WorldWideScience

Sample records for highly attenuated vaccinia

  1. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Directory of Open Access Journals (Sweden)

    Sanda Miloslav

    2010-05-01

    Full Text Available Abstract Background Vaccinia virus, one of the best known members of poxvirus family, has a wide host range both in vivo and in vitro. The expression of Flt3 ligand (FL by recombinant vaccinia virus (rVACV highly influenced properties of the virus in dependence on the level of expression. Results High production of FL driven by the strong synthetic promoter decreased the growth of rVACV in macrophage cell line J774.G8 in vitro as well as its multiplication in vivo when inoculated in mice. The inhibition of replication in vivo was mirrored in low levels of antibodies against vaccinia virus (anti-VACV which nearly approached to the negative serum level in non-infected mice. Strong FL expression changed not only the host range of the recombinant but also the basic protein contents of virions. The major proteins - H3L and D8L - which are responsible for the virus binding to the cells, and 28 K protein that serves as a virulence factor, were changed in the membrane portion of P13-E/L-FL viral particles. The core virion fraction contained multiple larger, uncleaved proteins and a higher amount of cellular proteins compared to the control virus. The overexpression of FL also resulted in its incorporation into the viral core of P13-E/L-FL IMV particles. In contrary to the equimolar ratio of glycosylated and nonglycosylated FL forms found in cells transfected with the expression plasmid, the recombinant virus incorporated mainly the smaller, nonglycosylated FL. Conclusions It has been shown that the overexpression of the Flt3L gene in VACV results in the attenuation of the virus in vivo.

  2. A novel high-throughput vaccinia virus neutralization assay and preexisting immunity in populations from different geographic regions in China.

    Directory of Open Access Journals (Sweden)

    Qiang Liu

    Full Text Available BACKGROUND: Pre-existing immunity to Vaccinia Tian Tan virus (VTT resulting from a large vaccination campaign against smallpox prior to the early 1980s in China, has been a major issue for application of VTT-vector based vaccines. It is essential to establish a sensitive and high-throughput neutralization assay to understand the epidemiology of Vaccinia-specific immunity in current populations in China. METHODOLOGY/PRINCIPAL FINDINGS: A new anti-Vaccinia virus (VACV neutralization assay that used the attenuated replication-competent VTT carrying the firefly luciferase gene of Photinus pyralis (rTV-Fluc was established and standardized for critical parameters that included the choice of cell line, viral infection dose, and the infection time. The current study evaluated the maintenance of virus-specific immunity after smallpox vaccination by conducting a non-randomized, cross-sectional analysis of antiviral antibody-mediated immune responses in volunteers examined 30-55 years after vaccination. The rTV-Fluc neutralization assay was able to detect neutralizing antibodies (NAbs against Vaccinia virus without the ability to differentiate strains of Vaccinia virus. We showed that the neutralizing titers measured by our assay were similar to those obtained by the traditional plaque reduction neutralization test (PRNT. Using this assay, we found a low prevalence of NAb to VTT (7.6% in individuals born before 1980 from Beijing and Anhui provinces in China, and when present, anti-VTT NAb titers were low. No NAbs were detected in all 222 samples from individuals born after 1980. There was no significant difference observed for titer or prevalence by gender, age range and geographic origin. CONCLUSION: A simplified, sensitive, standardized, reproducible, and high-throughput assay was developed for the quantitation of NAbs against different Vaccinia strains. The current study provides useful insights for the future development of VTT-based vaccination in

  3. Safety and immunogenicity of LC16m8, an attenuated smallpox vaccine in vaccinia-naive adults.

    Science.gov (United States)

    Kennedy, Jeffrey S; Gurwith, Marc; Dekker, Cornelia L; Frey, Sharon E; Edwards, Kathryn M; Kenner, Julie; Lock, Michael; Empig, Cyril; Morikawa, Shigeru; Saijo, Masayuki; Yokote, Hiroyuki; Karem, Kevin; Damon, Inger; Perlroth, Mark; Greenberg, Richard N

    2011-11-01

    LC16m8 is an attenuated cell culture-adapted Lister vaccinia smallpox vaccine missing the B5R protein and licensed for use in Japan. We conducted a phase I/II clinical trial that compared the safety and immunogenicity of LC16m8 with Dryvax in vaccinia-naive participants. Adverse events were assessed, as were electrocardiography and laboratory testing for cardiotoxicity and viral culturing of the vaccination sites. Neutralization titers to vaccinia, monkeypox, and variola major were assessed and cell-mediated immune responses were measured by interferon (IFN)-γ enzyme-linked immunosorbent spot and lymphoproliferation assays. Local and systemic reactions after vaccination with LC16m8 were similar to those reported after Dryvax. No clinically significant abnormalities consistent with cardiac toxicity were seen for either vaccine. Both vaccines achieved antivaccinia, antivariola, and antimonkeypox neutralizing antibody titers >1:40, although the mean plaque reduction neutralization titer of LC16m8 at day 30 after vaccination was significantly lower than Dryvax for anti-NYCBH vaccinia (P smallpox. Clinical Trials Registration. NCT00103584.

  4. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Czech Academy of Sciences Publication Activity Database

    Žurková, K.; Hainz, P.; Kryštofová, J.; Kutinová, L.; Šanda, Miloslav; Němečková, Š.

    2010-01-01

    Roč. 7, č. 1 (2010), 109/1-109/15 ISSN 1743-422X Institutional research plan: CEZ:AV0Z40550506 Keywords : vaccinia virus * antibodies * virulence Subject RIV: CE - Biochemistry Impact factor: 2.546, year: 2010

  5. Modified vaccinia virus Ankara protects macaques against respiratory challenge with monkeypox virus.

    NARCIS (Netherlands)

    K.J. Stittelaar (Koert); G. van Amerongen (Geert); I. Kondova (Ivanela); R.F. van Lavieren (Rob); F.H. Pistoor (Frank); H.G.M. Niesters (Bert); G.J.J. van Doornum (Gerard); B.A.M. van der Zeijst (Ben); L. Mateo (Luis); P.J. Chaplin (Paul); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)

    2005-01-01

    textabstractThe use of classical smallpox vaccines based on vaccinia virus (VV) is associated with severe complications in both naive and immune individuals. Modified vaccinia virus Ankara (MVA), a highly attenuated replication-deficient strain of VV, has been proven to be safe in humans and

  6. Immunogenicity and virulence of attenuated vaccinia virus Tian Tan encoding HIV-1 muti-epitope genes, p24 and cholera toxin B subunit in mice.

    Science.gov (United States)

    Du, Shouwen; Wang, Yuhang; Liu, Cunxia; Wang, Maopeng; Zhu, Yilong; Tan, Peng; Ren, Dayong; Li, Xiao; Tian, Mingyao; Yin, Ronglan; Li, Chang; Jin, Ningyi

    2015-07-01

    No effective prophylactic or therapeutic vaccine against HIV-1 in humans is currently available. This study analyzes the immunogenicity and safety of a recombinant attenuated vaccinia virus. A chimeric gene of HIV-1 multi-epitope genes containing CpG ODN and cholera toxin B subunit (CTB) was inserted into Chinese vaccinia virus Tian Tan strain (VTT) mutant strain. The recombinant virus rddVTT(-CCMp24) was assessed for immunogenicity and safety in mice. Results showed that the protein CCMp24 was expressed stably in BHK-21 infected with rddVTT(-CCMp24). And the recombinant virus induced the production of HIV-1 p24 specific immunoglobulin G (IgG), IL-2 and IL-4. The recombinant vaccine induced γ-interferon secretion against HIV peptides, and elicited a certain levels of immunological memory. Results indicated that the recombinant virus had certain immunogenicity to HIV-1. Additionally, the virulence of the recombinant virus was been attenuated in vivo of mice compared with wild type VTT (wtVTT), and the introduction of CTB and HIV Mp24 did not alter the infectivity and virulence of defective vaccinia virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Vaccinia viruses isolated from cutaneous disease in horses are highly virulent for rabbits.

    Science.gov (United States)

    Felipetto Cargnelutti, Juliana; Schmidt, Candice; Masuda, Eduardo Kenji; Braum, Lisiane Danusa; Weiblen, Rudi; Furtado Flores, Eduardo

    2012-03-01

    Two genotypically distinct Vaccinia viruses (VACV), named P1V and P2V, were isolated from an outbreak of cutaneous disease in horses in Southern Brazil. We herein investigated the susceptibility of rabbits, a proposed animal model, to P1V and P2V infection. Groups of weanling rabbits were inoculated intranasally (IN) with P1V or P2V at low (10(2.5) TCID50), medium (10(4.5)TCID50), or high titer (10(6.5)TCID50). Rabbits inoculated with medium and high titers shed virus in nasal secretions and developed serous to hemorrhagic nasal discharge and severe respiratory distress, followed by progressive apathy and high lethality. Clinical signs appeared around days 3-6 post-inoculation (pi) and lasted up to the day of death or euthanasia (around days 5-10). Virus shedding and clinical signs were less frequent in rabbits inoculated with low virus titers. Viremia was detected in all groups, with different frequencies. Viral DNA was detected in the feces of a few animals inoculated with P1V and P2V, low titer, and with P2V at high titer. Gross necropsy findings and histological examination showed diffuse interstitial fibrousing pneumonia with necrosuppurative bronchopneumonia and intestinal liquid content. Neutralizing antibodies were detected in all inoculated animals surviving beyond day 9 pi. These results show that rabbits are highly susceptible to VACV isolated from horses, and develop severe respiratory and systemic disease upon IN inoculation. Thus, rabbits may be used to study selected aspects of VACV infection and disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Oncolytic vaccinia therapy of squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Yong A

    2009-07-01

    Full Text Available Abstract Background Novel therapies are necessary to improve outcomes for patients with squamous cell carcinomas (SCC of the head and neck. Historically, vaccinia virus was administered widely to humans as a vaccine and led to the eradication of smallpox. We examined the therapeutic effects of an attenuated, replication-competent vaccinia virus (GLV-1h68 as an oncolytic agent against a panel of six human head and neck SCC cell lines. Results All six cell lines supported viral transgene expression (β-galactosidase, green fluorescent protein, and luciferase as early as 6 hours after viral exposure. Efficient transgene expression and viral replication (>150-fold titer increase over 72 hrs were observed in four of the cell lines. At a multiplicity of infection (MOI of 1, GLV-1h68 was highly cytotoxic to the four cell lines, resulting in ≥ 90% cytotoxicity over 6 days, and the remaining two cell lines exhibited >45% cytotoxicity. Even at a very low MOI of 0.01, three cell lines still demonstrated >60% cell death over 6 days. A single injection of GLV-1h68 (5 × 106 pfu intratumorally into MSKQLL2 xenografts in mice exhibited localized intratumoral luciferase activity peaking at days 2–4, with gradual resolution over 10 days and no evidence of spread to normal organs. Treated animals exhibited near-complete tumor regression over a 24-day period without any observed toxicity, while control animals demonstrated rapid tumor progression. Conclusion These results demonstrate significant oncolytic efficacy by an attenuated vaccinia virus for infecting and lysing head and neck SCC both in vitro and in vivo, and support its continued investigation in future clinical trials.

  9. High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4(+) T cell responses more than 30 years post-vaccinia virus vaccination

    DEFF Research Database (Denmark)

    Wang, M.; Tang, Sheila Tuyet; Lund, Ole

    2009-01-01

    Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human...

  10. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  11. Ribonuclease activity of vaccinia DNA topoisomerase IB: kinetic and high-throughput inhibition studies using a robust continuous fluorescence assay.

    Science.gov (United States)

    Kwon, Keehwan; Nagarajan, Rajesh; Stivers, James T

    2004-11-30

    Vaccinia type I DNA topoisomerase exhibits a strong site-specific ribonuclease activity when provided a DNA substrate that contains a single uridine ribonucleotide within a duplex DNA containing the sequence 5' CCCTU 3'. The reaction involves two steps: attack of the active site tyrosine nucleophile of topo I at the 3' phosphodiester of the uridine nucleotide to generate a covalent enzyme-DNA adduct, followed by nucleophilic attack of the uridine 2'-hydroxyl to release the covalently tethered enzyme. Here we report the first continuous spectroscopic assay for topoisomerase that allows monitoring of the ribonuclease reaction under multiple-turnover conditions. The assay is especially robust for high-throughput screening applications because sensitive molecular beacon technology is utilized, and the topoisomerase is released during the reaction to allow turnover of multiple substrate molecules by a single molecule of enzyme. Direct computer simulation of the fluorescence time courses was used to obtain the rate constants for substrate binding and release, covalent complex formation, and formation of the 2',3'-cyclic phosphodiester product of the ribonuclease reaction. The assay allowed rapid screening of a 500 member chemical library from which several new inhibitors of topo I were identified with IC(50) values in the range of 2-100 microM. Three of the most potent hits from the high-throughput screening were also found to inhibit plasmid supercoil relaxation by the enzyme, establishing the utility of the assay in identifying inhibitors of the biologically relevant DNA relaxation reaction. One of the most potent inhibitors of the vaccinia enzyme, 3-benzo[1,3]dioxol-5-yl-2-oxoproprionic acid, did not inhibit the closely related human enzyme. The inhibitory mechanism of this compound is unique and involves a step required for recycling the enzyme for steady-state turnover.

  12. A marker-free system for highly efficient construction of vaccinia virus vectors using CRISPR Cas9

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    Full Text Available The current method for creation of vaccinia virus (VACV vectors involves using a selection and purification marker, however inclusion of a gene without therapeutic value in the resulting vector is not desirable for clinical use. The Cre-LoxP system has been used to make marker-free Poxviruses, but the efficiency was very low. To obtain a marker-free VACV vector, we developed marker gene excision systems to modify the thymidine kinase (TK region and N1L regions using Cre-Loxp and Flp-FRET systems respectively. CRISPR-Cas9 system significantly resulted in a high efficiency (∼90% in generation of marker gene-positive TK-mutant VACV vector. The marker gene (RFP could be excised from the recombinant virus using Cre recombinase. To make a marker-free VV vector with double gene deletions targeting the TK and N1L gene, we constructed a donor repair vector targeting the N1L gene, which can carry a therapeutic gene and the marker (RFP that could be excised from the recombinant virus using Flp recombinase. The marker-free system developed here can be used to efficiently construct VACV vectors armed with any therapeutic genes in the TK region or N1L region without marker genes. Our marker-free system platform has significant potential for development of new marker-free VACV vectors for clinical application.

  13. Identification and preliminary characterization of vaccinia virus (Dryvax) antigens recognized by vaccinia immune globulin

    National Research Council Canada - National Science Library

    Jones-Trower, Agnes; Garcia, Alonzo; Meseda, Clement A; He, Yong; Weiss, Carol; Kumar, Arunima; Weir, Jerry P; Merchlinsky, Michael

    2005-01-01

    Using vaccinia immune globulin (VIG), a high-titer antibody preparation from immunized subjects, we demonstrate that the humoral immune response in humans is directed against numerous antigens in the Dryvax vaccine strain...

  14. A novel replication-competent vaccinia vector MVTT is superior to MVA for inducing high levels of neutralizing antibody via mucosal vaccination.

    Directory of Open Access Journals (Sweden)

    Xiaoxing Huang

    Full Text Available Mucosal vaccination offers great advantage for inducing protective immune response to prevent viral transmission and dissemination. Here, we report our findings of a head-to-head comparison of two viral vectors modified vaccinia Ankara (MVA and a novel replication-competent modified vaccinia Tian Tan (MVTT for inducing neutralizing antibodies (Nabs via intramuscular and mucosal vaccinations in mice. MVTT is an attenuated variant of the wild-type VTT, which was historically used as a smallpox vaccine for millions of Chinese people. The spike glycoprotein (S of SARS-CoV was used as the test antigen after the S gene was constructed in the identical genomic location of two vectors to generate vaccine candidates MVTT-S and MVA-S. Using identical doses, MVTT-S induced lower levels ( approximately 2-3-fold of anti- SARS-CoV neutralizing antibodies (Nabs than MVA-S through intramuscular inoculation. MVTT-S, however, was capable of inducing consistently 20-to-100-fold higher levels of Nabs than MVA-S when inoculated via either intranasal or intraoral routes. These levels of MVTT-S-induced Nab responses were substantially (approximately 10-fold higher than that induced via the intramuscular route in the same experiments. Moreover, pre-exposure to the wild-type VTT via intranasal or intraoral route impaired the Nab response via the same routes of MVTT-S vaccination probably due to the pre-existing anti-VTT Nab response. The efficacy of intranasal or intraoral vaccination, however, was still 20-to-50-fold better than intramuscular inoculation despite the subcutaneous pre-exposure to wild-type VTT. Our data have implications for people who maintain low levels of anti-VTT Nabs after historical smallpox vaccination. MVTT is therefore an attractive live viral vector for mucosal vaccination.

  15. Safety profile of the viral vectors of attenuated fowlpox strain FP9 and modified vaccinia virus Ankara recombinant for either of 2 preerythrocytic malaria antigens, ME-TRAP or the circumsporozoite protein, in children and adults in Kenya.

    Science.gov (United States)

    Bejon, Philip; Peshu, Norbert; Gilbert, Sarah C; Lowe, Brett S; Molyneux, Catherine S; Forsdyke, John; Lang, Trudie; Hill, Adrian V S; Marsh, Kevin

    2006-04-15

    We are developing a heterologous prime-boost vaccine strategy against malaria. This approach uses sequential immunization with different vectors to deliver a common preerythrocytic malaria antigen. Preliminary evidence of efficacy and safety has been previously documented in studies from an area where malaria is nonendemic. Additional safety data from an area where malaria is endemic are now required before larger-scale studies are undertaken to determine the efficacy of this vaccine strategy in the field. Other modified vaccinia virus Ankara (MVA) recombinants and prime-boost immunizations are being developed as vaccines against human immunodeficiency virus (HIV) infection, tuberculosis, and cancer, and MVA is a candidate attenuated smallpox vaccine. Candidate vaccines against malaria were intradermally administered to 73 adults (7 of whom were HIV positive) and 22 children in Kenya. These vaccines used the attenuated fowlpox strain FP9 and the MVA recombinant for either of 2 preerythrocytic malaria antigens, multiple preerythrocytic-stage epitopes joined with the preerythrocytic-stage antigen TRAP (ME-TRAP) and the circumsporozoite protein (CS). Adverse events were recorded. Reactogenicity was mild. MVA caused less frequent and less severe cutaneous reaction if given after FP9 priming. Half doses reduced the frequency and the severity of systemic reactogenicity, and particular vaccine lots were associated with different reactogenicities. Unexpectedly, prior immunity to the ME-TRAP antigen appeared to be protective against local reactions after immunization. Where the final intention is to use MVA after FP9 priming, previous testing of MVA alone overestimates reactogenicity. These recombinant vectors appear to be safe and suitable for use in larger-scale studies of children in Africa and of HIV-positive individuals.

  16. The detection of Vaccinia virus confirms the high circulation of Orthopoxvirus in buffaloes living in geographical isolation, Marajó Island, Brazilian Amazon.

    Science.gov (United States)

    Franco-Luiz, Ana Paula Moreira; Fagundes Pereira, Alexandre; de Oliveira, Cairo Henrique Sousa; Barbosa, José Diomedes; Oliveira, Danilo Bretas; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; de Souza Trindade, Giliane; Abrahão, Jônatas Santos; Kroon, Erna Geessien

    2016-06-01

    In Brazil, serologic evidence of Orthopoxvirus (OPV) circulation showed positivity around 20% in cattle, humans, monkeys and rodents. Although OPV seropositivity has been described in buffalo herds in southeastern Brazil, no Vaccinia virus (VACV) (member of genus OPV) outbreaks in buffalo herds have been described in this country. This study aimed to investigate the detection of anti-OPV antibodies and to study the OPV genome in Brazilian buffalo herds. Our results demonstrated a high OPV seropositivity in buffalo herds on Marajó Island and molecular data confirmed the circulation of VACV. The geographical isolation conditionmight be a sine qua non condition to explain our results. Copyright © 2016. Published by Elsevier Ltd.

  17. Significant Growth Inhibition of Canine Mammary Carcinoma Xenografts following Treatment with Oncolytic Vaccinia Virus GLV-1h68

    Science.gov (United States)

    Gentschev, Ivaylo; Ehrig, Klaas; Donat, Ulrike; Hess, Michael; Rudolph, Stephan; Chen, Nanhai; Yu, Yong A.; Zhang, Qian; Bullerdiek, Jörn; Nolte, Ingo; Stritzker, Jochen; Szalay, Aladar A.

    2010-01-01

    Canine mammary carcinoma is a highly metastatic tumor that is poorly responsive to available treatment. Therefore, there is an urgent need to identify novel agents for therapy of this disease. Recently, we reported that the oncolytic vaccinia virus GLV-1h68 could be a useful tool for therapy of canine mammary adenoma in vivo. In this study we analyzed the therapeutic effect of GLV-1h68 against canine mammary carcinoma. Cell culture data demonstrated that GLV-1h68 efficiently infected and destroyed cells of the mammary carcinoma cell line MTH52c. Furthermore, after systemic administration, this attenuated vaccinia virus strain primarily replicated in canine tumor xenografts in nude mice. Finally, infection with GLV-1h68 led to strong inflammatory and oncolytic effects resulting in significant growth inhibition of the tumors. In summary, the data showed that the GLV-1h68 virus strain has promising potential for effective treatment of canine mammary carcinoma. PMID:20631910

  18. [Modified vaccinia virus ankara (MVA)--development as recombinant vaccine and prospects for use in veterinary medicine].

    Science.gov (United States)

    Volz, Asisa; Fux, Robert; Langenmayer, Martin C; Sutter, Gerd

    2015-01-01

    Poxviruses as expression vectors are widely used in medical research for the development of recombinant vaccines and molecular therapies. Here we review recent accomplishments in vaccine research using recombinant modified vaccinia virus ankara (MVA). MVA is a highly attenuated vaccinia virus strain that originated from serial tissue culture passage in chicken embryo fibroblasts more than 40 years ago. Growth adaptation to avian host cells caused deletions and mutations in the viral genome affecting about 15% of the original genetic information. In consequence, MVA is replication-deficient in cells of mammalian origin and fails to produce many of the virulence factors encoded by conventional vaccinia virus. Because of its safety for the general environment MVA can be handled under conditions of biosafety level one. Non-replicating MVA can enter any target cell and activate its molecular life cycle to express all classes of viral and recombinant genes. Therefore, recombinant MVA have been established as an extremely safe and efficient vector system for vaccine development in medical research. By now, various recombinant MVA vaccines have been found safe and immunogenic when used for phase I/II clinical testing in humans, and suitable for industrial scale production following good practice of manufacturing. Thus, there is an obvious usefulness of recombinant MVA vaccines for novel prophylactic and therapeutic approaches also in veterinary medicine. Results from first studies in companion and farm animals are highly promising.

  19. Biosafety aspects of modified vaccinia virus Ankara (MVA)-based vectors used for gene therapy or vaccination.

    Science.gov (United States)

    Verheust, Céline; Goossens, Martine; Pauwels, Katia; Breyer, Didier

    2012-03-30

    The modified vaccinia virus Ankara (MVA) strain is a highly attenuated strain of vaccinia virus that has been demonstrated to be safe for humans. MVA is widely considered as the vaccinia virus strain of choice for clinical investigation because of its high safety profile. It also represents an excellent candidate for use as vector system in recombinant vaccine development for gene delivery or vaccination against infectious diseases or tumours, even in immunocompromised individuals. The use of MVA and recombinant MVA vectors must comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The purpose of the present paper is to highlight some biological characteristics of MVA and MVA-based recombinant vectors and to discuss these from a biosafety point of view in the context of the European regulatory framework for genetically modified organisms with emphasis on the assessment of potential risks associated with environmental release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Immunogenicity of viral vector, prime-boost SIV vaccine regimens in infant rhesus macaques: attenuated vesicular stomatitis virus (VSV) and modified vaccinia Ankara (MVA) recombinant SIV vaccines compared to live-attenuated SIV.

    Science.gov (United States)

    Van Rompay, Koen K A; Abel, Kristina; Earl, Patricia; Kozlowski, Pamela A; Easlick, Juliet; Moore, Joseph; Buonocore-Buzzelli, Linda; Schmidt, Kimberli A; Wilson, Robert L; Simon, Ian; Moss, Bernard; Rose, Nina; Rose, John; Marthas, Marta L

    2010-02-10

    In a previously developed infant macaque model mimicking HIV infection by breast-feeding, we demonstrated that intramuscular immunization with recombinant poxvirus vaccines expressing simian immunodeficiency virus (SIV) structural proteins provided partial protection against infection following oral inoculation with virulent SIV. In an attempt to further increase systemic but also local antiviral immune responses at the site of viral entry, we tested the immunogenicity of different orally administered, replicating vaccines. One group of newborn macaques received an oral prime immunization with a recombinant vesicular stomatitis virus expressing SIVmac239 gag, pol and env (VSV-SIVgpe), followed 2 weeks later by an intramuscular boost immunization with MVA-SIV. Another group received two immunizations with live-attenuated SIVmac1A11, administered each time both orally and intravenously. Control animals received mock immunizations or non-SIV VSV and MVA control vectors. Analysis of SIV-specific immune responses in blood and lymphoid tissues at 4 weeks of age demonstrated that both vaccine regimens induced systemic antibody responses and both systemic and local cell-mediated immune responses. The safety and immunogenicity of the VSV-SIVgpe+MVA-SIV immunization regimen described in this report provide the scientific incentive to explore the efficacy of this vaccine regimen against virulent SIV exposure in the infant macaque model. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  1. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Directory of Open Access Journals (Sweden)

    Marnie L Elizaga

    Full Text Available Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines.Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls, and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine.Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12% had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine.Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants.ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  2. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Science.gov (United States)

    Elizaga, Marnie L; Vasan, Sandhya; Marovich, Mary A; Sato, Alicia H; Lawrence, Dale N; Chaitman, Bernard R; Frey, Sharon E; Keefer, Michael C

    2013-01-01

    Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax) campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA) has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines. Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls), and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine. Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12%) had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine. Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants. ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  3. The 131-amino-acid repeat region of the essential 39-kilodalton core protein of fowlpox virus FP9, equivalent to vaccinia virus A4L protein, is nonessential and highly immunogenic.

    Science.gov (United States)

    Boulanger, D; Green, P; Smith, T; Czerny, C P; Skinner, M A

    1998-01-01

    The immunodominant, 39,000-molecular weight core protein (39K protein) of fowlpox virus (FP9 strain), equivalent to the vaccinia virus A4L gene product, contains highly charged domains at each end of the protein and multiple copies of a 12-amino-acid serine-rich repeat sequence in the middle of the protein. Similar repeats were also detected in other fowlpox virus strains, suggesting that they might confer a selective advantage to the virus. The molloscum contagiosum virus homolog (MC107L) also contains repeats, unlike the vaccinia virus protein. The number of repeats in the fowlpox virus protein does not seem to be crucial, since some strains have a different number of repeats, as shown by the difference in the size of the protein in these strains. The repeat region could be deleted, indicating that it is not essential for replication in vitro. It was not possible to delete the entire 39K protein, indicating that it was essential (transcriptional control signals for the flanking genes were left intact). The repeat region is partly responsible for the immunodominance of the protein, but the C-terminal part of the protein also contains highly antigenic linear epitopes. A role for the 39K protein in immune system modulation is discussed.

  4. Vaccinia scars associated with better survival for adults. An observational study from Guinea-Bissau

    DEFF Research Database (Denmark)

    Aaby, Peter; Gustafson, Per; Roth, Adam Anders Edvin

    2006-01-01

    Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality.......Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality....

  5. Creating a collimated ultrasound beam in highly attenuating fluids.

    Science.gov (United States)

    Raeymaekers, Bart; Pantea, Cristian; Sinha, Dipen N

    2012-04-01

    We have devised a method, based on a parametric array concept, to create a low-frequency (300-500 kHz) collimated ultrasound beam in fluids highly attenuating to sound. This collimated beam serves as the basis for designing an ultrasound visualization system that can be used in the oil exploration industry for down-hole imaging in drilling fluids. We present the results of two different approaches to generating a collimated beam in three types of highly attenuating drilling mud. In the first approach, the drilling mud itself was used as a nonlinear mixing medium to create a parametric array. However, the short absorption length in mud limits the mixing length and, consequently, the resulting beam is weak and broad. In the second improved approach, the beam generation process was confined to a separate "frequency mixing tube" that contained an acoustically non-linear, low attenuation medium (e.g., water) that allowed establishing a usable parametric array in the mixing tube. A low-frequency collimated beam was thus created prior to its propagation into the drilling fluid. Using the latter technique, the penetration depth of the low frequency ultrasound beam in the drilling fluid was significantly extended. We also present measurements of acoustic nonlinearity in various types of drilling mud. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Doxycycline Inducible Melanogenic Vaccinia Virus as Theranostic Anti-Cancer Agent.

    Science.gov (United States)

    Kirscher, Lorenz; Deán-Ben, Xosé Luis; Scadeng, Miriam; Zaremba, Angelika; Zhang, Qian; Kober, Christina; Fehm, Thomas Felix; Razansky, Daniel; Ntziachristos, Vasilis; Stritzker, Jochen; Szalay, Aladar A

    2015-01-01

    We reported earlier the diagnostic potential of a melanogenic vaccinia virus based system in magnetic resonance (MRI) and optoacoustic deep tissue imaging (MSOT). Since melanin overproduction lead to attenuated virus replication, we constructed a novel recombinant vaccinia virus strain (rVACV), GLV-1h462, which expressed the key enzyme of melanogenesis (tyrosinase) under the control of an inducible promoter-system. In this study melanin production was detected after exogenous addition of doxycycline in two different tumor xenograft mouse models. Furthermore, it was confirmed that this novel vaccinia virus strain still facilitated signal enhancement as detected by MRI and optoacoustic tomography. At the same time we demonstrated an enhanced oncolytic potential compared to the constitutively melanin synthesizing rVACV system.

  7. Human CD4+ T cell epitopes from vaccinia virus induced by vaccination or infection.

    Directory of Open Access Journals (Sweden)

    J Mauricio Calvo-Calle

    2007-10-01

    Full Text Available Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4(+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4(+ T cell responses have been poorly characterized, and CD4(+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens.

  8. Human CD4+ T Cell Epitopes from Vaccinia Virus Induced by Vaccination or Infection

    Science.gov (United States)

    Calvo-Calle, J. Mauricio; Strug, Iwona; Nastke, Maria-Dorothea; Baker, Stephen P; Stern, Lawrence J

    2007-01-01

    Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4+ T cell responses have been poorly characterized, and CD4+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens. PMID:17937498

  9. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins

    Directory of Open Access Journals (Sweden)

    Vemulapalli Srilakshmi

    2006-03-01

    Full Text Available Abstract Background Although many vaccinia virus proteins have been identified and studied in detail, only a few studies have attempted a comprehensive survey of the protein composition of the vaccinia virion. These projects have identified the major proteins of the vaccinia virion, but little has been accomplished to identify the unknown or less abundant proteins. Obtaining a detailed knowledge of the viral proteome of vaccinia virus will be important for advancing our understanding of orthopoxvirus biology, and should facilitate the development of effective antiviral drugs and formulation of vaccines. Results In order to accomplish this task, purified vaccinia virions were fractionated into a soluble protein enriched fraction (membrane proteins and lateral bodies and an insoluble protein enriched fraction (virion cores. Each of these fractions was subjected to further fractionation by either sodium dodecyl sulfate-polyacrylamide gel electophoresis, or by reverse phase high performance liquid chromatography. The soluble and insoluble fractions were also analyzed directly with no further separation. The samples were prepared for mass spectrometry analysis by digestion with trypsin. Tryptic digests were analyzed by using either a matrix assisted laser desorption ionization time of flight tandem mass spectrometer, a quadrupole ion trap mass spectrometer, or a quadrupole-time of flight mass spectrometer (the latter two instruments were equipped with electrospray ionization sources. Proteins were identified by searching uninterpreted tandem mass spectra against a vaccinia virus protein database created by our lab and a non-redundant protein database. Conclusion Sixty three vaccinia proteins were identified in the virion particle. The total number of peptides found for each protein ranged from 1 to 62, and the sequence coverage of the proteins ranged from 8.2% to 94.9%. Interestingly, two vaccinia open reading frames were confirmed as being expressed

  10. Use of a recombinant vaccinia virus expressing interferon gamma for post-exposure protection against vaccinia and ectromelia viruses.

    Directory of Open Access Journals (Sweden)

    Susan A Holechek

    Full Text Available Post-exposure vaccination with vaccinia virus (VACV has been suggested to be effective in minimizing death if administered within four days of smallpox exposure. While there is anecdotal evidence for efficacy of post-exposure vaccination this has not been definitively studied in humans. In this study, we analyzed post-exposure prophylaxis using several attenuated recombinant VACV in a mouse model. A recombinant VACV expressing murine interferon gamma (IFN-γ was most effective for post-exposure protection of mice infected with VACV and ectromelia virus (ECTV. Untreated animals infected with VACV exhibited severe weight loss and morbidity leading to 100% mortality by 8 to 10 days post-infection. Animals treated one day post-infection had milder symptoms, decreased weight loss and morbidity, and 100% survival. Treatment on days 2 or 3 post-infection resulted in 40% and 20% survival, respectively. Similar results were seen in ECTV-infected mice. Despite the differences in survival rates in the VACV model, the viral load was similar in both treated and untreated mice while treated mice displayed a high level of IFN-γ in the serum. These results suggest that protection provided by IFN-γ expressed by VACV may be mediated by its immunoregulatory activities rather than its antiviral effects. These results highlight the importance of IFN-γ as a modulator of the immune response for post-exposure prophylaxis and could be used potentially as another post-exposure prophylaxis tool to prevent morbidity following infection with smallpox and other orthopoxviruses.

