding sites in yeast. We conclude that the evolution of cis-regulatory element redundancy and multiplicity is impacted by many aspects of the biology of an organism: both adaptive and nonadaptive processes, both changes in cis to binding sites and in trans to the TFs that interact with them, both the functional setting of the promoter and the population genetic context of the individuals carrying them.

  9. Functional roles of Aves class-specific cis-regulatory elements on macroevolution of bird-specific features.

    Science.gov (United States)

    Seki, Ryohei; Li, Cai; Fang, Qi; Hayashi, Shinichi; Egawa, Shiro; Hu, Jiang; Xu, Luohao; Pan, Hailin; Kondo, Mao; Sato, Tomohiko; Matsubara, Haruka; Kamiyama, Namiko; Kitajima, Keiichi; Saito, Daisuke; Liu, Yang; Gilbert, M Thomas P; Zhou, Qi; Xu, Xing; Shiroishi, Toshihiko; Irie, Naoki; Tamura, Koji; Zhang, Guojie

    2017-02-06

    Unlike microevolutionary processes, little is known about the genetic basis of macroevolutionary processes. One of these magnificent examples is the transition from non-avian dinosaurs to birds that has created numerous evolutionary innovations such as self-powered flight and its associated wings with flight feathers. By analysing 48 bird genomes, we identified millions of avian-specific highly conserved elements (ASHCEs) that predominantly (>99%) reside in non-coding regions. Many ASHCEs show differential histone modifications that may participate in regulation of limb development. Comparative embryonic gene expression analyses across tetrapod species suggest ASHCE-associated genes have unique roles in developing avian limbs. In particular, we demonstrate how the ASHCE driven avian-specific expression of gene Sim1 driven by ASHCE may be associated with the evolution and development of flight feathers. Together, these findings demonstrate regulatory roles of ASHCEs in the creation of avian-specific traits, and further highlight the importance of cis-regulatory rewiring during macroevolutionary changes.

  10. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  11. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  12. BET Bromodomain Inhibition Releases the Mediator Complex from Select cis-Regulatory Elements

    Directory of Open Access Journals (Sweden)

    Anand S. Bhagwat

    2016-04-01

    Full Text Available The bromodomain and extraterminal (BET protein BRD4 can physically interact with the Mediator complex, but the relevance of this association to the therapeutic effects of BET inhibitors in cancer is unclear. Here, we show that BET inhibition causes a rapid release of Mediator from a subset of cis-regulatory elements in the genome of acute myeloid leukemia (AML cells. These sites of Mediator eviction were highly correlated with transcriptional suppression of neighboring genes, which are enriched for targets of the transcription factor MYB and for functions related to leukemogenesis. A shRNA screen of Mediator in AML cells identified the MED12, MED13, MED23, and MED24 subunits as performing a similar regulatory function to BRD4 in this context, including a shared role in sustaining a block in myeloid maturation. These findings suggest that the interaction between BRD4 and Mediator has functional importance for gene-specific transcriptional activation and for AML maintenance.

  13. Quantitative Analysis of Cis-Regulatory Element Activity Using Synthetic Promoters in Transgenic Plants.

    Science.gov (United States)

    Benn, Geoffrey; Dehesh, Katayoon

    2016-01-01

    Synthetic promoters, introduced stably or transiently into plants, are an invaluable tool for the identification of functional regulatory elements and the corresponding transcription factor(s) that regulate the amplitude, spatial distribution, and temporal patterns of gene expression. Here, we present a protocol describing the steps required to identify and characterize putative cis-regulatory elements. These steps include application of computational tools to identify putative elements, construction of a synthetic promoter upstream of luciferase, identification of transcription factors that regulate the element, testing the functionality of the element introduced transiently and/or stably into the species of interest followed by high-throughput luciferase screening assays, and subsequent data processing and statistical analysis.

  14. The cis-regulatory logic of the mammalian photoreceptor transcriptional network.

    Science.gov (United States)

    Hsiau, Timothy H-C; Diaconu, Claudiu; Myers, Connie A; Lee, Jongwoo; Cepko, Constance L; Corbo, Joseph C

    2007-07-25

    The photoreceptor cells of the retina are subject to a greater number of genetic diseases than any other cell type in the human body. The majority of more than 120 cloned human blindness genes are highly expressed in photoreceptors. In order to establish an integrative framework in which to understand these diseases, we have undertaken an experimental and computational analysis of the network controlled by the mammalian photoreceptor transcription factors, Crx, Nrl, and Nr2e3. Using microarray and in situ hybridization datasets we have produced a model of this network which contains over 600 genes, including numerous retinal disease loci as well as previously uncharacterized photoreceptor transcription factors. To elucidate the connectivity of this network, we devised a computational algorithm to identify the photoreceptor-specific cis-regulatory elements (CREs) mediating the interactions between these transcription factors and their target genes. In vivo validation of our computational predictions resulted in the discovery of 19 novel photoreceptor-specific CREs near retinal disease genes. Examination of these CREs permitted the definition of a simple cis-regulatory grammar rule associated with high-level expression. To test the generality of this rule, we used an expanded form of it as a selection filter to evolve photoreceptor CREs from random DNA sequences in silico. When fused to fluorescent reporters, these evolved CREs drove strong, photoreceptor-specific expression in vivo. This study represents the first systematic identification and in vivo validation of CREs in a mammalian neuronal cell type and lays the groundwork for a systems biology of photoreceptor transcriptional regulation.

  15. The cis-regulatory logic of the mammalian photoreceptor transcriptional network.

    Directory of Open Access Journals (Sweden)

    Timothy H-C Hsiau

    2007-07-01

    Full Text Available The photoreceptor cells of the retina are subject to a greater number of genetic diseases than any other cell type in the human body. The majority of more than 120 cloned human blindness genes are highly expressed in photoreceptors. In order to establish an integrative framework in which to understand these diseases, we have undertaken an experimental and computational analysis of the network controlled by the mammalian photoreceptor transcription factors, Crx, Nrl, and Nr2e3. Using microarray and in situ hybridization datasets we have produced a model of this network which contains over 600 genes, including numerous retinal disease loci as well as previously uncharacterized photoreceptor transcription factors. To elucidate the connectivity of this network, we devised a computational algorithm to identify the photoreceptor-specific cis-regulatory elements (CREs mediating the interactions between these transcription factors and their target genes. In vivo validation of our computational predictions resulted in the discovery of 19 novel photoreceptor-specific CREs near retinal disease genes. Examination of these CREs permitted the definition of a simple cis-regulatory grammar rule associated with high-level expression. To test the generality of this rule, we used an expanded form of it as a selection filter to evolve photoreceptor CREs from random DNA sequences in silico. When fused to fluorescent reporters, these evolved CREs drove strong, photoreceptor-specific expression in vivo. This study represents the first systematic identification and in vivo validation of CREs in a mammalian neuronal cell type and lays the groundwork for a systems biology of photoreceptor transcriptional regulation.

  16. Identification of cis-regulatory elements specific for different types of reactive oxygen species in Arabidopsis thaliana.

    Science.gov (United States)

    Petrov, Veselin; Vermeirssen, Vanessa; De Clercq, Inge; Van Breusegem, Frank; Minkov, Ivan; Vandepoele, Klaas; Gechev, Tsanko S

    2012-05-10

    The type of reactive oxygen species (ROS) is a major factor that determines the specificity of biological responses. These responses may be elicited by activation of transcription factors that recognize ROS-specific cis-regulatory elements in target genes. In search for Arabidopsis promoter motifs specific for particular types of ROS, genome-wide microarray expression profiles for 283 abiotic stress-related conditions were subjected to cluster analysis to identify gene groups induced by singlet oxygen, superoxide radicals, and H(2)O(2). Promoters of these gene groups were analyzed to identify cis-regulatory elements that are associated with specific types of ROS. Eleven ROS-specific de novo identified elements, seven known promoter motifs and several sequences enriched in ROS-responsive clusters but lacking in specificity are reported. The conservation of the identified motifs was determined in orthologous genes in C. papaya, V. vinifera and P. trichocarpa. Finally, biological functions were attributed to the motifs by calculation of GO-term enrichment for genes with conserved ROS-responsive elements. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Analysis of opo cis-regulatory landscape uncovers Vsx2 requirement in early eye morphogenesis.

    Science.gov (United States)

    Gago-Rodrigues, Ines; Fernández-Miñán, Ana; Letelier, Joaquin; Naranjo, Silvia; Tena, Juan J; Gómez-Skarmeta, José L; Martinez-Morales, Juan R

    2015-05-12

    The self-organized morphogenesis of the vertebrate optic cup entails coupling the activation of the retinal gene regulatory network to the constriction-driven infolding of the retinal epithelium. Yet the genetic mechanisms underlying this coordination remain largely unexplored. Through phylogenetic footprinting and transgenesis in zebrafish, here we examine the cis-regulatory landscape of opo, an endocytosis regulator essential for eye morphogenesis. Among the different conserved enhancers identified, we isolate a single retina-specific element (H6_10137) and show that its activity depends on binding sites for the retinal determinant Vsx2. Gain- and loss-of-function experiments and ChIP analyses reveal that Vsx2 regulates opo expression through direct binding to this retinal enhancer. Furthermore, we show that vsx2 knockdown impairs the primary optic cup folding. These data support a model by which vsx2, operating through the effector gene opo, acts as a central transcriptional node that coordinates neural retina patterning and optic cup invagination in zebrafish.

  18. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  19. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.

    Science.gov (United States)

    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A

    2016-04-01

    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Barcoded DNA-tag reporters for multiplex cis-regulatory analysis.

    Directory of Open Access Journals (Sweden)

    Jongmin Nam

    Full Text Available Cis-regulatory DNA sequences causally mediate patterns of gene expression, but efficient experimental analysis of these control systems has remained challenging. Here we develop a new version of "barcoded" DNA-tag reporters, "Nanotags" that permit simultaneous quantitative analysis of up to 130 distinct cis-regulatory modules (CRMs. The activities of these reporters are measured in single experiments by the NanoString RNA counting method and other quantitative procedures. We demonstrate the efficiency of the Nanotag method by simultaneously measuring hourly temporal activities of 126 CRMs from 46 genes in the developing sea urchin embryo, otherwise a virtually impossible task. Nanotags are also used in gene perturbation experiments to reveal cis-regulatory responses of many CRMs at once. Nanotag methodology can be applied to many research areas, ranging from gene regulatory networks to functional and evolutionary genomics.

  1. GPMiner: an integrated system for mining combinatorial cis-regulatory elements in mammalian gene group.

    Science.gov (United States)

    Lee, Tzong-Yi; Chang, Wen-Chi; Hsu, Justin Bo-Kai; Chang, Tzu-Hao; Shien, Dray-Ming

    2012-01-01

    Sequence features in promoter regions are involved in regulating gene transcription initiation. Although numerous computational methods have been developed for predicting transcriptional start sites (TSSs) or transcription factor (TF) binding sites (TFBSs), they lack annotations for do not consider some important regulatory features such as CpG islands, tandem repeats, the TATA box, CCAAT box, GC box, over-represented oligonucleotides, DNA stability, and GC content. Additionally, the combinatorial interaction of TFs regulates the gene group that is associated with same expression pattern. To investigate gene transcriptional regulation, an integrated system that annotates regulatory features in a promoter sequence and detects co-regulation of TFs in a group of genes is needed. This work identifies TSSs and regulatory features in a promoter sequence, and recognizes co-occurrence of cis-regulatory elements in co-expressed genes using a novel system. Three well-known TSS prediction tools are incorporated with orthologous conserved features, such as CpG islands, nucleotide composition, over-represented hexamer nucleotides, and DNA stability, to construct the novel Gene Promoter Miner (GPMiner) using a support vector machine (SVM). According to five-fold cross-validation results, the predictive sensitivity and specificity are both roughly 80%. The proposed system allows users to input a group of gene names/symbols, enabling the co-occurrence of TFBSs to be determined. Additionally, an input sequence can also be analyzed for homogeneity of experimental mammalian promoter sequences, and conserved regulatory features between homologous promoters can be observed through cross-species analysis. After identifying promoter regions, regulatory features are visualized graphically to facilitate gene promoter observations. The GPMiner, which has a user-friendly input/output interface, has numerous benefits in analyzing human and mouse promoters. The proposed system is freely

  2. Computational methods to dissect cis-regulatory transcriptional ...

    Indian Academy of Sciences (India)

    SEARCHU

    binding protein (NBP); promoter; transcription factor (TF); transcription factor binding sites (TFBS). Abbreviations used: CNG, conserved non-genic sequence; EST, expressed sequence tag; NBP nucleic acid-binding protein; PF, phylogenetic.

  3. Patterns of cis regulatory variation in diverse human populations.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    Full Text Available The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants, but also more recently to assist in the interpretation and elucidation of disease signals. To date, many studies have looked in specific tissues and population-based samples, but there has been limited assessment of the degree of inter-population variability in regulatory variation. We analyzed genome-wide gene expression in lymphoblastoid cell lines from a total of 726 individuals from 8 global populations from the HapMap3 project and correlated gene expression levels with HapMap3 SNPs located in cis to the genes. We describe the influence of ancestry on gene expression levels within and between these diverse human populations and uncover a non-negligible impact on global patterns of gene expression. We further dissect the specific functional pathways differentiated between populations. We also identify 5,691 expression quantitative trait loci (eQTLs after controlling for both non-genetic factors and population admixture and observe that half of the cis-eQTLs are replicated in one or more of the populations. We highlight patterns of eQTL-sharing between populations, which are partially determined by population genetic relatedness, and discover significant sharing of eQTL effects between Asians, European-admixed, and African subpopulations. Specifically, we observe that both the effect size and the direction of effect for eQTLs are highly conserved across populations. We observe an increasing proximity of eQTLs toward the transcription start site as sharing of eQTLs among populations increases, highlighting that variants close to TSS have stronger effects and therefore are more likely to be detected across a wider panel of populations. Together these results offer a unique picture and resource of the degree of differentiation among human populations in functional regulatory variation and provide an estimate for

  4. The molecular mechanism of a cis-regulatory adaptation in yeast.

    Directory of Open Access Journals (Sweden)

    Jessica Chang

    Full Text Available Despite recent advances in our ability to detect adaptive evolution involving the cis-regulation of gene expression, our knowledge of the molecular mechanisms underlying these adaptations has lagged far behind. Across all model organisms, the causal mutations have been discovered for only a handful of gene expression adaptations, and even for these, mechanistic details (e.g. the trans-regulatory factors involved have not been determined. We previously reported a polygenic gene expression adaptation involving down-regulation of the ergosterol biosynthesis pathway in the budding yeast Saccharomyces cerevisiae. Here we investigate the molecular mechanism of a cis-acting mutation affecting a member of this pathway, ERG28. We show that the causal mutation is a two-base deletion in the promoter of ERG28 that strongly reduces the binding of two transcription factors, Sok2 and Mot3, thus abolishing their regulation of ERG28. This down-regulation increases resistance to a widely used antifungal drug targeting ergosterol, similar to mutations disrupting this pathway in clinical yeast isolates. The identification of the causal genetic variant revealed that the selection likely occurred after the deletion was already present at high frequency in the population, rather than when it was a new mutation. These results provide a detailed view of the molecular mechanism of a cis-regulatory adaptation, and underscore the importance of this view to our understanding of evolution at the molecular level.

  5. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    Science.gov (United States)

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

    2013-01-01

    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  6. Cis-regulatory elements in the primate brain: from functional specialization to neurodegeneration

    NARCIS (Netherlands)

    Vermunt, Marit W.

    2017-01-01

    Over the last decade, the noncoding part of the genome has been shown to harbour thousands of cis-regulatory elements, such as enhancers, that activate well-defined gene expression programs. Here, we charted active enhancers in a multiplicity of human brain regions to understand the role of

  7. Transcription of Mammalian cis-Regulatory Elements Is Restrained by Actively Enforced Early Termination

    NARCIS (Netherlands)

    Austenaa, Liv M I; Barozzi, Iros; Simonatto, Marta; Masella, Silvia; Della Chiara, Giulia; Ghisletti, Serena; Curina, Alessia; de Wit, Elzo; Bouwman, Britta A M|info:eu-repo/dai/nl/41363745X; de Pretis, Stefano; Piccolo, Viviana; Termanini, Alberto; Prosperini, Elena; Pelizzola, Mattia; de Laat, Wouter|info:eu-repo/dai/nl/169934497; Natoli, Gioacchino

    2015-01-01

    Upon recruitment to active enhancers and promoters, RNA polymerase II (Pol II) generates short non-coding transcripts of unclear function. The mechanisms that control the length and the amount of ncRNAs generated by cis-regulatory elements are largely unknown. Here, we show that the adaptor protein

  8. The Wisdom of Crowds: Can Mathematical Models Crack the cis Regulatory Code?

    Science.gov (United States)

    Dresch, Jacqueline M; Arnosti, David N

    2015-12-23

    Genomic information includes not just a "parts list" of encoded proteins and RNAs, but also the information on regulation and function. To understand this more complex, deeper layer of biological information, recent efforts have turned to mathematical models as discovery engines of the cis regulatory code. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. CRX ChIP-seq reveals the cis-regulatory architecture of mouse photoreceptors

    NARCIS (Netherlands)

    J.C. Corbo (Joseph); K.A. Lawrence (Karen); M. Karlstetter (Marcus); C.A. Myers (Connie); M. Abdelaziz (Musa); W. Dirkes (William); K. Weigelt (Karin); M. Seifert (Martin); V. Benes (Vladimir); L.G. Fritsche (Lars); B.H.F. Weber (Bernhard); T. Langmann (Thomas)

    2010-01-01

    textabstractApproximately 98% of mammalian DNA is noncoding, yet we understand relatively little about the function of this enigmatic portion of the genome. The cis-regulatory elements that control gene expression reside in noncoding regions and can be identified by mapping the binding sites of

  10. Thousands of cis-regulatory sequence combinations are shared by Arabidopsis and poplar.

    Science.gov (United States)

    Ding, Jun; Hu, Haiyan; Li, Xiaoman

    2012-01-01

    The identification of cis-regulatory modules (CRMs) can greatly advance our understanding of gene regulatory mechanisms. Despite the existence of binding sites of more than three transcription factors (TFs) in a CRM, studies in plants often consider only the cooccurrence of binding sites of one or two TFs. In addition, CRM studies in plants are limited to combinations of only a few families of TFs. It is thus not clear how widespread plant TFs work together, which TFs work together to regulate plant genes, and how the combinations of these TFs are shared by different plants. To fill these gaps, we applied a frequent pattern-mining-based approach to identify frequently used cis-regulatory sequence combinations in the promoter sequences of two plant species, Arabidopsis (Arabidopsis thaliana) and poplar (Populus trichocarpa). A cis-regulatory sequence here corresponds to a DNA motif bound by a TF. We identified 18,638 combinations composed of two to six cis-regulatory sequences that are shared by the two plant species. In addition, with known cis-regulatory sequence combinations, gene function annotation, gene expression data, and known functional gene sets, we showed that the functionality of at least 96.8% and 65.2% of these shared combinations in Arabidopsis are partially supported, under a false discovery rate of 0.1 and 0.05, respectively. Finally, we discovered that 796 of the 18,638 combinations might relate to functions that are important in bioenergy research. Our work will facilitate the study of gene transcriptional regulation in plants.

  11. Evidence for the role of transposons in the recruitment of cis-regulatory motifs during the evolution of C4 photosynthesis.

    Science.gov (United States)

    Cao, Chensi; Xu, Jiajia; Zheng, Guangyong; Zhu, Xin-Guang

    2016-03-08

    C4 photosynthesis evolved from C3 photosynthesis and has higher light, water, and nitrogen use efficiencies. Several C4 photosynthesis genes show cell-specific expression patterns, which are required for these high resource-use efficiencies. However, the mechanisms underlying the evolution of cis-regulatory elements that control these cell-specific expression patterns remain elusive. In the present study, we tested the hypothesis that the cis-regulatory motifs related to C4 photosynthesis genes were recruited from non-photosynthetic genes and further examined potential mechanisms facilitating this recruitment. We examined 65 predicted bundle sheath cell-specific motifs, 17 experimentally validated cell-specific cis-regulatory elements, and 1,034 motifs derived from gene regulatory networks. Approximately 7, 5, and 1,000 of these three categories of motifs, respectively, were apparently recruited during the evolution of C4 photosynthesis. In addition, we checked 1) the distance between the acceptors and the donors of potentially recruited motifs in a chromosome, and 2) whether the potentially recruited motifs reside within the overlapping region of transposable elements and the promoter of donor genes. The results showed that 7, 4, and 658 of the potentially recruited motifs might have moved via the transposable elements. Furthermore, the potentially recruited motifs showed higher binding affinity to transcription factors compared to randomly generated sequences of the same length as the motifs. This study provides molecular evidence supporting the hypothesis that transposon-driven recruitment of pre-existing cis-regulatory elements from non-photosynthetic genes into photosynthetic genes plays an important role during C4 evolution. The findings of the present study coincide with the observed repetitive emergence of C4 during evolution.

  12. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Science.gov (United States)

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  13. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Directory of Open Access Journals (Sweden)

    Arindam Deb

    Full Text Available Combinations of cis-regulatory elements (CREs present at the promoters facilitate the binding of several transcription factors (TFs, thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic

  14. Prediction of tissue-specific cis-regulatory modules using Bayesian networks and regression trees

    Directory of Open Access Journals (Sweden)

    Chen Xiaoyu

    2007-12-01

    Full Text Available Abstract Background In vertebrates, a large part of gene transcriptional regulation is operated by cis-regulatory modules. These modules are believed to be regulating much of the tissue-specificity of gene expression. Results We develop a Bayesian network approach for identifying cis-regulatory modules likely to regulate tissue-specific expression. The network integrates predicted transcription factor binding site information, transcription factor expression data, and target gene expression data. At its core is a regression tree modeling the effect of combinations of transcription factors bound to a module. A new unsupervised EM-like algorithm is developed to learn the parameters of the network, including the regression tree structure. Conclusion Our approach is shown to accurately identify known human liver and erythroid-specific modules. When applied to the prediction of tissue-specific modules in 10 different tissues, the network predicts a number of important transcription factor combinations whose concerted binding is associated to specific expression.

  15. Cis-regulatory elements of the mouse Krt1.12 gene.

    Science.gov (United States)

    Wang, I-Jong; Carlson, Eric C; Liu, Chia-Yang; Kao, Candace W C; Hu, Fung-Rong; Kao, Winston W Y

    2002-04-07

    Keratin 12 is a cornea epithelial cell-specific intermediate filament component. To better understand the regulatory mechanism of its expression, the cis-regulatory elements located between the transcription start site and 600 bp upstream of the Krt1.12 gene were determined. The promoter activity of reporter gene constructs containing 0.6, 0.4, and 0.2 kb of DNA 5' upstream of Krt1.12 coupled to the lac Z gene were determined in rabbit corneas using Gene Gun technology. DNA foot printing and EMSA (electrophoresis mobility shift assay) were employed to identify putative cis-regulatory elements of the Krt1.12 gene using bovine corneal epithelial cell nuclear extracts. Enzyme activity assays and histochemical analysis of beta-galactosidase from the 0.6, 0.4, and 0.2 kb K12 promoter constructs indicated that the DNA elements between -0.2 and -0.6 kb 5' of the Krt1.12 gene contain cis-regulatory elements for its corneal epithelial cell-specific expression. Foot printing and EMSA showed that the sequences between -181 to -111 and -256 to -193 upstream of the Krt1.12 gene reacted to nuclear proteins isolated from bovine corneal epithelial cells. A Genbank search revealed that these two regions were potential binding sites for many transcription factors such as AP1, c/EBP, and KLF6. Immunofluorescent staining indicated the presence of c-jun and c/EBP transcription factors in the nuclei of corneal epithelial cells. The data is consistent with the notion that the -182 to -111 and -256 to -193 fragments 5' of the Krt1.12 gene may serve as corneal epithelial cell-specific cis-regulatory elements, and the coordinated interactions of various transcription factors are required for cornea-specific expression of Krt1.12 gene.

  16. Genes associated with the cis-regulatory functions of intragenic LINE-1 elements.

    Science.gov (United States)

    Wanichnopparat, Wachiraporn; Suwanwongse, Kulachanya; Pin-On, Piyapat; Aporntewan, Chatchawit; Mutirangura, Apiwat

    2013-03-27

    Thousands of intragenic long interspersed element 1 sequences (LINE-1 elements or L1s) reside within genes. These intragenic L1 sequences are conserved and regulate the expression of their host genes. When L1 methylation is decreased, either through chemical induction or in cancer, the intragenic L1 transcription is increased. The resulting L1 mRNAs form RISC complexes with pre-mRNA to degrade the complementary mRNA. In this study, we screened for genes that are involved in intragenic L1 regulation networks. Genes containing L1s were obtained from L1Base (http://l1base.molgen.mpg.de). The expression profiles of 205 genes in 516 gene knockdown experiments were obtained from the Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo). The expression levels of the genes with and without L1s were compared using Pearson's chi-squared test. After a permutation based statistical analysis and a multiple hypothesis testing, 73 genes were found to induce significant regulatory changes (upregulation and/or downregulation) in genes with L1s. In detail, 5 genes were found to induce both the upregulation and downregulation of genes with L1s, whereas 27 and 37 genes induced the downregulation and upregulation, respectively, of genes with L1s. These regulations sometimes differed depending on the cell type and the orientation of the intragenic L1s. Moreover, the siRNA-regulating genes containing L1s possess a variety of molecular functions, are responsible for many cellular phenotypes and are associated with a number of diseases. Cells use intragenic L1s as cis-regulatory elements within gene bodies to modulate gene expression. There may be several mechanisms by which L1s mediate gene expression. Intragenic L1s may be involved in the regulation of several biological processes, including DNA damage and repair, inflammation, immune function, embryogenesis, cell differentiation, cellular response to external stimuli and hormonal responses. Furthermore, in addition to cancer

  17. Expression-guided in silico evaluation of candidate cis regulatory codes for Drosophila muscle founder cells.

    Directory of Open Access Journals (Sweden)

    Anthony A Philippakis

    2006-05-01

    Full Text Available While combinatorial models of transcriptional regulation can be inferred for metazoan systems from a priori biological knowledge, validation requires extensive and time-consuming experimental work. Thus, there is a need for computational methods that can evaluate hypothesized cis regulatory codes before the difficult task of experimental verification is undertaken. We have developed a novel computational framework (termed "CodeFinder" that integrates transcription factor binding site and gene expression information to evaluate whether a hypothesized transcriptional regulatory model (TRM; i.e., a set of co-regulating transcription factors is likely to target a given set of co-expressed genes. Our basic approach is to simultaneously predict cis regulatory modules (CRMs associated with a given gene set and quantify the enrichment for combinatorial subsets of transcription factor binding site motifs comprising the hypothesized TRM within these predicted CRMs. As a model system, we have examined a TRM experimentally demonstrated to drive the expression of two genes in a sub-population of cells in the developing Drosophila mesoderm, the somatic muscle founder cells. This TRM was previously hypothesized to be a general mode of regulation for genes expressed in this cell population. In contrast, the present analyses suggest that a modified form of this cis regulatory code applies to only a subset of founder cell genes, those whose gene expression responds to specific genetic perturbations in a similar manner to the gene on which the original model was based. We have confirmed this hypothesis by experimentally discovering six (out of 12 tested new CRMs driving expression in the embryonic mesoderm, four of which drive expression in founder cells.

  18. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements.

    Directory of Open Access Journals (Sweden)

    Bonnie M Weasner

    2016-12-01

    Full Text Available The eyes absent (eya gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis.

  19. Systems analysis of cis-regulatory motifs in C4 photosynthesis genes using maize and rice leaf transcriptomic data during a process of de-etiolation.

    Science.gov (United States)

    Xu, Jiajia; Bräutigam, Andrea; Weber, Andreas P M; Zhu, Xin-Guang

    2016-09-01

    Identification of potential cis-regulatory motifs controlling the development of C4 photosynthesis is a major focus of current research. In this study, we used time-series RNA-seq data collected from etiolated maize and rice leaf tissues sampled during a de-etiolation process to systematically characterize the expression patterns of C4-related genes and to further identify potential cis elements in five different genomic regions (i.e. promoter, 5'UTR, 3'UTR, intron, and coding sequence) of C4 orthologous genes. The results demonstrate that although most of the C4 genes show similar expression patterns, a number of them, including chloroplast dicarboxylate transporter 1, aspartate aminotransferase, and triose phosphate transporter, show shifted expression patterns compared with their C3 counterparts. A number of conserved short DNA motifs between maize C4 genes and their rice orthologous genes were identified not only in the promoter, 5'UTR, 3'UTR, and coding sequences, but also in the introns of core C4 genes. We also identified cis-regulatory motifs that exist in maize C4 genes and also in genes showing similar expression patterns as maize C4 genes but that do not exist in rice C3 orthologs, suggesting a possible recruitment of pre-existing cis-elements from genes unrelated to C4 photosynthesis into C4 photosynthesis genes during C4 evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Cis-regulatory landscapes of four cell types of the retina.

    Science.gov (United States)

    Hartl, Dominik; Krebs, Arnaud R; Jüttner, Josephine; Roska, Botond; Schübeler, Dirk

    2017-11-16

    The retina is composed of ∼50 cell-types with specific functions for the process of vision. Identification of the cis-regulatory elements active in retinal cell-types is key to elucidate the networks controlling this diversity. Here, we combined transcriptome and epigenome profiling to map the regulatory landscape of four cell-types isolated from mouse retinas including rod and cone photoreceptors as well as rare inter-neuron populations such as horizontal and starburst amacrine cells. Integration of this information reveals sequence determinants and candidate transcription factors for controlling cellular specialization. Additionally, we refined parallel reporter assays to enable studying the transcriptional activity of large collection of sequences in individual cell-types isolated from a tissue. We provide proof of concept for this approach and its scalability by characterizing the transcriptional capacity of several hundred putative regulatory sequences within individual retinal cell-types. This generates a catalogue of cis-regulatory regions active in retinal cell types and we further demonstrate their utility as potential resource for cellular tagging and manipulation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    Directory of Open Access Journals (Sweden)

    Simpson Pat

    2010-09-01

    Full Text Available Abstract Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE, is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta. The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection.

  2. A primer on regression methods for decoding cis-regulatory logic

    Energy Technology Data Exchange (ETDEWEB)

    Das, Debopriya; Pellegrini, Matteo; Gray, Joe W.

    2009-03-03

    The rapidly emerging field of systems biology is helping us to understand the molecular determinants of phenotype on a genomic scale [1]. Cis-regulatory elements are major sequence-based determinants of biological processes in cells and tissues [2]. For instance, during transcriptional regulation, transcription factors (TFs) bind to very specific regions on the promoter DNA [2,3] and recruit the basal transcriptional machinery, which ultimately initiates mRNA transcription (Figure 1A). Learning cis-Regulatory Elements from Omics Data A vast amount of work over the past decade has shown that omics data can be used to learn cis-regulatory logic on a genome-wide scale [4-6]--in particular, by integrating sequence data with mRNA expression profiles. The most popular approach has been to identify over-represented motifs in promoters of genes that are coexpressed [4,7,8]. Though widely used, such an approach can be limiting for a variety of reasons. First, the combinatorial nature of gene regulation is difficult to explicitly model in this framework. Moreover, in many applications of this approach, expression data from multiple conditions are necessary to obtain reliable predictions. This can potentially limit the use of this method to only large data sets [9]. Although these methods can be adapted to analyze mRNA expression data from a pair of biological conditions, such comparisons are often confounded by the fact that primary and secondary response genes are clustered together--whereas only the primary response genes are expected to contain the functional motifs [10]. A set of approaches based on regression has been developed to overcome the above limitations [11-32]. These approaches have their foundations in certain biophysical aspects of gene regulation [26,33-35]. That is, the models are motivated by the expected transcriptional response of genes due to the binding of TFs to their promoters. While such methods have gathered popularity in the computational domain

  3. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Haitao Guo

    2017-01-01

    Full Text Available The discovery of cis-regulatory modules (CRMs is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them.

  4. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    Science.gov (United States)

    2017-01-01

    The discovery of cis-regulatory modules (CRMs) is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them. PMID:28497059

  5. Identification of cis-regulatory mutations generating de novo edges in personalized cancer gene regulatory networks.

    Science.gov (United States)

    Kalender Atak, Zeynep; Imrichova, Hana; Svetlichnyy, Dmitry; Hulselmans, Gert; Christiaens, Valerie; Reumers, Joke; Ceulemans, Hugo; Aerts, Stein

    2017-08-30

    The identification of functional non-coding mutations is a key challenge in the field of genomics. Here we introduce μ-cisTarget to filter, annotate and prioritize cis-regulatory mutations based on their putative effect on the underlying "personal" gene regulatory network. We validated μ-cisTarget by re-analyzing the TAL1 and LMO1 enhancer mutations in T-ALL, and the TERT promoter mutation in melanoma. Next, we re-sequenced the full genomes of ten cancer cell lines and used matched transcriptome data and motif discovery to identify master regulators with de novo binding sites that result in the up-regulation of nearby oncogenic drivers. μ-cisTarget is available from http://mucistarget.aertslab.org .

  6. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters.

    Science.gov (United States)

    Liu, Wusheng; Mazarei, Mitra; Peng, Yanhui; Fethe, Michael H; Rudis, Mary R; Lin, Jingyu; Millwood, Reginald J; Arelli, Prakash R; Stewart, Charles Neal

    2014-10-01

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co-expressed soybean genes that were selected from six reported microarray studies involving a compatible soybean-SCN interaction. A total of 116 overlapping motif regions (OMRs) were discovered bioinformatically that were identified by at least four out of seven bioinformatic tools. Using synthetic promoters, the inducibility of each OMR or motif itself was evaluated by co-localization of gain of function of an orange fluorescent protein reporter and the presence of SCN in transgenic soybean hairy roots. Among 16 OMRs detected from two experimentally confirmed SCN-inducible promoters, 11 OMRs (i.e. 68.75%) were experimentally confirmed to be SCN-inducible, leading to the discovery of 23 core motifs of 5- to 7-bp length, of which 14 are novel in plants. We found that a combination of the three best tools (i.e. SCOPE, W-AlignACE and Weeder) could detect all 23 core motifs. Thus, this strategy is a high-throughput approach for de novo motif discovery in soybean and offers great potential for novel motif discovery and synthetic promoter engineering for any plant and trait in crop biotechnology. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  7. DNaseI hypersensitivity and ultraconservation reveal novel, interdependent long-range enhancers at the complex Pax6 cis-regulatory region.

    Directory of Open Access Journals (Sweden)

    David J McBride

    Full Text Available The PAX6 gene plays a crucial role in development of the eye, brain, olfactory system and endocrine pancreas. Consistent with its pleiotropic role the gene exhibits a complex developmental expression pattern which is subject to strict spatial, temporal and quantitative regulation. Control of expression depends on a large array of cis-elements residing in an extended genomic domain around the coding region of the gene. The minimal essential region required for proper regulation of this complex locus has been defined through analysis of human aniridia-associated breakpoints and YAC transgenic rescue studies of the mouse smalleye mutant. We have carried out a systematic DNase I hypersensitive site (HS analysis across 200 kb of this critical region of mouse chromosome 2E3 to identify putative regulatory elements. Mapping the identified HSs onto a percent identity plot (PIP shows many HSs correspond to recognisable genomic features such as evolutionarily conserved sequences, CpG islands and retrotransposon derived repeats. We then focussed on a region previously shown to contain essential long range cis-regulatory information, the Pax6 downstream regulatory region (DRR, allowing comparison of mouse HS data with previous human HS data for this region. Reporter transgenic mice for two of the HS sites, HS5 and HS6, show that they function as tissue specific regulatory elements. In addition we have characterised enhancer activity of an ultra-conserved cis-regulatory region located near Pax6, termed E60. All three cis-elements exhibit multiple spatio-temporal activities in the embryo that overlap between themselves and other elements in the locus. Using a deletion set of YAC reporter transgenic mice we demonstrate functional interdependence of the elements. Finally, we use the HS6 enhancer as a marker for the migration of precerebellar neuro-epithelium cells to the hindbrain precerebellar nuclei along the posterior and anterior extramural streams allowing

  8. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Science.gov (United States)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  9. Thousands of Cis-Regulatory Sequence Combinations Are Shared by Arabidopsis and Poplar1[C][W][OA

    Science.gov (United States)

    Ding, Jun; Hu, Haiyan; Li, Xiaoman

    2012-01-01

    The identification of cis-regulatory modules (CRMs) can greatly advance our understanding of gene regulatory mechanisms. Despite the existence of binding sites of more than three transcription factors (TFs) in a CRM, studies in plants often consider only the cooccurrence of binding sites of one or two TFs. In addition, CRM studies in plants are limited to combinations of only a few families of TFs. It is thus not clear how widespread plant TFs work together, which TFs work together to regulate plant genes, and how the combinations of these TFs are shared by different plants. To fill these gaps, we applied a frequent pattern-mining-based approach to identify frequently used cis-regulatory sequence combinations in the promoter sequences of two plant species, Arabidopsis (Arabidopsis thaliana) and poplar (Populus trichocarpa). A cis-regulatory sequence here corresponds to a DNA motif bound by a TF. We identified 18,638 combinations composed of two to six cis-regulatory sequences that are shared by the two plant species. In addition, with known cis-regulatory sequence combinations, gene function annotation, gene expression data, and known functional gene sets, we showed that the functionality of at least 96.8% and 65.2% of these shared combinations in Arabidopsis are partially supported, under a false discovery rate of 0.1 and 0.05, respectively. Finally, we discovered that 796 of the 18,638 combinations might relate to functions that are important in bioenergy research. Our work will facilitate the study of gene transcriptional regulation in plants. PMID:22058225

  10. Dual functionality of cis-regulatory elements as developmental enhancers and Polycomb response elements.

    Science.gov (United States)

    Erceg, Jelena; Pakozdi, Tibor; Marco-Ferreres, Raquel; Ghavi-Helm, Yad; Girardot, Charles; Bracken, Adrian P; Furlong, Eileen E M

    2017-03-15

    Developmental gene expression is tightly regulated through enhancer elements, which initiate dynamic spatio-temporal expression, and Polycomb response elements (PREs), which maintain stable gene silencing. These two cis-regulatory functions are thought to operate through distinct dedicated elements. By examining the occupancy of the Drosophila pleiohomeotic repressive complex (PhoRC) during embryogenesis, we revealed extensive co-occupancy at developmental enhancers. Using an established in vivo assay for PRE activity, we demonstrated that a subset of characterized developmental enhancers can function as PREs, silencing transcription in a Polycomb-dependent manner. Conversely, some classic Drosophila PREs can function as developmental enhancers in vivo, activating spatio-temporal expression. This study therefore uncovers elements with dual function: activating transcription in some cells (enhancers) while stably maintaining transcriptional silencing in others (PREs). Given that enhancers initiate spatio-temporal gene expression, reuse of the same elements by the Polycomb group (PcG) system may help fine-tune gene expression and ensure the timely maintenance of cell identities. © 2017 Erceg et al.; Published by Cold Spring Harbor Laboratory Press.

  11. A Resource for Manipulating Gene Expression and Analyzing cis-Regulatory Modules in the Drosophila CNS

    Directory of Open Access Journals (Sweden)

    Laurina Manning

    2012-10-01

    Full Text Available Here, we describe the embryonic central nervous system expression of 5,000 GAL4 lines made using molecularly defined cis-regulatory DNA inserted into a single attP genomic location. We document and annotate the patterns in early embryos when neurogenesis is at its peak, and in older embryos where there is maximal neuronal diversity and the first neural circuits are established. We note expression in other tissues, such as the lateral body wall (muscle, sensory neurons, and trachea and viscera. Companion papers report on the adult brain and larval imaginal discs, and the integrated data sets are available online (http://www.janelia.org/gal4-gen1. This collection of embryonically expressed GAL4 lines will be valuable for determining neuronal morphology and function. The 1,862 lines expressed in small subsets of neurons (<20/segment will be especially valuable for characterizing interneuronal diversity and function, because although interneurons comprise the majority of all central nervous system neurons, their gene expression profile and function remain virtually unexplored.

  12. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    Science.gov (United States)

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin

    2016-03-01

    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria.

  13. Differential contribution of cis-regulatory elements to higher order chromatin structure and expression of the CFTR locus

    OpenAIRE

    Yang, Rui; Kerschner, Jenny L.; Gosalia, Nehal; Neems, Daniel; Gorsic, Lidija K.; Safi, Alexias; Crawford, Gregory E.; Kosak, Steven T.; Leir, Shih-Hsing; Harris, Ann

    2015-01-01

    Higher order chromatin structure establishes domains that organize the genome and coordinate gene expression. However, the molecular mechanisms controlling transcription of individual loci within a topological domain (TAD) are not fully understood. The cystic fibrosis transmembrane conductance regulator (CFTR) gene provides a paradigm for investigating these mechanisms. CFTR occupies a TAD bordered by CTCF/cohesin binding sites within which are cell-type-selective cis-regulatory elements for ...

  14. Single nucleotide polymorphisms with cis-regulatory effects on long non-coding transcripts in human primary monocytes.

    Directory of Open Access Journals (Sweden)

    Jonas Carlsson Almlöf

    Full Text Available We applied genome-wide allele-specific expression analysis of monocytes from 188 samples. Monocytes were purified from white blood cells of healthy blood donors to detect cis-acting genetic variation that regulates the expression of long non-coding RNAs. We analysed 8929 regions harboring genes for potential long non-coding RNA that were retrieved from data from the ENCODE project. Of these regions, 60% were annotated as intergenic, which implies that they do not overlap with protein-coding genes. Focusing on the intergenic regions, and using stringent analysis of the allele-specific expression data, we detected robust cis-regulatory SNPs in 258 out of 489 informative intergenic regions included in the analysis. The cis-regulatory SNPs that were significantly associated with allele-specific expression of long non-coding RNAs were enriched to enhancer regions marked for active or bivalent, poised chromatin by histone modifications. Out of the lncRNA regions regulated by cis-acting regulatory SNPs, 20% (n = 52 were co-regulated with the closest protein coding gene. We compared the identified cis-regulatory SNPs with those in the catalog of SNPs identified by genome-wide association studies of human diseases and traits. This comparison identified 32 SNPs in loci from genome-wide association studies that displayed a strong association signal with allele-specific expression of non-coding RNAs in monocytes, with p-values ranging from 6.7×10(-7 to 9.5×10(-89. The identified cis-regulatory SNPs are associated with diseases of the immune system, like multiple sclerosis and rheumatoid arthritis.

  15. AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors.

    Science.gov (United States)

    Davuluri, Ramana V; Sun, Hao; Palaniswamy, Saranyan K; Matthews, Nicole; Molina, Carlos; Kurtz, Mike; Grotewold, Erich

    2003-06-23

    The gene regulatory information is hardwired in the promoter regions formed by cis-regulatory elements that bind specific transcription factors (TFs). Hence, establishing the architecture of plant promoters is fundamental to understanding gene expression. The determination of the regulatory circuits controlled by each TF and the identification of the cis-regulatory sequences for all genes have been identified as two of the goals of the Multinational Coordinated Arabidopsis thaliana Functional Genomics Project by the Multinational Arabidopsis Steering Committee (June 2002). AGRIS is an information resource of Arabidopsis promoter sequences, transcription factors and their target genes. AGRIS currently contains two databases, AtTFDB (Arabidopsis thaliana transcription factor database) and AtcisDB (Arabidopsis thaliana cis-regulatory database). AtTFDB contains information on approximately 1,400 transcription factors identified through motif searches and grouped into 34 families. AtTFDB links the sequence of the transcription factors with available mutants and, when known, with the possible genes they may regulate. AtcisDB consists of the 5' regulatory sequences of all 29,388 annotated genes with a description of the corresponding cis-regulatory elements. Users can search the databases for (i) promoter sequences, (ii) a transcription factor, (iii) a direct target genes for a specific transcription factor, or (vi) a regulatory network that consists of transcription factors and their target genes. AGRIS provides the necessary software tools on Arabidopsis transcription factors and their putative binding sites on all genes to initiate the identification of transcriptional regulatory networks in the model dicotyledoneous plant Arabidopsis thaliana. AGRIS can be accessed from http://arabidopsis.med.ohio-state.edu.

  16. Bioinformatic analysis of cis-regulatory interactions between progesterone and estrogen receptors in breast cancer

    Directory of Open Access Journals (Sweden)

    Matloob Khushi

    2014-11-01

    Full Text Available Chromatin factors interact with each other in a cell and sequence-specific manner in order to regulate transcription and a wealth of publically available datasets exists describing the genomic locations of these interactions. Our recently published BiSA (Binding Sites Analyser database contains transcription factor binding locations and epigenetic modifications collected from published studies and provides tools to analyse stored and imported data. Using BiSA we investigated the overlapping cis-regulatory role of estrogen receptor alpha (ERα and progesterone receptor (PR in the T-47D breast cancer cell line. We found that ERα binding sites overlap with a subset of PR binding sites. To investigate further, we re-analysed raw data to remove any biases introduced by the use of distinct tools in the original publications. We identified 22,152 PR and 18,560 ERα binding sites (<5% false discovery rate with 4,358 overlapping regions among the two datasets. BiSA statistical analysis revealed a non-significant overall overlap correlation between the two factors, suggesting that ERα and PR are not partner factors and do not require each other for binding to occur. However, Monte Carlo simulation by Binary Interval Search (BITS, Relevant Distance, Absolute Distance, Jaccard and Projection tests by Genometricorr revealed a statistically significant spatial correlation of binding regions on chromosome between the two factors. Motif analysis revealed that the shared binding regions were enriched with binding motifs for ERα, PR and a number of other transcription and pioneer factors. Some of these factors are known to co-locate with ERα and PR binding. Therefore spatially close proximity of ERα binding sites with PR binding sites suggests that ERα and PR, in general function independently at the molecular level, but that their activities converge on a specific subset of transcriptional targets.

  17. Structural relationships between highly conserved elements and genes in vertebrate genomes.

    Directory of Open Access Journals (Sweden)

    Hong Sun

    Full Text Available Large numbers of sequence elements have been identified to be highly conserved among vertebrate genomes. These highly conserved elements (HCEs are often located in or around genes that are involved in transcription regulation and early development. They have been shown to be involved in cis-regulatory activities through both in vivo and additional computational studies. We have investigated the structural relationships between such elements and genes in six vertebrate genomes human, mouse, rat, chicken, zebrafish and tetraodon and detected several thousand cases of conserved HCE-gene associations, and also cases of HCEs with no common target genes. A few examples underscore the potential significance of our findings about several individual genes. We found that the conserved association between HCE/HCEs and gene/genes are not restricted to elements by their absolute distance on the genome. Notably, long-range associations were identified and the molecular functions of the associated genes do not show any particular overrepresentation of the functional categories previously reported. HCEs in close proximity are found to be linked with different set of gene/genes. The results reflect the highly complex correlation between HCEs and their putative target genes.

  18. Rearrangements of 2.5 Kilobases of Noncoding DNA from the Drosophila even-skipped Locus Define Predictive Rules of Genomic cis-Regulatory Logic

    Science.gov (United States)

    Kim, Ah-Ram; Martinez, Carlos; Ionides, John; Ramos, Alexandre F.; Ludwig, Michael Z.; Ogawa, Nobuo; Sharp, David H.; Reinitz, John

    2013-01-01

    Rearrangements of about 2.5 kilobases of regulatory DNA located 5′ of the transcription start site of the Drosophila even-skipped locus generate large-scale changes in the expression of even-skipped stripes 2, 3, and 7. The most radical effects are generated by juxtaposing the minimal stripe enhancers MSE2 and MSE3 for stripes 2 and 3 with and without small “spacer” segments less than 360 bp in length. We placed these fusion constructs in a targeted transformation site and obtained quantitative expression data for these transformants together with their controlling transcription factors at cellular resolution. These data demonstrated that the rearrangements can alter expression levels in stripe 2 and the 2–3 interstripe by a factor of more than 10. We reasoned that this behavior would place tight constraints on possible rules of genomic cis-regulatory logic. To find these constraints, we confronted our new expression data together with previously obtained data on other constructs with a computational model. The model contained representations of thermodynamic protein–DNA interactions including steric interference and cooperative binding, short-range repression, direct repression, activation, and coactivation. The model was highly constrained by the training data, which it described within the limits of experimental error. The model, so constrained, was able to correctly predict expression patterns driven by enhancers for other Drosophila genes; even-skipped enhancers not included in the training set; stripe 2, 3, and 7 enhancers from various Drosophilid and Sepsid species; and long segments of even-skipped regulatory DNA that contain multiple enhancers. The model further demonstrated that elevated expression driven by a fusion of MSE2 and MSE3 was a consequence of the recruitment of a portion of MSE3 to become a functional component of MSE2, demonstrating that cis-regulatory “elements” are not elementary objects. PMID:23468638

  19. SOX9 chromatin folding domains correlate with its real and putative distant cis-regulatory elements.

    Science.gov (United States)

    Smyk, Marta; Akdemir, Kadir Caner; Stankiewicz, Paweł

    2017-03-04

    Evolutionary conserved transcription factor SOX9, encoded by the dosage sensitive SOX9 gene on chromosome 17q24.3, plays an important role in development of multiple organs, including bones and testes. Heterozygous point mutations and genomic copy-number variant (CNV) deletions involving SOX9 have been reported in patients with campomelic dysplasia (CD), a skeletal malformation syndrome often associated with male-to-female sex reversal. Balanced and unbalanced structural genomic variants with breakpoints mapping up to 1.3 Mb up- and downstream to SOX9 have been described in patients with milder phenotypes, including acampomelic campomelic dysplasia, sex reversal, and Pierre Robin sequence. Based on the localization of breakpoints of genomic rearrangements causing different phenotypes, 5 genomic intervals mapping upstream to SOX9 have been defined. We have analyzed the publically available database of high-throughput chromosome conformation capture (Hi-C) in multiple cell lines in the genomic regions flanking SOX9. Consistent with the literature data, chromatin domain boundaries in the SOX9 locus exhibit conservation across species and remain largely constant across multiple cell types. Interestingly, we have found that chromatin folding domains in the SOX9 locus associate with the genomic intervals harboring real and putative regulatory elements of SOX9, implicating that variation in intra-domain interactions may be critical for dynamic regulation of SOX9 expression in a cell type-specific fashion. We propose that tissue-specific enhancers for other transcription factor genes may similarly utilize chromatin folding sub-domains in gene regulation.

  20. Maps of cis-Regulatory Nodes in Megabase Long Genome Segments are an Inevitable Intermediate Step Toward Whole Genome Functional Mapping.

    Science.gov (United States)

    Nikolaev, Lev G; Akopov, Sergey B; Chernov, Igor P; Sverdlov, Eugene D

    2007-04-01

    The availability of complete human and other metazoan genome sequences has greatly facilitated positioning and analysis of various genomic functional elements, with initial emphasis on coding sequences. However, complete functional maps of sequenced eukaryotic genomes should include also positions of all non-coding regulatory elements. Unfortunately, experimental data on genomic positions of a multitude of regulatory sequences, such as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. Since most genomic regulatory elements (e.g. enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements by computational methods is difficult and often ambiguous. Therefore, the development of high-throughput experimental approaches for identifying and mapping genomic functional elements is highly desirable. At the same time, the creation of whole-genome map of hundreds of thousands of regulatory elements in several hundreds of tissue/cell types is presently far beyond our capabilities. A possible alternative for the whole genome approach is to concentrate efforts on individual genomic segments and then to integrate the data obtained into a whole genome functional map. Moreover, the maps of polygenic fragments with functional cis-regulatory elements would provide valuable data on complex regulatory systems, including their variability and evolution. Here, we reviewed experimental approaches to the realization of these ideas, including our own developments of experimental techniques for selection of cis-acting functionally active DNA fragments from large (megabase-sized) segments of mammalian genomes.

  1. MotifCombinator: a web-based tool to search for combinations of cis-regulatory motifs

    Directory of Open Access Journals (Sweden)

    Tsunoda Tatsuhiko

    2007-03-01

    Full Text Available Abstract Background A combination of multiple types of transcription factors and cis-regulatory elements is often required for gene expression in eukaryotes, and the combinatorial regulation confers specific gene expression to tissues or environments. To reveal the combinatorial regulation, computational methods are developed that efficiently infer combinations of cis-regulatory motifs that are important for gene expression as measured by DNA microarrays. One promising type of computational method is to utilize regression analysis between expression levels and scores of motifs in input sequences. This type takes full advantage of information on expression levels because it does not require that the expression level of each gene be dichotomized according to whether or not it reaches a certain threshold level. However, there is no web-based tool that employs regression methods to systematically search for motif combinations and that practically handles combinations of more than two or three motifs. Results We here introduced MotifCombinator, an online tool with a user-friendly interface, to systematically search for combinations composed of any number of motifs based on regression methods. The tool utilizes well-known regression methods (the multivariate linear regression, the multivariate adaptive regression spline or MARS, and the multivariate logistic regression method for this purpose, and uses the genetic algorithm to search for combinations composed of any desired number of motifs. The visualization systems in this tool help users to intuitively grasp the process of the combination search, and the backup system allows users to easily stop and restart calculations that are expected to require large computational time. This tool also provides preparatory steps needed for systematic combination search – i.e., selecting single motifs to constitute combinations and cutting out redundant similar motifs based on clustering analysis. Conclusion

  2. Cis-regulatory PLETHORA promoter elements directing root and nodule expression are conserved between Arabidopsis thaliana and Medicago truncatula

    NARCIS (Netherlands)

    Franssen, H.G.J.M.; Kulikova, O.; Willemsen, V.A.; Heidstra, R.

    2017-01-01

    Nodules are unique organs formed on roots of legumes by soil-borne bacteria, collectively known as rhizobium. Recently, we have shown that orthologs of the AINTEGUMENTA-like (AIL) AP2 transcription factors PLETHORA (PLT) 1 to 4, that redundantly regulate Arabidopsis thaliana root development are

  3. An algorithmic perspective of de novo cis-regulatory motif finding based on ChIP-seq data.

    Science.gov (United States)

    Liu, Bingqiang; Yang, Jinyu; Li, Yang; McDermaid, Adam; Ma, Qin

    2017-03-08

    Transcription factors are proteins that bind to specific DNA sequences and play important roles in controlling the expression levels of their target genes. Hence, prediction of transcription factor binding sites (TFBSs) provides a solid foundation for inferring gene regulatory mechanisms and building regulatory networks for a genome. Chromatin immunoprecipitation sequencing (ChIP-seq) technology can generate large-scale experimental data for such protein-DNA interactions, providing an unprecedented opportunity to identify TFBSs (a.k.a. cis-regulatory motifs). The bottleneck, however, is the lack of robust mathematical models, as well as efficient computational methods for TFBS prediction to make effective use of massive ChIP-seq data sets in the public domain. The purpose of this study is to review existing motif-finding methods for ChIP-seq data from an algorithmic perspective and provide new computational insight into this field. The state-of-the-art methods were shown through summarizing eight representative motif-finding algorithms along with corresponding challenges, and introducing some important relative functions according to specific biological demands, including discriminative motif finding and cofactor motifs analysis. Finally, potential directions and plans for ChIP-seq-based motif-finding tools were showcased in support of future algorithm development. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Identification of Cis-regulatory Elements of Butyrophilin Gene of the ...

    African Journals Online (AJOL)

    Butyrophilin subfamily 1 member A1 is a highly expressed gene in mammary gland of all mammals during lactation. It is found to be the major integral protein in the milk fat globule membrane. Its interactions with other membrane elements and soluble proteins of the mammary epithelial cells regulate the secretion of milk fat.

  5. Modeling the cis-regulatory modules of genes expressed in developmental stages of Drosophila melanogaster.

    Science.gov (United States)

    López, Yosvany; Vandenbon, Alexis; Nose, Akinao; Nakai, Kenta

    2017-01-01

    Because transcription is the first step in the regulation of gene expression, understanding how transcription factors bind to their DNA binding motifs has become absolutely necessary. It has been shown that the promoters of genes with similar expression profiles share common structural patterns. This paper presents an extensive study of the regulatory regions of genes expressed in 24 developmental stages of Drosophila melanogaster. It proposes the use of a combination of structural features, such as positioning of individual motifs relative to the transcription start site, orientation, pairwise distance between motifs, and presence of motifs anywhere in the promoter for predicting gene expression from structural features of promoter sequences. RNA-sequencing data was utilized to create and validate the 24 models. When genes with high-scoring promoters were compared to those identified by RNA-seq samples, 19 (79.2%) statistically significant models, a number that exceeds previous studies, were obtained. Each model yielded a set of highly informative features, which were used to search for genes with similar biological functions.

  6. Transcriptional regulation of human-specific SVAF₁ retrotransposons by cis-regulatory MAST2 sequences.

    Science.gov (United States)

    Zabolotneva, Anastasia A; Bantysh, Olga; Suntsova, Maria V; Efimova, Nadezhda; Malakhova, Galina V; Schumann, Gerald G; Gayfullin, Nurshat M; Buzdin, Anton A

    2012-08-15

    SVA elements represent the youngest family of hominid non-LTR retrotransposons. Recently, a human-specific subfamily (termed SVA(F1), CpG-SVA, or MAST2-SVA) was discovered representing fusion of the CpG island-containing exon 1 of the MAST2 gene and a 5'-truncated SVA. SVA(F1) includes at least 84 members, which suggests exceptionally high retrotransposition level. We investigated if the acquirement of the MAST2 CpG-island might play a role in the success of the SVA(F1) subfamily. We observed that in 16 samples representing seven human tissues, MAST2 was cotranscribed with the members of the SVA(F1) subfamily, but not with other retrotransposons. We found that the methylation status of the MAST2-derived sequences of SVA(F1) elements reversely correlates with the transcriptional activity of MAST2. The MAST2 sequence at the 5' end of SVA(F1) acts as a positive transcriptional regulator in human germ cells. Finally, in various testicular tissue samples we uncovered a transcriptional correlation of MAST2 with the human L1, Alu and SVA retrotransposons. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. RNA expression in a cartilaginous fish cell line reveals ancient 3' noncoding regions highly conserved in vertebrates.

    Science.gov (United States)

    Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J; Barnes, David W

    2007-01-23

    We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3' UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3' mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology.

  8. Neutralizing the function of a β-globin-associated cis-regulatory DNA element using an artificial zinc finger DNA-binding domain.

    Science.gov (United States)

    Barrow, Joeva J; Masannat, Jude; Bungert, Jörg

    2012-10-30

    Gene expression is primarily regulated by cis-regulatory DNA elements and trans-interacting proteins. Transcription factors bind in a DNA sequence-specific manner and recruit activities that modulate the association and activity of transcription complexes at specific genes. Often, transcription factors belong to families of related proteins that interact with similar DNA sequences. Furthermore, genes are regulated by multiple, sometimes redundant, cis-regulatory elements. Thus, the analysis of the role of a specific DNA regulatory sequence and the interacting proteins in the context of intact cells is challenging. In this study, we designed and functionally characterized an artificial DNA-binding domain that neutralizes the function of a cis-regulatory DNA element associated with adult β-globin gene expression. The zinc finger DNA-binding domain (ZF-DBD), comprising six ZFs, interacted specifically with a CACCC site located 90 bp upstream of the transcription start site (-90 β-ZF-DBD), which is normally occupied by KLF1, a major regulator of adult β-globin gene expression. Stable expression of the -90 β-ZF-DBD in mouse erythroleukemia cells reduced the binding of KLF1 with the β-globin gene, but not with locus control region element HS2, and led to reduced transcription. Transient transgenic embryos expressing the -90 β-ZF-DBD developed normally but revealed reduced expression of the adult β-globin gene. These results demonstrate that artificial DNA-binding proteins lacking effector domains are useful tools for studying and modulating the function of cis-regulatory DNA elements.

  9. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs

    Directory of Open Access Journals (Sweden)

    Girgis Hani Z

    2012-02-01

    Full Text Available Abstract Background Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF binding sites (TFBSs. Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. Results We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was

  10. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs.

    Science.gov (United States)

    Girgis, Hani Z; Ovcharenko, Ivan

    2012-02-07

    Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs) and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF) binding sites (TFBSs). Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was 21-75% more precise than a related CRM

  11. Alternative splicing modulated by genetic variants demonstrates accelerated evolution regulated by highly conserved proteins.

    Science.gov (United States)

    Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Lin, Xianzhi; Chan, Tak-Ming; Wang, Rena; Xiao, Xinshu

    2016-04-01

    Identification of functional genetic variants and elucidation of their regulatory mechanisms represent significant challenges of the post-genomic era. A poorly understood topic is the involvement of genetic variants in mediating post-transcriptional RNA processing, including alternative splicing. Thus far, little is known about the genomic, evolutionary, and regulatory features of genetically modulated alternative splicing (GMAS). Here, we systematically identified intronic tag variants for genetic modulation of alternative splicing using RNA-seq data specific to cellular compartments. Combined with our previous method that identifies exonic tags for GMAS, this study yielded 622 GMAS exons. We observed that GMAS events are highly cell type independent, indicating that splicing-altering genetic variants could have widespread function across cell types. Interestingly, GMAS genes, exons, and single-nucleotide variants (SNVs) all demonstrated positive selection or accelerated evolution in primates. We predicted that GMAS SNVs often alter binding of splicing factors, with SRSF1 affecting the most GMAS events and demonstrating global allelic binding bias. However, in contrast to their GMAS targets, the predicted splicing factors are more conserved than expected, suggesting that cis-regulatory variation is the major driving force of splicing evolution. Moreover, GMAS-related splicing factors had stronger consensus motifs than expected, consistent with their susceptibility to SNV disruption. Intriguingly, GMAS SNVs in general do not alter the strongest consensus position of the splicing factor motif, except the more than 100 GMAS SNVs in linkage disequilibrium with polymorphisms reported by genome-wide association studies. Our study reports many GMAS events and enables a better understanding of the evolutionary and regulatory features of this phenomenon. © 2016 Hsiao et al.; Published by Cold Spring Harbor Laboratory Press.

  12. The in vivo dissection of direct RFX-target gene promoters in C. elegans reveals a novel cis-regulatory element, the C-box.

    Science.gov (United States)

    Burghoorn, Jan; Piasecki, Brian P; Crona, Filip; Phirke, Prasad; Jeppsson, Kristian E; Swoboda, Peter

    2012-08-15

    At the core of the primary transcriptional network regulating ciliary gene expression in Caenorhabditis elegans sensory neurons is the RFX/DAF-19 transcription factor, which binds and thereby positively regulates 13-15 bp X-box promoter motifs found in the cis-regulatory regions of many ciliary genes. However, the variable expression of direct RFX-target genes in various sets of ciliated sensory neurons (CSNs) occurs through as of yet uncharacterized mechanisms. In this study the cis-regulatory regions of 41 direct RFX-target genes are compared using in vivo genetic analyses and computational comparisons of orthologous nematode sequences. We find that neither the proximity to the translational start site nor the exact sequence composition of the X-box promoter motif of the respective ciliary gene can explain the variation in expression patterns observed among different direct RFX-target genes. Instead, a novel enhancer element appears to co-regulate ciliary genes in a DAF-19 dependent manner. This cytosine- and thymidine-rich sequence, the C-box, was found in the cis-regulatory regions in close proximity to the respective X-box motif for 84% of the most broadly expressed direct RFX-target genes sampled in this study. Molecular characterization confirmed that these 8-11 bp C-box sequences act as strong enhancer elements for direct RFX-target genes. An artificial promoter containing only an X-box promoter motif and two of the C-box enhancer elements was able to drive strong expression of a GFP reporter construct in many C. elegans CSNs. These data provide a much-improved understanding of how direct RFX-target genes are differentially regulated in C. elegans and will provide a molecular model for uncovering the transcriptional network mediating ciliary gene expression in animals. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Whole-mount in situ hybridization of sectioned tissues of species hybrids to detect cis-regulatory changes in gene expression pattern.

    Science.gov (United States)

    Futahashi, Ryo

    2011-01-01

    To distinguish whether differences in gene expression between species or between individuals of the same species are caused by cis-regulatory changes or by distribution differences in trans-regulatory proteins, comparison of species-specific mRNA expression in an F1 hybrid by whole-mount in situ hybridization is a rarely used yet very powerful tool. If asymmetric expression pattern is observed for the two alleles, this implies a cis-regulatory divergence of this gene. Alternatively, if symmetric expression pattern is observed for both alleles, the change in expression of this gene is probably caused by changes in the distribution of trans-regulatory proteins. In this chapter, I describe how to prepare RNA probes, tissue samples and how to detect mRNA expression pattern using in situ hybridization. Although I choose to present here the detection of yellow-related gene (YRG) expression pattern in the larval epidermis of swallowtail butterflies, this protocol can be adapted to other species and tissues. YRG mRNA expression is correlated with interspecific differences of yellow and green larval color pattern such as V-shaped markings in swallowtail butterflies. F1 hybrids show an intermediate color pattern between parental species. In this case, both species-specific YRG mRNA showed a similar expression pattern in F1 hybrids, suggesting that the change in expression of YRG is mainly caused by changes in the distribution of trans-regulatory proteins.

  14. A Generalized Linear Model for Decomposing Cis-regulatory, Parent-of-Origin, and Maternal Effects on Allele-Specific Gene Expression

    Directory of Open Access Journals (Sweden)

    Yasuaki Takada

    2017-07-01

    Full Text Available Joint quantification of genetic and epigenetic effects on gene expression is important for understanding the establishment of complex gene regulation systems in living organisms. In particular, genomic imprinting and maternal effects play important roles in the developmental process of mammals and flowering plants. However, the influence of these effects on gene expression are difficult to quantify because they act simultaneously with cis-regulatory mutations. Here we propose a simple method to decompose cis-regulatory (i.e., allelic genotype, genomic imprinting [i.e., parent-of-origin (PO], and maternal [i.e., maternal genotype (MG] effects on allele-specific gene expression using RNA-seq data obtained from reciprocal crosses. We evaluated the efficiency of method using a simulated dataset and applied the method to whole-body Drosophila and mouse trophoblast stem cell (TSC and liver RNA-seq data. Consistent with previous studies, we found little evidence of PO and MG effects in adult Drosophila samples. In contrast, we identified dozens and hundreds of mouse genes with significant PO and MG effects, respectively. Interestingly, a similar number of genes with significant PO effect were detect in mouse TSCs and livers, whereas more genes with significant MG effect were observed in livers. Further application of this method will clarify how these three effects influence gene expression levels in different tissues and developmental stages, and provide novel insight into the evolution of gene expression regulation.

  15. Does high harmonic generation conserve angular momentum?

    CERN Document Server

    Fleischer, Avner; Diskin, Tzvi; Sidorenko, Pavel; Cohen, Oren

    2013-01-01

    High harmonic generation (HHG) is a unique and useful process in which infrared or visible radiation is frequency up converted into the extreme ultraviolet and x ray spectral regions. As a parametric process, high harmonic generation should conserve the radiation energy, momentum and angular momentum. Indeed, conservation of energy and momentum have been demonstrated. Angular momentum of optical beams can be divided into two components: orbital and spin (polarization). Orbital angular momentum is assumed to be conserved and recently observed deviations were attributed to propagation effects. On the other hand, conservation of spin angular momentum has thus far never been studied, neither experimentally nor theoretically. Here, we present the first study on the role of spin angular momentum in extreme nonlinear optics by experimentally generating high harmonics of bi chromatic elliptically polarized pump beams that interact with isotropic media. While observing that the selection rules qualitatively correspond...

  16. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    NARCIS (Netherlands)

    Kusters, E.; Della Pina, S.; Castel, R.; Souer, E.; Koes, R.

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than

  17. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    NARCIS (Netherlands)

    Kusters, E.; Della Pina, S.; Castel, R.; Souer, E.J.; Koes, R.E.

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than

  18. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  19. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  20. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Directory of Open Access Journals (Sweden)

    Lamprini G Kalampoki

    Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  1. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Science.gov (United States)

    Kalampoki, Lamprini G; Flytzanis, Constantin N

    2014-01-01

    Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN). The Paracentrotus lividus Coup-TF gene (PlCoup-TF) is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232), was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3) within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1) or ectopic expression (RE2, RE3). It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  2. Group 1 Innate Lymphoid Cell Lineage Identity Is Determined by a cis-Regulatory Element Marked by a Long Non-coding RNA.

    Science.gov (United States)

    Mowel, Walter K; McCright, Sam J; Kotzin, Jonathan J; Collet, Magalie A; Uyar, Asli; Chen, Xin; DeLaney, Alexandra; Spencer, Sean P; Virtue, Anthony T; Yang, EnJun; Villarino, Alejandro; Kurachi, Makoto; Dunagin, Margaret C; Pritchard, Gretchen Harms; Stein, Judith; Hughes, Cynthia; Fonseca-Pereira, Diogo; Veiga-Fernandes, Henrique; Raj, Arjun; Kambayashi, Taku; Brodsky, Igor E; O'Shea, John J; Wherry, E John; Goff, Loyal A; Rinn, John L; Williams, Adam; Flavell, Richard A; Henao-Mejia, Jorge

    2017-09-19

    Commitment to the innate lymphoid cell (ILC) lineage is determined by Id2, a transcriptional regulator that antagonizes T and B cell-specific gene expression programs. Yet how Id2 expression is regulated in each ILC subset remains poorly understood. We identified a cis-regulatory element demarcated by a long non-coding RNA (lncRNA) that controls the function and lineage identity of group 1 ILCs, while being dispensable for early ILC development and homeostasis of ILC2s and ILC3s. The locus encoding this lncRNA, which we termed Rroid, directly interacted with the promoter of its neighboring gene, Id2, in group 1 ILCs. Moreover, the Rroid locus, but not the lncRNA itself, controlled the identity and function of ILC1s by promoting chromatin accessibility and deposition of STAT5 at the promoter of Id2 in response to interleukin (IL)-15. Thus, non-coding elements responsive to extracellular cues unique to each ILC subset represent a key regulatory layer for controlling the identity and function of ILCs. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Promoter analysis reveals cis-regulatory motifs associated with the expression of the WRKY transcription factor CrWRKY1 in Catharanthus roseus.

    Science.gov (United States)

    Yang, Zhirong; Patra, Barunava; Li, Runzhi; Pattanaik, Sitakanta; Yuan, Ling

    2013-12-01

    WRKY transcription factors (TFs) are emerging as an important group of regulators of plant secondary metabolism. However, the cis-regulatory elements associated with their regulation have not been well characterized. We have previously demonstrated that CrWRKY1, a member of subgroup III of the WRKY TF family, regulates biosynthesis of terpenoid indole alkaloids in the ornamental and medicinal plant, Catharanthus roseus. Here, we report the isolation and functional characterization of the CrWRKY1 promoter. In silico analysis of the promoter sequence reveals the presence of several potential TF binding motifs, indicating the involvement of additional TFs in the regulation of the TIA pathway. The CrWRKY1 promoter can drive the expression of a β-glucuronidase (GUS) reporter gene in native (C. roseus protoplasts and transgenic hairy roots) and heterologous (transgenic tobacco seedlings) systems. Analysis of 5'- or 3'-end deletions indicates that the sequence located between positions -140 to -93 bp and -3 to +113 bp, relative to the transcription start site, is critical for promoter activity. Mutation analysis shows that two overlapping as-1 elements and a CT-rich motif contribute significantly to promoter activity. The CrWRKY1 promoter is induced in response to methyl jasmonate (MJ) treatment and the promoter region between -230 and -93 bp contains a putative MJ-responsive element. The CrWRKY1 promoter can potentially be used as a tool to isolate novel TFs involved in the regulation of the TIA pathway.

  4. Forest conservation delivers highly variable coral reef conservation outcomes.

    Science.gov (United States)

    Klein, Carissa J; Jupiter, Stacy D; Selig, Elizabeth R; Watts, Matthew E; Halpern, Benjamin S; Kamal, Muhammad; Roelfsema, Chris; Possingham, Hugh P

    2012-06-01

    Coral reefs are threatened by human activities on both the land (e.g., deforestation) and the sea (e.g., overfishing). Most conservation planning for coral reefs focuses on removing threats in the sea, neglecting management actions on the land. A more integrated approach to coral reef conservation, inclusive of land-sea connections, requires an understanding of how and where terrestrial conservation actions influence reefs. We address this by developing a land-sea planning approach to inform fine-scale spatial management decisions and test it in Fiji. Our aim is to determine where the protection of forest can deliver the greatest return on investment for coral reef ecosystems. To assess the benefits of conservation to coral reefs, we estimate their relative condition as influenced by watershed-based pollution and fishing. We calculate the cost-effectiveness of protecting forest and find that investments deliver rapidly diminishing returns for improvements to relative reef condition. For example, protecting 2% of forest in one area is almost 500 times more beneficial than protecting 2% in another area, making prioritization essential. For the scenarios evaluated, relative coral reef condition could be improved by 8-58% if all remnant forest in Fiji were protected rather than deforested. Finally, we determine the priority of each coral reef for implementing a marine protected area when all remnant forest is protected for conservation. The general results will support decisions made by the Fiji Protected Area Committee as they establish a national protected area network that aims to protect 20% of the land and 30% of the inshore waters by 2020. Although challenges remain, we can inform conservation decisions around the globe by tackling the complex issues relevant to integrated land-sea planning.

  5. Discovery of cell-type specific DNA motif grammar in cis-regulatory elements using random Forest.

    Science.gov (United States)

    Wang, Xin; Lin, Peijie; Ho, Joshua W K

    2018-01-19

    It has been observed that many transcription factors (TFs) can bind to different genomic loci depending on the cell type in which a TF is expressed in, even though the individual TF usually binds to the same core motif in different cell types. How a TF can bind to the genome in such a highly cell-type specific manner, is a critical research question. One hypothesis is that a TF requires co-binding of different TFs in different cell types. If this is the case, it may be possible to observe different combinations of TF motifs - a motif grammar - located at the TF binding sites in different cell types. In this study, we develop a bioinformatics method to systematically identify DNA motifs in TF binding sites across multiple cell types based on published ChIP-seq data, and address two questions: (1) can we build a machine learning classifier to predict cell-type specificity based on motif combinations alone, and (2) can we extract meaningful cell-type specific motif grammars from this classifier model. We present a Random Forest (RF) based approach to build a multi-class classifier to predict the cell-type specificity of a TF binding site given its motif content. We applied this RF classifier to two published ChIP-seq datasets of TF (TCF7L2 and MAX) across multiple cell types. Using cross-validation, we show that motif combinations alone are indeed predictive of cell types. Furthermore, we present a rule mining approach to extract the most discriminatory rules in the RF classifier, thus allowing us to discover the underlying cell-type specific motif grammar. Our bioinformatics analysis supports the hypothesis that combinatorial TF motif patterns are cell-type specific.

  6. Exact p-value calculation for heterotypic clusters of regulatory motifs and its application in computational annotation of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Roytberg Mikhail A

    2007-10-01

    Full Text Available Abstract Background cis-Regulatory modules (CRMs of eukaryotic genes often contain multiple binding sites for transcription factors. The phenomenon that binding sites form clusters in CRMs is exploited in many algorithms to locate CRMs in a genome. This gives rise to the problem of calculating the statistical significance of the event that multiple sites, recognized by different factors, would be found simultaneously in a text of a fixed length. The main difficulty comes from overlapping occurrences of motifs. So far, no tools have been developed allowing the computation of p-values for simultaneous occurrences of different motifs which can overlap. Results We developed and implemented an algorithm computing the p-value that s different motifs occur respectively k1, ..., ks or more times, possibly overlapping, in a random text. Motifs can be represented with a majority of popular motif models, but in all cases, without indels. Zero or first order Markov chains can be adopted as a model for the random text. The computational tool was tested on the set of cis-regulatory modules involved in D. melanogaster early development, for which there exists an annotation of binding sites for transcription factors. Our test allowed us to correctly identify transcription factors cooperatively/competitively binding to DNA. Method The algorithm that precisely computes the probability of simultaneous motif occurrences is inspired by the Aho-Corasick automaton and employs a prefix tree together with a transition function. The algorithm runs with the O(n|Σ|(m|ℋ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaat0uy0HwzTfgDPnwy1egaryqtHrhAL1wy0L2yHvdaiqaacqWFlecsaaa@3762@| + K|σ|K ∏i ki time complexity, where n is the length of the text, |Σ| is the alphabet size, m is the

  7. Deletion hotspots in AMACR promoter CpG island are cis-regulatory elements controlling the gene expression in the colon.

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2009-01-01

    Full Text Available Alpha-methylacyl-coenzyme A racemase (AMACR regulates peroxisomal beta-oxidation of phytol-derived, branched-chain fatty acids from red meat and dairy products -- suspected risk factors for colon carcinoma (CCa. AMACR was first found overexpressed in prostate cancer but not in benign glands and is now an established diagnostic marker for prostate cancer. Aberrant expression of AMACR was recently reported in Cca; however, little is known about how this gene is abnormally activated in cancer. By using a panel of immunostained-laser-capture-microdissected clinical samples comprising the entire colon adenoma-carcinoma sequence, we show that deregulation of AMACR during colon carcinogenesis involves two nonrandom events, resulting in the mutually exclusive existence of double-deletion at CG3 and CG10 and deletion of CG12-16 in a newly identified CpG island within the core promoter of AMACR. The double-deletion at CG3 and CG10 was found to be a somatic lesion. It existed in histologically normal colonic glands and tubular adenomas with low AMACR expression and was absent in villous adenomas and all CCas expressing variable levels of AMACR. In contrast, deletion of CG12-16 was shown to be a constitutional allele with a frequency of 43% in a general population. Its prevalence reached 89% in moderately differentiated CCas strongly expressing AMACR but only existed at 14% in poorly differentiated CCas expressing little or no AMACR. The DNA sequences housing these deletions were found to be putative cis-regulatory elements for Sp1 at CG3 and CG10, and ZNF202 at CG12-16. Chromatin immunoprecipitation, siRNA knockdown, gel shift assay, ectopic expression, and promoter analyses supported the regulation by Sp1 and ZNF202 of AMACR gene expression in an opposite manner. Our findings identified key in vivo events and novel transcription factors responsible for AMACR regulation in CCas and suggested these AMACR deletions may have diagnostic/prognostic value for

  8. 76 FR 82075 - Highly Erodible Land and Wetland Conservation

    Science.gov (United States)

    2011-12-30

    .... These changes to the regulations are made to implement provisions specified in the Food, Conservation... Conservation.'' The regulations have been in place since the implementation of the requirements in the Food... Secretary 7 CFR Part 12 RIN 0560-AH97 Highly Erodible Land and Wetland Conservation AGENCY: Office of the...

  9. Readings in Wildlife and Fish Conservation, High School Conservation Curriculum Project.

    Science.gov (United States)

    Ensminger, Jack

    This publication is a tentative edition of readings on Wildlife and Fish Conservation in Louisiana, and as such it forms part of one of the four units of study designed for an experimental high school course, the "High School Conservation Curriculum Project." The other three units are concerned with Forest Conervation, Soil and Water…

  10. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    Science.gov (United States)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette; Eiberg, Hans; Hansen, Lars; Hussain, Muhammad Sajid; Rehman, Shoaib ur; Azhar, Aysha; Ali, Amjad; Bakhtiar, Syeda Marriam; Tommerup, Niels; Baig, Shahid Mahmood; Kjaer, Klaus W

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects have been reported in ZRS, the underlying regulatory mechanism is still unknown. In this study, we analyzed the effect on transcription factor binding of a novel ZRS point mutation (463T>G) in a Pakistani family with preaxial polydactyly and triphalangeal thumb. Electrophoretical mobility shift assay demonstrated a marked difference between wild-type and the mutant probe, which uniquely bound one or several transcription factors extracted from Caco-2 cells. This finding supports a model in which ectopic anterior SHH expression in the developing limb results from abnormal binding of one or more transcription factors to the mutant sequence. PMID:20068592

  11. Furrow Dike Water Conservation Practices in the Texas High Plains

    OpenAIRE

    Wistrand, Glen L.

    1984-01-01

    Furrow diking can prevent irrigation and rainfall runoff, conserve energy use, prevent soil loss, amd allow producers to reclaim land otherwise unusable, depending on soil, climate, and crops grown in a given area. Initial investment to use this technique may be recovered within the first season. This study analyzes the effects of diking on water and soil conservation, crop yields, costs, and energy use in farming, using examples of farms in the Texas High Plains area.

  12. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

  13. Conservation agriculture in high tunnels: soil health and profit enhancement

    Science.gov (United States)

    In 2013, through the USDA’s Evans-Allen capacity grant, the high tunnel became an on-farm research laboratory for conservation agriculture. Dr. Manuel R. Reyes, Professor and his research team from the North Carolina Agriculture and Technology State University (NCATSU), Greensboro, North Carolina (1...

  14. Generation of monoclonal antibodies against highly conserved antigens.

    Directory of Open Access Journals (Sweden)

    Hongzhe Zhou

    Full Text Available BACKGROUND: Therapeutic antibody development is one of the fastest growing areas of the pharmaceutical industry. Generating high-quality monoclonal antibodies against a given therapeutic target is very crucial for the success of the drug development. However, due to immune tolerance, some proteins that are highly conserved between mice and humans are not very immunogenic in mice, making it difficult to generate antibodies using a conventional approach. METHODOLOGY/PRINCIPAL FINDINGS: In this report, the impaired immune tolerance of NZB/W mice was exploited to generate monoclonal antibodies against highly conserved or self-antigens. Using two highly conserved human antigens (MIF and HMGB1 and one mouse self-antigen (TNF-alpha as examples, we demonstrate here that multiple clones of high affinity, highly specific antibodies with desired biological activities can be generated, using the NZB/W mouse as the immunization host and a T cell-specific tag fused to a recombinant antigen to stimulate the immune system. CONCLUSIONS/SIGNIFICANCE: We developed an efficient and universal method for generating surrogate or therapeutic antibodies against "difficult antigens" to facilitate the development of therapeutic antibodies.

  15. Common binding by redundant group B Sox proteins is evolutionarily conserved in Drosophila.

    Science.gov (United States)

    Carl, Sarah H; Russell, Steven

    2015-04-13

    Group B Sox proteins are a highly conserved group of transcription factors that act extensively to coordinate nervous system development in higher metazoans while showing both co-expression and functional redundancy across a broad group of taxa. In Drosophila melanogaster, the two group B Sox proteins Dichaete and SoxNeuro show widespread common binding across the genome. While some instances of functional compensation have been observed in Drosophila, the function of common binding and the extent of its evolutionary conservation is not known. We used DamID-seq to examine the genome-wide binding patterns of Dichaete and SoxNeuro in four species of Drosophila. Through a quantitative comparison of Dichaete binding, we evaluated the rate of binding site turnover across the genome as well as at specific functional sites. We also examined the presence of Sox motifs within binding intervals and the correlation between sequence conservation and binding conservation. To determine whether common binding between Dichaete and SoxNeuro is conserved, we performed a detailed analysis of the binding patterns of both factors in two species. We find that, while the regulatory networks driven by Dichaete and SoxNeuro are largely conserved across the drosophilids studied, binding site turnover is widespread and correlated with phylogenetic distance. Nonetheless, binding is preferentially conserved at known cis-regulatory modules and core, independently verified binding sites. We observed the strongest binding conservation at sites that are commonly bound by Dichaete and SoxNeuro, suggesting that these sites are functionally important. Our analysis provides insights into the evolution of group B Sox function, highlighting the specific conservation of shared binding sites and suggesting alternative sources of neofunctionalisation between paralogous family members.

  16. A universal algorithm for genome-wide in silicio identification of biologically significant gene promoter putative cis-regulatory-elements; identification of new elements for reactive oxygen species and sucrose signaling in Arabidopsis.

    Science.gov (United States)

    Geisler, Matt; Kleczkowski, Leszek A; Karpinski, Stanislaw

    2006-02-01

    Short motifs of many cis-regulatory elements (CREs) can be found in the promoters of most Arabidopsis genes, and this raises the question of how their presence can confer specific regulation. We developed a universal algorithm to test the biological significance of CREs by first identifying every Arabidopsis gene with a CRE and then statistically correlating the presence or absence of the element with the gene expression profile on multiple DNA microarrays. This algorithm was successfully verified for previously characterized abscisic acid, ethylene, sucrose and drought responsive CREs in Arabidopsis, showing that the presence of these elements indeed correlates with treatment-specific gene induction. Later, we used standard motif sampling methods to identify 128 putative motifs induced by excess light, reactive oxygen species and sucrose. Our algorithm was able to filter 20 out of 128 novel CREs which significantly correlated with gene induction by either heat, reactive oxygen species and/or sucrose. The position, orientation and sequence specificity of CREs was tested in silicio by analyzing the expression of genes with naturally occurring sequence variations. In three novel CREs the forward orientation correlated with sucrose induction and the reverse orientation with sucrose suppression. The functionality of the predicted novel CREs was experimentally confirmed using Arabidopsis cell-suspension cultures transformed with short promoter fragments or artificial promoters fused with the GUS reporter gene. Our genome-wide analysis opens up new possibilities for in silicio verification of the biological significance of newly discovered CREs, and allows for subsequent selection of such CREs for experimental studies.

  17. Helicity conservation in gauge boson scattering at high energy.

    Science.gov (United States)

    Gounaris, G J; Renard, F M

    2005-04-08

    We remark that the high energy gauge boson scattering processes involving two-body initial and final states satisfy certain selection rules described as helicity conservation of the gauge boson amplitudes (GBHC). These rules are valid at the Born level, as well as at the level of the leading and subleading 1-loop logarithmic corrections, in both the standard model and the minimal supersymmetric standard model (MSSM). A "fermionic equivalence" theorem is also proved, which suggests that GBHC is valid at all orders in the MSSM at sufficiently high energies, where the mass suppressed contributions are neglected.

  18. 77 FR 74167 - Information Collection Request: Highly Erodible Land Conservation and Wetland Conservation

    Science.gov (United States)

    2012-12-13

    ... information is collected in support of the conservation compliance provisions of Title XII of the Food Security Act of 1985 (the 1985 Farm Bill), as amended by the Food, Conservation, and Energy Act of 2008... Security Act of 1985 (16 U.S.C. 3801-3862), as amended by the Food, Conservation, and Energy Act of 2008...

  19. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  20. High-resolution genome-wide in vivo footprinting of diverse transcription factors in human cells.

    Science.gov (United States)

    Boyle, Alan P; Song, Lingyun; Lee, Bum-Kyu; London, Darin; Keefe, Damian; Birney, Ewan; Iyer, Vishwanath R; Crawford, Gregory E; Furey, Terrence S

    2011-03-01

    Regulation of gene transcription in diverse cell types is determined largely by varied sets of cis-elements where transcription factors bind. Here we demonstrate that data from a single high-throughput DNase I hypersensitivity assay can delineate hundreds of thousands of base-pair resolution in vivo footprints in human cells that precisely mark individual transcription factor-DNA interactions. These annotations provide a unique resource for the investigation of cis-regulatory elements. We find that footprints for specific transcription factors correlate with ChIP-seq enrichment and can accurately identify functional versus nonfunctional transcription factor motifs. We also find that footprints reveal a unique evolutionary conservation pattern that differentiates functional footprinted bases from surrounding DNA. Finally, detailed analysis of CTCF footprints suggests multiple modes of binding and a novel DNA binding motif upstream of the primary binding site.

  1. Antibody Recognition of a Highly Conserved Influenza Virus Epitope

    Energy Technology Data Exchange (ETDEWEB)

    Ekiert, Damian C.; Bhabha, Gira; Elsliger, Marc-André; Friesen, Robert H.E.; Jongeneelen, Mandy; Throsby, Mark; Goudsmit, Jaap; Wilson, Ian A.; Scripps; Crucell

    2009-05-21

    Influenza virus presents an important and persistent threat to public health worldwide, and current vaccines provide immunity to viral isolates similar to the vaccine strain. High-affinity antibodies against a conserved epitope could provide immunity to the diverse influenza subtypes and protection against future pandemic viruses. Cocrystal structures were determined at 2.2 and 2.7 angstrom resolutions for broadly neutralizing human antibody CR6261 Fab in complexes with the major surface antigen (hemagglutinin, HA) from viruses responsible for the 1918 H1N1 influenza pandemic and a recent lethal case of H5N1 avian influenza. In contrast to other structurally characterized influenza antibodies, CR6261 recognizes a highly conserved helical region in the membrane-proximal stem of HA1 and HA2. The antibody neutralizes the virus by blocking conformational rearrangements associated with membrane fusion. The CR6261 epitope identified here should accelerate the design and implementation of improved vaccines that can elicit CR6261-like antibodies, as well as antibody-based therapies for the treatment of influenza.

  2. Dynamic Epigenetic Control of Highly Conserved Noncoding Elements

    KAUST Repository

    Seridi, Loqmane

    2014-10-07

    Background Many noncoding genomic loci have remained constant over long evolutionary periods, suggesting that they are exposed to strong selective pressures. The molecular functions of these elements have been partially elucidated, but the fundamental reason for their extreme conservation is still unknown. Results To gain new insights into the extreme selection of highly conserved noncoding elements (HCNEs), we used a systematic analysis of multi-omic data to study the epigenetic regulation of such elements during the development of Drosophila melanogaster. At the sequence level, HCNEs are GC-rich and have a characteristic oligomeric composition. They have higher levels of stable nucleosome occupancy than their flanking regions, and lower levels of mononucleosomes and H3.3, suggesting that these regions reside in compact chromatin. Furthermore, these regions showed remarkable modulations in histone modification and the expression levels of adjacent genes during development. Although HCNEs are primarily initiated late in replication, about 10% were related to early replication origins. Finally, HCNEs showed strong enrichment within lamina-associated domains. Conclusion HCNEs have distinct and protective sequence properties, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. These observations indicate that such elements are likely to have essential cellular functions, and offer insights into their epigenetic properties.

  3. High cumulants of conserved charges and their statistical uncertainties

    Science.gov (United States)

    Li-Zhu, Chen; Ye-Yin, Zhao; Xue, Pan; Zhi-Ming, Li; Yuan-Fang, Wu

    2017-10-01

    We study the influence of measured high cumulants of conserved charges on their associated statistical uncertainties in relativistic heavy-ion collisions. With a given number of events, the measured cumulants randomly fluctuate with an approximately normal distribution, while the estimated statistical uncertainties are found to be correlated with corresponding values of the obtained cumulants. Generally, with a given number of events, the larger the cumulants we measure, the larger the statistical uncertainties that are estimated. The error-weighted averaged cumulants are dependent on statistics. Despite this effect, however, it is found that the three sigma rule of thumb is still applicable when the statistics are above one million. Supported by NSFC (11405088, 11521064, 11647093), Major State Basic Research Development Program of China (2014CB845402) and Ministry of Science and Technology (MoST) (2016YFE0104800)

  4. Conservation of noncoding microsatellites in plants: implication for gene regulation

    Directory of Open Access Journals (Sweden)

    Sun Xiaofen

    2006-12-01

    Full Text Available Abstract Background Microsatellites are extremely common in plant genomes, and in particular, they are significantly enriched in the 5' noncoding regions. Although some 5' noncoding microsatellites involved in gene regulation have been described, the general properties of microsatellites as regulatory elements are still unknown. To address the question of microsatellites associated with regulatory elements, we have analyzed the conserved noncoding microsatellite sequences (CNMSs in the 5' noncoding regions by inter- and intragenomic phylogenetic footprinting in the Arabidopsis and Brassica genomes. Results We identified 247 Arabidopsis-Brassica orthologous and 122 Arabidopsis paralogous CNMSs, representing 491 CT/GA and CTT/GAA repeats, which accounted for 10.6% of these types located in the 500-bp regions upstream of coding sequences in the Arabidopsis genome. Among these identified CNMSs, 18 microsatellites show high conservation in the regulatory regions of both orthologous and paralogous genes, and some of them also appear in the corresponding positions of more distant homologs in Arabidopsis, as well as in other plants. A computational scan of CNMSs for known cis-regulatory elements showed that light responsive elements were clustered in the region of CT/GA repeats, as well as salicylic acid responsive elements in the (CTTn/(GAAn sequences. Patterns of gene expression revealed that 70–80% of CNMS (CTTn/(GAAn associated genes were regulated by salicylic acid, which was consistent with the prediction of regulatory elements in silico. Conclusion Our analyses showed that some noncoding microsatellites were conserved in plants and appeared to be ancient. These CNMSs served as regulatory elements involved in light and salicylic acid responses. Our findings might have implications in the common features of the over-represented microsatellites for gene regulation in plant-specific pathways.

  5. Genomic cloning and promoter functional analysis of myostatin-2 in shi drum, Umbrina cirrosa: conservation of muscle-specific promoter activity.

    Science.gov (United States)

    Nadjar-Boger, Elisabeth; Maccatrozzo, Lisa; Radaelli, Giuseppe; Funkenstein, Bruria

    2013-02-01

    Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily, known as a negative regulator of skeletal muscle development and growth in mammals. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. Here we describe the cloning and sequence analysis of spliced and precursor (unspliced) transcripts as well as the 5' flanking region of MSTN-2 from the marine fish Umbrina cirrosa (ucMSTN-2). In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed high transcriptional activity in muscle cells and in differentiated neural cells, in accordance with our previous findings in MSTN-2 promoter from Sparus aurata. Comparative informatics analysis of MSTN-2 from several fish species revealed high conservation of the predicted amino acid sequence as well as the gene structure (exon length) although intron length varied between species. The proximal promoter of MSTN-2 gene was found to be conserved among Perciforms. In conclusion, this study reinforces our conclusion that MSTN-2 promoter is a very strong promoter, especially in muscle cells. In addition, we show that the MSTN-2 gene structure is highly conserved among fishes as is the predicted amino acid sequence of the peptide. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Sequence conservation and combinatorial complexity of Drosophila neural precursor cell enhancers

    Directory of Open Access Journals (Sweden)

    Kuzin Alexander

    2008-08-01

    Full Text Available Abstract Background The presence of highly conserved sequences within cis-regulatory regions can serve as a valuable starting point for elucidating the basis of enhancer function. This study focuses on regulation of gene expression during the early events of Drosophila neural development. We describe the use of EvoPrinter and cis-Decoder, a suite of interrelated phylogenetic footprinting and alignment programs, to characterize highly conserved sequences that are shared among co-regulating enhancers. Results Analysis of in vivo characterized enhancers that drive neural precursor gene expression has revealed that they contain clusters of highly conserved sequence blocks (CSBs made up of shorter shared sequence elements which are present in different combinations and orientations within the different co-regulating enhancers; these elements contain either known consensus transcription factor binding sites or consist of novel sequences that have not been functionally characterized. The CSBs of co-regulated enhancers share a large number of sequence elements, suggesting that a diverse repertoire of transcription factors may interact in a highly combinatorial fashion to coordinately regulate gene expression. We have used information gained from our comparative analysis to discover an enhancer that directs expression of the nervy gene in neural precursor cells of the CNS and PNS. Conclusion The combined use EvoPrinter and cis-Decoder has yielded important insights into the combinatorial appearance of fundamental sequence elements required for neural enhancer function. Each of the 30 enhancers examined conformed to a pattern of highly conserved blocks of sequences containing shared constituent elements. These data establish a basis for further analysis and understanding of neural enhancer function.

  7. High-pressure, flux-conserving tokamak equilibria

    Energy Technology Data Exchange (ETDEWEB)

    Dory, R.A.; Peng, Y.K.M.

    1976-08-01

    Magnetohydrodynamic (MHD) tokamak equilibria are found with values of ..beta.. up to 20 percent and prescribed MHD safety factor values (e.g., q(axis) = 1 and q(edge) = 4.8) for tokamaks with aspect ratio A = 4 and D-shaped cross section. If such equilibria could be attained experimentally, they would be very attractive for decreasing the projected costs of tokamak power reactors substantially. In the flux-conserving tokamak (FCT) model, where rapid heating is applied to an already relatively hot plasma, these high ..beta.. equilibria are achievable. We study the quasi-static evolution of FCT equilibria as ..beta.. increases. An operating window is found in the pressure profile width w/sub p/: for high ..beta.. the values of w/sub p/ must lie between 0.40 and 0.55 of the plasma minor width. Within this window, plasma current and poloidal ..beta.. increase monotonically with ..beta... For fixed plasma boundary, significant poloidal surface currents are induced, but these can be eliminated by small increases in the plasma minor radius, the pressure profile width, and the vacuum toroidal field.

  8. 78 FR 13566 - Energy Conservation Program for High-Intensity Discharge Lamps: Public Meeting and Availability...

    Science.gov (United States)

    2013-02-28

    ... Part 431 RIN 1904-AC36 Energy Conservation Program for High-Intensity Discharge Lamps: Public Meeting... conservation standards for high-intensity discharge (HID) lamps. The meeting will cover the analytical... High-Intensity Discharge Lamps, EERE-2010-BT-STD-0043 and/or RIN 1904-AC36, 1000 Independence Avenue SW...

  9. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  10. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  11. Assessment of selected conservation measures for high-temperature process industries

    Energy Technology Data Exchange (ETDEWEB)

    Kusik, C L; Parameswaran, K; Nadkarni, R; O& #x27; Neill, J K; Malhotra, S; Hyde, R; Kinneberg, D; Fox, L; Rossetti, M

    1981-01-01

    Energy conservation projects involving high-temperature processes in various stages of development are assessed to quantify their energy conservation potential; to determine their present status of development; to identify their research and development needs and estimate the associated costs; and to determine the most effective role for the Federal government in developing these technologies. The program analyzed 25 energy conserving processes in the iron and steel, aluminium, copper, magnesium, cement, and glassmaking industries. A preliminary list of other potential energy conservation projects in these industries is also presented in the appendix. (MCW)

  12. Phylum-Level Conservation of Regulatory Information in Nematodes despite Extensive Non-coding Sequence Divergence.

    Directory of Open Access Journals (Sweden)

    Kacy L Gordon

    2015-05-01

    Full Text Available Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2 from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements.

  13. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    Energy Technology Data Exchange (ETDEWEB)

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.

    2006-07-06

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  14. Detection of Weakly Conserved Ancestral Mammalian RegulatorySequences by Primate Comparisons

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qian-fei; Prabhakar, Shyam; Chanan, Sumita; Cheng,Jan-Fang; Rubin, Edward M.; Boffelli, Dario

    2006-06-01

    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detectcryptic functional elements, which are too weakly conserved among mammalsto distinguish from nonfunctional DNA. To address this problem, weexplored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  15. Telomeric expression sites are highly conserved in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Christiane Hertz-Fowler

    Full Text Available Subtelomeric regions are often under-represented in genome sequences of eukaryotes. One of the best known examples of the use of telomere proximity for adaptive purposes are the bloodstream expression sites (BESs of the African trypanosome Trypanosoma brucei. To enhance our understanding of BES structure and function in host adaptation and immune evasion, the BES repertoire from the Lister 427 strain of T. brucei were independently tagged and sequenced. BESs are polymorphic in size and structure but reveal a surprisingly conserved architecture in the context of extensive recombination. Very small BESs do exist and many functioning BESs do not contain the full complement of expression site associated genes (ESAGs. The consequences of duplicated or missing ESAGs, including ESAG9, a newly named ESAG12, and additional variant surface glycoprotein genes (VSGs were evaluated by functional assays after BESs were tagged with a drug-resistance gene. Phylogenetic analysis of constituent ESAG families suggests that BESs are sequence mosaics and that extensive recombination has shaped the evolution of the BES repertoire. This work opens important perspectives in understanding the molecular mechanisms of antigenic variation, a widely used strategy for immune evasion in pathogens, and telomere biology.

  16. Texas High Plains Initiative for Strategic and Innovative Irrigation Management and Conservation

    National Research Council Canada - National Science Library

    Weinheimer, Justin; Johnson, Phillip; Mitchell, Donna; Johnson, Jeff; Kellison, Rick

    2013-01-01

    The strategic management of irrigation applications to improve water‐use efficiency and meet economic objectives has been identified as a key factor in the conservation of water resources in the Texas High Plains region...

  17. 7 CFR Exhibit M to Subpart G of... - Implementation Procedures for the Conservation of Wetlands and Highly Erodible Land Affecting...

    Science.gov (United States)

    2010-01-01

    ... B, Highly Erodible Land Conservation, and Subtitle C, Wetland Conservation, of Title XII of the Food... technical guide and properly approved by the appropriate SCS conservation district or the SCS. To apply this... 7 Agriculture 13 2010-01-01 2009-01-01 true Implementation Procedures for the Conservation of...

  18. Homologous high-throughput expression and purification of highly conserved E coli proteins

    Directory of Open Access Journals (Sweden)

    Duchmann Rainer

    2007-06-01

    Full Text Available Abstract Background Genetic factors and a dysregulated immune response towards commensal bacteria contribute to the pathogenesis of Inflammatory Bowel Disease (IBD. Animal models demonstrated that the normal intestinal flora is crucial for the development of intestinal inflammation. However, due to the complexity of the intestinal flora, it has been difficult to design experiments for detection of proinflammatory bacterial antigen(s involved in the pathogenesis of the disease. Several studies indicated a potential association of E. coli with IBD. In addition, T cell clones of IBD patients were shown to cross react towards antigens from different enteric bacterial species and thus likely responded to conserved bacterial antigens. We therefore chose highly conserved E. coli proteins as candidate antigens for abnormal T cell responses in IBD and used high-throughput techniques for cloning, expression and purification under native conditions of a set of 271 conserved E. coli proteins for downstream immunologic studies. Results As a standardized procedure, genes were PCR amplified and cloned into the expression vector pQTEV2 in order to express proteins N-terminally fused to a seven-histidine-tag. Initial small-scale expression and purification under native conditions by metal chelate affinity chromatography indicated that the vast majority of target proteins were purified in high yields. Targets that revealed low yields after purification probably due to weak solubility were shuttled into Gateway (Invitrogen destination vectors in order to enhance solubility by N-terminal fusion of maltose binding protein (MBP, N-utilizing substance A (NusA, or glutathione S-transferase (GST to the target protein. In addition, recombinant proteins were treated with polymyxin B coated magnetic beads in order to remove lipopolysaccharide (LPS. Thus, 73% of the targeted proteins could be expressed and purified in large-scale to give soluble proteins in the range of 500

  19. Simple and High-Accurate Schemes for Hyperbolic Conservation Laws

    Directory of Open Access Journals (Sweden)

    Renzhong Feng

    2014-01-01

    Full Text Available The paper constructs a class of simple high-accurate schemes (SHA schemes with third order approximation accuracy in both space and time to solve linear hyperbolic equations, using linear data reconstruction and Lax-Wendroff scheme. The schemes can be made even fourth order accurate with special choice of parameter. In order to avoid spurious oscillations in the vicinity of strong gradients, we make the SHA schemes total variation diminishing ones (TVD schemes for short by setting flux limiter in their numerical fluxes and then extend these schemes to solve nonlinear Burgers’ equation and Euler equations. The numerical examples show that these schemes give high order of accuracy and high resolution results. The advantages of these schemes are their simplicity and high order of accuracy.

  20. High-resolution satellite imagery is an important yet underutilized resource in conservation biology.

    Science.gov (United States)

    Boyle, Sarah A; Kennedy, Christina M; Torres, Julio; Colman, Karen; Pérez-Estigarribia, Pastor E; de la Sancha, Noé U

    2014-01-01

    Technological advances and increasing availability of high-resolution satellite imagery offer the potential for more accurate land cover classifications and pattern analyses, which could greatly improve the detection and quantification of land cover change for conservation. Such remotely-sensed products, however, are often expensive and difficult to acquire, which prohibits or reduces their use. We tested whether imagery of high spatial resolution (≤5 m) differs from lower-resolution imagery (≥30 m) in performance and extent of use for conservation applications. To assess performance, we classified land cover in a heterogeneous region of Interior Atlantic Forest in Paraguay, which has undergone recent and dramatic human-induced habitat loss and fragmentation. We used 4 m multispectral IKONOS and 30 m multispectral Landsat imagery and determined the extent to which resolution influenced the delineation of land cover classes and patch-level metrics. Higher-resolution imagery more accurately delineated cover classes, identified smaller patches, retained patch shape, and detected narrower, linear patches. To assess extent of use, we surveyed three conservation journals (Biological Conservation, Biotropica, Conservation Biology) and found limited application of high-resolution imagery in research, with only 26.8% of land cover studies analyzing satellite imagery, and of these studies only 10.4% used imagery ≤5 m resolution. Our results suggest that high-resolution imagery is warranted yet under-utilized in conservation research, but is needed to adequately monitor and evaluate forest loss and conversion, and to delineate potentially important stepping-stone fragments that may serve as corridors in a human-modified landscape. Greater access to low-cost, multiband, high-resolution satellite imagery would therefore greatly facilitate conservation management and decision-making.

  1. Reference: OCTAMERMOTIFTAH3H4 [PLACE

    Lifescience Database Archive (English)

    Full Text Available OCTAMERMOTIFTAH3H4 Nakayama T, Sakamoto A, Yang P, Minami M, Fujimoto Y, Ito T, Iwa...buchi M Highly conserved hexamer, octamer and nonamer motifs are positive cis-regulatory elements of the whe

  2. High-Order Entropy Stable Finite Difference Schemes for Nonlinear Conservation Laws: Finite Domains

    Science.gov (United States)

    Fisher, Travis C.; Carpenter, Mark H.

    2013-01-01

    Developing stable and robust high-order finite difference schemes requires mathematical formalism and appropriate methods of analysis. In this work, nonlinear entropy stability is used to derive provably stable high-order finite difference methods with formal boundary closures for conservation laws. Particular emphasis is placed on the entropy stability of the compressible Navier-Stokes equations. A newly derived entropy stable weighted essentially non-oscillatory finite difference method is used to simulate problems with shocks and a conservative, entropy stable, narrow-stencil finite difference approach is used to approximate viscous terms.

  3. Butterflies of the high-altitude Atacama Desert: habitat use and conservation

    OpenAIRE

    Emma eDespland

    2014-01-01

    The butterfly fauna of the high-altitude desert of Northern Chile, though depauperate, shows high endemism, is poorly known and is of considerable conservation concern. This study surveys butterflies along the Andean slope between 2400 and 5000 m asl (prepuna, puna and Andean steppe habitats) as well as in high and low-altitude wetlands and in the neoriparian vegetation of agricultural sites. We also include historical sightings from museum records. We compare abundances between altitudes, be...

  4. EVALUATION OF WATER CONSERVATION POLICY ALTERNATIVES FOR THE SOUTHERN HIGH PLAINS OF TEXAS

    OpenAIRE

    Johnson, Jeffrey W.; Johnson, Phillip N.; Segarra, Eduardo; Willis, David B.

    2004-01-01

    Three alternative groundwater conservation policies were examined for their impact on the regional economy of the Southern High Plains of Texas using nonlinear optimization models and an input-output model. Restriction of drawdown of the aquifer was found to be more effective than proposed water use fees.

  5. Prospects for Parity Non-conservation Experiments with Highly Charged Heavy Ions

    OpenAIRE

    Maul, M.; Schäfer, A.; Greiner, W.; Indelicato, P.

    1996-01-01

    We discuss the prospects for parity non-conservation experiments with highly charged heavy ions. Energy levels and parity mixing for heavy ions with two to five electrons are calculated. We investigate two-photon-transitions and the possibility to observe interference effects between weak-matrix elements and Stark matrix elements for periodic electric field configurations.

  6. Balancing forest-regeneration probabilities and maintenance costs in dry grasslands of high conservation priority

    Science.gov (United States)

    Bolliger, Janine; Edwards, Thomas C.; Eggenberg, Stefan; Ismail, Sascha; Seidl, Irmi; Kienast, Felix

    2011-01-01

    Abandonment of agricultural land has resulted in forest regeneration in species-rich dry grasslands across European mountain regions and threatens conservation efforts in this vegetation type. To support national conservation strategies, we used a site-selection algorithm (MARXAN) to find optimum sets of floristic regions (reporting units) that contain grasslands of high conservation priority. We sought optimum sets that would accommodate 136 important dry-grassland species and that would minimize forest regeneration and costs of management needed to forestall predicted forest regeneration. We did not consider other conservation elements of dry grasslands, such as animal species richness, cultural heritage, and changes due to climate change. Optimal sets that included 95–100% of the dry grassland species encompassed an average of 56–59 floristic regions (standard deviation, SD 5). This is about 15% of approximately 400 floristic regions that contain dry-grassland sites and translates to 4800–5300 ha of dry grassland out of a total of approximately 23,000 ha for the entire study area. Projected costs to manage the grasslands in these optimum sets ranged from CHF (Swiss francs) 5.2 to 6.0 million/year. This is only 15–20% of the current total estimated cost of approximately CHF30–45 million/year required if all dry grasslands were to be protected. The grasslands of the optimal sets may be viewed as core sites in a national conservation strategy.

  7. Human developmental enhancers conserved between deuterostomes and protostomes.

    Directory of Open Access Journals (Sweden)

    Shoa L Clarke

    Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.

  8. Identification and classification of structural soil conservation measures based on very high resolution stereo satellite data.

    Science.gov (United States)

    Eckert, Sandra; Tesfay Ghebremicael, Selamawit; Hurni, Hans; Kohler, Thomas

    2017-05-15

    Land degradation affects large areas of land around the globe, with grave consequences for those living off the land. Major efforts are being made to implement soil and water conservation measures that counteract soil erosion and help secure vital ecosystem services. However, where and to what extent such measures have been implemented is often not well documented. Knowledge about this could help to identify areas where soil and water conservation measures are successfully supporting sustainable land management, as well as areas requiring urgent rehabilitation of conservation structures such as terraces and bunds. This study explores the potential of the latest satellite-based remote sensing technology for use in assessing and monitoring the extent of existing soil and water conservation structures. We used a set of very high resolution stereo Geoeye-1 satellite data, from which we derived a detailed digital surface model as well as a set of other spectral, terrain, texture, and filtered information layers. We developed and applied an object-based classification approach, working on two segmentation levels. On the coarser level, the aim was to delimit certain landscape zones. Information about these landscape zones is useful in distinguishing different types of soil and water conservation structures, as each zone contains certain specific types of structures. On the finer level, the goal was to extract and identify different types of linear soil and water conservation structures. The classification rules were based mainly on spectral, textural, shape, and topographic properties, and included object relationships. This approach enabled us to identify and separate from other classes the majority (78.5%) of terraces and bunds, as well as most hillside terraces (81.25%). Omission and commission errors are similar to those obtained by the few existing studies focusing on the same research objective but using different types of remotely sensed data. Based on our results

  9. Conservative Management for Stable High Ankle Injuries in Professional Football Players.

    Science.gov (United States)

    Knapik, Derrick M; Trem, Anthony; Sheehan, Joseph; Salata, Michael J; Voos, James E

    High ankle "syndesmosis" injuries are common in American football players relative to the general population. At the professional level, syndesmotic sprains represent a challenging and unique injury lacking a standardized rehabilitation protocol during conservative management. PubMed, Biosis Preview, SPORTDiscus, PEDro, and EMBASE databases were searched using the terms syndesmotic injuries, American football, conservative management, and rehabilitation. Clinical review. Level 3. When compared with lateral ankle sprains, syndesmosis injuries result in significantly prolonged recovery times and games lost. For stable syndesmotic injuries, conservative management features a brief period of immobilization and protected weightbearing followed by progressive strengthening exercises and running, and athletes can expect to return to competition in 2 to 6 weeks. Further research investigating the efficacy of dry needling and blood flow restriction therapy is necessary to evaluate the benefit of these techniques in the rehabilitation process. Successful conservative management of stable syndesmotic injuries in professional American football athletes requires a thorough understanding of the anatomy, injury mechanisms, diagnosis, and rehabilitation strategies utilized in elite athletes.

  10. Taxonomic distinctness and conservation of a new high biodiversity subterranean area in Brazil.

    Science.gov (United States)

    Gallão, Jonas E; Bichuette, Maria Elina

    2015-03-01

    Subterranean environments, even though they do not possess a primary production (photosynthesis), may present high biodiversity, faunistic originality, endemism, phylogenetic isolations and unique ecological and/or evolution events, in addition to rare taxa. Studies investigating the biological diversity in Neotropical caves are relatively rare and recent, and most of them have been conducted in Brazil. We sampled caves from the state of Bahia, northeastern Brazil, and through sampling sufficiency tests and richness estimators, we demonstrate that the normatization for the Brazilian cave laws is not adequate for its conservation and that only α diversity index is not enough to verify faunistic patterns. We suggest that a phylogenetic diversity index be more robust and accurate for conservation purposes, particularly the Taxonomic Distinctness index. Moreover, we propose that the sandstone complex caves from Chapada Diamantina National Park need to be classified as being of high subterranean biodiversity in a global scope.

  11. Computational methods to dissect cis-regulatory transcriptional ...

    Indian Academy of Sciences (India)

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for ...

  12. Assessing the importance of High Nature Value farmlands for the conservation of Lesser Kestrels Falco naumanni

    OpenAIRE

    Galanaki Antonia; Kominos Theodoros; Jones Martin J.

    2017-01-01

    Agricultural areas, such as cereal cultivations, that support species of European and/or national conservation concern are considered as ‘High Nature Value’ farmlands (HNVf) and are very important for the preservation of biodiversity in Europe. The lesser kestrel Falco naumanni is a migratory falcon breeding largely in the HNVf of the Mediterranean basin. The main cause of its decline in Europe has been habitat loss and degradation as a result of agricultural intensification driven largely by...

  13. Entropy Viscosity Method for High-Order Approximations of Conservation Laws

    KAUST Repository

    Guermond, J. L.

    2010-09-17

    A stabilization technique for conservation laws is presented. It introduces in the governing equations a nonlinear dissipation function of the residual of the associated entropy equation and bounded from above by a first order viscous term. Different two-dimensional test cases are simulated - a 2D Burgers problem, the "KPP rotating wave" and the Euler system - using high order methods: spectral elements or Fourier expansions. Details on the tuning of the parameters controlling the entropy viscosity are given. © 2011 Springer.

  14. Highly conserved non-coding sequences are associated with vertebrate development.

    Directory of Open Access Journals (Sweden)

    Adam Woolfe

    2005-01-01

    Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development

  15. HIGHLY CONSERVED O-FUCOSE SITES HAVE DISTINCT EFFECTS ON NOTCH1 FUNCTION

    Science.gov (United States)

    Rampal, Raajit; Arboleda-Velasquez, Joseph F.; Nita-Lazar, Alexandra; Kosik, Kenneth S.; Haltiwanger, Robert S.

    2005-01-01

    The extracellular domain of mouse Notch1 contains 36 tandem epidermal growth factor like (EGF) repeats, many of which are modified with O-fucose. Previous work from several laboratories has indicated that O-fucosylation plays an important role in ligand mediated Notch activation. Nonetheless, it is not clear whether all, or a subset, of the EGF repeats need to be O-fucosylated. Three O-fucose sites are invariantly conserved in all Notch homologues with 36 EGF repeats (within EGF repeats 12, 26 and 27). In order to investigate which O-fucose sites on Notch1 are important for ligand-mediated signaling, we mutated the three invariant O-fucose sites in mouse Notch1, along with several less highly conserved sites, and evaluated their ability to transduce Jagged1 and Delta1 mediated signaling in a cell-based assay. Our analysis revealed that mutation of any of the three invariant O-fucose sites resulted in significant changes in both Delta1 and Jagged1 mediated signaling, but mutations in less highly conserved sites had no detectable effect. Interestingly, mutation of each invariant site gave a distinct effect on Notch function. Mutation of the O-fucose site in EGF repeat 12 resulted in loss of Delta1 and Jagged1 signaling, while mutation of the O-fucose site in EGF repeat 26 resulted in hyperactivation of both Delta1 and Jagged1 signaling. Mutation of the O-fucose site in EGF repeat 27 resulted in faulty trafficking of the Notch receptor to the cell surface and a decreased S1 processing of the receptor. These results indicate that the most highly conserved O-fucose sites in Notch1 are important for both processing and ligand mediated signaling in the context of a cell-based signaling assay. PMID:15994302

  16. Identification of LAG3 high affinity aptamers by HT-SELEX and Conserved Motif Accumulation (CMA.

    Directory of Open Access Journals (Sweden)

    Mario Martínez Soldevilla

    Full Text Available LAG3 receptor belongs to a family of immune-checkpoints expressed in T lymphocytes and other cells of the immune system. It plays an important role as a rheostat of the immune response. Focus on this receptor as a potential therapeutic target in cancer immunotherapy has been underscored after the success of other immune-checkpoint blockade strategies in clinical trials. LAG3 showcases the interest in the field of autoimmunity as several studies show that LAG3-targeting antibodies can also be used for the treatment of autoimmune diseases. In this work we describe the identification of a high-affinity LAG3 aptamer by High Throughput Sequencing SELEX in combination with a study of potential conserved binding modes according to sequence conservation by using 2D-structure prediction and 3D-RNA modeling using Rosetta. The aptamer with the highest accumulation of these conserved sequence motifs displays the highest affinity to LAG3 recombinant soluble proteins and binds to LAG3-expressing lymphocytes. The aptamer described herein has the potential to be used as a therapeutic agent, as it enhances the threshold of T-cell activation. Nonetheless, in future applications, it could also be engineered for treatment of autoimmune diseases by target depletion of LAG3-effector T lymphocytes.

  17. Water Wisdom: 23 Stand-Alone Activities on Water Supply and Water Conservation for High School Students. 2nd Edition.

    Science.gov (United States)

    Massachusetts State Water Resources Authority, Boston.

    This water conservation education program for high schools consists of both stand-alone activities and teacher support materials. Lessons are divided into six broad categories: (1) The Water Cycle; (2) Water and Society; (3) Keeping Water Pure; (4) Visualizing Volumes; (5) The Economics of Water Use; and (6) Domestic Water Conservation. The…

  18. [Comparative chromosome painting shows the red panda (Ailurus fulgens) has a highly conserved karyotype].

    Science.gov (United States)

    Tian, Ying; Nie, Wen-Hui; Wang, Jin-Huan; Yang, Yun-Fei; Yang, Feng-Tang

    2002-02-01

    We have established a comparative chromosome map between red panda (Ailurus fulgens, 2n = 36) and dog by chromosome painting with biotin-labelled chromosome-specific probes of the dog. Dog probes specific for the 38 automates delineated 71 homologous segments in the metaphase chromosomes of red panda. Of the 38 autosomal paints, 18 probes each delineated one homologous segment in red panda genome, while the other 20 ones each detected two to five homologous segments. The dog X chromosome-specific paint delineated the whole X chromosome of the red panda. The results indicate that at least 28 fissions (breaks), 49 fusions and 4 inversions were needed to "convert" the dog karyotype to that of the red panda, suggesting that extensive chromosome rearrangements differentiate the karyotypes of red panda and dog. Based on the established comparative chromosome homologies of dog and domestic cat, we could infer that there were 26 segments of conserved synteny between red panda and domestic cat. Comparative analysis of the distribution patterns of conserved segments defined by dog paints in red panda and domestic cat genomes revealed at least 2 cryptic inversions in two large chromosomal regions of conserved synteny between red panda and domestic cat. The karyotype of red panda shows high degree of homology with that of domestic cat.

  19. Insight into highly conserved H1 subtype-specific epitopes in influenza virus hemagglutinin.

    Directory of Open Access Journals (Sweden)

    Ki Joon Cho

    Full Text Available Influenza viruses continuously undergo antigenic changes with gradual accumulation of mutations in hemagglutinin (HA that is a major determinant in subtype specificity. The identification of conserved epitopes within specific HA subtypes gives an important clue for developing new vaccines and diagnostics. We produced and characterized nine monoclonal antibodies that showed significant neutralizing activities against H1 subtype influenza viruses, and determined the complex structure of HA derived from a 2009 pandemic virus A/Korea/01/2009 (KR01 and the Fab fragment from H1-specific monoclonal antibody GC0587. The overall structure of the complex was essentially identical to the previously determined KR01 HA-Fab0757 complex structure. Both Fab0587 and Fab0757 recognize readily accessible head regions of HA, revealing broadly shared and conserved antigenic determinants among H1 subtypes. The β-strands constituted by Ser110-Glu115 and Lys169-Lys170 form H1 epitopes with distinct conformations from those of H1 and H3 HA sites. In particular, Glu112, Glu115, Lys169, and Lys171 that are highly conserved among H1 subtype HAs have close contacts with HCDR3 and LCDR3. The differences between Fab0587 and Fab0757 complexes reside mainly in HCDR3 and LCDR3, providing distinct antigenic determinants specific for 1918 pdm influenza strain. Our results demonstrate a potential key neutralizing epitope important for H1 subtype specificity in influenza virus.

  20. Species Richness and Community Structure on a High Latitude Reef: Implications for Conservation and Management

    Directory of Open Access Journals (Sweden)

    Wayne Houston

    2011-07-01

    Full Text Available In spite of the wealth of research on the Great Barrier Reef, few detailed biodiversity assessments of its inshore coral communities have been conducted. Effective conservation and management of marine ecosystems begins with fine-scale biophysical assessments focused on diversity and the architectural species that build the structural framework of the reef. In this study, we investigate key coral diversity and environmental attributes of an inshore reef system surrounding the Keppel Bay Islands near Rockhampton in Central Queensland, Australia, and assess their implications for conservation and management. The Keppels has much higher coral diversity than previously found. The average species richness for the 19 study sites was ~40 with representatives from 68% of the ~244 species previously described for the southern Great Barrier Reef. Using scleractinian coral species richness, taxonomic distinctiveness and coral cover as the main criteria, we found that five out of 19 sites had particularly high conservation value. A further site was also considered to be of relatively high value. Corals at this site were taxonomically distinct from the others (representatives of two families were found here but not at other sites and a wide range of functionally diverse taxa were present. This site was associated with more stressful conditions such as high temperatures and turbidity. Highly diverse coral communities or biodiversity ‘hotspots’ and taxonomically distinct reefs may act as insurance policies for climatic disturbance, much like Noah’s Arks for reefs. While improving water quality and limiting anthropogenic impacts are clearly important management initiatives to improve the long-term outlook for inshore reefs, identifying, mapping and protecting these coastal ‘refugia’ may be the key for ensuring their regeneration against catastrophic climatic disturbance in the meantime.