  11. The NYCBH vaccinia virus deleted for the innate immune evasion gene, E3L, protects rabbits against lethal challenge by rabbitpox virus

    Science.gov (United States)

    Denzler, Karen L; Rice, Amanda D; MacNeill, Amy L; Fukushima, Nobuko; Lindsey, Scott F; Wallace, Greg; Burrage, Andrew M; Smith, Andrew J; Manning, Brandi R; Swetnam, Daniele M; Gray, Stacey A; Moyer, RW; Jacobs, Bertram L

    2011-01-01

    Vaccinia virus deleted for the innate immune evasion gene, E3L, has been shown to be highly attenuated and yet induces a protective immune response against challenge by homologous virus in a mouse model. In this manuscript the NYCBH vaccinia virus vaccine strain was compared to NYCBH vaccinia virus deleted for E3L (NYCBHΔE3L) in a rabbitpox virus (RPV) challenge model. Upon scarification, both vaccines produced a desired skin lesion, although the lesion produced by NYCBHΔE3L was smaller. Both vaccines fully protected rabbits against lethal challenge by escalating doses of RPV, from 10 LD50 to 1,000 LD50. A single dose of NYCBHΔE3L protected rabbits from weight loss, fever, and clinical symptoms following the lowest dose challenge of 10 LD50, however it allowed a moderate level of RPV replication at the challenge site, some spread to external skin and mucosal surfaces, and increased numbers of secondary lesions as compared to vaccination with NYCBH. Alternately, two doses of NYCBHΔE3L fully protected rabbits from weight loss, fever, and clinical symptoms, following challenge with 100 to 1,000 LD50 RPV, and it prevented development of secondary lesions similar to protection seen with NYCBH. Finally, vaccination with either one or two doses of NYCBHΔE3L resulted in similar neutralizing antibody titers following RPV challenge as compared to titers obtained by vaccination with NYCBH. These results support the efficacy of the attenuated NYCBHΔE3L in protection against an orthologous poxvirus challenge. PMID:21840358

  12. Isolation and characterization of cidofovir resistant vaccinia viruses

    Directory of Open Access Journals (Sweden)

    Prichard Mark N

    2008-05-01

    Full Text Available Abstract Background The emergence of drug resistant viruses, together with the possibility of increased virulence, is an important concern in the development of new antiviral compounds. Cidofovir (CDV is a phosphonate nucleotide that is approved for use against cytomegalovirus retinitis and for the emergency treatment of smallpox or complications following vaccination. One mode of action for CDV has been demonstrated to be the inhibition of the viral DNA polymerase. Results We have isolated several CDV resistant (CDVR vaccinia viruses through a one step process, two of which have unique single mutations within the DNA polymerase. An additional resistant virus isolate provides evidence of a second site mutation within the genome involved in CDV resistance. The CDVR viruses were 3–7 fold more resistant to the drug than the parental viruses. The virulence of the CDVR viruses was tested in mice inoculated intranasally and all were found to be attenuated. Conclusion Resistance to CDV in vaccinia virus can be conferred individually by at least two different mutations within the DNA polymerase gene. Additional genes may be involved. This one step approach for isolating resistant viruses without serial passage and in the presence of low doses of drug minimizes unintended secondary mutations and is applicable to other potential antiviral agents.

  13. Attenuation Characteristics of High Frequency Seismic Waves in Southern India

    Science.gov (United States)

    Sivaram, K.; Utpal, Saikia; Kanna, Nagaraju; Kumar, Dinesh

    2017-07-01

    observed low- Q P and Q S values. Additionally, the enrichment of coda waves and significance of scattering mechanisms is evidenced in our observation of Q C > Q S estimates. Lapse time study shows Q C values increasing with lapse time. High Q C values at 40 s lapse times in WDC indicate that it may be a relatively stable region. In the absence of detailed body wave attenuation studies in this region, the frequency dependent Q relationships developed here are useful for the estimation of earthquake source parameters of the region. Also, these relations may be used for the simulation of earthquake strong ground motions which are required for the estimation of seismic hazard, geotechnical and retrofitting analysis of critical structures in the region.

  14. Thy1+ Nk Cells from Vaccinia Virus-Primed Mice Confer Protection against Vaccinia Virus Challenge in the Absence of Adaptive Lymphocytes

    Science.gov (United States)

    Gillard, Geoffrey O.; Bivas-Benita, Maytal; Hovav, Avi-Hai; Grandpre, Lauren E.; Panas, Michael W.; Seaman, Michael S.; Haynes, Barton F.; Letvin, Norman L.

    2011-01-01

    While immunological memory has long been considered the province of T- and B- lymphocytes, it has recently been reported that innate cell populations are capable of mediating memory responses. We now show that an innate memory immune response is generated in mice following infection with vaccinia virus, a poxvirus for which no cognate germline-encoded receptor has been identified. This immune response results in viral clearance in the absence of classical adaptive T and B lymphocyte populations, and is mediated by a Thy1+ subset of natural killer (NK) cells. We demonstrate that immune protection against infection from a lethal dose of virus can be adoptively transferred with memory hepatic Thy1+ NK cells that were primed with live virus. Our results also indicate that, like classical immunological memory, stronger innate memory responses form in response to priming with live virus than a highly attenuated vector. These results demonstrate that a defined innate memory cell population alone can provide host protection against a lethal systemic infection through viral clearance. PMID:21829360

  15. A pandemic influenza H1N1 live vaccine based on modified vaccinia Ankara is highly immunogenic and protects mice in active and passive immunizations.

    Directory of Open Access Journals (Sweden)

    Annett Hessel

    Full Text Available BACKGROUND: The development of novel influenza vaccines inducing a broad immune response is an important objective. The aim of this study was to evaluate live vaccines which induce both strong humoral and cell-mediated immune responses against the novel human pandemic H1N1 influenza virus, and to show protection in a lethal animal challenge model. METHODOLOGY/PRINCIPAL FINDINGS: For this purpose, the hemagglutinin (HA and neuraminidase (NA genes of the influenza A/California/07/2009 (H1N1 strain (CA/07 were inserted into the replication-deficient modified vaccinia Ankara (MVA virus--a safe poxviral live vector--resulting in MVA-H1-Ca and MVA-N1-Ca vectors. These live vaccines, together with an inactivated whole virus vaccine, were assessed in a lung infection model using immune competent Balb/c mice, and in a lethal challenge model using severe combined immunodeficient (SCID mice after passive serum transfer from immunized mice. Balb/c mice vaccinated with the MVA-H1-Ca virus or the inactivated vaccine were fully protected from lung infection after challenge with the influenza H1N1 wild-type strain, while the neuraminidase virus MVA-N1-Ca induced only partial protection. The live vaccines were already protective after a single dose and induced substantial amounts of neutralizing antibodies and of interferon-gamma-secreting (IFN-gamma CD4- and CD8 T-cells in lungs and spleens. In the lungs, a rapid increase of HA-specific CD4- and CD8 T cells was observed in vaccinated mice shortly after challenge with influenza swine flu virus, which probably contributes to the strong inhibition of pulmonary viral replication observed. In addition, passive transfer of antisera raised in MVA-H1-Ca vaccinated immune-competent mice protected SCID mice from lethal challenge with the CA/07 wild-type virus. CONCLUSIONS/SIGNIFICANCE: The non-replicating MVA-based H1N1 live vaccines induce a broad protective immune response and are promising vaccine candidates for

  16. Recombinant vaccinia DIs expressing simian immunodeficiency virus gag and pol in mammalian cells induces efficient cellular immunity as a safe immunodeficiency virus vaccine candidate.

    Science.gov (United States)

    Okamura, Tomotaka; Someya, Kenji; Matsuo, Kazuhiro; Hasegawa, Atsuhiko; Yamamoto, Naoki; Honda, Mitsuo

    2006-01-01

    A highly attenuated vaccinia virus substrain of Dairen-I (DIs) shows promise as a candidate vector for eliciting positive immunity against immune deficiency virus. DIs was randomly obtained by serial 1-day egg passages of a chorioarantoic membrane-adapted Dairen strain (DIE), resulting in substantial genomic deletion, including various genes regulating the virus-host-range. To investigate the impact of that deletion and of the subsequent insertion of a foreign gene into that region of DIs on the ability of the DIs recombinant to induce antigen-specific immunity, we generated a recombinant vaccinia DIs expressing fulllength gag and pol genes of simian immunodeficiency virus (SIV) (rDIsSIV gag/pol) and studied the biological and immunological characteristics of the recombinant natural mutant. The rDIsSIV gag/pol developed a tiny plaque on the chick embryo fibroblast (CEF). Viral particles of rDIsSIV gag/pol as well as SIV Gag-like particles were electromicroscopically detected in the cytoplasm. Interestingly, the recombinant DIs strain grows well in CEF cells but not in mammalian cells. While rDIsSIV gag/pol produces SIV proteins in mammalian HeLa and CV-1 cells, recombinant modified vaccinia Ankara strain (MVA) expressing SIV gag and pol genes (MVA/SIV239 gag/pol) clearly replicates in HeLa and CV-1 cell lines under synchronized growth conditions and produces the SIV protein in all cell lines. Moreover, intradermal administration of rDIsSIV gag/pol or of MVA/SIV239 gag/pol elicited similar levels of IFN-gamma spot-forming cells specific for SIV Gag. If the non-productive infection characteristically induced by recombinant DIs is sufficient to trigger immune induction, as we believe it is, then a human immunodeficiency virus vaccine employing the DIs recombinant would have the twin advantages of being both effective and safe.

  17. Apparent Attenuation at High Frequencies in Southern California

    Science.gov (United States)

    Lin, Y. P.; Jordan, T. H.

    2016-12-01

    Accurately simulating strong motions for seismic hazard analysis requires accurate 3D models of crustal structure. At low frequencies (job of accounting 3D elastic scattering on wavefield amplitudes. At higher frequencies, however, anelastic attenuation becomes more important, and the elastic scattering depends on unresolved small-scale heterogeneities, giving rise to a complex apparent attenuation structure that depends on both position and frequency. We place constraints on this structure in the band 1-10 Hz through the analysis of earthquake waveforms recorded by the Southern California Seismic Network (SCSN). We localize signals in frequency and time using wavelet transforms, and we account for source structure and geometrical spreading by referencing the spectral amplitudes to values computed from synthetic seismograms. Inversions of large datasets recover an attenuation structure that, when averaged laterally and over frequency, is generally consistent with the tomographic study of Hauksson & Shearer (2006). In particular, we find that the apparent quality factor for P waves (QP) is less than the apparent quality factor for S waves (QS), in contradiction with the classical relation QP 2QS that has been used for most wavefield modeling at low frequencies. The data are consistent with QP anomalies being strongest in the low-Q, near-surface waveguide, suggesting that strong scattering from small-scale heterogeneities may play a role in explaining this discrepancy. The data also require that the apparent attenuation be strongly frequency dependent across the 1-10 Hz band. We use 3D tomographic inversions conditioned on the 3D velocity models to test the hypothesis that the lateral variations in apparent attenuation structure are strongly correlated with velocity variations.

  18. Effects of poliovirus 2A(pro) on vaccinia virus gene expression.

    Science.gov (United States)

    Feduchi, E; Aldabe, R; Novoa, I; Carrasco, L

    1995-12-15

    The effects of transient expression of poliovirus 2A(pro) on p220 cleavage in COS cells have been analyzed. When 2A(pro) was cloned in plasmid pTM1 and transiently expressed in COS cells, efficient cleavage of p220 occurred after infection of these cells with a recombinant vaccinia virus bearing phage T7 RNA polymerase. High numbers of COS cells were transfected with pTM1-2A, as judged by p220 cleavage, thereby allowing an analysis of the effects of poliovirus 2A(pro) on vaccinia virus gene expression. A 40-50% cleavage of p220 by transfected poliovirus 2A(pro) was observed ten hours post infection and cleavage was almost complete (80-90%) 20-25 hours post infection with vaccinia virus. Profound inhibition of vaccinia virus protein synthesis was detectable ten hours post infection and was maximal 20-25 hours post infection. This inhibition resulted from neither a blockade of transcription of vaccinia virus nor a lack of translatability of the mRNAs present in cells that synthesize poliovirus 2A(pro). Addition of ara-C inhibited the replication of vaccinia virus and allowed the continued synthesis of cellular proteins. Under these conditions, 2A(pro) is expressed and blocks cellular translation. Finally, p220 cleavage by 2A(pro) did not inhibit the translation of a mRNA encoding poliovirus protein 2C, as directed by the 5' leader sequences of encephalomiocarditis virus. Therefore, these findings show a correlation between p220 cleavage and inhibition of translation from newly made mRNAs. Our results are discussed in the light of present knowledge of p220 function, and new approaches are considered that might provide further insights into the function(s) of initiation factor eIF-4F.

  19. Safety and High Level Efficacy of the Combination Malaria Vaccine Regimen of RTS,S/AS01B With Chimpanzee Adenovirus 63 and Modified Vaccinia Ankara Vectored Vaccines Expressing ME-TRAP.

    Science.gov (United States)

    Rampling, Tommy; Ewer, Katie J; Bowyer, Georgina; Bliss, Carly M; Edwards, Nick J; Wright, Danny; Payne, Ruth O; Venkatraman, Navin; de Barra, Eoghan; Snudden, Claudia M; Poulton, Ian D; de Graaf, Hans; Sukhtankar, Priya; Roberts, Rachel; Ivinson, Karen; Weltzin, Rich; Rajkumar, Bebi-Yassin; Wille-Reece, Ulrike; Lee, Cynthia K; Ockenhouse, Christian F; Sinden, Robert E; Gerry, Stephen; Lawrie, Alison M; Vekemans, Johan; Morelle, Danielle; Lievens, Marc; Ballou, Ripley W; Cooke, Graham S; Faust, Saul N; Gilbert, Sarah; Hill, Adrian V S

    2016-09-01

    The need for a highly efficacious vaccine against Plasmodium falciparum remains pressing. In this controlled human malaria infection (CHMI) study, we assessed the safety, efficacy and immunogenicity of a schedule combining 2 distinct vaccine types in a staggered immunization regimen: one inducing high-titer antibodies to circumsporozoite protein (RTS,S/AS01B) and the other inducing potent T-cell responses to thrombospondin-related adhesion protein (TRAP) by using a viral vector. Thirty-seven healthy malaria-naive adults were vaccinated with either a chimpanzee adenovirus 63 and modified vaccinia virus Ankara-vectored vaccine expressing a multiepitope string fused to TRAP and 3 doses of RTS,S/AS01B (group 1; n = 20) or 3 doses of RTS,S/AS01B alone (group 2; n = 17). CHMI was delivered by mosquito bites to 33 vaccinated subjects at week 12 after the first vaccination and to 6 unvaccinated controls. No suspected unexpected serious adverse reactions or severe adverse events related to vaccination were reported. Protective vaccine efficacy was observed in 14 of 17 subjects (82.4%) in group 1 and 12 of 16 subjects (75%) in group 2. All control subjects received a diagnosis of blood-stage malaria parasite infection. Both vaccination regimens were immunogenic. Fourteen protected subjects underwent repeat CHMI 6 months after initial CHMI; 7 of 8 (87.5%) in group 1 and 5 of 6 (83.3%) in group 2 remained protected. The high level of sterile efficacy observed in this trial is encouraging for further evaluation of combination approaches using these vaccine types. NCT01883609. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  20. Attenuation of high-energy x rays by iron shielding

    Energy Technology Data Exchange (ETDEWEB)

    Bespalov, V.I.; Chakhlov, V.L.; Shtein, M.M.

    1988-04-01

    Monte Carlo calculations are presented on electron-accelerator x-ray spectra for actual target thicknesses and electron energies of 4-50 MeV. Effective attenuation coefficients have been obtained as well as build-up factors for collimated beams andiron shielding of thickness form 1 to 80 cm. The radiation contrast has been determined as a function of thickness for this energy range.

  1. High Attenuation Rate for Shallow, Small Earthquakes in Japan

    Science.gov (United States)

    Si, Hongjun; Koketsu, Kazuki; Miyake, Hiroe

    2017-09-01

    We compared the attenuation characteristics of peak ground accelerations (PGAs) and velocities (PGVs) of strong motion from shallow, small earthquakes that occurred in Japan with those predicted by the equations of Si and Midorikawa (J Struct Constr Eng 523:63-70, 1999). The observed PGAs and PGVs at stations far from the seismic source decayed more rapidly than the predicted ones. The same tendencies have been reported for deep, moderate, and large earthquakes, but not for shallow, moderate, and large earthquakes. This indicates that the peak values of ground motion from shallow, small earthquakes attenuate more steeply than those from shallow, moderate or large earthquakes. To investigate the reason for this difference, we numerically simulated strong ground motion for point sources of M w 4 and 6 earthquakes using a 2D finite difference method. The analyses of the synthetic waveforms suggested that the above differences are caused by surface waves, which are predominant at stations far from the seismic source for shallow, moderate earthquakes but not for shallow, small earthquakes. Thus, although loss due to reflection at the boundaries of the discontinuous Earth structure occurs in all shallow earthquakes, the apparent attenuation rate for a moderate or large earthquake is essentially the same as that of body waves propagating in a homogeneous medium due to the dominance of surface waves.

  2. Safety of recombinant fowlpox strain FP9 and modified vaccinia virus Ankara vaccines against liver-stage P. falciparum malaria in non-immune volunteers.

    Science.gov (United States)

    Webster, D P; Dunachie, S; McConkey, S; Poulton, I; Moore, A C; Walther, M; Laidlaw, S M; Peto, T; Skinner, M A; Gilbert, S C; Hill, A V S

    2006-04-05

    The ability to generate potent antigen-specific T cell responses by vaccination has been a major hurdle in vaccinology. Vaccinia virus and avipox viruses have been shown to be capable of expressing antigens in mammalian cells and can induce a protective immune response against several mammalian pathogens. We report on two such vaccine constructs, modified vaccinia virus Ankara and FP9 (an attenuated fowlpox virus) both expressing the pre-erythrocytic malaria antigen thrombospondin-related adhesion protein and a string of CD8+ epitopes (ME-TRAP). In prime-boost combinations in a mouse model MVA and FP9 are highly immunogenic and induce substantial protective efficacy. A series of human clinical trials using the recombinant MVA and FP9 malaria vaccines encoding ME-TRAP, both independently and in prime-boost combinations with or without the DNA vaccine DNA ME-TRAP, has shown them to be both immunogenic for CD8+ T cells and capable of inducing protective efficacy. We report here a detailed analysis of the safety profiles of these viral vectors and show that anti-vector antibody responses induced by the vectors are generally low to moderate. We conclude that these vectors are safe and show acceptable side effect profiles for prophylactic vaccination.

  3. Unpolarized release of vaccinia virus and HIV antigen by colchicine treatment enhances intranasal HIV antigen expression and mucosal humoral responses.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available The induction of a strong mucosal immune response is essential to building successful HIV vaccines. Highly attenuated recombinant HIV vaccinia virus can be administered mucosally, but even high doses of immunization have been found unable to induce strong mucosal antibody responses. In order to solve this problem, we studied the interactions of recombinant HIV vaccinia virus Tiantan strain (rVTT-gagpol in mucosal epithelial cells (specifically Caco-2 cell layers and in BALB/c mice. We evaluated the impact of this virus on HIV antigen delivery and specific immune responses. The results demonstrated that rVTT-gagpol was able to infect Caco-2 cell layers and both the nasal and lung epithelia in BALB/c mice. The progeny viruses and expressed p24 were released mainly from apical surfaces. In BALB/c mice, the infection was limited to the respiratory system and was not observed in the blood. This showed that polarized distribution limited antigen delivery into the whole body and thus limited immune response. To see if this could be improved upon, we stimulated unpolarized budding of the virus and HIV antigens by treating both Caco-2 cells and BALB/c mice with colchicine. We found that, in BALB/c mice, the degree of infection and antigen expression in the epithelia went up. As a result, specific immune responses increased correspondingly. Together, these data suggest that polarized budding limits antigen delivery and immune responses, but unpolarized distribution can increase antigen expression and delivery and thus enhance specific immune responses. This conclusion can be used to optimize mucosal HIV vaccine strategies.

  4. Protein Primary Structure of the Vaccinia Virion at Increased Resolution

    Science.gov (United States)

    Ngo, Tuan; Mirzakhanyan, Yeva; Moussatche, Nissin; Gershon, Paul David

    2016-11-01

    Here we examine the protein covalent structure of the vaccinia virus virion. Within two virion preparations, >88% of the theoretical vaccinia virus-encoded proteome was detected with high confidence, including the first detection of products from 27 open reading frames (ORFs) previously designated "predicted," "uncharacterized," "inferred," or "hypothetical" polypeptides containing as few as 39 amino acids (aa) and six proteins whose detection required nontryptic proteolysis. We also detected the expression of four short ORFs, each of which was located within an ORF ("ORF-within-ORF"), including one not previously recognized or known to be expressed. Using quantitative mass spectrometry (MS), between 58 and 74 proteins were determined to be packaged. A total of 63 host proteins were also identified as candidates for packaging. Evidence is provided that some portion of virion proteins are "nicked" via a combination of endoproteolysis and concerted exoproteolysis in a manner, and at sites, independent of virus origin or laboratory procedures. The size of the characterized virion phosphoproteome was doubled from 189 (J. Matson, W. Chou, T. Ngo, and P. D. Gershon, Virology 452-453:310-323, 2014, doi:http://dx.doi.org/10.1016/j.virol.2014.01.012) to 396 confident, unique phosphorylation sites, 268 of which were within the packaged proteome. This included the unambiguous identification of phosphorylation "hot spots" within virion proteins. Using isotopically enriched ATP, 23 sites of intravirion kinase phosphorylation were detected within nine virion proteins, all at sites already partially occupied within the virion preparations. The clear phosphorylation of proteins RAP94 and RP19 was consistent with the roles of these proteins in intravirion early gene transcription. In a blind search for protein modifications, cysteine glutathionylation and O-linked glycosylation featured prominently. We provide evidence for the phosphoglycosylation of vaccinia virus proteins

  5. High seismic attenuation at a mid-ocean ridge reveals the distribution of deep melt

    Science.gov (United States)

    Eilon, Z.; Abers, G. A.

    2016-12-01

    Measurements of seismic velocity and attenuation provide complementary constraints on the thermal and compositional character of the Earth's interior. In particular, observations of attenuation hold promise for identifying and characterizing the presence of melt and thermal heterogeneity in the upper mantle. By measuring relative phase and amplitude spectra of teleseismic body waves recorded on three years of Cascadia Initiative ocean-bottom seismometers, we calculate differential attenuation across an entire oceanic plate, exploiting the unprecedented coverage from ridge to trench. This study comprises the most detailed body wave interrogation of mid-ocean ridge attenuation to date. We find a strong age-dependency to the apparent attenuation and travel time: maximal attenuation and delays (Δt*S 1.7 s and δTS 2 s) are observed at stations ≤50 km from the Juan de Fuca and Gorda ridge axes, and lowest attenuation is seen at stations on 4-8 Ma crust. The high attenuation implies quality factor (Q) on the order of 20 beneath the mid-ocean ridge - comparable to the lowest Q previously recorded worldwide, in the Lau back-arc. Observed phase spectra, absolute amplitudes, and travel times are not compatible with extrinsic sources of apparent attenuation (scattering or focusing) and imply anelastic dissipation in shear. The increase in ∆t* between 0-4 Ma of the spreading centers is inconsistent with a purely thermal control on attenuation. Rather, several lines of evidence point to a large, localized contribution from deep (>60 km) melt beneath the spreading centers, while the gradual diminution in attenuation with crustal age hints at ponded sub-lithospheric melt 50-100 km off axis. Simple synthetic models harnessing experimentally-derived anelastic scaling relationships indicate that the observations can be satisfied by a sub-ridge region in which up to 2% in situ melt enhances diffusivity and reduces diffusion creep shear viscosity by three orders of magnitude over

  6. Oral immunization and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein recombinant virus vaccine.

    OpenAIRE

    Rupprecht, C. E.; Wiktor, T. J.; Johnston, D H; Hamir, A. N.; Dietzschold, B; Wunner, W. H.; Glickman, L T; Koprowski, H

    1986-01-01

    Animal rabies control has been frustrated by the existence of multiple wildlife reservoirs and the lack of efficacious oral vaccines. In this investigation, raccoons fed a vaccinia-rabies glycoprotein recombinant virus in a sponge bait developed rabies virus-neutralizing antibody (0.6-54.0 units) and resisted street rabies virus infection 28 and 205 days after feeding. Additional raccoons immunized by oral infusion with attenuated antigenic variants of rabies virus strains CVS-11 and ERA fail...

  7. Susceptibility of Vaccinia Virus to Chemical Disinfectants

    Science.gov (United States)

    de Oliveira, Tércia Moreira Ludolfo; Rehfeld, Izabelle Silva; Coelho Guedes, Maria Isabel Maldonado; Ferreira, Jaqueline Maria Siqueira; Kroon, Erna Geessien; Lobato, Zélia Inês Portela

    2011-01-01

    Vaccinia virus (VACV) is the cause of bovine vaccinia (BV), an emerging zoonotic disease that affects dairy cows and milkers. Some chemical disinfectants have been used on farms affected by BV to disinfect cow teats and milkers' hands. To date, there is no information about the efficacy of disinfectants against VACV. Therefore, this study aimed to assess the virucidal activity of some active disinfectants commonly used in the field. Sodium hypochlorite, quaternary ammonium combined with chlorhexidine, and quaternary ammonium combined with glutaraldehyde were effective in inactivating the virus at all concentrations tested. Iodine and quaternary ammonium as the only active component were partially effective. The presence of bovine feces as organic matter and light decreased the effectiveness of sodium hypochlorite. These results show that an appropriated disinfection and asepsis of teats and hands may be helpful in the control and prevention of BV and other infections with VACV. PMID:21734141

  8. The development of a monolith-based purification process for Orthopoxvirus vaccinia virus Lister strain.

    Science.gov (United States)

    Vincent, David; Kramberger, Petra; Hudej, Rosana; Štrancar, Aleš; Wang, Yaohe; Zhou, Yuhong; Velayudhan, Ajoy

    2017-11-17

    The purification of large viruses remains an important field of research and development. The development of efficient purification trains is restricted by limited analytical methods, as well as by the complexity of large viruses, as well as the high variability in starting material from cell culture. Vaccinia virus holds great potential as an oncolytic and immunotherapeutic vaccine against a broad spectrum of cancers. In this work, monolith-based capture and polishing chromatographic steps for vaccinia virus Lister strain has been developed. Virus produced in CV-1 cells was harvested and passed through a 0.8μm pre-filter before loading onto CIEX, AIEX and HIC CIM monoliths. Without the need for nuclease treatment, up to 99% of the total DNA loaded can be removed from the vaccinia feed stream by the CIM OH monolith, which also reduces the total protein concentration in the product pool to LLOQ levels, and achieves infectious virus recoveries of 90%. Binding capacities of greater than 1×109pfu of vaccinia per mL of matrix were obtained on both CIM SO3 and CIM OH monoliths. Multiple orthogonal analytical methods have been used to develop process knowledge and understanding. Copyright © 2017. Published by Elsevier B.V.

  9. Vaccinia virus as an expression vector.

    Science.gov (United States)

    Talavera, A; Rodriguez, J M

    1992-01-01

    Vaccinia virus (Vv) is a member of the genus Orthopoxvirus, one of seven genera included in the family Poxviridae. Most of these viruses infect vertebrates (Orthopoxvirus, Avipoxvirus, Capripoxvirus, Leporipoxvirus, Suipoxvirus, and Parapoxvirus), but one genus, Entomopoxvirus, infects insects. It is interesting to note that the Fibroma and Mixoma viruses of the leporipoxvirus genus cause tumors in their hosts (rabbits), these being the only tumorigenic viruses in the family (1,2).

  10. Brazilian Vaccinia Viruses and Their Origins

    Centers for Disease Control (CDC) Podcasts

    2007-07-30

    Smallpox was eradicated more than 25 years ago, but live viruses used in vaccines may have survived to cause animal and human illness today. Dr. Inger Damon, Acting Branch Chief of the Poxvirus and Rabies Branch at CDC, discusses efforts to determine origins and spread of vaccinia viruses in Brazil.  Created: 7/30/2007 by Emerging Infectious Diseases.   Date Released: 7/30/2007.

  11. MUSE stares into the shadows: the high-resolution dust attenuation curve of NGC 5626

    Science.gov (United States)

    Viaene, S.; Sarzi, M.; Baes, M.; Fritz, J.; Puerari, I.

    2017-12-01

    The newest generation of integral field unit spectrographs brings three-dimensional mapping of nearby galaxies one step closer. While the focus up to this point was mostly on stars and ionized gas, it is also possible to look at dust in a new, more complete way. Using MUSE science verification observations of NGC 5626, we map the interstellar matter in this dusty lenticular. We use the resolving power of MUSE to measure the optical attenuation with a spectral resolution of 6.25 Å, at physical scales of 0.1-1 kpc. The integrated attenuation curve of NGC 5626 shows a smooth, slightly steeper than Milky Way and SMC attenuation curves. Several sharp features are superimposed: we measure lower attenuation at spectral emission lines and higher attenuation for the sodium line doublet. No correlation was observed between sodium line strength and reddening by dust on spatially resolved scales. Additionally, the continuum attenuation was found to be independent from the Balmer decrement (tracing ionized gas attenuation). We model and interpret the variations in the attenuation curves of each spatial resolution element of NGC 5626. We find that the amount and distribution of dust along the line of sight is highly degenerate with any variation in the intrinsic extinction law. Our analysis shows that the interstellar matter in NGC 5626 resides in a regular and well-settled disc. Our results preach caution in the application of simple recipes to de-redden global galaxy spectra and underlines the need for more realistic dust geometries when constructing such correction formulas.

  12. Rice bran water extract attenuates pancreatic abnormalities in high ...

    African Journals Online (AJOL)

    U,. Thawornchinsombut. S,. Pannangpetch P. Rice bran protein hydrolysates improve insulin resistance and decrease pro- inflammatory cytokine gene expression in rats fed a high carbohydrate-high fat diet. Nutrients 2015; 7(8): 6313-. 6329. 20. Kim SM, Rico CW, Lee SC, Kang MY. Modulatory effect of rice bran and phytic ...

  13. CCD-based optical CT scanning of highly attenuating phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Al-Nowais, Shamsa [Department of Physics, University of Surrey, Guildford (United Kingdom); Doran, Simon J [CRUK Clinical MR Research Group, Institute of Cancer Research, Sutton (United Kingdom)], E-mail: Simon.Doran@icr.ac.uk

    2009-05-01

    The introduction of optical computed tomography (optical-CT) offers economic and easy to use 3-D optical readout for gel dosimeters. However, previous authors have noted some challenges regarding the accuracy of such imaging techniques at high values of optical density. In this paper, we take a closer look at the 'cupping' artefact evident in both light-scattering polymer systems and highly light absorbing phantoms using our CCD-based optical scanner. In addition, a technique is implemented whereby the maximum measurable optical absorbance is extended to correct for any errors that may have occurred in the estimated value of the dark current or ambient light reaching the detector. The results indicate that for absorbance values up to 2.0, the optical scanner results have good accuracy, whereas this is not the case at high absorbance values for reasons yet to be explained.

  14. In a nutshell: structure and assembly of the vaccinia virion.

    Science.gov (United States)

    Condit, Richard C; Moussatche, Nissin; Traktman, Paula

    2006-01-01

    Poxviruses comprise a large family of viruses characterized by a large, linear dsDNA genome, a cytoplasmic site of replication and a complex virion morphology. The most notorious member of the poxvirus family is variola, the causative agent of smallpox. The laboratory prototype virus used for the study of poxviruses is vaccinia, the virus that was used as a live, naturally attenuated vaccine for the eradication of smallpox. Both the morphogenesis and structure of poxvirus virions are unique among viruses. Poxvirus virions apparently lack any of the symmetry features common to other viruses such as helical or icosahedral capsids or nucleocapsids. Instead poxvirus virions appear as "brick shaped" or "ovoid" membrane-bound particles with a complex internal structure featuring a walled, biconcave core flanked by "lateral bodies." The virion assembly pathway involves a remarkable fabrication of membrane-containing crescents and immature virions, which evolve into mature virions in a process that is unparalleled in virology. As a result of significant advances in poxvirus genetics and molecular biology during the past 15 years, we can now positively identify over 70 specific gene products contained in poxvirus virions, and we can describe the effects of mutations in over 50 specific genes on poxvirus assembly. This review summarizes these advances and attempts to assemble them into a comprehensible and thoughtful picture of poxvirus structure and assembly.

  15. Highly Attenuated Recombinant Vesicular Stomatitis Virus VSV-12′GFP Displays Immunogenic and Oncolytic Activity

    Science.gov (United States)

    Davis, John N.

    2013-01-01

    Vesicular stomatitis virus (VSV) has shown considerable promise both as an immunization vector and as an oncolytic virus. In both applications, an important concern is the safety profile of the virus. To generate a highly attenuated virus, we added two reporter genes to the 3′ end of the VSV genome, thereby shifting the NPMGL genes from positions 1 to 5 to positions 3 to 7. The resulting virus (VSV-12′GFP) was highly attenuated, generating smaller plaques than four other attenuated VSVs. In one-step growth curves, VSV-12′GFP displayed the slowest growth kinetics. The mechanism of attenuation appears to be due to reduced expression of VSV genes downstream of the reporter genes, as suggested by a 10.4-fold reduction in L-protein RNA transcript. Although attenuated, VSV-12′GFP was highly effective at generating an immune response, indicated by a high-titer antibody response against the green fluorescent protein (GFP) expressed by the virus. Although VSV-12′GFP was more attenuated than other VSVs on both normal and cancer cells, it nonetheless showed a greater level of infection of human cancer cells (glioma and melanoma) than of normal cells, and this effect was magnified in glioma by interferon application, indicating selective oncolysis. Intravenous VSV-12′GFP selectively infected human gliomas implanted into SCID mice subcutaneously or intracranially. All postnatal day 16 mice given intranasal VSV-12′GFP survived, whereas only 10% of those given VSV-G/GFP survived, indicating reduced neurotoxicity. Intratumoral injection of tumors with VSV-12′GFP dramatically suppressed tumor growth and enhanced survival. Together these data suggest this recombinant virus merits further study for its oncolytic and vaccine potential. PMID:23135719

  16. Highly attenuated recombinant vesicular stomatitis virus VSV-12'GFP displays immunogenic and oncolytic activity.

    Science.gov (United States)

    van den Pol, Anthony N; Davis, John N

    2013-01-01

    Vesicular stomatitis virus (VSV) has shown considerable promise both as an immunization vector and as an oncolytic virus. In both applications, an important concern is the safety profile of the virus. To generate a highly attenuated virus, we added two reporter genes to the 3' end of the VSV genome, thereby shifting the NPMGL genes from positions 1 to 5 to positions 3 to 7. The resulting virus (VSV-12'GFP) was highly attenuated, generating smaller plaques than four other attenuated VSVs. In one-step growth curves, VSV-12'GFP displayed the slowest growth kinetics. The mechanism of attenuation appears to be due to reduced expression of VSV genes downstream of the reporter genes, as suggested by a 10.4-fold reduction in L-protein RNA transcript. Although attenuated, VSV-12'GFP was highly effective at generating an immune response, indicated by a high-titer antibody response against the green fluorescent protein (GFP) expressed by the virus. Although VSV-12'GFP was more attenuated than other VSVs on both normal and cancer cells, it nonetheless showed a greater level of infection of human cancer cells (glioma and melanoma) than of normal cells, and this effect was magnified in glioma by interferon application, indicating selective oncolysis. Intravenous VSV-12'GFP selectively infected human gliomas implanted into SCID mice subcutaneously or intracranially. All postnatal day 16 mice given intranasal VSV-12'GFP survived, whereas only 10% of those given VSV-G/GFP survived, indicating reduced neurotoxicity. Intratumoral injection of tumors with VSV-12'GFP dramatically suppressed tumor growth and enhanced survival. Together these data suggest this recombinant virus merits further study for its oncolytic and vaccine potential.