  1. National-scale analysis for the identification of High Conservation Value Forests (HCVFs

    Directory of Open Access Journals (Sweden)

    Maesano M

    2011-02-01

    Full Text Available In Italy, forests cover about one third of the national territory. In recent years, sustainability has been applied to forest management through the introduction of the Sustainable Forest Management (SFM concept. Since the Rio Conference, several initiatives at international and governmental level aimed to realize the SFM concept by the establishment of a set of principles with general validity. One of the most successful initiatives is the Forest Stewardship Council (FSC, which has developed a system of voluntary certification specific for the forestry sector, as well as 10 principles and 56 criteria for good forest management. The concept of High Conservation Value Forest concept (HCVFs was defined in 1999 by FSC under Principle 9, and its application requires the identification of six categories of High Conservation Values (HCV. The aim of this study was to define the parameters for the HCVFs Italian forests, A first national mapping for the first level of High Conservation Value was developed focusing on protected areas, threatened and endangered species and the ecosystemic temporal use. Protected areas may constitute the basis of the SFM. This work is the result of data processing and distribution analysis through the intersection of vectorial data of national forests areas in ArcMap, on the basis of available information. Protected forest areas represent 34% of the national forest area. The different categories of protected areas contribute differently to protection, in particular the larger amount of preserved forests (22.96% falls within Sites of Community Importance (SCI. The analysis of highly protected forest types revealed major differences likely linked to site ecological conditions, which are extremely variable over the country. The HCVF concept is applied in the forest certification field and can be used in sustainable forest management, planning and land use, and policy commitments.

  2. High order numerical methods for networks of hyperbolic conservation laws coupled with ODEs and lumped parameter models

    Science.gov (United States)

    Borsche, Raul; Kall, Jochen

    2016-12-01

    In this paper we construct high order finite volume schemes on networks of hyperbolic conservation laws with coupling conditions involving ODEs. We consider two generalized Riemann solvers at the junction, one of Toro-Castro type and a solver of Harten, Enquist, Osher, Chakravarthy type. The ODE is treated with a Taylor method or an explicit Runge-Kutta scheme, respectively. Both resulting high order methods conserve quantities exactly if the conservation is part of the coupling conditions. Furthermore we present a technique to incorporate lumped parameter models, which arise from simplifying parts of a network. The high order convergence and the robust capturing of shocks are investigated numerically in several test cases.

  3. Fisheries conservation on the high seas: linking conservation physiology and fisheries ecology for the management of large pelagic fishes.

    Science.gov (United States)

    Horodysky, Andrij Z; Cooke, Steven J; Graves, John E; Brill, Richard W

    2016-01-01

    Populations of tunas, billfishes and pelagic sharks are fished at or over capacity in many regions of the world. They are captured by directed commercial and recreational fisheries (the latter of which often promote catch and release) or as incidental catch or bycatch in commercial fisheries. Population assessments of pelagic fishes typically incorporate catch-per-unit-effort time-series data from commercial and recreational fisheries; however, there have been notable changes in target species, areas fished and depth-specific gear deployments over the years that may have affected catchability. Some regional fisheries management organizations take into account the effects of time- and area-specific changes in the behaviours of fish and fishers, as well as fishing gear, to standardize catch-per-unit-effort indices and refine population estimates. However, estimates of changes in stock size over time may be very sensitive to underlying assumptions of the effects of oceanographic conditions and prey distribution on the horizontal and vertical movement patterns and distribution of pelagic fishes. Effective management and successful conservation of pelagic fishes requires a mechanistic understanding of their physiological and behavioural responses to environmental variability, potential for interaction with commercial and recreational fishing gear, and the capture process. The interdisciplinary field of conservation physiology can provide insights into pelagic fish demography and ecology (including environmental relationships and interspecific interactions) by uniting the complementary expertise and skills of fish physiologists and fisheries scientists. The iterative testing by one discipline of hypotheses generated by the other can span the fundamental-applied science continuum, leading to the development of robust insights supporting informed management. The resulting species-specific understanding of physiological abilities and tolerances can help to improve stock

  4. Fisheries conservation on the high seas: linking conservation physiology and fisheries ecology for the management of large pelagic fishes

    Science.gov (United States)

    Horodysky, Andrij Z.; Cooke, Steven J.; Graves, John E.; Brill, Richard W.

    2016-01-01

    Populations of tunas, billfishes and pelagic sharks are fished at or over capacity in many regions of the world. They are captured by directed commercial and recreational fisheries (the latter of which often promote catch and release) or as incidental catch or bycatch in commercial fisheries. Population assessments of pelagic fishes typically incorporate catch-per-unit-effort time-series data from commercial and recreational fisheries; however, there have been notable changes in target species, areas fished and depth-specific gear deployments over the years that may have affected catchability. Some regional fisheries management organizations take into account the effects of time- and area-specific changes in the behaviours of fish and fishers, as well as fishing gear, to standardize catch-per-unit-effort indices and refine population estimates. However, estimates of changes in stock size over time may be very sensitive to underlying assumptions of the effects of oceanographic conditions and prey distribution on the horizontal and vertical movement patterns and distribution of pelagic fishes. Effective management and successful conservation of pelagic fishes requires a mechanistic understanding of their physiological and behavioural responses to environmental variability, potential for interaction with commercial and recreational fishing gear, and the capture process. The interdisciplinary field of conservation physiology can provide insights into pelagic fish demography and ecology (including environmental relationships and interspecific interactions) by uniting the complementary expertise and skills of fish physiologists and fisheries scientists. The iterative testing by one discipline of hypotheses generated by the other can span the fundamental–applied science continuum, leading to the development of robust insights supporting informed management. The resulting species-specific understanding of physiological abilities and tolerances can help to improve stock

  5. Identification of proteins that form specific complexes with the highly conserved protein Translin in Schizosaccharomyces pombe.

    Science.gov (United States)

    Eliahoo, Elad; Litovco, Phyana; Ben Yosef, Ron; Bendalak, Keren; Ziv, Tamar; Manor, Haim

    2014-04-01

    Translin is a single-stranded DNA and RNA binding protein that has a high affinity for G-rich sequences. TRAX is a Translin paralog that associates with Translin. Both Translin and TRAX were highly conserved in eukaryotes. The nucleic acid binding form of Translin is a barrel-shaped homo-octamer. A Translin-TRAX hetero-octamer having a similar structure also binds nucleic acids. Previous reports suggested that Translin may be involved in chromosomal translocations, telomere metabolism and the control of mRNA transport and translation. More recent studies have indicated that Translin-TRAX hetero-octamers are involved in RNA silencing. To gain a further insight into the functions of Translin, we have undertaken to systematically search for proteins with which it forms specific complexes in living cells. Here we report the results of such a search conducted in the fission yeast Schizosaccharomyces pombe, a suitable model system. This search was carried out by affinity purification and immuno-precipitation techniques, combined with differential labeling of the intracellular proteins with the stable isotopes ¹⁵N and ¹⁴N. We identified for the first time two proteins containing an RNA Recognition Motif (RRM), which are specifically associated with the yeast Translin: (1) the pre-mRNA-splicing factor srp1 that belongs to the highly conserved SR family of proteins and (2) vip1, a protein conserved in fungi. Our data also support the presence of RNA in these intracellular complexes. Our experimental approach should be generally applicable to studies of weak intracellular protein-protein interactions and provides a clear distinction between false positive vs. truly interacting proteins. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Use of ancient sedimentary DNA as a novel conservation tool for high-altitude tropical biodiversity.

    Science.gov (United States)

    Boessenkool, Sanne; McGlynn, Gayle; Epp, Laura S; Taylor, David; Pimentel, Manuel; Gizaw, Abel; Nemomissa, Sileshi; Brochmann, Christian; Popp, Magnus

    2014-04-01

    Conservation of biodiversity may in the future increasingly depend upon the availability of scientific information to set suitable restoration targets. In traditional paleoecology, sediment-based pollen provides a means to define preanthropogenic impact conditions, but problems in establishing the exact provenance and ecologically meaningful levels of taxonomic resolution of the evidence are limiting. We explored the extent to which the use of sedimentary ancient DNA (sedaDNA) may complement pollen data in reconstructing past alpine environments in the tropics. We constructed a record of afro-alpine plants retrieved from DNA preserved in sediment cores from 2 volcanic crater sites in the Albertine Rift, eastern Africa. The record extended well beyond the onset of substantial anthropogenic effects on tropical mountains. To ensure high-quality taxonomic inference from the sedaDNA sequences, we built an extensive DNA reference library covering the majority of the afro-alpine flora, by sequencing DNA from taxonomically verified specimens. Comparisons with pollen records from the same sediment cores showed that plant diversity recovered with sedaDNA improved vegetation reconstructions based on pollen records by revealing both additional taxa and providing increased taxonomic resolution. Furthermore, combining the 2 measures assisted in distinguishing vegetation change at different geographic scales; sedaDNA almost exclusively reflects local vegetation, whereas pollen can potentially originate from a wide area that in highlands in particular can span several ecozones. Our results suggest that sedaDNA may provide information on restoration targets and the nature and magnitude of human-induced environmental changes, including in high conservation priority, biodiversity hotspots, where understanding of preanthropogenic impact (or reference) conditions is highly limited. © 2013 Society for Conservation Biology.

  7. Restriction fragment length polymorphism analysis shows that the hippuricase gene of Campylobacter jejuni is highly conserved.

    Science.gov (United States)

    Slater, E R; Owen, R J

    1997-10-01

    A 1151-bp amplicon containing the hippuricase (hipO) gene was obtained from 118 strains of Campylobacter jejuni and double-digested with AluI and DdeI to give five different PCR-RFLP patterns. Most strains had the six-banded profile predicted from sequence data. Lack of polymorphisms within the hipO gene indicated it was highly conserved amongst strains of Camp.jejuni, and the RFLP analysis provided only low discrimination as an epidemiological typing method. Detection of hipO by PCR provided a useful test for confirmatory identification of Camp. jejuni.

  8. Low-intensity agricultural landscapes in Transylvania support high butterfly diversity: implications for conservation.

    Science.gov (United States)

    Loos, Jacqueline; Dorresteijn, Ine; Hanspach, Jan; Fust, Pascal; Rakosy, László; Fischer, Joern

    2014-01-01

    European farmland biodiversity is declining due to land use changes towards agricultural intensification or abandonment. Some Eastern European farming systems have sustained traditional forms of use, resulting in high levels of biodiversity. However, global markets and international policies now imply rapid and major changes to these systems. To effectively protect farmland biodiversity, understanding landscape features which underpin species diversity is crucial. Focusing on butterflies, we addressed this question for a cultural-historic landscape in Southern Transylvania, Romania. Following a natural experiment, we randomly selected 120 survey sites in farmland, 60 each in grassland and arable land. We surveyed butterfly species richness and abundance by walking transects with four repeats in summer 2012. We analysed species composition using Detrended Correspondence Analysis. We modelled species richness, richness of functional groups, and abundance of selected species in response to topography, woody vegetation cover and heterogeneity at three spatial scales, using generalised linear mixed effects models. Species composition widely overlapped in grassland and arable land. Composition changed along gradients of heterogeneity at local and context scales, and of woody vegetation cover at context and landscape scales. The effect of local heterogeneity on species richness was positive in arable land, but negative in grassland. Plant species richness, and structural and topographic conditions at multiple scales explained species richness, richness of functional groups and species abundances. Our study revealed high conservation value of both grassland and arable land in low-intensity Eastern European farmland. Besides grassland, also heterogeneous arable land provides important habitat for butterflies. While butterfly diversity in arable land benefits from heterogeneity by small-scale structures, grasslands should be protected from fragmentation to provide

  9. Low-intensity agricultural landscapes in Transylvania support high butterfly diversity: implications for conservation.

    Directory of Open Access Journals (Sweden)

    Jacqueline Loos

    Full Text Available European farmland biodiversity is declining due to land use changes towards agricultural intensification or abandonment. Some Eastern European farming systems have sustained traditional forms of use, resulting in high levels of biodiversity. However, global markets and international policies now imply rapid and major changes to these systems. To effectively protect farmland biodiversity, understanding landscape features which underpin species diversity is crucial. Focusing on butterflies, we addressed this question for a cultural-historic landscape in Southern Transylvania, Romania. Following a natural experiment, we randomly selected 120 survey sites in farmland, 60 each in grassland and arable land. We surveyed butterfly species richness and abundance by walking transects with four repeats in summer 2012. We analysed species composition using Detrended Correspondence Analysis. We modelled species richness, richness of functional groups, and abundance of selected species in response to topography, woody vegetation cover and heterogeneity at three spatial scales, using generalised linear mixed effects models. Species composition widely overlapped in grassland and arable land. Composition changed along gradients of heterogeneity at local and context scales, and of woody vegetation cover at context and landscape scales. The effect of local heterogeneity on species richness was positive in arable land, but negative in grassland. Plant species richness, and structural and topographic conditions at multiple scales explained species richness, richness of functional groups and species abundances. Our study revealed high conservation value of both grassland and arable land in low-intensity Eastern European farmland. Besides grassland, also heterogeneous arable land provides important habitat for butterflies. While butterfly diversity in arable land benefits from heterogeneity by small-scale structures, grasslands should be protected from fragmentation

  10. Skinks (Reptilia: Scincidae) have highly conserved karyotypes as revealed by chromosome painting.

    Science.gov (United States)

    Giovannotti, M; Caputo, V; O'Brien, P C M; Lovell, F L; Trifonov, V; Cerioni, P Nisi; Olmo, E; Ferguson-Smith, M A; Rens, W

    2009-01-01

    Skinks represent the most diversified squamate reptiles with a great variation in body size and form, and are found worldwide in a variety of habitats. Their remarkable diversification has been accompanied by only a few chromosome rearrangements, resulting in highly-conservative chromosomal complements of these lizards. In this study cross-species chromosome painting using Scincus scincus (2n = 32) as the source genome, was used to detect the chromosomal rearrangements and homologies between the following skinks: Chalcides chalcides (2n = 28), C. ocellatus (2n = 28), Eumeces schneideri (2n = 32), Lepidothyris fernandi (2n = 30), Mabuya quinquetaeniata (2n = 32). The results of this study confirmed a high degree of chromosome conservation between these species. The main rearrangements in the studied skinks involve chromosomes 3, 5, 6 and 7 of S. scincus. These subtelocentric chromosomes are homologous to the p and q arms of metacentric pair 3 and 4 in C. chalcides, C. ocellatus, L. fernandi, and M. quinquetaeniata, while they are entirely conserved in E. schneideri. Other rearrangements involve S. scincus 11 in L. fernandi and M. quinquetaeniata, supporting the monophyly of Lygosominae, and one of the chromosomes S. scincus 12-16, in M. quinquetaeniata. In conclusion, our data support the monophyly of Scincidae and confirm that Scincus-Eumeces plus Chalcides do not form a monophyletic clade, suggesting that the Scincus-Eumeces clade is basal to other members of this family. This study represents the first time the whole genome of any reptile species has been used for cross-species chromosome painting to assess chromosomal evolution in this group of vertebrates. Copyright 2010 S. Karger AG, Basel.

  11. Entropy stable high order discontinuous Galerkin methods with suitable quadrature rules for hyperbolic conservation laws

    Science.gov (United States)

    Chen, Tianheng; Shu, Chi-Wang

    2017-09-01

    It is well known that semi-discrete high order discontinuous Galerkin (DG) methods satisfy cell entropy inequalities for the square entropy for both scalar conservation laws (Jiang and Shu (1994) [39]) and symmetric hyperbolic systems (Hou and Liu (2007) [36]), in any space dimension and for any triangulations. However, this property holds only for the square entropy and the integrations in the DG methods must be exact. It is significantly more difficult to design DG methods to satisfy entropy inequalities for a non-square convex entropy, and/or when the integration is approximated by a numerical quadrature. In this paper, we develop a unified framework for designing high order DG methods which will satisfy entropy inequalities for any given single convex entropy, through suitable numerical quadrature which is specific to this given entropy. Our framework applies from one-dimensional scalar cases all the way to multi-dimensional systems of conservation laws. For the one-dimensional case, our numerical quadrature is based on the methodology established in Carpenter et al. (2014) [5] and Gassner (2013) [19]. The main ingredients are summation-by-parts (SBP) operators derived from Legendre Gauss-Lobatto quadrature, the entropy conservative flux within elements, and the entropy stable flux at element interfaces. We then generalize the scheme to two-dimensional triangular meshes by constructing SBP operators on triangles based on a special quadrature rule. A local discontinuous Galerkin (LDG) type treatment is also incorporated to achieve the generalization to convection-diffusion equations. Extensive numerical experiments are performed to validate the accuracy and shock capturing efficacy of these entropy stable DG methods.

  12. High-order conservative discretizations for some cases of the rigid body motion

    Energy Technology Data Exchange (ETDEWEB)

    Kozlov, Roman [Department of Mathematics, University of Bergen, Johannes Brunsgate 12, 5008 Bergen (Norway)], E-mail: roman.kozlov@mi.uib.no

    2008-12-22

    Modified vector fields can be used to construct high-order structure-preserving numerical integrators for ordinary differential equations. In the present Letter we consider high-order integrators based on the implicit midpoint rule, which conserve quadratic first integrals. It is shown that these integrators are particularly suitable for the rigid body motion with an additional quadratic first integral. In this case high-order integrators preserve all four first integrals of motion. The approach is illustrated on the Lagrange top (a rotationally symmetric rigid body with a fixed point on the symmetry axis). The equations of motion are considered in the space fixed frame because in this frame Lagrange top admits a neat description. The Lagrange top motion includes the spherical pendulum and the planar pendulum, which swings in a vertical plane, as particular cases.

  13. 7 CFR 12.23 - Conservation plans and conservation systems.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Conservation plans and conservation systems. 12.23... CONSERVATION Highly Erodible Land Conservation § 12.23 Conservation plans and conservation systems. (a) Use of field office technical guide. A conservation plan or conservation system developed for the purposes of...

  14. Nosema ceranae alters a highly conserved hormonal stress pathway in honeybees.

    Science.gov (United States)

    Mayack, C; Natsopoulou, M E; McMahon, D P

    2015-12-01

    Nosema ceranae, an emerging pathogen of the western honeybee (Apis mellifera), is implicated in recent pollinator losses and causes severe energetic stress. However, whether precocious foraging and accelerated behavioural maturation in infected bees are caused by the infection itself or via indirect energetic stress remains unknown. Using a combination of nutritional and infection treatments, we investigated how starvation and infection alters the regulation of adipokinetic hormone (AKH) and octopamine, two highly conserved physiological pathways that respond to energetic stress by mobilizing fat stores and increasing search activity for food. Although there was no response from AKH when bees were experimentally infected with N. ceranae or starved, supporting the notion that honeybees have lost this pathway, there were significant regulatory changes in the octopamine pathway. Significantly, we found no evidence of acute energetic stress being the only cause of symptoms associated with N. ceranae infection. Therefore, the parasite itself appears to alter regulatory components along a highly conserved physiological pathway in an infection-specific manner. This indicates that pathogen-induced behavioural alteration of chronically infected bees should not just be viewed as a coincidental short-term by-product of pathogenesis (acute energetic stress) and may be a result of a generalist manipulation strategy to obtain energy for reproduction. © 2015 The Royal Entomological Society.

  15. Effects of the Conservation Reserve Program on Hydrologic Processes in the Southern High Plains

    Science.gov (United States)

    Haacker, E. M.; Smidt, S. J.; Kendall, A. D.; Basso, B.; Hyndman, D. W.

    2015-12-01

    The Southern High Plains Aquifer is a rapidly depleting resource that supports agriculture in parts of New Mexico and the Texas Panhandle. The development of the aquifer has changed the landscape and the water cycle of the region. This study illustrates the evolving patterns of land use and the effects of cultivation, from irrigated to dryland farming to the countermanding influence of the Conservation Reserve Program (CRP). Previous research indicates that greater recharge rates occur under cultivated land in the Southern High Plains than under unbroken soil: the transition to cultivation causes increased recharge, under both dryland and irrigated management, though most recharge still occurs through playa lakes. The Conservation Reserve Program takes land out of crop production, replacing the land cover with something more like the natural ecosystem. This may decrease recharge below fields, and reduce runoff that feeds playa lakes; or, CRP may help stabilize playa lakes, increasing recharge. Changes to the water cycle are investigated at the field scale using the System Approach to Land Use Sustainability (SALUS) crop model, and at the regional scale with the Landscape Hydrology Model (LHM), and compared with historical data and water table elevations.

  16. High-performance teams in wildlife conservation: A species reintroduction and recovery example

    Science.gov (United States)

    Clark, Tim W.; Westrum, Ron

    1989-11-01

    Reintroduction of animals to the wild to establish free-ranging viable populations is a valuable conservation tool, but ecological skills alone are not enough to ensure a successful reintroduction; also needed to do the work are effectively designed and managed programs. This article suggests general guidelines for organizing and managing reintroduction programs, reviews some basic organizational issues, and considers ways to develop high-performance teams The need to integrate reintroduction programs into their larger interorganizational context is discussed. The reintroduction program's structure must be appropriate for its function and should be properly staffed, led, and buffered from its political environment It should process information well, learn rapidly from its own mistakes, and be creative A high-performance team devotes most of its energies to solving external rather than internal problems

  17. High Re-Operation Rates Using Conserve Metal-On-Metal Total Hip Articulations

    DEFF Research Database (Denmark)

    Mogensen, S L; Jakobsen, Thomas; Christoffersen, Hardy

    2016-01-01

    INTRODUCTION: Metal-on-metal hip articulations have been intensely debated after reports of adverse reactions and high failure rates. The aim of this study was to retrospectively evaluate the implant of a metal-on.metal total hip articulation (MOM THA) from a single manufacture in a two...... of 53 months. 4 pseudotumors were diagnosed at time of follow up but no substantiated link was made between adverse reactions and re-operations. CONCLUSION: The high re-operation rates found in this study raised concern about the usage of the MOM THA and subsequently lead to the termination......-center study. MATERIALS AND METHODS: 108 CONSERVE(®) MOM THA were implanted in 92 patients between November 2005 and December 2010. Patients had at time of retrospective evaluation their journals reviewed for re-operations and adverse reactions. RESULTS: 20 hips were re-operated (18.4%) at a mean follow up...

  18. An assessment of high carbon stock and high conservation value approaches to sustainable oil palm cultivation in Gabon

    Science.gov (United States)

    Austin, Kemen G.; Lee, Michelle E.; Clark, Connie; Forester, Brenna R.; Urban, Dean L.; White, Lee; Kasibhatla, Prasad S.; Poulsen, John R.

    2017-01-01

    Industrial-scale oil palm cultivation is rapidly expanding in Gabon, where it has the potential to drive economic growth, but also threatens forest, biodiversity and carbon resources. The Gabonese government is promoting an ambitious agricultural expansion strategy, while simultaneously committing to minimize negative environmental impacts of oil palm agriculture. This study estimates the extent and location of suitable land for oil palm cultivation in Gabon, based on an analysis of recent trends in plantation permitting. We use the resulting suitability map to evaluate two proposed approaches to minimizing negative environmental impacts: a High Carbon Stock (HCS) approach, which emphasizes forest protection and climate change mitigation, and a High Conservation Value (HCV) approach, which focuses on safeguarding biodiversity and ecosystems. We quantify the forest area, carbon stock, and biodiversity resources protected under each approach, using newly developed maps of priority species distributions and forest biomass for Gabon. We find 2.7-3.9 Mha of suitable or moderately suitable land that avoid HCS areas, 4.4 million hectares (Mha) that avoid HCV areas, and 1.2-1.7 Mha that avoid both. This suggests that Gabon’s oil palm production target could likely be met without compromising important ecosystem services, if appropriate safeguards are put in place. Our analysis improves understanding of suitability for oil palm in Gabon, determines how conservation strategies align with national targets for oil palm production, and informs national land use planning.

  19. Human Activities in Natura 2000 Sites: A Highly Diversified Conservation Network

    Science.gov (United States)

    Tsiafouli, Maria A.; Apostolopoulou, Evangelia; Mazaris, Antonios D.; Kallimanis, Athanasios S.; Drakou, Evangelia G.; Pantis, John D.

    2013-05-01

    The Natura 2000 network was established across the European Union's (EU) Member States with the aim to conserve biodiversity, while ensuring the sustainability of human activities. However, to what kind and to what extent Natura 2000 sites are subject to human activities and how this varies across Member States remains unspecified. Here, we analyzed 111,269 human activity records from 14,727 protected sites in 20 Member States. The frequency of occurrence of activities differs among countries, with more than 86 % of all sites being subjected to agriculture or forestry. Activities like hunting, fishing, urbanization, transportation, and tourism are more frequently recorded in south European sites than in northern or eastern ones. The observed variations indicate that Natura 2000 networks are highly heterogeneous among EU Member States. Our analysis highlights the importance of agriculture in European landscapes and indicates possible targets for policy interventions at national, European, or "sub-European" level. The strong human presence in the Natura 2000 network throughout Member States, shows that conservation initiatives could succeed only by combining social and ecological sustainability and by ensuring the integration of policies affecting biodiversity.

  20. Determining the drivers of population structure in a highly urbanized landscape to inform conservation planning.

    Science.gov (United States)

    Thomassen, Henri A; Harrigan, Ryan J; Semple Delaney, Kathleen; Riley, Seth P D; Serieys, Laurel E K; Pease, Katherine; Wayne, Robert K; Smith, Thomas B

    2018-02-01

    Understanding the environmental contributors to population structure is of paramount importance for conservation in urbanized environments. We used spatially explicit models to determine genetic population structure under current and future environmental conditions across a highly fragmented, human-dominated environment in Southern California to assess the effects of natural ecological variation and urbanization. We focused on 7 common species with diverse habitat requirements, home-range sizes, and dispersal abilities. We quantified the relative roles of potential barriers, including natural environmental characteristics and an anthropogenic barrier created by a major highway, in shaping genetic variation. The ability to predict genetic variation in our models differed among species: 11-81% of intraspecific genetic variation was explained by environmental variables. Although an anthropogenically induced barrier (a major highway) severely restricted gene flow and movement at broad scales for some species, genetic variation seemed to be primarily driven by natural environmental heterogeneity at a local level. Our results show how assessing environmentally associated variation for multiple species under current and future climate conditions can help identify priority regions for maximizing population persistence under environmental change in urbanized regions. © 2017 Society for Conservation Biology.

  1. Highly conserved molecular pathways, including Wnt signaling, promote functional recovery from spinal cord injury in lampreys.

    Science.gov (United States)

    Herman, Paige E; Papatheodorou, Angelos; Bryant, Stephanie A; Waterbury, Courtney K M; Herdy, Joseph R; Arcese, Anthony A; Buxbaum, Joseph D; Smith, Jeramiah J; Morgan, Jennifer R; Bloom, Ona

    2018-01-15

    In mammals, spinal cord injury (SCI) leads to dramatic losses in neurons and synaptic connections, and consequently function. Unlike mammals, lampreys are vertebrates that undergo spontaneous regeneration and achieve functional recovery after SCI. Therefore our goal was to determine the complete transcriptional responses that occur after SCI in lampreys and to identify deeply conserved pathways that promote regeneration. We performed RNA-Seq on lamprey spinal cord and brain throughout the course of functional recovery. We describe complex transcriptional responses in the injured spinal cord, and somewhat surprisingly, also in the brain. Transcriptional responses to SCI in lampreys included transcription factor networks that promote peripheral nerve regeneration in mammals such as Atf3 and Jun. Furthermore, a number of highly conserved axon guidance, extracellular matrix, and proliferation genes were also differentially expressed after SCI in lampreys. Strikingly, ~3% of differentially expressed transcripts belonged to the Wnt pathways. These included members of the Wnt and Frizzled gene families, and genes involved in downstream signaling. Pharmacological inhibition of Wnt signaling inhibited functional recovery, confirming a critical role for this pathway. These data indicate that molecular signals present in mammals are also involved in regeneration in lampreys, supporting translational relevance of the model.

  2. Zero-tolerance biosecurity protects high-conservation-value island nature reserve.

    Science.gov (United States)

    Scott, John K; McKirdy, Simon J; van der Merwe, Johann; Green, Roy; Burbidge, Andrew A; Pickles, Greg; Hardie, Darryl C; Morris, Keith; Kendrick, Peter G; Thomas, Melissa L; Horton, Kristin L; O'Connor, Simon M; Downs, Justin; Stoklosa, Richard; Lagdon, Russell; Marks, Barbara; Nairn, Malcolm; Mengersen, Kerrie

    2017-04-10

    Barrow Island, north-west coast of Australia, is one of the world's significant conservation areas, harboring marsupials that have become extinct or threatened on mainland Australia as well as a rich diversity of plants and animals, some endemic. Access to construct a Liquefied Natural Gas (LNG) plant, Australia's largest infrastructure development, on the island was conditional on no non-indigenous species (NIS) becoming established. We developed a comprehensive biosecurity system to protect the island's biodiversity. From 2009 to 2015 more than 0.5 million passengers and 12.2 million tonnes of freight were transported to the island under the biosecurity system, requiring 1.5 million hrs of inspections. No establishments of NIS were detected. We made four observations that will assist development of biosecurity systems. Firstly, the frequency of detections of organisms corresponded best to a mixture log-normal distribution including the high number of zero inspections and extreme values involving rare incursions. Secondly, comprehensive knowledge of the island's biota allowed estimation of false positive detections (62% native species). Thirdly, detections at the border did not predict incursions on the island. Fourthly, the workforce detected more than half post-border incursions (59%). Similar approaches can and should be implemented for all areas of significant conservation value.

  3. High-order conservative reconstruction schemes for finite volume methods in cylindrical and spherical coordinates

    CERN Document Server

    Mignone, A

    2014-01-01

    High-order reconstruction schemes for the solution of hyperbolic conservation laws in orthogonal curvilinear coordinates are revised in the finite volume approach. The formulation employs a piecewise polynomial approximation to the zone-average values to reconstruct left and right interface states from within a computational zone to arbitrary order of accuracy by inverting a Vandermonde-like linear system of equations with spatially varying coefficients. The approach is general and can be used on uniform and non-uniform meshes although explicit expressions are derived for polynomials from second to fifth degree in cylindrical and spherical geometries with uniform grid spacing. It is shown that, in regions of large curvature, the resulting expressions differ considerably from their Cartesian counterparts and that the lack of such corrections can severely degrade the accuracy of the solution close to the coordinate origin. Limiting techniques and monotonicity constraints are revised for conventional reconstruct...

  4. A highly conserved segmental duplication in the subtelomeres of Plasmodium falciparum chromosomes varies in copy number

    Directory of Open Access Journals (Sweden)

    Ribacke Ulf

    2008-03-01

    Full Text Available Abstract Background Segmental duplications (SD have been found in genomes of various organisms, often accumulated at the ends of chromosomes. It has been assumed that the sequence homology in-between the SDs allow for ectopic interactions that may contribute to the emergence of new genes or gene variants through recombinatorial events. Methods In silico analysis of the 3D7 Plasmodium falciparum genome, conducted to investigate the subtelomeric compartments, led to the identification of subtelomeric SDs. Sequence variation and copy number polymorphisms of the SDs were studied by DNA sequencing, real-time quantitative PCR (qPCR and fluorescent in situ hybridization (FISH. The levels of transcription and the developmental expression of copy number variant genes were investigated by qPCR. Results A block of six genes of >10 kilobases in size, including var, rif, pfmc-2tm and three hypothetical genes (n-, o- and q-gene, was found duplicated in the subtelomeric regions of chromosomes 1, 2, 3, 6, 7, 10 and 11 (SD1. The number of SD1 per genome was found to vary from 4 to 8 copies in between different parasites. The intragenic regions of SD1 were found to be highly conserved across ten distinct fresh and long-term cultivated P. falciparum. Sequence variation was detected in a ≈ 23 amino-acid long hypervariable region of a surface-exposed loop of PFMC-2TM. A hypothetical gene within SD1, the n-gene, encoding a PEXEL/VTS-containing two-transmembrane protein was found expressed in ring stage parasites. The n-gene transcription levels were found to correlate to the number of n-gene copies. Fragments of SD1 harbouring two or three of the SD1-genes (o-gene, pfmc-2tm, q-gene were also found in the 3D7 genome. In addition a related second SD, SD2, of ≈ 55% sequence identity to SD1 was found duplicated in a fresh clinical isolate but was only present in a single copy in 3D7 and in other P. falciparum lines or clones. Conclusion Plasmodium falciparum carries

  5. Cortical cytasters: a highly conserved developmental trait of Bilateria with similarities to Ctenophora

    Directory of Open Access Journals (Sweden)

    Salinas-Saavedra Miguel

    2011-12-01

    Full Text Available Abstract Background Cytasters (cytoplasmic asters are centriole-based nucleation centers of microtubule polymerization that are observable in large numbers in the cortical cytoplasm of the egg and zygote of bilaterian organisms. In both protostome and deuterostome taxa, cytasters have been described to develop during oogenesis from vesicles of nuclear membrane that move to the cortical cytoplasm. They become associated with several cytoplasmic components, and participate in the reorganization of cortical cytoplasm after fertilization, patterning the antero-posterior and dorso-ventral body axes. Presentation of the hypothesis The specific resemblances in the development of cytasters in both protostome and deuterostome taxa suggest that an independent evolutionary origin is unlikely. An assessment of published data confirms that cytasters are present in several protostome and deuterostome phyla, but are absent in the non-bilaterian phyla Cnidaria and Ctenophora. We hypothesize that cytasters evolved in the lineage leading to Bilateria and were already present in the most recent common ancestor shared by protostomes and deuterostomes. Thus, cytasters would be an ancient and highly conserved trait that is homologous across the different bilaterian phyla. The alternative possibility is homoplasy, that is cytasters have evolved independently in different lineages of Bilateria. Testing the hypothesis So far, available published information shows that appropriate observations have been made in eight different bilaterian phyla. All of them present cytasters. This is consistent with the hypothesis of homology and conservation. However, there are several important groups for which there are no currently available data. The hypothesis of homology predicts that cytasters should be present in these groups. Increasing the taxonomic sample using modern techniques uniformly will test for evolutionary patterns supporting homology, homoplasy, or secondary loss of

  6. Cortical cytasters: a highly conserved developmental trait of Bilateria with similarities to Ctenophora.

    Science.gov (United States)

    Salinas-Saavedra, Miguel; Vargas, Alexander O

    2011-12-01

    Cytasters (cytoplasmic asters) are centriole-based nucleation centers of microtubule polymerization that are observable in large numbers in the cortical cytoplasm of the egg and zygote of bilaterian organisms. In both protostome and deuterostome taxa, cytasters have been described to develop during oogenesis from vesicles of nuclear membrane that move to the cortical cytoplasm. They become associated with several cytoplasmic components, and participate in the reorganization of cortical cytoplasm after fertilization, patterning the antero-posterior and dorso-ventral body axes. The specific resemblances in the development of cytasters in both protostome and deuterostome taxa suggest that an independent evolutionary origin is unlikely. An assessment of published data confirms that cytasters are present in several protostome and deuterostome phyla, but are absent in the non-bilaterian phyla Cnidaria and Ctenophora. We hypothesize that cytasters evolved in the lineage leading to Bilateria and were already present in the most recent common ancestor shared by protostomes and deuterostomes. Thus, cytasters would be an ancient and highly conserved trait that is homologous across the different bilaterian phyla. The alternative possibility is homoplasy, that is cytasters have evolved independently in different lineages of Bilateria. So far, available published information shows that appropriate observations have been made in eight different bilaterian phyla. All of them present cytasters. This is consistent with the hypothesis of homology and conservation. However, there are several important groups for which there are no currently available data. The hypothesis of homology predicts that cytasters should be present in these groups. Increasing the taxonomic sample using modern techniques uniformly will test for evolutionary patterns supporting homology, homoplasy, or secondary loss of cytasters. If cytasters are homologous and highly conserved across bilateria, their potential

  7. Streamlining and Core Genome Conservation among Highly Divergent Members of the SAR11 Clade

    Science.gov (United States)

    Grote, Jana; Thrash, J. Cameron; Huggett, Megan J.; Landry, Zachary C.; Carini, Paul; Giovannoni, Stephen J.; Rappé, Michael S.

    2012-01-01

    ABSTRACT SAR11 is an ancient and diverse clade of heterotrophic bacteria that are abundant throughout the world’s oceans, where they play a major role in the ocean carbon cycle. Correlations between the phylogenetic branching order and spatiotemporal patterns in cell distributions from planktonic ocean environments indicate that SAR11 has evolved into perhaps a dozen or more specialized ecotypes that span evolutionary distances equivalent to a bacterial order. We isolated and sequenced genomes from diverse SAR11 cultures that represent three major lineages and encompass the full breadth of the clade. The new data expand observations about genome evolution and gene content that previously had been restricted to the SAR11 Ia subclade, providing a much broader perspective on the clade’s origins, evolution, and ecology. We found small genomes throughout the clade and a very high proportion of core genome genes (48 to 56%), indicating that small genome size is probably an ancestral characteristic. In their level of core genome conservation, the members of SAR11 are outliers, the most conserved free-living bacteria known. Shared features of the clade include low GC content, high gene synteny, a large hypervariable region bounded by rRNA genes, and low numbers of paralogs. Variation among the genomes included genes for phosphorus metabolism, glycolysis, and C1 metabolism, suggesting that adaptive specialization in nutrient resource utilization is important to niche partitioning and ecotype divergence within the clade. These data provide support for the conclusion that streamlining selection for efficient cell replication in the planktonic habitat has occurred throughout the evolution and diversification of this clade. PMID:22991429

  8. Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Scharfe Maren

    2010-04-01

    Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.

  9. A guide to calculating habitat-quality metrics to inform conservation of highly mobile species

    Science.gov (United States)

    Bieri, Joanna A.; Sample, Christine; Thogmartin, Wayne E.; Diffendorfer, James E.; Earl, Julia E.; Erickson, Richard A.; Federico, Paula; Flockhart, D. T. Tyler; Nicol, Sam; Semmens, Darius J.; Skraber, T.; Wiederholt, Ruscena; Mattsson, Brady J.

    2018-01-01

    Many metrics exist for quantifying the relative value of habitats and pathways used by highly mobile species. Properly selecting and applying such metrics requires substantial background in mathematics and understanding the relevant management arena. To address this multidimensional challenge, we demonstrate and compare three measurements of habitat quality: graph-, occupancy-, and demographic-based metrics. Each metric provides insights into system dynamics, at the expense of increasing amounts and complexity of data and models. Our descriptions and comparisons of diverse habitat-quality metrics provide means for practitioners to overcome the modeling challenges associated with management or conservation of such highly mobile species. Whereas previous guidance for applying habitat-quality metrics has been scattered in diversified tracks of literature, we have brought this information together into an approachable format including accessible descriptions and a modeling case study for a typical example that conservation professionals can adapt for their own decision contexts and focal populations.Considerations for Resource ManagersManagement objectives, proposed actions, data availability and quality, and model assumptions are all relevant considerations when applying and interpreting habitat-quality metrics.Graph-based metrics answer questions related to habitat centrality and connectivity, are suitable for populations with any movement pattern, quantify basic spatial and temporal patterns of occupancy and movement, and require the least data.Occupancy-based metrics answer questions about likelihood of persistence or colonization, are suitable for populations that undergo localized extinctions, quantify spatial and temporal patterns of occupancy and movement, and require a moderate amount of data.Demographic-based metrics answer questions about relative or absolute population size, are suitable for populations with any movement pattern, quantify demographic

  10. A highly conserved amino acid in VP1 regulates maturation of enterovirus 71.

    Directory of Open Access Journals (Sweden)

    Yong-Xin Zhang

    2017-09-01

    Full Text Available Enterovirus 71 (EV71 is the major causative agent of hand, foot and mouth disease (HFMD in children, causing severe clinical outcomes and even death. Here, we report an important role of the highly conserved alanine residue at position 107 in the capsid protein VP1 (VP1A107 in the efficient replication of EV71. Substitutional mutations of VP1A107 significantly diminish viral growth kinetics without significant effect on viral entry, expression of viral genes and viral production. The results of mechanistic studies reveal that VP1A107 regulates the efficient cleavage of the VP0 precursor during EV71 assembly, which is required, in the next round of infection, for the transformation of the mature virion (160S into an intermediate or A-particle (135S, a key step of virus uncoating. Furthermore, the results of molecular dynamic simulations and hydrogen-bond networks analysis of VP1A107 suggest that flexibility of the VP1 BC loop or the region surrounding the VP1107 residue directly correlates with viral infectivity. It is possible that sufficient flexibility of the region surrounding the VP1107 residue favors VP0 conformational change that is required for the efficient cleavage of VP0 as well as subsequent viral uncoating and viral replication. Taken together, our data reveal the structural role of the highly conserved VP1A107 in regulating EV71 maturation. Characterization of this novel determinant of EV71 virulence would promote the study on pathogenesis of Enteroviruses.

  11. Highly conserved type 1 pili promote enterotoxigenic E. coli pathogen-host interactions.

    Directory of Open Access Journals (Sweden)

    Alaullah Sheikh

    2017-05-01

    Full Text Available Enterotoxigenic Escherichia coli (ETEC, defined by their elaboration of heat-labile (LT and/or heat-stable (ST enterotoxins, are a common cause of diarrheal illness in developing countries. Efficient delivery of these toxins requires ETEC to engage target host enterocytes. This engagement is accomplished using a variety of pathovar-specific and conserved E. coli adhesin molecules as well as plasmid encoded colonization factors. Some of these adhesins undergo significant transcriptional modulation as ETEC encounter intestinal epithelia, perhaps suggesting that they cooperatively facilitate interaction with the host. Among genes significantly upregulated on cell contact are those encoding type 1 pili. We therefore investigated the role played by these pili in facilitating ETEC adhesion, and toxin delivery to model intestinal epithelia. We demonstrate that type 1 pili, encoded in the E. coli core genome, play an essential role in ETEC virulence, acting in concert with plasmid-encoded pathovar specific colonization factor (CF fimbriae to promote optimal bacterial adhesion to cultured intestinal epithelium (CIE and to epithelial monolayers differentiated from human small intestinal stem cells. Type 1 pili are tipped with the FimH adhesin which recognizes mannose with stereochemical specificity. Thus, enhanced production of highly mannosylated proteins on intestinal epithelia promoted FimH-mediated ETEC adhesion, while conversely, interruption of FimH lectin-epithelial interactions with soluble mannose, anti-FimH antibodies or mutagenesis of fimH effectively blocked ETEC adhesion. Moreover, fimH mutants were significantly impaired in delivery of both heat-stable and heat-labile toxins to the target epithelial cells in vitro, and these mutants were substantially less virulent in rabbit ileal loop assays, a classical model of ETEC pathogenesis. Collectively, our data suggest that these highly conserved pili play an essential role in virulence of these

  12. Butterflies of the high-altitude Atacama Desert: habitat use and conservation.

    Science.gov (United States)

    Despland, Emma

    2014-01-01

    The butterfly fauna of the high-altitude desert of Northern Chile, though depauperate, shows high endemism, is poorly known and is of considerable conservation concern. This study surveys butterflies along the Andean slope between 2400 and 5000 m asl (prepuna, puna and Andean steppe habitats) as well as in high and low-altitude wetlands and in the neoriparian vegetation of agricultural sites. We also include historical sightings from museum records. We compare abundances between altitudes, between natural and impacted sites, as well as between two sampling years with different precipitation regimes. The results confirm high altitudinal turnover and show greatest similarity between wetland and slope faunas at similar altitudes. Results also underscore vulnerability to weather fluctuations, particularly in the more arid low-altitude sites, where abundances were much lower in the low precipitation sampling season and several species were not observed at all. Finally, we show that some species have shifted to the neoriparian vegetation of the agricultural landscape, whereas others were only observed in less impacted habitats dominated by native plants. These results suggest that acclimation to novel habitats depends on larval host plant use. The traditional agricultural environment can provide habitat for many, but not all, native butterfly species, but an estimation of the value of these habitats requires better understanding of butterfly life history strategies and relationships with host plants.

  13. Transcribed-ultra conserved region expression is associated with outcome in high-risk neuroblastoma

    Directory of Open Access Journals (Sweden)

    Garaventa Alberto

    2009-12-01

    Full Text Available Abstract Background Neuroblastoma is the most common, pediatric, extra-cranial, malignant solid tumor. Despite multimodal therapeutic protocols, outcome for children with a high-risk clinical phenotype remains poor, with long-term survival still less than 40%. Hereby, we evaluated the potential of non-coding RNA expression to predict outcome in high-risk, stage 4 neuroblastoma. Methods We analyzed expression of 481 Ultra Conserved Regions (UCRs by reverse transcription-quantitative real-time PCR and of 723 microRNAs by microarrays in 34 high-risk, stage 4 neuroblastoma patients. Results First, the comparison of 8 short- versus 12 long-term survivors showed that 54 UCRs were significantly (P P P P Conclusions Our pilot study suggests that a deregulation of the microRNA/T-UCR network may play an important role in the pathogenesis of neuroblastoma. After further validation on a larger independent set of samples, such findings may be applied as the first T-UCR prognostic signature for high-risk neuroblastoma patients.

  14. Butterflies of the high altitude Atacama Desert: habitat use and conservation

    Directory of Open Access Journals (Sweden)

    Emma eDespland

    2014-09-01

    Full Text Available The butterfly fauna of the high-altitude desert of Northern Chile, though depauperate, shows high endemism, is poorly known and is of considerable conservation concern. This study surveys butterflies along the Andean slope between 2400 and 500 m asl (prepuna, puna and Andean steppe habitats as well as in high and low altitude wetlands and in the neoriparian vegetation of agricultural sites. We also include historical sightings from museum records. We compare abundances between altitudes, between natural and impacted sites, as well as between two sampling years with different precipitation regimes. The results confirm high altitudinal turnover and show greatest similarity between wetland and slope faunas at similar altitudes. Results also underscore vulnerability to weather fluctuations, particularly in the more arid low-altitude sites, where abundances were much lower in the low precipitation sampling season and several species were not observed at all. Finally, we show that some species have shifted to the neoriparian vegetation of the agricultural landscape, whereas others were only observed in less impacted habitats dominated by native plants. These results suggest that acclimation to novel habitats depends on larval host plant use. The traditional agricultural environment can provide habitat for many, but not all, native butterfly species, but an estimation of the value of these habitats requires better understanding of butterfly life-history strategies and relationships with host plants.

  15. Single site-specific integration targeting coupled with embryonic stem cell differentiation provides a high-throughput alternative to in vivo enhancer analyses

    Directory of Open Access Journals (Sweden)

    Adam C. Wilkinson

    2013-10-01

    Comprehensive analysis of cis-regulatory elements is key to understanding the dynamic gene regulatory networks that control embryonic development. While transgenic animals represent the gold standard assay, their generation is costly, entails significant animal usage, and in utero development complicates time-course studies. As an alternative, embryonic stem (ES cells can readily be differentiated in a process that correlates well with developing embryos. Here, we describe a highly effective platform for enhancer assays using an Hsp68/Venus reporter cassette that targets to the Hprt locus in mouse ES cells. This platform combines the flexibility of Gateway® cloning, live cell trackability of a fluorescent reporter, low background and the advantages of single copy insertion into a defined genomic locus. We demonstrate the successful recapitulation of tissue-specific enhancer activity for two cardiac and two haematopoietic enhancers. In addition, we used this assay to dissect the functionality of the highly conserved Ets/Ets/Gata motif in the Scl+19 enhancer, which revealed that the Gata motif is not required for initiation of enhancer activity. We further confirmed that Gata2 is not required for endothelial activity of the Scl+19 enhancer using Gata2−/− Scl+19 transgenic embryos. We have therefore established a valuable toolbox to study gene regulatory networks with broad applicability.

  16. Single site-specific integration targeting coupled with embryonic stem cell differentiation provides a high-throughput alternative to in vivo enhancer analyses.

    Science.gov (United States)

    Wilkinson, Adam C; Goode, Debbie K; Cheng, Yi-Han; Dickel, Diane E; Foster, Sam; Sendall, Tim; Tijssen, Marloes R; Sanchez, Maria-Jose; Pennacchio, Len A; Kirkpatrick, Aileen M; Göttgens, Berthold

    2013-01-01

    Comprehensive analysis of cis-regulatory elements is key to understanding the dynamic gene regulatory networks that control embryonic development. While transgenic animals represent the gold standard assay, their generation is costly, entails significant animal usage, and in utero development complicates time-course studies. As an alternative, embryonic stem (ES) cells can readily be differentiated in a process that correlates well with developing embryos. Here, we describe a highly effective platform for enhancer assays using an Hsp68/Venus reporter cassette that targets to the Hprt locus in mouse ES cells. This platform combines the flexibility of Gateway® cloning, live cell trackability of a fluorescent reporter, low background and the advantages of single copy insertion into a defined genomic locus. We demonstrate the successful recapitulation of tissue-specific enhancer activity for two cardiac and two haematopoietic enhancers. In addition, we used this assay to dissect the functionality of the highly conserved Ets/Ets/Gata motif in the Scl+19 enhancer, which revealed that the Gata motif is not required for initiation of enhancer activity. We further confirmed that Gata2 is not required for endothelial activity of the Scl+19 enhancer using Gata2(-/-) Scl+19 transgenic embryos. We have therefore established a valuable toolbox to study gene regulatory networks with broad applicability.

  17. Habitat Re-Creation (Ecological Restoration) as a Strategy for Conserving Insect Communities in Highly Fragmented Landscapes

    Science.gov (United States)

    Shuey, John A.

    2013-01-01

    Because of their vast diversity, measured by both numbers of species as well as life history traits, insects defy comprehensive conservation planning. Thus, almost all insect conservation efforts target individual species. However, serious insect conservation requires goals that are set at the faunal level and conservation success requires strategies that conserve intact communities. This task is complicated in agricultural landscapes by high levels of habitat fragmentation and isolation. In many regions, once widespread insect communities are now functionally trapped on islands of ecosystem remnants and subject to a variety of stressors associated with isolation, small population sizes and artificial population fragmentation. In fragmented landscapes ecological restoration can be an effective strategy for reducing localized insect extinction rates, but insects are seldom included in restoration design criteria. It is possible to incorporate a few simple conservation criteria into restoration designs that enhance impacts to entire insect communities. Restoration can be used as a strategy to address fragmentation threats to isolated insect communities if insect communities are incorporated at the onset of restoration planning. Fully incorporating insect communities into restoration designs may increase the cost of restoration two- to three-fold, but the benefits to biodiversity conservation and the ecological services provided by intact insect communities justify the cost. PMID:26462535

  18. The importance of incorporating functional habitats into conservation planning for highly mobile species in dynamic systems.

    Science.gov (United States)

    Webb, Matthew H; Terauds, Aleks; Tulloch, Ayesha; Bell, Phil; Stojanovic, Dejan; Heinsohn, Robert

    2017-10-01

    The distribution of mobile species in dynamic systems can vary greatly over time and space. Estimating their population size and geographic range can be problematic and affect the accuracy of conservation assessments. Scarce data on mobile species and the resources they need can also limit the type of analytical approaches available to derive such estimates. We quantified change in availability and use of key ecological resources required for breeding for a critically endangered nomadic habitat specialist, the Swift Parrot (Lathamus discolor). We compared estimates of occupied habitat derived from dynamic presence-background (i.e., presence-only data) climatic models with estimates derived from dynamic occupancy models that included a direct measure of food availability. We then compared estimates that incorporate fine-resolution spatial data on the availability of key ecological resources (i.e., functional habitats) with more common approaches that focus on broader climatic suitability or vegetation cover (due to the absence of fine-resolution data). The occupancy models produced significantly (P < 0.001) smaller (up to an order of magnitude) and more spatially discrete estimates of the total occupied area than climate-based models. The spatial location and extent of the total area occupied with the occupancy models was highly variable between years (131 and 1498 km2 ). Estimates accounting for the area of functional habitats were significantly smaller (2-58% [SD 16]) than estimates based only on the total area occupied. An increase or decrease in the area of one functional habitat (foraging or nesting) did not necessarily correspond to an increase or decrease in the other. Thus, an increase in the extent of occupied area may not equate to improved habitat quality or function. We argue these patterns are typical for mobile resource specialists but often go unnoticed because of limited data over relevant spatial and temporal scales and lack of spatial data on the

  19. Highly conserved Z and molecularly diverged W chromosomes in the fish genus Triportheus (Characiformes, Triportheidae).

    Science.gov (United States)

    Yano, C F; Bertollo, L A C; Ezaz, T; Trifonov, V; Sember, A; Liehr, T; Cioffi, M B

    2017-03-01

    The main objectives of this study were to test: (1) whether the W-chromosome differentiation matches to species' evolutionary divergence (phylogenetic concordance) and (2) whether sex chromosomes share a common ancestor within a congeneric group. The monophyletic genus Triportheus (Characiformes, Triportheidae) was the model group for this study. All species in this genus so far analyzed have ZW sex chromosome system, where the Z is always the largest chromosome of the karyotype, whereas the W chromosome is highly variable ranging from almost homomorphic to highly heteromorphic. We applied conventional and molecular cytogenetic approaches including C-banding, ribosomal DNA mapping, comparative genomic hybridization (CGH) and cross-species whole chromosome painting (WCP) to test our questions. We developed Z- and W-chromosome paints from T. auritus for cross-species WCP and performed CGH in a representative species (T. signatus) to decipher level of homologies and rates of differentiation of W chromosomes. Our study revealed that the ZW sex chromosome system had a common origin, showing highly conserved Z chromosomes and remarkably divergent W chromosomes. Notably, the W chromosomes have evolved to different shapes and sequence contents within ~15-25 Myr of divergence time. Such differentiation highlights a dynamic process of W-chromosome evolution within congeneric species of Triportheus.

  20. Silencing Effect of Hominoid Highly Conserved Noncoding Sequences on Embryonic Brain Development

    Science.gov (United States)

    Mahmoudi Saber, Morteza

    2017-01-01

    Abstract Superfamily Hominoidea, which consists of Hominidae (humans and great apes) and Hylobatidae (gibbons), is well-known for sharing human-like characteristics, however, the genomic origins of these shared unique phenotypes have mainly remained elusive. To decipher the underlying genomic basis of Hominoidea-restricted phenotypes, we identified and characterized Hominoidea-restricted highly conserved noncoding sequences (HCNSs) that are a class of potential regulatory elements which may be involved in evolution of lineage-specific phenotypes. We discovered 679 such HCNSs from human, chimpanzee, gorilla, orangutan and gibbon genomes. These HCNSs were demonstrated to be under purifying selection but with lineage-restricted characteristics different from old CNSs. A significant proportion of their ancestral sequences had accelerated rates of nucleotide substitutions, insertions and deletions during the evolution of common ancestor of Hominoidea, suggesting the intervention of positive Darwinian selection for creating those HCNSs. In contrary to enhancer elements and similar to silencer sequences, these Hominoidea-restricted HCNSs are located in close proximity of transcription start sites. Their target genes are enriched in the nervous system, development and transcription, and they tend to be remotely located from the nearest coding gene. Chip-seq signals and gene expression patterns suggest that Hominoidea-restricted HCNSs are likely to be functional regulatory elements by imposing silencing effects on their target genes in a tissue-restricted manner during fetal brain development. These HCNSs, emerged through adaptive evolution and conserved through purifying selection, represent a set of promising targets for future functional studies of the evolution of Hominoidea-restricted phenotypes. PMID:28633494

  1. High School Biology Teachers' Use of Wildlife Conservation Magazines in the Classroom.

    Science.gov (United States)

    Chipman, Elizabeth; Brody, Michael

    1993-01-01

    Reports a survey of practicing biology teachers in the State of Maine and their use of conservation magazines, in particular, "Maine Fish and Wildlife Magazine," in their classrooms. Results indicate that 30% of the responding teachers use conservation magazines. Common uses include reporting research, discussing ethical issues, and…

  2. Swertia chirayta, a Threatened High-Value Medicinal Herb: Microhabitats and Conservation Challenges in Sikkim Himalaya, India

    Directory of Open Access Journals (Sweden)

    Bharat Kumar Pradhan

    2015-11-01

    Full Text Available Assessing the impact of threats, identifying favorable growing conditions, and predicting future population scenarios are vital for the conservation and management of threatened species. This study investigated the availability, microhabitat characteristics, threat status, and community associations of Swertia chirayta, a highly threatened Himalayan medicinal herb, in 22 populations in Sikkim, India, using the vertical belt transect method. Of the 14 microhabitats identified, open grassy slope emerged as the most favorable and wet grassy slope as the least favorable for S. chirayta. The species was dominant in 8 of the 10 major plant communities identified. Among 9 major types of disturbance identified, human movement and collection of non-timber forest products appeared as the biggest threats to S. chirayta. Disturbances significantly affected the availability of the species. S. chirayta, though under high anthropogenic threat, maintains high microhabitat pliability, which is vital for its conservation and management, provided immediate conservation measures are taken.

  3. High severity fire in forests of the southwest: Conservation implications. Progress Report August 2005

    Science.gov (United States)

    Haire, Sandra L.

    2006-01-01

    The occurrence of large, severe fires in southwestern ponderosa pine (Pinus ponderosa) forests has resulted in concern that these forests may not persist under such an extreme disturbance regime. In our research, we are examining the outcomes of high-severity fire in ponderosa pine forests and their neighboring communities across an elevational gradient. One goal of our work is to contribute to understanding the resiliency of these systems, but we also want to investigate the conservation values intrinsic to the diverse communities that represent alternative successional trajectories after severe fire. One assumption of our research is that the spatial pattern of a disturbance becomes increasingly important when the disturbance is large and biological legacies are few and sparse. We ask, therefore, what spectrum of plant communities results from high severity fire, and what is their relationship to spatial patterns of severity mapped in early post fire timeframes? Also, do spatial patterns of older burns (1950–80) differ from recent burns (1998–present) in ways that make us expect successional changes years from now to differ from those we observed at our older burn field sites?

  4. Comparative genomics of Burkholderia multivorans, a ubiquitous pathogen with a highly conserved genomic structure.

    Directory of Open Access Journals (Sweden)

    Charlotte Peeters

    Full Text Available The natural environment serves as a reservoir of opportunistic pathogens. A well-established method for studying the epidemiology of such opportunists is multilocus sequence typing, which in many cases has defined strains predisposed to causing infection. Burkholderia multivorans is an important pathogen in people with cystic fibrosis (CF and its epidemiology suggests that strains are acquired from non-human sources such as the natural environment. This raises the central question of whether the isolation source (CF or environment or the multilocus sequence type (ST of B. multivorans better predicts their genomic content and functionality. We identified four pairs of B. multivorans isolates, representing distinct STs and consisting of one CF and one environmental isolate each. All genomes were sequenced using the PacBio SMRT sequencing technology, which resulted in eight high-quality B. multivorans genome assemblies. The present study demonstrated that the genomic structure of the examined B. multivorans STs is highly conserved and that the B. multivorans genomic lineages are defined by their ST. Orthologous protein families were not uniformly distributed among chromosomes, with core orthologs being enriched on the primary chromosome and ST-specific orthologs being enriched on the second and third chromosome. The ST-specific orthologs were enriched in genes involved in defense mechanisms and secondary metabolism, corroborating the strain-specificity of these virulence characteristics. Finally, the same B. multivorans genomic lineages occur in both CF and environmental samples and on different continents, demonstrating their ubiquity and evolutionary persistence.

  5. The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya; Margolin, William

    2014-05-05

    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium, and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.

  6. Comparative genomics of Burkholderia multivorans, a ubiquitous pathogen with a highly conserved genomic structure.

    Science.gov (United States)

    Peeters, Charlotte; Cooper, Vaughn S; Hatcher, Philip J; Verheyde, Bart; Carlier, Aurélien; Vandamme, Peter

    2017-01-01

    The natural environment serves as a reservoir of opportunistic pathogens. A well-established method for studying the epidemiology of such opportunists is multilocus sequence typing, which in many cases has defined strains predisposed to causing infection. Burkholderia multivorans is an important pathogen in people with cystic fibrosis (CF) and its epidemiology suggests that strains are acquired from non-human sources such as the natural environment. This raises the central question of whether the isolation source (CF or environment) or the multilocus sequence type (ST) of B. multivorans better predicts their genomic content and functionality. We identified four pairs of B. multivorans isolates, representing distinct STs and consisting of one CF and one environmental isolate each. All genomes were sequenced using the PacBio SMRT sequencing technology, which resulted in eight high-quality B. multivorans genome assemblies. The present study demonstrated that the genomic structure of the examined B. multivorans STs is highly conserved and that the B. multivorans genomic lineages are defined by their ST. Orthologous protein families were not uniformly distributed among chromosomes, with core orthologs being enriched on the primary chromosome and ST-specific orthologs being enriched on the second and third chromosome. The ST-specific orthologs were enriched in genes involved in defense mechanisms and secondary metabolism, corroborating the strain-specificity of these virulence characteristics. Finally, the same B. multivorans genomic lineages occur in both CF and environmental samples and on different continents, demonstrating their ubiquity and evolutionary persistence.

  7. Acacia shrubs respond positively to high severity wildfire: Implications for conservation and fuel hazard management.

    Science.gov (United States)

    Gordon, Christopher E; Price, Owen F; Tasker, Elizabeth M; Denham, Andrew J

    2017-01-01

    High severity wildfires pose threats to human assets, but are also perceived to impact vegetation communities because a small number of species may become dominant immediately after fire. However there are considerable gaps in our knowledge about species-specific responses of plants to different fire severities, and how this influences fuel hazard in the short and long-term. Here we conduct a floristic survey at sites before and two years after a wildfire of unprecedented size and severity in the Warrumbungle National Park (Australia) to explore relationships between post-fire growth of a fire responsive shrub genera (Acacia), total mid-story vegetation cover, fire severity and fuel hazard. We then survey 129 plots surrounding the park to assess relationships between mid-story vegetation cover and time-since-fire. Acacia species richness and cover were 2.3 and 4.3 times greater at plots after than before the fire. However the same common dominant species were present throughout the study. Mid-story vegetation cover was 1.5 times greater after than before the wildfire, and Acacia species contribution to mid-story cover increased from 10 to 40%. Acacia species richness was not affected by fire severity, however strong positive associations were observed between Acacia and total mid-story vegetation cover and severity. Our analysis of mid-story vegetation recovery showed that cover was similarly high between 2 and 30years post-fire, then decreased until 52years. Collectively, our results suggest that Acacia species are extremely resilient to high severity wildfire and drive short to mid-term increases in fuel hazard. Our results are discussed in relation to fire regime management from the twin perspectives of conserving biodiversity and mitigating human losses due to wildfire. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Novel efficient genome-wide SNP panels for the conservation of the highly endangered Iberian lynx.

    Science.gov (United States)

    Kleinman-Ruiz, Daniel; Martínez-Cruz, Begoña; Soriano, Laura; Lucena-Perez, Maria; Cruz, Fernando; Villanueva, Beatriz; Fernández, Jesús; Godoy, José A

    2017-07-21

    The Iberian lynx (Lynx pardinus) has been acknowledged as the most endangered felid species in the world. An intense contraction and fragmentation during the twentieth century left less than 100 individuals split in two isolated and genetically eroded populations by 2002. Genetic monitoring and management so far have been based on 36 STRs, but their limited variability and the more complex situation of current populations demand more efficient molecular markers. The recent characterization of the Iberian lynx genome identified more than 1.6 million SNPs, of which 1536 were selected and genotyped in an extended Iberian lynx sample. We validated 1492 SNPs and analysed their heterozygosity, Hardy-Weinberg equilibrium, and linkage disequilibrium. We then selected a panel of 343 minimally linked autosomal SNPs from which we extracted subsets optimized for four different typical tasks in conservation applications: individual identification, parentage assignment, relatedness estimation, and admixture classification, and compared their power to currently used STR panels. We ascribed 21 SNPs to chromosome X based on their segregation patterns, and identified one additional marker that showed significant differentiation between sexes. For all applications considered, panels of autosomal SNPs showed higher power than the currently used STR set with only a very modest increase in the number of markers. These novel panels of highly informative genome-wide SNPs provide more powerful, efficient, and flexible tools for the genetic management and non-invasive monitoring of Iberian lynx populations. This example highlights an important outcome of whole-genome studies in genetically threatened species.

  9. High Connectivity of the Crocodile Shark between the Atlantic and Southwest Indian Oceans: Highlights for Conservation

    Science.gov (United States)

    da Silva Ferrette, Bruno Lopes; Mendonça, Fernando Fernandes; Coelho, Rui; de Oliveira, Paulo Guilherme Vasconcelos; Hazin, Fábio Hissa Vieira; Romanov, Evgeny V.; Oliveira, Claudio; Santos, Miguel Neves; Foresti, Fausto

    2015-01-01

    Among the various shark species that are captured as bycatch in commercial fishing operations, the group of pelagic sharks is still one of the least studied and known. Within those, the crocodile shark, Pseudocarcharias kamoharai, a small-sized lamnid shark, is occasionally caught by longline vessels in certain regions of the tropical oceans worldwide. However, the population dynamics of this species, as well as the impact of fishing mortality on its stocks, are still unknown, with the crocodile shark currently one of the least studied of all pelagic sharks. Given this, the present study aimed to assess the population structure of P. kamoharai in several regions of the Atlantic and Indian Oceans using genetic molecular markers. The nucleotide composition of the mitochondrial DNA control region of 255 individuals was analyzed, and 31 haplotypes were found, with an estimated diversity Hd = 0.627, and a nucleotide diversity π = 0.00167. An analysis of molecular variance (AMOVA) revealed a fixation index ΦST = -0.01118, representing an absence of population structure among the sampled regions of the Atlantic Ocean, and between the Atlantic and Indian Oceans. These results show a high degree of gene flow between the studied areas, with a single genetic stock and reduced population variability. In panmictic populations, conservation efforts can be concentrated in more restricted areas, being these representative of the total biodiversity of the species. When necessary, this strategy could be applied to the genetic maintenance of P. kamoharai. PMID:25689742

  10. Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).

    Science.gov (United States)

    Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong

    2006-08-01

    Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

  11. A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola.

    Science.gov (United States)

    Sanz-Martín, José M; Pacheco-Arjona, José Ramón; Bello-Rico, Víctor; Vargas, Walter A; Monod, Michel; Díaz-Mínguez, José M; Thon, Michael R; Sukno, Serenella A

    2016-09-01

    Colletotrichum graminicola causes maize anthracnose, an agronomically important disease with a worldwide distribution. We have identified a fungalysin metalloprotease (Cgfl) with a role in virulence. Transcriptional profiling experiments and live cell imaging show that Cgfl is specifically expressed during the biotrophic stage of infection. To determine whether Cgfl has a role in virulence, we obtained null mutants lacking Cgfl and performed pathogenicity and live microscopy assays. The appressorium morphology of the null mutants is normal, but they exhibit delayed development during the infection process on maize leaves and roots, showing that Cgfl has a role in virulence. In vitro chitinase activity assays of leaves infected with wild-type and null mutant strains show that, in the absence of Cgfl, maize leaves exhibit increased chitinase activity. Phylogenetic analyses show that Cgfl is highly conserved in fungi. Similarity searches, phylogenetic analysis and transcriptional profiling show that C. graminicola encodes two LysM domain-containing homologues of Ecp6, suggesting that this fungus employs both Cgfl-mediated and LysM protein-mediated strategies to control chitin signalling. © 2015 BSPP and John Wiley & Sons Ltd.

  12. A dominant EV71-specific CD4+ T cell epitope is highly conserved among human enteroviruses.

    Directory of Open Access Journals (Sweden)

    Ruicheng Wei

    Full Text Available CD4+ T cell-mediated immunity plays a central role in determining the immunopathogenesis of viral infections. However, the role of CD4+ T cells in EV71 infection, which causes hand, foot and mouth disease (HFMD, has yet to be elucidated. We applied a sophisticated method to identify promiscuous CD4+ T cell epitopes contained within the sequence of the EV71 polyprotein. Fifteen epitopes were identified, and three of them are dominant ones. The most dominant epitope is highly conserved among enterovirus species, including HFMD-related coxsackieviruses, HFMD-unrelated echoviruses and polioviruses. Furthermore, the CD4+ T cells specific to the epitope indeed cross-reacted with the homolog of poliovirus 3 Sabin. Our findings imply that CD4+ T cell responses to poliovirus following vaccination, or to other enteroviruses to which individuals may be exposed in early childhood, may have a modulating effect on subsequent CD4+ T cell response to EV71 infection or vaccine.

  13. High connectivity of the crocodile shark between the Atlantic and Southwest Indian Oceans: highlights for conservation.

    Directory of Open Access Journals (Sweden)

    Bruno Lopes da Silva Ferrette

    Full Text Available Among the various shark species that are captured as bycatch in commercial fishing operations, the group of pelagic sharks is still one of the least studied and known. Within those, the crocodile shark, Pseudocarcharias kamoharai, a small-sized lamnid shark, is occasionally caught by longline vessels in certain regions of the tropical oceans worldwide. However, the population dynamics of this species, as well as the impact of fishing mortality on its stocks, are still unknown, with the crocodile shark currently one of the least studied of all pelagic sharks. Given this, the present study aimed to assess the population structure of P. kamoharai in several regions of the Atlantic and Indian Oceans using genetic molecular markers. The nucleotide composition of the mitochondrial DNA control region of 255 individuals was analyzed, and 31 haplotypes were found, with an estimated diversity Hd = 0.627, and a nucleotide diversity π = 0.00167. An analysis of molecular variance (AMOVA revealed a fixation index ΦST = -0.01118, representing an absence of population structure among the sampled regions of the Atlantic Ocean, and between the Atlantic and Indian Oceans. These results show a high degree of gene flow between the studied areas, with a single genetic stock and reduced population variability. In panmictic populations, conservation efforts can be concentrated in more restricted areas, being these representative of the total biodiversity of the species. When necessary, this strategy could be applied to the genetic maintenance of P. kamoharai.

  14. Specific binding of eukaryotic ORC to DNA replication origins depends on highly conserved basic residues.

    Science.gov (United States)

    Kawakami, Hironori; Ohashi, Eiji; Kanamoto, Shota; Tsurimoto, Toshiki; Katayama, Tsutomu

    2015-10-12

    In eukaryotes, the origin recognition complex (ORC) heterohexamer preferentially binds replication origins to trigger initiation of DNA replication. Crystallographic studies using eubacterial and archaeal ORC orthologs suggested that eukaryotic ORC may bind to origin DNA via putative winged-helix DNA-binding domains and AAA+ ATPase domains. However, the mechanisms how eukaryotic ORC recognizes origin DNA remain elusive. Here, we show in budding yeast that Lys-362 and Arg-367 residues of the largest subunit (Orc1), both outside the aforementioned domains, are crucial for specific binding of ORC to origin DNA. These basic residues, which reside in a putative disordered domain, were dispensable for interaction with ATP and non-specific DNA sequences, suggesting a specific role in recognition. Consistent with this, both residues were required for origin binding of Orc1 in vivo. A truncated Orc1 polypeptide containing these residues solely recognizes ARS sequence with low affinity and Arg-367 residue stimulates sequence specific binding mode of the polypeptide. Lys-362 and Arg-367 residues of Orc1 are highly conserved among eukaryotic ORCs, but not in eubacterial and archaeal orthologs, suggesting a eukaryote-specific mechanism underlying recognition of replication origins by ORC.

  15. Homoeologous chromosomes of Xenopus laevis are highly conserved after whole-genome duplication.

    Science.gov (United States)

    Uno, Y; Nishida, C; Takagi, C; Ueno, N; Matsuda, Y

    2013-11-01

    It has been suggested that whole-genome duplication (WGD) occurred twice during the evolutionary process of vertebrates around 450 and 500 million years ago, which contributed to an increase in the genomic and phenotypic complexities of vertebrates. However, little is still known about the evolutionary process of homoeologous chromosomes after WGD because many duplicate genes have been lost. Therefore, Xenopus laevis (2n=36) and Xenopus (Silurana) tropicalis (2n=20) are good animal models for studying the process of genomic and chromosomal reorganization after WGD because X. laevis is an allotetraploid species that resulted from WGD after the interspecific hybridization of diploid species closely related to X. tropicalis. We constructed a comparative cytogenetic map of X. laevis using 60 complimentary DNA clones that covered the entire chromosomal regions of 10 pairs of X. tropicalis chromosomes. We consequently identified all nine homoeologous chromosome groups of X. laevis. Hybridization signals on two pairs of X. laevis homoeologous chromosomes were detected for 50 of 60 (83%) genes, and the genetic linkage is highly conserved between X. tropicalis and X. laevis chromosomes except for one fusion and one inversion and also between X. laevis homoeologous chromosomes except for two inversions. These results indicate that the loss of duplicated genes and inter- and/or intrachromosomal rearrangements occurred much less frequently in this lineage, suggesting that these events were not essential for diploidization of the allotetraploid genome in X. laevis after WGD.

  16. A Highly Conserved Bacterial D-Serine Uptake System Links Host Metabolism and Virulence.

    Directory of Open Access Journals (Sweden)

    James P R Connolly

    2016-01-01

    Full Text Available The ability of any organism to sense and respond to challenges presented in the environment is critically important for promoting or restricting colonization of specific sites. Recent work has demonstrated that the host metabolite D-serine has the ability to markedly influence the outcome of infection by repressing the type III secretion system of enterohaemorrhagic Escherichia coli (EHEC in a concentration-dependent manner. However, exactly how EHEC monitors environmental D-serine is not understood. In this work, we have identified two highly conserved members of the E. coli core genome, encoding an inner membrane transporter and a transcriptional regulator, which collectively help to "sense" levels of D-serine by regulating its uptake from the environment and in turn influencing global gene expression. Both proteins are required for full expression of the type III secretion system and diversely regulated prophage-encoded effector proteins demonstrating an important infection-relevant adaptation of the core genome. We propose that this system acts as a key safety net, sampling the environment for this metabolite, thereby promoting colonization of EHEC to favorable sites within the host.

  17. High qualitative and quantitative conservation of alternative splicing in Caenorhabditis elegans and Caenorhabditis briggsae

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Irimia, Manuel; Mørk, Søren

    2007-01-01

    Alternative splicing (AS) is an important contributor to proteome diversity and is regarded as an explanatory factor for the relatively low number of human genes compared with less complex animals. To assess the evolutionary conservation of AS and its developmental regulation, we have investigated...... the qualitative and quantitative expression of 21 orthologous alternative splice events through the development of 2 nematode species separated by 85-110 Myr of evolutionary time. We demonstrate that most of these alternative splice events present in Caenorhabditis elegans are conserved in Caenorhabditis briggsae...... mechanisms controlling AS are to a large extent conserved during the evolution of Caenorhabditis. This strong conservation indicates that both major and minor splice forms have important functional roles and that the relative quantities in which they are expressed are crucial. Our results therefore suggest...

  18. Design of ecoregional monitoring in conservation areas of high-latitude ecosystems under contemporary climate change

    Science.gov (United States)

    Beever, Erik A.; Woodward, Andrea

    2011-01-01

    Land ownership in Alaska includes a mosaic of federally managed units. Within its agency’s context, each unit has its own management strategy, authority, and resources of conservation concern, many of which are migratory animals. Though some units are geographically isolated, many are nevertheless linked by paths of abiotic and biotic flows, such as rivers, air masses, flyways, and terrestrial and aquatic migration routes. Furthermore, individual land units exist within the context of a larger landscape pattern of shifting conditions, requiring managers to understand at larger spatial scales the status and trends in the synchrony and spatial concurrence of species and associated suitable habitats. Results of these changes will determine the ability of Alaska lands to continue to: provide habitat for local and migratory species; absorb species whose ranges are shifting northward; and experience mitigation or exacerbation of climate change through positive and negative atmospheric feedbacks. We discuss the geographic and statutory contexts that influence development of ecological monitoring; argue for the inclusion of significant amounts of broad-scale monitoring; discuss the importance of defining clear programmatic and monitoring objectives; and draw from lessons learned from existing long-term, broad-scale monitoring programs to apply to the specific contexts relevant to high-latitude protected areas such as those in Alaska. Such areas are distinguished by their: marked seasonality; relatively large magnitudes of contemporary change in climatic parameters; and relative inaccessibility due to broad spatial extent, very low (or zero) road density, and steep and glaciated areas. For ecological monitoring to effectively support management decisions in high-latitude areas such as Alaska, a monitoring program ideally would be structured to address the actual spatial and temporal scales of relevant processes, rather than the artificial boundaries of individual land

  19. High risks of losing genetic diversity in an endemic Mauritian gecko: implications for conservation.

    Science.gov (United States)

    Buckland, Steeves; Cole, Nik C; Groombridge, Jim J; Küpper, Clemens; Burke, Terry; Dawson, Deborah A; Gallagher, Laura E; Harris, Stephen

    2014-01-01

    Genetic structure can be a consequence of recent population fragmentation and isolation, or a remnant of historical localised adaptation. This poses a challenge for conservationists since misinterpreting patterns of genetic structure may lead to inappropriate management. Of 17 species of reptile originally found in Mauritius, only five survive on the main island. One of these, Phelsuma guimbeaui (lowland forest day gecko), is now restricted to 30 small isolated subpopulations following severe forest fragmentation and isolation due to human colonisation. We used 20 microsatellites in ten subpopulations and two mitochondrial DNA (mtDNA) markers in 13 subpopulations to: (i) assess genetic diversity, population structure and genetic differentiation of subpopulations; (ii) estimate effective population sizes and migration rates of subpopulations; and (iii) examine the phylogenetic relationships of haplotypes found in different subpopulations. Microsatellite data revealed significant population structure with high levels of genetic diversity and isolation by distance, substantial genetic differentiation and no migration between most subpopulations. MtDNA, however, showed no evidence of population structure, indicating that there was once a genetically panmictic population. Effective population sizes of ten subpopulations, based on microsatellite markers, were small, ranging from 44 to 167. Simulations suggested that the chance of survival and allelic diversity of some subpopulations will decrease dramatically over the next 50 years if no migration occurs. Our DNA-based evidence reveals an urgent need for a management plan for the conservation of P. guimbeaui. We identified 18 threatened and 12 viable subpopulations and discuss a range of management options that include translocation of threatened subpopulations to retain maximum allelic diversity, and habitat restoration and assisted migration to decrease genetic erosion and inbreeding for the viable subpopulations.

  20. High risks of losing genetic diversity in an endemic Mauritian gecko: implications for conservation.

    Directory of Open Access Journals (Sweden)

    Steeves Buckland

    Full Text Available Genetic structure can be a consequence of recent population fragmentation and isolation, or a remnant of historical localised adaptation. This poses a challenge for conservationists since misinterpreting patterns of genetic structure may lead to inappropriate management. Of 17 species of reptile originally found in Mauritius, only five survive on the main island. One of these, Phelsuma guimbeaui (lowland forest day gecko, is now restricted to 30 small isolated subpopulations following severe forest fragmentation and isolation due to human colonisation. We used 20 microsatellites in ten subpopulations and two mitochondrial DNA (mtDNA markers in 13 subpopulations to: (i assess genetic diversity, population structure and genetic differentiation of subpopulations; (ii estimate effective population sizes and migration rates of subpopulations; and (iii examine the phylogenetic relationships of haplotypes found in different subpopulations. Microsatellite data revealed significant population structure with high levels of genetic diversity and isolation by distance, substantial genetic differentiation and no migration between most subpopulations. MtDNA, however, showed no evidence of population structure, indicating that there was once a genetically panmictic population. Effective population sizes of ten subpopulations, based on microsatellite markers, were small, ranging from 44 to 167. Simulations suggested that the chance of survival and allelic diversity of some subpopulations will decrease dramatically over the next 50 years if no migration occurs. Our DNA-based evidence reveals an urgent need for a management plan for the conservation of P. guimbeaui. We identified 18 threatened and 12 viable subpopulations and discuss a range of management options that include translocation of threatened subpopulations to retain maximum allelic diversity, and habitat restoration and assisted migration to decrease genetic erosion and inbreeding for the viable

  1. A Highly Conserved Residue in HIV-1 Nef Alpha Helix 2 Modulates Protein Expression.

    Science.gov (United States)

    Johnson, Aaron L; Dirk, Brennan S; Coutu, Mathieu; Haeryfar, S M Mansour; Arts, Eric J; Finzi, Andrés; Dikeakos, Jimmy D

    2016-01-01

    Extensive genetic diversity is a defining characteristic of human immunodeficiency virus type 1 (HIV-1) and poses a significant barrier to the development of an effective vaccine. To better understand the impact of this genetic diversity on the HIV-1 pathogenic factor Nef, we compiled a panel of reference strains from the NIH Los Alamos HIV Database. Initial sequence analysis identified point mutations at Nef residues 13, 84, and 92 in subtype C reference strain C.BR92025 from Brazil. Functional analysis revealed impaired major histocompatibility complex class I and CD4 downregulation of strain C.BR92025 Nef, which corresponded to decreased protein expression. Metabolic labeling demonstrated that strain C.BR92025 Nef has a greater rate of protein turnover than subtype B reference strain B.JRFL that, on the basis of mutational analysis, is related to Nef residue A84. An alanine-to-valine substitution at position 84, located in alpha helix 2 of Nef, was sufficient to alter the rate of turnover of an otherwise highly expressed Nef protein. In conclusion, these findings highlight HIV-1 Nef residue A84 as a major determinant of protein expression that may offer an additional avenue to disrupt or mediate the effects of this key HIV-1 pathogenic factor. IMPORTANCE The HIV-1 Nef protein has been established as a key pathogenic determinant of HIV/AIDS, but there is little knowledge of how the extensive genetic diversity of HIV-1 affects Nef function. Upon compiling a set of subtype-specific reference strains, we identified a subtype C reference strain, C.BR92025, that contained natural polymorphisms at otherwise highly conserved residues 13, 84, and 92. Interestingly, strain C.BR92025 Nef displayed impaired Nef function and had decreased protein expression. We have demonstrated that strain C.BR92025 Nef has a higher rate of protein turnover than highly expressed Nef proteins and that this higher rate of protein turnover is due to an alanine-to-valine substitution at Nef

  2. High salt intake reprioritizes osmolyte and energy metabolism for body fluid conservation.

    Science.gov (United States)

    Kitada, Kento; Daub, Steffen; Zhang, Yahua; Klein, Janet D; Nakano, Daisuke; Pedchenko, Tetyana; Lantier, Louise; LaRocque, Lauren M; Marton, Adriana; Neubert, Patrick; Schröder, Agnes; Rakova, Natalia; Jantsch, Jonathan; Dikalova, Anna E; Dikalov, Sergey I; Harrison, David G; Müller, Dominik N; Nishiyama, Akira; Rauh, Manfred; Harris, Raymond C; Luft, Friedrich C; Wassermann, David H; Sands, Jeff M; Titze, Jens

    2017-05-01

    Natriuretic regulation of extracellular fluid volume homeostasis includes suppression of the renin-angiotensin-aldosterone system, pressure natriuresis, and reduced renal nerve activity, actions that concomitantly increase urinary Na+ excretion and lead to increased urine volume. The resulting natriuresis-driven diuretic water loss is assumed to control the extracellular volume. Here, we have demonstrated that urine concentration, and therefore regulation of water conservation, is an important control system for urine formation and extracellular volume homeostasis in mice and humans across various levels of salt intake. We observed that the renal concentration mechanism couples natriuresis with correspondent renal water reabsorption, limits natriuretic osmotic diuresis, and results in concurrent extracellular volume conservation and concentration of salt excreted into urine. This water-conserving mechanism of dietary salt excretion relies on urea transporter-driven urea recycling by the kidneys and on urea production by liver and skeletal muscle. The energy-intense nature of hepatic and extrahepatic urea osmolyte production for renal water conservation requires reprioritization of energy and substrate metabolism in liver and skeletal muscle, resulting in hepatic ketogenesis and glucocorticoid-driven muscle catabolism, which are prevented by increasing food intake. This natriuretic-ureotelic, water-conserving principle relies on metabolism-driven extracellular volume control and is regulated by concerted liver, muscle, and renal actions.

  3. High-frequency ultrasound for intraoperative margin assessments in breast conservation surgery: a feasibility study

    Directory of Open Access Journals (Sweden)

    Hart Vern P

    2011-10-01

    Full Text Available Abstract Background In addition to breast imaging, ultrasound offers the potential for characterizing and distinguishing between benign and malignant breast tissues due to their different microstructures and material properties. The aim of this study was to determine if high-frequency ultrasound (20-80 MHz can provide pathology sensitive measurements for the ex vivo detection of cancer in margins during breast conservation surgery. Methods Ultrasonic tests were performed on resected margins and other tissues obtained from 17 patients, resulting in 34 specimens that were classified into 15 pathology categories. Pulse-echo and through-transmission measurements were acquired from a total of 57 sites on the specimens using two single-element 50-MHz transducers. Ultrasonic attenuation and sound speed were obtained from time-domain waveforms. The waveforms were further processed with fast Fourier transforms to provide ultrasonic spectra and cepstra. The ultrasonic measurements and pathology types were analyzed for correlations. The specimens were additionally re-classified into five pathology types to determine specificity and sensitivity values. Results The density of peaks in the ultrasonic spectra, a measure of spectral structure, showed significantly higher values for carcinomas and precancerous pathologies such as atypical ductal hyperplasia than for normal tissue. The slopes of the cepstra for non-malignant pathologies displayed significantly greater values that differentiated them from the normal and malignant tissues. The attenuation coefficients were sensitive to fat necrosis, fibroadenoma, and invasive lobular carcinoma. Specificities and sensitivities for differentiating pathologies from normal tissue were 100% and 86% for lobular carcinomas, 100% and 74% for ductal carcinomas, 80% and 82% for benign pathologies, and 80% and 100% for fat necrosis and adenomas. Specificities and sensitivities were also determined for differentiating each

  4. Gene co-regulation is highly conserved in the evolution of eukaryotes and prokaryotes.

    NARCIS (Netherlands)

    Snel, B.; Noort, V. van; Huynen, M.A.

    2004-01-01

    Differences between species have been suggested to largely reside in the network of connections among the genes. Nevertheless, the rate at which these connections evolve has not been properly quantified. Here, we measure the extent to which co-regulation between pairs of genes is conserved over

  5. Conservation hotspots for the turtles on the high seas of the Atlantic Ocean.

    Science.gov (United States)

    Huang, Hsiang-Wen

    2015-01-01

    Understanding the distribution of bycaught sea turtles could inform conservation strategies and priorities. This research analyses the distribution of turtles caught as longline fisheries bycatch on the high seas of the Atlantic Ocean. This research collected 18,142 bycatch observations and 47.1 million hooks from large-scale Taiwanese longline vessels in the Atlantic Ocean from June 2002 to December 2013. The coverage rates were ranged from 0.48% to 17.54% by year. Seven hundred and sixty-seven turtles were caught, and the major species were leatherback (59.8%), olive ridley (27.1%) and loggerhead turtles (8.7%). Most olive ridley (81.7%) and loggerhead (82.1%) turtles were hooked, while the leatherbacks were both hooked (44.0%) and entangled (31.8%). Depending on the species, 21.4% to 57.7% were dead when brought onboard. Most of the turtles were caught in tropical areas, especially in the Gulf of Guinea (15°N-10°S, 30°W-10°E), but loggerheads were caught in the south Atlantic Ocean (25°S-35°S, 40°W-10°E and 30°S-40°S, 55°W-45°W). The bycatch rate was the highest at 0.030 per 1000 hooks for leatherbacks in the tropical area. The bycatch rates of olive ridley ranged from 0 to 0.010 per thousand hooks. The loggerhead bycatch rates were higher in the northern and southern Atlantic Ocean and ranged from 0.0128 to 0.0239 per thousand hooks. Due to the characteristics of the Taiwanese deep-set longline fleet, bycatch rates were lower than those of coastal longline fisheries, but mortality rates were higher because of the long hours of operation. Gear and bait modification should be considered to reduce sea turtle bycatch and increase survival rates while reducing the use of shallow hooks would also be helpful.

  6. Conservation hotspots for the turtles on the high seas of the Atlantic Ocean.

    Directory of Open Access Journals (Sweden)

    Hsiang-Wen Huang

    Full Text Available Understanding the distribution of bycaught sea turtles could inform conservation strategies and priorities. This research analyses the distribution of turtles caught as longline fisheries bycatch on the high seas of the Atlantic Ocean. This research collected 18,142 bycatch observations and 47.1 million hooks from large-scale Taiwanese longline vessels in the Atlantic Ocean from June 2002 to December 2013. The coverage rates were ranged from 0.48% to 17.54% by year. Seven hundred and sixty-seven turtles were caught, and the major species were leatherback (59.8%, olive ridley (27.1% and loggerhead turtles (8.7%. Most olive ridley (81.7% and loggerhead (82.1% turtles were hooked, while the leatherbacks were both hooked (44.0% and entangled (31.8%. Depending on the species, 21.4% to 57.7% were dead when brought onboard. Most of the turtles were caught in tropical areas, especially in the Gulf of Guinea (15°N-10°S, 30°W-10°E, but loggerheads were caught in the south Atlantic Ocean (25°S-35°S, 40°W-10°E and 30°S-40°S, 55°W-45°W. The bycatch rate was the highest at 0.030 per 1000 hooks for leatherbacks in the tropical area. The bycatch rates of olive ridley ranged from 0 to 0.010 per thousand hooks. The loggerhead bycatch rates were higher in the northern and southern Atlantic Ocean and ranged from 0.0128 to 0.0239 per thousand hooks. Due to the characteristics of the Taiwanese deep-set longline fleet, bycatch rates were lower than those of coastal longline fisheries, but mortality rates were higher because of the long hours of operation. Gear and bait modification should be considered to reduce sea turtle bycatch and increase survival rates while reducing the use of shallow hooks would also be helpful.

  7. Applications of very high-resolution imagery in the study and conservation of large predators in the Southern Ocean.

    Science.gov (United States)

    Larue, Michelle A; Knight, Joseph

    2014-12-01

    The Southern Ocean is one of the most rapidly changing ecosystems on the planet due to the effects of climate change and commercial fishing for ecologically important krill and fish. Because sea ice loss is expected to be accompanied by declines in krill and fish predators, decoupling the effects of climate and anthropogenic changes on these predator populations is crucial for ecosystem-based management of the Southern Ocean. We reviewed research published from 2007 to 2014 that incorporated very high-resolution satellite imagery to assess distribution, abundance, and effects of climate and other anthropogenic changes on populations of predators in polar regions. Very high-resolution imagery has been used to study 7 species of polar animals in 13 papers, many of which provide methods through which further research can be conducted. Use of very high-resolution imagery in the Southern Ocean can provide a broader understanding of climate and anthropogenic forces on populations and inform management and conservation recommendations. We recommend that conservation biologists continue to integrate high-resolution remote sensing into broad-scale biodiversity and population studies in remote areas, where it can provide much needed detail. © 2014 Society for Conservation Biology.

  8. High-Quality 3d Models and Their Use in a Cultural Heritage Conservation Project

    Science.gov (United States)

    Tucci, G.; Bonora, V.; Conti, A.; Fiorini, L.

    2017-08-01

    Cultural heritage digitization and 3D modelling processes are mainly based on laser scanning and digital photogrammetry techniques to produce complete, detailed and photorealistic three-dimensional surveys: geometric as well as chromatic aspects, in turn testimony of materials, work techniques, state of preservation, etc., are documented using digitization processes. The paper explores the topic of 3D documentation for conservation purposes; it analyses how geomatics contributes in different steps of a restoration process and it presents an overview of different uses of 3D models for the conservation and enhancement of the cultural heritage. The paper reports on the project to digitize the earthenware frieze of the Ospedale del Ceppo in Pistoia (Italy) for 3D documentation, restoration work support, and digital and physical reconstruction and integration purposes. The intent to design an exhibition area suggests new ways to take advantage of 3D data originally acquired for documentation and scientific purposes.

  9. Further progress on defining highly conserved immunogenic epitopes for a global HIV vaccine

    DEFF Research Database (Denmark)

    De Groot, Anne S; Levitz, Lauren; Ardito, Matthew T

    2012-01-01

    of global HIV evolution. Twenty-seven HLA-A3 epitopes were chosen from an analysis performed in 2003 on 10,803 HIV-1 sequences, and additional sequences were selected in 2009 based on an expanded set of 43,822 sequences. These epitopes were tested in vitro for HLA binding and for immunogenicity with PBMCs......Two major obstacles confronting HIV vaccine design have been the extensive viral diversity of HIV-1 globally and viral evolution driven by escape from CD8(+) cytotoxic T-cell lymphocyte (CTL)-mediated immune pressure. Regions of the viral genome that are not able to escape immune response...... and that are conserved in sequence and across time may represent the "Achilles' heel" of HIV and would be excellent candidates for vaccine development. In this study, T-cell epitopes were selected using immunoinformatics tools, combining HLA-A3 binding predictions with relative sequence conservation in the context...

  10. High Resolution Mapping of Soils and Landforms for the Desert Renewable Energy Conservation Plan (DRECP)

    Science.gov (United States)

    Potter, Christopher S.; Li, Shuang

    2014-01-01

    The Desert Renewable Energy Conservation Plan (DRECP), a major component of California's renewable energy planning efforts, is intended to provide effective protection and conservation of desert ecosystems, while allowing for the sensible development of renewable energy projects. This NASA mapping report was developed to support the DRECP and the Bureau of Land Management (BLM). We outline in this document remote sensing image processing methods to deliver new maps of biological soils crusts, sand dune movements, desert pavements, and sub-surface water sources across the DRECP area. We focused data processing first on the largely unmapped areas most likely to be used for energy developments, such as those within Renewable Energy Study Areas (RESA) and Solar Energy Zones (SEZs). We used imagery (multispectral and radar) mainly from the years 2009-2011.

  11. Comparative Public Support for Conserving Reptile Species is High: Australian Evidence and its Implications

    OpenAIRE

    Tisdell, Clement A.; Wilson, Clevo; Swarna Nantha, Hemanath

    2004-01-01

    This paper investigates factors influencing the public’s support for conservation of tropical reptile species in a focal group drawing on Australian data and an experiment involving a sample of the Australian public. The influences of the likeability of the species, their degree of endangerment, ethical considerations as well as knowledge are examined and found to be important. Likeability is found to be much less important than the existing literature suggests. This is highlighted by compari...

  12. Adaptive evolution of conserved noncoding elements in mammals.

    Directory of Open Access Journals (Sweden)

    Su Yeon Kim

    2007-09-01

    Full Text Available Conserved noncoding elements (CNCs are an abundant feature of vertebrate genomes. Some CNCs have been shown to act as cis-regulatory modules, but the function of most CNCs remains unclear. To study the evolution of CNCs, we have developed a statistical method called the "shared rates test" to identify CNCs that show significant variation in substitution rates across branches of a phylogenetic tree. We report an application of this method to alignments of 98,910 CNCs from the human, chimpanzee, dog, mouse, and rat genomes. We find that approximately 68% of CNCs evolve according to a null model where, for each CNC, a single parameter models the level of constraint acting throughout the phylogeny linking these five species. The remaining approximately 32% of CNCs show departures from the basic model including speed-ups and slow-downs on particular branches and occasionally multiple rate changes on different branches. We find that a subset of the significant CNCs have evolved significantly faster than the local neutral rate on a particular branch, providing strong evidence for adaptive evolution in these CNCs. The distribution of these signals on the phylogeny suggests that adaptive evolution of CNCs occurs in occasional short bursts of evolution. Our analyses suggest a large set of promising targets for future functional studies of adaptation.

  13. Calcified plaque resorptive status as determined by high-resolution ultrasound is predictive of successful conservative management of calcific tendinosis.

    Science.gov (United States)

    Lin, Chien-Hung; Chao, Hai-Lun; Chiou, Hong-Jen

    2012-08-01

    In patients with calcific tendinosis, the morphology of calcified plaques is associated with response to conservative management. We aimed to determine changes in pain and morphology of plaques in patients with calcific tendinosis and non-arc-shaped plaques identified by high-resolution ultrasonography who received only conservative treatment. A total of 33 patients with a mean age of 63.3±10.3 years were included. Pain scores at the time of first and follow-up ultrasound were recorded, and the degree of plaque resolution was calculated. At follow-up, 90.9% (30 of 33) of patients reported improvement in pain, and 84.8% (28 of 33) patient had more than 50% elimination of plaques. Most of increased vascularity observed in color Doppler ultrasonography during 1st visit disappeared at follow-up. In patients with calcific tendinosis, non-arc-shaped plaques determined by high-resolution ultrasonography are likely to resolve and conservative management is warranted. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  14. Calcified plaque resorptive status as determined by high-resolution ultrasound is predictive of successful conservative management of calcific tendinosis

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Hung [Department of Diagnostic Radiology, Chi-Mei Medical Center, Yung Kang City, Tainan, Taiwan (China); Department of Health Care Administration, Chung-Hwa University of Medical Technology, Tainan, Taiwan (China); Chao, Hai-Lun [Department of Health Care Administration, Chung-Hwa University of Medical Technology, Tainan, Taiwan (China); Chiou, Hong-Jen, E-mail: hjchiou@vghtpe.gov.tw [Department of Radiology, Taipei Veterans General Hospital, National Yang Ming University, School of Medicine, and National Defense Medical Center, No. 201, Sec. 2, Shih-Pai Rd., Taipei 11217, Taiwan (China)

    2012-08-15

    Objective: In patients with calcific tendinosis, the morphology of calcified plaques is associated with response to conservative management. We aimed to determine changes in pain and morphology of plaques in patients with calcific tendinosis and non-arc-shaped plaques identified by high-resolution ultrasonography who received only conservative treatment. Methods: A total of 33 patients with a mean age of 63.3 {+-} 10.3 years were included. Pain scores at the time of first and follow-up ultrasound were recorded, and the degree of plaque resolution was calculated. Results: At follow-up, 90.9% (30 of 33) of patients reported improvement in pain, and 84.8% (28 of 33) patient had more than 50% elimination of plaques. Most of increased vascularity observed in color Doppler ultrasonography during 1st visit disappeared at follow-up. Conclusions: In patients with calcific tendinosis, non-arc-shaped plaques determined by high-resolution ultrasonography are likely to resolve and conservative management is warranted.

  15. Structure Analysis Uncovers a Highly Diverse but Structurally Conserved Effector Family in Phytopathogenic Fungi.

    Science.gov (United States)

    de Guillen, Karine; Ortiz-Vallejo, Diana; Gracy, Jérome; Fournier, Elisabeth; Kroj, Thomas; Padilla, André

    2015-10-01

    Phytopathogenic ascomycete fungi possess huge effector repertoires that are dominated by hundreds of sequence-unrelated small secreted proteins. The molecular function of these effectors and the evolutionary mechanisms that generate this tremendous number of singleton genes are largely unknown. To get a deeper understanding of fungal effectors, we determined by NMR spectroscopy the 3-dimensional structures of the Magnaporthe oryzae effectors AVR1-CO39 and AVR-Pia. Despite a lack of sequence similarity, both proteins have very similar 6 β-sandwich structures that are stabilized in both cases by a disulfide bridge between 2 conserved cysteins located in similar positions of the proteins. Structural similarity searches revealed that AvrPiz-t, another effector from M. oryzae, and ToxB, an effector of the wheat tan spot pathogen Pyrenophora tritici-repentis have the same structures suggesting the existence of a family of sequence-unrelated but structurally conserved fungal effectors that we named MAX-effectors (Magnaporthe Avrs and ToxB like). Structure-informed pattern searches strengthened this hypothesis by identifying MAX-effector candidates in a broad range of ascomycete phytopathogens. Strong expansion of the MAX-effector family was detected in M. oryzae and M. grisea where they seem to be particularly important since they account for 5-10% of the effector repertoire and 50% of the cloned avirulence effectors. Expression analysis indicated that the majority of M. oryzae MAX-effectors are expressed specifically during early infection suggesting important functions during biotrophic host colonization. We hypothesize that the scenario observed for MAX-effectors can serve as a paradigm for ascomycete effector diversity and that the enormous number of sequence-unrelated ascomycete effectors may in fact belong to a restricted set of structurally conserved effector families.

  16. NFAT5 regulates HIV-1 in primary monocytes via a highly conserved long terminal repeat site.

    Directory of Open Access Journals (Sweden)

    Shahin Ranjbar

    2006-12-01

    Full Text Available To replicate, HIV-1 capitalizes on endogenous cellular activation pathways resulting in recruitment of key host transcription factors to its viral enhancer. RNA interference has been a powerful tool for blocking key checkpoints in HIV-1 entry into cells. Here we apply RNA interference to HIV-1 transcription in primary macrophages, a major reservoir of the virus, and specifically target the transcription factor NFAT5 (nuclear factor of activated T cells 5, which is the most evolutionarily divergent NFAT protein. By molecularly cloning and sequencing isolates from multiple viral subtypes, and performing DNase I footprinting, electrophoretic mobility shift, and promoter mutagenesis transfection assays, we demonstrate that NFAT5 functionally interacts with a specific enhancer binding site conserved in HIV-1, HIV-2, and multiple simian immunodeficiency viruses. Using small interfering RNA to ablate expression of endogenous NFAT5 protein, we show that the replication of three major HIV-1 viral subtypes (B, C, and E is dependent upon NFAT5 in human primary differentiated macrophages. Our results define a novel host factor-viral enhancer interaction that reveals a new regulatory role for NFAT5 and defines a functional DNA motif conserved across HIV-1 subtypes and representative simian immunodeficiency viruses. Inhibition of the NFAT5-LTR interaction may thus present a novel therapeutic target to suppress HIV-1 replication and progression of AIDS.

  17. Universal antibodies against the highly conserved influenza fusion peptide cross-neutralize several subtypes of influenza A virus

    Energy Technology Data Exchange (ETDEWEB)

    Hashem, Anwar M. [Centre for Vaccine Evaluation, Biologics and Genetic Therapies Directorate, HPFB, Health Canada, Ottawa, ON (Canada); Department of Microbiology, Faculty of Medicine, King Abdulaziz University, Jeddah (Saudi Arabia); Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON (Canada); Van Domselaar, Gary [National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB (Canada); Li, Changgui; Wang, Junzhi [National Institute for the Control of Pharmaceutical and Biological Products, Beijing (China); She, Yi-Min; Cyr, Terry D. [Centre for Vaccine Evaluation, Biologics and Genetic Therapies Directorate, HPFB, Health Canada, Ottawa, ON (Canada); Sui, Jianhua [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Department of Medicine, Harvard Medical School, 44 Binney Street, Boston, MA 02115 (United States); He, Runtao [National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB (Canada); Marasco, Wayne A. [Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Department of Medicine, Harvard Medical School, 44 Binney Street, Boston, MA 02115 (United States); Li, Xuguang, E-mail: Sean.Li@hc-sc.gc.ca [Centre for Vaccine Evaluation, Biologics and Genetic Therapies Directorate, HPFB, Health Canada, Ottawa, ON (Canada); Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON (Canada)

    2010-12-10

    Research highlights: {yields} The fusion peptide is the only universally conserved epitope in all influenza viral hemagglutinins. {yields} Anti-fusion peptide antibodies are universal antibodies that cross-react with all influenza HA subtypes. {yields} The universal antibodies cross-neutralize different influenza A subtypes. {yields} The universal antibodies inhibit the fusion process between the viruses and the target cells. -- Abstract: The fusion peptide of influenza viral hemagglutinin plays a critical role in virus entry by facilitating membrane fusion between the virus and target cells. As the fusion peptide is the only universally conserved epitope in all influenza A and B viruses, it could be an attractive target for vaccine-induced immune responses. We previously reported that antibodies targeting the first 14 amino acids of the N-terminus of the fusion peptide could bind to virtually all influenza virus strains and quantify hemagglutinins in vaccines produced in embryonated eggs. Here we demonstrate that these universal antibodies bind to the viral hemagglutinins in native conformation presented in infected mammalian cell cultures and neutralize multiple subtypes of virus by inhibiting the pH-dependant fusion of viral and cellular membranes. These results suggest that this unique, highly-conserved linear sequence in viral hemagglutinin is exposed sufficiently to be attacked by the antibodies during the course of infection and merits further investigation because of potential importance in the protection against diverse strains of influenza viruses.

  18. Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies.

    Directory of Open Access Journals (Sweden)

    Shuxiao Zhang

    2015-07-01

    Full Text Available Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes.

  19. Highly conserved gene order and numerous novel repetitive elements in genomic regions linked to wing pattern variation in Heliconius butterflies

    Directory of Open Access Journals (Sweden)

    Halder Georg

    2008-07-01

    Full Text Available Abstract Background With over 20 parapatric races differing in their warningly colored wing patterns, the butterfly Heliconius erato provides a fascinating example of an adaptive radiation. Together with matching races of its co-mimic Heliconius melpomene, H. erato also represents a textbook case of Müllerian mimicry, a phenomenon where common warning signals are shared amongst noxious organisms. It is of great interest to identify the specific genes that control the mimetic wing patterns of H. erato and H. melpomene. To this end we have undertaken comparative mapping and targeted genomic sequencing in both species. This paper reports on a comparative analysis of genomic sequences linked to color pattern mimicry genes in Heliconius. Results Scoring AFLP polymorphisms in H. erato broods allowed us to survey loci at approximately 362 kb intervals across the genome. With this strategy we were able to identify markers tightly linked to two color pattern genes: D and Cr, which were then used to screen H. erato BAC libraries in order to identify clones for sequencing. Gene density across 600 kb of BAC sequences appeared relatively low, although the number of predicted open reading frames was typical for an insect. We focused analyses on the D- and Cr-linked H. erato BAC sequences and on the Yb-linked H. melpomene BAC sequence. A comparative analysis between homologous regions of H. erato (Cr-linked BAC and H. melpomene (Yb-linked BAC revealed high levels of sequence conservation and microsynteny between the two species. We found that repeated elements constitute 26% and 20% of BAC sequences from H. erato and H. melpomene respectively. The majority of these repetitive sequences appear to be novel, as they showed no significant similarity to any other available insect sequences. We also observed signs of fine scale conservation of gene order between Heliconius and the moth Bombyx mori, suggesting that lepidopteran genome architecture may be conserved

  20. CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

    Science.gov (United States)

    Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

    2012-07-01

    Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

  1. On optimal control problem for conservation law modelling one class of highly re-entrant production systems

    Science.gov (United States)

    D'Apice, Ciro; Kogut, Peter I.

    2017-07-01

    We discuss the optimal control problem stated as the minimization in the L2-sense of the mismatch between the actual out-flux and a demand forecast for a hyperbolic conservation law that models a highly re-entrant production system. The output of the factory is described as a function of the work in progress and the position of the so-called push-pull point (PPP) where we separate the beginning of the factory employing a push policy from the end of the factory, which uses a pull policy.

  2. Hearing sensitivity in context: Conservation implications for a highly vocal endangered species

    Directory of Open Access Journals (Sweden)

    Megan A. Owen

    2016-04-01

    Full Text Available Hearing sensitivity is a fundamental determinant of a species’ vulnerability to anthropogenic noise, however little is known about the hearing capacities of most conservation dependent species. When audiometric data are integrated with other aspects of species’ acoustic ecology, life history, and characteristic habitat topography and soundscape, predictions can be made regarding probable vulnerability to the negative impacts of different types of anthropogenic noise. Here we used an adaptive psychoacoustic technique to measure hearing thresholds in the endangered giant panda; a species that uses acoustic communication to coordinate reproduction. Our results suggest that giant pandas have functional hearing into the ultrasonic range, with good sensitivity between 10.0 and 16.0 kHz, and best sensitivity measured at 12.5–14.0 kHz. We estimated the lower and upper limits of functional hearing as 0.10 and 70.0 kHz respectively. While these results suggest that panda hearing is similar to that of some other terrestrial carnivores, panda hearing thresholds above 14.0 kHz were significantly lower (i.e., more sensitive than those of the polar bear, the only other bear species for which data are available. We discuss the implications of this divergence, as well as the relationship between hearing sensitivity and the spectral parameters of panda vocalizations. We suggest that these data, placed in context, can be used towards the development of a sensory-based model of noise disturbance for the species.

  3. The highly conserved KEOPS/EKC complex is essential for a universal tRNA modification, t6A.

    Science.gov (United States)

    Srinivasan, Madhusudhan; Mehta, Preeti; Yu, Yao; Prugar, Evelyn; Koonin, Eugene V; Karzai, A Wali; Sternglanz, Rolf

    2011-03-02

    The highly conserved Kinase, Endopeptidase and Other Proteins of small Size (KEOPS)/Endopeptidase-like and Kinase associated to transcribed Chromatin (EKC) protein complex has been implicated in transcription, telomere maintenance and chromosome segregation, but its exact function remains unknown. The complex consists of five proteins, Kinase-Associated Endopeptidase (Kae1), a highly conserved protein present in bacteria, archaea and eukaryotes, a kinase (Bud32) and three additional small polypeptides. We showed that the complex is required for a universal tRNA modification, threonyl carbamoyl adenosine (t6A), found in all tRNAs that pair with ANN codons in mRNA. We also showed that the bacterial ortholog of Kae1, YgjD, is required for t6A modification of Escherichia coli tRNAs. The ATPase activity of Kae1 and the kinase activity of Bud32 are required for the modification. The yeast protein Sua5 has been reported previously to be required for t6A synthesis. Using yeast extracts, we established an in vitro system for the synthesis of t6A that requires Sua5, Kae1, threonine, bicarbonate and ATP. It remains to be determined whether all reported defects of KEOPS/EKC mutants can be attributed to the lack of t6A, or whether the complex has multiple functions.

  4. Mechanisms regulating GLUT4 transcription in skeletal muscle cells are highly conserved across vertebrates.

    Directory of Open Access Journals (Sweden)

    Rubén Marín-Juez

    Full Text Available The glucose transporter 4 (GLUT4 plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes, and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates.

  5. Mechanisms Regulating GLUT4 Transcription in Skeletal Muscle Cells Are Highly Conserved across Vertebrates

    Science.gov (United States)

    Marín-Juez, Rubén; Diaz, Mónica; Morata, Jordi; Planas, Josep V.

    2013-01-01

    The glucose transporter 4 (GLUT4) plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes), and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates. PMID:24260440

  6. Identification and characterization of novel and conserved microRNAs in radish (Raphanus sativus L.) using high-throughput sequencing.

    Science.gov (United States)

    Xu, Liang; Wang, Yan; Xu, Yuanyuan; Wang, Liangju; Zhai, Lulu; Zhu, Xianwen; Gong, Yiqin; Ye, Shan; Liu, Liwang

    2013-03-01

    MicroRNAs (miRNAs) are endogenous, non-coding, small RNAs that play significant regulatory roles in plant growth, development, and biotic and abiotic stress responses. To date, a great number of conserved and species-specific miRNAs have been identified in many important plant species such as Arabidopsis, rice and poplar. However, little is known about identification of miRNAs and their target genes in radish (Raphanus sativus L.). In the present study, a small RNA library from radish root was constructed and sequenced using the high-throughput Solexa sequencing. Through sequence alignment and secondary structure prediction, a total of 545 conserved miRNA families as well as 15 novel (with their miRNA* strand) and 64 potentially novel miRNAs were identified. Quantitative real-time PCR (qRT-PCR) analysis confirmed that both conserved and novel miRNAs were expressed in radish, and some of them were preferentially expressed in certain tissues. A total of 196 potential target genes were predicted for 42 novel radish miRNAs. Gene ontology (GO) analysis showed that most of the targets were involved in plant growth, development, metabolism and stress responses. This study represents a first large-scale identification and characterization of radish miRNAs and their potential target genes. These results could lead to the further identification of radish miRNAs and enhance our understanding of radish miRNA regulatory mechanisms in diverse biological and metabolic processes. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Conservative Management of Cesarean Scar Ectopic Pregnancy with Fetal Heart Activity and a Very High β-hCG.

    Science.gov (United States)

    McLaren, Rodney; McCalla, Sandra; Irani, Mohamad

    2015-01-01

    Cesarean scar ectopic pregnancy (CSP) is a rare type of ectopic pregnancy that is growing in incidence. The diagnosis of most CSP occurs when patients present in unstable conditions requiring surgical management and leading sometimes to hysterectomy. It has been shown that medical management is a safe option for early diagnosed hemodynamically stable CSP. However, no cases of CSP with β-hCG higher than 62,000 IU/L, conservatively treated, have been reported. We report the case of a 29-year-old patient who presented for her first prenatal visit at 13-week gestation and was diagnosed with CSP with present fetal heart tones and a quantitative β-hCG of 144,337 IU/L. She was treated with bilateral uterine artery embolization and systemic methotrexate. Her β-hCG significantly decreased and became undetectable within 10 weeks. We propose that patients with CSP with very high β-hCG and fetal heart activity can be offered conservative or fertility preserving management.

  8. Conservative Management of Cesarean Scar Ectopic Pregnancy with Fetal Heart Activity and a Very High β-hCG

    Directory of Open Access Journals (Sweden)

    Rodney McLaren

    2015-01-01

    Full Text Available Cesarean scar ectopic pregnancy (CSP is a rare type of ectopic pregnancy that is growing in incidence. The diagnosis of most CSP occurs when patients present in unstable conditions requiring surgical management and leading sometimes to hysterectomy. It has been shown that medical management is a safe option for early diagnosed hemodynamically stable CSP. However, no cases of CSP with β-hCG higher than 62,000 IU/L, conservatively treated, have been reported. We report the case of a 29-year-old patient who presented for her first prenatal visit at 13-week gestation and was diagnosed with CSP with present fetal heart tones and a quantitative β-hCG of 144,337 IU/L. She was treated with bilateral uterine artery embolization and systemic methotrexate. Her β-hCG significantly decreased and became undetectable within 10 weeks. We propose that patients with CSP with very high β-hCG and fetal heart activity can be offered conservative or fertility preserving management.

  9. Identification of a highly conserved valine-glycine-phenylalanine amino acid triplet required for HIV-1 Nef function

    Directory of Open Access Journals (Sweden)

    Meuwissen Pieter J

    2012-04-01

    Full Text Available Abstract Background The Nef protein of HIV facilitates virus replication and disease progression in infected patients. This role as pathogenesis factor depends on several genetically separable Nef functions that are mediated by interactions of highly conserved protein-protein interaction motifs with different host cell proteins. By studying the functionality of a series of nef alleles from clinical isolates, we identified a dysfunctional HIV group O Nef in which a highly conserved valine-glycine-phenylalanine (VGF region, which links a preceding acidic cluster with the following proline-rich motif into an amphipathic surface was deleted. In this study, we aimed to study the functional importance of this VGF region. Results The dysfunctional HIV group O8 nef allele was restored to the consensus sequence, and mutants of canonical (NL4.3, NA-7, SF2 and non-canonical (B2 and C1422 HIV-1 group M nef alleles were generated in which the amino acids of the VGF region were changed into alanines (VGF→AAA and tested for their capacity to interfere with surface receptor trafficking, signal transduction and enhancement of viral replication and infectivity. We found the VGF motif, and each individual amino acid of this motif, to be critical for downregulation of MHC-I and CXCR4. Moreover, Nef’s association with the cellular p21-activated kinase 2 (PAK2, the resulting deregulation of cofilin and inhibition of host cell actin remodeling, and targeting of Lck kinase to the trans-golgi-network (TGN were affected as well. Of particular interest, VGF integrity was essential for Nef-mediated enhancement of HIV virion infectivity and HIV replication in peripheral blood lymphocytes. For targeting of Lck kinase to the TGN and viral infectivity, especially the phenylalanine of the triplet was essential. At the molecular level, the VGF motif was required for the physical interaction of the adjacent proline-rich motif with Hck. Conclusion Based on these findings, we

  10. Ancient exaptation of a CORE-SINE retroposon into a highly conserved mammalian neuronal enhancer of the proopiomelanocortin gene.

    Directory of Open Access Journals (Sweden)

    Andrea M Santangelo

    2007-10-01

    Full Text Available The proopiomelanocortin gene (POMC is expressed in the pituitary gland and the ventral hypothalamus of all jawed vertebrates, producing several bioactive peptides that function as peripheral hormones or central neuropeptides, respectively. We have recently determined that mouse and human POMC expression in the hypothalamus is conferred by the action of two 5' distal and unrelated enhancers, nPE1 and nPE2. To investigate the evolutionary origin of the neuronal enhancer nPE2, we searched available vertebrate genome databases and determined that nPE2 is a highly conserved element in placentals, marsupials, and monotremes, whereas it is absent in nonmammalian vertebrates. Following an in silico paleogenomic strategy based on genome-wide searches for paralog sequences, we discovered that opossum and wallaby nPE2 sequences are highly similar to members of the superfamily of CORE-short interspersed nucleotide element (SINE retroposons, in particular to MAR1 retroposons that are widely present in marsupial genomes. Thus, the neuronal enhancer nPE2 originated from the exaptation of a CORE-SINE retroposon in the lineage leading to mammals and remained under purifying selection in all mammalian orders for the last 170 million years. Expression studies performed in transgenic mice showed that two nonadjacent nPE2 subregions are essential to drive reporter gene expression into POMC hypothalamic neurons, providing the first functional example of an exapted enhancer derived from an ancient CORE-SINE retroposon. In addition, we found that this CORE-SINE family of retroposons is likely to still be active in American and Australian marsupial genomes and that several highly conserved exonic, intronic and intergenic sequences in the human genome originated from the exaptation of CORE-SINE retroposons. Together, our results provide clear evidence of the functional novelties that transposed elements contributed to their host genomes throughout evolution.

  11. Ancient exaptation of a CORE-SINE retroposon into a highly conserved mammalian neuronal enhancer of the proopiomelanocortin gene.

    Science.gov (United States)

    Santangelo, Andrea M; de Souza, Flávio S J; Franchini, Lucía F; Bumaschny, Viviana F; Low, Malcolm J; Rubinstein, Marcelo

    2007-10-01

    The proopiomelanocortin gene (POMC) is expressed in the pituitary gland and the ventral hypothalamus of all jawed vertebrates, producing several bioactive peptides that function as peripheral hormones or central neuropeptides, respectively. We have recently determined that mouse and human POMC expression in the hypothalamus is conferred by the action of two 5' distal and unrelated enhancers, nPE1 and nPE2. To investigate the evolutionary origin of the neuronal enhancer nPE2, we searched available vertebrate genome databases and determined that nPE2 is a highly conserved element in placentals, marsupials, and monotremes, whereas it is absent in nonmammalian vertebrates. Following an in silico paleogenomic strategy based on genome-wide searches for paralog sequences, we discovered that opossum and wallaby nPE2 sequences are highly similar to members of the superfamily of CORE-short interspersed nucleotide element (SINE) retroposons, in particular to MAR1 retroposons that are widely present in marsupial genomes. Thus, the neuronal enhancer nPE2 originated from the exaptation of a CORE-SINE retroposon in the lineage leading to mammals and remained under purifying selection in all mammalian orders for the last 170 million years. Expression studies performed in transgenic mice showed that two nonadjacent nPE2 subregions are essential to drive reporter gene expression into POMC hypothalamic neurons, providing the first functional example of an exapted enhancer derived from an ancient CORE-SINE retroposon. In addition, we found that this CORE-SINE family of retroposons is likely to still be active in American and Australian marsupial genomes and that several highly conserved exonic, intronic and intergenic sequences in the human genome originated from the exaptation of CORE-SINE retroposons. Together, our results provide clear evidence of the functional novelties that transposed elements contributed to their host genomes throughout evolution.

  12. 78 FR 20503 - Energy Conservation Program: Availability of the Interim Technical Support Document for High...

    Science.gov (United States)

    2013-04-05

    ... Renewable Energy, Building Technologies, EE-2J, 1000 Independence Avenue SW, Washington, DC 20585- 0121... Document for High-Intensity Discharge Lamps AGENCY: Office of Energy Efficiency and Renewable Energy.... Mail: Ms. Brenda Edwards, U.S. Department of Energy, Building Technologies Program, Mailstop EE-2J...

  13. 77 FR 11785 - Energy Conservation Program: Public Meeting and Availability of the Framework Document for High...

    Science.gov (United States)

    2012-02-28

    ... of Energy Efficiency and Renewable Energy, Building Technologies Program, EE-2J, 1000 Independence... Document for High-Intensity Discharge Lamps AGENCY: Office of Energy Efficiency and Renewable Energy..., 2012. ADDRESSES: The public meeting will be held at the U.S. Department of Energy, Forrestal Building...

  14. Comparison of three-dimensional optical coherence tomography and high resolution photography for art conservation studies.

    Science.gov (United States)

    Adler, Desmond C; Stenger, Jens; Gorczynska, Iwona; Lie, Henry; Hensick, Teri; Spronk, Ron; Wolohojian, Stephan; Khandekar, Narayan; Jiang, James Y; Barry, Scott; Cable, Alex E; Huber, Robert; Fujimoto, James G

    2007-11-26

    Gold punchwork and underdrawing in Renaissance panel paintings are analyzed using both three-dimensional swept source / Fourier domain optical coherence tomography (3D-OCT) and high resolution digital photography. 3D-OCT can generate en face images with micrometer-scale resolutions at arbitrary sectioning depths, rejecting out-of-plane light by coherence gating. Therefore 3D-OCT is well suited for analyzing artwork where a surface layer obscures details of interest. 3D-OCT also enables cross-sectional imaging and quantitative measurement of 3D features such as punch depth, which is beneficial for analyzing the tools and techniques used to create works of art. High volumetric imaging speeds are enabled by the use of a Fourier domain mode locked (FDML) laser as the 3D-OCT light source. High resolution infrared (IR) digital photography is shown to be particularly useful for the analysis of underdrawing, where the materials used for the underdrawing and paint layers have significantly different IR absrption properties. In general, 3D-OCT provides a more flexible and comprehensive analysis of artwork than high resolution photography, but also requires more complex instrumentation and data analysis.

  15. Identification of immunogenic HLA-B7 "Achilles' heel" epitopes within highly conserved regions of HIV

    DEFF Research Database (Denmark)

    De Groot, Anne S; Rivera, Daniel S; McMurry, Julie A

    2008-01-01

    Genetic polymorphisms in class I human leukocyte antigen molecules (HLA) have been shown to determine susceptibility to HIV infection as well as the rate of progression to AIDS. In particular, the HLA-B7 supertype has been shown to be associated with high viral loads and rapid progression to dise...