  17. Low-resolution structure of vaccinia virus DNA replication machinery.

    Science.gov (United States)

    Sèle, Céleste; Gabel, Frank; Gutsche, Irina; Ivanov, Ivan; Burmeister, Wim P; Iseni, Frédéric; Tarbouriech, Nicolas

    2013-02-01

    Smallpox caused by the poxvirus variola virus is a highly lethal disease that marked human history and was eradicated in 1979 thanks to a worldwide mass vaccination campaign. This virus remains a significant threat for public health due to its potential use as a bioterrorism agent and requires further development of antiviral drugs. The viral genome replication machinery appears to be an ideal target, although very little is known about its structure. Vaccinia virus is the prototypic virus of the Orthopoxvirus genus and shares more than 97% amino acid sequence identity with variola virus. Here we studied four essential viral proteins of the replication machinery: the DNA polymerase E9, the processivity factor A20, the uracil-DNA glycosylase D4, and the helicase-primase D5. We present the recombinant expression and biochemical and biophysical characterizations of these proteins and the complexes they form. We show that the A20D4 polymerase cofactor binds to E9 with high affinity, leading to the formation of the A20D4E9 holoenzyme. Small-angle X-ray scattering yielded envelopes for E9, A20D4, and A20D4E9. They showed the elongated shape of the A20D4 cofactor, leading to a 150-Å separation between the polymerase active site of E9 and the DNA-binding site of D4. Electron microscopy showed a 6-fold rotational symmetry of the helicase-primase D5, as observed for other SF3 helicases. These results favor a rolling-circle mechanism of vaccinia virus genome replication similar to the one suggested for tailed bacteriophages.

  18. Inulin oligofructose attenuates metabolic syndrome in high-carbohydrate, high-fat diet-fed rats.

    Science.gov (United States)

    Kumar, Senthil A; Ward, Leigh C; Brown, Lindsay

    2016-11-01

    Prebiotics alter bacterial content in the colon, and therefore could be useful for obesity management. We investigated the changes following addition of inulin oligofructose (IO) in the food of rats fed either a corn starch (C) diet or a high-carbohydrate, high-fat (H) diet as a model of diet-induced metabolic syndrome. IO did not affect food intake, but reduced body weight gain by 5·3 and 12·3 % in corn starch+inulin oligofructose (CIO) and high-carbohydrate, high-fat with inulin oligofructose (HIO) rats, respectively. IO reduced plasma concentrations of free fatty acids by 26·2 % and TAG by 75·8 % in HIO rats. IO increased faecal output by 93·2 %, faecal lipid excretion by 37·9 % and weight of caecum by 23·4 % and colon by 41·5 % in HIO rats. IO improved ileal morphology by reducing inflammation and improving the density of crypt cells in HIO rats. IO attenuated H diet-induced increases in abdominal fat pads (C 275 (sem 19), CIO 264 (sem 40), H 688 (sem 55), HIO 419 (sem 32) mg/mm tibial length), fasting blood glucose concentrations (C 4·5 (sem 0·1), CIO 4·2 (sem 0·1), H 5·2 (sem 0·1), HIO 4·3 (sem 0·1) mmol/l), systolic blood pressure (C 124 (sem 2), CIO 118 (sem 2), H 152 (sem 2), HIO 123 (sem 3) mmHg), left ventricular diastolic stiffness (C 22·9 (sem 0·6), CIO 22·9 (sem 0·5), H 27·8 (sem 0·5), HIO 22·6 (sem 1·2)) and plasma alanine transaminase (C 29·6 (sem 2·8), CIO 32·1 (sem 3·0), H 43·9 (sem 2·6), HIO 33·6 (sem 2·0) U/l). IO attenuated H-induced increases in inflammatory cell infiltration in the heart and liver, lipid droplets in the liver and plasma lipids as well as impaired glucose and insulin tolerance. These results suggest that increasing soluble fibre intake with IO improves signs of the metabolic syndrome by decreasing gastrointestinal carbohydrate and lipid uptake.

  19. Protection of Mice from Lethal Vaccinia Virus Infection by Vaccinia Virus Protein Subunits with a CpG Adjuvant

    Directory of Open Access Journals (Sweden)

    Sarah Reeman

    2017-12-01

    Full Text Available Smallpox vaccination carries a high risk of adverse events in recipients with a variety of contra-indications for live vaccines. Although alternative non-replicating vaccines have been described in the form of replication-deficient vaccine viruses, DNA vaccines, and subunit vaccines, these are less efficacious than replicating vaccines in animal models. DNA and subunit vaccines in particular have not been shown to give equivalent protection to the traditional replicating smallpox vaccine. We show here that combinations of the orthopoxvirus A27, A33, B5 and L1 proteins give differing levels of protection when administered in different combinations with different adjuvants. In particular, the combination of B5 and A27 proteins adjuvanted with CpG oligodeoxynucleotides (ODN gives a level of protection in mice that is equivalent to the Lister traditional vaccine in a lethal vaccinia virus challenge model.

  20. High-energy neutrino attenuation in the Earth and its associated uncertainties

    Science.gov (United States)

    Vincent, Aaron C.; Argüelles, Carlos A.; Kheirandish, Ali

    2017-11-01

    We describe νFATE: Neutrino Fast Attenuation Through Earth, a very rapid method of accurately computing the attenuation of high-energy neutrinos during their passage through Earth to detectors such as IceCube, ANTARES or KM3Net, including production of secondary neutrinos from τ± lepton decay. We then use this method to quantify the error on attenuation due to uncertainties in the isotropic neutrino spectrum, the composition of the Earth, and the parton distribution functions. We show that these can be as large as 20%, which can significantly impact reconstructed astrophysical neutrino parameters, as well as searches for new physics. An implementation of this algorithm is provided as a public code.

  1. First evidence for high anelastic attenuation beneath the Red Sea from Love wave analysis

    Energy Technology Data Exchange (ETDEWEB)

    Hadiouche, Ouiza (Seismologisches Zentralobservatorium, Erlangen (West Germany))

    1990-10-01

    Attenuation coefficients of Love waves are determined for two seismic paths along the Red Sea. The attenuation coefficients are obtained using the multiple filter method for periods from 25 to 130 s along one path and from 40 to 130 s along the second one. The two sets of observations are in good agreement with anomalously high attenuation coefficients similar to those reported across a young part of the Pacific Ocean. Indeed, the values lie on average between 3.3 {plus minus} 0.6 and 1.1 {plus minus} 0.3 (10{sup {minus}4}km{sup {minus}1}) higher values being observed at shorter periods. In a second part of the paper, these apparent attenuation observations are interpreted in terms of a distribution of intrinsic absorption in the upper mantle. A frequency independent Q{sub {beta}} model is obtained using a trial-and-error method. The best fit to the data required a large and very low Q{sub {beta}} (30-50) zone below a depth of 50 km, underlying a thin and high Q{sub {beta}} (200-300) lid. These results are consistent with high heat flows and low velocities which characterize this tectonically active area, and corroborate the inference of anomalously high temperatures and low viscosity in the upper mantle beneath the Red Sea from recent seismological results.

  2. Vulvar vaccinia infection after sexual contact with a smallpox vaccinee.

    Science.gov (United States)

    Muzny, Christina A; King, Heather; Byers, Paul; Currier, Mary; Nolan, Rathel; Mena, Leandro

    2009-04-01

    Vaccinia (smallpox) vaccine is an effective immunizing agent that brought about global eradication of naturally occurring smallpox, as declared by the World Health Organization in 1980. The United States ceased generalized smallpox vaccination in 1972 but reinstated it in 2002 for military personnel and selected healthcare workers (first responders who may be investigating possible cases of smallpox or caring for patients in selected hospitals) after the 2001 bioterrorism attacks. Since reinstitution of the vaccine, reports of transmission of vaccinia virus through contact with military smallpox vaccinees have been published, including four cases of female genital infection. We report a subsequent case of vulvar vaccinia infection acquired during sexual contact with a military vaccinee.

  3. Vaccinia virus, a promising new therapeutic agent for pancreatic cancer.

    Science.gov (United States)

    Al Yaghchi, Chadwan; Zhang, Zhongxian; Alusi, Ghassan; Lemoine, Nicholas R; Wang, Yaohe

    2015-01-01

    The poor prognosis of pancreatic cancer patients signifies a need for radically new therapeutic strategies. Tumor-targeted oncolytic viruses have emerged as attractive therapeutic candidates for cancer treatment due to their inherent ability to specifically target and lyse tumor cells as well as induce antitumor effects by multiple action mechanisms. Vaccinia virus has several inherent features that make it particularly suitable for use as an oncolytic agent. In this review, we will discuss the potential of vaccinia virus in the management of pancreatic cancer in light of our increased understanding of cellular and immunological mechanisms involved in the disease process as well as our extending knowledge in the biology of vaccinia virus.

  4. Protection from rabies by a vaccinia virus recombinant containing the rabies virus glycoprotein gene.

    OpenAIRE

    Wiktor, T. J.; Macfarlan, R I; Reagan, K J; Dietzschold, B; Curtis, P. J.; Wunner, W. H.; Kieny, M P; Lathe, R; Lecocq, J P; Mackett, M.

    1984-01-01

    Inoculation of rabbits and mice with a vaccinia-rabies glycoprotein recombinant (V-RG) virus resulted in rapid induction of high concentrations of rabies virus-neutralizing antibodies and protection from severe intracerebral challenge with several strains of rabies virus. Protection from virus challenge also was achieved against the rabies-related Duvenhage virus but not against the Mokola virus. Effective immunization by V-RG depended on the expression of a rabies glycoprotein that registere...

  5. High Frequency Attenuation Modeling and Event Amplitude Estimation in the Southern Nevada Region

    Science.gov (United States)

    Pyle, M. L.; Walter, W. R.; Pasyanos, M.

    2016-12-01

    Measurement of seismic amplitudes plays a critical role in underground explosion monitoring and the discrimination between earthquakes and explosions, which is crucial for global security. In order to improve amplitude estimation at small event-to-station distances, an accurate 2D model of attenuation is important. As part of the Source Physics Experiment (SPE), we develop a detailed attenuation model for the region around southern Nevada and test the model's usefulness in predicting amplitudes of local events. The SPE consists of a series of chemical explosions at the Nevada National Security Site (NNSS) designed to improve our understanding of explosion physics and enable better modeling of explosion sources. A high-resolution attenuation model will aid in the waveform modeling efforts of these experiments, and enable us to take a more detailed look at local event discrimination. To improve our understanding of the propagation of energy from sources in the area to local and regional stations in the western U.S., we invert regional phases to examine the crust and upper mantle attenuation structure of southern Nevada and the surrounding region. We consider observed amplitudes as the frequency-domain product of a source term, a site term, a geometrical spreading term, and an attenuation (Q) term (e.g. Walter and Taylor, 2001). Initially we take a staged approach to first determine the best 1D Q values; next we calculate source terms using the 1D model, and finally we solve for the best 2D Q parameters and site terms considering all frequencies simultaneously. Preliminary results show that our attenuation model correlates quite well with the regional geology, and a small number of comparisons of predicted and observed amplitudes from past SPE shots show reasonable agreement. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  6. Protective efficacy of a recombinant vaccinia virus in vaccinia-immune mice.

    Science.gov (United States)

    Andrew, M E

    1989-10-01

    Recombinant viral vectors offer a potential means of vaccinating against diseases for which there are no current safe vaccines. One of the criteria on which a viral vaccine vector would be selected is that it either circulates in the human or livestock population without producing overt disease (e.g. adenovirus) or has a history as a safe vaccine (e.g. vaccinia virus). However, this selection criterion also means that the target population is likely to have circulating antibodies that are specific to the vaccine vector. Since a percentage of the world's population has been vaccinated during the World Health Organization's Smallpox Eradication Campaign, such antibody titres, which are likely to lower vaccine efficacy, have been raised as an objection to the use of recombinant vaccinia viruses as vaccines. We have tested the effect of vaccinia-specific immunity on the protective efficacy of a recombinant virus, VV-PR8-HA6 (1) which expresses the haemagglutinin of the influenza virus A/PR/8/34.

  7. Vaccinia Virus Infections in a Martial Arts Gym

    Centers for Disease Control (CDC) Podcasts

    2011-04-04

    This podcast discusses an outbreak of vaccinia virus in Maryland in 2008. Christine Hughes, a health scientist with the Poxvirus and Rabies Branch at CDC, and co-author of a paper in the April 2011 issue of CDC's journal, discusses vaccinia virus infections in a martial arts gym.  Created: 4/4/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/5/2011.

  8. Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Bedognetti Davide

    2011-10-01

    Full Text Available Abstract Background Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. Methods In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. Results We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Conclusions Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection.

  9. Dairy production practices and associated risks for bovine vaccinia exposure in cattle, Brazil

    Directory of Open Access Journals (Sweden)

    I.A. Borges

    2017-11-01

    Full Text Available A cross-sectional serosurvey was performed to identify environmental features or practices of dairy farms associated with risk for exposure to vaccinia-like viruses in dairy cattle in Brazil. Sera from 103 cows from 18 farms in Minas Gerais state were examined for Orthopoxvirus-neutralizing antibodies. A database of 243 binary or multiple-selection categorical variables regarding the physical features and surrounding ecology of each property was obtained. Thirteen of 46 presumptive predictor variables were found to be significantly associated with Orthopoxvirus serostatus by univariate logistic regression methods. Use of teat sanitizer and having felids on the property were independently associated with virus exposure by multivariable analysis. Rodents have long been suspected of serving as maintenance reservoirs for vaccinia-like viruses in Brazil. Therefore, domestic felids are not only effective predators of small rodent pests, but also their urine can serve as a deterrent to rodent habitation in buildings such as stables and barns. These results corroborate previous evidence of the high significance of rodents in the Vaccinia virus transmission cycle, and they also raise questions regarding the common use of teat sanitizers in dairy production areas.

  10. High Resolution Regional Attenuation for the Source Physics Experiment Using Multiphase Inversion

    Science.gov (United States)

    Pyle, M. L.; Walter, W. R.; Pasyanos, M.

    2015-12-01

    Seismic event amplitude measurement plays a critical role in the discrimination between earthquakes and explosions. An accurate 2D model of the attenuation experienced by seismic waves traveling through the earth is especially important for reasonable amplitude estimation at small event-to-station distances. In this study, we investigate the detailed attenuation structure in the region around southern Nevada as part of the Source Physics Experiment (SPE). The SPE consists of a series of chemical explosions at the Nevada National Security Site (NNSS) designed to improve our understanding of explosion physics and enable better modeling of explosion sources. Phase I of the SPE is currently being conducted in the Climax Stock Granite and Phase II will move to a contrasting dry alluvium geology. A high-resolution attenuation model will aid in the modeling efforts of these experiments. To improve our understanding of the propagation of energy from sources in the area to local and regional stations in the western U.S., we invert regional phases Pn, Pg, and Lg to examine the crust and upper mantle attenuation structure of southern Nevada and the surrounding region. We consider observed amplitudes as the frequency-domain product of a source term, a site term, a geometrical spreading term, and an attenuation (Q) term (e.g. Walter and Taylor, 2001). Initially we take a staged approach to first determine the best 1D Q values; next we calculate source terms using the 1D model, and finally we solve for the best 2D Q parameters and site terms considering all frequencies simultaneously. Our preliminary results agree generally with those from the continent-wide study by Pasyanos (2013). With additional data we are working to develop a more detailed and higher frequency model of the region as well as move toward a fully non-linear inversion.

  11. Imaging behavior of high-transmission attenuating phase-shift mask films

    Science.gov (United States)

    Hibbs, Michael; Nemoto, Satoru; Komizo, Toru

    2006-10-01

    The properties of phase shifting attenuator films are quantified in a variety of ways. Transverse dimensions are measured by optical microscopes or scanning electron microscopes. Vertical dimension and profiles are measured by atomic force microscopes or indirectly by optical scatterometry. The complex refractive index of an attenuator film can be characterized by ellipsometry or by spectroscopic analysis of reflected and transmitted light. Transmission and phase measurements can be made with optical interferometric techniques. Data acquired in these ways can be used as inputs to simulation programs to model the image forming characteristics of the films. For simplicity and speed of calculation, the simulation programs typically use a thin-mask approximation, in which the vertical absorber geometry is ignored and the phase shifting attenuator regions are characterized only by their transmission, phase shift, and two-dimensional geometric shapes. Inclusion of the full three-dimensional profile and complex refractive index of the absorber can be done, but at the cost of greatly increased calculation time and a loss of the simplicity of understanding afforded by the thin-mask model. For example, the thin-mask model assumes that every geometrical feature etched into a given attenuator film will have the same phase and transmission properties. Comparison of thin-mask modeling results with the full three dimensional model shows that this assumption is not true. The effective dimensional bias, phase, transmission, and defocus are strong functions of the feature size, pitch, and complex refractive index of the film. Three dimensional simulations were run for several commercial and developmental high-transmission phase-shifting attenuator films. The effective phase and dimensional printing bias were calculated as a function of pitch for each film. Surprising differences were found in the results for the various film types.

  12. High-sensitivity attenuated total internal reflection continuous-wave terahertz imaging

    Science.gov (United States)

    Liu, Hongxiang; Wang, Yuye; Xu, Degang; Wu, Limin; Yan, Chao; Yan, Dexian; Tang, Longhuang; He, Yixin; Feng, Hua; Yao, Jianquan

    2017-09-01

    We demonstrate an attenuated total internal reflection imaging system. The surface information of the sample on top of a prism can be acquired by two-dimensionally scanning this prism moving in the vertical plane with horizontally incident continuous terahertz waves at a fixed height. The principles and feasibility of this method are investigated. The effective imaging area on the prism, image resolution and polarization dependence of contrast enhancement and stability improvement are analyzed. Examples including solid agar, distilled water and porcine tissue are presented, demonstrating the method’s advantages of high sensitivity and simple sample preparation. The experimental and theoretical results consistently show that p-polarization contributes to enhanced image contrast and more stable intensity of the attenuated total internal reflected signal.

  13. Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?

    DEFF Research Database (Denmark)

    Jespersen, Sanne; Hønge, Bo Langhoff; Medina, Candida

    Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?......Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?...

  14. Nonspecific and attenuated negative symptoms in patients at clinical high-risk for schizophrenia.

    Science.gov (United States)

    Lencz, Todd; Smith, Christopher W; Auther, Andrea; Correll, Christoph U; Cornblatt, Barbara

    2004-05-01

    Retrospective studies have shown that nonspecific psychopathology and negative symptoms, including social isolation and academic dysfunction, tend to precede onset of psychosis. The present report describes the baseline psychopathology of subjects in the Hillside Recognition and Prevention (RAP) Program, and presents an operationalized classification algorithm for the prospective study of both positive and negative symptoms of clinical high-risk (CHR) for schizophrenia. Eighty-two adolescent and young adult patients were characterized using semi-structured interviews of both a parent informant and the patient. The Scale of Prodromal Symptoms (SOPS) was utilized to derive a three-part classification scheme: CHR- subjects (n=20) were defined as having at least one attenuated negative symptom with no positive symptoms; CHR+ subjects (n=42) were defined as having one or more attenuated positive symptoms without psychosis; schizophrenia-like psychosis (SLP) subjects (n=20) were defined as having a psychotic symptom, but without meeting criterion A, B, or C of DSM-IV schizophrenia. Social isolation was the most common presenting symptom. The three RAP subgroups did not significantly differ in levels of attenuated negative and disorganized symptoms, despite the fact that these were not required for inclusion in the CHR+ and SLP groups. Common co-morbid diagnoses included major depression, attention deficit hyperactivity disorder, avoidant personality disorder, and Cluster A personality disorders. Negative symptoms and other nonspecific behavioral abnormalities represent clinically important phenomena in prodromal patients, and may provide insight into pathophysiologic mechanisms in schizophrenia and possible preventive interventions.

  15. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity

    Science.gov (United States)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.

    1999-04-01

    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  16. High frequency deep brain stimulation attenuates subthalamic and cortical rhythms in Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Diane eWhitmer

    2012-06-01

    Full Text Available Parkinson’s disease (PD is marked by excessive synchronous activity in the beta (8-35 Hz band throughout the cortico-basal ganglia network. The optimal location of high frequency deep brain stimulation (HF DBS within the subthalamic nucleus (STN region and the location of maximal beta hypersynchrony are currently matters of debate. Additionally, the effect of STN HF DBS on neural synchrony in functionally connected regions of motor cortex is unknown and of great interest. Scalp EEG studies demonstrated that stimulation of the STN can activate motor cortex antidromically, but the spatial specificity of this effect has not been examined. The present study examined the effect of STN HF DBS on neural synchrony within the cortico-basal ganglia network in patients with PD. We measured local field potentials dorsal to and within the STN of PD patients, and additionally in the motor cortex in a subset of these patients. We used diffusion tensor imaging (DTI to guide the placement of subdural cortical surface electrodes over the DTI-identified origin of the hyperdirect pathway between motor cortex and the STN. The results demonstrated that local beta power was attenuated during HF DBS both dorsal to and within the STN. The degree of attenuation was monotonic with increased DBS voltages in both locations, but this voltage-dependent effect was greater in the central STN than dorsal to the STN (p < 0.05. Cortical signals over the estimated origin of the hyperdirect pathway also demonstrated attenuation of beta hypersynchrony during DBS dorsal to or within STN, whereas signals from non-specific regions of motor cortex were not attenuated. The spatially specific suppression of beta synchrony in the motor cortex support the hypothesis that DBS may treat Parkinsonism by reducing excessive synchrony in the functionally connected sensorimotor network.

  17. High-frequency attenuation and backscatter measurements of rat blood between 30 and 60 MHz

    Science.gov (United States)

    Huang, Chih-Chung

    2010-10-01

    There has recently been a great deal of interest in noninvasive high-frequency ultrasound imaging of small animals such as rats due to their being the preferred animal model for gene therapy and cancer research. Improving the interpretation of the obtained images and furthering the development of the imaging devices require a detailed knowledge of the ultrasound attenuation and backscattering of biological tissue (e.g. blood) at high frequencies. In the present study, the attenuation and backscattering coefficients of the rat red blood cell (RBC) suspensions and whole blood with hematocrits ranging from 6% to 40% were measured between 30 and 60 MHz using a modified substitution approach. The acoustic parameters of porcine blood under the same conditions were also measured in order to compare differences in the blood properties between these two animals. For porcine blood, both whole blood and RBC suspension were stirred at a rotation speed of 200 rpm. Three different rotation speeds of 100, 200 and 300 rpm were carried out for rat blood experiments. The attenuation coefficients of both rat and porcine blood were found to increase linearly with frequency and hematocrit (the values of coefficients of determination (r2) are around 0.82-0.97 for all cases). The average attenuation coefficient of rat whole blood with a hematocrit of 40% increased from 0.26 Nepers mm-1 at 30 MHz to 0.47 Nepers mm-1 at 60 MHz. The maximum backscattering coefficients of both rat and porcine RBC suspensions were between 10% and 15% hematocrits at all frequencies. The fourth-power dependence of backscatter on frequency was approximately valid for rat RBC suspensions with hematocrits between 6% and 40%. However, the frequency dependence of the backscatter estimate deviates from a fourth-power law for porcine RBC suspension with hematocrit higher than 20%. The backscattering coefficient plateaued for hematocrits higher than 15% in porcine blood, but for rat blood it was maximal around a

  18. High-frequency attenuation and backscatter measurements of rat blood between 30 and 60 MHz

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Chih-Chung, E-mail: j648816n@ms23.hinet.ne [Department of Electrical Engineering, Fu Jen Catholic University, Taipei, Taiwan (China)

    2010-10-07

    There has recently been a great deal of interest in noninvasive high-frequency ultrasound imaging of small animals such as rats due to their being the preferred animal model for gene therapy and cancer research. Improving the interpretation of the obtained images and furthering the development of the imaging devices require a detailed knowledge of the ultrasound attenuation and backscattering of biological tissue (e.g. blood) at high frequencies. In the present study, the attenuation and backscattering coefficients of the rat red blood cell (RBC) suspensions and whole blood with hematocrits ranging from 6% to 40% were measured between 30 and 60 MHz using a modified substitution approach. The acoustic parameters of porcine blood under the same conditions were also measured in order to compare differences in the blood properties between these two animals. For porcine blood, both whole blood and RBC suspension were stirred at a rotation speed of 200 rpm. Three different rotation speeds of 100, 200 and 300 rpm were carried out for rat blood experiments. The attenuation coefficients of both rat and porcine blood were found to increase linearly with frequency and hematocrit (the values of coefficients of determination (r{sup 2}) are around 0.82-0.97 for all cases). The average attenuation coefficient of rat whole blood with a hematocrit of 40% increased from 0.26 Nepers mm{sup -1} at 30 MHz to 0.47 Nepers mm{sup -1} at 60 MHz. The maximum backscattering coefficients of both rat and porcine RBC suspensions were between 10% and 15% hematocrits at all frequencies. The fourth-power dependence of backscatter on frequency was approximately valid for rat RBC suspensions with hematocrits between 6% and 40%. However, the frequency dependence of the backscatter estimate deviates from a fourth-power law for porcine RBC suspension with hematocrit higher than 20%. The backscattering coefficient plateaued for hematocrits higher than 15% in porcine blood, but for rat blood it was

  19. Innate immune response of human plasmacytoid dendritic cells to poxvirus infection is subverted by vaccinia E3 via its Z-DNA/RNA binding domain.

    Directory of Open Access Journals (Sweden)

    Hua Cao

    Full Text Available Plasmacytoid dendritic cells (pDCs play important roles in antiviral innate immunity by producing type I interferon (IFN. In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i vaccinia virus, but not myxoma virus, expresses inhibitor(s of the poxvirus sensing pathway(s in pDCs; and (ii Heat-VAC infection fails to produce inhibitor(s but rather produces novel activator(s, likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029 lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating

  20. Innate Immune Response of Human Plasmacytoid Dendritic Cells to Poxvirus Infection Is Subverted by Vaccinia E3 via Its Z-DNA/RNA Binding Domain

    Science.gov (United States)

    Dai, Peihong; Wang, Weiyi; Li, Hao; Yuan, Jianda; Wang, Fangjin; Fang, Chee-Mun; Pitha, Paula M; Liu, Jia; Condit, Richard C; McFadden, Grant; Merghoub, Taha; Houghton, Alan N; Young, James W; Shuman, Stewart; Deng, Liang

    2012-01-01

    Plasmacytoid dendritic cells (pDCs) play important roles in antiviral innate immunity by producing type I interferon (IFN). In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h) gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i) vaccinia virus, but not myxoma virus, expresses inhibitor(s) of the poxvirus sensing pathway(s) in pDCs; and (ii) Heat-VAC infection fails to produce inhibitor(s) but rather produces novel activator(s), likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029) lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating properties of

  1. Cryo-electron tomography of vaccinia virus

    Science.gov (United States)

    Cyrklaff, Marek; Risco, Cristina; Fernández, Jose Jesús; Jiménez, Maria Victoria; Estéban, Mariano; Baumeister, Wolfgang; Carrascosa, José L.

    2005-01-01

    The combination of cryo-microscopy and electron tomographic reconstruction has allowed us to determine the structure of one of the more complex viruses, intracellular mature vaccinia virus, at a resolution of 4–6 nm. The tomographic reconstruction allows us to dissect the different structural components of the viral particle, avoiding projection artifacts derived from previous microscopic observations. A surface-rendering representation revealed brick-shaped viral particles with slightly rounded edges and dimensions of ≈360 × 270 × 250 nm. The outer layer was consistent with a lipid membrane (5–6 nm thick), below which usually two lateral bodies were found, built up by a heterogeneous material without apparent ordering or repetitive features. The internal core presented an inner cavity with electron dense coils of presumptive DNA–protein complexes, together with areas of very low density. The core was surrounded by two layers comprising an overall thickness of ≈18–19 nm; the inner layer was consistent with a lipid membrane. The outer layer was discontinuous, formed by a periodic palisade built by the side interaction of T-shaped protein spikes that were anchored in the lower membrane and were arranged into small hexagonal crystallites. It was possible to detect a few pore-like structures that communicated the inner side of the core with the region outside the layer built by the T-shaped spike palisade. PMID:15699328

  2. Membrane remodelling during vaccinia virus morphogenesis.

    Science.gov (United States)

    Chichón, Francisco Javier; Rodríguez, María Josefa; Risco, Cristina; Fraile-Ramos, Alberto; Fernández, José Jesús; Esteban, Mariano; Carrascosa, José L

    2009-07-01

    VACV (vaccinia virus) is one of the most complex viruses, with a size exceeding 300 nm and more than 100 structural proteins. Its assembly involves sequential interactions and important rearrangements of its structural components. We have used electron tomography of sections of VACV-infected cells to follow, in three dimensions, the remodelling of the membrane components of the virus during envelope maturation. The tomograms obtained suggest that a number of independent 'crescents' interact with each other to enclose the volume of an incomplete ellipsoid in the viral factory area, attaining the overall shape and size characteristic of the first immature form of the virus [IV (immature virus)]. The incorporation of the DNA into these forms leads to particles with a nucleoid [IVN (IV with nucleoid)] that results in local disorganization of the envelope in regions near the condensed DNA. These particles suffer the progressive disappearance of the membrane outer spikes with a change in the shape of the membrane, becoming locally curled. The transformation of the IVN into the mature virus involves an extreme rearrangement of the particle envelope, which becomes fragmented and undulated. During this process, we also observed connections between the outer membranes with internal ones, suggesting that the latter originate from internalization of the IV envelope. The main features observed for VACV membrane maturation during morphogenesis resemble the breakdown and reassembly of cellular endomembranes.

  3. Incongruencies in Vaccinia Virus Phylogenetic Trees

    Directory of Open Access Journals (Sweden)

    Chad Smithson

    2014-10-01

    Full Text Available Over the years, as more complete poxvirus genomes have been sequenced, phylogenetic studies of these viruses have become more prevalent. In general, the results show similar relationships between the poxvirus species; however, some inconsistencies are notable. Previous analyses of the viral genomes contained within the vaccinia virus (VACV-Dryvax vaccine revealed that their phylogenetic relationships were sometimes clouded by low bootstrapping confidence. To analyze the VACV-Dryvax genomes in detail, a new tool-set was developed and integrated into the Base-By-Base bioinformatics software package. Analyses showed that fewer unique positions were present in each VACV-Dryvax genome than expected. A series of patterns, each containing several single nucleotide polymorphisms (SNPs were identified that were counter to the results of the phylogenetic analysis. The VACV genomes were found to contain short DNA sequence blocks that matched more distantly related clades. Additionally, similar non-conforming SNP patterns were observed in (1 the variola virus clade; (2 some cowpox clades; and (3 VACV-CVA, the direct ancestor of VACV-MVA. Thus, traces of past recombination events are common in the various orthopoxvirus clades, including those associated with smallpox and cowpox viruses.