  16. Energy conservation and high-frequency damping in numerical time integration

    DEFF Research Database (Denmark)

    Krenk, Steen

    2008-01-01

    additional variables to represent damping. In the present paper it is demonstrated, how damping equivalent to the α-damping of the Newmark algorithm can be introduced directly via displacement and velocity dependent terms. It is furthermore shown, how this damping can be improved by introduction of a new set...... this often leads to a fairly large number of high-frequency modes, that are not represented well – and occasionally directly erroneously – by the model. It is desirable to cure this problem by devising algorithms that include the possibility of introducing algorithmic energy dissipation of the high......-frequency modes. The problem is well known from classic collocation based algorithms – notably various forms of the Newmark algorithm – where the equation of motion is supplemented by approximate relations between displacement, velocity and acceleration. Here adjustment of the algorithmic parameters can be used...

  17. Energy conservation and high-frequency damping in numerical time-integration

    DEFF Research Database (Denmark)

    Krenk, Steen

    2007-01-01

    by introduction of a new set of variables related to the displacement and velocity vectors by a suitable first order filter with scalar coefficients. By this device an algorithmic damping can be obtained that is of third order in the low-frequency regime. It is an important feature of both algorithms...... this often leads to a fairly large number of high-frequency modes, that are not represented well - and occasionally directly erroneously - by the model. It is desirable to cure this problem by devising algorithms that include the possibility of introducing algorithmic energy dissipation of the high......-frequency modes. The problem is well known from classic collocation based algorithms - notably various forms of the Newmark algorithm where the equation of motion is supplemented by approximate relations between displacement, velocity and acceleration. Here adjustment of the algorithmic parameters can be used...

  18. Clade IVa Basic Helix-Loop-Helix Transcription Factors Form Part of a Conserved Jasmonate Signaling Circuit for the Regulation of Bioactive Plant Terpenoid Biosynthesis.

    Science.gov (United States)

    Mertens, Jan; Van Moerkercke, Alex; Vanden Bossche, Robin; Pollier, Jacob; Goossens, Alain

    2016-12-01

    Plants produce many bioactive, specialized metabolites to defend themselves when facing various stress situations. Their biosynthesis is directed by a tightly controlled regulatory circuit that is elicited by phytohormones such as jasmonate (JA). The basic helix-loop-helix (bHLH) transcription factors (TFs) bHLH iridoid synthesis 1 (BIS1) and Triterpene Saponin Activating Regulator (TSAR) 1 and 2, from Catharanthus roseus and Medicago truncatula, respectively, all belong to clade IVa of the bHLH protein family and activate distinct terpenoid pathways, thereby mediating monoterpenoid indole alkaloid (MIA) and triterpene saponin (TS) accumulation, respectively, in these two species. In this study, we report that promoters of the genes encoding the enzymes involved in the specific terpenoid pathway of one of these species can be transactivated by the orthologous bHLH factor from the other species through recognition of the same cis-regulatory elements. Accordingly, ectopic expression of CrBIS1 in M. truncatula hairy roots up-regulated the expression of all genes required for soyasaponin production, resulting in strongly increased levels of soyasaponins in the transformed roots. Likewise, transient expression of MtTSAR1 and MtTSAR2 in C. roseus petals led to up-regulation of the genes involved in the iridoid branch of the MIA pathway. Together, our data illustrate the functional similarity of these JA-inducible TFs and indicate that recruitment of defined cis-regulatory elements constitutes an important aspect of the evolution of conserved regulatory modules for the activation of species-specific terpenoid biosynthesis pathways by common signals such as the JA phytohormones. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. A highly conserved Poc1 protein characterized in embryos of the hydrozoan Clytia hemisphaerica: localization and functional studies.

    Directory of Open Access Journals (Sweden)

    Cécile Fourrage

    Full Text Available Poc1 (Protein of Centriole 1 proteins are highly conserved WD40 domain-containing centriole components, well characterized in the alga Chlamydomonas, the ciliated protazoan Tetrahymena, the insect Drosophila and in vertebrate cells including Xenopus and zebrafish embryos. Functions and localizations related to the centriole and ciliary axoneme have been demonstrated for Poc1 in a range of species. The vertebrate Poc1 protein has also been reported to show an additional association with mitochondria, including enrichment in the specialized "germ plasm" region of Xenopus oocytes. We have identified and characterized a highly conserved Poc1 protein in the cnidarian Clytia hemisphaerica. Clytia Poc1 mRNA was found to be strongly expressed in eggs and early embryos, showing a punctate perinuclear localization in young oocytes. Fluorescence-tagged Poc1 proteins expressed in developing embryos showed strong localization to centrioles, including basal bodies. Anti-human Poc1 antibodies decorated mitochondria in Clytia, as reported in human cells, but failed to recognise endogenous or fluorescent-tagged Clytia Poc1. Injection of specific morpholino oligonucleotides into Clytia eggs prior to fertilization to repress Poc1 mRNA translation interfered with cell division from the blastula stage, likely corresponding to when neosynthesis normally takes over from maternally supplied protein. Cell cycle lengthening and arrest were observed, phenotypes consistent with an impaired centriolar biogenesis or function. The specificity of the defects could be demonstrated by injection of synthetic Poc1 mRNA, which restored normal development. We conclude that in Clytia embryos, Poc1 has an essentially centriolar localization and function.

  20. The highly conserved HA2 protein of the influenza A virus induces a cross protective immune response.

    Science.gov (United States)

    Lee, Jong-Soo; Chowdhury, Mohammed Y E; Moon, Ho-Jin; Choi, Young-Ki; Talactac, Melbourne R; Kim, Jae-Hoon; Park, Min-Eun; Son, Hwa-Young; Shin, Kwang-Soon; Kim, Chul-Joong

    2013-12-01

    Existing influenza vaccines protect mostly homologous subtypes and acted most effectively only when well matched to the circulating strain. Immunization with an updated vaccine is therefore necessary to maintain long-term protection and the development of a broadly protective influenza vaccine against the threat of pandemic outbreak. The highly conserved HA2 glyco-polypeptide (HA2 gp) is a promising new candidate for such an influenza vaccine. Helical domain and the fusion peptide (residues 15-137) of surface antigen from influenza A subtype A/EM/Korea/W149/06 (H5N1) was used to assess the potentiality of HA2 vaccination against multiple subtypes of the influenza viruses. The construct, named H5HA2 was expressed in Escherichia coli and allowed to refold from inclusion bodies. Purified proteins were used to investigate the immunogenicity of H5HA2 and its potential for cross protection. The immunization of mice with H5HA2 induced HA2 antibodies, HA2 specific T-cell responses, and protection against homologous A/EM/Korea/W149/06 (H5N1) influenza. Immunized mice were also protected from two distinct heterosubtypes of influenza: A/Puerto Rico/1/34(H1N1) and bird/Korea/w81/2005(H5N2). Results suggest that recombinant proteins based on the highly conserved residues within HA2 are candidates for the development of vaccines against pandemic outbreaks of emergent influenza variants. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Computation and Analysis of High Rocky Slope Safety in a Water Conservancy Project

    Directory of Open Access Journals (Sweden)

    Meng Yang

    2015-01-01

    Full Text Available An integrated method, covering the actual monitoring analysis, practical geological model, and theoretical mathematical simulation model, is systematically proposed and successfully applied. Deformation characteristic of a unique high rocky slope was firstly analyzed from multiple angles and multiple layers by changeable elevations and distances. Arrangements of monitoring points were listed and monitoring equipment was designed to comprise a complete monitoring system. Present larger displacement was concluded for bottom larger displacement caused by water erosion and middle larger displacement formed by seepage. Temporal and spatial displacements rule study of multiple-points linkage effects with water factor proved this conclusion. To better excavate useful message and analyze the deep rule from the practical monitoring data, the slope geological model was conducted and rock mechanic parameters were researched. Finally, a unique three-dimensional finite element model was applied to approach the structure character using numerical simulations. The corresponding strength criterion was used to determine the safety coefficient by selecting a typical section. Subsequently, an integrated three-dimensional finite element model of the slope and dam was developed and more detailed deformation evolution mechanism was revealed. This study is expected to provide a powerful and systematic method to analyze very high, important, and dangerous slopes.

  2. Cross-Breeding Is Inevitable to Conserve the Highly Inbred Population of Puffin Hunter: The Norwegian Lundehund.

    Science.gov (United States)

    Kettunen, Anne; Daverdin, Marc; Helfjord, Turid; Berg, Peer

    2017-01-01

    The Norwegian Lundehund is a highly endangered native dog breed. Low fertility and high frequency predisposition to intestinal disorder imply inbreeding depression. We assessed the genetic diversity of the Lundehund population from pedigree data and evaluated the potential of optimal contribution selection and cross-breeding in the long-term management of the Lundehund population. The current Norwegian Lundehund population is highly inbred and has lost 38.8% of the genetic diversity in the base population. Effective population size estimates varied between 13 and 82 depending on the method used. Optimal contribution selection alone facilitates no improvement in the current situation in the Lundehund due to the extremely high relatedness of the whole population. Addition of (replacement with) 10 breeding candidates of foreign breed to 30 Lundehund breeders reduced the parental additive genetic relationship by 40-42% (48-53%). Immediate actions are needed to increase the genetic diversity in the current Lundehund population. The only option to secure the conservation of this rare breed is to introduce individuals from foreign breeds as breeding candidates.

  3. Cross-Breeding Is Inevitable to Conserve the Highly Inbred Population of Puffin Hunter: The Norwegian Lundehund.

    Directory of Open Access Journals (Sweden)

    Anne Kettunen

    Full Text Available The Norwegian Lundehund is a highly endangered native dog breed. Low fertility and high frequency predisposition to intestinal disorder imply inbreeding depression. We assessed the genetic diversity of the Lundehund population from pedigree data and evaluated the potential of optimal contribution selection and cross-breeding in the long-term management of the Lundehund population. The current Norwegian Lundehund population is highly inbred and has lost 38.8% of the genetic diversity in the base population. Effective population size estimates varied between 13 and 82 depending on the method used. Optimal contribution selection alone facilitates no improvement in the current situation in the Lundehund due to the extremely high relatedness of the whole population. Addition of (replacement with 10 breeding candidates of foreign breed to 30 Lundehund breeders reduced the parental additive genetic relationship by 40-42% (48-53%. Immediate actions are needed to increase the genetic diversity in the current Lundehund population. The only option to secure the conservation of this rare breed is to introduce individuals from foreign breeds as breeding candidates.

  4. High-order conservative finite difference GLM-MHD schemes for cell-centered MHD

    Science.gov (United States)

    Mignone, Andrea; Tzeferacos, Petros; Bodo, Gianluigi

    2010-08-01

    We present and compare third- as well as fifth-order accurate finite difference schemes for the numerical solution of the compressible ideal MHD equations in multiple spatial dimensions. The selected methods lean on four different reconstruction techniques based on recently improved versions of the weighted essentially non-oscillatory (WENO) schemes, monotonicity preserving (MP) schemes as well as slope-limited polynomial reconstruction. The proposed numerical methods are highly accurate in smooth regions of the flow, avoid loss of accuracy in proximity of smooth extrema and provide sharp non-oscillatory transitions at discontinuities. We suggest a numerical formulation based on a cell-centered approach where all of the primary flow variables are discretized at the zone center. The divergence-free condition is enforced by augmenting the MHD equations with a generalized Lagrange multiplier yielding a mixed hyperbolic/parabolic correction, as in Dedner et al. [J. Comput. Phys. 175 (2002) 645-673]. The resulting family of schemes is robust, cost-effective and straightforward to implement. Compared to previous existing approaches, it completely avoids the CPU intensive workload associated with an elliptic divergence cleaning step and the additional complexities required by staggered mesh algorithms. Extensive numerical testing demonstrate the robustness and reliability of the proposed framework for computations involving both smooth and discontinuous features.

  5. Two strains of Crocosphaera watsonii with highly conserved genomes are distinguished by strain-specific features

    Directory of Open Access Journals (Sweden)

    Shellie Roxanne Bench

    2011-12-01

    Full Text Available Unicellular nitrogen-fixing cyanobacteria are important components of marine phytoplankton. Although non-nitrogen-fixing marine phytoplankton generally exhibit high gene sequence and genomic diversity, gene sequences of natural populations and isolated strains of Crocosphaera watsonii, one of two most abundant open ocean unicellular cyanobacteria groups, have been shown to be 98-100% identical.. The low sequence diversity in Crocosphaera is a dramatic contrast to sympatric species of Prochlorococcus and Synechococcus, and raises the question of how genome differences can explain observed phenotypic diversity among Crocosphaera strains. Here we show, through whole genome comparisons of two phenotypically different strains, that there are strain-specific sequences in each genome, and numerous genome rearrangements, despite exceptionally low sequence diversity in shared genomic regions. Some of the strain-specific sequences encode functions that explain observed phenotypic differences, such as exopolysaccharide biosynthesis. The pattern of strain-specific sequences distributed throughout the genomes, along with rearrangements in shared sequences is evidence of significant genetic mobility that may be attributed to the hundreds of transposase genes found in both strains. Furthermore, such genetic mobility appears to be the main mechanism of strain divergence in Crocosphaera which do not accumulate DNA microheterogeneity over the vast majority of their genomes. The strain-specific sequences found in this study provide tools for future physiological studies, as well as genetic markers to help determine the relative abundance of phenotypes in natural populations.

  6. Adenoid cystic breast carcinoma: high rates of margin positivity after breast conserving surgery.

    Science.gov (United States)

    Hodgson, Nicole C; Lytwyn, Alice; Bacopulos, Sarah; Elavathil, Leela

    2010-02-01

    Adenoid cystic carcinoma of the breast (ACCB) is a rare malignancy with favorable prognosis: axillary lymph node involvement, distant metastases, and death due to disease are uncommon. ACCB may recur locally many years after primary surgical excision and may be substantially higher if primary procedure is lumpectomy rather than mastectomy. Pathology database searched to identify patients diagnosed with ACCB between 1988 and 2007 at Hamilton Health Sciences Centre, Hamilton, Ontario, Canada.Two pathologists independently reviewed histology to confirm diagnosis of ACCB, and documented surgical procedure, tumor size, tumor grade, surgical margin, and lymph node status. Immunohistochemistry was performed on representative blocks and independently reviewed by 2 pathologists. Clinical and radiologic data were retrospectively reviewed. Fifteen cases of ACCB were identified and pathology slides were available for 12. The median age was 62 years. Seven patients presented with a palpable mass and breast pain was described in 3. Positive surgical margins were identified in 5 patients (42%). Only 3 patients had postoperative radiation therapy. Our series shows frequent resection margin involvement in ACCB. Neither clinical nor mammographic examination consistently delineated full tumor extent preoperatively. Future use of magnetic resonance imaging in preoperative assessment may prevent high positive margin rate when lumpectomy is planned. Histologic assessment of tumor extent may be difficult, but immunohistochemistry may be helpful in this regard.

  7. Genomic analysis of six new Geobacillus strains reveals highly conserved carbohydrate degradation architectures and strategies

    Directory of Open Access Journals (Sweden)

    Phillip eBrumm

    2015-05-01

    Full Text Available In this work we report the whole genome sequences of six new Geobacillus xylanolytic strains along with the genomic analysis of their capability to degrade carbohydrates.. The six sequenced Geobacillus strains described here have a range of GC contents from 43.9% to 52.5% and clade with named Geobacillus species throughout the entire genus. We have identified a ~200 kb unique super-cluster in all six strains, containing five to eight distinct carbohydrate degradation clusters in a single genomic region, a feature not seen in other genera. The Geobacillus strains rely on a small number of secreted enzymes located within distinct clusters for carbohydrate utilization, in contrast to most biomass-degrading organisms which contain numerous secreted enzymes located randomly throughout the genomes. All six strains are able to utilize fructose, arabinose, xylose, mannitol, gluconate, xylan, and α-1,6-glucosides. The gene clusters for utilization of these seven substrates have identical organization and the individual proteins have a high percent identity to their homologs. The strains show significant differences in their ability to utilize inositol, sucrose, lactose, α-mannosides, α-1,4-glucosides and arabinan.

  8. Expression and genomic analysis of midasin, a novel and highly conserved AAA protein distantly related to dynein

    Directory of Open Access Journals (Sweden)

    Gibbons I R

    2002-07-01

    Full Text Available Abstract Background The largest open reading frame in the Saccharomyces genome encodes midasin (MDN1p, YLR106p, an AAA ATPase of 560 kDa that is essential for cell viability. Orthologs of midasin have been identified in the genome projects for Drosophila, Arabidopsis, and Schizosaccharomyces pombe. Results Midasin is present as a single-copy gene encoding a well-conserved protein of ~600 kDa in all eukaryotes for which data are available. In humans, the gene maps to 6q15 and encodes a predicted protein of 5596 residues (632 kDa. Sequence alignments of midasin from humans, yeast, Giardia and Encephalitozoon indicate that its domain structure comprises an N-terminal domain (35 kDa, followed by an AAA domain containing six tandem AAA protomers (~30 kDa each, a linker domain (260 kDa, an acidic domain (~70 kDa containing 35–40% aspartate and glutamate, and a carboxy-terminal M-domain (30 kDa that possesses MIDAS sequence motifs and is homologous to the I-domain of integrins. Expression of hemagglutamin-tagged midasin in yeast demonstrates a polypeptide of the anticipated size that is localized principally in the nucleus. Conclusions The highly conserved structure of midasin in eukaryotes, taken in conjunction with its nuclear localization in yeast, suggests that midasin may function as a nuclear chaperone and be involved in the assembly/disassembly of macromolecular complexes in the nucleus. The AAA domain of midasin is evolutionarily related to that of dynein, but it appears to lack a microtubule-binding site.

  9. based conservation

    African Journals Online (AJOL)

    http://dx.doi.org/10.4314/mcd.v10i2.1. Increasing women's par- ticipation in community- based conservation: key to success? Ensuring that both men and women benefit equitably from conservation and development programs is likely to increase the long-term success of both conservation and development goals. However ...

  10. Energy audit of three energy-conserving devices in a steel industry demonstration program. Task III. GTE high temperature recuperation

    Energy Technology Data Exchange (ETDEWEB)

    Holden, F.C.; Hoffman, A.O.; Lownie, H.W.

    1983-06-01

    The Office of Industrial Programs of the Department of Energy has undertaken a program to demonstrate to industry the benefits of installing various energy-conserving devices and equipment. This report presents results on one of those systems, a high-temperature ceramic recuperator designed and manufactured by Sylvania Chemical and Metallurgical Division, GTE Products Corporation of Towanda, Pennsylvania. The ceramic cross-flow recuperator unit recovers waste heat from the hot combustion gases and delivers preheated air to high-temperature burners of various manufacture. Of the 38 host site installations included in the program, sufficient operating data were obtained from 28 sites to evaluate the benefits in terms of energy and economic savings that can be achieved. Performance and cost data are analyzed and presented for those 28 installations, which covered a variety of applications, sizes, and industry types. Except for 5 sites where unusual operating or data-collection problems were encountered, the improvements in performance of the recuperated furnaces equalled or exceeded estimates; the average of the total fuel savings for these 23 sites was 44.0 percent, some portion of which resulted from furnace improvements other than recuperation. Payback times were calculated for both total costs and for recuperator-related costs, using a cumulative annual after-tax cash flow method which includes tax investment credits, estimates of general and fuel-price inflation, and maintenance costs.

  11. A highly conserved epitope-vaccine candidate against varicella-zoster virus induces neutralizing antibodies in mice.

    Science.gov (United States)

    Zhu, Rui; Liu, Jian; Chen, Chunye; Ye, Xiangzhong; Xu, Longfa; Wang, Wei; Zhao, Qinjian; Zhu, Hua; Cheng, Tong; Xia, Ningshao

    2016-03-18

    Varicella-zoster virus (VZV) is a highly infectious agent of varicella and herpes zoster (HZ). Vaccination is by far the most effective way to prevent these diseases. More safe, stable and efficient vaccines, such as epitope-based vaccines, now have been increasingly investigated by many researchers. However, only a few VZV neutralizing epitopes have been identified to date. We have previously identified a linear epitope between amino acid residues 121 and 135 of gE. In this study, we validated that this epitope is highly conserved amongst different VZV strains that covered five existing phylogenetic clades with an identity of 100%. We evaluated the immunogenicity of the recombinant hepatitis B virus core (HBc) virus-like particles (VLPs) which included amino acids (121-135). VZV-gE-specific antibodies were detected in immunized mouse serum using ELISA. The anti-peptide antiserum positively detected VZV via Western blot and immunofluorescent staining assays. More importantly, these peptides could neutralize VZV, indicating that these peptides represented neutralizing epitopes. These findings have important implications for the development of epitope-based protective VZV vaccines. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. A Web-Based GIS for Reporting Water Usage in the High Plains Underground Water Conservation District

    Science.gov (United States)

    Jia, M.; Deeds, N.; Winckler, M.

    2012-12-01

    The High Plains Underground Water Conservation District (HPWD) is the largest and oldest of the Texas water conservation districts, and oversees approximately 1.7 million irrigated acres. Recent rule changes have motivated HPWD to develop a more automated system to allow owners and operators to report well locations, meter locations, meter readings, the association between meters and wells, and contiguous acres. INTERA, Inc. has developed a web-based interactive system for HPWD water users to report water usage and for the district to better manage its water resources. The HPWD web management system utilizes state-of-the-art GIS techniques, including cloud-based Amazon EC2 virtual machine, ArcGIS Server, ArcSDE and ArcGIS Viewer for Flex, to support web-based water use management. The system enables users to navigate to their area of interest using a well-established base-map and perform a variety of operations and inquiries against their spatial features. The application currently has six components: user privilege management, property management, water meter registration, area registration, meter-well association and water use report. The system is composed of two main databases: spatial database and non-spatial database. With the help of Adobe Flex application at the front end and ArcGIS Server as the middle-ware, the spatial feature geometry and attributes update will be reflected immediately in the back end. As a result, property owners, along with the HPWD staff, collaborate together to weave the fabric of the spatial database. Interactions between the spatial and non-spatial databases are established by Windows Communication Foundation (WCF) services to record water-use report, user-property associations, owner-area associations, as well as meter-well associations. Mobile capabilities will be enabled in the near future for field workers to collect data and synchronize them to the spatial database. The entire solution is built on a highly scalable cloud

  13. Genetic diversity and genetic structure of an endemic Mexican Dusky Rattlesnake (Crotalus triseriatus) in a highly modified agricultural landscape: implications for conservation.

    Science.gov (United States)

    Sunny, Armando; Monroy-Vilchis, Octavio; Zarco-González, Martha M; Mendoza-Martínez, Germán David; Martínez-Gómez, Daniel

    2015-12-01

    It is necessary to determine genetic diversity of fragmented populations in highly modified landscapes to understand how populations respond to land-use change. This information will help guide future conservation and management strategies. We conducted a population genetic study on an endemic Mexican Dusky Rattlesnake (Crotalus triseriatus) in a highly modified landscape near the Toluca metropolitan area, in order to provide crucial information for the conservation of this species. There was medium levels of genetic diversity, with a few alleles and genotypes. We identified three genetically differentiated clusters, likely as a result of different habitat cover type. We also found evidence of an ancestral genetic bottleneck and medium values of effective population size. Inbreeding coefficients were low and there was a moderate gene flow. Our results can be used as a basis for future research and C. triseriatus conservation efforts, particularly considering that the Trans-Mexican Volcanic Belt is heavily impacted by destructive land-use practices.

  14. Sialic acid mediated transcriptional modulation of a highly conserved sialometabolism gene cluster in Haemophilus influenzae and its effect on virulence

    Directory of Open Access Journals (Sweden)

    Moxon Richard

    2010-02-01

    Full Text Available Abstract Background Sialic acid has been shown to be a major virulence determinant in the pathogenesis of otitis media caused by the bacterium Haemophilus influenzae. This study aimed to characterise the expression of genes required for the metabolism of sialic acid and to investigate the role of these genes in virulence. Results Using qRT-PCR, we observed decreased transcriptional activity of genes within a cluster that are required for uptake and catabolism of 5-acetyl neuraminic acid (Neu5Ac, when bacteria were cultured in the presence of the sugar. We show that these uptake and catabolic genes, including a sialic acid regulatory gene (siaR, are highly conserved in the H. influenzae natural population. Mutant strains were constructed for seven of the nine genes and their influence upon LPS sialylation and resistance of the bacteria to the killing effect of normal human serum were assessed. Mutations in the Neu5Ac uptake (TRAP transporter genes decreased virulence in the chinchilla model of otitis media, but the attenuation was strain dependent. In contrast, mutations in catabolism genes and genes regulating sialic acid metabolism (siaR and crp did not attenuate virulence. Conclusion The commensal and pathogenic behaviour of H. influenzae involves LPS sialylation that can be influenced by a complex regulatory interplay of sialometabolism genes.

  15. A missense mutation in a highly conserved alternate exon of dynamin-1 causes epilepsy in fitful mice.

    Directory of Open Access Journals (Sweden)

    Rebecca M Boumil

    2010-08-01

    Full Text Available Dynamin-1 (Dnm1 encodes a large multimeric GTPase necessary for activity-dependent membrane recycling in neurons, including synaptic vesicle endocytosis. Mice heterozygous for a novel spontaneous Dnm1 mutation--fitful--experience recurrent seizures, and homozygotes have more debilitating, often lethal seizures in addition to severe ataxia and neurosensory deficits. Fitful is a missense mutation in an exon that defines the DNM1a isoform, leaving intact the alternatively spliced exon that encodes DNM1b. The expression of the corresponding alternate transcripts is developmentally regulated, with DNM1b expression highest during early neuronal development and DNM1a expression increasing postnatally with synaptic maturation. Mutant DNM1a does not efficiently self-assemble into higher order complexes known to be necessary for proper dynamin function, and it also interferes with endocytic recycling in cell culture. In mice, the mutation results in defective synaptic transmission characterized by a slower recovery from depression after trains of stimulation. The DNM1a and DNM1b isoform pair is highly conserved in vertebrate evolution, whereas invertebrates have only one isoform. We speculate that the emergence of more specialized forms of DNM1 may be important in organisms with complex neuronal function.

  16. The master switchers in the aging of cardiovascular system, reverse senescence by microRNA signatures; as highly conserved molecules.

    Science.gov (United States)

    Pourrajab, Fatemeh; Vakili Zarch, Abbas; Hekmatimoghaddam, Seyedhossein; Zare-Khormizi, Mohamad Reza

    2015-11-01

    The incidence of CVD increases with aging, because of long-term exposure to risk factors/stressors. Aging is a complex biological process resulting in progressive loss of physiological integrity, leading to impaired function and increased vulnerability to death. The main hallmarks of aging are cellular senescence, stem cell exhaustion, and altered intracellular communication. The major hallmarks of senescence are mitochondrial dysfunction, genomic instability, telomere attrition and epigenetic alterations, all of which contributing to cellular aging. Such events are controls by a family of small, non-coding RNAs (miRNAs) that interact with component of cellular senescence pathway; mitochondrial biogenesis/removal, DNA damage response machinery and IGF-1 signaling pathway. Here, we review recent in vivo/in vitro reports that miRNAs are key modulators of heart senescence, and act as master switchers to influence reprogramming pathway. We discuss evidence that abrupt deregulation of some mit-miRNAs governing senescence programs underlies age-associated CVD. In particular, due to the highly conserved nature and well-recognized target sites, miRNAs have been defined as master switchers in controlling heart progenitor cell biology. Modulation of mit-miRNA expression holds the great promise in switching off/on cellular senescence/reprogramming to rejuvenate stem cells to aid regenerative process. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Comparative Mitogenomics of the Genus Odontobutis (Perciformes: Gobioidei: Odontobutidae) Revealed Conserved Gene Rearrangement and High Sequence Variations.

    Science.gov (United States)

    Ma, Zhihong; Yang, Xuefen; Bercsenyi, Miklos; Wu, Junjie; Yu, Yongyao; Wei, Kaijian; Fan, Qixue; Yang, Ruibin

    2015-10-20

    To understand the molecular evolution of mitochondrial genomes (mitogenomes) in the genus Odontobutis, the mitogenome of Odontobutis yaluensis was sequenced and compared with those of another four Odontobutis species. Our results displayed similar mitogenome features among species in genome organization, base composition, codon usage, and gene rearrangement. The identical gene rearrangement of trnS-trnL-trnH tRNA cluster observed in mitogenomes of these five closely related freshwater sleepers suggests that this unique gene order is conserved within Odontobutis. Additionally, the present gene order and the positions of associated intergenic spacers of these Odontobutis mitogenomes indicate that this unusual gene rearrangement results from tandem duplication and random loss of large-scale gene regions. Moreover, these mitogenomes exhibit a high level of sequence variation, mainly due to the differences of corresponding intergenic sequences in gene rearrangement regions and the heterogeneity of tandem repeats in the control regions. Phylogenetic analyses support Odontobutis species with shared gene rearrangement forming a monophyletic group, and the interspecific phylogenetic relationships are associated with structural differences among their mitogenomes. The present study contributes to understanding the evolutionary patterns of Odontobutidae species.

  18. Highly conserved serine residue 40 in HIV-1 p6 regulates capsid processing and virus core assembly

    Directory of Open Access Journals (Sweden)

    Solbak Sara MØ

    2011-02-01

    Full Text Available Abstract Background The HIV-1 p6 Gag protein regulates the final abscission step of nascent virions from the cell membrane by the action of two late assembly (L- domains. Although p6 is located within one of the most polymorphic regions of the HIV-1 gag gene, the 52 amino acid peptide binds at least to two cellular budding factors (Tsg101 and ALIX, is a substrate for phosphorylation, ubiquitination, and sumoylation, and mediates the incorporation of the HIV-1 accessory protein Vpr into viral particles. As expected, known functional domains mostly overlap with several conserved residues in p6. In this study, we investigated the importance of the highly conserved serine residue at position 40, which until now has not been assigned to any known function of p6. Results Consistently with previous data, we found that mutation of Ser-40 has no effect on ALIX mediated rescue of HIV-1 L-domain mutants. However, the only feasible S40F mutation that preserves the overlapping pol open reading frame (ORF reduces virus replication in T-cell lines and in human lymphocyte tissue cultivated ex vivo. Most intriguingly, L-domain mediated virus release is not dependent on the integrity of Ser-40. However, the S40F mutation significantly reduces the specific infectivity of released virions. Further, it was observed that mutation of Ser-40 selectively interferes with the cleavage between capsid (CA and the spacer peptide SP1 in Gag, without affecting cleavage of other Gag products. This deficiency in processing of CA, in consequence, led to an irregular morphology of the virus core and the formation of an electron dense extra core structure. Moreover, the defects induced by the S40F mutation in p6 can be rescued by the A1V mutation in SP1 that generally enhances processing of the CA-SP1 cleavage site. Conclusions Overall, these data support a so far unrecognized function of p6 mediated by Ser-40 that occurs independently of the L-domain function, but selectively

  19. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone.

    Science.gov (United States)

    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza; Waxman, David J

    2016-01-01

    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  20. Biodiversity Conservation in Asia

    OpenAIRE

    Dale Squires

    2014-01-01

    Asian's remarkable economic growth brought many benefits but also fuelled threats to its ecosystems and biodiversity. Economic growth brings biodiversity threats but also conservation opportunities. Continued biodiversity loss is inevitable, but the types, areas and rates of biodiversity loss are not. Prioritising biodiversity conservation, tempered by what is tractable, remains a high priority. Policy and market distortions and failures significantly underprice biodiversity, undermine ecosys...

  1. An evolutionarily conserved enhancer regulates Bmp4 expression in developing incisor and limb bud.

    Directory of Open Access Journals (Sweden)

    Dolrudee Jumlongras

    Full Text Available To elucidate the transcriptional regulation of Bmp4 expression during organogenesis, we used phylogenetic footprinting and transgenic reporter analyses to identify Bmp4 cis-regulatory modules (CRMs. These analyses identified a regulatory region located ∼46 kb upstream of the mouse Bmp4 transcription start site that had previously been shown to direct expression in lateral plate mesoderm. We refined this regulatory region to a 396-bp minimal enhancer, and show that it recapitulates features of endogenous Bmp4 expression in developing mandibular arch ectoderm and incisor epithelium during the initiation-stage of tooth development. In addition, this enhancer directs expression in the apical ectodermal ridge (AER of the developing limb and in anterior and posterior limb mesenchyme. Transcript profiling of E11.5 mouse incisor dental lamina, together with protein binding microarray (PBM analyses, allowed identification of a conserved DNA binding motif in the Bmp4 enhancer for Pitx homeoproteins, which are also expressed in the developing mandibular and incisor epithelium. In vitro electrophoretic mobility shift assays (EMSA and in vivo transgenic reporter mutational analyses revealed that this site supports Pitx binding and that the site is necessary to recapitulate aspects of endogenous Bmp4 expression in developing craniofacial and limb tissues. Finally, Pitx2 chromatin immunoprecipitation (ChIP demonstrated direct binding of Pitx2 to this Bmp4 enhancer site in a dental epithelial cell line. These results establish a direct molecular regulatory link between Pitx family members and Bmp4 gene expression in developing incisor epithelium.

  2. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements

    KAUST Repository

    Guturu, H.

    2013-11-11

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and \\'through-DNA\\' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex.

  3. An ancient genomic regulatory block conserved across bilaterians and its dismantling in tetrapods by retrogene replacement.

    Science.gov (United States)

    Maeso, Ignacio; Irimia, Manuel; Tena, Juan J; González-Pérez, Esther; Tran, David; Ravi, Vydianathan; Venkatesh, Byrappa; Campuzano, Sonsoles; Gómez-Skarmeta, José Luis; Garcia-Fernàndez, Jordi

    2012-04-01

    Developmental genes are regulated by complex, distantly located cis-regulatory modules (CRMs), often forming genomic regulatory blocks (GRBs) that are conserved among vertebrates and among insects. We have investigated GRBs associated with Iroquois homeobox genes in 39 metazoans. Despite 600 million years of independent evolution, Iroquois genes are linked to ankyrin-repeat-containing Sowah genes in nearly all studied bilaterians. We show that Iroquois-specific CRMs populate the Sowah locus, suggesting that regulatory constraints underlie the maintenance of the Iroquois-Sowah syntenic block. Surprisingly, tetrapod Sowah orthologs are intronless and not associated with Iroquois; however, teleost and elephant shark data demonstrate that this is a derived feature, and that many Iroquois-CRMs were ancestrally located within Sowah introns. Retroposition, gene, and genome duplication have allowed selective elimination of Sowah exons from the Iroquois regulatory landscape while keeping associated CRMs, resulting in large associated gene deserts. These results highlight the importance of CRMs in imposing constraints to genome architecture, even across large phylogenetic distances, and of gene duplication-mediated genetic redundancy to disentangle these constraints, increasing genomic plasticity.

  4. Evolutionary mirages: selection on binding site composition creates the illusion of conserved grammars in Drosophila enhancers.

    Directory of Open Access Journals (Sweden)

    Richard W Lusk

    2010-01-01

    question the common practice of inferring "cis-regulatory grammars" from the organization and evolutionary dynamics of developmental enhancers.

  5. Surgical versus conservative treatment for high-risk stress fractures of the lower leg (anterior tibial cortex, navicular and fifth metatarsal base): a systematic review

    NARCIS (Netherlands)

    Mallee, W.H.; Weel, H.; van Dijk, C.N.; van Tulder, M.W.; Kerkhoffs, G.M.; Lin, C.W.C.

    2015-01-01

    Aim To compare surgical and conservative treatment for high-risk stress fractures of the anterior tibial cortex, navicular and proximal fifth metatarsal. Methods Systematic searches of CENTRAL, MEDLINE, EMBASE, CINAHL, SPORTDiscus and PEDro were performed to identify relevant prospective and

  6. Comparing the cost-effectiveness of water conservation policies in a depleting aquifer:A dynamic analysis of the Kansas High Plains

    Science.gov (United States)

    This research analyzes two groundwater conservation policies in the Kansas High Plains located within the Ogallala aquifer: 1) cost-share assistance to increase irrigation efficiency; and 2) incentive payments to convert irrigated crop production to dryland crop production. To compare the cost-effec...

  7. Phosphocholine-containing, zwitterionic glycosphingolipids of adult Onchocerca volvulus as highly conserved antigenic structures of parasitic nematodes.

    Science.gov (United States)

    Wuhrer, M; Rickhoff, S; Dennis, R D; Lochnit, G; Soboslay, P T; Baumeister, S; Geyer, R

    2000-01-01

    Human Onchocerca volvulus infection sera were found to recognize zwitterionic glycolipids of O. volvulus and to cross-react with those of other parasitic nematodes (Ascaris suum, Setaria digitata and Litomosoides sigmodontis). By the use of an epitope-specific monoclonal antibody, zwitterionic glycolipids of all these nematode species were observed to contain the antigenic determinant phosphocholine. A hyperimmune serum specific for arthro-series glycolipid structures reacted with the various neutral glycolipids of all these nematodes, which demonstrated that their oligosaccharide moieties belonged to the arthro-series of protostomial glycolipids. These results indicated that arthro-series glycosphingolipids carrying, in part, phosphocholine substituents, represent highly conserved, antigenic glycolipid markers of parasitic nematodes. Three glycolipid components of the O. volvulus zwitterionic fraction were structurally characterized by matrix-assisted laser-desorption/ionization time-of-flight MS, methylation analysis and exoglycosidase treatment. Their chemical structures were elucidated to be phosphocholine-6GlcNAc(beta1-3)Man(beta1-4)Glc(1-1)ceramide, GalNAc(beta1-4)[phosphocholine-6]GlcNAc(beta1-3)Man(beta1-4)Glc(1-1) ceramide and Gal(alpha1-3)GalNAc(beta1-4)[phosphocholine-6]GlcNAc(beta1-3)Man(beta 1-4)Glc(1-1)ceramide for the zwitterionic ceramide tri-, tetra- and penta-hexosides respectively. The ceramide composition was found to be dominated by 2-hydroxylated docosanoic (C(22h:0)), tricosanoic (C(23h:0)) and tetracosanoic (C(24h:0)) acids, and C(17) sphingosine (C(d17:1)) (where (h) is hydroxylated and (d) is dihydroxylated). PMID:10816437

  8. An insulator element located at the cyclin B1 interacting protein 1 gene locus is highly conserved among mammalian species.

    Science.gov (United States)

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

    2015-01-01

    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle.

  9. An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

    Science.gov (United States)

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

    2015-01-01

    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

  10. Conservation of the S10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus Leptospira.

    Directory of Open Access Journals (Sweden)

    Berta Victoria

    Full Text Available S10-spc-alpha is a 17.5 kb cluster of 32 genes encoding ribosomal proteins. This locus has an unusual composition and organization in Leptospira interrogans. We demonstrate the highly conserved nature of this region among diverse Leptospira and show its utility as a phylogenetically informative region. Comparative analyses were performed by PCR using primer sets covering the whole locus. Correctly sized fragments were obtained by PCR from all L. interrogans strains tested for each primer set indicating that this locus is well conserved in this species. Few differences were detected in amplification profiles between different pathogenic species, indicating that the S10-spc-alpha locus is conserved among pathogenic Leptospira. In contrast, PCR analysis of this locus using DNA from saprophytic Leptospira species and species with an intermediate pathogenic capacity generated varied results. Sequence alignment of the S10-spc-alpha locus from two pathogenic species, L. interrogans and L. borgpetersenii, with the corresponding locus from the saprophyte L. biflexa serovar Patoc showed that genetic organization of this locus is well conserved within Leptospira. Multilocus sequence typing (MLST of four conserved regions resulted in the construction of well-defined phylogenetic trees that help resolve questions about the interrelationships of pathogenic Leptospira. Based on the results of secY sequence analysis, we found that reliable species identification of pathogenic Leptospira is possible by comparative analysis of a 245 bp region commonly used as a target for diagnostic PCR for leptospirosis. Comparative analysis of Leptospira strains revealed that strain H6 previously classified as L. inadai actually belongs to the pathogenic species L. interrogans and that L. meyeri strain ICF phylogenetically co-localized with the pathogenic clusters. These findings demonstrate that the S10-spc-alpha locus is highly conserved throughout the genus and may be more

  11. A review of the allozyme data set for the Canarian endemic flora: causes of the high genetic diversity levels and implications for conservation.

    Science.gov (United States)

    Pérez de Paz, Julia; Caujapé-Castells, Juli

    2013-06-01

    Background and Aims Allozyme and reproductive data sets for the Canarian flora are updated in order to assess how the present levels and structuring of genetic variation have been influenced by the abiotic island traits and by phylogenetically determined biotic traits of the corresponding taxa; and in order to suggest conservation guidelines. Methods Kruskal-Wallis tests are conducted to assess the relationships of 27 variables with genetic diversity (estimated by A, P, Ho and He) and structuring (GST) of 123 taxa representing 309 populations and 16 families. Multiple linear regression analyses (MLRAs) are carried out to determine the relative influence of the less correlated significant abiotic and biotic factors on the genetic diversity levels. Key Results and Conclusions The interactions between biotic features of the colonizing taxa and the abiotic island features drive plant diversification in the Canarian flora. However, the lower weight of closeness to the mainland than of (respectively) high basic chromosome number, partial or total self-incompatibility and polyploidy in the MLRAs indicates substantial phylogenetic constraint; the importance of a high chromosome number is feasibly due to the generation of a larger number of linkage groups, which increase gametic and genotypic diversity. Genetic structure is also more influenced by biotic factors (long-range seed dispersal, basic chromosome number and partial or total self-incompatibility) than by distance to the mainland. Conservation-wise, genetic structure estimates (FST/GST) only reflect endangerment under intensive population sampling designs, and neutral genetic variation levels do not directly relate to threat status or to small population sizes. Habitat protection is emphasized, but the results suggest the need for urgent implementation of elementary reproductive studies in all cases, and for ex situ conservation measures for the most endangered taxa, even without prior studies. In non

  12. The maize INDETERMINATE1 flowering time regulator defines a highly conserved zinc finger protein family in higher plants

    Directory of Open Access Journals (Sweden)

    Colasanti Joseph

    2006-06-01

    Full Text Available Abstract Background The maize INDETERMINATE1 gene, ID1, is a key regulator of the transition to flowering and the founding member of a transcription factor gene family that encodes a protein with a distinct arrangement of zinc finger motifs. The zinc fingers and surrounding sequence make up the signature ID domain (IDD, which appears to be found in all higher plant genomes. The presence of zinc finger domains and previous biochemical studies showing that ID1 binds to DNA suggests that members of this gene family are involved in transcriptional regulation. Results Comparison of IDD genes identified in Arabidopsis and rice genomes, and all IDD genes discovered in maize EST and genomic databases, suggest that ID1 is a unique member of this gene family. High levels of sequence similarity amongst all IDD genes from maize, rice and Arabidopsis suggest that they are derived from a common ancestor. Several unique features of ID1 suggest that it is a divergent member of the maize IDD family. Although no clear ID1 ortholog was identified in the Arabidopsis genome, highly similar genes that encode proteins with identity extending beyond the ID domain were isolated from rice and sorghum. Phylogenetic comparisons show that these putative orthologs, along with maize ID1, form a group separate from other IDD genes. In contrast to ID1 mRNA, which is detected exclusively in immature leaves, several maize IDD genes showed a broad range of expression in various tissues. Further, Western analysis with an antibody that cross-reacts with ID1 protein and potential orthologs from rice and sorghum shows that all three proteins are detected in immature leaves only. Conclusion Comparative genomic analysis shows that the IDD zinc finger family is highly conserved among both monocots and dicots. The leaf-specific ID1 expression pattern distinguishes it from other maize IDD genes examined. A similar leaf-specific localization pattern was observed for the putative ID1 protein

  13. Reshaping conservation

    DEFF Research Database (Denmark)

    Funder, Mikkel; Danielsen, Finn; Ngaga, Yonika

    2013-01-01

    members strengthen the monitoring practices to their advantage, and to some extent move them beyond the reach of government agencies and conservation and development practitioners. This has led to outcomes that are of greater social and strategic value to communities than the original 'planned' benefits......, although the monitoring scheme has also to some extent become dominated by local 'conservation elites' who negotiate the terrain between the state and other community members. Our findings suggest that we need to move beyond simplistic assumptions of community strategies and incentives in participatory...... conservation and allow for more adaptive and politically explicit governance spaces in protected area management....

  14. A pathway for low zinc homeostasis that is conserved in animals and acts in parallel to the pathway for high zinc homeostasis.

    Science.gov (United States)

    Dietrich, Nicholas; Schneider, Daniel L; Kornfeld, Kerry

    2017-11-16

    The essential element zinc plays critical roles in biology. High zinc homeostasis mechanisms are beginning to be defined in animals, but low zinc homeostasis is poorly characterized. We investigated low zinc homeostasis in Caenorhabditis elegans because the genome encodes 14 evolutionarily conserved Zrt, Irt-like protein (ZIP) zinc transporter family members. Three C. elegans zipt genes were regulated in zinc-deficient conditions; these promoters contained an evolutionarily conserved motif that we named the low zinc activation (LZA) element that was both necessary and sufficient for activation of transcription in response to zinc deficiency. These results demonstrated that the LZA element is a critical part of the low zinc homeostasis pathway. Transcriptional regulation of the LZA element required the transcription factor ELT-2 and mediator complex member MDT-15. We investigated conservation in mammals by analyzing LZA element function in human cultured cells; the LZA element-mediated transcriptional activation in response to zinc deficiency in cells, suggesting a conserved pathway of low zinc homeostasis. We propose that the pathway for low zinc homeostasis, which includes the LZA element and ZIP transporters, acts in parallel to the pathway for high zinc homeostasis, which includes the HZA element, HIZR-1 transcription factor and cation diffusion facilitator transporters. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. "Toward High School Biology": Helping Middle School Students Understand Chemical Reactions and Conservation of Mass in Nonliving and Living Systems

    Science.gov (United States)

    Herrmann-Abell, Cari F.; Koppal, Mary; Roseman, Jo Ellen

    2016-01-01

    Modern biology has become increasingly molecular in nature, requiring students to understand basic chemical concepts. Studies show, however, that many students fail to grasp ideas about atom rearrangement and conservation during chemical reactions or the application of these ideas to biological systems. To help provide students with a better…

  16. Implementing Community-Based Comprehensive Sexuality Education with High-Risk Youth in a Conservative Environment: Lessons Learned

    Science.gov (United States)

    Secor-Turner, Molly; Randall, Brandy A.; Christensen, Katie; Jacobson, Amy; Loyola Meléndez, Migdalia

    2017-01-01

    Although comprehensive sexuality education programmes have the potential to improve the sexual health and well-being of young people, many socially conservative rural states in the USA have laws and policies restricting school-based comprehensive sexuality education and supporting abstinence-only education. This paper describes the process of…

  17. Structural organization of essential iron-sulfur clusters in the evolutionarily highly conserved ATP-binding cassette protein ABCE1

    NARCIS (Netherlands)

    Barthelme, Dominik; Scheele, Urte; Dinkelaker, Stephanie; Janoschka, Adam; MacMillan, Fraser; Albers, Sonja-Verena; Driessen, Arnold J. M.; Stagni, Marco Salamone; Bill, Eckhard; Meyer-Klaucke, Wolfram; Schuenemann, Volker; Tampe, Robert; Schünemann, Volker

    2007-01-01

    The ABC protein ABCE1, formerly named RNase L inhibitor RLI1, is one of the most conserved proteins in evolution and is expressed in all organisms except eubacteria. Because of its fundamental role in translation initiation and/or ribosome biosynthesis, ABCE1 is essential for life. Its molecular

  18. PreCisIon: PREdiction of CIS-regulatory elements improved by gene's positION.

    Science.gov (United States)

    Elati, Mohamed; Nicolle, Rémy; Junier, Ivan; Fernández, David; Fekih, Rim; Font, Julio; Képès, François

    2013-02-01

    Conventional approaches to predict transcriptional regulatory interactions usually rely on the definition of a shared motif sequence on the target genes of a transcription factor (TF). These efforts have been frustrated by the limited availability and accuracy of TF binding site motifs, usually represented as position-specific scoring matrices, which may match large numbers of sites and produce an unreliable list of target genes. To improve the prediction of binding sites, we propose to additionally use the unrelated knowledge of the genome layout. Indeed, it has been shown that co-regulated genes tend to be either neighbors or periodically spaced along the whole chromosome. This study demonstrates that respective gene positioning carries significant information. This novel type of information is combined with traditional sequence information by a machine learning algorithm called PreCisIon. To optimize this combination, PreCisIon builds a strong gene target classifier by adaptively combining weak classifiers based on either local binding sequence or global gene position. This strategy generically paves the way to the optimized incorporation of any future advances in gene target prediction based on local sequence, genome layout or on novel criteria. With the current state of the art, PreCisIon consistently improves methods based on sequence information only. This is shown by implementing a cross-validation analysis of the 20 major TFs from two phylogenetically remote model organisms. For Bacillus subtilis and Escherichia coli, respectively, PreCisIon achieves on average an area under the receiver operating characteristic curve of 70 and 60%, a sensitivity of 80 and 70% and a specificity of 60 and 56%. The newly predicted gene targets are demonstrated to be functionally consistent with previously known targets, as assessed by analysis of Gene Ontology enrichment or of the relevant literature and databases.

  19. Finding cis-regulatory modules in Drosophila using phylogenetic hidden Markov models

    DEFF Research Database (Denmark)

    Wong, Wendy S W; Nielsen, Rasmus

    2007-01-01

    MOTIVATION: Finding the regulatory modules for transcription factors binding is an important step in elucidating the complex molecular mechanisms underlying regulation of gene expression. There are numerous methods available for solving this problem, however, very few of them take advantage of th...... of prediction over methods that do not take advantage of the data from multiple species. AVAILABILITY: The new method is made accessible under GPL in a new publicly available JAVA program: EvoPromoter. It can be downloaded at http://sourceforge.net/projects/evopromoter/....

  20. Making connections: Insulators organize eukaryotic chromosomes into independent cis-regulatory networks

    Science.gov (United States)

    Chetverina, Darya; Aoki, Tsutomu; Erokhin, Maksim; Georgiev, Pavel; Schedl, Paul

    2015-01-01

    Summary Insulators play a central role in subdividing the chromosome into a series of discrete topologically independent domains and in ensuring that enhancers and silencers contact their appropriate target genes. In this review we first discuss the general characteristics of insulator elements and their associated protein factors. A growing collection of insulator proteins have been identified including a family of proteins whose expression is developmental regulator. We next consider several unexpected discoveries that require us to completely rethink both how insulators function (and how they can best be assayed). These discoveries also require a reevaluation of how insulators might restrict or orchestrate (by preventing or promoting) interactions between regulatory elements and their target genes. We conclude by connecting these new insights into the mechanisms of insulator action to dynamic changes in the 3-dimensional topology of the chromatin fiber and the generation of specific patterns of gene activity during development and differentiation. PMID:24277632

  1. Landscape of histone modifications in a sponge reveals the origin of animal cis-regulatory complexity

    Science.gov (United States)

    Gaiti, Federico; Jindrich, Katia; Fernandez-Valverde, Selene L; Roper, Kathrein E; Degnan, Bernard M; Tanurdžić, Miloš

    2017-01-01

    Combinatorial patterns of histone modifications regulate developmental and cell type-specific gene expression and underpin animal complexity, but it is unclear when this regulatory system evolved. By analysing histone modifications in a morphologically-simple, early branching animal, the sponge Amphimedonqueenslandica, we show that the regulatory landscape used by complex bilaterians was already in place at the dawn of animal multicellularity. This includes distal enhancers, repressive chromatin and transcriptional units marked by H3K4me3 that vary with levels of developmental regulation. Strikingly, Amphimedon enhancers are enriched in metazoan-specific microsyntenic units, suggesting that their genomic location is extremely ancient and likely to place constraints on the evolution of surrounding genes. These results suggest that the regulatory foundation for spatiotemporal gene expression evolved prior to the divergence of sponges and eumetazoans, and was necessary for the evolution of animal multicellularity. DOI: http://dx.doi.org/10.7554/eLife.22194.001 PMID:28395144

  2. Cis Regulatory Effects on A-to-I RNA Editing in Related Drosophila Species

    Directory of Open Access Journals (Sweden)

    Anne L. Sapiro

    2015-05-01

    Full Text Available Adenosine-to-inosine RNA editing modifies maturing mRNAs through the binding of adenosine deaminase acting on RNA (Adar proteins to double-stranded RNA structures in a process critical for neuronal function. Editing levels at individual editing sites span a broad range and are mediated by both cis-acting elements (surrounding RNA sequence and secondary structure and trans-acting factors. Here, we aim to determine the roles that cis-acting elements and trans-acting factors play in regulating editing levels. Using two closely related Drosophila species, D. melanogaster and D. sechellia, and their F1 hybrids, we dissect the effects of cis sequences from trans regulators on editing levels by comparing species-specific editing in parents and their hybrids. We report that cis sequence differences are largely responsible for editing level differences between these two Drosophila species. This study presents evidence for cis sequence and structure changes as the dominant evolutionary force that modulates RNA editing levels between these Drosophila species.

  3. Hearing Conservation

    Science.gov (United States)

    1995-01-01

    the federal standard. Footnote** See Title 29 Code of Federal Regulations (CFR) 1910.95 "Occupational Noise Exposure." (Back to text) | USDOL | CONTACT INFORMATION | DISCLAIMER | 15 of 15 OSHA 3074 - Hearing Conservation

  4. Wildlife Conservation

    OpenAIRE

    Spash, Clive L.; Aldred, Jonathan

    1998-01-01

    In this paper we consider how conservation has arisen as a key aspect of the reaction to human-initiated degradation and disappearance of ecosystems, wild lands. and wildlife. Concern over species extinction is given an historical perspective which shows the way in which pressure on wild and natural aspects of global ecology have changed in recent centuries. The role of conservation in the struggle to protect the environment is then analysed using underlying ethical arguments behind the econo...

  5. Austere conservation

    DEFF Research Database (Denmark)

    Bluwstein, Jevgeniy; Moyo, Francis; Kicheleri, Rose Peter

    2016-01-01

    . Our findings suggest that WMAs foster very limited ownership, participation and collective action at the community level, because WMA governance follows an austere logic of centralized control over key resources. Thus, we suggest that it is difficult to argue that WMAs are community-owned conservation...... initiatives until a genuinely devolved and more flexible conservation model is implemented to give space for popular participation in rule-making....

  6. CONDOR: a database resource of developmentally associated conserved non-coding elements

    Directory of Open Access Journals (Sweden)

    Smith Sarah

    2007-08-01

    Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

  7. A zebrafish screen for craniofacial mutants identifies wdr68 as a highly conserved gene required for endothelin-1 expression

    Directory of Open Access Journals (Sweden)

    Amsterdam Adam

    2006-06-01

    identification of approximately 25% of the essential genes required for craniofacial development. The identification of zebrafish models for two human disease syndromes indicates that homologs to the other genes are likely to also be relevant for human craniofacial development. The initial characterization of wdr68 suggests an important role in craniofacial development for the highly conserved Wdr68-Dyrk1 protein complexes.

  8. Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Directory of Open Access Journals (Sweden)

    Fraser Tresa S

    2010-11-01

    Full Text Available Abstract Background Dengue viruses (DENV are one of the most important viral diseases in the world with approximately 100 million infections and 200,000 deaths each year. The current lack of an approved tetravalent vaccine and ineffective insecticide control measures warrant a search for alternatives to effectively combat DENV. The trans-splicing variant of the Tetrahymena thermophila group I intron catalytic RNA, or ribozyme, is a powerful tool for post-transcriptional RNA modification. The nature of the ribozyme and the predictability with which it can be directed makes it a powerful tool for modifying RNA in nearly any cell type without the need for genome-altering gene therapy techniques or dependence on native cofactors. Results Several anti-DENV Group I trans-splicing introns (αDENV-GrpIs were designed and tested for their ability to target DENV-2 NGC genomes in situ. We have successfully targeted two different uracil bases on the positive sense genomic strand within the highly conserved 5'-3' cyclization sequence (CS region common to all serotypes of DENV with our αDENV-GrpIs. Our ribozymes have demonstrated ability to specifically trans-splice a new RNA sequence downstream of the targeted site in vitro and in transfected insect cells as analyzed by firefly luciferase and RT-PCR assays. The effectiveness of these αDENV-GrpIs to target infecting DENV genomes is also validated in transfected or transformed Aedes mosquito cell lines upon infection with unattenuated DENV-2 NGC. Conclusions Analysis shows that our αDENV-GrpIs have the ability to effectively trans-splice the DENV genome in situ. Notably, these results show that the αDENV-GrpI 9v1, designed to be active against all forms of Dengue virus, effectively targeted the DENV-2 NGC genome in a sequence specific manner. These novel αDENV-GrpI introns provide a striking alternative to other RNA based approaches for the transgenic suppression of DENV in transformed mosquito cells and

  9. Inhibitory control and visuo-spatial reversibility in Piaget’s seminal number conservation task: A high-density ERP study.

    Directory of Open Access Journals (Sweden)

    Gregoire eBorst

    2013-12-01

    Full Text Available The present high-density ERP study on 13 adults aimed to determine whether number conservation relies on the ability to inhibit the overlearned length-equals-number strategy and then imagine the shortening of the row that was lengthened. Participants performed the number-conservation task and, after the EEG session, the mental imagery task. In the number-conservation task, first two rows with the same number of tokens and the same length were presented on a computer screen (COV condition and then, the tokens in one of the two rows were spread apart (INT condition. Participants were instructed to determine whether the two rows had an identical number of tokens. In the mental imagery task, two rows with different lengths but the same number of tokens were presented and participants were instructed to imagine the tokens in the longer row aligning with the tokens in the shorter row. In the number-conservation task, we found that the amplitudes of the centro-parietal N2 and fronto-central P3 were higher in the INT than in the COV conditions. In addition, the differences in response times between the two conditions were correlated with the differences in the amplitudes of the fronto-central P3. In light of previous results reported on the number-conservation task in adults, the present results suggest that inhibition might be necessary to succeed the number-conservation task in adults even when the transformation of the length of one of the row is displayed. Finally, we also reported correlations between the speed at which participants could imagine the shortening of one of the row in the mental imagery task, the speed at which participants could determine that the two rows had the same number of tokens after the tokens in one of the row were spread apart and the latency of the late positive parietal component in the number-conservation task. Therefore, performing the number-conservation task might involve mental transformation processes in adults.

  10. Conservation Research and Development/ New Ultra-Low Carbon High Strength Steels with Improved Bake Hardenability for Enhanced Stretch Formability and Dent Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Anthony J. DeArdo; C. Isaac Garcia

    2003-12-15

    Conservation Research and Development/New Ultra-Low Carbon High Strength Steels with Improved Bake Hardenability for Enhanced Stretch Formability and Dent Resistance. The experimental work can be divided into four phases. In each phase, the materials were received or designed, processed and tested, to evaluate the BH increment or response, as a function of compositions and processing conditions. Microstructural characterization by various techniques was performed in order to gain insights into the mechanisms of flow stress increment by bake hardening.

  11. Reconciling nature conservation and traditional farming practices: a spatially explicit framework to assess the extent of High Nature Value farmlands in the European countryside.

    Science.gov (United States)

    Lomba, Angela; Alves, Paulo; Jongman, Rob H G; McCracken, David I

    2015-03-01

    Agriculture constitutes a dominant land cover worldwide, and rural landscapes under extensive farming practices acknowledged due to high biodiversity levels. The High Nature Value farmland (HNVf) concept has been highlighted in the EU environmental and rural policies due to their inherent potential to help characterize and direct financial support to European landscapes where high nature and/or conservation value is dependent on the continuation of specific low-intensity farming systems. Assessing the extent of HNV farmland by necessity relies on the availability of both ecological and farming systems' data, and difficulties associated with making such assessments have been widely described across Europe. A spatially explicit framework of data collection, building out from local administrative units, has recently been suggested as a means of addressing such difficulties. This manuscript tests the relevance of the proposed approach, describes the spatially explicit framework in a case study area in northern Portugal, and discusses the potential of the approach to help better inform the implementation of conservation and rural development policies. Synthesis and applications: The potential of a novel approach (combining land use/cover, farming and environmental data) to provide more accurate and efficient mapping and monitoring of HNV farmlands is tested at the local level in northern Portugal. The approach is considered to constitute a step forward toward a more precise targeting of landscapes for agri-environment schemes, as it allowed a more accurate discrimination of areas within the case study landscape that have a higher value for nature conservation.

  12. The selective conservative management of small traumatic pneumothoraces following stab injuries is safe: experience from a high-volume trauma service in South Africa.

    Science.gov (United States)

    Kong, V Y; Oosthuizen, G V; Clarke, D L

    2015-02-01

    The selective conservative management of small pneumothoraces (PTXs) following stab injuries is controversial. We reviewed a cohort of patients managed conservatively in a high volume trauma service in South Africa. A retrospective review over a 2-year period identified 125 asymptomatic patients with small PTXs measuring chest radiograph who were managed conservatively. Of the 125 patients included in the study, 92% were male (115/125), and the median age for all patients was 21 years (19-24). Ninety-seven per cent (121/125) of the weapons involved were knives, and 3% (4/125) were screwdrivers. Sixty-one per cent of all injuries were on the left side. Eighty-two per cent (102/125) sustained a single stab, and 18% (23/125) had multiple stabs. Thirty-nine per cent (49/125) had a PTX <0.5 cm (Group A), 26% (32/125) were ≥ 0.5 to <1 cm (Group B), 19% (24/125) were ≥ 1 to <1.5 cm (Group C) and 15% (20/125) were ≥ 1.5 to <2 cm (Group D). Three per cent of all patients (4/125) eventually required ICDs (one in Group C, three in Group D). All four patients had ICDs in situ for 24 h. The remaining 97% (121/125) were all managed successfully by active clinical observation alone. There were no subsequent readmissions, morbidity or mortality as a direct result of our conservative approach. The selective conservative management of asymptomatic small PTXs from stab injuries is safe if undertaken in the appropriate setting.

  13. Conservation endocrinology

    Science.gov (United States)

    McCormick, Stephen; Romero, L. Michael

    2017-01-01

    Endocrinologists can make significant contributions to conservation biology by helping to understand the mechanisms by which organisms cope with changing environments. Field endocrine techniques have advanced rapidly in recent years and can provide substantial information on the growth, stress, and reproductive status of individual animals, thereby providing insight into current and future responses of populations to changes in the environment. Environmental stressors and reproductive status can be detected nonlethally by measuring a number of endocrine-related endpoints, including steroids in plasma, living and nonliving tissue, urine, and feces. Information on the environmental or endocrine requirements of individual species for normal growth, development, and reproduction will provide critical information for species and ecosystem conservation. For many taxa, basic information on endocrinology is lacking, and advances in conservation endocrinology will require approaches that are both “basic” and “applied” and include integration of laboratory and field approaches.

  14. Bioproduction and optimization of rosmarinic acid production in Solenostemon scutellarioides through media manipulation and conservation of high yielding clone via encapsulation.

    Science.gov (United States)

    Sahu, Ranabir; Dewanjee, Saikat; Gangopadhyay, Moumita

    2013-09-01

    The present study describes the role of different exogenous phytohormones, polyamines and sucrose on growth and rosmarinic acid (RA) production in whole plant culture of Solenostemon scutellarioides. It was further aimed to conserve elite clones via synthetic seed technology. S. scutellarioides was treated either singly or in combination with different phytohormones. Cultures incubated with NAA (0.5 mg L(-1)) yielded the highest RA accumulation (g(-1FW)), but negatively affected the growth. So, overall RA content was insignificant. Cultures incubated with IBA, BAP and GA3 at low concentration significantly improved growth and RA bioaccumulation. In the combinatorial study, IBA+BAP+GA3 (0.5 mg L(-1) each) was found optimum for plant biomass and RA production (65.2% improvement of total RA). Amongst polyamines, putrescine (1 mg L(-1)) exhibited 20.4% improvement of total RA content. The intracellular RA accumulation (g(-1FW)) was significantly higher between 5 and 7% of sucrose concentrations. However, the total increase in RA content was inhibited due to deterioration of the culture with increasing sucrose concentration. Based on the effect of different treatments on growth and RA accumulation, a high yielding and stable plant line was selected for conservation via alginate encapsulation. Uniform shaped alginate coated synthetic seeds conserved up to 6 months exhibited high regeneration potential and RA content.

  15. Using evolutionary conserved modules in gene networks as a strategy to leverage high throughput gene expression queries.

    Directory of Open Access Journals (Sweden)

    Jeanne M Serb

    Full Text Available BACKGROUND: Large-scale gene expression studies have not yielded the expected insight into genetic networks that control complex processes. These anticipated discoveries have been limited not by technology, but by a lack of effective strategies to investigate the data in a manageable and meaningful way. Previous work suggests that using a pre-determined seed-network of gene relationships to query large-scale expression datasets is an effective way to generate candidate genes for further study and network expansion or enrichment. Based on the evolutionary conservation of gene relationships, we test the hypothesis that a seed network derived from studies of retinal cell determination in the fly, Drosophila melanogaster, will be an effective way to identify novel candidate genes for their role in mouse retinal development. METHODOLOGY/PRINCIPAL FINDINGS: Our results demonstrate that a number of gene relationships regulating retinal cell differentiation in the fly are identifiable as pairwise correlations between genes from developing mouse retina. In addition, we demonstrate that our extracted seed-network of correlated mouse genes is an effective tool for querying datasets and provides a context to generate hypotheses. Our query identified 46 genes correlated with our extracted seed-network members. Approximately 54% of these candidates had been previously linked to the developing brain and 33% had been previously linked to the developing retina. Five of six candidate genes investigated further were validated by experiments examining spatial and temporal protein expression in the developing retina. CONCLUSIONS/SIGNIFICANCE: We present an effective strategy for pursuing a systems biology approach that utilizes an evolutionary comparative framework between two model organisms, fly and mouse. Future implementation of this strategy will be useful to determine the extent of network conservation, not just gene conservation, between species and will

  16. Colorful Conservation

    Science.gov (United States)

    Skophammer, Karen

    2011-01-01

    Some people only think about conservation on Earth Day. Being in the "art business" however, this author is always conscious of the many products she thinks get wasted when they could be reused, recycled, and restored--especially in a school building and art room. In this article, she describes an art lesson that allows students to paint…

  17. Creative conservation

    NARCIS (Netherlands)

    Bentham, Roelof J.

    1968-01-01

    The increasing exploitation of our natural resources, the unlimited occupation of ever more new areas, and the intensification of land-use, make it necessary for us to expand the concept of conservation. But we also need to reconsider that concept itself. For the changing conditions in the

  18. [Conservation Units.

    Science.gov (United States)

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  19. Integrating conservation costs into sea level rise adaptive conservation prioritization

    Directory of Open Access Journals (Sweden)

    Mingjian Zhu

    2015-07-01

    Full Text Available Biodiversity conservation requires strategic investment as resources for conservation are often limited. As sea level rises, it is important and necessary to consider both sea level rise and costs in conservation decision making. In this study, we consider costs of conservation in an integrated modeling process that incorporates a geomorphological model (SLAMM, species habitat models, and conservation prioritization (Zonation to identify conservation priorities in the face of landscape dynamics due to sea level rise in the Matanzas River basin of northeast Florida. Compared to conservation priorities that do not consider land costs in the analysis process, conservation priorities that consider costs in the planning process change significantly. The comparison demonstrates that some areas with high conservation values might be identified as lower priorities when integrating economic costs in the planning process and some areas with low conservation values might be identified as high priorities when considering costs in the planning process. This research could help coastal resources managers make informed decisions about where and how to allocate conservation resources more wisely to facilitate biodiversity adaptation to sea level rise.

  20. The high-resolution structure of activated opsin reveals a conserved solvent network in the transmembrane region essential for activation

    Science.gov (United States)

    Blankenship, Elise; Vahedi-Faridi, Ardeschir; Lodowski, David T.

    2015-01-01

    Rhodopsin, a light-activated G protein coupled receptor (GPCR), has been the subject of numerous biochemical and structural investigations, serving as a model receptor for GPCRs and their activation. Herein we present the 2.3 Å resolution structure of native-source rhodopsin stabilized in a conformation competent for G protein binding. An extensive water-mediated hydrogen bond network linking the chromophore binding site to the site of G protein binding is observed, providing connections to conserved motifs essential for GPCR activation. Comparison of this extensive solvent mediated hydrogen-bonding network to the positions of ordered solvent in earlier crystallographic structures of rhodopsin photointermediates reveals both static structural and dynamic functional water-protein interactions present during the activation process. When taken with observations that solvent occupies similar positions in the structures of other GPCRs, these analyses strongly support an integral role for this dynamic ordered water network in both rhodopsin and GPCR activation. PMID:26526852

  1. Exporting conservation

    OpenAIRE

    LTRA-12

    2012-01-01

    Metadata only record Soil degradation represents a major threat to food security, particularly in mountainous regions of Southeast Asia, where rainfall can wash away inches of topsoil. This article presents conservation agriculture as a potential solution, focusing on the work that North Carolina Agricultural and Technical State University conducts in Southeast Asia in conjunction with regional partners as part of the Sustainable Agriculture and Natural Resource Management (SANREM) collabo...

  2. Identification and solution structure of a highly conserved C-terminal domain within ORF1p required for retrotransposition of long interspersed nuclear element-1.

    Science.gov (United States)

    Januszyk, Kurt; Li, Patrick Wai-Lun; Villareal, Valerie; Branciforte, Dan; Wu, Haihong; Xie, Yongming; Feigon, Juli; Loo, Joseph A; Martin, Sandra L; Clubb, Robert T

    2007-08-24

    Long interspersed nuclear element-1 (LINE-1 or L1) retrotransposons comprise a large fraction of the human and mouse genomes. The mobility of these successful elements requires the protein encoded by open reading frame-1 (ORF1p), which binds single-stranded RNA with high affinity and functions as a nucleic acid chaperone. In this report, we have used limited proteolysis, filter binding, and NMR spectroscopy to characterize the global structure of ORF1p and the three-dimensional structure of a highly conserved RNA binding domain. ORF1p contains three structured regions, a coiled-coil domain, a middle domain of unknown function, and a C-terminal domain (CTD). We show that high affinity RNA binding by ORF1p requires the CTD and residues within an amino acid protease-sensitive segment that joins the CTD to the middle domain. Insights in the mechanism of RNA binding were obtained by determining the solution structure of the CTD, which is shown to adopt a novel fold consisting of a three-stranded beta sheet that is packed against three alpha-helices. An RNA binding surface on the CTD has been localized using chemical shift perturbation experiments and is proximal to residues previously shown to be essential for retrotransposition, RNA binding, and chaperone activity. A similar structure and mechanism of RNA binding is expected for all vertebrate long interspersed nuclear element-1 elements, since residues encoding the middle, protease-sensitive segment, and CTD are highly conserved.

  3. Computational analysis and determination of a highly conserved surface exposed segment in H5N1 avian flu and H1N1 swine flu neuraminidase

    Directory of Open Access Journals (Sweden)

    Nandy Ashesh

    2010-02-01

    Full Text Available Abstract Background Catalytic activity of influenza neuraminidase (NA facilitates elution of progeny virions from infected cells and prevents their self-aggregation mediated by the catalytic site located in the body region. Research on the active site of the molecule has led to development of effective inhibitors like oseltamivir, zanamivir etc, but the high rate of mutation and interspecies reassortment in viral sequences and the recent reports of oseltamivir resistant strains underlines the importance of determining additional target sites for developing future antiviral compounds. In a recent computational study of 173 H5N1 NA gene sequences we had identified a 50-base highly conserved region in 3'-terminal end of the NA gene. Results We extend the graphical and numerical analyses to a larger number of H5N1 NA sequences (514 and H1N1 swine flu sequences (425 accessed from GenBank. We use a 2D graphical representation model for the gene sequences and a Graphical Sliding Window Method (GSWM for protein sequences scanning the sequences as a block of 16 amino acids at a time. Using a protein sequence descriptor defined in our model, the protein sliding scan method allowed us to compare the different strains for block level variability, which showed significant statistical correlation to average solvent accessibility of the residue blocks; single amino acid position variability results in no correlation, indicating the impact of stretch variability in chemical environment. Close to the C-terminal end the GSWM showed less descriptor-variability with increased average solvent accessibility (ASA that is also supported by conserved predicted secondary structure of 3' terminal RNA and visual evidence from 3D crystallographic structure. Conclusion The identified terminal segment, strongly conserved in both RNA and protein sequences, is especially significant as it is surface exposed and structural chemistry reveals the probable role of this stretch in

  4. Orchid conservation: further links.

    Science.gov (United States)

    Fay, Michael F

    2016-07-01

    Due in great part to their often complex interactions with mycorrhizal fungi, pollinators and host trees, Orchidaceae present particular challenges for conservation. Furthermore, orchids, as potentially the largest family of angiosperms with >26000 species, species complexes and frequent hybrid formation, are complex to catalogue. Following a highlight in 2015, a further seven papers focusing on orchids, their interactions with beneficial organisms, pollinators and mycorrhiza, and other factors relating to their conservation, including threats from human utilization and changing land use, are presented here. The production of an online flora of all known plants and an assessment of the conservation status of all known plant species as far as possible, to guide conservation action are the first two targets of the Global Strategy for Plant Conservation Without knowing how many species there are and how they should be circumscribed, neither of these targets is achievable. Orchids are a fascinating subject for fundamental research with rapid species evolution, specific organ structure and development, but they also suffer from high levels of threat. Effective orchid conservation must take account of the beneficial interactions with fungi and pollinators and the potentially detrimental effects of over-collection and changes in land use. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

    DEFF Research Database (Denmark)

    Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens

    1999-01-01

    We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

  6. A highly conserved NF-κB-responsive enhancer is critical for thymic expression of Aire in mice.

    Science.gov (United States)

    Haljasorg, Uku; Bichele, Rudolf; Saare, Mario; Guha, Mithu; Maslovskaja, Julia; Kõnd, Karin; Remm, Anu; Pihlap, Maire; Tomson, Laura; Kisand, Kai; Laan, Martti; Peterson, Pärt

    2015-12-01

    Autoimmune regulator (Aire) has a unique expression pattern in thymic medullary epithelial cells (mTECs), in which it plays a critical role in the activation of tissue-specific antigens. The expression of Aire in mTECs is activated by receptor activator of nuclear factor κB (RANK) signaling; however, the molecular mechanism behind this activation is unknown. Here, we characterize a conserved noncoding sequence 1 (CNS1) containing two NF-κB binding sites upstream of the Aire coding region. We show that CNS1-deficient mice lack thymic expression of Aire and share several features of Aire-knockout mice, including downregulation of Aire-dependent genes, impaired terminal differentiation of the mTEC population, and reduced production of thymic Treg cells. In addition, we show that CNS1 is indispensable for RANK-induced Aire expression and that CNS1 is activated by NF-κB pathway complexes containing RelA. Together, our results indicate that CNS1 is a critical link between RANK signaling, NF-κB activation, and thymic expression of Aire. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Highly conserved functions of the Brachyury gene on morphogenetic movements: insight from the early-diverging phylum Ctenophora.

    Science.gov (United States)

    Yamada, Atsuko; Martindale, Mark Q; Fukui, Akimasa; Tochinai, Shin

    2010-03-01

    Brachyury, a member of the T-box transcription family identified in a diverse array of metazoans, was initially recognized for its function in mesoderm formation and notochord differentiation in vertebrates; however, its ancestral role has been suggested to be in control of morphogenetic movements. Here, we show that morpholino oligonucleotide knockdown of Brachyury (MlBra) in embryos of a ctenophore, one of the most ancient groups of animals, prevents the invagination of MlBra expressing stomodeal cells and is rescued with corresponding RNA injections. Injection of RNA encoding a dominant-interfering construct of MlBra causes identical phenotypes to that of RNA encoding a dominant-interfering form of Xenopus Brachyury (Xbra) in Xenopus embryos. Both injected embryos down-regulate Xbra downstream genes, Xbra itself and Xwnt11 but not axial mesodermal markers, resulting in failure to complete gastrulation due to loss of convergent extension movements. Moreover, animal cap assay reveals that MlBra induces Xwnt11 like Xbra. Overall results using Xenopus embryos show that these two genes are functionally interchangeable. These functional experiments demonstrate for the first time in a basal metazoan that the primitive role of Brachyury is to regulate morphogenetic movements, rather than to specify endomesodermal fates, and the role is conserved between non-bilaterian metazoans and vertebrates. Copyright 2009 Elsevier Inc. All rights reserved.

  8. A high-order finite-volume method for hyperbolic conservation laws on locally-refined grids

    Energy Technology Data Exchange (ETDEWEB)

    McCorquodale, Peter; Colella, Phillip

    2011-01-28

    We present a fourth-order accurate finite-volume method for solving time-dependent hyperbolic systems of conservation laws on Cartesian grids with multiple levels of refinement. The underlying method is a generalization of that in [5] to nonlinear systems, and is based on using fourth-order accurate quadratures for computing fluxes on faces, combined with fourth-order accurate Runge?Kutta discretization in time. To interpolate boundary conditions at refinement boundaries, we interpolate in time in a manner consistent with the individual stages of the Runge-Kutta method, and interpolate in space by solving a least-squares problem over a neighborhood of each target cell for the coefficients of a cubic polynomial. The method also uses a variation on the extremum-preserving limiter in [8], as well as slope flattening and a fourth-order accurate artificial viscosity for strong shocks. We show that the resulting method is fourth-order accurate for smooth solutions, and is robust in the presence of complex combinations of shocks and smooth flows.

  9. Evolution of gene regulatory network architectures: examples of subcircuit conservation and plasticity between classes of echinoderms.

    Science.gov (United States)

    Hinman, Veronica F; Yankura, Kristen A; McCauley, Brenna S

    2009-04-01

    Developmental gene regulatory networks (GRNs) explain how regulatory states are established in particular cells during development and how these states then determine the final form of the embryo. Evolutionary changes to the sequence of the genome will direct reorganization of GRN architectures, which in turn will lead to the alteration of developmental programs. A comparison of GRN architectures must consequently reveal the molecular basis for the evolution of developmental programs among different organisms. This review highlights some of the important findings that have emerged from the most extensive direct comparison of GRN architectures to date. Comparison of the orthologous GRNs for endomesodermal specification in the sea urchin and sea star, provides examples of several discrete, functional GRN subcircuits and shows that they are subject to diverse selective pressures. This demonstrates that different regulatory linkages may be more or less amenable to evolutionary change. One of the more surprising findings from this comparison is that GRN-level functions may be maintained while the factors performing the functions have changed, suggesting that GRNs have a high capacity for compensatory changes involving transcription factor binding to cis regulatory modules.

  10. High spatial resolution mapping of the Cerrado's land cover and land use types in the priority area for conservation Chapada da Contagem, Brazil.

    Science.gov (United States)

    Ribeiro, F.; Roberts, D. A.; Davis, F. W.; Antunes Daldegan, G.; Nackoney, J.; Hess, L. L.

    2016-12-01

    The Brazilian savanna, Cerrado, is the second largest biome over South America and the most floristically diverse savanna in the world. This biome is considered a conservation hotspot in respect to its biodiversity importance and rapid transformation of its landscape. The Cerrado's natural vegetation has been severely transformed by agriculture and pasture activities. Currently it is the main agricultural frontier in Brazil and one of the most threatened Brazilian biomes. This scenario results in environmental impacts such as ecosystems fragmentation as well as losses in connectivity, biodiversity and gene flow, changes in the microclimate and energy, carbon and nutrients cycles, among others. The Priority Areas for Conservation is a governmental program from Brazil that identifies areas with high conservation priority. One of this program's recommendation is a natural vegetation map including their major ecosystem classes. This study aims to generate more precise information for the Cerrado's vegetation. The main objective of this study is to identify which ecosystems are being prioritized and/or threatened by land use, refining information for further protection. In order to test methods, the priority area for conservation Chapada da Contagem was selected as the study site. This area is ranked as "extremely high priority" by the government and is located in the Federal District and Goias State, Brazil. Satellites with finer spatial resolution may improve the classification of the Cerrado's vegetation. Remote sensing methods and two criteria were tested using RapidEye 3A imagery (5m spatial resolution) collected in 2014 in order to classify the Cerrado's major land cover types of this area, as well as its land use. One criterion considers the Cerrado's major terrestrial ecosystems, which are divided into forest, savanna and grassland. The other involves scaling it down to the major physiognomic groups of each ecosystem. Other sources of environmental dataset such

  11. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex.

    Science.gov (United States)

    Stegmann, Cora; Abdellatif, Mohamed E A; Laib Sampaio, Kerstin; Walther, Paul; Sinzger, Christian

    2017-01-01

    The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection. Like all herpesviruses, the widespread human pathogen HCMV depends on glycoproteins gB, gH, and gL for entry into target cells. Additionally, gH and gL have to bind gO in a trimeric complex for efficient cell-free infection. Homologs of gO are shared by all cytomegaloviruses, with 13 amino acids being highly conserved. In a mutational

  12. Positive selection drives rapid evolution of certain amino acid residues in an evolutionarily highly conserved interferon-inducible antiviral protein of fishes.

    Science.gov (United States)

    Padhi, Abinash

    2013-01-01

    Viperin, an evolutionarily highly conserved interferon-inducible multifunctional protein, has previously been reported to exhibit antiviral activity against a wide range of DNA and RNA viruses. Utilizing the complete nucleotide coding sequence data of fish viperin antiviral genes, and employing the maximum likelihood-based codon substitution models, the present study reports the pervasive role of positive selection in the evolution of viperin antiviral protein in fishes. The overall rate of nonsynonymous (dN) to synonymous (dS) substitutions (dN/dS) for the three functional domains of viperin (N-terminal, central domain and C-terminal) were 1.1, 0.12, and 0.24, respectively. Codon-by-codon substitution analyses have revealed that while most of the positively selected sites were located at the N-terminal amphipathic α-helix domain, few amino acid residues at the C-terminal domain were under positive selection. However, none of the sites in the central domain were under positive selection. These results indicate that, although viperin is evolutionarily highly conserved, the three functional domains experienced differential selection pressures. Taken together with the results of previous studies, the present study suggests that the persistent antagonistic nature of surrounding infectious viral pathogens might be the likely cause for such adaptive evolutionary changes of certain amino acids in fish viperin antiviral protein.

  13. Toward High School Biology: Helping Middle School Students Understand Chemical Reactions and Conservation of Mass in Nonliving and Living Systems.

    Science.gov (United States)

    Herrmann-Abell, Cari F; Koppal, Mary; Roseman, Jo Ellen

    2016-01-01

    Modern biology has become increasingly molecular in nature, requiring students to understand basic chemical concepts. Studies show, however, that many students fail to grasp ideas about atom rearrangement and conservation during chemical reactions or the application of these ideas to biological systems. To help provide students with a better foundation, we used research-based design principles and collaborated in the development of a curricular intervention that applies chemistry ideas to living and nonliving contexts. Six eighth grade teachers and their students participated in a test of the unit during the Spring of 2013. Two of the teachers had used an earlier version of the unit the previous spring. The other four teachers were randomly assigned either to implement the unit or to continue teaching the same content using existing materials. Pre- and posttests were administered, and the data were analyzed using Rasch modeling and hierarchical linear modeling. The results showed that, when controlling for pretest score, gender, language, and ethnicity, students who used the curricular intervention performed better on the posttest than the students using existing materials. Additionally, students who participated in the intervention held fewer misconceptions. These results demonstrate the unit's promise in improving students' understanding of the targeted ideas. © 2016 C. F. Herrmann-Abell et al. CBE—Life Sciences Education © 2016 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  14. High-Level Systemic Expression of Conserved Influenza Epitope in Plants on the Surface of Rod-Shaped Chimeric Particles

    Directory of Open Access Journals (Sweden)

    Natalia V. Petukhova

    2014-04-01

    Full Text Available Recombinant viruses based on the cDNA copy of the tobacco mosaic virus (TMV genome carrying different versions of the conserved M2e epitope from influenza virus A cloned into the coat protein (CP gene were obtained and partially characterized by our group previously; cysteines in the human consensus M2e sequence were changed to serine residues. This work intends to show some biological properties of these viruses following plant infections. Agroinfiltration experiments on Nicotiana benthamiana confirmed the efficient systemic expression of M2e peptides, and two point amino acid substitutions in recombinant CPs significantly influenced the symptoms and development of viral infections. Joint expression of RNA interference suppressor protein p19 from tomato bushy stunt virus (TBSV did not affect the accumulation of CP-M2e-ser recombinant protein in non-inoculated leaves. RT-PCR analysis of RNA isolated from either infected leaves or purified TMV-M2e particles proved the genetic stability of TMV‑based viral vectors. Immunoelectron microscopy of crude plant extracts demonstrated that foreign epitopes are located on the surface of chimeric virions. The rod‑shaped geometry of plant-produced M2e epitopes is different from the icosahedral or helical filamentous arrangement of M2e antigens on the carrier virus-like particles (VLP described earlier. Thereby, we created a simple and efficient system that employs agrobacteria and plant viral vectors in order to produce a candidate broad-spectrum flu vaccine.

  15. Physiology in conservation translocations

    Science.gov (United States)

    Tarszisz, Esther; Dickman, Christopher R.; Munn, Adam J.

    2014-01-01

    Conservation translocations aim to restore species to their indigenous ranges, protect populations from threats and/or reinstate ecosystem functions. They are particularly important for the conservation and management of rare and threatened species. Despite tremendous efforts and advancement in recent years, animal conservation translocations generally have variable success, and the reasons for this are often uncertain. We suggest that when little is known about the physiology and wellbeing of individuals either before or after release, it will be difficult to determine their likelihood of survival, and this could limit advancements in the science of translocations for conservation. In this regard, we argue that physiology offers novel approaches that could substantially improve translocations and associated practices. As a discipline, it is apparent that physiology may be undervalued, perhaps because of the invasive nature of some physiological measurement techniques (e.g. sampling body fluids, surgical implantation). We examined 232 publications that dealt with translocations of terrestrial vertebrates and aquatic mammals and, defining ‘success’ as high or low, determined how many of these studies explicitly incorporated physiological aspects into their protocols and monitoring. From this review, it is apparent that physiological evaluation before and after animal releases could progress and improve translocation/reintroduction successes. We propose a suite of physiological measures, in addition to animal health indices, for assisting conservation translocations over the short term and also for longer term post-release monitoring. Perhaps most importantly, we argue that the incorporation of physiological assessments of animals at all stages of translocation can have important welfare implications by helping to reduce the total number of animals used. Physiological indicators can also help to refine conservation translocation methods. These approaches fall

  16. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics.

    Directory of Open Access Journals (Sweden)

    Tsvia Gildor

    2015-07-01

    Full Text Available Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl. The high resolution of our studies reveals highly reproducible gene initiation times that have lower variation than those of maximal mRNA levels between different individuals of the same species. This observation supports a threshold behavior of gene activation that is less sensitive to input concentrations. We then compare Mediterranean sea urchin gene expression profiles to those of its Pacific Ocean relative, Strongylocentrotus purpuratus (Sp. These species shared a common ancestor about 40 million years ago and show highly similar embryonic morphologies. Our comparative analyses of five regulatory circuits operating in different embryonic territories reveal a high conservation of the temporal order of gene activation but also some cases of divergence. A linear ratio of 1.3-fold between gene initiation times in Pl and Sp is partially explained by scaling of the developmental rates with temperature. Scaling the developmental rates according to the estimated Sp-Pl ratio and normalizing the expression levels reveals a striking conservation of relative dynamics of gene expression between the species. Overall, our findings demonstrate the ability of biological developmental systems to tightly control the timing of gene activation and relative dynamics and overcome expression noise induced by genetic variation and growth conditions.

  17. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics.

    Science.gov (United States)

    Gildor, Tsvia; Ben-Tabou de-Leon, Smadar

    2015-07-01

    Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl). The high resolution of our studies reveals highly reproducible gene initiation times that have lower variation than those of maximal mRNA levels between different individuals of the same species. This observation supports a threshold behavior of gene activation that is less sensitive to input concentrations. We then compare Mediterranean sea urchin gene expression profiles to those of its Pacific Ocean relative, Strongylocentrotus purpuratus (Sp). These species shared a common ancestor about 40 million years ago and show highly similar embryonic morphologies. Our comparative analyses of five regulatory circuits operating in different embryonic territories reveal a high conservation of the temporal order of gene activation but also some cases of divergence. A linear ratio of 1.3-fold between gene initiation times in Pl and Sp is partially explained by scaling of the developmental rates with temperature. Scaling the developmental rates according to the estimated Sp-Pl ratio and normalizing the expression levels reveals a striking conservation of relative dynamics of gene expression between the species. Overall, our findings demonstrate the ability of biological developmental systems to tightly control the timing of gene activation and relative dynamics and overcome expression noise induced by genetic variation and growth conditions.

  18. Mammals of the high altitudes of western Arunachal Pradesh, eastern Himalaya: an assessment of threats and conservation needs

    NARCIS (Netherlands)

    Mishra, C.; Madhusudan, M.D.; Datta, A.

    2006-01-01

    he high altitudes of Arunachal Pradesh, India, located in the Eastern Himalaya biodiversity hotspot, remain zoologically unexplored and unprotected. We report results of recent mammal surveys in the high altitude habitats of western Arunachal Pradesh. A total of 35 mammal species (including 12

  19. Comprehensive Non-Destructive Conservation Documentation of Lunar Samples Using High-Resolution Image-Based 3D Reconstructions and X-Ray CT Data

    Science.gov (United States)

    Blumenfeld, E. H.; Evans, C. A.; Oshel, E. R.; Liddle, D. A.; Beaulieu, K.; Zeigler, R. A.; Hanna, R. D.; Ketcham, R. A.

    2015-01-01

    Established contemporary conservation methods within the fields of Natural and Cultural Heritage encourage an interdisciplinary approach to preservation of heritage material (both tangible and intangible) that holds "Outstanding Universal Value" for our global community. NASA's lunar samples were acquired from the moon for the primary purpose of intensive scientific investigation. These samples, however, also invoke cultural significance, as evidenced by the millions of people per year that visit lunar displays in museums and heritage centers around the world. Being both scientifically and culturally significant, the lunar samples require a unique conservation approach. Government mandate dictates that NASA's Astromaterials Acquisition and Curation Office develop and maintain protocols for "documentation, preservation, preparation and distribution of samples for research, education and public outreach" for both current and future collections of astromaterials. Documentation, considered the first stage within the conservation methodology, has evolved many new techniques since curation protocols for the lunar samples were first implemented, and the development of new documentation strategies for current and future astromaterials is beneficial to keeping curation protocols up to date. We have developed and tested a comprehensive non-destructive documentation technique using high-resolution image-based 3D reconstruction and X-ray CT (XCT) data in order to create interactive 3D models of lunar samples that would ultimately be served to both researchers and the public. These data enhance preliminary scientific investigations including targeted sample requests, and also provide a new visual platform for the public to experience and interact with the lunar samples. We intend to serve these data as they are acquired on NASA's Astromaterials Acquisistion and Curation website at http://curator.jsc.nasa.gov/. Providing 3D interior and exterior documentation of astromaterial

  20. A model of tripeptidyl-peptidase I (CLN2, a ubiquitous and highly conserved member of the sedolisin family of serine-carboxyl peptidases

    Directory of Open Access Journals (Sweden)

    Oyama Hiroshi

    2003-11-01

    Full Text Available Abstract Background Tripeptidyl-peptidase I, also known as CLN2, is a member of the family of sedolisins (serine-carboxyl peptidases. In humans, defects in expression of this enzyme lead to a fatal neurodegenerative disease, classical late-infantile neuronal ceroid lipofuscinosis. Similar enzymes have been found in the genomic sequences of several species, but neither systematic analyses of their distribution nor modeling of their structures have been previously attempted. Results We have analyzed the presence of orthologs of human CLN2 in the genomic sequences of a number of eukaryotic species. Enzymes with sequences sharing over 80% identity have been found in the genomes of macaque, mouse, rat, dog, and cow. Closely related, although clearly distinct, enzymes are present in fish (fugu and zebra, as well as in frogs (Xenopus tropicalis. A three-dimensional model of human CLN2 was built based mainly on the homology with Pseudomonas sp. 101 sedolisin. Conclusion CLN2 is very highly conserved and widely distributed among higher organisms and may play an important role in their life cycles. The model presented here indicates a very open and accessible active site that is almost completely conserved among all known CLN2 enzymes. This result is somehow surprising for a tripeptidase where the presence of a more constrained binding pocket was anticipated. This structural model should be useful in the search for the physiological substrates of these enzymes and in the design of more specific inhibitors of CLN2.

  1. Characterization of chicken octamer-binding proteins demonstrates that POU domain-containing homeobox transcription factors have been highly conserved during vertebrate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Petryniak, B.; Postema, C.E.; McCormack, W.T.; Thompson, C.B. (Univ. of Michigan Medical Center, Ann Arbor (USA)); Staudt, L.M. (National Cancer Institute, Bethesda, MD (USA))

    1990-02-01

    The DNA sequence motif ATTTGCAT (octamer) or its inverse complement has been identified as an evolutionarily conserved element in the promoter region of immunoglobulin genes. Two major DNA-binding proteins that bind in a sequence-specific manner to the octamer DNA sequence have been identified in mammalian species--a ubiquitously expressed protein (Oct-1) and a lymphoid-specific protein (Oct-2). During characterization of the promoter region of the chicken immunoglobulin light chain gene, the authors identified two homologous octamer-binding proteins in chicken B cells. when the cloning of the human gene for Oct-2 revealed it to be a member of a distinct family of homeobox genes, they sought to determine if the human Oct-2 cDNA could be used to identify homologous chicken homeobox genes. Using a human Oct-2 homeobox-specific DNA probe, they were able to identify 6-10 homeobox-containing genes in the chicken genome, demonstrating that the Oct-2-related subfamily of homeobox genes exists in avian species. DNA sequence analysis revealed it to be the chicken homologue of the human Oct-1 gene. Together, the data show that the POU-containing subfamily of homeobox genes have been highly conserved during vertebrate evolution, apparently as a result of selection for their DNA-binding and transcriptional regulatory properties.

  2. High order sub-cell finite volume schemes for solving hyperbolic conservation laws I: basic formulation and one-dimensional analysis

    Science.gov (United States)

    Pan, JianHua; Ren, YuXin

    2017-08-01

    In this paper, a family of sub-cell finite volume schemes for solving the hyperbolic conservation laws is proposed and analyzed in one-dimensional cases. The basic idea of this method is to subdivide a control volume (main cell) into several sub-cells and the finite volume discretization is applied to each of the sub-cells. The averaged values on the sub-cells of current and face neighboring main cells are used to reconstruct the polynomial distributions of the dependent variables. This method can achieve arbitrarily high order of accuracy using a compact stencil. It is similar to the spectral volume method incorporating with PNPM technique but with fundamental differences. An elaborate utilization of these differences overcomes some shortcomings of the spectral volume method and results in a family of accurate and robust schemes for solving the hyperbolic conservation laws. In this paper, the basic formulation of the proposed method is presented. The Fourier analysis is performed to study the properties of the one-dimensional schemes. A WENO limiter based on the secondary reconstruction is constructed.

  3. Sensitivity analysis of conservation targets in systematic conservation planning.

    Science.gov (United States)

    Levin, Noam; Mazor, Tessa; Brokovich, Eran; Jablon, Pierre-Elie; Kark, Salit

    2015-10-01

    Systematic conservation planning has rapidly advanced in the past decade and has been increasingly incorporated in multiple studies and conservation projects. One of its requirements is a quantitative definition of conservation targets. While the Convention on Biological Diversity aims to expand the world's protected area network to 17% of the land surface, in many cases such uniform policy-driven targets may not be appropriate for achieving persistence of various species. Targets are often set arbitrarily, often because information required for the persistence of each species is unavailable or unknown in the focal region. Conservation planners therefore need to establish complementary novel approaches to address the gaps in setting targets. Here, we develop and present a novel method that aims to help guide the selection of conservation targets, providing support for decision makers, planners, and managers. This is achieved by examining the overall flexibility of the conservation network resulting from conservation prioritization, and aiming for greater flexibility. To test this approach we applied the decision support tool Marxan to determine marine conservation priority areas in the eastern Mediterranean Sea as a case study. We assessed the flexibility of the conservation network by comparing 80 different scenarios in which conservation targets were gradually increased and assessed by a range of calculated metrics (e.g., the percentage of the total area selected, the overall connectivity). We discovered that when conservation targets were set too low (i.e., below 10% of the distribution range of each species), very few areas were identified as irreplaceable and the conservation network was not well defined. Interestingly, when conservation targets were set too high (over 50% of the species' range), too many conservation priority areas were selected as irreplaceable, an outcome which is realistically infeasible to implement. As a general guideline, we found that

  4. Inhibition of Hepatitis C Virus in Mice by a Small Interfering RNA Targeting a Highly Conserved Sequence in Viral IRES Pseudoknot.

    Directory of Open Access Journals (Sweden)

    Jae-Su Moon

    Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.

  5. The highly conserved 5' untranslated region as an effective target towards the inhibition of Enterovirus 71 replication by unmodified and appropriate 2'-modified siRNAs

    Directory of Open Access Journals (Sweden)

    Deng Jun-Xia

    2012-08-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 is a highly infectious agent that plays an etiological role in hand, foot, and mouth disease. It is associated with severe neurological complications and has caused significant mortalities in recent large-scale outbreaks. Currently, no effective vaccine or specific clinical therapy is available against EV71. Methods Unmodified 21 nucleotide small interfering RNAs (siRNAs and classic 2′-modified (2′-O-methylation or 2′-fluoro modification siRNAs were designed to target highly conserved 5′ untranslated region (UTR of the EV71 genome and employed as anti-EV71 agents. Real-time TaqMan RT-PCR, western blot analysis and plaque assays were carried out to evaluate specific viral inhibition by the siRNAs. Results Transfection of rhabdomyosarcoma (RD cells with siRNAs targeting the EV71 genomic 5′ UTR significantly delayed and alleviated the cytopathic effects of EV71 infection, increased cell viability in EV71-infected RD cells. The inhibitory effect on EV71 replication was sequence-specific and dosage-dependent, with significant corresponding decreases in viral RNA, VP1 protein and viral titer. Appropriate 2′-modified siRNAs exhibited similar RNA interference (RNAi activity with dramatically increased serum stability in comparison with unmodified counterparts. Conclusion Sequences were identified within the highly conserved 5′ UTR that can be targeted to effectively inhibit EV71 replication through RNAi strategies. Appropriate 2′-modified siRNAs provide a promising approach to optimizing siRNAs to overcome barriers on RNAi-based antiviral therapies for broader administration.

  6. The highly conserved 5' untranslated region as an effective target towards the inhibition of Enterovirus 71 replication by unmodified and appropriate 2'-modified siRNAs.

    Science.gov (United States)

    Deng, Jun-Xia; Nie, Xiao-Jing; Lei, Ying-Feng; Ma, Chao-Feng; Xu, Dong-Liang; Li, Biao; Xu, Zhi-Kai; Zhang, Guo-Cheng

    2012-08-13

    Enterovirus 71 (EV71) is a highly infectious agent that plays an etiological role in hand, foot, and mouth disease. It is associated with severe neurological complications and has caused significant mortalities in recent large-scale outbreaks. Currently, no effective vaccine or specific clinical therapy is available against EV71. Unmodified 21 nucleotide small interfering RNAs (siRNAs) and classic 2'-modified (2'-O-methylation or 2'-fluoro modification) siRNAs were designed to target highly conserved 5' untranslated region (UTR) of the EV71 genome and employed as anti-EV71 agents. Real-time TaqMan RT-PCR, western blot analysis and plaque assays were carried out to evaluate specific viral inhibition by the siRNAs. Transfection of rhabdomyosarcoma (RD) cells with siRNAs targeting the EV71 genomic 5' UTR significantly delayed and alleviated the cytopathic effects of EV71 infection, increased cell viability in EV71-infected RD cells. The inhibitory effect on EV71 replication was sequence-specific and dosage-dependent, with significant corresponding decreases in viral RNA, VP1 protein and viral titer. Appropriate 2'-modified siRNAs exhibited similar RNA interference (RNAi) activity with dramatically increased serum stability in comparison with unmodified counterparts. Sequences were identified within the highly conserved 5' UTR that can be targeted to effectively inhibit EV71 replication through RNAi strategies. Appropriate 2'-modified siRNAs provide a promising approach to optimizing siRNAs to overcome barriers on RNAi-based antiviral therapies for broader administration.

  7. Hepatitis B virus depicts a high degree of conservation during the immune-tolerant phase in familiarly transmitted chronic hepatitis B infection: deep-sequencing and phylogenetic analysis.

    Science.gov (United States)

    Sede, M; Lopez-Ledesma, M; Frider, B; Pozzati, M; Campos, R H; Flichman, D; Quarleri, J

    2014-01-01

    When intrafamilial transmission of hepatitis B virus (HBV) occurs, a virus with the same characteristics interacts with diverse hosts' immune systems and may thus result in different mutations to escape immune pressure. In this study, the HBV genomic characterization was assessed longitudinally after intrafamilial transmission using nucleotide sequence data of phylogenetic and mutational analyses, including those obtained by deep-sequencing for the first time. Furthermore, HBeAg-anti-HBe profile and variability of HBV core-derived epitopes were also evaluated. Strong evidence was obtained from intrafamilial transmission of HBV genotype D1 by phylogenetic inferences. HBV isolates exhibited high degree (~99%) of genomic conservation for almost 20 years, when patients were persistently HBeAg positive with normal amino transferase levels. This identity remained high among immune-tolerant siblings. In contrast, it diminished significantly (P = 0.02) when the mother cleared HBeAg (immune clearance phase). By deep-sequencing, the quantitative analysis of the dynamics of basal core promoter (BCP) (A1762T, G1764A; A1766C; T1773C; 8-bp deletion; and other) and precore (G1896A) variants among HBV isolates from family members exhibited differences during the follow-up. However, only those from the mother showed amino acid variations at core protein that would impair their MHC-II binding. Hence, when intrafamilial transmission occurs, HBV was highly conserved under the immune-tolerant phase, but it exhibited mutations more frequently during the immune clearance phase. The analysis of the HBV BCP and precore mutants after intrafamilial HBV transmission contributes to a better understanding of how they evolve over time. © 2013 John Wiley & Sons Ltd.

  8. Use of genotyping by sequencing data to develop a high-throughput and multifunctional SNP panel for conservation applications in Pacific lamprey.

    Science.gov (United States)

    Hess, Jon E; Campbell, Nathan R; Docker, Margaret F; Baker, Cyndi; Jackson, Aaron; Lampman, Ralph; McIlraith, Brian; Moser, Mary L; Statler, David P; Young, William P; Wildbill, Andrew J; Narum, Shawn R

    2015-01-01

    Next-generation sequencing data can be mined for highly informative single nucleotide polymorphisms (SNPs) to develop high-throughput genomic assays for nonmodel organisms. However, choosing a set of SNPs to address a variety of objectives can be difficult because SNPs are often not equally informative. We developed an optimal combination of 96 high-throughput SNP assays from a total of 4439 SNPs identified in a previous study of Pacific lamprey (Entosphenus tridentatus) and used them to address four disparate objectives: parentage analysis, species identification and characterization of neutral and adaptive variation. Nine of these SNPs are FST outliers, and five of these outliers are localized within genes and significantly associated with geography, run-timing and dwarf life history. Two of the 96 SNPs were diagnostic for two other lamprey species that were morphologically indistinguishable at early larval stages and were sympatric in the Pacific Northwest. The majority (85) of SNPs in the panel were highly informative for parentage analysis, that is, putatively neutral with high minor allele frequency across the species' range. Results from three case studies are presented to demonstrate the broad utility of this panel of SNP markers in this species. As Pacific lamprey populations are undergoing rapid decline, these SNPs provide an important resource to address critical uncertainties associated with the conservation and recovery of this imperiled species. © 2014 John Wiley & Sons Ltd.

  9. High degree of conservancy among secreted salivary gland proteins from two geographically distant Phlebotomus duboscqi sandflies populations (Mali and Kenya

    Directory of Open Access Journals (Sweden)

    Sissoko Ibrahim

    2006-09-01

    Full Text Available Abstract Background Salivary proteins from sandflies are potential targets for exploitation as vaccines to control Leishmania infection; in this work we tested the hypothesis that salivary proteins from geographically distant Phlebotomus duboscqi sandfly populations are highly divergent due to the pressure exerted by the host immune response. Salivary gland cDNA libraries were prepared from wild-caught P. duboscqi from Mali and recently colonised flies of the same species from Kenya. Results Transcriptome and proteome analysis resulted in the identification of the most abundant salivary gland-secreted proteins. Orthologues of these salivary proteins were identified by phylogenetic tree analysis. Moreover, comparative analysis between the orthologues of these two different populations resulted in a high level of protein identity, including the predicted MHC class II T-cell epitopes from all these salivary proteins. Conclusion These data refute the hypothesis that salivary proteins from geographically distinct populations of the same Phlebotomus sandfly species are highly divergent. They also suggest the potential for using the same species-specific components in a potential vector saliva-based vaccine.

  10. Priorities for global felid conservation.

    Science.gov (United States)

    Dickman, Amy J; Hinks, Amy E; Macdonald, Ewan A; Burnham, Dawn; Macdonald, David W

    2015-06-01

    Conservation resources are limited, necessitating prioritization of species and locations for action. Most prioritization approaches are based solely on biologically relevant characteristics of taxa or areas and ignore geopolitical realities. Doing so risks a poor return on conservation investment due to nonbiological factors, such as economic or political instability. We considered felids, a taxon which attracts intense conservation attention, to demonstrate a new approach that incorporates both intrinsic species traits and geopolitical characteristics of countries. We developed conservation priority scores for wild felids based on their International Union for Conservation of Nature status, body mass, habitat, range within protected area, evolutionary distinctiveness, and conservation umbrella potential. We used published data on governance, economics and welfare, human population pressures, and conservation policy to assign conservation-likelihood scores to 142 felid-hosting countries. We identified 71 countries as high priorities (above median) for felid conservation. These countries collectively encompassed all 36 felid species and supported an average of 96% of each species' range. Of these countries, 60.6% had below-average conservation-likelihood scores, which indicated these countries are relatively risky conservation investments. Governance was the most common factor limiting conservation likelihood. It was the major contributor to below-median likelihood scores for 62.5% of the 32 felid species occurring in lower-likelihood countries. Governance was followed by economics for which scores were below median for 25% of these species. An average of 58% of species' ranges occurred in 43 higher-priority lower-likelihood countries. Human population pressure was second to governance as a limiting factor when accounting for percentage of species' ranges in each country. As conservation likelihood decreases, it will be increasingly important to identify relevant

  11. The ORF59 DNA polymerase processivity factor homologs of Old World primate RV2 rhadinoviruses are highly conserved nuclear antigens expressed in differentiated epithelium in infected macaques

    Directory of Open Access Journals (Sweden)

    Burnside Kellie L

    2009-11-01

    Full Text Available Abstract Background ORF59 DNA polymerase processivity factor of the human rhadinovirus, Kaposi's sarcoma-associated herpesvirus (KSHV, is required for efficient copying of the genome during virus replication. KSHV ORF59 is antigenic in the infected host and is used as a marker for virus activation and replication. Results We cloned, sequenced and expressed the genes encoding related ORF59 proteins from the RV1 rhadinovirus homologs of KSHV from chimpanzee (PtrRV1 and three species of macaques (RFHVMm, RFHVMn and RFHVMf, and have compared them with ORF59 proteins obtained from members of the more distantly-related RV2 rhadinovirus lineage infecting the same non-human primate species (PtrRV2, RRV, MneRV2, and MfaRV2, respectively. We found that ORF59 homologs of the RV1 and RV2 Old World primate rhadinoviruses are highly conserved with distinct phylogenetic clustering of the two rhadinovirus lineages. RV1 and RV2 ORF59 C-terminal domains exhibit a strong lineage-specific conservation. Rabbit antiserum was developed against a C-terminal polypeptide that is highly conserved between the macaque RV2 ORF59 sequences. This anti-serum showed strong reactivity towards ORF59 encoded by the macaque RV2 rhadinoviruses, RRV (rhesus and MneRV2 (pig-tail, with no cross reaction to human or macaque RV1 ORF59 proteins. Using this antiserum and RT-qPCR, we determined that RRV ORF59 is expressed early after permissive infection of both rhesus primary fetal fibroblasts and African green monkey kidney epithelial cells (Vero in vitro. RRV- and MneRV2-infected foci showed strong nuclear expression of ORF59 that correlated with production of infectious progeny virus. Immunohistochemical studies of an MneRV2-infected macaque revealed strong nuclear expression of ORF59 in infected cells within the differentiating layer of epidermis corroborating previous observations that differentiated epithelial cells are permissive for replication of KSHV-like rhadinoviruses

  12. Molecular Characterization and Expression Profiling of Brachypodium distachyon L. Cystatin Genes Reveal High Evolutionary Conservation and Functional Divergence in Response to Abiotic Stress

    Directory of Open Access Journals (Sweden)

    Saminathan Subburaj

    2017-05-01

    Full Text Available Cystatin is a class of proteins mainly involved in cysteine protease inhibition and plant growth and development, as well as tolerance under various abiotic stresses. In this study, we performed the first comprehensive analysis of the molecular characterization and expression profiling in response to various abiotic stresses of the cystatin gene family in Brachypodium distachyon, a novel model plant for Triticum species with huge genomes. Comprehensive searches of the Brachypodium genome database identified 25 B. distachyon cystatin (BdC genes that are distributed unevenly on chromosomes; of these, nine and two were involved in tandem and segmental duplication events, respectively. All BdC genes had similar exon/intron structural organization, with three conserved motifs similar to those from other plant species, indicating their high evolutionary conservation. Expression profiling of 10 typical BdC genes revealed ubiquitous expression in different organs at varying expression levels. BdC gene expression in seedling leaves was particularly highly induced by various abiotic stresses, including the plant hormone abscisic acid and various environmental cues (cold, H2O2, CdCl2, salt, and drought. Interestingly, most BdC genes were significantly upregulated under multiple abiotic stresses, including BdC15 under all stresses, BdC7-2 and BdC10 under five stresses, and BdC7-1, BdC2-1, BdC14, and BdC12 under four stresses. The putative metabolic pathways of cytastin genes in response to various abiotic stresses mainly involve the aberrant protein degradation pathway and reactive oxygen species (ROS-triggered programmed cell death signaling pathways. These observations provide a better understanding of the structural and functional characteristics of the plant cystatin gene family.

  13. Repeated conservation threats across the Americas: High levels of blood and bone lead in the Andean Condor widen the problem to a continental scale.

    Science.gov (United States)

    Wiemeyer, Guillermo M; Pérez, Miguel A; Torres Bianchini, Laura; Sampietro, Luciano; Bravo, Guillermo F; Jácome, N Luis; Astore, Vanesa; Lambertucci, Sergio A

    2017-01-01

    Wildlife lead exposure is an increasing conservation threat that is being widely investigated. However, for some areas of the world (e.g., South America) and certain species, research on this subject is still scarce or only local information is available. We analyzed the extent and intensity of lead exposure for a widely distributed threatened species, the Andean Condor (Vultur gryphus). We conducted the study at two different scales: 1) sampling of birds received for rehabilitation or necropsy in Argentina, and 2) bibliographic review and extensive survey considering exposure event for the species' distribution in South America. Wild condors from Argentina (n = 76) presented high lead levels consistent with both recent and previous exposure (up to 104 μg/dL blood level, mean 15.47 ± 21.21 μg/dL and up to 148.20 ppm bone level, mean 23.08 ± 31.39 ppm). In contrast, captive bred individuals -not exposed to lead contamination- had much lower lead levels (mean blood level 5.63 ± 3.08 μg/dL, and mean bone level 2.76 ± 3.06 ppm). Condors were exposed to lead throughout their entire range in continental Argentina, which represents almost sixty percent (>4000 km) of their geographical distribution. We also present evidence of lead exposure events in Chile, Ecuador, and Peru. Lead poisoning is a widespread major conservation threat for the Andean Condor, and probably other sympatric carnivores from South America. The high number and wide range of Andean Condors with lead values complement the results for the California Condor and other scavengers in North America suggesting lead poisoning is a continental threat. Urgent actions are needed to reduce this poison in the wild. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Integrating Landsat Data and High-Resolution Imagery for Applied Conservation Assessment of Forest Cover in Latin American Heterogenous Landscapes

    Science.gov (United States)

    Thomas, N.; Rueda, X.; Lambin, E.; Mendenhall, C. D.

    2012-12-01

    Large intact forested regions of the world are known to be critical to maintaining Earth's climate, ecosystem health, and human livelihoods. Remote sensing has been successfully implemented as a tool to monitor forest cover and landscape dynamics over broad regions. Much of this work has been done using coarse resolution sensors such as AVHRR and MODIS in combination with moderate resolution sensors, particularly Landsat. Finer scale analysis of heterogeneous and fragmented landscapes is commonly performed with medium resolution data and has had varying success depending on many factors including the level of fragmentation, variability of land cover types, patch size, and image availability. Fine scale tree cover in mixed agricultural areas can have a major impact on biodiversity and ecosystem sustainability but may often be inadequately captured with the global to regional (coarse resolution and moderate resolution) satellite sensors and processing techniques widely used to detect land use and land cover changes. This study investigates whether advanced remote sensing methods are able to assess and monitor percent tree canopy cover in spatially complex human-dominated agricultural landscapes that prove challenging for traditional mapping techniques. Our study areas are in high altitude, mixed agricultural coffee-growing regions in Costa Rica and the Colombian Andes. We applied Random Forests regression tree analysis to Landsat data along with additional spectral, environmental, and spatial variables to predict percent tree canopy cover at 30m resolution. Image object-based texture, shape, and neighborhood metrics were generated at the Landsat scale using eCognition and included in the variable suite. Training and validation data was generated using high resolution imagery from digital aerial photography at 1m to 2.5 m resolution. Our results are promising with Pearson's correlation coefficients between observed and predicted percent tree canopy cover of .86 (Costa

  15. Conservation Kickstart- Catalyzing Conservation Initiatives Worldwide

    Science.gov (United States)

    Treinish, G.

    2014-12-01

    Adventurers and Scientists for Conservation (ASC) is a nonprofit organization that collects environmental data to catalyze conservation initiatives worldwide. Adventure athletes have the skills and motivation to reach the most remote corners of the world. ASC utilizes those skills to provide the scientific community with data while providing the outdoor community with purpose beyond the personal high of reaching a summit or rowing across an ocean. We carefully select projects, choosing partnerships that will maximize the impact of ASC volunteers. Each project must have a clear path to a tangible conservation outcome and demonstrate a clear need for our brand of volunteers. We partner with government agencies, universities, and independant reseachers to kickstart data collection efforts around the world. Last year, through a partnership with the Olympic National Forest, 20 volunteers from the Seattle area set up and monitored camera traps in an effort to survey for costal Pacific marten. Our work led to the species' listing as "critically imperiled" with NatureServe. A partnership with the inaugural Great Pacific Race, engaging trans-Pacific rowing teams, searched for microplastics in the Pacific Ocean as part of our ongoing microplastics campaign. In a multi-year partnership with the American Prairie Reserve (APR), ASC volunteer crews live and work on the Reserve collecting wildlife data year round. The data we obtain directly informs the Reserve's wildlife management decisions. On this project, our crews have safely and effectively navigated temperature extremes from -30 degrees to 100+ degrees while traveling in a remote location. We are currently scouting projects in the Okavango Delta of Botswana and the rainforest of Suriname where we will be able to cover large amounts of area in a short periord of time. ASC is at the crossroads of the adventure and coservation science communities. Our approach of answering specific questions by using highly skilled and

  16. Development and implementation of a site-specific water quality limit for uranium in a high conservation value ecosystem.

    Science.gov (United States)

    van Dam, Rick A; Hogan, Alicia C; Harford, Andrew J

    2017-07-01

    Water quality guideline values (GVs) are a key tool for water quality assessments. Site-specific GVs, which incorporate data relevant to local conditions and organisms, provide a higher level of confidence that the GV will protect the aquatic ecosystem at a site compared to generic GVs. Site-specific GVs are, therefore, considered particularly suitable for sites of high sociopolitical or ecological importance. The present paper provides an example of the refinement of a site-specific GV for high ecological value aquatic ecosystems in Kakadu National Park, Northern Territory, Australia, to improve its site specificity and statistical robustness, thereby increasing confidence in its application. Uranium is a contaminant of concern for Ranger U mine, which releases water into Magela Creek and Gulungul Creek in Kakadu National Park. A site-specific GV for U has been applied, as a statutory limit, to Magela Creek since 2004 and to Gulungul Creek since 2015. The GV of 6 μg/L U was derived from toxicity data for 5 local species tested under local conditions. The acquisition of additional U data, including new information on the effect of DOC on U toxicity, enabled a revision of the site-specific U GV to 2.8 μg/L U and an ability to adjust the value on the basis of environmental concentrations of DOC. The revised GV has been adopted as the statutory limit, with the regulatory framework structured so the GV requires adjustment based on DOC concentration only when an exceedance occurs. Monitoring data for Magela Creek (2001-2013) and Gulungul Creek (2003-2013) downstream of the mine show that dissolved U has not exceeded 1 μg/L. Integr Environ Assess Manag 2017;13:765-777. © 2016 SETAC. © 2016 SETAC.

  17. The Genetic Linkage Map of the Medicinal Mushroom Agaricus subrufescens Reveals Highly Conserved Macrosynteny with the Congeneric Species Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Marie Foulongne-Oriol

    2016-05-01

    Full Text Available Comparative linkage mapping can rapidly facilitate the transfer of genetic information from model species to orphan species. This macrosynteny analysis approach has been extensively used in plant species, but few example are available in fungi, and even fewer in mushroom crop species. Among the latter, the Agaricus genus comprises the most cultivable or potentially cultivable species. Agaricus bisporus, the button mushroom, is the model for edible and cultivable mushrooms. We have developed the first genetic linkage map for the basidiomycete A. subrufescens, an emerging mushroom crop known for its therapeutic properties and potential medicinal applications. The map includes 202 markers distributed over 16 linkage groups (LG, and covers a total length of 1701 cM, with an average marker spacing of 8.2 cM. Using 96 homologous loci, we also demonstrated the high level of macrosynteny with the genome of A. bisporus. The 13 main LG of A. subrufescens were syntenic to the 13 A. bisporus chromosomes. A disrupted synteny was observed for the three remaining A. subrufescens LG. Electronic mapping of a collection of A. subrufescens expressed sequence tags on A. bisporus genome showed that the homologous loci were evenly spread, with the exception of a few local hot or cold spots of homology. Our results were discussed in the light of Agaricus species evolution process. The map provides a framework for future genetic or genomic studies of the medicinal mushroom A. subrufescens.

  18. Effectiveness of convective drying to conserve indigenous yeasts with high volatile profile isolated from algerian fermented raw bovine milk (Rayeb

    Directory of Open Access Journals (Sweden)

    Latifa HAMOUDI-BELARBI

    2016-01-01

    Full Text Available Abstract Yeasts Candida tropicalis, Yarrowia lipolytica, Wickerhamomyces anomalus, Issatchenkia orientalis, Kluyveromyces marxianus, Saprochaete suaveolens and Trichosporon coremiiforme were isolated and identified by physiological, biochemical tests with API 20C AUX system and molecular methods by restriction fragment analysis of PCR-amplified 28S-rRNA from Algerian fermented raw bovine milk (Rayeb. Selected yeasts S. suaveolens, I. orientalis, K. marxianus and W. anomalus produced esters and higher esters which can exert a pertinent influence on the sensory characteristics of Rayeb. Viability of S. suaveolens and W. anomalus using three methods of drying (freeze-drying, convective drying, and spray-drying and during 4 months of storage at 4 °C and 25 °C in the darkness was studied. Immediately after each drying method, high survival was obtained using freeze-drying followed by convective drying in rice cakes and spray-drying respectively. During storage at 4 °C, convective drying provided better survival of yeast cultures of S. suaveolens and W. anomalus than freeze-drying. At 25 °C of storage, convective and freeze-dried yeast cultures showed no significant loss of viable cells up to 2 months of storage. Spray-dried yeast cultures had the greatest loss of viable count during the 3 months of storage at 25 °C.

  19. Identification of a Highly Conserved Epitope on Avian Influenza Virus Non-Structural Protein 1 Using a Peptide Microarray.

    Directory of Open Access Journals (Sweden)

    Jiashan Sun

    Full Text Available Avian influenza virus (AIV non-structural protein 1 (NS1 is a multifunctional protein. It is present at high levels in infected cells and can be used for AIV detection and diagnosis. In this study, we generated monoclonal antibody (MAb D7 against AIV NS1 protein by immunization of BALB/c mice with purified recombinant NS1 protein expressed in Escherichia coli. Isotype determination revealed that the MAb was IgG1/κ-type subclass. To identify the epitope of the MAb D7, the NS1 protein was truncated into a total of 225 15-mer peptides with 14 amino acid overlaps, which were spotted for a peptide microarray. The results revealed that the MAb D7 recognized the consensus DAPF motif. Furthermore, the AIV NS1 protein with the DAPF motif deletion was transiently expressed in 293T cells and failed to react with MAb D7. Subsequently, the DAPF motif was synthesized with an elongated GSGS linker at both the C- and N-termini. The MAb D7 reacted with the synthesized peptide both in enzyme-linked immunosorbent assay (ELISA and dot-blot assays. From these results, we concluded that DAPF motif is the epitope of MAb D7. To our knowledge, this is the first report of a 4-mer epitope on the NS1 protein of AIV that can be recognized by MAb using a peptide microarray, which is able to simplify epitope identification, and that could serve as the basis for immune responses against avian influenza.

  20. High levels of genetic diversity and population structure in an endemic and rare species: implications for conservation.

    Science.gov (United States)

    Turchetto, Caroline; Segatto, Ana Lúcia A; Mäder, Geraldo; Rodrigues, Daniele M; Bonatto, Sandro L; Freitas, Loreta B

    2016-01-13

    The analysis of genetic structure and variability of isolated species is of critical importance in evaluating whether stochastic or human-caused factors are affecting rare species. Low genetic diversity compromises the ability of populations to evolve and reduces their chances of survival under environmental changes. Petunia secreta, a rare and endemic species, is an annual and heliophilous herb that is bee-pollinated and easily recognizable by its purple and salverform corolla. It was described as a new species of the Petunia genus in 2005. Few individuals of P. secreta have been observed in nature and little is known about this species. All the natural populations of P. secreta that were found were studied using 15 microsatellite loci, two intergenic plastid sequences and morphological traits. Statistical analysis was performed to describe the genetic diversity of this rare species and the results compared with those of more widespread and frequent Petunia species from the same geographic area to understand whether factors associated with population size could affect rare species of this genus. The results showed that despite its rarity, P. secreta presented high genetic diversity that was equivalent to or even higher than that of widespread Petunia species. It was shown that this species is divided into two evolutionary lineages, and the genetic differentiation indices between them and other congeneric species presented different patterns. The major risk to P. secreta maintenance is its rarity, suggesting the necessity of a preservation programme and more biological and evolutionary studies that handle the two evolutionary lineages independently. Published by Oxford University Press on behalf of the Annals of Botany Company.