  4. Impact of attenuation correction strategies on the quantification of High Resolution Research Tomograph PET studies

    Energy Technology Data Exchange (ETDEWEB)

    Velden, Floris H P van [Department of Nuclear Medicine and PET Research, VU University Medical Centre, Amsterdam (Netherlands); Kloet, Reina W [Department of Nuclear Medicine and PET Research, VU University Medical Centre, Amsterdam (Netherlands); Berckel, Bart N M van [Department of Nuclear Medicine and PET Research, VU University Medical Centre, Amsterdam (Netherlands); Molthoff, Carla F M [Department of Nuclear Medicine and PET Research, VU University Medical Centre, Amsterdam (Netherlands); Jong, Hugo W A M de [Department of Nuclear Medicine, University Medical Centre Utrecht, Utrecht (Netherlands); Lammertsma, Adriaan A [Department of Nuclear Medicine and PET Research, VU University Medical Centre, Amsterdam (Netherlands); Boellaard, Ronald [Department of Nuclear Medicine and PET Research, VU University Medical Centre, Amsterdam (Netherlands)

    2008-01-07

    In this study, the quantitative accuracy of different attenuation correction strategies presently available for the High Resolution Research Tomograph (HRRT) was investigated. These attenuation correction methods differ in reconstruction and processing (segmentation) algorithms used for generating a {mu}-image from measured 2D transmission scans, an intermediate step in the generation of 3D attenuation correction factors. Available methods are maximum-a-posteriori reconstruction (MAP-TR), unweighted OSEM (UW-OSEM) and NEC-TR, which transforms sinogram values back to their noise equivalent counts (NEC) to restore Poisson distribution. All methods can be applied with or without {mu}-image segmentation. However, for MAP-TR a {mu}-histogram is a prior during reconstruction. All possible strategies were evaluated using phantoms of various sizes, simulating preclinical and clinical situations. Furthermore, effects of emission contamination of the transmission scan on the accuracy of various attenuation correction strategies were studied. Finally, the accuracy of various attenuation corrections strategies and its relative impact on the reconstructed activity concentration (AC) were evaluated using small animal and human brain studies. For small structures, MAP-TR with human brain priors showed smaller differences in {mu}-values for transmission scans with and without emission contamination (<8%) than the other methods (<26%). In addition, it showed best agreement with true AC (deviation <4.5%). A specific prior designed to take into account the presence of small animal fixation devices only very slightly improved AC precision to 4.3%. All methods scaled {mu}-values of a large homogeneous phantom to within 4% of the water peak, but MAP-TR provided most accurate AC after reconstruction. However, for clinical data MAP-TR using the default prior settings overestimated the thickness of the skull, resulting in overestimations of {mu}-values in regions near the skull and thus in

  5. High-intensity exercise attenuates postprandial lipaemia and markers of oxidative stress.

    Science.gov (United States)

    Gabriel, Brendan; Ratkevicius, Aivaras; Gray, Patrick; Frenneaux, Michael P; Gray, Stuart R

    2012-09-01

    Regular exercise can reduce the risk of CVD (cardiovascular disease). Although moderate-intensity exercise can attenuate postprandial TAG (triacylglycerol), high-intensity intermittent exercise might be a more effective method to improve health. We compared the effects of high-intensity intermittent exercise and 30 min of brisk walking on postprandial TAG, soluble adhesion molecules and markers of oxidative stress. Nine men each completed three 2-day trials. On day 1, subjects rested (control), walked briskly for 30 min (walking) or performed 5×30 s maximal sprints (high-intensity). On day 2, subjects consumed a high-fat meal for breakfast and 3 h later for lunch. Blood samples were taken at various times and analysed for TAG, glucose, insulin, ICAM-1 (intracellular adhesion molecule-1), VCAM-1 (vascular adhesion molecule-1), TBARS (thiobarbituric acid- reactive substances), protein carbonyls and β-hydroxybutyrate. On day 2 of the high-intensity trial, there was a lower (Pwalking trial (8.98±2.84 mmol/l per 7 h). A trend (P=0.056) for a reduced total TAG AUC was also seen during the high-intensity trial (14.13±2.83 mmol/l per 7 h) compared with control (17.18±3.92 mmol/l per 7 h), walking showed no difference (16.33±3.51 mmol/l per 7 h). On day 2 of the high-intensity trial plasma TBARS and protein carbonyls were also reduced (Pwalking trials. In conclusion, high-intensity intermittent exercise attenuates postprandial TAG and markers of oxidative stress after the consumption of a high-fat meal.

  6. Intrinsic and scattering attenuation of high-frequency S-waves in the central part of the External Dinarides

    Science.gov (United States)

    Majstorović, Josipa; Belinić, Tena; Namjesnik, Dalija; Dasović, Iva; Herak, Davorka; Herak, Marijan

    2017-09-01

    The central part of the External Dinarides (CED) is a geologically and tectonically complex region formed in the collision between the Adriatic microplate and the European plate. In this study, the contributions of intrinsic and scattering attenuation ( Q i - 1 and Q sc - 1 , respectively) to the total S-wave attenuation were calculated for the first time. The multiple lapse-time window analysis (MLTWA method), based on the assumptions of multiple isotropic scattering in a homogeneous medium with uniformly distributed scatterers, was applied to seismograms of 450 earthquakes recorded at six seismic stations. Selected events have hypocentral distances between 40 and 90 km with local magnitudes between 1.5 and 4.7. The analysis was performed over 11 frequency bands with central frequencies between 1.5 and 16 Hz. Results show that the seismic albedo of the studied area is less than 0.5 and Q i - 1 > Q sc - 1 at all central frequencies and for all stations. These imply that the intrinsic attenuation dominates over scattering attenuation in the whole study area. Calculated total S-wave and expected coda wave attenuation for CED are in a very good agreement with the ones measured in previous studies using the coda normalization and the coda-Q methods. All estimated attenuation factors decrease with increasing frequency. The intrinsic attenuation for CED is among the highest observed elsewhere, which could be due to the highly fractured and fluid-filled carbonates in the upper crust. The scattering and the total S-wave attenuation for CED are close to the average values obtained in other studies performed worldwide. In particular, good agreement of frequency dependence of total attenuation in CED and in the regions that contributed most strong-motion records for ground motion prediction equations used in PSHA in Croatia indicates that those were well chosen and applicable to this area as far as their attenuation properties are concerned.

  7. Enteric Immunization of Mice Against Influenza with Recombinant Vaccinia

    Science.gov (United States)

    Meitin, Catherine A.; Bender, Bradley S.; Small, Parker A., Jr.

    1994-11-01

    Intrajejunal administration to mice of a recombinant vaccinia virus containing the influenza virus hemagglutinin gene induced IgA antibody in nasal, gut, and vaginal secretions. It also induced IgG antibody in serum and cell-mediated immunity. The immunization provided significant protection against an influenza virus challenge. This work suggests that enteric-coated recombinant vaccinia could be an orally administered, inexpensive, multivalent, temperature-stable, safe, and effective vaccine for children that could be particularly useful in developing nations, where multiple injections are not easily administered. Oral administration of vaccines should also reduce children's fear of shots at the doctor's office.

  8. High-Attenuation Areas on Chest Computed Tomography and Clinical Respiratory Outcomes in Community-Dwelling Adults.

    Science.gov (United States)

    Podolanczuk, Anna J; Oelsner, Elizabeth C; Barr, R Graham; Bernstein, Elana J; Hoffman, Eric A; Easthausen, Imaani J; Stukovsky, Karen Hinckley; RoyChoudhury, Arindam; Michos, Erin D; Raghu, Ganesh; Kawut, Steven M; Lederer, David J

    2017-12-01

    Areas of increased lung attenuation visualized by computed tomography are associated with all-cause mortality in the general population. It is uncertain whether this association is attributable to interstitial lung disease (ILD). To determine whether high-attenuation areas are associated with the risk of ILD hospitalization and mortality in the general population. We performed a cohort study of 6,808 adults aged 45-84 years sampled from six communities in the United States. High-attenuation areas were defined as the percentage of imaged lung volume with attenuation values between -600 and -250 Hounsfield units. An adjudication panel determined ILD hospitalization and death. After adjudication, 52 participants had a diagnosis of ILD during 75,232 person-years (median, 12.2 yr) of follow-up. There were 48 hospitalizations attributable to ILD (crude rate, 6.4 per 10,000 person-years). Twenty participants died as a result of ILD (crude rate, 2.7 per 10,000 person-years). High-attenuation areas were associated with an increased rate of ILD hospitalization (adjusted hazard ratio, 2.6 per 1-SD increment in high-attenuation areas; 95% confidence interval, 1.9-3.5; P areas were also associated with an increased rate of ILD-specific death (adjusted hazard ratio, 2.3; 95% confidence interval, 1.7-3.0; P Areas of increased lung attenuation are a novel risk factor for ILD hospitalization and mortality. Measurement of high-attenuation areas by screening and diagnostic computed tomography may be warranted in at-risk adults.

  9. HIGH-RESOLUTION SEISMIC VELOCITY AND ATTENUATION MODELS OF THE CAUCASUS-CASPIAN REGION

    Energy Technology Data Exchange (ETDEWEB)

    Mellors, R; Gok, R; Sandvol, E

    2007-07-10

    The southwest edge of Eurasia is a tectonically and structurally complex region that includes the Caspian and Black Sea basins, the Caucasus Mountains, and the high plateaus south of the Caucasus. Crustal and upper mantle velocities show great heterogeneity in this region and regional phases display variations in both amplitudes and travel time. Furthermore, due to a lack of quality data, the region has largely been unexplored in terms of the detailed lithospheric seismic structure. A unified high-resolution 3D velocity and attenuation model of the crust and upper mantle will be developed and calibrated. This model will use new data from 23 new broadband stations in the region analyzed with a comprehensive set of techniques. Velocity models of the crust and upper mantle will be developed using a joint inversion of receiver functions and surface waves. The surface wave modeling will use both event-based methods and ambient noise tomography. Regional phase (Pg, Pn, Sn, and Lg) Q model(s) will be constructed using the new data in combination with existing data sets. The results of the analysis (both attenuation and velocity modeling) will be validated using modeling of regional phases, calibration with selected events, and comparison with previous work. Preliminary analyses of receiver functions show considerable variability across the region. All results will be integrated into the KnowledgeBase.

  10. Retrograde Transport from Early Endosomes to the trans-Golgi Network Enables Membrane Wrapping and Egress of Vaccinia Virus Virions.

    Science.gov (United States)

    Sivan, Gilad; Weisberg, Andrea S; Americo, Jeffrey L; Moss, Bernard

    2016-10-01

    . Interference with wrapping or subsequent steps results in severe attenuation of the virus. Some previous studies had suggested that the wrapping membrane arises from the trans-Golgi network, whereas others suggested an origin from early endosomes. Some nonenveloped viruses use retrograde trafficking for entry into the cell. In contrast, we provided evidence that retrograde transport from early endosomes to the trans-Golgi network is required for the membrane-wrapping step in morphogenesis of vaccinia virus and egress from the cell. The potent in vitro inhibition of this step by the drug Retro-2 suggests that derivatives with enhanced pharmacological properties might serve as useful antipoxviral agents. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Immunodomination during peripheral vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Leon C W Lin

    Full Text Available Immunodominance is a fundamental property of CD8(+ T cell responses to viruses and vaccines. It had been observed that route of administration alters immunodominance after vaccinia virus (VACV infection, but only a few epitopes were examined and no mechanism was provided. We re-visited this issue, examining a panel of 15 VACV epitopes and four routes, namely intradermal (i.d., subcutaneous (s.c., intraperitoneal (i.p. and intravenous (i.v. injection. We found that immunodominance is sharpened following peripheral routes of infection (i.d. and s.c. compared with those that allow systemic virus dissemination (i.p. and i.v.. This increased immunodominance was demonstrated with native epitopes of VACV and with herpes simplex virus glycoprotein B when expressed from VACV. Responses to some subdominant epitopes were altered by as much as fourfold. Tracking of virus, examination of priming sites, and experiments restricting virus spread showed that priming of CD8(+ T cells in the spleen was necessary, but not sufficient to broaden responses. Further, we directly demonstrated that immunodomination occurs more readily when priming is mainly in lymph nodes. Finally, we were able to reduce immunodominance after i.d., but not i.p. infection, using a VACV expressing the costimulators CD80 (B7-1 and CD86 (B7-2, which is notable because VACV-based vaccines incorporating these molecules are in clinical trials. Taken together, our data indicate that resources for CD8(+ T cell priming are limiting in local draining lymph nodes, leading to greater immunodomination. Further, we provide evidence that costimulation can be a limiting factor that contributes to immunodomination. These results shed light on a possible mechanism of immunodomination and highlight the need to consider multiple epitopes across the spectrum of immunogenicities in studies aimed at understanding CD8(+ T cell immunity to viruses.

  12. Progressive Vaccinia: Case Description and Laboratory-Guided Therapy With Vaccinia Immune Globulin, ST-246, and CMX001

    Science.gov (United States)

    Lederman, Edith R.; Davidson, Whitni; Groff, Harold L.; Smith, Scott K.; Warkentien, Tyler; Li, Yu; Wilkins, Kimberly A.; Karem, Kevin L.; Akondy, Rama S.; Ahmed, Rafi; Frace, Michael; Shieh, Wun-Ju; Zaki, Sherif; Hruby, Dennis E.; Painter, Wendy P.; Bergman, Kimberly L.; Cohen, Jeffrey I.; Damon, Inger K.

    2012-01-01

    Progressive vaccinia (PV) is a rare but potentially lethal complication that develops in smallpox vaccine recipients with severely impaired cellular immunity. We describe a patient with PV who required treatment with vaccinia immune globulin and who received 2 investigational agents, ST-246 and CMX001. We describe the various molecular, pharmacokinetic, and immunologic studies that provided guidance to escalate and then successfully discontinue therapy. Despite development of resistance to ST-246 during treatment, the patient had resolution of PV. This case demonstrates the need for continued development of novel anti-orthopoxvirus pharmaceuticals and the importance of both intensive and timely clinical and laboratory support in management of PV. PMID:22904336

  13. Perceiving Partners to Endorse Benevolent Sexism Attenuates Highly Anxious Women's Negative Reactions to Conflict.

    Science.gov (United States)

    Cross, Emily J; Overall, Nickola C; Hammond, Matthew D

    2016-07-01

    Benevolent sexism prescribes that men are dependent on women in relationships and should cherish their partners. The current research examined whether perceiving male partners to endorse benevolent sexism attenuates highly anxious women's negative reactions to relationship conflict. Greater attachment anxiety was associated with greater distress and insecurity during couples' conflict discussions (Study 1), during daily conflict with intimate partners (Study 2), and when recalling experiences of relationship conflict (Study 3). However, this heightened distress and insecurity was attenuated when women (but not men) perceived their partner to strongly endorse benevolent sexism (Studies 1-3) and thus believed their partner could be relied upon to remain invested (Study 3B). These novel results illustrate that perceiving partners to endorse benevolent sexism alleviates anxious women's insecure reactions to relationship threat by conveying partner's continued reliability. Implications of these security-enhancing effects are considered in light of the role benevolent sexism plays in sustaining gender inequality. © 2016 by the Society for Personality and Social Psychology, Inc.

  14. Oncolytic vaccinia virotherapy of anaplastic thyroid cancer in vivo.

    Science.gov (United States)

    Lin, Shu-Fu; Price, Daniel L; Chen, Chun-Hao; Brader, Peter; Li, Sen; Gonzalez, Lorena; Zhang, Qian; Yu, Yong A; Chen, Nanhai; Szalay, Aladar A; Fong, Yuman; Wong, Richard J

    2008-11-01

    Anaplastic thyroid carcinoma (ATC) is a fatal disease with a median survival of only 6 months. Novel therapies are needed to improve dismal outcomes. A mutated, replication-competent, vaccinia virus (GLV-1h68) has oncolytic effects on human ATC cell lines in vitro. We assessed the utility of GLV-1h68 in treating anaplastic thyroid cancer in vivo. Athymic nude mice with xenograft flank tumors of human ATCs (8505C and DRO90-1) were treated with a single intratumoral injection of GLV-1h68 at low dose (5x10(5) plaque-forming unit), high dose (5x10(6) plaque-forming unit), or PBS. Virus-mediated marker gene expression (luciferase, green fluorescent protein, and beta-galactosidase), viral biodistribution, and flank tumor volumes were measured. Luciferase expression was detected 2 d after injection. Continuous viral replication within tumors was reflected by increasing luciferase activity to d 9. At d 10, tumor viral recovery was increased more than 50-fold as compared with the injected dose, and minimal virus was recovered from the lung, liver, brain, heart, spleen, and kidneys. High-dose virus directly injected into normal tissues was undetectable at d 10. The mean volume of control 8505C tumors increased 50.8-fold by d 45, in contrast to 10.5-fold (low dose) and 2.1-fold (high dose; P=0.028) increases for treated tumors. DRO90-1 tumors also showed significant growth inhibition by high-dose virus. No virus-related toxicity was observed throughout the study. GLV-1h68 efficiently infects, expresses transgenes within, and inhibits the growth of ATC in vivo. These promising findings support future clinical trials for patients with ATC.

  15. A Randomized, Double-Blind, Placebo-Controlled Phase II Trial Investigating the Safety and Immunogenicity of Modified Vaccinia Ankara Smallpox Vaccine (MVA-BN® in 56-80-Year-Old Subjects.

    Directory of Open Access Journals (Sweden)

    Richard N Greenberg

    Full Text Available Modified Vaccinia Ankara MVA-BN® is a live, highly attenuated, viral vaccine under advanced development as a non-replicating smallpox vaccine. In this Phase II trial, the safety and immunogenicity of Modified Vaccinia Ankara MVA-BN® (MVA was assessed in a 56-80 years old population.MVA with a virus titer of 1 x 108 TCID50/dose was administered via subcutaneous injection to 56-80 year old vaccinia-experienced subjects (N = 120. Subjects received either two injections of MVA (MM group or one injection of Placebo and one injection of MVA (PM group four weeks apart. Safety was evaluated by assessment of adverse events (AE, focused physical exams, electrocardiogram recordings and safety laboratories. Solicited AEs consisted of a set of pre-defined expected local reactions (erythema, swelling, pain, pruritus, and induration and systemic symptoms (body temperature, headache, myalgia, nausea and fatigue and were recorded on a memory aid for an 8-day period following each injection. The immunogenicity of the vaccine was evaluated in terms of humoral immune responses measured with a vaccinia-specific enzyme-linked immunosorbent assay (ELISA and a plaque reduction neutralization test (PRNT before and at different time points after vaccination.Vaccinations were well tolerated by all subjects. No serious adverse event related to MVA and no case of myopericarditis was reported. The overall incidence of unsolicited AEs was similar in both groups. For both groups immunogenicity responses two weeks after the final vaccination (i.e. Visit 4 were as follows: Seroconversion (SC rates (doubling of titers from baseline in vaccine specific antibody titers measured by ELISA were 83.3% in Group MM and 82.8% in Group PM (difference 0.6% with 95% exact CI [-13.8%, 15.0%], and 90.0% for Group MM and 77.6% for Group PM measured by PRNT (difference 12.4% with 95% CI of [-1.1%, 27.0%]. Geometric mean titers (GMT measured by ELISA two weeks after the final vaccination for

  16. Vaccinia virus as a subhelper for AAV replication and packaging

    Directory of Open Access Journals (Sweden)

    Andrea R Moore

    Full Text Available Adeno-associated virus (AAV has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  17. Vaccinia virus encodes a polypeptide with DNA ligase activity.

    Science.gov (United States)

    Kerr, S M; Smith, G L

    1989-11-25

    Vaccinia virus gene SalF 15R potentially encodes a polypeptide of 63 kD which shares 30% amino acid identity with S. pombe and S. cerevisiae DNA ligases. DNA ligase proteins can be identified by incubation with alpha-(32P)ATP, resulting in the formation of a covalent DNA ligase-AMP adduct, an intermediate in the enzyme reaction. A novel radio-labelled polypeptide of approximately 61 kD appears in extracts from vaccinia virus infected cells after incubation with alpha-(32P)ATP. This protein is present throughout infection and is a DNA ligase as the radioactivity is discharged in the presence of either DNA substrate or pyrophosphate. DNA ligase assays show an increase in enzyme activity in cell extracts after vaccinia virus infection. A rabbit antiserum, raised against a bacterial fusion protein of beta-galactosidase and a portion of SalF 15R, immune-precipitates polypeptides of 61 and 54 kD from extracts of vaccinia virus-infected cells. This antiserum also immune-precipitates the novel DNA ligase-AMP adduct, thus proving that the observed DNA ligase is encoded by SalF 15R.

  18. Vaccinia virus as a subhelper for AAV replication and packaging.

    Science.gov (United States)

    Moore, Andrea R; Dong, Biao; Chen, Lingxia; Xiao, Weidong

    2015-01-01

    Adeno-associated virus (AAV) has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV) has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  19. Prior methamphetamine self-administration attenuates serotonergic deficits induced by subsequent high-dose methamphetamine administrations.

    Science.gov (United States)

    McFadden, Lisa M; Hunt, Madison M; Vieira-Brock, Paula L; Muehle, Janice; Nielsen, Shannon M; Allen, Scott C; Hanson, Glen R; Fleckenstein, Annette E

    2012-11-01

    Pre-clinical studies indicate that high-dose, non-contingent methamphetamine (METH) administration both rapidly and persistently decreases serotonergic neuronal function. Despite research indicating the hippocampus plays an important role in METH abuse and is affected by METH use, effects of METH self-administration on hippocampal serotonergic neurons are not well understood, and were thus an important focus of the current study. Because humans often administer METH in a binge-like pattern, effects of prior METH self-administration on a subsequent "binge-like" METH treatment were also examined. Rats were treated as described above, and sacrificed 1 or 8d after self-administration or 1h or 7d after the final binge METH or saline exposure. Hippocampal serotonin (5-hydroxytryptamine; 5HT) content and transporter (SERT) function were assessed. METH self-administration per se had no persistent effect on hippocampal 5HT content or SERT function. However, this treatment attenuated the persistent, but not acute, hippocampal serotonergic deficits caused by a subsequent repeated, high-dose, non-continent METH treatment administered 1 d the last self-administration session. No attenuation in persistent deficits were seen when the high-dose administration of METH occurred 15d after the last self-administration session. The present findings demonstrate that METH self-administration alters serotonergic neurons so as to engender "tolerance" to the persistent serotonergic deficits caused by a subsequent METH exposure. However, this "tolerance" does not persist. These data provide a foundation to investigate complex questions including how the response of serotonergic neurons to METH may contribute to contingent-related disorders such as dependence and relapse. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. Propofol attenuates high glucose-induced superoxide anion accumulation in human umbilical vein endothelial cells.

    Science.gov (United States)

    Wang, Jiaqiang; Jiang, Hui; Wang, Jing; Zhao, Yanjun; Zhu, Yun; Zhu, Minmin

    2016-12-01

    Perioperative hyperglycemia is a common clinical metabolic disorder. Hyperglycemia could induce endothelial apoptosis, dysfunction, and inflammation, resulting in endothelial injury. Propofol is a widely used anesthetic drug in clinical settings. Our previous studies indicated that propofol attenuated high glucose-induced endothelial apoptosis, dysfunction, and inflammation via inhibiting reactive oxygen species (ROS) accumulation. However, the mechanisms by which propofol reduces high glucose-induced endothelial ROS accumulation are still obscure. In this study, we examined how propofol attenuates high glucose-induced endothelial ROS accumulation. Compared with 5 mm glucose treatment, 15 mm glucose upregulated the expression of pin-1, phosphatase A2 (PP2A), p66shc and mitochondrial p66shc expression, increased p66shc -Ser36 phosphorylation, and O2·- accumulation. More importantly, although propofol had no effect on 15 mm glucose-induced p66shc -Ser36 phosphorylation and pin-1 expression, propofol could downregulated PP2A expression and p66shc expression in whole-cell and mitochondrion, resulting in the reduction of O2·- accumulation. Moreover, we demonstrated that the antioxidative effect of propofol was similar to that of calyculin A, an inhibitor of PP2A. In contrast, FTY720, an activator of PP2A, antagonized the effect of propofol. Our data indicated that the antioxidative effect of propofol was achieved by downregulating PP2A expression, resulting in the inhibition of p66shc -Ser36 dephosphorylation and mitochondrial p66shc expression. © 2016 Société Française de Pharmacologie et de Thérapeutique.

  1. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development.

    Science.gov (United States)

    Volz, A; Sutter, G

    2017-01-01

    Safety tested Modified Vaccinia virus Ankara (MVA) is licensed as third-generation vaccine against smallpox and serves as a potent vector system for development of new candidate vaccines against infectious diseases and cancer. Historically, MVA was developed by serial tissue culture passage in primary chicken cells of vaccinia virus strain Ankara, and clinically used to avoid the undesirable side effects of conventional smallpox vaccination. Adapted to growth in avian cells MVA lost the ability to replicate in mammalian hosts and lacks many of the genes orthopoxviruses use to conquer their host (cell) environment. As a biologically well-characterized mutant virus, MVA facilitates fundamental research to elucidate the functions of poxvirus host-interaction factors. As extremely safe viral vectors MVA vaccines have been found immunogenic and protective in various preclinical infection models. Multiple recombinant MVA currently undergo clinical testing for vaccination against human immunodeficiency viruses, Mycobacterium tuberculosis or Plasmodium falciparum. The versatility of the MVA vector vaccine platform is readily demonstrated by the swift development of experimental vaccines for immunization against emerging infections such as the Middle East Respiratory Syndrome. Recent advances include promising results from the clinical testing of recombinant MVA-producing antigens of highly pathogenic avian influenza virus H5N1 or Ebola virus. This review summarizes our current knowledge about MVA as a unique strain of vaccinia virus, and discusses the prospects of exploiting this virus as research tool in poxvirus biology or as safe viral vector vaccine to challenge existing and future bottlenecks in vaccinology. © 2017 Elsevier Inc. All rights reserved.

  2. Can vaccinia virus be replaced by MVA virus for testing virucidal activity of chemical disinfectants?

    Directory of Open Access Journals (Sweden)

    Rapp Ingrid

    2010-06-01

    Full Text Available Abstract Background Vaccinia virus strain Lister Elstree (VACV is a test virus in the DVV/RKI guidelines as representative of the stable enveloped viruses. Since the potential risk of laboratory-acquired infections with VACV persists and since the adverse effects of vaccination with VACV are described, the replacement of VACV by the modified vaccinia Ankara strain (MVA was studied by testing the activity of different chemical biocides in three German laboratories. Methods The inactivating properties of different chemical biocides (peracetic acid, aldehydes and alcohols were tested in a quantitative suspension test according to the DVV/RKI guideline. All tests were performed with a protein load of 10% fetal calf serum with both viruses in parallel using different concentrations and contact times. Residual virus was determined by endpoint dilution method. Results The chemical biocides exhibited similar virucidal activity against VACV and MVA. In three cases intra-laboratory differences were determined between VACV and MVA - 40% (v/v ethanol and 30% (v/v isopropanol are more active against MVA, whereas MVA seems more stable than VACV when testing with 0.05% glutardialdehyde. Test accuracy across the three participating laboratories was high. Remarkably inter-laboratory differences in the reduction factor were only observed in two cases. Conclusions Our data provide valuable information for the replacement of VACV by MVA for testing chemical biocides and disinfectants. Because MVA does not replicate in humans this would eliminate the potential risk of inadvertent inoculation with vaccinia virus and disease in non-vaccinated laboratory workers.

  3. Interference effects at a dielectric plate applied as a high-power-laser attenuator.

    Science.gov (United States)

    Gregorcic, Peter; Babnik, Ales; Mozina, Janez

    2010-02-15

    The interference effects caused by the Fresnel reflections of a Gaussian beam on the boundaries of a dielectric plate, which can be considered as a Fabry-Perot etalon, were theoretically and experimentally investigated. In addition to the incident angle and the polarization of the incident light, two additional parameters--the plate's parallelism and the temperature--which are often neglected, were analyzed. Based on the theoretical predictions and the measured behavior of the transmittance of the dielectric plate a new, temperature-controlled variable high-power-laser attenuator is proposed. Unwanted changes in the plate's transmittance caused by the absorption of laser pulses within the plate are also presented. These phenomena are important in many applications where dielectric plates are used for a variety of purposes.

  4. X-Ray CT of Highly-Attenuating Objects: 9- or 15- MV Spectra?

    Energy Technology Data Exchange (ETDEWEB)

    Stone, G; Trebes, J; Perry, R; Schneberk, D; Logan, C

    2005-08-29

    We imaged-highly attenuating test objects in three dimensions with 9-MV (at LLNL) and 15-MV (at Hill Air Force Base) x-ray spectra. While we used the same detector and motion control, there were differences that we could not control in the two radiography bays and in the sources. The results show better spatial resolution for the 9-MV spectrum and better contrast for the 15-MV spectrum. The 15-MV data contains a noise pattern that obfuscates the data. It is our judgment that if sufficient attention were given to design of the bay, beam dump, collimation, filtration and linac spot size; a 15-MV imaging system using a flat panel could be developed with spatial resolution of 5 lp/mm and contrastive performance better than we have demonstrated using a 9-MV spectrum.

  5. α-Amyrin attenuates high fructose diet-induced metabolic syndrome in rats.

    Science.gov (United States)

    Prabhakar, Pankaj; Reeta, K H; Maulik, Subir Kumar; Dinda, Amit Kumar; Gupta, Yogendra Kumar

    2017-01-01

    This study investigated the effect of α-amyrin (a pentacyclic triterpene) on high-fructose diet (HFD)-induced metabolic syndrome in rats. Male Wistar rats were randomly distributed into different groups. The control group was fed normal rat chow diet. The HFD group was fed HFD (60%; w/w) for 42 days. Pioglitazone (10 mg/kg, orally, once daily) was used as a standard drug. α-Amyrin was administered in 3 doses (50, 100, and 200 mg/kg, orally, once daily along with HFD). Plasma glucose, total cholesterol, triglycerides, and high-density lipoprotein cholesterol (HDL-C) were estimated. Changes in blood pressure, oral glucose tolerance, and insulin tolerance were measured. Hepatic oxidative stress as well as messenger RNA (mRNA) and protein levels of peroxisome proliferator-activated receptor alpha (PPAR-α) were analyzed. A significant increase in systolic blood pressure, plasma glucose, total cholesterol, and plasma triglycerides and a significant decrease in HDL-C were observed in HFD rats as compared with control rats. Glucose tolerance and insulin tolerance were also significantly impaired with HFD. α-Amyrin prevented these changes in a dose-dependent manner. Hepatic oxidative stress as well as micro- and macrovesicular fatty changes in hepatocytes caused by HFD were also attenuated by α-amyrin. α-Amyrin preserved the hepatic mRNA and protein levels of PPAR-α, which was reduced in HFD group. This study thus demonstrates that α-amyrin attenuates HFD-induced metabolic syndrome in rats.

  6. Attenuation of laser generated ultrasound in steel at high temperatures; comparison of theory and experimental measurements.

    Science.gov (United States)

    Kube, Christopher M

    2016-08-01

    This article reexamines some recently published laser ultrasound measurements of the longitudinal attenuation coefficient obtained during annealing of two steel samples (DP600 and S550). Theoretical attenuation models based on perturbation theory are compared to these experimental measurements. It is observed that the Rayleigh attenuation formulas provide the correct qualitative agreement, but overestimate the experimental values. The more general theoretical attenuation model considered here demonstrates strong quantitative agreement, which highlights the applicability of the model during real-time metal processing. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. An attenuated LC16m8 smallpox vaccine: analysis of full-genome sequence and induction of immune protection.

    Science.gov (United States)

    Morikawa, Shigeru; Sakiyama, Tokuki; Hasegawa, Hideki; Saijo, Masayuki; Maeda, Akihiko; Kurane, Ichiro; Maeno, Go; Kimura, Junko; Hirama, Chie; Yoshida, Teruhiko; Asahi-Ozaki, Yasuko; Sata, Tetsutaro; Kurata, Takeshi; Kojima, Asato

    2005-09-01

    The potential threat of smallpox bioterrorism has made urgent the development of lower-virulence vaccinia virus vaccines. An attenuated LC16m8 (m8) vaccine was developed in 1975 from the Lister strain used in the World Health Organization smallpox eradication program but was not used against endemic smallpox. Today, no vaccines can be tested with variola virus for efficacy in humans, and the mechanisms of immune protection against the major intracellular mature virion (IMV) and minor extracellular enveloped virion (EEV) populations of poxviruses are poorly understood. Here, we determined the full-genome sequences of the m8, parental LC16mO (mO), and grandparental Lister (LO) strains and analyzed their evolutionary relationships. Sequence data and PCR analysis indicated that m8 was a progeny of LO and that m8 preserved almost all of the open reading frames of vaccinia virus except for the disrupted EEV envelope gene B5R. In accordance with this genomic background, m8 induced 100% protection against a highly pathogenic vaccinia WR virus in mice by a single vaccination, despite the lack of anti-B5R and anti-EEV antibodies. The immunogenicity and priming efficacy with the m8 vaccine consisting mainly of IMV were as high as those with the intact-EEV parental mO and grandparental LO vaccines. Thus, mice vaccinated with 10(7) PFU of m8 produced low levels of anti-B5R antibodies after WR challenge, probably because of quick clearance of B5R-expressing WR EEV by strong immunity induced by the vaccination. These results suggest that priming with m8 IMV provides efficient protection despite undetectable levels of immunity against EEV.

  8. A heterologous prime-boosting strategy with replicating Vaccinia virus vectors and plant-produced HIV-1 Gag/dgp41 virus-like particles.

    Science.gov (United States)

    Meador, Lydia R; Kessans, Sarah A; Kilbourne, Jacquelyn; Kibler, Karen V; Pantaleo, Giuseppe; Roderiguez, Mariano Esteban; Blattman, Joseph N; Jacobs, Bertram L; Mor, Tsafrir S

    2017-07-01

    Showing modest efficacy, the RV144 HIV-1 vaccine clinical trial utilized a non-replicating canarypox viral vector and a soluble gp120 protein boost. Here we built upon the RV144 strategy by developing a novel combination of a replicating, but highly-attenuated Vaccinia virus vector, NYVAC-KC, and plant-produced HIV-1 virus-like particles (VLPs). Both components contained the full-length Gag and a membrane anchored truncated gp41 presenting the membrane proximal external region with its conserved broadly neutralizing epitopes in the pre-fusion conformation. We tested different prime/boost combinations of these components in mice and showed that the group primed with NYVAC-KC and boosted with both the viral vectors and plant-produced VLPs have the most robust Gag-specific CD8 T cell responses, at 12.7% of CD8 T cells expressing IFN-γ in response to stimulation with five Gag epitopes. The same immunization group elicited the best systemic and mucosal antibody responses to Gag and dgp41 with a bias towards IgG1. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. CD69 Deficiency Enhances the Host Response to Vaccinia Virus Infection through Altered NK Cell Homeostasis.

    Science.gov (United States)

    Notario, Laura; Alari-Pahissa, Elisenda; de Molina, Antonio; Lauzurica, Pilar

    2016-07-15

    During the host response to viral infection, the transmembrane CD69 protein is highly upregulated in all immune cells. We have studied the role of CD69 in the murine immune response to vaccinia virus (VACV) infection, and we report that the absence of CD69 enhances protection against VACV at both short and long times postinfection in immunocompetent and immunodeficient mice. Natural killer (NK) cells were implicated in the increased infection control, since the differences were greatly diminished when NK cells were depleted. This role of NK cells was not based on an altered NK cell reactivity, since CD69 did not affect the NK cell activation threshold in response to major histocompatibility complex class I NK cell targets or protein kinase C activation. Instead, NK cell numbers were increased in the spleen and peritoneum of CD69-deficient infected mice. That was not just secondary to better infection control in CD69-deficient mice, since NK cell numbers in the spleens and the blood of uninfected CD69(-/-) mice were already augmented. CD69-deficient NK cells from infected mice did not have an altered proliferation capacity. However, a lower spontaneous cell death rate was observed for CD69(-/-) lymphocytes. Thus, our results suggest that CD69 limits the innate immune response to VACV infection at least in part through cell homeostatic survival. We show that increased natural killer (NK) cell numbers augment the host response and survival after infection with vaccinia virus. This phenotype is found in the absence of CD69 in immunocompetent and immunodeficient hosts. As part of the innate immune system, NK lymphocytes are activated and participate in the defense against infection. Several studies have focused on the contribution of NK cells to protection against infection with vaccinia virus. In this study, it was demonstrated that the augmented early NK cell response in the absence of CD69 is responsible for the increased protection seen during infection with

  10. Cytokine-modified VSV is attenuated for neural pathology, but is both highly immunogenic and oncolytic.

    Science.gov (United States)

    Miller, James; Bidula, Sarah M; Jensen, Troels M; Reiss, Carol Shoshkes

    2009-12-01

    Vesicular stomatitis virus (VSV), an enveloped, nonsegmented, negative-stranded RNA virus, is being tested by several laboratories as an antitumor agent. Unfortunately, viral infection of the central nervous system (CNS) has been observed by many groups following administration to tumor-bearing animals. In rodents, VSV encephalitis is characterized by weight-loss, paralysis, and high mortality. In order to provide protection from VSV infection of the CNS after therapeutic administration, we have attenuated VSV by the introduction of the gene encoding the proinflammatory cytokine interleukin (IL)-23, and designated the new virus VSV23. We hypothesize that while VSV23 is replicating within tumors, resulting in tumor destruction, the expression of IL-23 will enhance host antitumor and antiviral immune responses. In the event that the virus escapes from the tumor, the host's immune system will be activated and the virus will be rapidly cleared from healthy tissue. Experimental VSV23 infection of the CNS is characterized by decreased viral replication, morbidity, and mortality. VSV23 is capable of stimulating the enhanced production of nitric oxide in the CNS, which is critical for elimination of VSV from infected neurons. Intraperitoneal administration of VSV23 stimulates both nonspecific natural killer cell, virus-specific cytolytic T lymphocyte and memory virus-specific proliferative T cell responses against wild-type VSV in splenocytes. Furthermore, VSV23 is able to replicate in, and induce apoptosis of tumor cells in vitro. These data indicate that VSV23 is immunogenic, attenuated and suitable for testing as an efficacious and safe oncolytic agent.

  11. High-Resolution Attenuation Model for Gujarat: State of Western India

    Science.gov (United States)

    Jaiswal, N.; Singh, C.; Prajapati, S.

    2016-12-01

    In India, Gujarat belongs to the highest seismicity zone other than Himalayan belts. It has suffered from great economic and social loss due to many large magnitude earthquakes in the past. Thus the area needs a special attention from the seismic hazard point of view. It is the state of intraplate earthquakes similar to New Madrid Seismic zone in the United States. In the present study we have prepared a Lg attenuation tomographic model for Gujarat. The study also employs the other complementary information to get a detailed understanding into the mechanisms of attenuation. It will be useful in seismic hazard risk study and in estimating the source parameters of earthquakes. The amplitude of Lg wave is sensitive to different tectonic structures like faults, mountains and ocean basins. It travels predominantly through the continental crust but does not travel across ocean basins. Fifteen earthquakes of Mb >5 recorded at 40 stations operated in the region are chosen for the initial LgQ measurement using the standard two-station method. Finally, 5 events with 70 high-quality inter-station paths are selected from 117 possible pairs that are (1) aligned approximately with the source and (2) separated enough to permit the use of the standard two-station method for LgQ estimation. By using these values of Q0 (1 Hz LgQ) as input, an inversion is performed to have a Lg Q model for the region. A drastic spatial variation in Q0 has been noticed across our study region. Kutch, Jamnagar area are characterized by lowest Q0 values (300). These variations could be correlated with thermal effects, petrophysical properties and heterogeneity present in the crust.

  12. HIGH-RESOLUTION SEISMIC VELOCITY AND ATTENUATION MODELS OF THE CAUCASUS-CASPIAN REGION

    Energy Technology Data Exchange (ETDEWEB)

    Mellors, R; Gok, R; Pasyanos, M; Skobeltsyn, G; Teoman, U; Godoladze, T; Sandvol, E

    2008-07-01

    The southwest edge of Eurasia is a tectonically and structurally complex region that includes the Caspian and Black Sea basins, the Caucasus Mountains, and the high plateaus south of the Caucasus. Using data from 25 broadband stations located in the region, new estimates of crustal and upper mantle thickness, velocity structure, and attenuation are being developed. Receiver functions have been determined for all stations. Depth to Moho is estimated using slant stacking of the receiver functions, forward modeling, and inversion. Moho depths along the Caspian and in the Kura Depression are in general poorly constrained using only receiver functions due to thick sedimentary basin sediments. The best fitting models suggest a low velocity upper crust with Moho depths ranging from 30 to 40 km. Crustal thicknesses increase in the Greater Caucasus with Moho depths of 40 to 50 km. Pronounced variations with azimuth of source are observed indicating 3D structural complexity and upper crustal velocities are higher than in the Kura Depression to the south. In the Lesser Caucasus, south and west of the Kura Depression, the crust is thicker (40 to 50 km) and upper crustal velocities are higher. Work is underway to refine these models with the event based surface wave dispersion and ambient noise correlation measurements from continuous data. Regional phase (Lg and Pg) attenuation models as well as blockage maps for Pn and Sn are being developed. Two methods are used to estimate Q: the two-station method to estimate inter-station Q and the reversed, two-station, two event method. The results are then inverted to create Lg and Pg Q maps. Initial results suggest substantial variations in both Pg and Lg Q in the region. A zone of higher Pg Q extends west from the Caspian between the Lesser and Greater Caucasus and a narrow area of higher Lg Q is observed.

  13. Intermittent access to a nutritionally complete high-fat diet attenuates alcohol drinking in rats.

    Science.gov (United States)

    Sirohi, Sunil; Van Cleef, Arriel; Davis, Jon F

    2017-02-01

    Binge eating disorder and alcohol use disorder (AUD) frequently co-occur in the presence of other psychiatric conditions. Data suggest that binge eating engages similar behavioral and neurochemical processes common to AUD, which might contribute to the etiology or maintenance of alcoholism. However, it is unclear how binge feeding behavior and alcohol intake interact to promote initiation or maintenance of AUD. We investigated the impact of binge-like feeding on alcohol intake and anxiety-like behavior in male Long Evans rats. Rats received chow (controls) or extended intermittent access (24h twice a week; Int-HFD) to a nutritionally complete high-fat diet for six weeks. Standard rodent chow was available ad-libitum to all groups and food intake was measured. Following HFD exposure, 20.0% ethanol, 2.0% sucrose intake and endocrine peptide levels were evaluated. Anxiety-like behavior was measured using a light-dark (LD) box apparatus. Rats in the Int-HFD group displayed a binge-like pattern of feeding (alternations between caloric overconsumption and voluntary caloric restriction). Surprisingly, alcohol intake was significantly attenuated in the Int-HFD group whereas sugar consumption was unaffected. Plasma acyl-ghrelin levels were significantly elevated in the Int-HFD group, whereas glucagon-like peptide-1 levels did not change. Moreover, rats in the Int-HFD group spent more time in the light side of the LD box compared to controls, indicating that binge-like feeding induced anxiolytic effects. Collectively, these data suggest that intermittent access to HFD attenuates alcohol intake through reducing anxiety-like behavior, a process potentially controlled by elevated plasma ghrelin levels. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Attenuation capability of low activation-modified high manganese austenitic stainless steel for fusion reactor system

    Energy Technology Data Exchange (ETDEWEB)

    Eissa, M.M. [Steel Technology Department, Central Metallurgical Research and Development Institute (CMRDI), Helwan (Egypt); El-kameesy, S.U.; El-Fiki, S.A. [Physics Department, Faculty of Science, Ain Shams University, Cairo (Egypt); Ghali, S.N. [Steel Technology Department, Central Metallurgical Research and Development Institute (CMRDI), Helwan (Egypt); El Shazly, R.M. [Physics Department, Faculty of Science, Al-Azhar University, Cairo (Egypt); Saeed, Aly, E-mail: aly_8h@yahoo.com [Nuclear Power station Department, Faculty of Engineering, Egyptian-Russian University, Cairo (Egypt)

    2016-11-15

    Highlights: • Improvement stainless steel alloys to be used in fusion reactors. • Structural, mechanical, attenuation properties of investigated alloys were studied. • Good agreement between experimental and calculated results has been achieved. • The developed alloys could be considered as candidate materials for fusion reactors. - Abstract: Low nickel-high manganese austenitic stainless steel alloys, SSMn9Ni and SSMn10Ni, were developed to use as a shielding material in fusion reactor system. A standard austenitic stainless steel SS316L was prepared and studied as a reference sample. The microstructure properties of the present stainless steel alloys were investigated using Schaeffler diagram, optical microscopy, and X-ray diffraction pattern. Mainly, an austenite phase was observed for the prepared stainless steel alloys. Additionally, a small ferrite phase was observed in SS316L and SSMn10Ni samples. The mechanical properties of the prepared alloys were studied using Vickers hardness and tensile tests at room temperature. The studied manganese stainless steel alloys showed higher hardness, yield strength, and ultimate tensile strength than SS316L. On the other hand, the manganese stainless steel elongation had relatively lower values than the standard SS316L. The removal cross section for both slow and total slow (primary and those slowed down in sample) neutrons were carried out using {sup 241}Am-Be neutron source. Gamma ray attenuation parameters were carried out for different gamma ray energy lines which emitted from {sup 60}Co and {sup 232}Th radioactive sources. The developed manganese stainless steel alloys had a higher total slow removal cross section than SS316L. While the slow neutron and gamma rays were nearly the same for all studied stainless steel alloys. From the obtained results, the developed manganese stainless steel alloys could be considered as candidate materials for fusion reactor system with low activation based on the short life

  15. High dose compressive loads attenuate bone mineral loss in humans with spinal cord injury

    Science.gov (United States)

    Dudley-Javoroski, S.; Saha, P. K.; Liang, G.; Li, C.; Gao, Z.

    2012-01-01

    Summary People with spinal cord injury (SCI) lose bone and muscle integrity after their injury. Early doses of stress, applied through electrically induced muscle contractions, preserved bone density at high-risk sites. Appropriately prescribed stress early after the injury may be an important consideration to prevent bone loss after SCI. Introduction Skeletal muscle force can deliver high compressive loads to bones of people with spinal cord injury (SCI). The effective osteogenic dose of load for the distal femur, a chief site of fracture, is unknown. The purpose of this study is to compare three doses of bone compressive loads at the distal femur in individuals with complete SCI who receive a novel stand training intervention. Methods Seven participants performed unilateral quadriceps stimulation in supported stance [150% body weight (BW) compressive load—“High Dose” while opposite leg received 40% BW—“Low Dose”]. Five participants stood passively without applying quadriceps electrical stimulation to either leg (40% BW load—“Low Dose”). Fifteen participants performed no standing (0% BW load—“Untrained”) and 14 individuals without SCI provided normative data. Participants underwent bone mineral density (BMD) assessment between one and six times over a 3-year training protocol. Results BMD for the High Dose group significantly exceeded BMD for both the Low Dose and the Untrained groups (p0.05), indicating that BMD for participants performing passive stance did not differ from individuals who performed no standing. High-resolution CT imaging of one High Dose participant revealed 86% higher BMD and 67% higher trabecular width in the High Dose limb. Conclusion Over 3 years of training, 150% BW compressive load in upright stance significantly attenuated BMD decline when compared to passive standing or to no standing. High-resolution CT indicated that trabecular architecture was preserved by the 150% BW dose of load. PMID:22187008

  16. Linarin Enriched Extract Attenuates Liver Injury and Inflammation Induced by High-Fat High-Cholesterol Diet in Rats

    Directory of Open Access Journals (Sweden)

    Zhen-Jie Zhuang

    2017-01-01

    Full Text Available The aim of this study was to explore the potential beneficial effects of linarin enriched Flos Chrysanthemi extract (Lin-extract on nonalcoholic steatohepatitis (NASH induced by high-fat high-cholesterol (HFHC diet in rats. SD rats received normal diet, HFHC diet, or HFHC diet plus different doses of Lin-extract. The liver content of triglyceride and total cholesterol markedly increased in HFHC diet-fed model rats while middle and high dose of Lin-extract lowered liver cholesterol significantly. The expression of stearoyl-CoA desaturase (SCD1 was upregulated by HFHC diet and further elevated by high dose Lin-extract. High dose of Lin-extract also markedly lowered the serum alanine aminotransferase (ALT and aspartate aminotransferase (AST and inhibited the activation of c-Jun N-terminal kinase (JNK induced by HFHC in livers. The HFHC-increased mRNA levels of hepatic inflammation cytokines, including monocyte chemotactic protein-1 (MCP-1, tumor necrosis factor-α (TNF-α, and chemokine (C-X-C motif ligand 1 (CXCL1, were suppressed by Lin-extract dose-dependently. Furthermore, pathology evaluation showed that high dose Lin-extract greatly improved lobular inflammation. Our results suggest that Lin-extract could attenuate liver injury and inflammation induced by HFHC diet in rats. Its modulatory effect on lipid metabolism may partially contribute to this protective effect.

  17. Methamphetamine treatment during development attenuates the dopaminergic deficits caused by subsequent high-dose methamphetamine administration.

    Science.gov (United States)

    McFadden, Lisa M; Hoonakker, Amanda J; Vieira-Brock, Paula L; Stout, Kristen A; Sawada, Nicole M; Ellis, Jonathan D; Allen, Scott C; Walters, Elliot T; Nielsen, Shannon M; Gibb, James W; Alburges, Mario E; Wilkins, Diana G; Hanson, Glen R; Fleckenstein, Annette E

    2011-08-01

    Administration of high doses of methamphetamine (METH) causes persistent dopaminergic deficits in both nonhuman preclinical models and METH-dependent persons. Noteworthy, adolescent [i.e., postnatal day (PND) 40] rats are less susceptible to this damage than young adult (PND90) rats. In addition, biweekly treatment with METH, beginning at PND40 and continuing throughout development, prevents the persistent dopaminergic deficits caused by a "challenge" high-dose METH regimen when administered at PND90. Mechanisms underlying this "resistance" were thus investigated. Results revealed that biweekly METH treatment throughout development attenuated both the acute and persistent deficits in VMAT2 function, as well as the acute hyperthermia, caused by a challenge METH treatment. Pharmacokinetic alterations did not appear to contribute to the protection afforded by the biweekly treatment. Maintenance of METH-induced hyperthermia abolished the protection against both the acute and persistent VMAT2-associated deficits suggesting that alterations in thermoregulation were caused by exposure of rats to METH during development. These findings suggest METH during development prevents METH-induced hyperthermia and the consequent METH-related neurotoxicity. Copyright © 2011 Wiley-Liss, Inc.

  18. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246

    Directory of Open Access Journals (Sweden)

    Earl R. Kern

    2010-12-01

    Full Text Available Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  19. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246.

    Science.gov (United States)

    Quenelle, Debra C; Kern, Earl R

    2010-12-01

    Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  20. Approximation of the energy spectrum of a high-intense Bremsstrahlung source by the moments method using the attenuation curve

    CERN Document Server

    Nedavnij, O I

    2001-01-01

    A method of approximating energy spectrum of high-intensity Bremsstrahlung sources by the method of moments along attenuation curve is suggested. The method is based on preliminary differentiation of dependence of effective factor of radiation attenuation, calculation of random energy value moments and use of orthogonal polynomials. Analysis of results of mathematical experiment suggests that the method is fit for approximating energy spectra. Root-mean-square error of the approximation in the specific example made up 5% at most at initial error of 0.2%

  1. Cytoplasmic ATR Activation Promotes Vaccinia Virus Genome Replication

    Directory of Open Access Journals (Sweden)

    Antonio Postigo

    2017-05-01

    Full Text Available In contrast to most DNA viruses, poxviruses replicate their genomes in the cytoplasm without host involvement. We find that vaccinia virus induces cytoplasmic activation of ATR early during infection, before genome uncoating, which is unexpected because ATR plays a fundamental nuclear role in maintaining host genome integrity. ATR, RPA, INTS7, and Chk1 are recruited to cytoplasmic DNA viral factories, suggesting canonical ATR pathway activation. Consistent with this, pharmacological and RNAi-mediated inhibition of canonical ATR signaling suppresses genome replication. RPA and the sliding clamp PCNA interact with the viral polymerase E9 and are required for DNA replication. Moreover, the ATR activator TOPBP1 promotes genome replication and associates with the viral replisome component H5. Our study suggests that, in contrast to long-held beliefs, vaccinia recruits conserved components of the eukaryote DNA replication and repair machinery to amplify its genome in the host cytoplasm.

  2. Raspberry seed flour attenuates high-sucrose diet-mediated hepatic stress and adipose tissue inflammation.

    Science.gov (United States)

    Kang, Inhae; Espín, Juan Carlos; Carr, Timothy P; Tomás-Barberán, Francisco A; Chung, Soonkyu

    2016-06-01

    Chronic intake of high sucrose (HS) diet exacerbates high-fat (HF) diet-induced obesity and its associated metabolic complications. Previously, we have demonstrated that ellagic acid (EA), an abundant polyphenol found in some fruits and nuts, exerts distinct lipid-lowering characteristics in hepatocytes and adipocytes. In this study, we hypothesized that EA supplementation inhibits HS diet-mediated hepatic toxicity and its accompanied metabolic dysregulation. To test this hypothesis, C57BL/6 male mice were randomly assigned to three isocaloric HF diets (41% calories from fat) containing either no-sucrose (HF), high-sucrose (HFHS), or high-sucrose plus EA (HFHS-R) from raspberry seed flour (RSF, equivalent to 0.03% of EA), and fed for 12weeks. The inclusion of EA from RSF significantly improved HFHS diet-mediated dyslipidemia and restored glucose homeostasis levels similar to the HF diet-fed mice. Despite marginal difference in hepatic triglyceride content, the addition of EA substantially reversed the activation of endoplasmic reticulum (ER) stress and oxidative damage triggered by HFHS diet in the liver. These effects of EA were further confirmed in human hepatoma cells by reducing ER stress and reactive oxygen species (ROS) production. Moreover, HFHS-R diet significantly decreased visceral adipocyte hypertrophy and adipose tissue inflammation evidenced by reduced proinflammatory gene expression and macrophage infiltration. In summary, EA supplementation from RSF was effective in reducing HFHS diet-mediated metabolic complication by attenuating hepatic ER and oxidative stresses as well as adipocyte inflammation. Our results suggest that the inclusion of EA in diets may normalize metabolic insults triggered by HS consumption. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. High glucose attenuates shear-induced changes in endothelial hydraulic conductivity by degrading the glycocalyx.

    Science.gov (United States)

    Lopez-Quintero, Sandra V; Cancel, Limary M; Pierides, Alexis; Antonetti, David; Spray, David C; Tarbell, John M

    2013-01-01

    Diabetes mellitus is a risk factor for cardiovascular disease; however, the mechanisms through which diabetes impairs homeostasis of the vasculature have not been completely elucidated. The endothelium interacts with circulating blood through the surface glycocalyx layer, which serves as a mechanosensor/transducer of fluid shear forces leading to biomolecular responses. Atherosclerosis localizes typically in regions of low or disturbed shear stress, but in diabetics, the distribution is more diffuse, suggesting that there is a fundamental difference in the way cells sense shear forces. In the present study, we examined the effect of hyperglycemia on mechanotranduction in bovine aortic endothelial cells (BAEC). After six days in high glucose media, we observed a decrease in heparan sulfate content coincident with a significant attenuation of the shear-induced hydraulic conductivity response, lower activation of eNOS after exposure to shear, and reduced cell alignment with shear stress. These studies are consistent with a diabetes-induced change to the glycocalyx altering endothelial response to shear stress that could affect the distribution of atherosclerotic plaques.

  4. Cannabidiol attenuates high glucose-induced endothelial cell inflammatory response and barrier disruption

    Science.gov (United States)

    Rajesh, Mohanraj; Mukhopadhyay, Partha; Bátkai, Sándor; Haskó, György; Liaudet, Lucas; Drel, Viktor R.; Obrosova, Irina G.; Pacher, Pál

    2008-01-01

    A nonpsychoactive cannabinoid cannabidiol (CBD) has been shown to exert potent anti-inflammatory and antioxidant effects and has recently been reported to lower the incidence of diabetes in nonobese diabetic mice and to preserve the blood-retinal barrier in experimental diabetes. In this study we have investigated the effects of CBD on high glucose (HG)-induced, mitochondrial superoxide generation, NF-κB activation, nitrotyrosine formation, inducible nitric oxide synthase (iNOS) and adhesion molecules ICAM-1 and VCAM-1 expression, monocyte-endothelial adhesion, transendothelial migration of monocytes, and disruption of endothelial barrier function in human coronary artery endothelial cells (HCAECs). HG markedly increased mitochondrial superoxide generation (measured by flow cytometry using MitoSOX), NF-κB activation, nitrotyrosine formation, upregulation of iNOS and adhesion molecules ICAM-1 and VCAM-1, transendothelial migration of monocytes, and monocyte-endothelial adhesion in HCAECs. HG also decreased endothelial barrier function measured by increased permeability and diminished expression of vascular endothelial cadherin in HCAECs. Remarkably, all the above mentioned effects of HG were attenuated by CBD pretreatment. Since a disruption of the endothelial function and integrity by HG is a crucial early event underlying the development of various diabetic complications, our results suggest that CBD, which has recently been approved for the treatment of inflammation, pain, and spasticity associated with multiple sclerosis in humans, may have significant therapeutic benefits against diabetic complications and atherosclerosis. PMID:17384130

  5. High-calorie glucose-rich food attenuates neuroglycopenic symptoms in patients with Addison's disease.

    Science.gov (United States)

    Klement, Johanna; Hubold, Christian; Cords, Hannah; Oltmanns, Kerstin M; Hallschmid, Manfred; Born, Jan; Lehnert, Hendrik; Peters, Achim

    2010-02-01

    Patients with Addison's disease often suffer from fatigue, faintness, lack of concentration, and memory deficits, i.e. symptoms reminiscent of those of neuroglycopenia. Suspecting that a lack of central nervous glucose contributes to these symptoms, we examined whether they can be attenuated by the intake of palatable food rich in glucose ("comfort food") in these patients and, furthermore, whether comfort food reduces hypothalamus-pituitary-adrenal axis activity as observed in animal studies. Design/Setting/Patients/Outcome: Ten Addison patients with primary adrenal insufficiency and acutely discontinued cortisol substitution and 10 matched healthy controls each participated in two experimental sessions in which they were offered a free-choice high-calorie buffet (comfort food) and green salad, respectively, after a mental stress test. Neuroglycopenic and autonomic symptoms, cognitive function (short-term memory, attention), and hormones of the sympathoadrenal system (ACTH, cortisol, catecholamines) were assessed throughout the sessions. Scores of neuroglycopenic symptoms were persistently higher in Addison patients than in controls and were improved by comfort food in comparison to salad (P comfort food, as was memory (each P comfort food reduces symptoms of neuroglycopenia in Addison patients, suggesting that Addison's disease is associated with a deficit in cerebral energy supply that can partly be alleviated by intake of palatable food. It will be important to investigate whether additional oral glucose supply may be helpful in improving patients' well-being.

  6. Volume Attenuation and High Frequency Loss as Auditory Depth Cues in Stereoscopic 3D Cinema

    Science.gov (United States)

    Manolas, Christos; Pauletto, Sandra

    2014-09-01

    Assisted by the technological advances of the past decades, stereoscopic 3D (S3D) cinema is currently in the process of being established as a mainstream form of entertainment. The main focus of this collaborative effort is placed on the creation of immersive S3D visuals. However, with few exceptions, little attention has been given so far to the potential effect of the soundtrack on such environments. The potential of sound both as a means to enhance the impact of the S3D visual information and to expand the S3D cinematic world beyond the boundaries of the visuals is large. This article reports on our research into the possibilities of using auditory depth cues within the soundtrack as a means of affecting the perception of depth within cinematic S3D scenes. We study two main distance-related auditory cues: high-end frequency loss and overall volume attenuation. A series of experiments explored the effectiveness of these auditory cues. Results, although not conclusive, indicate that the studied auditory cues can influence the audience judgement of depth in cinematic 3D scenes, sometimes in unexpected ways. We conclude that 3D filmmaking can benefit from further studies on the effectiveness of specific sound design techniques to enhance S3D cinema.

  7. Application of reverse genetics for producing attenuated vaccine strains against highly pathogenic avian influenza viruses.

    Science.gov (United States)

    Uchida, Yuko; Takemae, Nobuhiro; Saito, Takehiko

    2014-08-01

    In this study, reverse genetics was applied to produce vaccine candidate strains against highly pathogenic avian influenza viruses (HPAIVs) of the H5N1 subtype. The H5 subtype vaccine strains were generated by a reverse genetics method in a biosafety level 2 facility. The strain contained the HA gene from the H5N1 subtype HPAIV attenuated by genetic modification at the cleavage site, the NA gene derived from the H5N1 subtype HPAI or the H5N3 subtype of avian influenza virus and internal genes from A/Puerto Rico/8/34. Vaccination with an inactivated recombinant virus with oil-emulsion completely protected chickens from a homologous viral challenge with a 640 HAU or 3,200 HAU/vaccination dose. Vaccination with a higher dose of antigen, 3,200 HAU, was effective at increasing survival and efficiently reduced viral shedding even when challenged by a virus of a different HA clade. The feasibility of differentiation of infected from vaccinated animals (DIVA) was demonstrated against a challenge with H5N1 HPAIVs when the recombinant H5N3 subtype viruses were used as the antigens of the vaccine. Our study demonstrated that the use of reverse genetics would be an option to promptly produce an inactivated vaccine with better matching of antigenicity to a circulating strain.

  8. High glucose attenuates shear-induced changes in endothelial hydraulic conductivity by degrading the glycocalyx.

    Directory of Open Access Journals (Sweden)

    Sandra V Lopez-Quintero

    Full Text Available Diabetes mellitus is a risk factor for cardiovascular disease; however, the mechanisms through which diabetes impairs homeostasis of the vasculature have not been completely elucidated. The endothelium interacts with circulating blood through the surface glycocalyx layer, which serves as a mechanosensor/transducer of fluid shear forces leading to biomolecular responses. Atherosclerosis localizes typically in regions of low or disturbed shear stress, but in diabetics, the distribution is more diffuse, suggesting that there is a fundamental difference in the way cells sense shear forces. In the present study, we examined the effect of hyperglycemia on mechanotranduction in bovine aortic endothelial cells (BAEC. After six days in high glucose media, we observed a decrease in heparan sulfate content coincident with a significant attenuation of the shear-induced hydraulic conductivity response, lower activation of eNOS after exposure to shear, and reduced cell alignment with shear stress. These studies are consistent with a diabetes-induced change to the glycocalyx altering endothelial response to shear stress that could affect the distribution of atherosclerotic plaques.

  9. Attenuation of virus production at high multiplicities of infection in Aureococcus anophagefferens

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Christopher M.; Bidle, Kay D., E-mail: bidle@marine.rutgers.edu

    2014-10-15

    Infection dynamics (saturation kinetics, infection efficiency, adsorption and burst size) for the Aureococcus anophagefferens-Brown Tide virus (AaV) system were investigated using susceptible and resistant strains. Adsorption assays revealed that virus affinity to the cell surface is a key determinant of infectivity. Saturation of infection occurred at a multiplicity of infection (MOI) of 8 viruses per host and resulted in ∼90–95% of infected cells, with burst sizes ranging from 164 to 191. Insight from the AaV genome implicates recycling of host nucleotides rather than de novo synthesis as a constraint on viral replication. Viral yields and mean burst sizes were significantly diminished with increasing MOI. This phenomenon, which was reminiscent of phage-induced ‘lysis from without’, appeared to be caused by viral contact and was unrelated to bacteria, signaling/toxic compounds, or defective interfering viruses. We posit that high-MOI effects attenuate viral proliferation in natural systems providing a negative feedback on virus-induced bloom collapse.

  10. Interest of the attenuation coefficient in multiparametric high frequency ultrasound investigation of whole blood coagulation process.

    Science.gov (United States)

    Callé, Rachel; Plag, Camille; Patat, Frédéric; Ossant, Frédéric

    2009-01-01

    Previous studies [R. Libgot, F. Ossant, Y. Gruel, P. Lermusiaux, and F. Patat, Proc.-IEEE Utrason. Symp. 4, 2259-2262 (2005); R. Libgot-Calle, F. Ossant, Y. Gruel, P. Lermusiaux, and F. Patat, Ultrasound Med. Biol. 34, 252-264 (2008); F. Ossant, R. Libgot, P. Coupe, P. Lermusiaux, and F. Patat, Proc.-IEEE Ultrason. Symp. 2, 846-849 (2004)] showed the potential of an in vitro high frequency ultrasound (beyond 20 MHz) device to describe the blood clotting process. The parameters were simultaneously estimated in double transmission (DT) with the calculation of the velocity of longitudinal waves and in backscattering (BS) modes with the estimation of the integrated BS coefficient and the effective scatterer size. The aim of the present study was to show how the integrated attenuation coefficient (IAC) assessed in DT mode could provide additional information on this process, especially regarding the fibrin polymerization which is an important part of the coagulation process. A characteristic time t(a) of the variations in IAC that could be linked to fibrin formation was identified.

  11. Live vaccinia-rabies virus recombinants, but not an inactivated rabies virus cell culture vaccine, protect B-lymphocyte-deficient A/WySnJ mice against rabies: considerations of recombinant defective poxviruses for rabies immunization of immunocompromised individuals.

    Science.gov (United States)

    Lodmell, Donald L; Esposito, Joseph J; Ewalt, Larry C

    2004-09-03

    Presently, commercially available cell culture rabies vaccines for humans and animals consist of the five inactivated rabies virus proteins. The vaccines elicit a CD4+ helper T-cell response and a humoral B-cell response against the viral glycoprotein (G) resulting in the production of virus neutralizing antibody. Antibody against the viral nucleoprotein (N) is also present, but the mechanism(s) of its protection is unclear. HIV-infected individuals with low CD4+ T-lymphocyte counts and individuals undergoing treatment with immunosuppressive drugs have an impaired neutralizing antibody response after pre- and post-exposure immunization with rabies cell culture vaccines. Here we show the efficacy of live vaccinia-rabies virus recombinants, but not a cell culture vaccine consisting of inactivated rabies virus, to elicit elevated levels of neutralizing antibody in B-lymphocyte deficient A/WySnJ mice. The cell culture vaccine also failed to protect the mice, whereas a single immunization of a vaccinia recombinant expressing the rabies virus G or co-expressing G and N equally protected the mice up to 18 months after vaccination. The data suggest that recombinant poxviruses expressing the rabies virus G, in particular replication defective poxviruses such as canarypox or MVA vaccinia virus that undergo abortive replication in non-avian cells, or the attenuated vaccinia virus NYVAC, should be evaluated as rabies vaccines in immunocompromised individuals.

  12. High protein diets do not attenuate decrements in testosterone and IGF-I during energy deficit.

    Science.gov (United States)

    Henning, Paul C; Margolis, Lee M; McClung, James P; Young, Andrew J; Pasiakos, Stefan M

    2014-05-01

    Energy deficit (ED) diminishes fat-free mass (FFM) with concomitant reductions in anabolic hormone secretion. A modest increase in protein to recommended dietary allowance (RDA) levels during ED minimally attenuates decrements in insulin-like growth factor-I (IGF-I). The impact of dietary protein above the RDA on circulating anabolic hormones and their relationships with FFM in response to ED are not well described. Thirty-three adults were assigned diets providing protein at 0.8 (RDA), 1.6 (2×-RDA), and 2.4 (3×-RDA) g/kg/d for 31days. Testosterone, sex-hormone binding globulin (SHBG) and IGF-I system components were assessed after a 10-day period of weight-maintenance (WM) and after a 21-day period of ED (40%) achieved by an increase in energy expenditure and decreased energy intake. Associations between the change in FFM and anabolic hormone levels were determined. As compared to WM and regardless of dietary protein intake, total and free testosterone, total IGF-I, and acid-labile subunit decreased (P<0.05), whereas SHBG and IGF binding proteins-1, -2, and -3 increased (P<0.05) during ED. There were no energy-by-protein interactions on any hormones or IGF-I system components measured. Changes in FFM in response to ED were negatively associated with acid-labile subunit (ALS) (r=-0.62, P<0.05) in 2×-RDA; however, no other relationships were observed. Consuming a high protein diet does not impact the androgenic and IGF-I system response to ED. These data suggest that the protective effects of high protein diets on FFM during ED are likely not influenced by anabolic hormone concentrations. Published by Elsevier Inc.

  13. A highly attenuated recombinant human respiratory syncytial virus lacking the G protein induces long-lasting protection in cotton rats.

    Science.gov (United States)

    Widjojoatmodjo, Myra N; Boes, Jolande; van Bers, Marleen; van Remmerden, Yvonne; Roholl, Paul J M; Luytjes, Willem

    2010-06-02

    Respiratory syncytial virus (RSV) is a primary cause of serious lower respiratory tract illness for which there is still no safe and effective vaccine available. Using reverse genetics, recombinant (r)RSV and an rRSV lacking the G gene (DeltaG) were constructed based on a clinical RSV isolate (strain 98-25147-X). Growth of both recombinant viruses was equivalent to that of wild type virus in Vero cells, but was reduced in human epithelial cells like Hep-2. Replication in cotton rat lungs could not be detected for DeltaG, while rRSV was 100-fold attenuated compared to wild type virus. Upon single dose intranasal administration in cotton rats, both recombinant viruses developed high levels of neutralizing antibodies and conferred comparable long-lasting protection against RSV challenge; protection against replication in the lungs lasted at least 147 days and protection against pulmonary inflammation lasted at least 75 days. Collectively, the data indicate that a single dose immunization with the highly attenuated DeltaG as well as the attenuated rRSV conferred long term protection in the cotton rat against subsequent RSV challenge, without inducing vaccine enhanced pathology. Since DeltaG is not likely to revert to a less attenuated phenotype, we plan to evaluate this deletion mutant further and to investigate its potential as a vaccine candidate against RSV infection.