  1. Cuvier's Beaked Whale, Ziphius cavirostris, Distribution and Occurrence in the Mediterranean Sea: High-Use Areas and Conservation Threats.

    Science.gov (United States)

    Podestà, M; Azzellino, A; Cañadas, A; Frantzis, A; Moulins, A; Rosso, M; Tepsich, P; Lanfredi, C

    Cuvier's beaked whale (Ziphius cavirostris G. Cuvier, 1823) is the only beaked whale species commonly found in the Mediterranean Sea. Until recently, species presence in this area was only inferred from stranding events. Dedicated cetacean surveys have increased our knowledge of the distribution of Cuvier's beaked whales, even though many areas still remain unexplored. Here, we present an updated analysis of available sighting and stranding data, focusing on the atypical mass strandings that have occurred in the Mediterranean Sea since 1963. We describe in detail the five more recent events (2006-14), highlighting their relationship with naval exercises that used mid-frequency active sonar. The distribution of the species is apparently characterized by areas of high density where animals seem to be relatively abundant, including the Alborán Sea, Ligurian Sea, Central Tyrrhenian Sea, southern Adriatic Sea and the Hellenic Trench, but other such areas may exist where little or no survey work has been conducted. Population size has been estimated for the Alborán and Ligurian seas. Habitat modelling studies for those areas, confirmed the species preference for the continental slope and its particular association with submarine canyons, as has also been found to be the case in other areas of the world. The application of results from habitat modelling to areas different from their calibration sites is proposed as a management tool for minimizing the potential impacts of human activities at sea. Military sonar is known worldwide as a threat for this species and is suggested to be a major threat for Cuvier's beaked whale in the Mediterranean Sea. © 2016 Elsevier Ltd. All rights reserved.

  2. A highly conserved candidate chemoreceptor expressed in both olfactory and gustatory tissues in the malaria vector Anopheles gambiae.

    Science.gov (United States)

    Pitts, R Jason; Fox, A Nicole; Zwiebel, Laurence J

    2004-04-06

    Anopheles gambiae is a highly anthropophilic mosquito responsible for the majority of malaria transmission in Africa. The biting and host preference behavior of this disease vector is largely influenced by its sense of smell, which is presumably facilitated by G protein-coupled receptor signaling [Takken, W. & Knols, B. (1999) Annu. Rev. Entomol. 44, 131-157]. Because of the importance of host preference to the mosquitoes' ability to transmit disease, we have initiated studies intended to elucidate the molecular mechanisms underlying olfaction in An. gambiae. In the course of these studies, we have identified a number of genes potentially involved in signal transduction, including a family of candidate odorant receptors. One of these receptors, encoded by GPRor7 (hereafter referred to as AgOr7), is remarkably similar to an odorant receptor that is expressed broadly in olfactory tissues and has been identified in Drosophila melanogaster and other insects [Krieger, J., Klink, O., Mohl, C., Raming, K. & Breer, H. (2003) J. Comp. Physiol. A 189, 519-526; Vosshall, L. B., Amrein, H., Morozov, P. S., Rzhetsky, A. & Axel, R. (1999) Cell 96, 725-736]. We have observed AgOr7 expression in olfactory and gustatory tissues in adult An. gambiae and during several stages of the mosquitoes' development. Within the female adult peripheral chemosensory system, antiserum against the AgOR7 polypeptide labels most sensilla of the antenna and maxillary palp as well as a subset of proboscis sensilla. Furthermore, AgOR7 antiserum labeling is observed within the larval antenna and maxillary palpus. These results are consistent with a role for AgOr7 in both olfaction and gustation in An. gambiae and raise the possibility that AgOr7 orthologs may also be of general importance to both modalities of chemosensation in other insects.

  3. Multi-species comparative analysis of the equine ACE gene identifies a highly conserved potential transcription factor binding site in intron 16.

    Directory of Open Access Journals (Sweden)

    Natasha A Hamilton

    Full Text Available Angiotensin converting enzyme (ACE is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.

  4. The human CD8+ T cell responses induced by a live attenuated tetravalent dengue vaccine are directed against highly conserved epitopes.

    Science.gov (United States)

    Weiskopf, Daniela; Angelo, Michael A; Bangs, Derek J; Sidney, John; Paul, Sinu; Peters, Bjoern; de Silva, Aruna D; Lindow, Janet C; Diehl, Sean A; Whitehead, Stephen; Durbin, Anna; Kirkpatrick, Beth; Sette, Alessandro

    2015-01-01

    The incidence of infection with any of the four dengue virus serotypes (DENV1 to -4) has increased dramatically in the last few decades, and the lack of a treatment or vaccine has contributed to significant morbidity and mortality worldwide. A recent comprehensive analysis of the human T cell response against wild-type DENV suggested an human lymphocyte antigen (HLA)-linked protective role for CD8(+) T cells. We have collected one-unit blood donations from study participants receiving the monovalent or tetravalent live attenuated DENV vaccine (DLAV), developed by the U.S. National Institutes of Health. Peripheral blood mononuclear cells from these donors were screened in gamma interferon enzyme-linked immunosorbent spot assays with pools of predicted, HLA-matched, class I binding peptides covering the entire DENV proteome. Here, we characterize for the first time CD8(+) T cell responses after live attenuated dengue vaccination and show that CD8(+) T cell responses in vaccinees were readily detectable and comparable to natural dengue infection. Interestingly, whereas broad responses to structural and nonstructural (NS) proteins were observed after monovalent vaccination, T cell responses following tetravalent vaccination were, dramatically, focused toward the highly conserved NS proteins. Epitopes were highly conserved in a vast variety of field isolates and able to elicit multifunctional T cell responses. Detailed knowledge of the T cell response will contribute to the identification of robust correlates of protection in natural immunity and following vaccination against DENV. The development of effective vaccination strategies against dengue virus (DENV) infection and clinically significant disease is a task of high global public health value and significance, while also being a challenge of significant complexity. A recent efficacy trial of the most advanced dengue vaccine candidate, demonstrated only partial protection against all four DENV serotypes, despite

  5. The Human CD8+ T Cell Responses Induced by a Live Attenuated Tetravalent Dengue Vaccine Are Directed against Highly Conserved Epitopes

    Science.gov (United States)

    Angelo, Michael A.; Bangs, Derek J.; Sidney, John; Paul, Sinu; Peters, Bjoern; de Silva, Aruna D.; Lindow, Janet C.; Diehl, Sean A.; Whitehead, Stephen; Durbin, Anna; Kirkpatrick, Beth; Sette, Alessandro

    2014-01-01

    ABSTRACT The incidence of infection with any of the four dengue virus serotypes (DENV1 to -4) has increased dramatically in the last few decades, and the lack of a treatment or vaccine has contributed to significant morbidity and mortality worldwide. A recent comprehensive analysis of the human T cell response against wild-type DENV suggested an human lymphocyte antigen (HLA)-linked protective role for CD8+ T cells. We have collected one-unit blood donations from study participants receiving the monovalent or tetravalent live attenuated DENV vaccine (DLAV), developed by the U.S. National Institutes of Health. Peripheral blood mononuclear cells from these donors were screened in gamma interferon enzyme-linked immunosorbent spot assays with pools of predicted, HLA-matched, class I binding peptides covering the entire DENV proteome. Here, we characterize for the first time CD8+ T cell responses after live attenuated dengue vaccination and show that CD8+ T cell responses in vaccinees were readily detectable and comparable to natural dengue infection. Interestingly, whereas broad responses to structural and nonstructural (NS) proteins were observed after monovalent vaccination, T cell responses following tetravalent vaccination were, dramatically, focused toward the highly conserved NS proteins. Epitopes were highly conserved in a vast variety of field isolates and able to elicit multifunctional T cell responses. Detailed knowledge of the T cell response will contribute to the identification of robust correlates of protection in natural immunity and following vaccination against DENV. IMPORTANCE The development of effective vaccination strategies against dengue virus (DENV) infection and clinically significant disease is a task of high global public health value and significance, while also being a challenge of significant complexity. A recent efficacy trial of the most advanced dengue vaccine candidate, demonstrated only partial protection against all four DENV

  6. Non-native and native organisms moving into high elevation and high latitude ecosystems in an era of climate change: new challenges for ecology and conservation

    Science.gov (United States)

    Pauchard, Aníbal; Albihn, Ann; Alexander, Jake; Burgess, Treena; Daehler, Curt; Essl, Franz; Evengard, Birgitta; Greenwood, Greg; Haider, Sylvia; Lenoir, Jonathan; McDougall, K.; Milbau, Ann; Muths, Erin L.; Nunez, Martin; Pellissier, Lois; Rabitsch, Wolfgang; Rew, Lisa; Robertson, Mark; Sanders, Nathan; Kueffer, Christoph

    2016-01-01

    Cold environments at high elevation and high latitude are often viewed as resistant to biological invasions. However, climate warming, land use change and associated increased connectivity all increase the risk of biological invasions in these environments. Here we present a summary of the key discussions of the workshop ‘Biosecurity in Mountains and Northern Ecosystems: Current Status and Future Challenges’ (Flen, Sweden, 1–3 June 2015). The aims of the workshop were to (1) increase awareness about the growing importance of species expansion—both non-native and native—at high elevation and high latitude with climate change, (2) review existing knowledge about invasion risks in these areas, and (3) encourage more research on how species will move and interact in cold environments, the consequences for biodiversity, and animal and human health and wellbeing. The diversity of potential and actual invaders reported at the workshop and the likely interactions between them create major challenges for managers of cold environments. However, since these cold environments have experienced fewer invasions when compared with many warmer, more populated environments, prevention has a real chance of success, especially if it is coupled with prioritisation schemes for targeting invaders likely to have greatest impact. Communication and co-operation between cold environment regions will facilitate rapid response, and maximise the use of limited research and management resources.

  7. Integrated maps in quail (Coturnix japonica confirm the high degree of synteny conservation with chicken (Gallus gallus despite 35 million years of divergence

    Directory of Open Access Journals (Sweden)

    Vignoles Matthieu

    2006-05-01

    Full Text Available Abstract Background By comparing the quail genome with that of chicken, chromosome rearrangements that have occurred in these two galliform species over 35 million years of evolution can be detected. From a more practical point of view, the definition of conserved syntenies helps to predict the position of genes in quail, based on information taken from the chicken sequence, thus enhancing the utility of this species in biological studies through a better knowledge of its genome structure. A microsatellite and an Amplified Fragment Length Polymorphism (AFLP genetic map were previously published for quail, as well as comparative cytogenetic data with chicken for macrochromosomes. Quail genomics will benefit from the extension and the integration of these maps. Results The integrated linkage map presented here is based on segregation analysis of both anonymous markers and functional gene loci in 1,050 quail from three independent F2 populations. Ninety-two loci are resolved into 14 autosomal linkage groups and a Z chromosome-specific linkage group, aligned with the quail AFLP map. The size of linkage groups ranges from 7.8 cM to 274.8 cM. The total map distance covers 904.3 cM with an average spacing of 9.7 cM between loci. The coverage is not complete, as macrochromosome CJA08, the gonosome CJAW and 23 microchromosomes have no marker assigned yet. Significant sequence identities of quail markers with chicken enabled the alignment of the quail linkage groups on the chicken genome sequence assembly. This, together with interspecific Fluorescence In Situ Hybridization (FISH, revealed very high similarities in marker order between the two species for the eight macrochromosomes and the 14 microchromosomes studied. Conclusion Integrating the two microsatellite and the AFLP quail genetic maps greatly enhances the quality of the resulting information and will thus facilitate the identification of Quantitative Trait Loci (QTL. The alignment with the

  8. The Oklahoma Field Test: Air-conditioning electricity savings from standard energy conservation measures, radiant barriers, and high-efficiency window air conditioners

    Energy Technology Data Exchange (ETDEWEB)

    Ternes, M.P.; Levins, W.P.

    1992-08-01

    A field test Involving 104 houses was performed in Tulsa, Oklahoma, to measure the air-conditioning electricity consumption of low-income houses equipped with window air conditioners, the reduction in this electricity consumption attributed to the installation of energy conservation measures (ECMS) as typically installed under the Oklahoma Weatherization Assistance Program (WAP), and the reduction achieved by the replacement of low-efficiency window air conditioners with high-efficiency units and the installation of attic radiant barriers. Air-conditioning electricity consumption and indoor temperature were monitored weekly during the pre-weatherization period (June to September 1988) and post-weatherization period (May to September 1989). House energy consumption models and regression analyses were used to normalize the air-conditioning electricity savings to average outdoor temperature conditions and the pre-weatherization indoor temperature of each house. The following conclusions were drawn from the study: (1) programs directed at reducing air-conditioning electricity consumption should be targeted at clients with high consumption to improve cost effectiveness; (2) replacing low-efficiency air conditioners with high-efficiency units should be considered an option in a weatherization program directed at reducing air-conditioning electricity consumption; (3) ECMs currently being installed under the Oklahoma WAP (chosen based on effectiveness at reducing space-heating energy consumption) should continue to be justified based on their space-heating energy savings potential only; and (4) attic radiant barriers should not be included in the Oklahoma WAP if alternatives with verified savings are available or until further testing demonstrates energy savings or other benefits in this typo of housing.

  9. Whole-genome sequences of Odocoileus hemionus deer adenovirus isolates from deer, moose and elk are highly conserved and support a new species in the genus Atadenovirus.

    Science.gov (United States)

    Miller, Myrna M; Cornish, Todd E; Creekmore, Terry E; Fox, Karen; Laegreid, Will; McKenna, Jennifer; Vasquez, Marce; Woods, Leslie W

    2017-09-01

    We present the first complete genome sequence of Odocoileus hemionus deer adenovirus 1 (OdAdV-1). This virus can cause sporadic haemorrhagic disease in cervids, although epizootics with high mortality have occurred in California. OdAdV-1 has been placed in the genus Atadenovirus, based on partial hexon, pVIII and fibre genes. Ten field isolates recovered from naturally infected mule deer (Odocoileus hemionus), white-tailed deer (Odocoileus virginiana) and moose (Alces alces) from Wyoming, black-tailed deer (Odocoileus hemionus columbianus) from California, and Rocky Mountain elk (Cervus elaphus nelsoni) from Colorado and Washington state were sequenced. The genome lengths ranged from 30 620 to 30 699 bp, contained the predicted proteins and gene organization typical of members of genus Atadenovirus, and had a high percentage of A/T nucleotides (66.7 %). Phylogenic analysis found that the closest ancestry was with ruminant atadenoviruses, while a divergence of the hexon, polymerase and penton base proteins of more than 15 % supports classification as a new species. Genetic global comparison between the 10 isolates found an overall 99 % identity, but greater divergence was found between those recovered from moose and elk as compared to deer, and a single variable region contained most of these differences. Our findings demonstrate that OdAdV-1 is highly conserved between 10 isolates recovered from multiple related cervid species, but genotypic differences, largely localized to a variable region, define two strains. We propose that the virus type name be changed to cervid adenovirus 1, with the species name Cervid atadenovirus A. Sequence data were used to develop molecular assays for improved detection and genotyping.

  10. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress

    KAUST Repository

    Kinoshita, Natsuko

    2012-09-01

    The functions of microRNAs and their target mRNAs in Arabidopsis thaliana development have been widely documented; however, roles of stress-responsive microRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAA-Ala Resistant3 (IAR3) as a new target of miR167a. As expected, IAR3 mRNA was cleaved at the miR167a complementary site and under high osmotic stress miR167a levels decreased, whereas IAR3 mRNA levels increased. IAR3 hydrolyzes an inactive form of auxin (indole-3-acetic acid [IAA]-alanine) and releases bioactive auxin (IAA), a central phytohormone for root development. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress-induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 mRNAs and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible noncoding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. Sequence comparison revealed the miR167 target site on IAR3 mRNA is conserved in evolutionarily distant plant species. Finally, we showed that IAR3 is required for drought tolerance. © 2012 American Society of Plant Biologists. All rights reserved.

  11. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  12. A highly conserved gene island of three genes on chromosome 3B of hexaploid wheat: diverse gene function and genomic structure maintained in a tightly linked block

    Directory of Open Access Journals (Sweden)

    Ma Wujun

    2010-05-01

    Full Text Available Abstract Background The complexity of the wheat genome has resulted from waves of retrotransposable element insertions. Gene deletions and disruptions generated by the fast replacement of repetitive elements in wheat have resulted in disruption of colinearity at a micro (sub-megabase level among the cereals. In view of genomic changes that are possible within a given time span, conservation of genes between species tends to imply an important functional or regional constraint that does not permit a change in genomic structure. The ctg1034 contig completed in this paper was initially studied because it was assigned to the Sr2 resistance locus region, but detailed mapping studies subsequently assigned it to the long arm of 3B and revealed its unusual features. Results BAC shotgun sequencing of the hexaploid wheat (Triticum aestivum cv. Chinese Spring genome has been used to assemble a group of 15 wheat BACs from the chromosome 3B physical map FPC contig ctg1034 into a 783,553 bp genomic sequence. This ctg1034 sequence was annotated for biological features such as genes and transposable elements. A three-gene island was identified among >80% repetitive DNA sequence. Using bioinformatics analysis there were no observable similarity in their gene functions. The ctg1034 gene island also displayed complete conservation of gene order and orientation with syntenic gene islands found in publicly available genome sequences of Brachypodium distachyon, Oryza sativa, Sorghum bicolor and Zea mays, even though the intergenic space and introns were divergent. Conclusion We propose that ctg1034 is located within the heterochromatic C-band region of deletion bin 3BL7 based on the identification of heterochromatic tandem repeats and presence of significant matches to chromodomain-containing gypsy LTR retrotransposable elements. We also speculate that this location, among other highly repetitive sequences, may account for the relative stability in gene order and

  13. Subsets of Women With Close or Positive Margins After Breast-Conserving Surgery With High Local Recurrence Risk Despite Breast Plus Boost Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Lupe, Krystine [British Columbia Cancer Agency, Department of Radiation Oncology, Victoria and Vancouver, British Columbia (Canada); Truong, Pauline T., E-mail: ptruong@bccancer.bc.ca [British Columbia Cancer Agency, Department of Radiation Oncology, Victoria and Vancouver, British Columbia (Canada); Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Alexander, Cheryl [Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); Lesperance, Mary [Department of Mathematics and Statistics, University of Victoria, Victoria, Vancouver, British Columbia (Canada); Speers, Caroline [Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); Tyldesley, Scott [British Columbia Cancer Agency, Department of Radiation Oncology, Victoria and Vancouver, British Columbia (Canada); Breast Cancer Outcomes Unit, British Columbia Cancer Agency, Vancouver, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada)

    2011-11-15

    Purpose: (1) To examine the effect of surgical margin status on local recurrence (LR) and survival following breast-conserving therapy; (2) To identify subsets with close or positive margins with high LR risk despite whole breast radiotherapy (RT) plus boost. Methods and Materials: Subjects were 2,264 women with pT1-3, any N, M0 invasive breast cancer, treated with breast-conserving surgery and whole breast {+-} boost RT. Five-year Kaplan-Meier (KM) LR, breast cancer-specific and overall survival (BCSS and OS) were compared between cohorts with negative (n = 1,980), close (n = 222), and positive (n = 62) margins. LR rates were analyzed according to clinicopathologic characteristics. Multivariable Cox regression modeling and matched analysis of close/positive margin cases and negative margin controls were performed. Results: Median follow-up was 5.2 years. Boost RT was used in 92% of patients with close or positive margins. Five-year KM LR rates in the negative, close and positive margin cohorts were 1.3%, 4.0%, and 5.2%, respectively (p = 0.001). BCSS and OS were similar in the three margin subgroups. In the close/positive margin cohort, LR rates were 10.2% with age <45 years, 11.8% with Grade III, 11.3% with lymphovascular invasion (LVI), and 26.3% with {>=}4 positive nodes. Corresponding rates in the negative margin cohort were 2.3%, 2.4%, 1.0%, and 2.4%, respectively. On Cox regression analysis of the entire cohort, close or positive margin, Grade III histology, {>=}4 positive nodes, and lack of systemic therapy were significantly associated with higher LR risk. When close/positive margin cases were matched to negative margin controls, the difference in 5-year LR remained significant (4.25% vs. 0.7%, p < 0.001). Conclusions: On univariable analysis, subsets with close or positive margins, in combination with age <45 years, Grade III, LVI, and {>=}4 positive nodes, have 5-year LR >10% despite whole breast plus boost RT. These patients should be considered for

  14. Induction of Heme Oxygenase-1 Deficiency and Associated Glutamate-Mediated Neurotoxicity Is a Highly Conserved HIV Phenotype of Chronic Macrophage Infection That Is Resistant to Antiretroviral Therapy.

    Science.gov (United States)

    Gill, Alexander J; Kovacsics, Colleen E; Vance, Patricia J; Collman, Ronald G; Kolson, Dennis L

    2015-10-01

    neuropathological processes that persist in antiretroviral therapy (ART)-treated HIV-infected individuals. To this end, we previously identified one such possible process, a deficiency of the antioxidative and anti-inflammatory enzyme heme oxygenase-1 (HO-1) in the brains of individuals with HAND. In the present study, our findings suggest that the HO-1 deficiency associated with excess glutamate production and neurotoxicity in HIV-infected macrophages is a highly conserved phenotype of macrophage-tropic HIV strains and that this phenotype can persist in the macrophage compartment in the presence of ART. This suggests a plausible mechanism by which HIV infection of brain macrophages in ART-treated individuals could exacerbate oxidative stress and glutamate-induced neuronal injury, each of which is associated with neurocognitive dysfunction in infected individuals. Thus, therapies that rescue the HO-1 deficiency in HIV-infected individuals could provide additional neuroprotection to ART. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Making conservation work for everyone

    Energy Technology Data Exchange (ETDEWEB)

    Wiersma, J. [Veridian Corp., Ajax, ON (Canada)

    2004-07-01

    This presentation discussed the economic value of conservation, the optimal deployment of energy conservation. A sample load profile was presented to demonstrate how much electricity the average residential customer uses on a summer day. The average customer does not have the tools to understand the financial consequences of conservation for different types of equipment at different times of the day. Smart metering technology could help in this regard. Accurate unsubsidized prices are also considered to be the best incentive to conserve because customers will reduce electricity use when the prices are high. It was also suggested that standards for new appliances should be increased effectively to their economic value. The enablers to energy conservation include solid consumer education programs, real time metering in places where it is cost effective, real time pricing in places where it is practical, and power rates that reflect real costs. Barriers to energy conservation include the residual economic advantage that may be insufficient to justify investment; support from local distribution companies and transmission companies if the lost revenue adjustment mechanism (LRAM) is not sufficient to recover lost revenue and if LDCs are not sufficiently involved in the design of the electricity conservation program. 7 figs.

  16. Immunogenicity of Leishmania-derived hepatitis B small surface antigen particles exposing highly conserved E2 epitope of hepatitis C virus.

    Science.gov (United States)

    Czarnota, Anna; Tyborowska, Jolanta; Peszyńska-Sularz, Grażyna; Gromadzka, Beata; Bieńkowska-Szewczyk, Krystyna; Grzyb, Katarzyna

    2016-04-13

    Hepatitis C virus (HCV) infection is a major health problem worldwide, affecting an estimated 2-3 % of human population. An HCV vaccine, however, remains unavailable. High viral diversity poses a challenge in developing a vaccine capable of eliciting a broad neutralizing antibody response against all HCV genotypes. The small surface antigen (sHBsAg) of hepatitis B virus (HBV) has the ability to form highly immunogenic subviral particles which are currently used as an efficient anti-HBV vaccine. It also represents an attractive antigen carrier for the delivery of foreign sequences. In the present study, we propose a bivalent vaccine candidate based on novel chimeric particles in which highly conserved epitope of HCV E2 glycoprotein (residues 412-425) was inserted into the hydrophilic loop of sHBsAg. The expression of chimeric protein was performed in an unconventional, Leishmania tarentolae expression system resulting in an assembly of particles which retained immunogenicity of both HCV epitope and sHBsAg protein. Direct transmission electron microscopy observation and immunogold staining confirmed the formation of spherical particles approximately 22 nm in diameter, and proper foreign epitope exposition. Furthermore, the sera of mice immunized with chimeric particles proved reactive not only to purified yeast-derived sHBsAg proteins but also HCV E2 412-425 synthetic peptide. Most importantly, they were also able to cross-react with E1E2 complexes from different HCV genotypes. For the first time, we confirmed successful assembly of chimeric sHBsAg virus-like particles (VLPs) in the L. tarentolae expression system which has the potential to produce high-yields of properly N-glycosylated mammalian proteins. We also proved that chimeric Leishmania-derived VLPs are highly immunogenic and able to elicit cross-reactive antibody response against HCV. This approach may prove useful in the development of a bivalent prophylactic vaccine against HBV and HCV and opens up a new

  17. Conservation and genetic characterisation of common bean landraces from Cilento region (southern Italy): high differentiation in spite of low genetic diversity.

    Science.gov (United States)

    De Luca, Daniele; Cennamo, Paola; Del Guacchio, Emanuele; Di Novella, Riccardo; Caputo, Paolo

    2018-02-01

    Since its introduction from Central-South America to Italy almost 500 years ago, the common bean (Phaseolus vulgaris L.) was largely cultivated across the peninsula in hundreds of different landraces. However, globalisation and technological modernisation of agricultural practices in the last decades promoted the cultivation of few varieties at the expense of traditional and local agro-ecotypes, which have been confined to local markets or have completely disappeared. The aim of this study was to evaluate the genetic diversity and differentiation in 12 common bean landraces once largely cultivated in the Cilento region (Campania region, southern Italy), and now the object of a recovery program to save them from extinction. The analysis conducted using 13 nuclear microsatellite loci in 140 individuals revealed a high degree of homozygosity within each landrace and a strong genetic differentiation that was reflected in the success in assigning individuals to the source landrace. On the contrary, internal transcribed spacers 1 and 2, analysed in one individual per landrace, were highly similar among common bean landraces but allowed the identification of a cowpea variety (Vigna unguiculata Walp.), a crop largely cultivated in the Old World before the arrival of common bean from Americas. In conclusion, our study highlighted that conservation of landraces is important not only for the cultural and socio-economic value that they have for local communities, but also because the time and conditions in which they have been selected have led to that genetic distinctiveness that is at the basis of many potential agronomical applications and dietary benefits.

  18. The albinism of the feral Asinara white donkeys (Equus asinus) is determined by a missense mutation in a highly conserved position of the tyrosinase (TYR) gene deduced protein.

    Science.gov (United States)

    Utzeri, V J; Bertolini, F; Ribani, A; Schiavo, G; Dall'Olio, S; Fontanesi, L

    2016-02-01

    A feral donkey population (Equus asinus), living in the Asinara National Park (an island north-west of Sardinia, Italy), includes a unique white albino donkey subpopulation or colour morph that is a major attraction of this park. Disrupting mutations in the tyrosinase (TYR) gene are known to cause recessive albinisms in humans (oculocutaneous albinism Type 1; OCA1) and other species. In this study, we analysed the donkey TYR gene as a strong candidate to identify the causative mutation of the albinism of these donkeys. The TYR gene was sequenced from 13 donkeys (seven Asinara white albino and six coloured animals). Seven single nucleotide polymorphisms were identified. A missense mutation (c.604C>G; p.His202Asp) in a highly conserved amino acid position (even across kingdoms), which disrupts the first copper-binding site (CuA) of functional protein, was identified in the homozygous condition (G/G or D/D) in all Asinara white albino donkeys and in the albino son of a trio (the grey parents had genotype C/G or H/D), supporting the recessive mode of inheritance of this mutation. Genotyping 82 donkeys confirmed that Asinara albino donkeys had genotype G/G whereas all other coloured donkeys had genotype C/C or C/G. Across-population association between the c.604C>G genotypes and the albino coat colour was highly significant (P = 6.17E-18). The identification of the causative mutation of the albinism in the Asinara white donkeys might open new perspectives to study the dynamics of this putative deleterious allele in a feral population and to manage this interesting animal genetic resource. © 2015 Stichting International Foundation for Animal Genetics.

  19. Mistaken identity: activating conservative political identities induces "conservative" financial decisions.

    Science.gov (United States)

    Morris, Michael W; Carranza, Erica; Fox, Craig R

    2008-11-01

    Four studies investigated whether activating a social identity can lead group members to choose options that are labeled in words associated with that identity. When political identities were made salient, Republicans (but not Democrats) became more likely to choose the gamble or investment option labeled "conservative." This shift did not occur in a condition in which the same options were unlabeled. Thus, the mechanism underlying the effect appears to be not activated identity-related values prioritizing low risk, but rather activated identity-related language (the group label "conservative"). Indeed, when political identities were salient, Republicans favored options labeled "conservative" regardless of whether the options were low or high risk. Finally, requiring participants to explain the label "conservative" before making their choice did not diminish the effect, which suggests that it does not merely reflect inattention to content or construct accessibility. We discuss the implications of these results for the literatures on identity, priming, choice, politics, and marketing.

  20. Electron and high-dose-rate brachytherapy boost in the conservative treatment of stage I-II breast cancer. First results of the randomized Budapest boost trial

    Energy Technology Data Exchange (ETDEWEB)

    Polgar, C.; Fodor, J. [National Institute of Oncology, Department of Radiotherapy, Budapest (Hungary); Orosz, Z. [National Institute of Oncology, Center of Experimental and Human Tumor Pathology Budapest (HU)] [and others

    2002-11-01

    Background and Aims: To evaluate the effect of electron and high-dose-rate brachytherapy (HDR BT) boost on local tumor control (LTC), side effects and cosmesis after breast-conserving surgery (BCS) in a prospective randomized study. Patients and Methods: 207 women with stage I-II breast cancer who underwent BCS were treated by 50 Gy irradiation to the whole breast and then randomly assigned to receive either a boost to the tumor bed (n=104) or no further radiotherapy (n=103). Boost treatments consisted of either 16 Gy electron irradiation (n=52) or 12-14.25 Gy HDR BT (n=52). Breast cancer-related events, side effects, and cosmetic results were assessed. Results: At a median follow-up of 5.3 years, the crude rate of local recurrence was 6.7% (7/104) with and 15.5% (16/103) without boost. The 5-year probability of LTC, relapse-free survival (RFS), and cancer-specific survival (CSS) was 92.7% vs 84.9% (p=0.049), 76.6% vs 66.2% (p=0.044), and 90.4% vs. 82.1% (p=0.053), respectively. There was no significant difference in LTC between patients treated with electron or HDR BT boost (94.2% vs 91.4%; p=0.74). On multivariate analysis, patient age <40 years (RR: 4.53), positive margin status (RR: 4.17), and high mitotic activity index (RR: 3.60) were found to be significant risk factors for local recurrence. The incidence of grade 2-3 side effects was higher in the boost arm (17.3% vs 7.8%; p=0.03). However, the rate of excellent/good cosmetic results was similar for the two arms (85.6% vs 91.3%; p=0.14). Cosmesis was rated as excellent/good in 88.5% of patients treated with HDR BT and 82.7% of patients with electron boost (p=0.29). Conclusions: Boost dose significantly improves LTC and RFS in patients treated with BCS and radiotherapy. In spite of the higher incidence of late side effects in the boost arm, boost dose is strongly recommended for patients at high risk for local recurrence. Positive or close margin status, high mitotic activity index, and young patient age

  1. Conservation genetics of amphibians.

    Science.gov (United States)

    Beebee, T J C

    2005-12-01

    Amphibians are good models for investigating the genetics of wild animal populations because they are: (1) widely distributed in most ecosystems; (2) easy to sample in breeding assemblages; (3) often philopatric to breeding sites, generating high levels of population genetic structure; (4) amenable to controlled crossings in the laboratory; and (5) of major conservation concern. Neutral genetic markers, mostly microsatellites, have been used successfully in studies of amphibian effective population sizes and structures, and in assessing the consequences of hybridisation. Phylogeography has provided important insights into population histories and the fates of introductions. Quantitative genetic methods have demonstrated adaptive variation in life history traits of importance to fitness and therefore to population viability.

  2. Differential DNA methylation at conserved non-genic elements and evidence for transgenerational inheritance following developmental exposure to mono(2-ethylhexyl) phthalate and 5-azacytidine in zebrafish.

    Science.gov (United States)

    Kamstra, Jorke H; Sales, Liana Bastos; Aleström, Peter; Legler, Juliette

    2017-01-01

    Exposure to environmental stressors during development may lead to latent and transgenerational adverse health effects. To understand the role of DNA methylation in these effects, we used zebrafish as a vertebrate model to investigate heritable changes in DNA methylation following chemical-induced stress during early development. We exposed zebrafish embryos to non-embryotoxic concentrations of the biologically active phthalate metabolite mono(2-ethylhexyl) phthalate (MEHP, 30 µM) and the DNA methyltransferase 1 inhibitor 5-azacytidine (5AC, 10 µM). Direct, latent and transgenerational effects on DNA methylation were assessed using global, genome-wide and locus-specific DNA methylation analyses. Following direct exposure in zebrafish embryos from 0 to 6 days post-fertilization, genome-wide analysis revealed a multitude of differentially methylated regions, strongly enriched at conserved non-genic elements for both compounds. Pathways involved in adipogenesis were enriched with the putative obesogenic compound MEHP. Exposure to 5AC resulted in enrichment of pathways involved in embryonic development and transgenerational effects on larval body length. Locus-specific methylation analysis of 10 differentially methylated sites revealed six of these loci differentially methylated in sperm sampled from adult zebrafish exposed during development to 5AC, and in first and second generation larvae. With MEHP, consistent changes were found at 2 specific loci in first and second generation larvae. Our results suggest a functional role for DNA methylation on cis-regulatory conserved elements following developmental exposure to compounds. Effects on these regions are potentially transferred to subsequent generations.

  3. The highly conserved skb1 gene encodes a protein that interacts with Shk1, a fission yeast Ste20/PAK homolog.

    Science.gov (United States)

    Gilbreth, M; Yang, P; Wang, D; Frost, J; Polverino, A; Cobb, M H; Marcus, S

    1996-11-26

    The Shk1 protein kinase, a homolog of Saccharomyces cerevisiae Ste20 and mammalian p21Cdc42/Rac-activated kinases, is an essential component of a Ras- and Cdc42-dependent signaling cascade required for cell viability, normal morphology, and mitogen-activated protein kinase-mediated sexual responses in the fission yeast, Schizosaccharomyces pombe. To identify S. pombe proteins that modulate or mediate Shk1 functions, we conducted a two-hybrid screen for Shk1-interacting proteins. One of the genes identified as a result of this screen was skb1. We show that Skb1 interacts with a region of the N-terminal regulatory domain of Shk1 distinct from that to which Cdc42 binds, and that Shk1, Cdc42, and Skb1 are able to form a ternary complex in vivo. S.pombe cells carrying an skb1 null mutation are less elongate in morphology than wild-type cells and exhibit a moderate growth defect. The morphology defect of the skb1 deletion mutant is suppressed by overexpression of Shk1. Overexpression of Skb1 causes wild-type S. pombe cells to become hyperelongated. Additional genetic analyses described herein suggest that Skb1 is a component of the morphology control branch of the Ras signaling cascade in S. pombe and that it positively modulates Shk1 function. Homologs of Skb1 are encoded by open reading frames in the genomes of S. cerevisiae and Caenorhabditis elegans and by an uncharacterized human cDNA sequence. Thus, skb1 may be the first well-characterized member of a highly conserved family of genes encoding potential p21Cdc42/Rac-activated kinase regulators.

  4. The highly conserved skb1 gene encodes a protein that interacts with Shk1, a fission yeast Ste20/PAK homolog

    Science.gov (United States)

    Gilbreth, Mary; Yang, Peirong; Wang, Dan; Frost, Jeff; Polverino, Anthony; Cobb, Melanie H.; Marcus, Stevan

    1996-01-01

    The Shk1 protein kinase, a homolog of Saccharomyces cerevisiae Ste20 and mammalian p21Cdc42/Rac-activated kinases, is an essential component of a Ras- and Cdc42-dependent signaling cascade required for cell viability, normal morphology, and mitogen-activated protein kinase-mediated sexual responses in the fission yeast, Schizosaccharomyces pombe. To identify S. pombe proteins that modulate or mediate Shk1 functions, we conducted a two-hybrid screen for Shk1-interacting proteins. One of the genes identified as a result of this screen was skb1. We show that Skb1 interacts with a region of the N-terminal regulatory domain of Shk1 distinct from that to which Cdc42 binds, and that Shk1, Cdc42, and Skb1 are able to form a ternary complex in vivo. S. pombe cells carrying an skb1 null mutation are less elongate in morphology than wild-type cells and exhibit a moderate growth defect. The morphology defect of the skb1 deletion mutant is suppressed by overexpression of Shk1. Overexpression of Skb1 causes wild-type S. pombe cells to become hyperelongated. Additional genetic analyses described herein suggest that Skb1 is a component of the morphology control branch of the Ras signaling cascade in S. pombe and that it positively modulates Shk1 function. Homologs of Skb1 are encoded by open reading frames in the genomes of S. cerevisiae and Caenorhabditis elegans and by an uncharacterized human cDNA sequence. Thus, skb1 may be the first well-characterized member of a highly conserved family of genes encoding potential p21Cdc42/Rac-activated kinase regulators. PMID:8943016

  5. Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis

    Science.gov (United States)

    2014-01-01

    Background microRNAs (miRNAs) are endogenous, noncoding, small RNAs that have essential regulatory functions in plant growth, development, and stress response processes. However, limited information is available about their functions in sexual reproduction of flowering plants. Pollen development is an important process in the life cycle of a flowering plant and is a major factor that affects the yield and quality of crop seeds. Results This study aims to identify miRNAs involved in pollen development. Two independent small RNA libraries were constructed from the flower buds of the male sterile line (Bcajh97-01A) and male fertile line (Bcajh97-01B) of Brassica campestris ssp. chinensis. The libraries were subjected to high-throughput sequencing by using the Illumina Solexa system. Eight novel miRNAs on the other arm of known pre-miRNAs, 54 new conserved miRNAs, and 8 novel miRNA members were identified. Twenty-five pairs of novel miRNA/miRNA* were found. Among all the identified miRNAs, 18 differentially expressed miRNAs with over two-fold change between flower buds of male sterile line (Bcajh97-01A) and male fertile line (Bcajh97-01B) were identified. qRT-PCR analysis revealed that most of the differentially expressed miRNAs were preferentially expressed in flower buds of the male fertile line (Bcajh97-01B). Degradome analysis showed that a total of 15 genes were predicted to be the targets of seven miRNAs. Conclusions Our findings provide an overview of potential miRNAs involved in pollen development and interactions between miRNAs and their corresponding targets, which may provide important clues on the function of miRNAs in pollen development. PMID:24559317

  6. Molecular Evolution of Vertebrate Neurotrophins: Co-Option of the Highly Conserved Nerve Growth Factor Gene into the Advanced Snake Venom Arsenalf

    Science.gov (United States)

    Sunagar, Kartik; Fry, Bryan Grieg; Jackson, Timothy N. W.; Casewell, Nicholas R.; Undheim, Eivind A. B.; Vidal, Nicolas; Ali, Syed A.; King, Glenn F.; Vasudevan, Karthikeyan; Vasconcelos, Vitor; Antunes, Agostinho

    2013-01-01

    Neurotrophins are a diverse class of structurally related proteins, essential for neuronal development, survival, plasticity and regeneration. They are characterized by major family members, such as the nerve growth factors (NGF), brain-derived neurotrophic factors (BDNF) and neurotrophin-3 (NT-3), which have been demonstrated here to lack coding sequence variations and follow the regime of negative selection, highlighting their extremely important conserved role in vertebrate homeostasis. However, in stark contrast, venom NGF secreted as part of the chemical arsenal of the venomous advanced snake family Elapidae (and to a lesser extent Viperidae) have characteristics consistent with the typical accelerated molecular evolution of venom components. This includes a rapid rate of diversification under the significant influence of positive-selection, with the majority of positively-selected sites found in the secreted β-polypeptide chain (74%) and on the molecular surface of the protein (92%), while the core structural and functional residues remain highly constrained. Such focal mutagenesis generates active residues on the toxin molecular surface, which are capable of interacting with novel biological targets in prey to induce a myriad of pharmacological effects. We propose that caenophidian NGFs could participate in prey-envenoming by causing a massive release of chemical mediators from mast cells to mount inflammatory reactions and increase vascular permeability, thereby aiding the spread of other toxins and/or by acting as proapoptotic factors. Despite their presence in reptilian venom having been known for over 60 years, this is the first evidence that venom-secreted NGF follows the molecular evolutionary pattern of other venom components, and thus likely participates in prey-envenomation. PMID:24312363

  7. Molecular evolution of vertebrate neurotrophins: co-option of the highly conserved nerve growth factor gene into the advanced snake venom arsenalf.

    Directory of Open Access Journals (Sweden)

    Kartik Sunagar

    Full Text Available Neurotrophins are a diverse class of structurally related proteins, essential for neuronal development, survival, plasticity and regeneration. They are characterized by major family members, such as the nerve growth factors (NGF, brain-derived neurotrophic factors (BDNF and neurotrophin-3 (NT-3, which have been demonstrated here to lack coding sequence variations and follow the regime of negative selection, highlighting their extremely important conserved role in vertebrate homeostasis. However, in stark contrast, venom NGF secreted as part of the chemical arsenal of the venomous advanced snake family Elapidae (and to a lesser extent Viperidae have characteristics consistent with the typical accelerated molecular evolution of venom components. This includes a rapid rate of diversification under the significant influence of positive-selection, with the majority of positively-selected sites found in the secreted β-polypeptide chain (74% and on the molecular surface of the protein (92%, while the core structural and functional residues remain highly constrained. Such focal mutagenesis generates active residues on the toxin molecular surface, which are capable of interacting with novel biological targets in prey to induce a myriad of pharmacological effects. We propose that caenophidian NGFs could participate in prey-envenoming by causing a massive release of chemical mediators from mast cells to mount inflammatory reactions and increase vascular permeability, thereby aiding the spread of other toxins and/or by acting as proapoptotic factors. Despite their presence in reptilian venom having been known for over 60 years, this is the first evidence that venom-secreted NGF follows the molecular evolutionary pattern of other venom components, and thus likely participates in prey-envenomation.

  8. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.

    2002-01-01

    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  9. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  10. Building robust conservation plans.

    Science.gov (United States)

    Visconti, Piero; Joppa, Lucas

    2015-04-01

    Systematic conservation planning optimizes trade-offs between biodiversity conservation and human activities by accounting for socioeconomic costs while aiming to achieve prescribed conservation objectives. However, the most cost-efficient conservation plan can be very dissimilar to any other plan achieving the set of conservation objectives. This is problematic under conditions of implementation uncertainty (e.g., if all or part of the plan becomes unattainable). We determined through simulations of parallel implementation of conservation plans and habitat loss the conditions under which optimal plans have limited chances of implementation and where implementation attempts would fail to meet objectives. We then devised a new, flexible method for identifying conservation priorities and scheduling conservation actions. This method entails generating a number of alternative plans, calculating the similarity in site composition among all plans, and selecting the plan with the highest density of neighboring plans in similarity space. We compared our method with the classic method that maximizes cost efficiency with synthetic and real data sets. When implementation was uncertain--a common reality--our method provided higher likelihood of achieving conservation targets. We found that χ, a measure of the shortfall in objectives achieved by a conservation plan if the plan could not be implemented entirely, was the main factor determining the relative performance of a flexibility enhanced approach to conservation prioritization. Our findings should help planning authorities prioritize conservation efforts in the face of uncertainty about future condition and availability of sites. © 2014 Society for Conservation Biology.

  11. Cis-Regulatory Control of the Nuclear Receptor Coup-TF Gene in the Sea Urchin Paracentrotus lividus Embryo

    OpenAIRE

    Lamprini G Kalampoki; Flytzanis, Constantin N.

    2014-01-01

    Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN). The Paracentrotus lividus Coup-TF gene (PlCoup-TF) is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the plute...

  12. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo

    National Research Council Canada - National Science Library

    Kalampoki, Lamprini G; Flytzanis, Constantin N

    2014-01-01

    ...). The Paracentrotus lividus Coup-TF gene (PlCoup-TF) is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ...

  13. The Footprint of Polygenic Adaptation on Stress-Responsive Cis-Regulatory Divergence in the Arabidopsis Genus.

    Science.gov (United States)

    He, Fei; Arce, Agustin L; Schmitz, Gregor; Koornneef, Maarten; Novikova, Polina; Beyer, Andreas; de Meaux, Juliette

    2016-08-01

    Adaptation of a complex trait often requires the accumulation of many modifications to finely tune its underpinning molecular components to novel environmental requirements. The investigation of cis-acting regulatory modifications can be used to pinpoint molecular systems partaking in such complex adaptations. Here, we identify cis-acting modifications with the help of an interspecific crossing scheme designed to distinguish modifications derived in each of the two sister species, Arabidopsis halleri and A. lyrata Allele-specific expression levels were assessed in three environmental conditions chosen to reflect interspecific ecological differences: cold exposure, dehydration, and standard conditions. The functions described by Gene Ontology categories enriched in cis-acting mutations are markedly different in A. halleri and A. lyrata, suggesting that polygenic adaptation reshaped distinct polygenic molecular functions in the two species. In the A. halleri lineage, an excess of cis-acting changes affecting metal transport and homeostasis was observed, confirming that the well-known heavy metal tolerance of this species is the result of polygenic selection. In A. lyrata, we find a marked excess of cis-acting changes among genes showing a transcriptional response to cold stress in the outgroup species A. thaliana The adaptive relevance of these changes will have to be validated. We finally observed that polygenic molecular functions enriched in derived cis-acting changes are more constrained at the amino acid level. Using the distribution of cis-acting variation to tackle the polygenic basis of adaptation thus reveals the contribution of mutations of small effect to Darwinian adaptation. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. A dual cis-regulatory code links IRF8 to constitutive and inducible gene expression in macrophages

    Science.gov (United States)

    Mancino, Alessandra; Termanini, Alberto; Barozzi, Iros; Ghisletti, Serena; Ostuni, Renato; Prosperini, Elena; Ozato, Keiko

    2015-01-01

    The transcription factor (TF) interferon regulatory factor 8 (IRF8) controls both developmental and inflammatory stimulus-inducible genes in macrophages, but the mechanisms underlying these two different functions are largely unknown. One possibility is that these different roles are linked to the ability of IRF8 to bind alternative DNA sequences. We found that IRF8 is recruited to distinct sets of DNA consensus sequences before and after lipopolysaccharide (LPS) stimulation. In resting cells, IRF8 was mainly bound to composite sites together with the master regulator of myeloid development PU.1. Basal IRF8–PU.1 binding maintained the expression of a broad panel of genes essential for macrophage functions (such as microbial recognition and response to purines) and contributed to basal expression of many LPS-inducible genes. After LPS stimulation, increased expression of IRF8, other IRFs, and AP-1 family TFs enabled IRF8 binding to thousands of additional regions containing low-affinity multimerized IRF sites and composite IRF–AP-1 sites, which were not premarked by PU.1 and did not contribute to the basal IRF8 cistrome. While constitutively expressed IRF8-dependent genes contained only sites mediating basal IRF8/PU.1 recruitment, inducible IRF8-dependent genes contained variable combinations of constitutive and inducible sites. Overall, these data show at the genome scale how the same TF can be linked to constitutive and inducible gene regulation via distinct combinations of alternative DNA-binding sites. PMID:25637355

  15. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  16. The Oklahoma Field Test: Air-Conditioning Electricity Savings from Standard Energy Conservation Measures, Radiant Barriers, and High-Efficiency Window Air Conditioners

    Energy Technology Data Exchange (ETDEWEB)

    Ternes, M.P.

    1992-01-01

    A field test involving 104 houses was performed in Tulsa, Oklahoma, to measure the air-conditioning electricity consumption of low-income houses equipped with window air conditioners, the reduction in this electricity consumption attributed to the installation of energy conservation measures (ECMs) as typically installed under the Oklahoma Weatherization Assistance Program (WAP), and the reduction achieved by the replacement of low-efficiency window air conditioners with high-efficiency units and the installation of attic radiant barriers. Air-conditioning electricity consumption and indoor temperature were monitored weekly during the pre-weatherization period (June to September 1988) and post-weatherization period (May to September 1989). House energy consumption models and regression analyses were used to normalize the air-conditioning electricity savings to average outdoor temperature conditions and the pre-weatherization indoor temperature of each house. The average measured pre-weatherization air-conditioning electricity consumption was 1664 kWh/year ($119/year). Ten percent of the houses used less than 250 kWh/year, while another 10% used more than 3000 kWh/year. An average reduction in air-conditioning electricity consumption of 535 kWh/year ($38/year and 28% of pre-weatherization consumption) was obtained from replacement of one low-efficiency window air conditioner (EER less than 7.0) per house with a high-efficiency unit (EER greater than 9.0). For approximately the same cost, savings tripled to 1503 kWh/year ($107/year and 41% of pre-weatherization consumption) in those houses with initial air-conditioning electricity consumption greater than 2750 kWh/year. For these houses, replacement of a low-efficiency air conditioner with a high-efficiency unit was cost effective using the incremental cost of installing a new unit now rather than later; the average installation cost for these houses under a weatherization program was estimated to be $786. The

  17. Local recurrence after breast-conserving therapy for invasive breast cancer: high incidence in young patients and association with poor survival

    NARCIS (Netherlands)

    Elkhuizen, P. H.; van de Vijver, M. J.; Hermans, J.; Zonderland, H. M.; van de Velde, C. J.; Leer, J. W.

    1998-01-01

    PURPOSE: To study risk factors for local recurrence (LR) after breast-conserving therapy (BCT) for invasive breast cancer and, for patients with an LR, the mode of detection, location, treatment, influence of radiation therapy, and impact on survival. METHODS AND MATERIALS: 1360 patients (median age

  18. Conservation of the S10-spc-alpha Locus within Otherwise Highly Pastic Genomes Provides Phylogenetic Insight into the Genus Leptospira

    Science.gov (United States)

    A comparative analysis of the Leptospira interrogans S10-spc-alpha operon was performed by PCR using primer sets covering the whole operon. Correctly sized fragments were obtained by PCR from all of L. interrogans strains for each primer set indicating that the S10-spc-alpha locus is well conserved ...

  19. Conservation genetics in transition to conservation genomics

    DEFF Research Database (Denmark)

    Ouborg, N. Joop; Pertoldi, Cino; Loeschcke, Volker

    2010-01-01

    in conservation biology. This has allowed assessment of the impact of genetic drift on genetic variation, of the level of inbreeding within populations, and of the amount of gene flow between or within populations. Recent developments in genomic techniques, including next generation sequencing, whole genome scans...... and gene-expression pattern analysis, have made it possible to step up from a limited number of neutral markers to genome-wide estimates of functional genetic variation. Here, we focus on how the transition of conservation genetics to conservation genomics leads to insights into the dynamics of selectively...

  20. Identification of Plasmodium falciparum reticulocyte binding protein homologue 5-interacting protein, PfRipr, as a highly conserved blood-stage malaria vaccine candidate.

    Science.gov (United States)

    Ntege, Edward H; Arisue, Nobuko; Ito, Daisuke; Hasegawa, Tomoyuki; Palacpac, Nirianne M Q; Egwang, Thomas G; Horii, Toshihiro; Takashima, Eizo; Tsuboi, Takafumi

    2016-11-04

    Genetic variability in Plasmodium falciparum malaria parasites hampers current malaria vaccine development efforts. Here, we hypothesize that to address the impact of genetic variability on vaccine efficacy in clinical trials, conserved antigen targets should be selected to achieve robust host immunity across multiple falciparum strains. Therefore, suitable vaccine antigens should be assessed for levels of polymorphism and genetic diversity. Using a total of one hundred and two clinical isolates from a region of high malaria transmission in Uganda, we analyzed extent of polymorphism and genetic diversity in four recently reported novel blood-stage malaria vaccine candidate proteins: Rh5 interacting protein (PfRipr), GPI anchored micronemal antigen (PfGAMA), rhoptry-associated leucine zipper-like protein 1 (PfRALP1) and Duffy binding-like merozoite surface protein 1 (PfMSPDBL1). In addition, utilizing the wheat germ cell-free system, we expressed recombinant proteins for the four candidates based on P. falciparum laboratory strain 3D7 sequences, immunized rabbits to obtain specific antibodies (Abs) and performed functional growth inhibition assay (GIA). The GIA activity of the raised Abs was demonstrated using both homologous 3D7 and heterologous FVO strains in vitro. Both pfripr and pfralp1 are less polymorphic but the latter is comparatively more diverse, with varied number of regions having insertions and deletions, asparagine and 6-mer repeats in the coding sequences. Pfgama and pfmspdbl1 are polymorphic and genetically diverse among the isolates with antibodies against the 3D7-based recombinant PfGAMA and PfMSPDBL1 inhibiting merozoite invasion only in the 3D7 but not FVO strain. Moreover, although Abs against the 3D7-based recombinant PfRipr and PfRALP1 proteins potently inhibited merozoite invasion of both 3D7 and FVO, the GIA activity of anti-PfRipr was much higher than that of anti-PfRALP1. Thus, PfRipr is regarded as a promising blood-stage vaccine

  1. Water quality of the Ogallala Formation, central High Plains aquifer within the North Plains Groundwater Conservation District, Texas Panhandle, 2012-13

    Science.gov (United States)

    Baldys, Stanley; Haynie, Monti M.; Beussink, Amy M.

    2014-01-01

    In cooperation with the North Plains Groundwater Conservation District (NPGCD), the U.S. Geological Survey collected and analyzed water-quality samples at 30 groundwater monitor wells in the NPGCD in the Texas Panhandle. All of the wells were completed in the Ogallala Formation of the central High Plains aquifer. Samples from each well were collected during February–March 2012 and in March 2013. Depth to groundwater in feet below land surface was measured at each well before sampling to determine the water-quality sampling depths. Water-quality samples were analyzed for physical properties, major ions, nutrients, and trace metals, and 6 of the 30 samples were analyzed for pesticides. There was a strong relation between specific conductance and dissolved solids as evidenced by a coefficient of determination (R2) value of 0.98. The dissolved-solids concentration in water from five wells exceeded the secondary drinking-water standard of 500 milligrams per liter set by the U.S. Environmental Protection Agency. Water from 3 of these 5 wells was near the north central part of the NPGCD. Nitrate values exceeded the U.S. Environmental Protection Agency maximum contaminant level of 10 milligrams per liter in 2 of the 30 wells. A sodium-adsorption ratio of 23.4 was measured in the sample collected from well Da-3589 in Dallam County, with the next largest sodium-adsorption ratio measured in the sample collected from well Da-3588 (12.5), also in Dallum County. The sodium-adsorption ratios measured in all other samples were less than 10. The groundwater was generally a mixed cation-bicarbonate plus carbonate type. Twenty-three trace elements were analyzed, and no concentrations exceeded the secondary drinking-water standard or maximum contaminant level set by the U.S. Environmental Protection Agency for water supplies. In 2012, 6 of the 30 wells were sampled for commonly used pesticides. Atrazine and its degradate 2-Chloro-4-isopropylamino-6-amino-s-triazine were detected in

  2. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  3. Beyond Conservation Agriculture

    Directory of Open Access Journals (Sweden)

    Ken E Giller

    2015-10-01

    Full Text Available Global support for Conservation Agriculture (CA as a pathway to Sustainable Intensification is strong. CA revolves around three principles: no-till (or minimal soil disturbance, soil cover, and crop rotation. The benefits arising from the ease of crop management, energy/cost/time savings and soil and water conservation led to widespread adoption of CA, particularly on large farms in the Americas and Australia, where farmers harness the tools of modern science: highly-sophisticated machines, potent agrochemicals and biotechnology. Over the past ten years CA has been promoted among smallholder farmers in the (sub- tropics, often with disappointing results. Growing evidence challenges the claims that CA increases crop yields and builds-up soil carbon although increased stability of crop yields in dry climates is evident. Our analyses suggest pragmatic adoption on larger mechanized farms, and limited uptake of CA by smallholder farmers in developing countries. We propose a rigorous, context-sensitive approach based on Systems Agronomy to analyze and explore sustainable intensification options, including the potential of CA. There is an urgent need to move beyond dogma and prescriptive approaches to provide soil and crop management options for farmers to enable the Sustainable Intensification of agriculture.

  4. Beyond conservation agriculture

    Science.gov (United States)

    Giller, Ken E.; Andersson, Jens A.; Corbeels, Marc; Kirkegaard, John; Mortensen, David; Erenstein, Olaf; Vanlauwe, Bernard

    2015-01-01

    Global support for Conservation Agriculture (CA) as a pathway to Sustainable Intensification is strong. CA revolves around three principles: no-till (or minimal soil disturbance), soil cover, and crop rotation. The benefits arising from the ease of crop management, energy/cost/time savings, and soil and water conservation led to widespread adoption of CA, particularly on large farms in the Americas and Australia, where farmers harness the tools of modern science: highly-sophisticated machines, potent agrochemicals, and biotechnology. Over the past 10 years CA has been promoted among smallholder farmers in the (sub-) tropics, often with disappointing results. Growing evidence challenges the claims that CA increases crop yields and builds-up soil carbon although increased stability of crop yields in dry climates is evident. Our analyses suggest pragmatic adoption on larger mechanized farms, and limited uptake of CA by smallholder farmers in developing countries. We propose a rigorous, context-sensitive approach based on Systems Agronomy to analyze and explore sustainable intensification options, including the potential of CA. There is an urgent need to move beyond dogma and prescriptive approaches to provide soil and crop management options for farmers to enable the Sustainable Intensification of agriculture. PMID:26579139

  5. Mutational analysis of two highly conserved motifs in the silencing suppressor encoded by tomato spotted wilt virus (genus Tospovirus, family Bunyaviridae).

    Science.gov (United States)

    Zhai, Ying; Bag, Sudeep; Mitter, Neena; Turina, Massimo; Pappu, Hanu R

    2014-06-01

    Tospoviruses cause serious economic losses to a wide range of field and horticultural crops on a global scale. The NSs gene encoded by tospoviruses acts as a suppressor of host plant defense. We identified amino acid motifs that are conserved in all of the NSs proteins of tospoviruses for which the sequence is known. Using tomato spotted wilt virus (TSWV) as a model, the role of these motifs in suppressor activity of NSs was investigated. Using site-directed point mutations in two conserved motifs, glycine, lysine and valine/threonine (GKV/T) at positions 181-183 and tyrosine and leucine (YL) at positions 412-413, and an assay to measure the reversal of gene silencing in Nicotiana benthamiana line 16c, we show that substitutions (K182 to A, and L413 to A) in these motifs abolished suppressor activity of the NSs protein, indicating that these two motifs are essential for the RNAi suppressor function of tospoviruses.

  6. Further progress on defining highly conserved immunogenic epitopes for a global HIV vaccine: HLA-A3-restricted GAIA vaccine epitopes.

    Science.gov (United States)

    De Groot, Anne S; Levitz, Lauren; Ardito, Matthew T; Skowron, Gail; Mayer, Kenneth H; Buus, Soren; Boyle, Christine M; Martin, William D

    2012-07-01

    Two major obstacles confronting HIV vaccine design have been the extensive viral diversity of HIV-1 globally and viral evolution driven by escape from CD8(+) cytotoxic T-cell lymphocyte (CTL)-mediated immune pressure. Regions of the viral genome that are not able to escape immune response and that are conserved in sequence and across time may represent the "Achilles' heel" of HIV and would be excellent candidates for vaccine development. In this study, T-cell epitopes were selected using immunoinformatics tools, combining HLA-A3 binding predictions with relative sequence conservation in the context of global HIV evolution. Twenty-seven HLA-A3 epitopes were chosen from an analysis performed in 2003 on 10,803 HIV-1 sequences, and additional sequences were selected in 2009 based on an expanded set of 43,822 sequences. These epitopes were tested in vitro for HLA binding and for immunogenicity with PBMCs of HIV-infected donors from Providence, Rhode Island. Validation of these HLA-A3 epitopes conserved across time, clades, and geography supports the hypothesis that epitopes such as these would be candidates for inclusion in our globally relevant GAIA HIV vaccine constructs.