  14. Frequency of adverse events after vaccination with different vaccinia strains.

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2006-08-01

    Full Text Available BACKGROUND: Large quantities of smallpox vaccine have been stockpiled to protect entire nations against a possible reintroduction of smallpox. Planning for an appropriate use of these stockpiled vaccines in response to a smallpox outbreak requires a rational assessment of the risks of vaccination-related adverse events, compared to the risk of contracting an infection. Although considerable effort has been made to understand the dynamics of smallpox transmission in modern societies, little attention has been paid to estimating the frequency of adverse events due to smallpox vaccination. Studies exploring the consequences of smallpox vaccination strategies have commonly used a frequency of approximately one death per million vaccinations, which is based on a study of vaccination with the New York City Board of Health (NYCBH strain of vaccinia virus. However, a multitude of historical studies of smallpox vaccination with other vaccinia strains suggest that there are strain-related differences in the frequency of adverse events after vaccination. Because many countries have stockpiled vaccine based on the Lister strain of vaccinia virus, a quantitative evaluation of the adverse effects of such vaccines is essential for emergency response planning. We conducted a systematic review and statistical analysis of historical data concerning vaccination against smallpox with different strains of vaccinia virus. METHODS AND FINDINGS: We analyzed historical vaccination data extracted from the literature. We extracted data on the frequency of postvaccinal encephalitis and death with respect to vaccinia strain and age of vaccinees. Using a hierarchical Bayesian approach for meta-analysis, we estimated the expected frequencies of postvaccinal encephalitis and death with respect to age at vaccination for smallpox vaccines based on the NYCBH and Lister vaccinia strains. We found large heterogeneity between findings from different studies and a time-period effect

  15. Short-Term Hypocaloric High-Fiber and High-Protein Diet Improves Hepatic Steatosis Assessed by Controlled Attenuation Parameter.

    Science.gov (United States)

    Arslanow, Anita; Teutsch, Melanie; Walle, Hardy; Grünhage, Frank; Lammert, Frank; Stokes, Caroline S

    2016-06-16

    Non-alcoholic fatty liver disease is one of the most prevalent liver diseases and increases the risk of fibrosis and cirrhosis. Current standard treatment focuses on lifestyle interventions. The primary aim of this study was to assess the effects of a short-term low-calorie diet on hepatic steatosis, using the controlled attenuation parameter (CAP) as quantitative tool. In this prospective observational study, 60 patients with hepatic steatosis were monitored during a hypocaloric high-fiber, high-protein diet containing 1,000 kcal/day. At baseline and after 14 days, we measured hepatic fat contents using CAP during transient elastography, body composition with bioelectrical impedance analysis, and serum liver function tests and lipid profiles using standard clinical-chemical assays. The median age was 56 years (25-78 years); 51.7% were women and median body mass index was 31.9 kg/m(2) (22.4-44.8 kg/m(2)). After 14 days, a significant CAP reduction (14.0%; PCAP improvements occur after only 14 days on short-term low-calorie diet, together with reductions of body composition parameters, serum lipids, and liver enzymes, pointing to the dynamics of hepatic lipid turnover.

  16. An Attenuated LC16m8 Smallpox Vaccine: Analysis of Full-Genome Sequence and Induction of Immune Protection§

    Science.gov (United States)

    Morikawa, Shigeru; Sakiyama, Tokuki; Hasegawa, Hideki; Saijo, Masayuki; Maeda, Akihiko; Kurane, Ichiro; Maeno, Go; Kimura, Junko; Hirama, Chie; Yoshida, Teruhiko; Asahi-Ozaki, Yasuko; Sata, Tetsutaro; Kurata, Takeshi; Kojima, Asato

    2005-01-01

    The potential threat of smallpox bioterrorism has made urgent the development of lower-virulence vaccinia virus vaccines. An attenuated LC16m8 (m8) vaccine was developed in 1975 from the Lister strain used in the World Health Organization smallpox eradication program but was not used against endemic smallpox. Today, no vaccines can be tested with variola virus for efficacy in humans, and the mechanisms of immune protection against the major intracellular mature virion (IMV) and minor extracellular enveloped virion (EEV) populations of poxviruses are poorly understood. Here, we determined the full-genome sequences of the m8, parental LC16mO (mO), and grandparental Lister (LO) strains and analyzed their evolutionary relationships. Sequence data and PCR analysis indicated that m8 was a progeny of LO and that m8 preserved almost all of the open reading frames of vaccinia virus except for the disrupted EEV envelope gene B5R. In accordance with this genomic background, m8 induced 100% protection against a highly pathogenic vaccinia WR virus in mice by a single vaccination, despite the lack of anti-B5R and anti-EEV antibodies. The immunogenicity and priming efficacy with the m8 vaccine consisting mainly of IMV were as high as those with the intact-EEV parental mO and grandparental LO vaccines. Thus, mice vaccinated with 107 PFU of m8 produced low levels of anti-B5R antibodies after WR challenge, probably because of quick clearance of B5R-expressing WR EEV by strong immunity induced by the vaccination. These results suggest that priming with m8 IMV provides efficient protection despite undetectable levels of immunity against EEV. PMID:16140764

  17. In vitro recognition of an orf virus early promoter in a vaccinia virus extract

    NARCIS (Netherlands)

    Vos, J C; Mercer, R. A.; Fleming, S B; Robinson, A J

    1992-01-01

    DNA fragments containing varying lengths of the 5' end of an orf virus early gene (ORF3) and its associated promoter were introduced into sodium deoxycholate-solubilized vaccinia virus extracts capable of initiating transcription in vitro from vaccinia virus early promoters. After separation of the

  18. Analysis of variola and vaccinia virus neutralization assays for smallpox vaccines.

    Science.gov (United States)

    Hughes, Christine M; Newman, Frances K; Davidson, Whitni B; Olson, Victoria A; Smith, Scott K; Holman, Robert C; Yan, Lihan; Frey, Sharon E; Belshe, Robert B; Karem, Kevin L; Damon, Inger K

    2012-07-01

    Possible smallpox reemergence drives research for third-generation vaccines that effectively neutralize variola virus. A comparison of neutralization assays using different substrates, variola and vaccinia (Dryvax and modified vaccinia Ankara [MVA]), showed significantly different 90% neutralization titers; Dryvax underestimated while MVA overestimated variola neutralization. Third-generation vaccines may rely upon neutralization as a correlate of protection.

  19. In silico-accelerated identification of conserved and immunogenic variola/vaccinia T-cell epitopes

    DEFF Research Database (Denmark)

    Moise, Leonard; McMurry, Julie A; Buus, Søren

    2009-01-01

    Epitopes shared by the vaccinia and variola viruses underlie the protective effect of vaccinia immunization against variola infection. We set out to identify a subset of cross-reactive epitopes using bioinformatics and immunological methods. Putative T-cell epitopes were computationally predicted...

  20. High-Intensity Interval Training Attenuates Insulin Resistance Induced by Sleep Deprivation in Healthy Males.

    Science.gov (United States)

    de Souza, Jorge F T; Dáttilo, Murilo; de Mello, Marco T; Tufik, Sergio; Antunes, Hanna K M

    2017-01-01

    Introduction: Sleep deprivation can impair several physiological systems and recently, new evidence has pointed to the relationship between a lack of sleep and carbohydrate metabolism, consequently resulting in insulin resistance. To minimize this effect, High-Intensity Interval Training (HIIT) is emerging as a potential strategy. Objective: The aim of this study was to investigate the effects of HIIT on insulin resistance induced by sleep deprivation. Method: Eleven healthy male volunteers were recruited, aged 18-35 years, who declared taking 7-8 h sleep per night. All volunteers were submitted to four different conditions: a single night of regular sleep (RS condition), 24 h of total sleep deprivation ( SD condition), HIIT training followed by regular sleep (HIIT+RS condition), and HIIT training followed by 24 h of total sleep deprivation (HIIT+ SD condition). They performed six training sessions over 2 weeks and each session consisted of 8-12 × 60 s intervals at 100% of peak power output. In each experimental condition, tests for glucose, insulin, cortisol, free fatty acids, and insulin sensitivity, measured by oral glucose tolerance test (OGTT), were performed. Results: Sleep deprivation increased glycaemia and insulin levels, as well as the area under the curve. Furthermore, an increase in free fatty acids concentrations and basal metabolism was observed. There were no differences in the concentrations of cortisol. However, HIIT before 24 h of sleep deprivation attenuated the increase of glucose, insulin, and free fatty acids. Conclusion: Twenty-four hours of sleep deprivation resulted in acute insulin resistance. However, HIIT is an effective strategy to minimize the deleterious effects promoted by this condition.

  1. High iodine concentration attenuates RET/PTC3 oncogene activation in thyroid follicular cells.

    Science.gov (United States)

    Fiore, Ana Paula Zen Petisco; Fuziwara, Cesar Seigi; Kimura, Edna Teruko

    2009-11-01

    Papillary thyroid carcinoma (PTC) is frequently associated with a RET gene rearrangement that generates a RET/PTC oncogene. RET/PTC is a fusion of the tyrosine kinase domain of RET to the 5' portion of a different gene. This fusion results in a constitutively active MAPK pathway, which plays a key role in PTC development. The RET/PTC3 fusion is primarily associated with radiation-related PTC. Epidemiological studies show a lower incidence of PTC in radiation-exposed regions that are associated with an iodine-rich diet. Since the influence of excess iodine on the development of thyroid cancer is still unclear, the aim of this study is to evaluate the effect of high iodine concentrations on RET/PTC3-activated thyroid cells. PTC3-5 cells, a rat thyroid cell lineage harboring doxycycline-inducible RET/PTC3, were treated with 10(-3) M NaI. Cell growth was analyzed by cell counting and the MTT assay. The expression and phosphorylation state of MAPK pathway-related (Braf, Erk, pErk, and pRet) and thyroid-specific (natrium-iodide symporter [Nis] and thyroid-stimulating hormone receptor [Tshr]) proteins were analyzed by Western blotting. Thyroid-specific gene expression was further analyzed by quantitative reverse transcription (RT)-polymerase chain reaction. A significant inhibition of proliferation was observed, along with no significant variation in cell death rate, in the iodine-treated cells. Further, iodine treatment attenuated the loss of Nis and Tshr gene and protein expression induced by RET/PTC3 oncogene induction. Finally, iodine treatment reduced Ret and Erk phosphorylation, without altering Braf and Erk expression. Our results indicate an antioncogenic role for excess iodine during thyroid oncogenic activation. These findings contribute to a better understanding of the effect of iodine on thyroid follicular cells, particularly how it may play a protective role during RET/PTC3 oncogene activation.

  2. High-Intensity Interval Training Attenuates Insulin Resistance Induced by Sleep Deprivation in Healthy Males

    Directory of Open Access Journals (Sweden)

    Jorge F. T. de Souza

    2017-12-01

    Full Text Available Introduction: Sleep deprivation can impair several physiological systems and recently, new evidence has pointed to the relationship between a lack of sleep and carbohydrate metabolism, consequently resulting in insulin resistance. To minimize this effect, High-Intensity Interval Training (HIIT is emerging as a potential strategy.Objective: The aim of this study was to investigate the effects of HIIT on insulin resistance induced by sleep deprivation.Method: Eleven healthy male volunteers were recruited, aged 18–35 years, who declared taking 7–8 h sleep per night. All volunteers were submitted to four different conditions: a single night of regular sleep (RS condition, 24 h of total sleep deprivation (SD condition, HIIT training followed by regular sleep (HIIT+RS condition, and HIIT training followed by 24 h of total sleep deprivation (HIIT+SD condition. They performed six training sessions over 2 weeks and each session consisted of 8–12 × 60 s intervals at 100% of peak power output. In each experimental condition, tests for glucose, insulin, cortisol, free fatty acids, and insulin sensitivity, measured by oral glucose tolerance test (OGTT, were performed.Results: Sleep deprivation increased glycaemia and insulin levels, as well as the area under the curve. Furthermore, an increase in free fatty acids concentrations and basal metabolism was observed. There were no differences in the concentrations of cortisol. However, HIIT before 24 h of sleep deprivation attenuated the increase of glucose, insulin, and free fatty acids.Conclusion: Twenty-four hours of sleep deprivation resulted in acute insulin resistance. However, HIIT is an effective strategy to minimize the deleterious effects promoted by this condition.

  3. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA)

    DEFF Research Database (Denmark)

    Cottingham, Matthew G; Andersen, Rikke F; Spencer, Alexandra J

    2008-01-01

    -length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering) of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A...... to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA), now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full......-2006). In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+) T cells against an epitope from Plasmodium berghei was created using Gal...

  4. A replication-deficient rabies virus vaccine expressing Ebola virus glycoprotein is highly attenuated for neurovirulence

    Energy Technology Data Exchange (ETDEWEB)

    Papaneri, Amy B. [Emerging Viral Pathogens Section, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Fort Detrick, MD 21702 (United States); Wirblich, Christoph [Department of Microbiology and Immunology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA 19107 (United States); Cann, Jennifer A.; Cooper, Kurt [Integrated Research Facility, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Fort Detrick MD, 21702 (United States); Jahrling, Peter B. [Emerging Viral Pathogens Section, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Fort Detrick, MD 21702 (United States); Integrated Research Facility, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Fort Detrick MD, 21702 (United States); Schnell, Matthias J., E-mail: matthias.schnell@jefferson.edu [Department of Microbiology and Immunology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA 19107 (United States); Jefferson Vaccine Center, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA 19107 (United States); Blaney, Joseph E., E-mail: jblaney@niaid.nih.gov [Emerging Viral Pathogens Section, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Fort Detrick, MD 21702 (United States)

    2012-12-05

    We are developing inactivated and live-attenuated rabies virus (RABV) vaccines expressing Ebola virus (EBOV) glycoprotein for use in humans and endangered wildlife, respectively. Here, we further characterize the pathogenesis of the live-attenuated RABV/EBOV vaccine candidates in mice in an effort to define their growth properties and potential for safety. RABV vaccines expressing GP (RV-GP) or a replication-deficient derivative with a deletion of the RABV G gene (RV{Delta}G-GP) are both avirulent after intracerebral inoculation of adult mice. Furthermore, RV{Delta}G-GP is completely avirulent upon intracerebral inoculation of suckling mice unlike parental RABV vaccine or RV-GP. Analysis of RV{Delta}G-GP in the brain by quantitative PCR, determination of virus titer, and immunohistochemistry indicated greatly restricted virus replication. In summary, our findings indicate that RV-GP retains the attenuation phenotype of the live-attenuated RABV vaccine, and RV{Delta}G-GP would appear to be an even safer alternative for use in wildlife or consideration for human use.

  5. Vectors based on modified vaccinia Ankara expressing influenza H5N1 hemagglutinin induce substantial cross-clade protective immunity.

    Directory of Open Access Journals (Sweden)

    Annett Hessel

    Full Text Available BACKGROUND: New highly pathogenic H5N1 influenza viruses are continuing to evolve with a potential threat for an influenza pandemic. So far, the H5N1 influenza viruses have not widely circulated in humans and therefore constitute a high risk for the non immune population. The aim of this study was to evaluate the cross-protective potential of the hemagglutinins of five H5N1 strains of divergent clades using a live attenuated modified vaccinia Ankara (MVA vector vaccine. METHODOLOGY/PRINCIPAL FINDINGS: The replication-deficient MVA virus was used to express influenza hemagglutinin (HA proteins. Specifically, recombinant MVA viruses expressing the HA genes of the clade 1 virus A/Vietnam/1203/2004 (VN/1203, the clade 2.1.3 virus A/Indonesia/5/2005 (IN5/05, the clade 2.2 viruses A/turkey/Turkey/1/2005 (TT01/05 and A/chicken/Egypt/3/2006 (CE/06, and the clade 2.3.4 virus A/Anhui/1/2005 (AH1/05 were constructed. These experimental live vaccines were assessed in a lethal mouse model. Mice vaccinated with the VN/1203 hemagglutinin-expressing MVA induced excellent protection against all the above mentioned clades. Also mice vaccinated with the IN5/05 HA expressing MVA induced substantial protection against homologous and heterologous AH1/05 challenge. After vaccination with the CE/06 HA expressing MVA, mice were fully protected against clade 2.2 challenge and partially protected against challenge of other clades. Mice vaccinated with AH1/05 HA expressing MVA vectors were only partially protected against homologous and heterologous challenge. The live vaccines induced substantial amounts of neutralizing antibodies, mainly directed against the homologous challenge virus, and high levels of HA-specific IFN-γ secreting CD4 and CD8 T-cells against epitopes conserved among the H5 clades and subclades. CONCLUSIONS/SIGNIFICANCE: The highest level of cross-protection was induced by the HA derived from the VN/1203 strain, suggesting that pandemic H5 vaccines

  6. Constitutional high expression of an APC mRNA isoform in a subset of attenuated familial adenomatous polyposis patients.

    Science.gov (United States)

    Venesio, Tiziana; Balsamo, Antonella; Sfiligoi, Christian; Fuso, Luca; Molatore, Sara; Ranzani, Guglielmina Nadia; Risio, Mauro

    2007-03-01

    Familial adenomatous polyposis is an inherited condition associated with hundreds to thousands of colorectal adenomas conferring a very high risk of cancer at a young age. In addition to "classical" form, there is also an attenuated polyposis, with fewer than 100 polyps and a delayed age of cancer onset. Both classical and attenuated polyposis are characterized by a relevant phenotypic heterogeneity. The disease has been linked to constitutive mutations of either APC tumor suppressor gene, or less frequently, MYH base-excision repair gene. However, the genetic cause remains undetected in up to 70-80% of patients with the attenuated form. This analysis was performed on 26 polyposis patients with the attenuated phenotype. All patients had formerly proven to be negative for APC truncating mutations that typically represent the majority of APC gene alterations. We evaluated the APC mRNA constitutional level by real-time quantitative reverse transcription polymerase chain reaction (PCR). Eleven patients (42%) showed an anomalous APC transcription level. One patient with reduced mRNA was a carrier of a whole APC gene deletion. In seven out of the ten remaining cases, we found the increased expression of an APC mRNA isoform resulting from exon 10/15 connection and giving rise to a stable truncated peptide. Mutations neither in the invariant splice sites nor in the known transcription regulatory signals were found. Our results support the notion that in attenuated polyposis patients, a detailed investigation of APC transcription can allow detection of rare alterations. Although functional data are required, the isoform we observed might have some pathogenic role, accounting for the heterogeneous phenotype that characterizes the polyposis syndrome.

  7. Rational design of a live attenuated dengue vaccine: 2'-o-methyltransferase mutants are highly attenuated and immunogenic in mice and macaques.

    Directory of Open Access Journals (Sweden)

    Roland Züst

    Full Text Available Dengue virus is transmitted by Aedes mosquitoes and infects at least 100 million people every year. Progressive urbanization in Asia and South-Central America and the geographic expansion of Aedes mosquito habitats have accelerated the global spread of dengue, resulting in a continuously increasing number of cases. A cost-effective, safe vaccine conferring protection with ideally a single injection could stop dengue transmission. Current vaccine candidates require several booster injections or do not provide protection against all four serotypes. Here we demonstrate that dengue virus mutants lacking 2'-O-methyltransferase activity are highly sensitive to type I IFN inhibition. The mutant viruses are attenuated in mice and rhesus monkeys and elicit a strong adaptive immune response. Monkeys immunized with a single dose of 2'-O-methyltransferase mutant virus showed 100% sero-conversion even when a dose as low as 1,000 plaque forming units was administrated. Animals were fully protected against a homologous challenge. Furthermore, mosquitoes feeding on blood containing the mutant virus were not infected, whereas those feeding on blood containing wild-type virus were infected and thus able to transmit it. These results show the potential of 2'-O-methyltransferase mutant virus as a safe, rationally designed dengue vaccine that restrains itself due to the increased susceptibility to the host's innate immune response.

  8. Expanding the repertoire of Modified Vaccinia Ankara-based vaccine vectors via genetic complementation strategies.

    Directory of Open Access Journals (Sweden)

    David A Garber

    Full Text Available Modified Vaccinia virus Ankara (MVA is a safe, highly attenuated orthopoxvirus that is being developed as a recombinant vaccine vector for immunization against a number of infectious diseases and cancers. However, the expression by MVA vectors of large numbers of poxvirus antigens, which display immunodominance over vectored antigens-of-interest for the priming of T cell responses, and the induction of vector-neutralizing antibodies, which curtail the efficacy of subsequent booster immunizations, remain as significant impediments to the overall utility of such vaccines. Thus, genetic approaches that enable the derivation of MVA vectors that are antigenically less complex may allow for rational improvement of MVA-based vaccines.We have developed a genetic complementation system that enables the deletion of essential viral genes from the MVA genome, thereby allowing us to generate MVA vaccine vectors that are antigenically less complex. Using this system, we deleted the essential uracil-DNA-glycosylase (udg gene from MVA and propagated this otherwise replication-defective variant on a complementing cell line that constitutively expresses the poxvirus udg gene and that was derived from a newly identified continuous cell line that is permissive for growth of wild type MVA. The resulting virus, MVADeltaudg, does not replicate its DNA genome or express late viral gene products during infection of non-complementing cells in culture. As proof-of-concept for immunological 'focusing', we demonstrate that immunization of mice with MVADeltaudg elicits CD8+ T cell responses that are directed against a restricted repertoire of vector antigens, as compared to immunization with parental MVA. Immunization of rhesus macaques with MVADeltaudg-gag, a udg(- recombinant virus that expresses an HIV subtype-B consensus gag transgene, elicited significantly higher frequencies of Gag-specific CD8 and CD4 T cells following both primary (2-4-fold and booster (2-fold

  9. RNAi Screening Reveals Proteasome- and Cullin3-Dependent Stages in Vaccinia Virus Infection

    Directory of Open Access Journals (Sweden)

    Jason Mercer

    2012-10-01

    Full Text Available A two-step, automated, high-throughput RNAi silencing screen was used to identify host cell factors required during vaccinia virus infection. Validation and analysis of clustered hits revealed previously unknown processes during virus entry, including a mechanism for genome uncoating. Viral core proteins were found to be already ubiquitinated during virus assembly. After entering the cytosol of an uninfected cell, the viral DNA was released from the core through the activity of the cell’s proteasomes. Next, a Cullin3-based ubiquitin ligase mediated a further round of ubiquitination and proteasome action. This was needed in order to initiate viral DNA replication. The results accentuate the value of large-scale RNAi screens in providing directions for detailed cell biological investigation of complex pathways. The list of cell functions required during poxvirus infection will, moreover, provide a resource for future virus-host cell interaction studies and for the discovery of antivirals.

  10. High seismic attenuation at a mid-ocean ridge reveals the distribution of deep melt.

    Science.gov (United States)

    Eilon, Zachary C; Abers, Geoffrey A

    2017-05-01

    At most mid-ocean ridges, a wide region of decompression melting must be reconciled with a narrow neovolcanic zone and the establishment of full oceanic crustal thickness close to the rift axis. Two competing paradigms have been proposed to explain melt focusing: narrow mantle upwelling due to dynamic effects related to in situ melt or wide mantle upwelling with lateral melt transport in inclined channels. Measurements of seismic attenuation provide a tool for identifying and characterizing the presence of melt and thermal heterogeneity in the upper mantle. We use a unique data set of teleseismic body waves recorded on the Cascadia Initiative's Amphibious Array to simultaneously measure seismic attenuation and velocity across an entire oceanic microplate. We observe maximal differential attenuation and the largest delays ([Formula: see text] s and δTS ~ 2 s) in a narrow zone seismic quality factor (Qs ≤ 25) is among the lowest observed worldwide. Models harnessing experimentally derived anelastic scaling relationships require a 150-km-deep subridge region containing up to 2% in situ melt. The low viscosity and low density associated with this deep, narrow melt column provide the conditions for dynamic mantle upwelling, explaining a suite of geophysical observations at ridges, including electrical conductivity and shear velocity anomalies.

  11. Comparative Proteomic Profiling of Ehrlichia ruminantium Pathogenic Strain and Its High-Passaged Attenuated Strain Reveals Virulence and Attenuation-Associated Proteins.

    Directory of Open Access Journals (Sweden)

    Isabel Marcelino

    Full Text Available The obligate intracellular bacterium Ehrlichia ruminantium (ER causes heartwater, a fatal tick-borne disease in livestock. In the field, ER strains present different levels of virulence, limiting vaccine efficacy, for which the molecular basis remains unknown. Moreover, there are no genetic tools currently available for ER manipulation, thus limiting the knowledge of the genes/proteins that are essential for ER pathogenesis and biology. As such, to identify proteins and/or mechanisms involved in ER virulence, we performed the first exhaustive comparative proteomic analysis between a virulent strain (ERGvir and its high-passaged attenuated strain (ERGatt. Despite their different behaviors in vivo and in vitro, our results from 1DE-nanoLC-MS/MS showed that ERGvir and ERGatt share 80% of their proteins; this core proteome includes chaperones, proteins involved in metabolism, protein-DNA-RNA biosynthesis and processing, and bacterial effectors. Conventional 2DE revealed that 85% of the identified proteins are proteoforms, suggesting that post-translational modifications (namely glycosylation are important in ER biology. Strain-specific proteins were also identified: while ERGatt has an increased number and overexpression of proteins involved in cell division, metabolism, transport and protein processing, ERGvir shows an overexpression of proteins and proteoforms (DIGE experiments involved in pathogenesis such as Lpd, AnkA, VirB9 and B10, providing molecular evidence for its increased virulence in vivo and in vitro. Overall, our work reveals that ERGvir and ERGatt proteomes are streamlined to fulfill their biological function (maximum virulence for ERGvir and replicative capacity for ERGatt, and we provide both pioneering data and novel insights into the pathogenesis of this obligate intracellular bacterium.

  12. Comparative Proteomic Profiling of Ehrlichia ruminantium Pathogenic Strain and Its High-Passaged Attenuated Strain Reveals Virulence and Attenuation-Associated Proteins

    Science.gov (United States)

    Marcelino, Isabel; Ventosa, Miguel; Pires, Elisabete; Müller, Markus; Lisacek, Frédérique; Lefrançois, Thierry; Vachiery, Nathalie; Coelho, Ana Varela

    2015-01-01

    The obligate intracellular bacterium Ehrlichia ruminantium (ER) causes heartwater, a fatal tick-borne disease in livestock. In the field, ER strains present different levels of virulence, limiting vaccine efficacy, for which the molecular basis remains unknown. Moreover, there are no genetic tools currently available for ER manipulation, thus limiting the knowledge of the genes/proteins that are essential for ER pathogenesis and biology. As such, to identify proteins and/or mechanisms involved in ER virulence, we performed the first exhaustive comparative proteomic analysis between a virulent strain (ERGvir) and its high-passaged attenuated strain (ERGatt). Despite their different behaviors in vivo and in vitro, our results from 1DE-nanoLC-MS/MS showed that ERGvir and ERGatt share 80% of their proteins; this core proteome includes chaperones, proteins involved in metabolism, protein-DNA-RNA biosynthesis and processing, and bacterial effectors. Conventional 2DE revealed that 85% of the identified proteins are proteoforms, suggesting that post-translational modifications (namely glycosylation) are important in ER biology. Strain-specific proteins were also identified: while ERGatt has an increased number and overexpression of proteins involved in cell division, metabolism, transport and protein processing, ERGvir shows an overexpression of proteins and proteoforms (DIGE experiments) involved in pathogenesis such as Lpd, AnkA, VirB9 and B10, providing molecular evidence for its increased virulence in vivo and in vitro. Overall, our work reveals that ERGvir and ERGatt proteomes are streamlined to fulfill their biological function (maximum virulence for ERGvir and replicative capacity for ERGatt), and we provide both pioneering data and novel insights into the pathogenesis of this obligate intracellular bacterium. PMID:26691135

  13. The novel capripoxvirus vector lumpy skin disease virus efficiently boosts modified vaccinia Ankara human immunodeficiency virus responses in rhesus macaques.

    Science.gov (United States)

    Burgers, Wendy A; Ginbot, Zekarias; Shen, Yen-Ju; Chege, Gerald K; Soares, Andreia P; Müller, Tracey L; Bunjun, Rubina; Kiravu, Agano; Munyanduki, Henry; Douglass, Nicola; Williamson, Anna-Lise

    2014-10-01

    Poxvirus vectors represent promising human immunodeficiency virus (HIV) vaccine candidates and were a component of the only successful HIV vaccine efficacy trial to date. We tested the immunogenicity of a novel recombinant capripoxvirus vector, lumpy skin disease virus (LSDV), in combination with modified vaccinia Ankara (MVA), both expressing genes from HIV-1. Here, we demonstrated that the combination regimen was immunogenic in rhesus macaques, inducing high-magnitude, broad and balanced CD4(+) and CD8(+) T-cell responses, and transient activation of the immune response. These studies support further development of LSDV as a vaccine vector. © 2014 The Authors.

  14. Deletion ofF4L(ribonucleotide reductase) in vaccinia virus produces a selective oncolytic virus and promotes anti-tumor immunity with superior safety in bladder cancer models.

    Science.gov (United States)

    Potts, Kyle G; Irwin, Chad R; Favis, Nicole A; Pink, Desmond B; Vincent, Krista M; Lewis, John D; Moore, Ronald B; Hitt, Mary M; Evans, David H

    2017-05-01

    Bladder cancer has a recurrence rate of up to 80% and many patients require multiple treatments that often fail, eventually leading to disease progression. In particular, standard of care for high-grade disease, Bacillus Calmette-Guérin (BCG), fails in 30% of patients. We have generated a novel oncolytic vaccinia virus (VACV) by mutating the F4L gene that encodes the virus homolog of the cell-cycle-regulated small subunit of ribonucleotide reductase (RRM2). The F4L -deleted VACVs are highly attenuated in normal tissues, and since cancer cells commonly express elevated RRM2 levels, have tumor-selective replication and cell killing. These F4L -deleted VACVs replicated selectively in immune-competent rat AY-27 and xenografted human RT112-luc orthotopic bladder cancer models, causing significant tumor regression or complete ablation with no toxicity. It was also observed that rats cured of AY-27 tumors by VACV treatment developed anti-tumor immunity as evidenced by tumor rejection upon challenge and by ex vivo cytotoxic T-lymphocyte assays. Finally, F4L -deleted VACVs replicated in primary human bladder cancer explants. Our findings demonstrate the enhanced safety and selectivity of F4L -deleted VACVs, with application as a promising therapy for patients with BCG-refractory cancers and immune dysregulation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  15. Vaccinia virus G8R protein: a structural ortholog of proliferating cell nuclear antigen (PCNA.

    Directory of Open Access Journals (Sweden)

    Melissa Da Silva

    Full Text Available BACKGROUND: Eukaryotic DNA replication involves the synthesis of both a DNA leading and lagging strand, the latter requiring several additional proteins including flap endonuclease (FEN-1 and proliferating cell nuclear antigen (PCNA in order to remove RNA primers used in the synthesis of Okazaki fragments. Poxviruses are complex viruses (dsDNA genomes that infect eukaryotes, but surprisingly little is known about the process of DNA replication. Given our previous results that the vaccinia virus (VACV G5R protein may be structurally similar to a FEN-1-like protein and a recent finding that poxviruses encode a primase function, we undertook a series of in silico analyses to identify whether VACV also encodes a PCNA-like protein. RESULTS: An InterProScan of all VACV proteins using the JIPS software package was used to identify any PCNA-like proteins. The VACV G8R protein was identified as the only vaccinia protein that contained a PCNA-like sliding clamp motif. The VACV G8R protein plays a role in poxvirus late transcription and is known to interact with several other poxvirus proteins including itself. The secondary and tertiary structure of the VACV G8R protein was predicted and compared to the secondary and tertiary structure of both human and yeast PCNA proteins, and a high degree of similarity between all three proteins was noted. CONCLUSIONS: The structure of the VACV G8R protein is predicted to closely resemble the eukaryotic PCNA protein; it possesses several other features including a conserved ubiquitylation and SUMOylation site that suggest that, like its counterpart in T4 bacteriophage (gp45, it may function as a sliding clamp ushering transcription factors to RNA polymerase during late transcription.

  16. Monitoring imaging of lesions induced by high intensity focused ultrasound based on differential ultrasonic attenuation and integrated backscatter estimation.

    Science.gov (United States)

    Zhong, Hui; Wan, Ming-Xi; Jiang, Yi-Feng; Wang, Su-Pin

    2007-01-01

    We investigated the feasibility of two monitoring imaging methods to visualize and evaluate the high intensity focused ultrasound (HIFU) induced lesions in vitro during and after their formation, which were based on differential ultrasonic parameter estimation. Firstly, ultrasonic attenuation slope of tissue sample was estimated based on the spectral analysis of ultrasound RF backscattered signals. The differential attenuation slope maps were acquired, which were interpreted as the differences between the pretreatment image and those obtained in different stages during HIFU therapy. Secondly, ultrasonic integrated backscatter (IBS), defined as the frequency average of the backscatter transfer function over the useful bandwidth, was proposed quantitatively to evaluate the extent of lesions with the same RF signals as the first method. Differential IBS maps were also acquired to visualize temporal evolution of lesion formation. It was found in pig liver in vitro that more precise definition of the treated area was obtained from the differential IBS images than from differential attenuation slope images. Dramatic increase in both attenuation and IBS value was observed during the therapy, which may be related to dramatic enhancement of cavitation due to boiling and accompanying tissue damage. Two methods to obtain one differential image were compared and the cumulative differential image was found to be able to eliminate noises and artifacts to some extent, which was the cumulation of a series of differential images acquired from the differences between the temporally adjacent RF data frames. Moreover, we presented a bidirectional color code for identification of the artifacts due to tissue movements caused by HIFU radiation force. We conclude that cumulative differential IBS images have the potential to monitor the formation of HIFU-induced lesions.

  17. High-intensity interval exercise attenuates but does not eliminate endothelial dysfunction after a fast food meal.

    Science.gov (United States)

    Tucker, Wesley J; Sawyer, Brandon J; Jarrett, Catherine L; Bhammar, Dharini M; Ryder, Justin R; Angadi, Siddhartha S; Gaesser, Glenn A

    2018-02-01

    We investigated whether two different bouts of high-intensity interval exercise (HIIE) could attenuate postprandial endothelial dysfunction. Thirteen young (27 ± 1 yr), nonexercise-trained men underwent three randomized conditions: 1) four 4-min intervals at 85-95% of maximum heart rate separated by 3 min of active recovery (HIIE 4 × 4), 2) 16 1-min intervals at 85-95% of maximum heart rate separated by 1 min of active recovery (HIIE 16 × 1), and 3) sedentary control. HIIE was performed in the afternoon, ~18 h before the morning fast food meal (1,250 kcal, 63g of fat). Brachial artery flow-mediated dilation (FMD) was performed before HIIE ( baseline 1), during fasting before meal ingestion ( baseline 2), and 30 min, 2 h, and 4 h postprandial. Capillary glucose and triglycerides were assessed at fasting, 30 min, 1 h, 2 h, and 4 h (triglycerides only). Both HIIE protocols increased fasting FMD compared with control (HIIE 4 × 4: 6.1 ± 0.4%, HIIE 16 × 1: 6.3 ± 0.5%, and control: 5.1 ± 0.4%, P fast food meal can attenuate but not entirely eliminate postprandial decreases in FMD. This effect is not dependent on reductions in postprandial lipemia or glycemia. NEW & NOTEWORTHY Two similar high-intensity interval exercise (HIIE) protocols performed ∼18 h before ingestion of a high-energy fast food meal attenuated but did not entirely eliminate postprandial endothelial dysfunction in young men largely by improving fasting endothelial function. Both HIIE protocols produced essentially identical results, suggesting high reproducibility of HIIE effects.

  18. Myricitrin Attenuates High Glucose-Induced Apoptosis through Activating Akt-Nrf2 Signaling in H9c2 Cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Bin Zhang

    2016-07-01

    Full Text Available Hyperglycemia, as well as diabetes mellitus, has been shown to trigger cardiac cell apoptosis. We have previously demonstrated that myricitrin prevents endothelial cell apoptosis. However, whether myricitrin can attenuate H9c2 cell apoptosis remains unknown. In this study, we established an experiment model in H9c2 cells exposed to high glucose. We tested the hypothesis that myricitrin may inhibit high glucose (HG-induced cardiac cell apoptosis as determined by TUNEL staining. Furthermore, myricitrin promoted antioxidative enzyme production, suppressed high glucose-induced reactive oxygen species (ROS production and decreased mitochondrial membrane potential (MMP in H9c2 cells. This agent significantly inhibited apoptotic protein expression, activated Akt and facilitated the transcription of NF-E2-related factor 2 (Nrf2-mediated protein (heme oxygenase-1 (HO-1 and quinone oxidoreductase 1 (NQO-1 expression as determined by Western blotting. Significantly, an Akt inhibitor (LY294002 or HO-1 inhibitor (ZnPP not only inhibited myricitrin-induced HO-1/NQO-1 upregulation but also alleviated its anti-apoptotic effects. In summary, these observations demonstrate that myricitrin activates Nrf2-mediated anti-oxidant signaling and attenuates H9c2 cell apoptosis induced by high glucose via activation of Akt signaling.

  19. Is it possible to infer the frequency-dependent seismic attenuation of fractured materials from high-strain creep tests?

    Science.gov (United States)

    mallet, celine; quintal, beatriz; caspari, eva; holliger, klaus

    2016-04-01

    The seismic and hydraulic characterization of fractured rocks is an important objective for reservoir development in general and the production of geothermal energy in particular. The attenuation of seismic waves in saturated fractured media is governed by local displacements of the fluid relative to the solid induced by the compressions and extensions associated with the passing wavefield. This phenomenon is generally referred to as wave-induced fluid flow (WIFF). Recent evidence suggests that this energy dissipation mechanism is sensitive to the interconnectivity of the fractures, which offers the perspective of linking seismic observations to the hydraulic properties of fractured rocks. Here, we consider the results of laboratory experiments, which are referred to as creep tests. Such tests consist of applying a constant stress to a water-saturated thermally cracked glass sample and recording the resulting strain response as a function of time. The primary advantages of the considered material are (i) that the fracture network is well documented and (ii) that the homogeneous and non-porous glass matrix limits WIFF to the fracture network. Due to the high stress levels as well as other technical issues, creep tests are not commonly used for laboratory-based measurements of energy dissipation. Therefore, an objective of this study is to explore whether and to what extent such data can be interpreted in terms of the seismic attenuation characteristics of the probed samples, as this might open access to a vast reservoir of corresponding data, notably for cracked materials. Transforming the observed time-dependent stress-strain relation into the Fourier domain, allows us to infer the corresponding frequency-dependent attenuation characteristics, which we then seek to interpret through numerical simulations based on Biot's quasi-static poroelastic equations. The 2D geometry of the fracture network considered in these simulations is derived from a scanning electron

  20. Composite media mixing Bragg and local resonances for highly attenuating and broad bandgaps.

    Science.gov (United States)

    Kaina, Nadège; Fink, Mathias; Lerosey, Geoffroy

    2013-11-19

    In this article, we investigate composite media which present both a local resonance and a periodic structure. We numerically and experimentally consider the case of a very academic and simplified system that is a quasi-one dimensional split ring resonator medium. We modify its periodicity to shift the position of the Bragg bandgap relative to the local resonance one. We observe that for a well-chosen lattice constant, the local resonance frequency matches the Bragg frequency thus opening a single bandgap which is at the same time very wide and strongly attenuating. We explain this interesting phenomenon by the dispersive nature of the unit cell of the medium, using an analogy with the concept of white light cavities. Our results provide new ways to design wide and efficient bandgap materials.

  1. Natural attenuation process via microbial oxidation of arsenic in a high Andean watershed.

    Science.gov (United States)

    Leiva, Eduardo D; Rámila, Consuelo d P; Vargas, Ignacio T; Escauriaza, Cristian R; Bonilla, Carlos A; Pizarro, Gonzalo E; Regan, John M; Pasten, Pablo A

    2014-01-01

    Rivers in northern Chile have arsenic (As) concentrations at levels that are toxic for humans and other organisms. Microorganism-mediated redox reactions have a crucial role in the As cycle; the microbial oxidation of As (As(III) to As(V)) is a critical transformation because it favors the immobilization of As in the solid phase. We studied the role of microbial As oxidation for controlling the mobility of As in the extreme environment found in the Chilean Altiplano (i.e., > 4000 meters above sea level (masl) and Azufre River sub-basin, where the natural attenuation of As from hydrothermal discharge (pH 4-6) was observed. As(III) was actively oxidized by a microbial consortium, leading to a significant decrease in the dissolved As concentrations and a corresponding increase in the sediment's As concentration downstream of the hydrothermal source. In-situ oxidation experiments demonstrated that the As oxidation required biological activity, and microbiological molecular analysis confirmed the presence of As(III)-oxidizing groups (aroA-like genes) in the system. In addition, the pH measurements and solid phase analysis strongly suggested that the As removal mechanism involved adsorption or coprecipitation with Fe-oxyhydroxides. Taken together, these results indicate that the microorganism-mediated As oxidation contributed to the attenuation of As concentrations and the stabilization of As in the solid phase, therefore controlling the amount of As transported downstream. This study is the first to demonstrate the microbial oxidation of As in Altiplano basins and its relevance in the immobilization of As. © 2013.

  2. The mechanisms of genetically modified vaccinia viruses for the treatment of cancer.

    Science.gov (United States)

    Jefferson, Artrish; Cadet, Valerie E; Hielscher, Abigail

    2015-09-01

    The use of oncolytic viruses for the treatment of cancer is an emerging field of cancer research and therapy. Oncolytic viruses are designed to induce tumor specific immunity while replicating selectively within cancer cells to cause lysis of the tumor cells. While there are several forms of oncolytic viruses, the use of vaccinia viruses for oncolysis may be more beneficial than other forms of oncolytic viruses. For example, vaccinia viruses have been shown to exert their anti-tumor effects through genetic engineering strategies which enhance their therapeutic efficacy. This paper will address some of the most common forms of genetically modified vaccinia viruses and will explore the mechanisms whereby they selectively target, enter and destroy cancer cells. Furthermore, this review will highlight how vaccinia viruses activate host immune responses against cancer cells and will address clinical trials evaluating the tumor-directed and killing efficacy of these viruses against solid tumors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Vaccinia virus outperforms a panel of other poxviruses as a potent oncolytic agent for the control of head and neck squamous cell carcinoma cell lines.

    Science.gov (United States)

    Nichols, Anthony C; Yoo, John; Um, Sung; Mundi, Neil; Palma, David A; Fung, Kevin; Macneil, S Danielle; Koropatnick, James; Mymryk, Joe S; Barrett, John W

    2014-01-01

    Head and neck squamous cell carcinoma (HNSCC) is the fifth most common cancer worldwide. Existing therapies for advanced tumors have high failure rates and can have severe consequences in terms of pain, disfigurement, and poor speech and swallowing function. New treatment strategies are needed to improve outcomes for patients suffering with this disease and oncolytic viruses represent a promising approach. We infected six well-characterized HNSCC cell lines (Cal27, Detroit562, FaDu, SCC4, SCC15, SCC25), with increasing doses of a panel of poxviruses (including myxoma, vaccinia, raccoonpox and tanapox viruses) modified to express green fluorescence protein to determine which virus was the most effective oncolytic agent in cell-based assays. While myxoma, raccoonpox and tanapox displayed differing efficacy in the panel of cell lines, vaccinia virus was the most potent of the tested poxviruses and was highly effective in controlling cell growth in all cell lines. Oncolytic poxviruses, particularly vaccinia virus, were effective in killing HNSCC in vitro and hold promise as potential treatments for patients with HNSCC. Copyright © 2013 S. Karger AG, Basel.

  4. Immune Modulation in Primary Vaccinia virus Zoonotic Human Infections

    Directory of Open Access Journals (Sweden)

    Juliana Assis Silva Gomes

    2012-01-01

    Full Text Available In 2010, the WHO celebrated the 30th anniversary of the smallpox eradication. Ironically, infections caused by viruses related to smallpox are being increasingly reported worldwide, including Monkeypox, Cowpox, and Vaccinia virus (VACV. Little is known about the human immunological responses elicited during acute infections caused by orthopoxviruses. We have followed VACV zoonotic outbreaks taking place in Brazil and analyzed cellular immune responses in patients acutely infected by VACV. Results indicated that these patients show a biased immune modulation when compared to noninfected controls. Amounts of B cells are low and less activated in infected patients. Although present, T CD4+ cells are also less activated when compared to noninfected individuals, and so are monocytes/macrophages. Similar results were obtained when Balb/C mice were experimentally infected with a VACV sample isolated during the zoonotic outbreaks. Taking together, the data suggest that zoonotic VACVs modulate specific immune cell compartments during an acute infection in humans.

  5. An OTA-C filter for ECG acquisition systems with highly linear range and less passband attenuation

    Science.gov (United States)

    Jihai, Duan; Chuang, Lan; Weilin, Xu; Baolin, Wei

    2015-05-01

    A fifth order operational transconductance amplifier-C (OTA-C) Butterworth type low-pass filter with highly linear range and less passband attenuation is presented for wearable bio-telemetry monitoring applications in a UWB wireless body area network. The source degeneration structure applied in typical small transconductance circuit is improved to provide a highly linear range for the OTA-C filter. Moreover, to reduce the passband attenuation of the filter, a cascode structure is employed as the output stage of the OTA. The OTA-based circuit is operated in weak inversion due to strict power limitation in the biomedical chip. The filter is fabricated in a SMIC 0.18-μm CMOS process. The measured results for the filter have shown a passband gain of -6.2 dB, while the -3-dB frequency is around 276 Hz. For the 0.8 VPP sinusoidal input at 100 Hz, a total harmonic distortion (THD) of -56.8 dB is obtained. An electrocardiogram signal with noise interference is fed into this chip to validate the function of the designed filter. Project supported by the National Natural Science Foundation of China (Nos. 61161003, 61264001, 61166004) and the Guangxi Natural Science Foundation (No. 2013GXNSFAA019333).

  6. Measurements of attenuation coefficient for evaluating the hardness of a cataract lens by a high-frequency ultrasonic needle transducer

    Science.gov (United States)

    Chen, Ruimin; Tsui, Po-Hsiang; Zhou, Qifa; Humayun, Mark S; Shung, K Kirk

    2010-01-01

    A cataract is a clouding of the lens in the eye that affects vision. Phacoemulsification is the mostly common surgical method for treating cataracts, and determining that the optimal phacoemulsification energy is dependent on measuring the hardness of the lens. This study explored the use of an ultrasound needle transducer for invasive measurements of ultrasound attenuation coefficient to evaluate the hardness of the cataract lens. A 47 MHz high-frequency needle transducer with a diameter of 0.9 mm was fabricated by a polarized PMN-33%PT single crystal in the present study. The attenuation coefficients at different stages of an artificial porcine cataract lens were measured using the spectral shift approach. The hardness of the cataract lens was also evaluated by mechanical measurement of its elastic properties. The results demonstrated that the ultrasonic attenuation coefficient was increased from 0.048 ± 0.02 to 0.520 ± 0.06 dB mm−1 MHz−1 corresponding to an increase in Young’s modulus from 6 ± 0.4 to 96 ± 6.2 kPa as the cataract further developed. In order to evaluate the feasibility of combining needle transducer and phacoemulsification probe for real-time measurement during cataract surgery, the needle transducer was mounted on the phacoemulsification probe for a vibration test. The results indicated that there was no apparent damage to the tip of the needle transducer and the pulse–echo test showed that a good performance in sensitivity was maintained after the vibration test. PMID:19759408

  7. Attenuation of high sucrose diet-induced insulin resistance in ABC transporter deficient white mutant of Drosophila melanogaster.

    Science.gov (United States)

    Navrotskaya, Valeriya; Oxenkrug, Gregory; Vorobyova, Lyudmila; Summergrad, Paul

    2016-03-01

    Exposure to high sugar diet (HSD) is an experimental model of insulin resistance (IR) and type 2 diabetes (T2D) in mammals and insects. In Drosophila, HSD-induced IR delays emergence of pupae from larvae and eclosion of imago from pupae. Understanding of mechanisms of IR/T2D is essential for refining T2D prevention and treatment strategies. Dysregulation of tryptophan (Trp)-kynurenine (Kyn) pathway was suggested as one of the mechanisms of IR/T2D development. Rate-limiting enzyme of Trp-Kyn pathway in Drosophila is Trp 2,3-dioxygenase (TDO), an evolutionary conserved ortholog of human TDO. We previously reported attenuation of HSD-induced IR in vermilion mutants with inactive TDO. Conversion of Trp to Kyn is regulated not only by TDO activity but by intracellular Trp transport via ATP-binding cassette (ABC) transporter encoded by white gene in Drosophila. In order to evaluate the possible impact of deficient intracellular Trp transport on the inducement of IR by HSD, we compared the effect of HSD on pre-imago development in wild type flies, Canton-Special (C-S), and C-S flies containing white gene, white (C-S). Presence of white gene attenuated (by 50%) HSD-induced delay of pupae emergence from larvae and female and male imago eclosion from pupae. Present study together with our earlier report reveals that both decreased TDO activity (due to vermilion gene mutation) or deficient Trp transport into cell without affecting TDO levels (due to white gene mutation) attenuate HSD-induced development of IR in Drosophila model of T2D. Our data provide further support for hypothesis that dysregulation of Trp-Kyn pathway is one of the pathophysiological mechanisms and potential target for early diagnosis, prevention and treatment of IR/T2D.

  8. Measurements of attenuation coefficient for evaluating the hardness of a cataract lens by a high-frequency ultrasonic needle transducer

    Energy Technology Data Exchange (ETDEWEB)

    Huang, C.-C. [Department of Electronic Engineering, Fu Jen Catholic University, Taipei 24205, Taiwan (China); Chen Ruimin; Zhou Qifa; Shung, K Kirk [NIH Resource on Medical Ultrasonic Transducer Technology, Department of Biomedical Engineering, University of Southern California, Los Angeles, CA 90089 (United States); Tsui, P.-H. [Division of Mechanics, Research Center for Applied Sciences, Academia Sinica, Taipei 11529, Taiwan (China); Humayun, Mark S [Doheny Retina Institute, Doheny Eye Institute, Department of Ophthalmology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033 (United States)], E-mail: j648816n@ms23.hinet.net

    2009-10-07

    A cataract is a clouding of the lens in the eye that affects vision. Phacoemulsification is the mostly common surgical method for treating cataracts, and determining that the optimal phacoemulsification energy is dependent on measuring the hardness of the lens. This study explored the use of an ultrasound needle transducer for invasive measurements of ultrasound attenuation coefficient to evaluate the hardness of the cataract lens. A 47 MHz high-frequency needle transducer with a diameter of 0.9 mm was fabricated by a polarized PMN-33%PT single crystal in the present study. The attenuation coefficients at different stages of an artificial porcine cataract lens were measured using the spectral shift approach. The hardness of the cataract lens was also evaluated by mechanical measurement of its elastic properties. The results demonstrated that the ultrasonic attenuation coefficient was increased from 0.048 {+-} 0.02 to 0.520 {+-} 0.06 dB mm{sup -1} MHz{sup -1} corresponding to an increase in Young's modulus from 6 {+-} 0.4 to 96 {+-} 6.2 kPa as the cataract further developed. In order to evaluate the feasibility of combining needle transducer and phacoemulsification probe for real-time measurement during cataract surgery, the needle transducer was mounted on the phacoemulsification probe for a vibration test. The results indicated that there was no apparent damage to the tip of the needle transducer and the pulse-echo test showed that a good performance in sensitivity was maintained after the vibration test.

  9. A cancer-favoring oncolytic vaccinia virus shows enhanced suppression of stem-cell like colon cancer.

    Science.gov (United States)

    Yoo, So Young; Bang, Seo Young; Jeong, Su-Nam; Kang, Dae Hwan; Heo, Jeong

    2016-03-29

    Stem cell-like colon cancer cells (SCCs) pose a major challenge in colon cancer treatment because of their resistance to chemotherapy and radiotherapy. Oncolytic virus-based therapy has shown promising results in uncured cancer patients; however, its effects on SCCs are not well studied yet. Here, we engineered a cancer-favoring oncolytic vaccinia virus (CVV) as a potent biotherapeutic and investigated its therapeutic efficacy in terms of killing SCCs. CVV is an evolved Wyeth strain vaccinia virus (EVV) lacking the viral thymidine kinase. SCC models were established using human or mouse colon cancer spheres, which continuously expressed stemness markers. The cancer-favoring characteristics and different cytotoxic pathways for killing cancer cells successfully overrode general drug resistance, thereby killing colon cancer cells regardless of the presence of SCCs. Subcutaneously injected HT29 spheres showed lower growth in CVV-treated models than in 5-Fu-treated models. Intraperitoneally injected CT26 spheres induced tumor masses in the abdominal region. CVV-treated groups showed higher survival rates and smaller tumor mass formation, compared to 5-Fu-treated groups. Interestingly, the combined treatment of CVV with 5-Fu showed improved survival rates and complete suppression of tumor mass. The CVV developed in this study, thus, effectively suppresses SCCs, which can be synergistically enhanced by simultaneous treatment with the anticancer drug 5-Fu. Our novel CVV is highly advantageous as a next-generation therapeutic for treating colon cancer.

  10. Host-range restriction of vaccinia virus E3L deletion mutant can be overcome in vitro, but not in vivo, by expression of the influenza virus NS1 protein.

    Directory of Open Access Journals (Sweden)

    Susana Guerra

    Full Text Available During the last decades, research focused on vaccinia virus (VACV pathogenesis has been intensified prompted by its potential beneficial application as a vector for vaccine development and anti-cancer therapies, but also due to the fear of its potential use as a bio-terrorism threat. Recombinant viruses lacking a type I interferon (IFN antagonist are attenuated and hence good vaccine candidates. However, vaccine virus growth requires production in IFN-deficient systems, and thus viral IFN antagonists that are active in vitro, yet not in vivo, are of great value. The VACV E3 and influenza virus NS1 proteins are distinct double-stranded RNA-binding proteins that play an important role in pathogenesis by inhibiting the mammalian IFN-regulated innate antiviral response. Based on the functional similarities between E3 and NS1, we investigated the ability of NS1 to replace the biological functions of E3 of VACV in both in vitro and in vivo systems. For this, we generated a VACV recombinant virus lacking the E3L gene, yet expressing NS1 (VVΔE3L/NS1. Our study revealed that NS1 can functionally replace E3 in cultured cells, rescuing the protein synthesis blockade, and preventing apoptosis and RNA breakdown. In contrast, in vivo the VVΔE3L/NS1 virus was highly attenuated after intranasal inoculation, as it was unable to spread to the lungs and other organs. These results indicate that there are commonalities but also functional differences in the roles of NS1 and E3 as inhibitors of the innate antiviral response, which could potentially be utilized for vaccine production purposes in the future.

  11. Palmitoleic Acid (N-7 Attenuates the Immunometabolic Disturbances Caused by a High-Fat Diet Independently of PPARα

    Directory of Open Access Journals (Sweden)

    Camila O. Souza

    2014-01-01

    Full Text Available Palmitoleic acid (PMA has anti-inflammatory and antidiabetic activities. Here we tested whether these effects of PMA on glucose homeostasis and liver inflammation, in mice fed with high-fat diet (HFD, are PPAR-α dependent. C57BL6 wild-type (WT and PPAR-α-knockout (KO mice fed with a standard diet (SD or HFD for 12 weeks were treated after the 10th week with oleic acid (OLA, 300 mg/kg of b.w. or PMA 300 mg/kg of b.w. Steatosis induced by HFD was associated with liver inflammation only in the KO mice, as shown by the increased hepatic levels of IL1-beta, IL-12, and TNF-α; however, the HFD increased the expression of TLR4 and decreased the expression of IL1-Ra in both genotypes. Treatment with palmitoleate markedly attenuated the insulin resistance induced by the HFD, increased glucose uptake and incorporation into muscle in vitro, reduced the serum levels of AST in WT mice, decreased the hepatic levels of IL1-beta and IL-12 in KO mice, reduced the expression of TLR-4 and increased the expression of IL-1Ra in WT mice, and reduced the phosphorylation of NF B (p65 in the livers of KO mice. We conclude that palmitoleate attenuates diet-induced insulin resistance, liver inflammation, and damage through mechanisms that do not depend on PPAR-α.

  12. Metformin exerts glucose-lowering action in high-fat fed mice via attenuating endotoxemia and enhancing insulin signaling.

    Science.gov (United States)

    Zhou, Zi-Yu; Ren, Li-Wei; Zhan, Ping; Yang, Han-Yan; Chai, Dan-Dan; Yu, Zhi-Wen

    2016-08-01

    Accumulating evidence shows that lipopolysaccharides (LPS) derived from gut gram-negative bacteria can be absorbed, leading to endotoxemia that triggers systemic inflammation and insulin resistance. In this study we examined whether metformin attenuated endotoxemia, thus improving insulin signaling in high-fat diet fed mice. Mice were fed a high-fat diet for 18 weeks to induce insulin resistance. One group of the mice was treated with oral metformin (100 mg·kg(-1)·d(-1)) for 4 weeks. Another group was treated with LPS (50 μg·kg(-1)·d(-1), sc) for 5 days followed by the oral metformin for 10 d. Other two groups received a combination of antibiotics for 7 d or a combination of antibiotics for 7 d followed by the oral metformin for 4 weeks, respectively. Glucose metabolism and insulin signaling in liver and muscle were evaluated, the abundance of gut bacteria, gut permeability and serum LPS levels were measured. In high-fat fed mice, metformin restored the tight junction protein occludin-1 levels in gut, reversed the elevated gut permeability and serum LPS levels, and increased the abundance of beneficial bacteria Lactobacillus and Akkermansia muciniphila. Metformin also increased PKB Ser473 and AMPK T172 phosphorylation, decreased MDA contents and redox-sensitive PTEN protein levels, activated the anti-oxidative Nrf2 system, and increased IκBα in liver and muscle of the mice. Treatment with exogenous LPS abolished the beneficial effects of metformin on glucose metabolism, insulin signaling and oxidative stress in liver and muscle of the mice. Treatment with antibiotics alone produced similar effects as metformin did. Furthermore, the beneficial effects of antibiotics were addictive to those of metformin. Metformin administration attenuates endotoxemia and enhances insulin signaling in high-fat fed mice, which contributes to its anti-diabetic effects.

  13. Transforming growth factor alpha, Shope fibroma growth factor, and vaccinia growth factor can replace myxoma growth factor in the induction of myxomatosis in rabbits.

    Science.gov (United States)

    Opgenorth, A; Nation, N; Graham, K; McFadden, G

    1993-02-01

    The epidermal growth factor (EGF) homologues encoded by vaccinia virus, myxoma virus, and malignant rabbit fibroma virus have been shown to contribute to the pathogenicity of virus infection upon inoculation of susceptible hosts. However, since the primary structures of these growth factors and the disease profiles induced by different poxvirus genera vary substantially, the degree to which the various EGF homologues perform similar roles in viral pathogenesis remains unclear. In order to determine whether different EGF-like growth factors can perform qualitatively similar functions in the induction of myxomatosis in rabbits, we created recombinant myxoma virus variants in which the native growth factor, myxoma growth factor (MGF), was disrupted and replaced with either vaccinia virus growth factor, Shope fibroma growth factor, or rat transforming growth factor alpha. Unlike the control virus containing an inactivated MGF gene, which caused marked attenuation of the disease syndrome and substantially less proliferation of the epithelial cell layers in the conjunctiva and respiratory tract, the recombinant myxoma virus strains expressing heterologous growth factors produced infections which were both clinically and histopathologically indistinguishable from wild-type myxomatosis. We conclude that these poxviral and cellular EGF-like growth factors, which are diverse with respect to primary structure and origin, have similar biological functions in the context of myxoma virus pathogenesis and are mitogenic for the same target cells.

  14. Resistant starch and exercise independently attenuate weight regain on a high fat diet in a rat model of obesity

    Directory of Open Access Journals (Sweden)

    Johnson Ginger C

    2011-07-01

    Full Text Available Abstract Background Long-term weight reduction remains elusive for many obese individuals. Resistant starch (RS and exercise may be useful for weight maintenance. The effects of RS, with or without exercise, on weight regain was examined during relapse to obesity on a high carbohydrate, high fat (HC/HF diet. Methods Obesity-prone rats were fed ad libitum for 16 weeks then weight reduced on a low fat diet to induce a 17% body weight loss (weight reduced rats. Weight reduced rats were maintained on an energy-restricted low fat diet for 18 weeks, with or without a daily bout of treadmill exercise. Rats were then allowed free access to HC/HF diet containing low (0.3% or high (5.9% levels of RS. Weight regain, energy balance, body composition, adipocyte cellularity, and fuel utilization were monitored as rats relapsed to obesity and surpassed their original, obese weight. Results Both RS and exercise independently attenuated weight regain by reducing the energy gap between the drive to eat and suppressed energy requirements. Exercise attenuated the deposition of lean mass during relapse, whereas its combination with RS sustained lean mass accrual as body weight returned. Early in relapse, RS lowered insulin levels and reduced the deposition of fat in subcutaneous adipose tissue. Exercise cessation at five weeks of relapse led to increased weight gain, body fat, subcutaneous adipocytes, and decreased lean mass; all detrimental consequences to overall metabolic health. Conclusions These data are the first to show the complimentary effects of dietary RS and regular exercise in countering the metabolic drive to regain weight following weight loss and suggest that exercise cessation, in the context of relapse on a HC/HF diet, may have dire metabolic consequences.

  15. Seven days of high carbohydrate ingestion does not attenuate post-exercise IL-6 and hepcidin levels.

    Science.gov (United States)

    Badenhorst, Claire E; Dawson, Brian; Cox, Gregory R; Sim, Marc; Laarakkers, Coby M; Swinkels, Dorine W; Peeling, Peter

    2016-09-01

    This investigation examined if a high carbohydrate (CHO) diet, maintained across a seven-day training period, could attenuate post-exercise interleukin-6 (IL-6) and serum hepcidin levels. Twelve endurance-trained male athletes completed two seven-day running training blocks whilst consuming either a high (8 g kg(-1)) versus a low (3 g kg(-1)) CHO isoenergetic diet. Each training block consisted of five running sessions performed on days 1, 2, 4, 5, and 7, with the intensity and duration of each session matched between training weeks. Serum levels of Interleukin-6 (IL-6) and hepcidin were measured pre- and either immediately (IL-6) or 3-h (hepcidin) post-exercise on days 1 and 7 of each training week. During each training week, the immediate post-exercise IL-6 and 3-h post-exercise serum hepcidin levels were significantly elevated (both p = 0.001) from pre-exercise on days 1 and 7. These increases were not different between trials. These results suggest that the ingestion of a high (compared to low) CHO diet over a seven-day training period is ineffective in attenuating post-exercise IL-6 and hepcidin responses. Such results may be due to the modest training load, the increased protein intake in the low-CHO trial, and a 48 h recovery period prior to sample collection on day 7, allowing a full recovery of muscle glycogen status between exercise sessions.

  16. Consumption of both low and high (-)-epicatechin apple puree attenuates platelet reactivity and increases plasma concentrations of nitric oxide metabolites: a randomized controlled trial.

    Science.gov (United States)

    Gasper, Amy; Hollands, Wendy; Casgrain, Amelie; Saha, Shikha; Teucher, Birgit; Dainty, Jack R; Venema, Dini P; Hollman, Peter C; Rein, Maarit J; Nelson, Rebecca; Williamson, Gary; Kroon, Paul A

    2014-10-01

    We hypothesised that consumption of flavanol-containing apple puree would modulate platelet activity and increase nitric oxide metabolite status, and that high flavanol apple puree would exert a greater effect than low flavanol apple puree. 25 subjects consumed 230 g of apple puree containing 25 and 100mg epicatechin (low and high flavanol apple puree, respectively) and aspirin (75 mg) in random order. Measurements were made at baseline, acutely after treatment (2, 6 and 24 h), and after 14 d of treatment. Low flavanol apple puree significantly attenuated ADP and epinephrine-induced integrin-β3 expression 2 h and 6 h after consumption and ADP and epinephrine-induced P-selectin expression within 2h of consumption. High flavanol apple puree attenuated epinephrine and ADP-induced integrin-β3 expression after 2 and 6h. ADP and epinephrine-induced integrin-β3 expression was significantly attenuated 2, 6 and 24 h after consumption of aspirin, whilst 14 d aspirin consumption attenuated collagen-induced P-selectin expression only. The plasma total nitric oxide metabolite conc. was significantly increased 6h after consumption of both low and high flavanol apple purees. In conclusion, consumption of apple purees containing ⩾25 or 100 mg flavanols transiently attenuated ex vivo integrin-β3 and P-selectin expression and increased plasma nitric oxide metabolite conc. in healthy subjects, but the effect was not enhanced for the high flavanol apple puree. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Applicator Attenuation Effect on Dose Calculations of Esophageal High-Dose Rate Brachytherapy Using EDR2 Film

    Directory of Open Access Journals (Sweden)

    Seyed Mohsen Hosseini Daghigh

    2012-03-01

    Full Text Available Introduction Interaluminal brachytherapy is one of the important methods of esophageal cancer treatment. The effect of applicator attenuation is not considered in dose calculation method released by AAPM-TG43. In this study, the effect of High-Dose Rate (HDR brachytherapy esophageal applicator on dose distribution was surveyed in HDR brachytherapy. Materials and Methods A cylindrical PMMA phantom was built in order to be inserted by various sizes of esophageal applicators. EDR2 films were placed at 33 mm from Ir-192 source and irradiated with 1.5 Gy after planning using treatment planning system for all applicators. Results The results of film dosimetry in reference point for 6, 8, 10, and 20 mm applicators were 1.54, 1.53, 1.48, and 1.50 Gy, respectively. The difference between practical and treatment planning system results was 0.023 Gy (

  18. High Fat Diet Attenuates the Anticontractile Activity of Aortic PVAT via a Mechanism Involving AMPK and Reduced Adiponectin Secretion

    Directory of Open Access Journals (Sweden)

    Tarek A. M. Almabrouk

    2018-02-01

    Full Text Available Background and aim: Perivascular adipose tissue (PVAT positively regulates vascular function through production of factors such as adiponectin but this effect is attenuated in obesity. The enzyme AMP-activated protein kinase (AMPK is present in PVAT and is implicated in mediating the vascular effects of adiponectin. In this study, we investigated the effect of an obesogenic high fat diet (HFD on aortic PVAT and whether any changes involved AMPK.Methods: Wild type Sv129 (WT and AMPKα1 knockout (KO mice aged 8 weeks were fed normal diet (ND or HFD (42% kcal fat for 12 weeks. Adiponectin production by PVAT was assessed by ELISA and AMPK expression studied using immunoblotting. Macrophages in PVAT were identified using immunohistochemistry and markers of M1 and M2 macrophage subtypes evaluated using real time-qPCR. Vascular responses were measured in endothelium-denuded aortic rings with or without attached PVAT. Carotid wire injury was performed and PVAT inflammation studied 7 days later.Key results: Aortic PVAT from KO and WT mice was morphologically indistinct but KO PVAT had more infiltrating macrophages. HFD caused an increased infiltration of macrophages in WT mice with increased expression of the M1 macrophage markers Nos2 and Il1b and the M2 marker Chil3. In WT mice, HFD reduced the anticontractile effect of PVAT as well as reducing adiponectin secretion and AMPK phosphorylation. PVAT from KO mice on ND had significantly reduced adiponectin secretion and no anticontractile effect and feeding HFD did not alter this. Wire injury induced macrophage infiltration of PVAT but did not cause further infiltration in KO mice.Conclusions: High-fat diet causes an inflammatory infiltrate, reduced AMPK phosphorylation and attenuates the anticontractile effect of murine aortic PVAT. Mice lacking AMPKα1 phenocopy many of the changes in wild-type aortic PVAT after HFD, suggesting that AMPK may protect the vessel against deleterious changes in response to

  19. Monocyte chemotactic protein-1 deficiency attenuates and high-fat diet exacerbates bone loss in mice with Lewis lung carcinoma.