  7. Water conservation behavior in Australia

    Science.gov (United States)

    Dolnicar, Sara; Hurlimann, Anna; Grün, Bettina

    2012-01-01

    Ensuring a nation's long term water supply requires the use of both supply-sided approaches such as water augmentation through water recycling, and demand-sided approaches such as water conservation. Conservation behavior can only be increased if the key drivers of such behavior are understood. The aim of this study is to reveal the main drivers from a comprehensive pool of hypothesized factors. An empirical study was conducted with 3094 Australians. Data was analyzed using multivariate linear regression analysis and decision trees to determine which factors best predict self-reported water conservation behavior. Two key factors emerge: high level of pro-environmental behavior; and pro-actively seeking out information about water. A number of less influential factors are also revealed. Public communication strategy implications are derived. PMID:22522412

  8. Conservation: Toward firmer ground

    Science.gov (United States)

    1975-01-01

    The following aspects of energy conservation were discussed: conservation history and goals, conservation modes, conservation accounting-criteria, and a method to overcome obstacles. The conservation modes tested fall into one of the following categories: reduced energy consumption, increased efficiency of energy utilization, or substitution of one or more forms of energy for another which is in shorter supply or in some sense thought to be of more value. The conservation accounting criteria include net energy reduction, economic, and technical criteria. A method to overcome obstacles includes (approaches such as: direct personal impact (life style, income, security, aspiration), an element of crisis, large scale involvement of environmental, safety, and health issues, connections to big government, big business, big politics, involvement of known and speculative science and technology, appeal to moral and ethical standards, the transient nature of opportunities to correct the system.

  9. Comparative Developmental Transcriptomics Reveals Rewiring of a Highly Conserved Gene Regulatory Network during a Major Life History Switch in the Sea Urchin Genus Heliocidaris.

    Directory of Open Access Journals (Sweden)

    Jennifer W Israel

    2016-03-01

    Full Text Available The ecologically significant shift in developmental strategy from planktotrophic (feeding to lecithotrophic (nonfeeding development in the sea urchin genus Heliocidaris is one of the most comprehensively studied life history transitions in any animal. Although the evolution of lecithotrophy involved substantial changes to larval development and morphology, it is not known to what extent changes in gene expression underlie the developmental differences between species, nor do we understand how these changes evolved within the context of the well-defined gene regulatory network (GRN underlying sea urchin development. To address these questions, we used RNA-seq to measure expression dynamics across development in three species: the lecithotroph Heliocidaris erythrogramma, the closely related planktotroph H. tuberculata, and an outgroup planktotroph Lytechinus variegatus. Using well-established statistical methods, we developed a novel framework for identifying, quantifying, and polarizing evolutionary changes in gene expression profiles across the transcriptome and within the GRN. We found that major changes in gene expression profiles were more numerous during the evolution of lecithotrophy than during the persistence of planktotrophy, and that genes with derived expression profiles in the lecithotroph displayed specific characteristics as a group that are consistent with the dramatically altered developmental program in this species. Compared to the transcriptome, changes in gene expression profiles within the GRN were even more pronounced in the lecithotroph. We found evidence for conservation and likely divergence of particular GRN regulatory interactions in the lecithotroph, as well as significant changes in the expression of genes with known roles in larval skeletogenesis. We further use coexpression analysis to identify genes of unknown function that may contribute to both conserved and derived developmental traits between species

  10. Comparative Developmental Transcriptomics Reveals Rewiring of a Highly Conserved Gene Regulatory Network during a Major Life History Switch in the Sea Urchin Genus Heliocidaris.

    Science.gov (United States)

    Israel, Jennifer W; Martik, Megan L; Byrne, Maria; Raff, Elizabeth C; Raff, Rudolf A; McClay, David R; Wray, Gregory A

    2016-03-01

    The ecologically significant shift in developmental strategy from planktotrophic (feeding) to lecithotrophic (nonfeeding) development in the sea urchin genus Heliocidaris is one of the most comprehensively studied life history transitions in any animal. Although the evolution of lecithotrophy involved substantial changes to larval development and morphology, it is not known to what extent changes in gene expression underlie the developmental differences between species, nor do we understand how these changes evolved within the context of the well-defined gene regulatory network (GRN) underlying sea urchin development. To address these questions, we used RNA-seq to measure expression dynamics across development in three species: the lecithotroph Heliocidaris erythrogramma, the closely related planktotroph H. tuberculata, and an outgroup planktotroph Lytechinus variegatus. Using well-established statistical methods, we developed a novel framework for identifying, quantifying, and polarizing evolutionary changes in gene expression profiles across the transcriptome and within the GRN. We found that major changes in gene expression profiles were more numerous during the evolution of lecithotrophy than during the persistence of planktotrophy, and that genes with derived expression profiles in the lecithotroph displayed specific characteristics as a group that are consistent with the dramatically altered developmental program in this species. Compared to the transcriptome, changes in gene expression profiles within the GRN were even more pronounced in the lecithotroph. We found evidence for conservation and likely divergence of particular GRN regulatory interactions in the lecithotroph, as well as significant changes in the expression of genes with known roles in larval skeletogenesis. We further use coexpression analysis to identify genes of unknown function that may contribute to both conserved and derived developmental traits between species. Collectively, our results

  11. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    , supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...... from the GENCODE project in human and our expression quantification analysis performed in NOD and B6 mice using qRT-PCR. Furthermore, 17 of the 23 SNPs already known to be implicated with T1D were observed within the long non-coding RNA region in mouse. The spatially conserved regulatory elements...

  12. Exploiting deterministic maintenance opportunity windows created by conservative engineering design rules that result in free time locked into large high-speed coupled production lines with finite buffers

    Directory of Open Access Journals (Sweden)

    Durandt, Casper

    2016-08-01

    Full Text Available Conservative engineering design rules for large serial coupled production processes result in machines having locked-in free time (also called ‘critical downtime’ or ‘maintenance opportunity windows’, which cause idle time if not used. Operators are not able to assess a large production process holistically, and so may not be aware that they form the current bottleneck – or that they have free time available due to interruptions elsewhere. A real-time method is developed to accurately calculate and display free time in location and magnitude, and efficiency improvements are demonstrated in large-scale production runs.

  13. Wildlife conservation on farmland

    National Research Council Canada - National Science Library

    Macdonald, David W; Feber, R. (Ruth)

    2015-01-01

    ...: Integrates more than 30 years of research by the Wildlife Conservation Research Unit at Oxford to reveal how agricultural systems and wildlife interact, presenting examples from scales varying...

  14. Paradigms for parasite conservation.

    Science.gov (United States)

    Dougherty, Eric R; Carlson, Colin J; Bueno, Veronica M; Burgio, Kevin R; Cizauskas, Carrie A; Clements, Christopher F; Seidel, Dana P; Harris, Nyeema C

    2016-08-01

    Parasitic species, which depend directly on host species for their survival, represent a major regulatory force in ecosystems and a significant component of Earth's biodiversity. Yet the negative impacts of parasites observed at the host level have motivated a conservation paradigm of eradication, moving us farther from attainment of taxonomically unbiased conservation goals. Despite a growing body of literature highlighting the importance of parasite-inclusive conservation, most parasite species remain understudied, underfunded, and underappreciated. We argue the protection of parasitic biodiversity requires a paradigm shift in the perception and valuation of their role as consumer species, similar to that of apex predators in the mid-20th century. Beyond recognizing parasites as vital trophic regulators, existing tools available to conservation practitioners should explicitly account for the unique threats facing dependent species. We built upon concepts from epidemiology and economics (e.g., host-density threshold and cost-benefit analysis) to devise novel metrics of margin of error and minimum investment for parasite conservation. We define margin of error as the risk of accidental host extinction from misestimating equilibrium population sizes and predicted oscillations, while minimum investment represents the cost associated with conserving the additional hosts required to maintain viable parasite populations. This framework will aid in the identification of readily conserved parasites that present minimal health risks. To establish parasite conservation, we propose an extension of population viability analysis for host-parasite assemblages to assess extinction risk. In the direst cases, ex situ breeding programs for parasites should be evaluated to maximize success without undermining host protection. Though parasitic species pose a considerable conservation challenge, adaptations to conservation tools will help protect parasite biodiversity in the face of

  15. Introducing Conservation of Momentum

    Science.gov (United States)

    Brunt, Marjorie; Brunt, Geoff

    2013-01-01

    The teaching of the principle of conservation of linear momentum is considered (ages 15 + ). From the principle, the momenta of two masses in an isolated system are considered. Sketch graphs of the momenta make Newton's laws appear obvious. Examples using different collision conditions are considered. Conservation of momentum is considered…

  16. Resource Conservation Glossary.

    Science.gov (United States)

    Soil Conservation Society of America, Ankeny, IA.

    This glossary is a composite of terms selected from 13 technologies, and is the expanded revision of the original 1952 edition of "The Soil and Water Conservation Glossary." The terms were selected from these areas: agronomy, biology, conservation, ecology, economics, engineering, forestry, geology, hydrology, range, recreation, soils, and…

  17. Creative Soil Conservation

    Science.gov (United States)

    Smith, Martha

    2010-01-01

    Take plant lessons outdoors with this engaging and inquiry-based activity in which third-grade students learn how to apply soil conservation methods to growing plants. They also collect data and draw conclusions about the effectiveness of their method of soil conservation. An added benefit to this activity is that the third-grade students played…

  18. Fixism and conservation science.

    Science.gov (United States)

    Robert, Alexandre; Fontaine, Colin; Veron, Simon; Monnet, Anne-Christine; Legrand, Marine; Clavel, Joanne; Chantepie, Stéphane; Couvet, Denis; Ducarme, Frédéric; Fontaine, Benoît; Jiguet, Frédéric; le Viol, Isabelle; Rolland, Jonathan; Sarrazin, François; Teplitsky, Céline; Mouchet, Maud

    2017-08-01

    The field of biodiversity conservation has recently been criticized as relying on a fixist view of the living world in which existing species constitute at the same time targets of conservation efforts and static states of reference, which is in apparent disagreement with evolutionary dynamics. We reviewed the prominent role of species as conservation units and the common benchmark approach to conservation that aims to use past biodiversity as a reference to conserve current biodiversity. We found that the species approach is justified by the discrepancy between the time scales of macroevolution and human influence and that biodiversity benchmarks are based on reference processes rather than fixed reference states. Overall, we argue that the ethical and theoretical frameworks underlying conservation research are based on macroevolutionary processes, such as extinction dynamics. Current species, phylogenetic, community, and functional conservation approaches constitute short-term responses to short-term human effects on these reference processes, and these approaches are consistent with evolutionary principles. © 2016 Society for Conservation Biology.

  19. Context and Number Conservation.

    Science.gov (United States)

    Silverman, Irwin W.

    1979-01-01

    A replication study was conducted to determine whether conservation-of-number performance would be improved by questioning the subject only after the transformation is performed, rather than before and after the transformation, as is done in the standard conservation test. Subjects were preschoolers, aged 0-4 to 5-7. (Author/MP)

  20. Conservation in transportation

    Energy Technology Data Exchange (ETDEWEB)

    None

    1980-05-30

    A nationwide examination was made of grassroots energy conservation programs related to transportation. Information compiled from civic groups, trade associations, and corporations is included on driver awareness/mass transit; travel; and ride sharing. It is concluded that a willingness by the public to cooperate in transportation energy conservation exists and should be exploited. (LCL)

  1. Madagascar Conservation & Development

    African Journals Online (AJOL)

    Madagascar Conservation & Development welcomes the results of original research, field surveys, advances in field and laboratory techniques, book reviews, and informal status reports from research, conservation, development and management programs and in-field projects in Madagascar. In addition, notes on changes ...

  2. Water Conservation Resource List.

    Science.gov (United States)

    NJEA Review, 1981

    1981-01-01

    Alarmed by the growing water shortage, the New Jersey State Office of Dissemination has prepared this annotated list of free or inexpensive instructional materials for teaching about water conservation, K-l2. A tipsheet for home water conservation is appended. (Editor/SJL)

  3. Risk propensity differences between managers and entrepreneurs and between low- and high-growth entrepreneurs: a reply in a more conservative vein.

    Science.gov (United States)

    Miner, John B; Raju, Nambury S

    2004-02-01

    A recent article (W. H. Stewart & P. L. Roth, 2001) in the Journal of Applied Psychology presented the conclusion from meta-analysis that entrepreneurs have a higher risk propensity than managers and that this propensity is particularly pronounced among the growth-oriented. A previously unresolved question was said to be laid to rest and a "vital component" of a theory of entrepreneurship established. The present article disagrees and cites data from 14 studies not included in the Stewart and Roth (2001) analysis, adding up to a conclusion (supported by new meta-analyses) that entrepreneurs (and those with a growth orientation) are more risk avoidant. Thus, a conservative view, retaining the position that the role of risk propensity in entrepreneurship remains unresolved, is upheld. Potential explanations for the conflicting results are explored. ((c) 2004 APA, all rights reserved)

  4. A highly conserved N-terminal sequence for teleost vitellogenin with potential value to the biochemistry, molecular biology and pathology of vitellogenesis

    Science.gov (United States)

    Folmar, L.D.; Denslow, N.D.; Wallace, R.A.; LaFleur, G.; Gross, T.S.; Bonomelli, S.; Sullivan, C.V.

    1995-01-01

    N-terminal amino acid sequences for vitellogenin (Vtg) from six species of teleost fish (striped bass, mummichog, pinfish, brown bullhead, medaka, yellow perch and the sturgeon) are compared with published N-terminal Vtg sequences for the lamprey, clawed frog and domestic chicken. Striped bass and mummichog had 100% identical amino acids between positions 7 and 21, while pinfish, brown bullhead, sturgeon, lamprey, Xenopus and chicken had 87%, 93%, 60%, 47%, 47-60%) for four transcripts and had 40% identical, respectively, with striped bass for the same positions. Partial sequences obtained for medaka and yellow perch were 100% identical between positions 5 to 10. The potential utility of this conserved sequence for studies on the biochemistry, molecular biology and pathology of vitellogenesis is discussed.

  5. Highly conserved regions in Ebola virus RNA dependent RNA polymerase may be act as a universal novel peptide vaccine target: a computational approach.

    Science.gov (United States)

    Oany, Arafat Rahman; Sharmin, Tahmina; Chowdhury, Afrin Sultana; Jyoti, Tahmina Pervin; Hasan, Md Anayet

    2015-12-01

    Ebola virus (EBOV) is such kind of virus which is responsible for 23,825 cases and 9675 deaths worldwide only in 2014 and with an average diseases fatality rate between 25 % and 90 %. Although, medical technology has tried to handle the problems, there is no Food and Drug Administration (FDA)-approved therapeutics or vaccines available for the prevention, post exposure, or treatment of Ebola virus disease (EVD). In the present study, we used the immunoinformatics approach to design a potential epitope-based vaccine against the RNA-dependent RNA polymerase-L of EBOV. BioEdit v7.2.3 sequence alignment editor, Jalview v2 and CLC Sequence Viewer v7.0.2 were used for the initial sequence analysis for securing the conservancy from the sequences. Later the Immune Epitope Database and Analysis Resource (IEDB-AR) was used for the identification of T-cell and B-cellepitopes associated with type I and II major histocompatibility complex molecules analysis. Finally, the population coverage analysis was employed. The core epitope "FRYEFTAPF" was found to be the most potential one, with 100 % conservancy among all the strains of EBOV. It also interacted with both type I and II major histocompatibility complex molecules and is considered as nonallergenic in nature. Finally, with impressive cumulative population coverage of 99.87 % for the both MHC-I and MHC-II class throughout the world population was found for the proposed epitope. To end, the projected peptide gave us a solid stand to propose for vaccine consideration and that might be experimented for its potency in eliciting immunity through humoral and cell mediated immune responses in vitro and in vivo.

  6. The highly conserved serine threonine kinase StkP of Streptococcus pneumoniae contributes to penicillin susceptibility independently from genes encoding penicillin-binding proteins

    Directory of Open Access Journals (Sweden)

    Dias Ricardo

    2009-06-01

    Full Text Available Abstract Background The serine/threonine kinase StkP of Streptococcus pneumoniae is a major virulence factor in the mouse model of infection. StkP is a modular protein with a N-terminal kinase domain a C-terminal PASTA domain carrying the signature of penicillin-binding protein (PBP and prokaryotic serine threonine kinase. In laboratory cultures, one target of StkP is the phosphoglucosamine mutase GlmM involved in the first steps of peptidoglycan biosynthesis. In order to further elucidate the importance of StkP in S. pneumoniae, its role in resistance to β-lactams has been assessed by mutational analysis in laboratory cultures and its genetic conservation has been investigated in isolates from infected sites (virulent, asymptomatic carriers, susceptible and non-susceptible to β-lactams. Results Deletion replacement mutation in stkP conferred hypersensitivity to penicillin G and was epistatic on mutations in PBP2X, PBP2B and PBP1A from the resistant 9V clinical isolate URA1258. Genetic analysis of 55 clinical isolates identified 11 StkP alleles differing from the reference R6 allele. None relevant mutation in the kinase or the PASTA domains were found to account for susceptibility of the isolates. Rather the minimal inhibitory concentration (MIC values of the strains appeared to be determined by their PBP alleles. Conclusion The results of genetic dissection analysis in lab strain Cp1015 reveal that StkP is involved in the bacterial response to penicillin and is epistatic on mutations PBP 2B, 2X and 1A. However analysis of the clinical isolates did not allow us to find the StkP alleles putatively involved in determining the virulence or the resistance level of a given strain, suggesting a strong conservation of StkP in clinical isolates.

  7. Wildlife cancer: a conservation perspective.

    Science.gov (United States)

    McAloose, Denise; Newton, Alisa L

    2009-07-01

    Until recently, cancer in wildlife was not considered to be a conservation concern. However, with the identification of Tasmanian devil facial tumour disease, sea turtle fibropapillomatosis and sea lion genital carcinoma, it has become apparent that neoplasia can be highly prevalent and have considerable effects on some species. It is also clear that anthropogenic activities contribute to the development of neoplasia in wildlife species, such as beluga whales and bottom-dwelling fish, making them sensitive sentinels of disturbed environments.

  8. Integrating agricultural expansion into conservation biogeography: conflicts and priorities

    Directory of Open Access Journals (Sweden)

    Ricardo Dobrovolski

    2014-06-01

    Full Text Available Increasing food production without compromising biodiversity is one of the great challenges for humanity. The aims of my thesis were to define spatial priorities for biodiversity conservation and to evaluate conservation conflicts considering agricultural expansion in the 21st century. I also tested the effect of globalizing conservation efforts on both food production and biodiversity conservation. I found spatial conflicts between biodiversity conservation and agricultural expansion. However, incorporating agricultural expansion data into the spatial prioritization process can significantly alleviate conservation conflicts, by reducing spatial correlation between the areas under high impact of agriculture and the priority areas for conservation. Moreover, developing conservation blueprints at the global scale, instead of the usual approach based on national boundaries, can benefit both food production and biodiversity. Based on these findings I conclude that the incorporation of agricultural expansion as a key component for defining global conservation strategies should be added to the list of solutions for our cultivated planet.

  9. Making conservation research more relevant for conservation practitioners

    NARCIS (Netherlands)

    Laurance, W.F.; Koster, H.; Grooten, M.; Anderson, A.B.; Zuidema, P.A.; Zwick, S.; Zagt, R.J.; Lynam, A.J.; Linkie, M.; Anten, N.P.R.

    2012-01-01

    Conservation scientists and practitioners share many of the same goals. Yet in a majority of cases, we argue, research conducted by academic conservation scientists actually makes surprisingly few direct contributions to environmental conservation. We illustrate how researchers can increase the

  10. Association of Locoregional Control With High Body Mass Index in Women Undergoing Breast Conservation Therapy for Early-Stage Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Bergom, Carmen; Kelly, Tracy; Bedi, Meena; Saeed, Hina; Prior, Phillip [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Rein, Lisa E.; Szabo, Aniko [Division of Biostatistics, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Wilson, J. Frank; Currey, Adam D. [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, Wisconsin (United States); White, Julia, E-mail: Julia.White@osumc.edu [Department of Radiation Oncology, James Cancer Hospital, Ohio State University Comprehensive Cancer Center, Columbus, Ohio (United States)

    2016-09-01

    Purpose: Obesity, as measured by the body mass index (BMI), is a risk factor for distant recurrence and decreased survival in breast cancer. We sought to determine whether the BMI correlated with local recurrence and reduced survival in a cohort of predominantly obese women treated with breast conservation therapy. Methods and Materials: From 1998 to 2010, 154 women with early-stage invasive breast cancer and 39 patients with ductal carcinoma in situ underwent prone whole breast irradiation. Cox proportional hazards regression, Kaplan-Meier methods with the log-rank test, and multivariate analysis were used to explore the association of the outcomes with the BMI. Results: The median patient age was 60 years, and the median follow-up duration was 73 months. The median BMI was 33.2 kg/m{sup 2}; 91% of the patients were overweight (BMI ≥25 kg/m{sup 2}) and 69% of the patients were clinically obese (BMI ≥30 kg/m{sup 2}). The BMI was significantly associated with the locoregional recurrence-free interval for patients with invasive cancer and ductal carcinoma in situ (hazard ratio [HR], 1.09; P=.047). Also, a trend was seen for increased locoregional recurrence with a higher BMI (P=.09) for patients with invasive disease, which was significant when examining the outcomes with a BMI stratified by the median value of 33.2 kg/m{sup 2} (P=.008). A greater BMI was also significantly associated with decreased distant recurrence-free interval (HR, 1.09; P=.011) and overall survival (HR, 1.09; P=.004); this association remained on multivariate analysis (distant recurrence-free interval, P=.034; overall survival, P=.0007). Conclusions: These data suggest that the BMI might affect the rate of locoregional recurrence in breast cancer patients. A higher BMI predicted a worse distant recurrence-free interval and overall survival. The present investigation adds to the increasing evidence that BMI is an important prognostic factor in early-stage breast cancer treated with

  11. Lasers in the Conservation of Artworks

    CERN Document Server

    Nimmrichter, Johann; Schreiner, Manfred; LACONA VI Proceedings

    2007-01-01

    Within the last decades, the use of lasers in artworks conservation became an important tool for many conservators, scientists, architects and other experts, who are involved in the care of monuments and artefacts or laser technology. For the first time in 1995 Professor Costas Fotakis brought together restorers and scientists to discuss the potential of lasers in art conservation. Since then the field of "Lasers in the Conservation of Artworks" has gained enormously in importance. Nowadays restorers and laser scientists work close together in order to develop new fields of applications during the last years. Furthermore a large number of national and international research projects have been carried out by conservator-restorers, architects and scientists. In the last 10 years a number of historical and artistic high quality monuments (e.g. St. Stephens Cathedral in Vienna) have been cleaned or measured by laser and brought the laser in the spectra of tools which are useful in the sensible field of artworks. ...

  12. Novel urban ecosystems, biodiversity, and conservation.

    Science.gov (United States)

    Kowarik, Ingo

    2011-01-01

    With increasing urbanization the importance of cities for biodiversity conservation grows. This paper reviews the ways in which biodiversity is affected by urbanization and discusses the consequences of different conservation approaches. Cities can be richer in plant species, including in native species, than rural areas. Alien species can lead to both homogenization and differentiation among urban regions. Urban habitats can harbor self-sustaining populations of rare and endangered native species, but cannot replace the complete functionality of (semi-)natural remnants. While many conservation approaches tend to focus on such relict habitats and native species in urban settings, this paper argues for a paradigm shift towards considering the whole range of urban ecosystems. Although conservation attitudes may be challenged by the novelty of some urban ecosystems, which are often linked to high numbers of nonnative species, it is promising to consider their associated ecosystem services, social benefits, and possible contribution to biodiversity conservation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Climate change threatens European conservation areas

    Science.gov (United States)

    Araújo, Miguel B; Alagador, Diogo; Cabeza, Mar; Nogués-Bravo, David; Thuiller, Wilfried

    2011-01-01

    Europe has the world's most extensive network of conservation areas. Conservation areas are selected without taking into account the effects of climate change. How effectively would such areas conserve biodiversity under climate change? We assess the effectiveness of protected areas and the Natura 2000 network in conserving a large proportion of European plant and terrestrial vertebrate species under climate change. We found that by 2080, 58 ± 2.6% of the species would lose suitable climate in protected areas, whereas losses affected 63 ± 2.1% of the species of European concern occurring in Natura 2000 areas. Protected areas are expected to retain climatic suitability for species better than unprotected areas (Pareas retain climate suitability for species no better and sometimes less effectively than unprotected areas. The risk is high that ongoing efforts to conserve Europe's biodiversity are jeopardized by climate change. New policies are required to avert this risk. PMID:21447141

  14. Identification of highly conserved regions in L-segment of Crimean-Congo hemorrhagic fever virus and immunoinformatic prediction about potential novel vaccine.

    Science.gov (United States)

    Oany, Arafat Rahman; Ahmad, Shah Adil Ishtiyaq; Hossain, Mohammad Uzzal; Jyoti, Tahmina Pervin

    2015-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonotic viral disease with a disease fatality rate between 15% and 70%. Despite the wide range of distribution, the virus (CCHFV) is basically endemic in Africa, Asia, eastern Europe, and the Middle East. Acute febrile illness associated with petechiae, disseminated intravascular coagulation, and multiple-organ failure are the main symptoms of the disease. With all these fatal effects, CCHFV is considered a huge threat as no successful therapeutic approach is currently available for the treatment of this disease. In the present study, we have used the immunoinformatics approach to design a potential epitope-based vaccine against the RNA-dependent RNA polymerase-L of CCHFV. Both the T-cell and B-cell epitopes were assessed, and the epitope "DCSSTPPDR" was found to be the most potential one, with 100% conservancy among all the strains of CCHFV. The epitope was also found to interact with both type I and II major histocompatibility complex molecules and is considered nonallergenic as well. In vivo study of our proposed peptide is advised for novel universal vaccine production, which might be an effective path to prevent CCHF disease.

  15. Tourism and Conservation

    DEFF Research Database (Denmark)

    Budeanu, Adriana

    2017-01-01

    Tourism is promoted by policy makers and international organizations as a tool for advancing conservation agendas, while contributing to poverty alleviation and human development, under the banner of ecotourism or sustainable tourism. However, the indiscriminating use of complex and ambiguous...

  16. Hearing Conservation Team

    Data.gov (United States)

    Federal Laboratory Consortium — The Hearing Conservation Team focuses on ways to identify the early stages of noise-induced damage to the human ear.Our current research involves the evaluation of...

  17. Energy Conservation Behaviour Toolkit

    NARCIS (Netherlands)

    Kalz, Marco; Börner, Dirk; Ternier, Stefaan; Specht, Marcus

    2013-01-01

    Kalz, M., Börner, D., Ternier, S., & Specht, M. (2013, 31 January). Energy Conservation Behaviour Toolkit. Presentation given at the symposium "Groene ICT en Duurzame ontwikkeling: Meters maken in het Hoger Onderwijs", Driebergen, The Netherlands.

  18. Metro Conservation Corridors

    Data.gov (United States)

    Minnesota Department of Natural Resources — The Metro Conservation Corridors (MeCC) grow out of the natural resource analysis work done by the DNR in the late '90's, documented in the Metro Greenprint...

  19. Mesocycles in conserving plastics

    DEFF Research Database (Denmark)

    Shashoua, Yvonne

    2016-01-01

    Analysis suggests that progress in conservation of plastics objects and artworks can be described by a series of overlapping mesocycles. Focus has been placed for periods of 5-10 years each on determining the degradation pathways in the 1990s, developing strategies to inhibit those pathways from...... plastics has been the origin of the data describing lifetimes. By contrast, mesocycles in developing suitable storage and display microclimates for plastics have mirrored preventive conservation practices for natural polymeric materials. The rate of the third mesocycle, interventive conservation, has been...... driven by the need to balance the requirements for reversibility in conservation practices with the artist’s intent and significance. Developments within each of the three mesocycles from the 1990s to date are discussed in this article. Environmental science and toxicology of waste plastics offer a novel...

  20. Novel urban ecosystems, biodiversity, and conservation

    Energy Technology Data Exchange (ETDEWEB)

    Kowarik, Ingo, E-mail: kowarik@tu-berlin.de [Department of Ecology, Technische Universitaet Berlin, Rothenburgstr. 12, D 12165 Berlin (Germany)

    2011-08-15

    With increasing urbanization the importance of cities for biodiversity conservation grows. This paper reviews the ways in which biodiversity is affected by urbanization and discusses the consequences of different conservation approaches. Cities can be richer in plant species, including in native species, than rural areas. Alien species can lead to both homogenization and differentiation among urban regions. Urban habitats can harbor self-sustaining populations of rare and endangered native species, but cannot replace the complete functionality of (semi-)natural remnants. While many conservation approaches tend to focus on such relict habitats and native species in urban settings, this paper argues for a paradigm shift towards considering the whole range of urban ecosystems. Although conservation attitudes may be challenged by the novelty of some urban ecosystems, which are often linked to high numbers of nonnative species, it is promising to consider their associated ecosystem services, social benefits, and possible contribution to biodiversity conservation. - Highlights: > This paper reviews biotic responses to urbanization and urban conservation approaches. > Cities may be rich in both native and nonnative species. > Urban habitats cannot replace the functionality of natural remnants. > However, even novel urban habitats may harbour rare and endangered species. > Conservation approaches should consider the perspective of novel urban ecosystems. - This paper reviews the ways in which biodiversity is affected by urbanization and argues for expanding urban conservation approaches.

  1. 76 FR 22785 - Wetland Conservation

    Science.gov (United States)

    2011-04-25

    ... 7 CFR Part 12 RIN 0578-AA58 Wetland Conservation AGENCY: Office of the Secretary, United States... concerning the Natural Resources Conservation Service's (NRCS) coordination responsibilities. DATES..., Director, Ecological Sciences Division, U.S. Department of Agriculture, Natural Resources Conservation...

  2. RapA2 Is a Calcium-binding Lectin Composed of Two Highly Conserved Cadherin-like Domains That Specifically Recognize Rhizobium leguminosarum Acidic Exopolysaccharides*

    Science.gov (United States)

    Abdian, Patricia L.; Caramelo, Julio J.; Ausmees, Nora; Zorreguieta, Angeles

    2013-01-01

    In silico analyses have revealed a conserved protein domain (CHDL) widely present in bacteria that has significant structural similarity to eukaryotic cadherins. A CHDL domain was shown to be present in RapA, a protein that is involved in autoaggregation of Rhizobium cells, biofilm formation, and adhesion to plant roots as shown by us and others. Structural similarity to cadherins suggested calcium-dependent oligomerization of CHDL domains as a mechanistic basis for RapA action. Here we show by circular dichroism spectroscopy, light scattering, isothermal titration calorimetry, and other methods that RapA2 from Rhizobium leguminosarum indeed exhibits a cadherin-like β-sheet conformation and that its proper folding and stability are dependent on the binding of one calcium ion per protein molecule. By further in silico analysis we also reveal that RapA2 consists of two CHDL domains and expand the range of CHDL-containing proteins in bacteria and archaea. However, light scattering assays at various concentrations of added calcium revealed that RapA2 formed neither homo-oligomers nor hetero-oligomers with RapB (a distinct CHDL protein), indicating that RapA2 does not mediate cellular interactions through a cadherin-like mechanism. Instead, we demonstrate that RapA2 interacts specifically with the acidic exopolysaccharides (EPSs) produced by R. leguminosarum in a calcium-dependent manner, sustaining a role of these proteins in the development of the biofilm matrix made of EPS. Because EPS binding by RapA2 can only be attributed to its two CHDL domains, we propose that RapA2 is a calcium-dependent lectin and that CHDL domains in various bacterial and archaeal proteins confer carbohydrate binding activity to these proteins. PMID:23235153

  3. HvHMA2, a P(1B)-ATPase from barley, is highly conserved among cereals and functions in Zn and Cd transport.

    Science.gov (United States)

    Mills, Rebecca F; Peaston, Kerry A; Runions, John; Williams, Lorraine E

    2012-01-01

    Manipulation of crops to improve their nutritional value (biofortification) and optimisation of plants for removal of toxic metals from contaminated soils (phytoremediation) are major goals. Identification of membrane transporters with roles in zinc and cadmium transport would be useful for both aspects. The P(1B)-ATPases play important roles in heavy metal allocation and detoxification in Arabidopsis and it is now important to elucidate their roles in monocots. We identified nine P(1B)-ATPases in barley and this study focuses on the functional characterization of HvHMA2, providing evidence for its role in heavy metal transport. HvHMA2 was cloned using information from EST analysis and 5' RACE. It possesses the conserved aspartate that is phosphorylated during the reaction cycle of P-type pumps and has motifs and key residues characteristic of P(1B)-ATPases, falling into the P(1B-2) subclass. Homologous sequences occur in three major sub-families of the Poaceae (Gramineae). Heterologous expression in Saccharomyces cerevisiae demonstrates that HvHMA2 functions as a Zn and Cd pump. Mutagenesis studies show that proposed cation coordination sites of the P(1B-2) pumps are crucial for the metal responses conferred by HvHMA2 in yeast. HvHMA2 expression suppresses the Zn-deficient phenotype of the Arabidopsis hma2hma4 mutant indicating that HvHMA2 functions as a Zn pump in planta and could play a role in root to shoot Zn transport. When expressed in Arabidopsis, HvHMA2 localises predominantly to the plasma membrane.

  4. HvHMA2, a P(1B-ATPase from barley, is highly conserved among cereals and functions in Zn and Cd transport.

    Directory of Open Access Journals (Sweden)

    Rebecca F Mills

    Full Text Available Manipulation of crops to improve their nutritional value (biofortification and optimisation of plants for removal of toxic metals from contaminated soils (phytoremediation are major goals. Identification of membrane transporters with roles in zinc and cadmium transport would be useful for both aspects. The P(1B-ATPases play important roles in heavy metal allocation and detoxification in Arabidopsis and it is now important to elucidate their roles in monocots. We identified nine P(1B-ATPases in barley and this study focuses on the functional characterization of HvHMA2, providing evidence for its role in heavy metal transport. HvHMA2 was cloned using information from EST analysis and 5' RACE. It possesses the conserved aspartate that is phosphorylated during the reaction cycle of P-type pumps and has motifs and key residues characteristic of P(1B-ATPases, falling into the P(1B-2 subclass. Homologous sequences occur in three major sub-families of the Poaceae (Gramineae. Heterologous expression in Saccharomyces cerevisiae demonstrates that HvHMA2 functions as a Zn and Cd pump. Mutagenesis studies show that proposed cation coordination sites of the P(1B-2 pumps are crucial for the metal responses conferred by HvHMA2 in yeast. HvHMA2 expression suppresses the Zn-deficient phenotype of the Arabidopsis hma2hma4 mutant indicating that HvHMA2 functions as a Zn pump in planta and could play a role in root to shoot Zn transport. When expressed in Arabidopsis, HvHMA2 localises predominantly to the plasma membrane.

  5. Characterization of a highly conserved human homolog to the chicken neural cell surface protein Bravo/Nr-CAM that maps to chromosome band 7q31

    Energy Technology Data Exchange (ETDEWEB)

    Lane, R.P.; Vielmetter, J.; Dreyer, W.J. [California Institute of Technology, Pasadena, CA (United States)] [and others

    1996-08-01

    The neuronal cell adhesion molecule Bravo/Nr-CAM is a cell surface protein of the immunoglobulin (Ig) superfamily and is closely related to the L1/NgCAM and neurofascin molecules, all of which contain six immunoglobulin domains, five fibronectin repeats, a transmembrane region, and an intracellular domain. Chicken Bravo/Nr-CAM has been shown to interact with other cell surface molecules of the Ig superfamily and has been implicated in specific pathfinding roles of axonal growth cones in the developing nervous system. We now report the characterization of cDNA clones encoding the human Bravo/Nr-CAM protein, which, like its chicken homolog, is composed of six V-like Ig domains and five fibronectin type III repeats. The human Bravo/Nr-CAM homolog also contains a transmembrane and intracellular domain, both of which are 100% conserved at the amino acid level compared to its chicken homolog. Overall, the human Bravo/Nr-CAM homolog is 82% identical to the chicken Bravo/Nr-CAM amino acid sequence. Independent cDNAs encoding four different isoforms were also identified, all of which contain alternatively spliced variants around the fifth fibronectin type III repeat, including one isoform that had been previously identified for chicken Bravo/Nr-CAM. Northern blot analysis reveals one mRNA species of approximately 7.0 kb in adult human brain tissue. Fluorescence in situ hybridization maps the gene for human Bravo/Nr-CAM to human chromosome 7q31.1-q31.2. This chromosomal locus has been previously identified as containing a tumore suppressor candidate gene commonly deleted in certain human cancer tissues. 38 refs., 5 figs.

  6. A NEW WORLD MONKEY MICROSATELLITE (AP74 HIGHLY CONSERVED IN PRIMATES AP74, un microsatélite de Monos del Nuevo Mundo altamente conservado en Primates

    Directory of Open Access Journals (Sweden)

    LUCIANA INÉS OKLANDER

    2012-04-01

    Full Text Available Given their great variability, microsatellites or STRs became the most commonly used genetic markers over the last 15 years. The analysis of these markers requires minimum quantities of DNA, allowing the use of non invasive samples, such as feces or hair. We amplified the microsatellite Ap74 in blood and hair samples in order to analyze the levels of genomic conservation among a wide range of primates including: Lemur catta, Alouatta caraya, Ateles belzebuth, Ateles chamek, Pan troglodytes, Papio sp., and Homo sapiens. In all cases we obtained amplification products that exhibited similar size both in monkeys and human (oscillating between 126 and 176 bp, except in the lemur where the detected fragment presented a size of approximately 1000 bp. The analysis of the nucleotide sequences permitted the evaluation of the molecular modifications experienced during the evolutionary process in primates.Dado su alta variabilidad, los microsatélites o STR se convirtieron en los marcadores genéticos más ampliamente utilizados en los últimos 15 años. El análisis de estos marcadores requiere una mínima cantidad de ADN, permitiendo el uso de muestras no invasivas, tales como pelos o heces. Con el objetivo de analizar niveles de conservación genómica, amplificamos el microsatélite Ap74 en muestras de pelo y sangre de un amplio rango de primates incluyendo: Lemur catta, Alouatta caraya, Ateles belzebuth, Ateles chamek, Pan troglodytes, Papio sp., y Homo sapiens. En todos los casos obtuvimos productos de amplificación que exhibieron un tamaño similar (oscilando entre 126 y 176 pb, con excepción del lémur, donde el fragmento detectado presentó un tamaño de aproximadamente 1000 pb. El análisis de las secuencias nucleotídicas nos permitió evaluar las modificaciones moleculares ocurridas durante el proceso evolutivo en primates.

  7. Conservative Management of Urinary Incontinence in Women

    Science.gov (United States)

    Faiena, Izak; Patel, Neal; Parihar, Jaspreet S; Calabrese, Marc; Tunuguntla, Hari

    2015-01-01

    Urinary incontinence in women has a high prevalence and causes significant morbidity. Given that urinary incontinence is not generally a progressive disease, conservative therapies play an integral part in the management of these patients. We conducted a nonsystematic review of the literature to identify high-quality studies that evaluated the different components of conservative management of stress urinary incontinence, including behavioral therapy, bladder training, pelvic floor muscle training, lifestyle changes, mechanical devices, vaginal cones, and electrical stimulation. Urinary incontinence can have a severe impact on our healthcare system and patients’ quality of life. There are currently a wide variety of treatment options for these patients, ranging from conservative treatment to surgical treatment. Although further research is required in the area of conservative therapies, nonsurgical treatments are effective and are preferred by some patients. PMID:26543427

  8. Creative Conservation Communication

    Science.gov (United States)

    Houston, Jason

    2015-04-01

    I am a fellow with the International League of Conservation photographers (iLCP) and have been focused on photographing conservation dynamics at the intersection of social and environmental issues for a decade. Subjects have included traditional concerns such as deforestation, water conservation, endangered species, and fisheries. However, I rarely make photographs of the traditional nature, wildlife, landscapes, or environmental atrocities that most people think of when they think about environmentalism. Instead, I photograph people and how they live on the planet, as I believe passionately that without also considering social and cultural concerns, we will not be able to effectively and sustainably do conservation work or achieve positive environmental change. My presentation will share recent photography projects on forest conservation in Indonesian Borneo and fisheries management in Central America where I used a 'stakeholder profile-based' process to broadly survey the complexity of the issues while also making personal connections for these projects' diverse audiences. Through these case studies I will explore the opportunities and challenges of combining the authenticity, accuracy, and scientific validity of journalistic and documentary work with the emotional impact of the conventions of art and storytelling.

  9. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics

    National Research Council Canada - National Science Library

    Gildor, Tsvia; Ben-Tabou de-Leon, Smadar

    2015-01-01

    .... Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus lividus (Pl...

  10. Smart Water Conservation System for Irrigated Landscape

    Science.gov (United States)

    2016-05-01

    a semi - arid climate , where indoor air is mostly re-circulated, and HVAC unit temperature set points are intentionally high to conserve energy...Traditional Irrigation System • May be applicable in any climate (i.e., arid and/or semi - arid ). • Are economical in many regions of the country where...consumption for irrigation at our DoD installations located in semi - arid regions where alternative water conservation measures are being pursued. The

  11. Biochemical and Structural Characterizations of Two Dictyostelium Cellobiohydrolases from the Amoebozoa Kingdom Reveal a High Level of Conservation between Distant Phylogenetic Trees of Life

    Science.gov (United States)

    Hobdey, Sarah E.; Knott, Brandon C.; Haddad Momeni, Majid; Taylor, Larry E.; Borisova, Anna S.; Podkaminer, Kara K.; VanderWall, Todd A.; Himmel, Michael E.; Decker, Stephen R.

    2016-01-01

    ABSTRACT Glycoside hydrolase family 7 (GH7) cellobiohydrolases (CBHs) are enzymes commonly employed in plant cell wall degradation across eukaryotic kingdoms of life, as they provide significant hydrolytic potential in cellulose turnover. To date, many fungal GH7 CBHs have been examined, yet many questions regarding structure-activity relationships in these important natural and commercial enzymes remain. Here, we present the crystal structures and a biochemical analysis of two GH7 CBHs from social amoeba: Dictyostelium discoideum Cel7A (DdiCel7A) and Dictyostelium purpureum Cel7A (DpuCel7A). DdiCel7A and DpuCel7A natively consist of a catalytic domain and do not exhibit a carbohydrate-binding module (CBM). The structures of DdiCel7A and DpuCel7A, resolved to 2.1 Å and 2.7 Å, respectively, are homologous to those of other GH7 CBHs with an enclosed active-site tunnel. Two primary differences between the Dictyostelium CBHs and the archetypal model GH7 CBH, Trichoderma reesei Cel7A (TreCel7A), occur near the hydrolytic active site and the product-binding sites. To compare the activities of these enzymes with the activity of TreCel7A, the family 1 TreCel7A CBM and linker were added to the C terminus of each of the Dictyostelium enzymes, creating DdiCel7ACBM and DpuCel7ACBM, which were recombinantly expressed in T. reesei. DdiCel7ACBM and DpuCel7ACBM hydrolyzed Avicel, pretreated corn stover, and phosphoric acid-swollen cellulose as efficiently as TreCel7A when hydrolysis was compared at their temperature optima. The Ki of cellobiose was significantly higher for DdiCel7ACBM and DpuCel7ACBM than for TreCel7A: 205, 130, and 29 μM, respectively. Taken together, the present study highlights the remarkable degree of conservation of the activity of these key natural and industrial enzymes across quite distant phylogenetic trees of life. IMPORTANCE GH7 CBHs are among the most important cellulolytic enzymes both in nature and for emerging industrial applications for

  12. Energy conservation in high-rise buildings: changes in air conditioning load induced by vertical temperature and humidity profile in Delhi

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, S. [Institute of Social Forestry and Eco-rehabilitation, ICFRE, Allahabad (India); Kumar, Sanjay [Indian Inst. of Technology, Centre for Atmospheric Sciences, New Delhi (India); Kumar, N. [MIT, Civil Engineering Dept., Bihar (India)

    1998-12-31

    Temperature and humidity profiles in the upper atmosphere are different from those observed by ground level meteorological stations and used to design HVAC systems for high-rise buildings. There exist correlations among solar energy, atmospheric turbidity and pollutants in urban areas, affecting the temperature and humidity profiles with variation in height. In the present study, a theoretical model is developed considering these parameters, and the HVAC load is calculated. The results are compared with the HVAC load calculated from data obtained from the meteorological station, and the comparison showed that the results differ significantly (20%) for a hypothetical 200 m high office building. (Author)

  13. Two Centuries of Soil Conservation.

    Science.gov (United States)

    Helms, Douglas

    1991-01-01

    Narrates U.S. soil conservation history since the late eighteenth century. Discusses early practices such as contour plowing. Profiles individuals who promoted soil conservation and were largely responsible for the creation of the Soil Conservation Service. Explains the causes of erosion and how soil conservation districts help farmers prevent…

  14. Information, conservation and retrieval

    Energy Technology Data Exchange (ETDEWEB)

    Eng, T. [Swedish Nuclear Fuel and Waste Management Co., Stockholm (Sweden); Norberg, E. [National Swedish Archives, Stockholm (Sweden); Torbacke, J. [Stockholm Univ. (Sweden). Dept. of History; Jensen, M. [Swedish Radiation Protection Inst., Stockholm (Sweden)

    1996-12-01

    The seminar took place on the Swedish ship for transportation of radioactive wastes, M/S Sigyn, which at summer time is used for exhibitions. The seminar treated items related to general information needs in society and questions related to radioactive waste, i.e. how knowledge about a waste repository should be passed on to future generations. Three contributions are contained in the report from the seminar and are indexed separately: `Active preservation - otherwise no achieves`; `The conservation and dissemination of information - A democratic issue`; and, `Conservation and retrieval of information - Elements of a strategy to inform future societies about nuclear waste repositories`.

  15. Energy conservation in infants.

    Science.gov (United States)

    Blass, Elliott

    2015-08-01

    Energy acquisition through suckling has been widely studied in rat and human infants. Processes mediating energy conservation, however, have not received the attention that they deserve. This essay, in honor of Professor Jerry Hogan, discusses parallel behaviors used by rat and human mothers to minimize energy loss in their offspring. Parallel mechanisms underlying energy preservation have been identified in rats and humans, suggesting phylogenetic conservation and possibly continuity. This article is part of a Special Issue entitled: In Honor of Jerry Hogan. Copyright © 2015. Published by Elsevier B.V.

  16. From Civic Conservation to the Age of Ecology: The Rise and Synthesis of Ecological Ideas in the American High School Science Curriculum, 1900-1980

    Science.gov (United States)

    Laubach, Stephen A.

    2013-01-01

    Ecological ideas have been manifested in diverse ways in American high schools since the early twentieth century. Core scientific concepts in ecology--the study of the relationship between organisms and their environment--include adaptations, plant succession, ecosystem ecology, and population ecology. This dissertation argues, however, that there…

  17. Quantifying solute transport processes: are chemically "conservative" tracers electrically conservative?

    Science.gov (United States)

    Singha, Kamini; Li, Li; Day-Lewis, Frederick D.; Regberg, Aaron B.

    2012-01-01

    The concept of a nonreactive or conservative tracer, commonly invoked in investigations of solute transport, requires additional study in the context of electrical geophysical monitoring. Tracers that are commonly considered conservative may undergo reactive processes, such as ion exchange, thus changing the aqueous composition of the system. As a result, the measured electrical conductivity may reflect not only solute transport but also reactive processes. We have evaluated the impacts of ion exchange reactions, rate-limited mass transfer, and surface conduction on quantifying tracer mass, mean arrival time, and temporal variance in laboratory-scale column experiments. Numerical examples showed that (1) ion exchange can lead to resistivity-estimated tracer mass, velocity, and dispersivity that may be inaccurate; (2) mass transfer leads to an overestimate in the mobile tracer mass and an underestimate in velocity when using electrical methods; and (3) surface conductance does not notably affect estimated moments when high-concentration tracers are used, although this phenomenon may be important at low concentrations or in sediments with high and/or spatially variable cation-exchange capacity. In all cases, colocated groundwater concentration measurements are of high importance for interpreting geophysical data with respect to the controlling transport processes of interest.

  18. Comparative Study of Regulatory Circuits in Two Sea Urchin Species Reveals Tight Control of Timing and High Conservation of Expression Dynamics.

    OpenAIRE

    Tsvia Gildor; Smadar Ben-Tabou de-Leon

    2015-01-01

    Accurate temporal control of gene expression is essential for normal development and must be robust to natural genetic and environmental variation. Studying gene expression variation within and between related species can delineate the level of expression variability that development can tolerate. Here we exploit the comprehensive model of sea urchin gene regulatory networks and generate high-density expression profiles of key regulatory genes of the Mediterranean sea urchin, Paracentrotus li...

  19. High-resolution mapping of H4K16 and H3K23 acetylation reveals conserved and unique distribution patterns in Arabidopsis and rice

    OpenAIRE

    Lu, Li; Chen, Xiangsong; Sanders, Dean; Qian, Shuiming; Zhong, Xuehua

    2015-01-01

    Histone acetylation and deacetylation are key epigenetic gene regulatory mechanisms that play critical roles in eukaryotes. Acetylation of histone 4 lysine 16 (H4K16ac) is implicated in many cellular processes. However, its biological function and relationship with transcription are largely unexplored in plants. We generated first genome-wide high-resolution maps of H4K16ac in Arabidopsis thaliana and Oryza sativa. We showed that H4K16ac is preferentially enriched around the transcription sta...

  20. Future directions for conservation

    NARCIS (Netherlands)

    Keulartz, Jozef

    2016-01-01

    The use of target baselines or reference states for conservation and restoration has become increasingly problematic and impractical, due to rapid environmental change, the paradigm shift in ecology from a static to a dynamic view of nature, and growing awareness of the role of cultural

  1. Conservation of Beclardia macrostachya

    African Journals Online (AJOL)

    admpather

    little research was done on the biology of these orchids in Mauritius (Roberts, 2001). Therefore, the biology of Beclardia macrostachya was studied and consequently, appropriate strategies would be devised for its conservation. There is only one known species under the genus Beclardia which is Beclardia macrostachya ...

  2. Biological science in conservation

    Science.gov (United States)

    David M. Johns

    2000-01-01

    Large-scale wildlands reserve systems offer one of the best hopes for slowing, if not reversing, the loss of biodiversity and wilderness. Establishing such reserves requires both sound biology and effective advocacy. Attempts by The Wildlands Project and its cooperators to meld science and advocacy in the service of conservation is working, but is not without some...

  3. Conservation and gene banking

    Science.gov (United States)

    Plant conservation has several objectives the main ones include safeguarding our food supply, preserving crop wild relatives for breeding and selection of new cultivars, providing material for industrial and pharmaceutical uses and preserving the beauty and diversity of our flora for generations to ...

  4. Urban bird conservation

    NARCIS (Netherlands)

    Snep, Robbert P.H.; Kooijmans, Jip Louwe; Kwak, Robert G.M.; Foppen, Ruud P.B.; Parsons, Holly; Awasthy, Monica; Sierdsema, Henk L.K.; Marzluff, John M.; Fernandez-Juricic, Esteban; Laet, de Jenny

    2016-01-01

    Following the call from the United Nations Convention on Biological Diversity “Cities & Biodiversity Outlook” project to better preserve urban biodiversity, this paper presents stakeholder-specific statements for bird conservation in city environments. Based upon the current urban bird

  5. Foundry energy conservation workbook

    Energy Technology Data Exchange (ETDEWEB)

    None

    1990-10-01

    This report discusses methods for promoting energy conservation in foundries. Use of electric power, natural gas, and coke are evaluated. Waste heat recovery systems are considered. Energy consumption in the specific processes of electric melting, natural gas melting, heat treatments, ladle melting, and coke fuel melting is described. An example energy analysis is included. (GHH)

  6. Foundry energy conservation workbook

    Energy Technology Data Exchange (ETDEWEB)

    1990-12-31

    This report discusses methods for promoting energy conservation in foundries. Use of electric power, natural gas, and coke are evaluated. Waste heat recovery systems are considered. Energy consumption in the specific processes of electric melting, natural gas melting, heat treatments, ladle melting, and coke fuel melting is described. An example energy analysis is included. (GHH)

  7. Energy Conservation Simplified

    Science.gov (United States)

    Hecht, Eugene

    2008-01-01

    The standard formulation of energy conservation involves the subsidiary ideas of kinetic energy ("KE"), work ("W"), thermal energy, internal energy, and a half-dozen different kinds of potential energy ("PE"): elastic, chemical, nuclear, gravitational, and so forth. These quantities came to be recognized during the centuries over which the…

  8. "Conservative" views of abortion.

    Science.gov (United States)

    Devine, P E

    1997-01-01

    The introduction to this essay, which presents and defends the "conservative" position on abortion, explains that this position holds that 1) abortion is wrong because it destroys the fetus; 2) the fetus has full personhood from conception (or very near conception); 3) abortion is only justified under special circumstances, such as when the pregnancy poses a threat to the woman's life; and 4) these conclusions should be reflected in law and public policy. Part 2 sets forth the moral foundations for this position. The third part considers the status of the fetus and reviews the various arguments that have been forwarded to resolve the question, such as the species principle, the potentiality principle, the sentience principle, and the conventionalist principle. Part 4 applies the conservative position to problems posed by hard cases, determines that abortion is a form of homicide from two weeks after fertilization (at the latest), reviews circumstances in which various legal definitions of homicide are applicable, argues for the denial of abortion funding by the state, and notes that violent militancy is not the appropriate response to a belief that abortion should be illegal. Section 5 refutes objections to the conservative position based on the fact that some opponents of abortion also oppose contraception, based on feminist ideals, and based on calls for religious freedom in a pluralistic society. In conclusion, the labels applied to the abortion debate are examined, and it is suggested that "communitarian" is the best term for the conservative position.

  9. Madagascar Conservation & Development

    African Journals Online (AJOL)

    www.journalmcd.com

    MADAGASCAR CONSERVATION & DEVELOPMENT. VOLUME 7 | ISSUE 1 — JUNE 2012. PAGE 5 .... and measurements of deforestation in Africa and Madagascar, but the deforestation itself continues: in some places – espe ... the islands around Africa, in the 1982 FAO compila- tion. For the purpose of the present article, ...

  10. Beyond conservation agriculture

    NARCIS (Netherlands)

    Giller, K.E.; Andersson, J.A.; Corbeels, Marc; Kirkegaard, John; Mortensen, David; Erenstein, Olaf; Vanlauwe, Bernard

    2015-01-01

    Global support for Conservation Agriculture (CA) as a pathway to Sustainable Intensification is strong. CA revolves around three principles: no-till (or minimal soil disturbance), soil cover, and crop rotation. The benefits arising from the ease of crop management, energy/cost/time savings, and

  11. Large-scale nucleotide sequence alignment and sequence variability assessment to identify the evolutionarily highly conserved regions for universal screening PCR assay design: an example of influenza A virus.

    Science.gov (United States)

    Nagy, Alexander; Jiřinec, Tomáš; Černíková, Lenka; Jiřincová, Helena; Havlíčková, Martina

    2015-01-01

    The development of a diagnostic polymerase chain reaction (PCR) or quantitative PCR (qPCR) assay for universal detection of highly variable viral genomes is always a difficult task. The purpose of this chapter is to provide a guideline on how to align, process, and evaluate a huge set of homologous nucleotide sequences in order to reveal the evolutionarily most conserved positions suitable for universal qPCR primer and hybridization probe design. Attention is paid to the quantification and clear graphical visualization of the sequence variability at each position of the alignment. In addition, specific problems related to the processing of the extremely large sequence pool are highlighted. All of these steps are performed using an ordinary desktop computer without the need for extensive mathematical or computational skills.

  12. Understanding conservationists' perspectives on the new-conservation debate.

    Science.gov (United States)

    Holmes, George; Sandbrook, Chris; Fisher, Janet A

    2017-04-01

    A vibrant debate about the future direction of biodiversity conservation centers on the merits of the so-called new conservation. Proponents of the new conservation advocate a series of positions on key conservation ideas, such as the importance of human-dominated landscapes and conservation's engagement with capitalism. These have been fiercely contested in a debate dominated by a few high-profile individuals, and so far there has been no empirical exploration of existing perspectives on these issues among a wider community of conservationists. We used Q methodology to examine empirically perspectives on the new conservation held by attendees at the 2015 International Congress for Conservation Biology (ICCB). Although we identified a consensus on several key issues, 3 distinct positions emerged: in favor of conservation to benefit people but opposed to links with capitalism and corporations, in favor of biocentric approaches but with less emphasis on wilderness protection than prominent opponents of new conservation, and in favor of the published new conservation perspective but with less emphasis on increasing human well-being as a goal of conservation. Our results revealed differences between the debate on the new conservation in the literature and views held within a wider, but still limited, conservation community and demonstrated the existence of at least one viewpoint (in favor of conservation to benefit people but opposed to links with capitalism and corporations) that is almost absent from the published debate. We hope the fuller understanding we present of the variety of views that exist but have not yet been heard, will improve the quality and tone of debates on the subject. © 2016 The Authors. Conservation Biology published by Wiley Periodicals, Inc. on behalf of Society for Conservation Biology.

  13. Discovery of sympatric dwarf lemur species in the high-altitude rain forest of Tsinjoarivo, Eastern Madagascar: implications for biogeography and conservation.

    Science.gov (United States)

    Blanco, Marina B; Godfrey, Laurie R; Rakotondratsima, Mamihasimbola; Rahalinarivo, Vololonirina; Samonds, Karen E; Raharison, Jean-Luc; Irwin, Mitchell T

    2009-01-01

    The number of species within the Malagasy lemur genus Cheirogaleus is currently under debate. Museum collections are spotty, and field work, supplemented by morphometric and genetic analysis, is essential for documenting geographic distributions, ecological characteristics and species boundaries. We report here field evidence for 2 dwarf lemur species at Tsinjoarivo, an eastern-central high-altitude rain forest: one, from a forest fragment, displaying coat and dental characteristics similar to C. sibreei (previously described only from museum specimens) and the other, from the continuous forest, resembling individuals of Cheirogaleus found today at Ranomafana National Park, further to the south. This study represents the first confirmation of a living population of grey-fawn, C.-sibreei-like, dwarf lemurs in Madagascar. 2008 S. Karger AG, Basel.

  14. Cosmetic Analysis Following Breast-Conserving Surgery and Adjuvant High-Dose-Rate Interstitial Brachytherapy for Early-Stage Breast Cancer: A Prospective Clinical Study

    Energy Technology Data Exchange (ETDEWEB)

    Garsa, Adam A.; Ferraro, Daniel J.; DeWees, Todd [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Margenthaler, Julie A. [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Naughton, Michael [Department of Medicine, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Aft, Rebecca [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Department of Surgery, John Cochran Veterans Hospital, St. Louis, Missouri (United States); Gillanders, William E.; Eberlein, Timothy [Department of Surgery, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Matesa, Melissa A. [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States); Zoberi, Imran, E-mail: izoberi@radonc.wustl.edu [Department of Radiation Oncology, Siteman Cancer Center, Barnes-Jewish Hospital and Washington University School of Medicine, St. Louis, Missouri (United States)

    2013-03-15

    Purpose: To prospectively evaluate cosmetic outcomes in women treated with accelerated partial breast irradiation using high-dose-rate interstitial brachytherapy for early-stage breast cancer. Methods and Materials: Between 2004 and 2008, 151 patients with early-stage breast cancer were enrolled in a phase 2 prospective clinical trial. Eligible patients had stage Tis-T2 tumors of ≤3 cm that were excised with negative margins and with no nodal involvement. Patients received 3.4 Gy twice daily to a total dose of 34 Gy. Both the patients and the treating radiation oncologist qualitatively rated cosmesis as excellent, good, fair, or poor over time and ascribed a cause for changes in cosmesis. Cosmetic outcome was evaluated quantitatively by percentage of breast retraction assessment (pBRA). Patients also reported their satisfaction with treatment over time. Results: Median follow-up was 55 months. The rates of excellent-to-good cosmesis reported by patients and the treating radiation oncologist were 92% and 97% pretreatment, 91% and 97% at 3 to 4 months' follow-up, 87% and 94% at 2 years, and 92% and 94% at 3 years, respectively. Breast infection and adjuvant chemotherapy were independent predictors of a fair-to-poor cosmetic outcome at 3 years. Compared to pretreatment pBRA (7.35), there was no significant change in pBRA over time. The volume receiving more than 150 Gy (V150) was the only significant predictor of pBRA. The majority of patients (86.6%) were completely satisfied with their treatment. Conclusions: Patients and the treating physician reported a high rate of excellent-to-good cosmetic outcomes at all follow-up time points. Acute breast infection and chemotherapy were associated with worse cosmetic outcomes. Multicatheter interstitial brachytherapy does not significantly change breast size as measured by pBRA.

  15. Genetic evaluation of seeds of highly endangered Pinus uliginosa Neumann from Węgliniec reserve for ex-situ conservation program

    Directory of Open Access Journals (Sweden)

    Andrzej Lewandowski

    2011-01-01

    Full Text Available Peat-bog pine Pinus uliginosa Neumann has become extinct or rare in many parts of Europe. We have investigated the levels of genetic variation and inbreeding in seeds collected from a highly endangered reserve of this species in Poland, using allozymes as genetic markers. Generally, a high level of genetic variation was observed. The mean expected heterozygosity was 0.376, while average (Na and effective (Ne numbers of alleles per locus were 2.45 and 1.67, respectively. Nevertheless, we have detected relatively low levels of outcrossing, and potential biparental inbreeding. The population-wide multilocus outcrossing rate was estimated to be 0.706 (±0.091, while the minimum variance mea