    Science.gov (United States)

    Yan, Lin; Nielsen, Forrest H; Sundaram, Sneha; Cao, Jay

    2017-04-04

    Bone loss occurs in obesity and cancer-associated complications including wasting. This study determined whether a high-fat diet and a deficiency in monocyte chemotactic protein-1 (MCP-1) altered bone structural defects in male C57BL/6 mice with Lewis lung carcinoma (LLC) metastases in lungs. Compared to non-tumor-bearing mice, LLC reduced bone volume fraction, connectivity density, trabecular number, trabecular thickness and bone mineral density and increased trabecular separation in femurs. Similar changes occurred in vertebrae. The high-fat diet compared to the AIN93G diet exacerbated LLC-induced detrimental structural changes; the exacerbation was greater in femurs than in vertebrae. Mice deficient in MCP-1 compared to wild-type mice exhibited increases in bone volume fraction, connectivity density, trabecular number and decreases in trabecular separation in both femurs and vertebrae, and increases in trabecular thickness and bone mineral density and a decrease in structure model index in vertebrae. Lewis lung carcinoma significantly decreased osteocalcin but increased tartrate-resistant acid phosphatase 5b (TRAP 5b) in plasma. In LLC-bearing mice, the high-fat diet increased and MCP-1 deficiency decreased plasma TRAP 5b; neither the high-fat diet nor MCP-1 deficiency resulted in significant changes in plasma concentration of osteocalcin. In conclusion, pulmonary metastasis of LLC is accompanied by detrimental bone structural changes; MCP-1 deficiency attenuates and high-fat diet exacerbates the metastasis-associated bone wasting.

  20. Carrot juice ingestion attenuates high fructose-induced circulatory pro-inflammatory mediators in weanling Wistar rats.

    Science.gov (United States)

    Mahesh, Malleswarapu; Bharathi, Munugala; Raja Gopal Reddy, Mooli; Pappu, Pranati; Putcha, Uday Kumar; Vajreswari, Ayyalasomayajula; Jeyakumar, Shanmugam M

    2017-03-01

    Adipose tissue, an endocrine organ, plays a vital role not only in energy homeostasis, but also in the development and/or progression of various metabolic diseases, such as insulin resistance, type 2 diabetes and non-alcoholic fatty liver disease (NAFLD), via several factors and mechanisms, including inflammation. This study tested, whether carrot juice administration affected the adipose tissue development and its inflammatory status in a high fructose diet-induced rat model. For this purpose, male weanling Wistar rats were divided into four groups and fed either control or high fructose diet of AIN-93G composition with or without carrot juice ingestion for an 8 week period. Administration of carrot juice did not affect the adiposity and cell size of visceral fat depot; retroperitoneal white adipose tissue (RPWAT), which was corroborated with unaltered expression of genes involved in adipogenic and lipogenic pathways. However, it significantly reduced the high fructose diet-induced elevation of plasma free fatty acid (FFA) (P ≤ 0.05), macrophage chemoattractant protein 1 (MCP1) (P ≤ 0.01) and high sensitive C-reactive protein (hsCRP) (P ≤ 0.05) levels. Carrot juice administration attenuated the high fructose diet-induced elevation of levels of circulatory FFA and pro-inflammatory mediators; MCP1 and hsCRP without affecting the adiposity and cell size of visceral fat depot; RPWAT. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. Methamphetamine treatment during development attenuates the dopaminergic deficits caused by subsequent high-dose methamphetamine administration

    OpenAIRE

    McFadden, Lisa M.; Hoonakker, Amanda J.; Vieira-Brock, Paula L.; Stout, Kristen A.; Sawada, Nicole M; Ellis, Jonathan D; Allen, Scott C.; Walters, Elliot T.; Nielsen, Shannon M.; Gibb, James W.; Alburges, Mario E.; Wilkins, Diana G.; Hanson, Glen R.; Fleckenstein, Annette E.

    2011-01-01

    Administration of high doses of methamphetamine (METH) causes persistent dopaminergic deficits in both nonhuman preclinical models and METH-dependent persons. Noteworthy, adolescent (i.e., postnatal day (PND) 40) rats are less susceptible to this damage than young adult (PND90) rats. In addition, biweekly treatment with METH, beginning at PND40 and continuing throughout development, prevents the persistent dopaminergic deficits caused by a “challenge” high-dose METH regimen when administered ...

  2. Deriving effective atomic numbers from DECT based on a parameterization of the ratio of high and low linear attenuation coefficients.

    Science.gov (United States)

    Landry, Guillaume; Seco, Joao; Gaudreault, Mathieu; Verhaegen, Frank

    2013-10-07

    Dual energy computed tomography (DECT) can provide simultaneous estimation of relative electron density ρe and effective atomic number Zeff. The ability to obtain these quantities (ρe, Zeff) has been shown to benefit selected radiotherapy applications where tissue characterization is required. The conventional analysis method (spectral method) relies on knowledge of the CT scanner photon spectra which may be difficult to obtain accurately. Furthermore an approximate empirical attenuation correction of the photon spectrum through the patient is necessary. We present an alternative approach based on a parameterization of the measured ratio of low and high kVp linear attenuation coefficients for deriving Zeff which does not require the estimation of the CT scanner spectra. In a first approach, the tissue substitute method (TSM), the Rutherford parameterization of the linear attenuation coefficients was employed to derive a relation between Zeff and the ratio of the linear attenuation coefficients measured at the low and high kVp of the CT scanner. A phantom containing 16 tissue mimicking inserts was scanned with a dual source DECT scanner at 80 and 140 kVp. The data from the 16 inserts phantom was used to obtain model parameters for the relation between Zeff and [Formula: see text]. The accuracy of the method was evaluated with a second phantom containing 4 tissue mimicking inserts. The TSM was compared to a more complex approach, the reference tissue method (RTM), which requires the derivation of stoichiometric fit parameters. These were derived from the 16 inserts phantom scans and used to calculate CT numbers at 80 and 140 kVp for a set of tabulated reference human tissues. Model parameters for the parameterization of [Formula: see text] were estimated for this reference tissue dataset and compared to the results of the TSM. Residuals on Zeff for the reference tissue dataset for both TSM and RTM were compared to those obtained from the spectral method. The

  3. High endogenous activated protein C levels attenuates bleomycin-induced pulmonary fibrosis.

    Science.gov (United States)

    Lin, Cong; von der Thüsen, Jan; Isermann, Berend; Weiler, Hartmut; van der Poll, Tom; Borensztajn, Keren; Spek, Chris A

    2016-11-01

    Coagulation activation accompanied by reduced anticoagulant activity is a key characteristic of patients with idiopathic pulmonary fibrosis (IPF). Although the importance of coagulation activation in IPF is well studied, the potential relevance of endogenous anticoagulant activity in IPF progression remains elusive. We assess the importance of the endogenous anticoagulant protein C pathway on disease progression during bleomycin-induced pulmonary fibrosis. Wild-type mice and mice with high endogenous activated protein C APC levels (APC high ) were subjected to bleomycin-induced pulmonary fibrosis. Fibrosis was assesses by hydroxyproline and histochemical analysis. Macrophage recruitment was assessed immunohistochemically. In vitro, macrophage migration was analysed by transwell migration assays. Fourteen days after bleomycin instillation, APC high mice developed pulmonary fibrosis to a similar degree as wild-type mice. Interestingly, Aschcroft scores as well as lung hydroxyproline levels were significantly lower in APC high mice than in wild-type mice on day 28. The reduction in fibrosis in APC high mice was accompanied by reduced macrophage numbers in their lungs and subsequent in vitro experiments showed that APC inhibits thrombin-dependent macrophage migration. Our data suggest that high endogenous APC levels inhibit the progression of bleomycin-induced pulmonary fibrosis and that APC modifies pulmonary fibrosis by limiting thrombin-dependent macrophage recruitment. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  4. Epitope mapping by random peptide phage display reveals essential residues for vaccinia extracellular enveloped virion spread

    Directory of Open Access Journals (Sweden)

    He Yong

    2012-09-01

    Full Text Available Abstract Background A33 is a type II integral membrane protein expressed on the extracellular enveloped form of vaccinia virus (VACV. Passive transfer of A33-directed monoclonal antibodies or vaccination with an A33 subunit vaccine confers protection against lethal poxvirus challenge in animal models. Homologs of A33 are highly conserved among members of the Orthopoxvirus genus and are potential candidates for inclusion in vaccines or assays targeting extracellular enveloped virus activity. One monoclonal antibody directed against VACV A33, MAb-1G10, has been shown to target a conformation-dependent epitope. Interestingly, while it recognizes VACV A33 as well as the corresponding variola homolog, it does not bind to the monkeypox homolog. In this study, we utilized a random phage display library to investigate the epitope recognized by MAb-1G10 that is critical for facilitating cell-to-cell spread of the vaccinia virus. Results By screening with linear or conformational random phage libraries, we found that phages binding to MAb-1G10 display the consensus motif CEPLC, with a disulfide bond formed between two cysteine residues required for MAb-1G10 binding. Although the phage motif contained no linear sequences homologous to VACV A33, structure modeling and analysis suggested that residue D115 is important to form the minimal epitope core. A panel of point mutants expressing the ectodomain of A33 protein was generated and analyzed by either binding assays such as ELISA and immunoprecipitation or a functional assessment by blocking MAb-1G10 mediated comet inhibition in cell culture. Conclusions These results confirm L118 as a component of the MAb-1G10 binding epitope, and further identify D115 as an essential residue. By defining the minimum conformational structure, as well as the conformational arrangement of a short peptide sequence recognized by MAb-1G10, these results introduce the possibility of designing small molecule mimetics that may

  5. Protective effect of Toll-like receptor 4 in pulmonary vaccinia infection.

    Directory of Open Access Journals (Sweden)

    Martha A Hutchens

    2008-09-01

    Full Text Available Innate immune responses are essential for controlling poxvirus infection. The threat of a bioterrorist attack using Variola major, the smallpox virus, or zoonotic transmission of other poxviruses has renewed interest in understanding interactions between these viruses and their hosts. We recently determined that TLR3 regulates a detrimental innate immune response that enhances replication, morbidity, and mortality in mice in response to vaccinia virus, a model pathogen for studies of poxviruses. To further investigate Toll-like receptor signaling in vaccinia infection, we first focused on TRIF, the only known adapter protein for TLR3. Unexpectedly, bioluminescence imaging showed that mice lacking TRIF are more susceptible to vaccinia infection than wild-type mice. We then focused on TLR4, the other Toll-like receptor that signals through TRIF. Following respiratory infection with vaccinia, mice lacking TLR4 signaling had greater viral replication, hypothermia, and mortality than control animals. The mechanism of TLR4-mediated protection was not due to increased release of proinflammatory cytokines or changes in total numbers of immune cells recruited to the lung. Challenge of primary bone marrow macrophages isolated from TLR4 mutant and control mice suggested that TLR4 recognizes a viral ligand rather than an endogenous ligand. These data establish that TLR4 mediates a protective innate immune response against vaccinia virus, which informs development of new vaccines and therapeutic agents targeted against poxviruses.

  6. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Meseda, Clement A. [Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Srinivasan, Kumar [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Wise, Jasen [Qiagen, Frederick, MD (United States); Catalano, Jennifer [Center for Tobacco Products, Food and Drug Administration, Bethesda, MD (United States); Yamada, Kenneth M. [National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)

    2014-11-07

    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection.

  7. CM156, a high affinity sigma ligand, attenuates the stimulant and neurotoxic effects of methamphetamine in mice.

    Science.gov (United States)

    Kaushal, Nidhi; Seminerio, Michael J; Shaikh, Jamaluddin; Medina, Mark A; Mesangeau, Christophe; Wilson, Lisa L; McCurdy, Christopher R; Matsumoto, Rae R

    2011-01-01

    Methamphetamine (METH) is a highly addictive psychostimulant drug of abuse. Low and high dose administration of METH leads to locomotor stimulation, and dopaminergic and serotonergic neurotoxicity, respectively. The behavioral stimulant and neurotoxic effects of METH can contribute to addiction and other neuropsychiatric disorders, thus necessitating the identification of potential pharmacotherapeutics against these effects produced by METH. METH binds to σ receptors at physiologically relevant concentrations. Also, σ receptors are present on and can modulate dopaminergic and serotonergic neurons. Therefore, σ receptors provide a viable target for the development of pharmacotherapeutics against the adverse effects of METH. In the present study, CM156, a σ receptor ligand with high affinity and selectivity for σ receptors over 80 other non-σ binding sites, was evaluated against METH-induced stimulant, hyperthermic, and neurotoxic effects. Pretreatment of male, Swiss Webster mice with CM156 dose dependently attenuated the locomotor stimulation, hyperthermia, striatal dopamine and serotonin depletions, and striatal dopamine and serotonin transporter reductions produced by METH, without significant effects of CM156 on its own. These results demonstrate the ability of a highly selective σ ligand to mitigate the effects of METH. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Inhibition of soluble epoxide hydrolase attenuates high-fat-diet-induced hepatic steatosis by reduced systemic inflammatory status in mice.

    Directory of Open Access Journals (Sweden)

    Yan Liu

    Full Text Available Non-alcoholic fatty liver disease is associated with obesity and considered an inflammatory disease. Soluble epoxide hydrolase (sEH is a major enzyme hydrolyzing epoxyeicosatrienoic acids and attenuates their cardiovascular protective and anti-inflammatory effects. We examined whether sEH inhibition can protect against high-fat (HF-diet-induced fatty liver in mice and the underlying mechanism. Compared with wild-type littermates, sEH-null mice showed lower diet-induced lipid accumulation in liver, as seen by Oil-red O staining and triglycerides levels. We studied the effect of sEH inhibition on diet-induced fatty liver by feeding C57BL/6 mice an HF diet for 8 weeks (short-term or 16 weeks (long-term and administering t-AUCB, a selective sEH inhibitor. sEH inhibition had no effect on the HF-diet-increased body and adipose tissue weight or impaired glucose tolerance but alleviated the diet-induced hepatic steatosis. Adenovirus-mediated overexpression of sEH in liver increased the level of triglycerides in liver and the hepatic inflammatory response. Surprisingly, the induced expression of sEH in liver occurred only with the long-term but not short-term HF diet, which suggests a secondary effect of HF diet on regulating sEH expression. Furthermore, sEH inhibition attenuated the HF-diet-induced increase in plasma levels of proinflammatory cytokines and their mRNA upregulation in adipose tissue, which was accompanied by increased macrophage infiltration. Therefore, sEH inhibition could alleviate HF-diet-induced hepatic steatosis, which might involve its anti-inflammatory effect in adipose tissue and direct inhibition in liver. sEH may be a therapeutic target for HF-diet-induced hepatic steatosis in inhibiting systemic inflammation.

  9. Assembly of vaccinia virus: Role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks

    NARCIS (Netherlands)

    Sodeik, B.; Doms, R.W.; Ericsson, M.; Hiller, G.; Machamer, C.E.; van 't Hof, W.J.; van Meer, G.|info:eu-repo/dai/nl/068570368; Moss, B.; Griffiths, G.

    1993-01-01

    Vaccinia virus, the prototype of the Poxviridae, is a large DNA virus which replicates in the cytoplasm of the host cell. The assembly pathway of vaccinia virus displays several unique features, such as the production of two structurally distinct, infectious forms. One of these, termed intracellular

  10. Annatto carotenoids attenuate oxidative stress and inflammatory response after high-calorie meal in healthy subjects.

    Science.gov (United States)

    Roehrs, Miguel; Conte, Lisiane; da Silva, Dariane Trivisiol; Duarte, Thiago; Maurer, Luana Haselein; de Carvalho, José Antonio Mainardi; Moresco, Rafael Noal; Somacal, Sabrina; Emanuelli, Tatiana

    2017-10-01

    The aim of this study was to evaluate the effect of annatto carotenoids intake associated to a single high-calorie meal (high fat and high carbohydrate) in postprandial biochemical, inflammatory and oxidative stress markers. Twelve healthy subjects (6 men, 6 women) were included in this randomised, controlled crossover study. Baseline blood samples were collected from fasting subjects that immediately received high-calorie meal without carotenoid (placebo) or containing 1.2mg/kg bixin (BIX) or 0.06mg/kg norbixin (NBIX). Blood samples were taken 60, 120 and 240min after meal intake. NBIX intake did not affect biochemical blood markers but reduced the postprandial levels of inflammatory cytokines (IL-1, IL-6 and TNF-α) and lipid oxidation 60-120min after meal. BIX only partially prevented postprandial-induced lipid oxidation. Results indicate that the intake of NBIX may be an alternative to reduce the postprandial inflammatory and oxidative stress responses to high-calorie meals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Neonatal overfeeding attenuates acute central pro-inflammatory effects of short-term high fat diet

    Directory of Open Access Journals (Sweden)

    Guohui eCai

    2015-01-01

    Full Text Available Neonatal obesity predisposes individuals to obesity throughout life. In rats, neonatal overfeeding also leads to early accelerated weight gain that persists into adulthood. The phenotype is associated with dysfunction in a number of systems including paraventricular nucleus of the hypothalamus (PVN responses to psychological and immune stressors. However, in many cases weight gain in neonatally overfed rats stabilizes in early adulthood so the animal does not become more obese as it ages. Here we examined if neonatal overfeeding by suckling rats in small litters predisposes them to exacerbated metabolic and central inflammatory disturbances if they are also given a high fat diet in later life. In adulthood we gave the rats normal chow, 3 days, or 3 weeks high fat diet (45% kcal from fat and measured peripheral indices of metabolic disturbance. We also investigated hypothalamic microglial changes, as an index of central inflammation, as well as PVN responses to lipopolysaccharide (LPS. Surprisingly, neonatal overfeeding did not predispose rats to the metabolic effects of a high fat diet. Weight changes and glucose metabolism were unaffected by the early life experience. However, short term (3 day high fat diet was associated with more microglia in the hypothalamus and a markedly exacerbated PVN response to LPS in control rats; effects not seen in the neonatally overfed. Our findings indicate neonatally overfed animals are not more susceptible to the adverse metabolic effects of a short-term high fat diet but may be less able to respond to the central effects.

  12. Genomic identification of human vaccinia virus keratoconjunctivitis and its importance as a laboratory-acquired infection

    Directory of Open Access Journals (Sweden)

    Zahra Movahedi Motlagh

    2016-01-01

    Full Text Available Context: Vaccinia virus (VACV is a member of orthopoxvirus genus of the family Poxviridae. VACVs are enveloped, double-stranded DNA viruses. Several species of this family, for example, molluscum contagiosum, smallpox, deerpox, horsepox, rabbitpox, and VACVs may cause conjunctivitis. Aims: Given the high incidence of keratoconjunctivitis in Iran (approximately 3.6%-53.9% and insufficient clinical diagnostic measures, laboratory tests for detection of its causes and determination of accurate keratoconjunctivitis/conjunctivitis prevalence due to different pathogens are essential. Settings and Design: In this research, conjunctival samples collected from 100 patients with keratoconjunctivitis signs were referred to an eye hospital of Iran. Subjects and Methods: After DNA extraction, polymerase chain reaction (PCR was carried out for detection of VACV. PCR-positive products were further subjected to DNA sequencing. Statistical Analysis Used: The results were analyzed using Chi-square test. Results: In this study, 28% of the samples were positive and a statistically significant relationship obtained between working in medical or research laboratories and VACV prevalence (P < 0.05. Conclusions: This study showed a high rate of VACV keratoconjunctivitis, and therefore, further studies for its prevention and control are necessary.

  13. Purple Sweet Potato Attenuate Weight Gain in High Fat Diet Induced Obese Mice.

    Science.gov (United States)

    Ju, Ronghui; Zheng, Shujuan; Luo, Hongxia; Wang, Changgang; Duan, Lili; Sheng, Yao; Zhao, Changhui; Xu, Wentao; Huang, Kunlun

    2017-03-01

    Purple sweet potato (PSP) is widely grown in Asia and considered as a healthy vegetable. The objective of the current study was to determine the anti-obesity effect of the PSP on high fat diet induced obese C57BL/6J mice. The mice were administrated with high fat diet supplemented with the sweet potato (SP) or PSP at the concentration of 15% and 30% for 12 wk, respectively. The results showed that the supplementation of SP or PSP at 30% significantly ameliorated high fat diet induced obesity and its associated risk factors, including reduction of body weight and fat accumulation, improvement of lipid profile and modulation of energy expenditure. Moreover, PSP also posed beneficial effect on the liver and kidney functions. These results indicate that PSP and SP have anti-obesity effect and are effective to reduce the metabolic risk. © 2017 Institute of Food Technologists®.

  14. Enhanced T cell-mediated protection against malaria in human challenges by using the recombinant poxviruses FP9 and modified vaccinia virus Ankara.

    Science.gov (United States)

    Webster, Daniel P; Dunachie, Susanna; Vuola, Jenni M; Berthoud, Tamara; Keating, Sheila; Laidlaw, Stephen M; McConkey, Samuel J; Poulton, Ian; Andrews, Laura; Andersen, Rikke F; Bejon, Philip; Butcher, Geoff; Sinden, Robert; Skinner, Michael A; Gilbert, Sarah C; Hill, Adrian V S

    2005-03-29

    Malaria is a major global health problem for which an effective vaccine is required urgently. Prime-boost vaccination regimes involving plasmid DNA and recombinant modified vaccinia virus Ankara-encoding liver-stage malaria antigens have been shown to be powerfully immunogenic for T cells and capable of inducing partial protection against experimental malaria challenge in humans, manifested as a delay in time to patent parasitemia. Here, we report that substitution of plasmid DNA as the priming vector with a specific attenuated recombinant fowlpox virus, FP9, vaccine in such prime-boost regimes can elicit complete sterile protection that can last for 20 months. Protection at 20 months was associated with persisting memory but not effector T cell responses. The protective efficacy of various immunization regimes correlated with the magnitude of induced immune responses, supporting the strategy of maximizing durable T cell immunogenicity to develop more effective liver-stage vaccines against Plasmodium falciparum malaria.

  15. High-Resolution Seismic Velocity and Attenuation Models of Eastern Tibet and Adjacent Regions (Post Print)

    Science.gov (United States)

    2012-06-04

    closely beneath the Moho discontinuity, and thus its velocity model mainly represents the velocity structure of the uppermost mantle. We have applied the...have high Pn velocities. An abrupt Moho depth change is suggested by the observed significant difference of station delays along Kunlun, the northern

  16. High-fat Diet Enhances and Plasminogen Activator Inhibitor-1 Deficiency Attenuates Bone Loss in Mice with Lewis Lung Carcinoma.

    Science.gov (United States)

    Yan, Lin; Nielsen, Forrest H; Sundaram, Sneha; Cao, Jay

    2015-07-01

    This study determined the effects of a high-fat diet and plasminogen activator inhibitor-1 deficiency (Pai1(-/-)) on the bone structure in male C57BL/6 mice bearing Lewis lung carcinoma (LLC) in lungs. Significant reduction in bone volume fraction (BV/TV), trabecular number (Tb.N) and bone mineral density (BMD) in femurs and vertebrae were found in LLC-bearing mice compared to non-tumor-bearing mice. In LLC-bearing mice, the high-fat diet compared to the AIN93G control diet significantly reduced BV/TV, Tb.N and BMD in femurs and BV/TV in vertebrae. The high-fat diet significantly reduced BMD in vertebrae in wild-type mice but not in Pai1(-/-) mice. Compared to wild-type mice, PAI1 deficiency significantly increased BV/TV and Tb.N in femurs. The plasma concentration of osteocalcin was significantly lower and that of tartrate-resistant acid phosphatase 5b (TRAP5b) was significantly higher in LLC-bearing mice. The high-fat diet significantly reduced plasma osteocalcin and increased TRAP5b. Deficiency in PAI1 prevented the high-fat diet-induced increases in plasma TRAP5b. These findings demonstrate that a high-fat diet enhances, whereas PAI1 deficiency, attenuates metastasis-associated bone loss, indicating that a high-fat diet and PAI1 contribute to metastasis-associated bone deterioration. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Quercetin Isolated from Toona sinensis Leaves Attenuates Hyperglycemia and Protects Hepatocytes in High-Carbohydrate/High-Fat Diet and Alloxan Induced Experimental Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Yali Zhang

    2016-01-01

    Full Text Available The development of diabetes mellitus is related to oxidant stress induced by a high carbohydrate/high-fat diet (HFD. Quercetin, as a major bioactive component in Toona sinensis leaves (QTL, is a natural antioxidant. However, the exact mechanism by which QTL ameliorate diabetes mellitus is still unknown. In this study, we investigated the hypoglycemic effects and hepatocytes protection of QTL on HFD and alloxan induced diabetic mice. Intragastric administration of QTL significantly reduced body weight gain, serum glucose, insulin, total cholesterol, triglyceride, low density lipoprotein-cholesterol, alanine aminotransferase, and aspartate aminotransferase serum levels compared to those of diabetic mice. Furthermore, it significantly attenuated oxidative stress, as determined by lipid peroxidation, nitric oxide content, and inducible nitric oxide synthase activity and as a result attenuated liver injury. QTL also significantly suppressed the diabetes-induced activation of the p65/NF-κB and ERK1/2/MAPK pathways, as well as caspase-9 and caspase-3 levels in liver tissues of diabetic mice. Finally, micrograph analysis of liver samples showed decreased cellular organelle injury in hepatocytes of QTL treated mice. Taken together, QTL can be viewed as a promising dietary agent that can be used to reduce the risk of diabetes mellitus and its secondary complications by ameliorating oxidative stress in the liver.

  18. High-frequency seismic wave propagation within the heterogeneous crust: effects of seismic scattering and intrinsic attenuation on ground motion modelling

    Science.gov (United States)

    Takemura, Shunsuke; Kobayashi, Manabu; Yoshimoto, Kazuo

    2017-09-01

    For practical modelling of high-frequency (>1 Hz) seismic wave propagation, we analysed the apparent radiation patterns and attenuations of P and S waves using observed Hi-net velocity seismograms for small-to-moderate crustal earthquakes in the Chugoku region, southwestern Japan. By comparing observed and simulated seismograms, we estimated practical parameter sets of crustal small-scale velocity heterogeneity and intrinsic attenuations of P and S waves (QP.int-1 and QS.int-1). Numerical simulations of seismic wave propagation were conducted via the finite-difference method using a 1-D crustal velocity structure model with additional 3-D small-scale velocity heterogeneity and intrinsic attenuation. The estimated crustal small-scale velocity heterogeneity is stochastically characterized by an exponential-type power spectral density function with correlation length of 1 km and root-mean-square value of 0.03. Estimated QP.int-1 and QS.int-1 values range from 10-2.6 to 10-2.0 and 10-2.8 to 10-2.4, respectively, indicating QP.int-1 > QS.int-1 for high frequencies (>1 Hz). Intrinsic attenuation dominates over scattering attenuation, which is caused by small-scale velocity heterogeneity. The crustal parameters obtained in this study are useful for evaluating peak ground velocities and coda envelopes for moderate crustal earthquakes via physical-based simulations using a 3-D heterogeneous structure model.

  19. Microwave energy attenuators on the basis of aluminum nitride with high level of microwave energy absorption

    Directory of Open Access Journals (Sweden)

    Chasnyk V. I.

    2014-08-01

    Full Text Available Results of experimental studies of aluminum nitride based composites with addition of silicon carbide and molybdenum having high microwave absorption are presented. The interconnection between high level of absorption and volume electrical resistance was observed: maximum absorption of 6.5±1,0 dB/mm corresponds to the electrical resistance of (4—5·105 Ohm·m. Level of absorption of 3.5±0,5 dB/mm is revealed for the dielectric material with electrical conductivity of 1012 Ohm·m. The patterns detected during the study allow to predict the minimum and maximum levels of absorption of microwave energy in the two-phase composites based on aluminum nitride with molybdenum or silicon carbide, based on the measured volume of electrical resistance.

  20. Cytokine-modified VSV is attenuated for neural pathology, but is both highly immunogenic and oncolytic

    OpenAIRE

    Miller, James; Bidula, Sarah M; Jensen, Troels M; Reiss, Carol Shoshkes

    2009-01-01

    Vesicular stomatitis virus (VSV), an enveloped, nonsegmented, negative-stranded RNA virus, is being tested by several laboratories as an antitumor agent. Unfortunately, viral infection of the central nervous system (CNS) has been observed by many groups following administration to tumor-bearing animals. In rodents, VSV encephalitis is characterized by weight-loss, paralysis, and high mortality. In order to provide protection from VSV infection of the CNS after therapeutic administration, we h...

  1. Modified vaccinia virus Ankara triggers type I IFN production in murine conventional dendritic cells via a cGAS/STING-mediated cytosolic DNA-sensing pathway.

    Directory of Open Access Journals (Sweden)

    Peihong Dai

    2014-04-01

    Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated poxvirus that has been engineered as a vaccine against infectious agents and cancers. Our goal is to understand how MVA modulates innate immunity in dendritic cells (DCs, which can provide insights to vaccine design. In this study, using murine bone marrow-derived dendritic cells, we assessed type I interferon (IFN gene induction and protein secretion in response to MVA infection. We report that MVA infection elicits the production of type I IFN in murine conventional dendritic cells (cDCs, but not in plasmacytoid dendritic cells (pDCs. Transcription factors IRF3 (IFN regulatory factor 3 and IRF7, and the positive feedback loop mediated by IFNAR1 (IFN alpha/beta receptor 1, are required for the induction. MVA induction of type I IFN is fully dependent on STING (stimulator of IFN genes and the newly discovered cytosolic DNA sensor cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase. MVA infection of cDCs triggers phosphorylation of TBK1 (Tank-binding kinase 1 and IRF3, which is abolished in the absence of cGAS and STING. Furthermore, intravenous delivery of MVA induces type I IFN in wild-type mice, but not in mice lacking STING or IRF3. Treatment of cDCs with inhibitors of endosomal and lysosomal acidification or the lysosomal enzyme Cathepsin B attenuated MVA-induced type I IFN production, indicating that lysosomal enzymatic processing of virions is important for MVA sensing. Taken together, our results demonstrate a critical role of the cGAS/STING-mediated cytosolic DNA-sensing pathway for type I IFN induction in cDCs by MVA. We present evidence that vaccinia virulence factors E3 and N1 inhibit the activation of IRF3 and the induction of IFNB gene in MVA-infected cDCs.

  2. Water, partial melting and the origin of the seismic low velocity and high attenuation zone in the upper mantle

    Science.gov (United States)

    Karato, Shun-ichiro; Jung, Haemyeong

    1998-04-01

    The common belief that the seismic low velocity and high attenuation zone (the asthenosphere) is caused by the presence of a small amount of melt is not supported by recent mineral physics and seismological observations. A review of recent mineral physics observations suggests that water significantly reduces seismic wave velocities through anelastic relaxation and hence, at a small melt fraction expected in most of the Earth's upper mantle, partial melting will increase seismic wave velocities through the removal of water from minerals such as olivine. Therefore the asthenosphere, in this model, is a layer where no significant partial melting occurs and hence a high water content is retained. We apply this model to calculate seismic wave velocities and attenuation in the upper mantle with a range of water contents. The seismic structures calculated from this model depend on geotherm, the mode of partial melting (batch or fractional melting) and the geometry of upwelling flow (passive flow or dynamic upwelling). The sharp velocity change around 60-80 km (the Gutenberg discontinuity) can be attributed to a sharp change in water content due to partial melting, if the temperature there is relatively high as implied by the plate model and if melting occurs as fractional melting but not by batch melting. However, the significant increase in seismic wave velocity with age in young oceanic upper mantle suggests rapid cooling as predicted by a cooling half-space model. Thus, the present model suggests fast cooling in the early stage but slow cooling in the later stage of evolution of the oceanic upper mantle, the latter being caused presumably by some additional heat in the old oceanic upper mantle. The seismic structures of typical oceanic upper mantle with a fast spreading rate (e.g., the Pacific) is consistent with passive spreading, whereas the greater depth of the G-discontinuity and the weaker seismic anisotropy in back-arc regions (e.g., the Philippine Sea) suggest

  3. High value of controlled attenuation parameter predicts a poor antiviral response in patients with chronic hepatits B.

    Science.gov (United States)

    Chen, Jing; Wang, Meng-Lan; Long, Qin; Bai, Lang; Tang, Hong

    2017-08-15

    Controlled attenuation parameter (CAP) is a non-invasive method for diagnosing hepatic steatosis based on vibration-controlled transient elastography. The objective of this study was to investigate the effect of high value of CAP on antiviral therapy in patients with chronic hepatitis B (CHB). Patients with CHB receiving enticavir for initial antiviral therapy were studied; they were divided into the high CAP group and normal CAP group at baseline according to the CAP values. The effect of the antiviral therapy between the two groups were compared at week 12, 24 and 48. Patients with high CAP value at baseline were divided into three subgroups, mild, moderate and severe elevation; the therapeutic response were compared among patients with normal CAP and subgroups of patients with elevated CAP. A total of 153 patients were enrolled. Among them, 63 were in the high CAP group and 90 in the normal CAP group. Patients with high CAP had lower rates of ALT normalization and HBV DNA clearance in response to antiviral therapy compared with those with normal CAP at week 12, 24 and 48. Further analysis showed that the rate of ALT normalization in patients with mildly and moderately elevated CAP were significant lower than those with normal CAP at week 12 and 24; while the difference was not significant between the patients with normal CAP and those with severely elevated CAP. The rate of HBV DNA clearance was significantly lower in patients with severely elevated CAP compared with those with normal CAP at week 12, 24 and 48. CHB patients with high CAP had poor response to antiviral therapy. Copyright © 2017 The Editorial Board of Hepatobiliary & Pancreatic Diseases International. Published by Elsevier B.V. All rights reserved.

  4. High-phosphorus diet maximizes and low-dose calcitriol attenuates skeletal muscle changes in long-term uremic rats.

    Science.gov (United States)

    Acevedo, Luz M; López, Ignacio; Peralta-Ramírez, Alan; Pineda, Carmen; Chamizo, Verónica E; Rodríguez, Mariano; Aguilera-Tejero, Escolástico; Rivero, José-Luis L

    2016-05-01

    Although disorders of mineral metabolism and skeletal muscle are common in chronic kidney disease (CKD), their potential relationship remains unexplored. Elevations in plasma phosphate, parathyroid hormone, and fibroblastic growth factor 23 together with decreased calcitriol levels are common features of CKD. High-phosphate intake is a major contributor to progression of CKD. This study was primarily aimed to determine the influence of high-phosphate intake on muscle and to investigate whether calcitriol supplementation counteracts negative skeletal muscle changes associated with long-term uremia. Proportions and metabolic and morphological features of myosin-based muscle fiber types were assessed in the slow-twitch soleus and the fast-twitch tibialis cranialis muscles of uremic rats (5/6 nephrectomy, Nx) and compared with sham-operated (So) controls. Three groups of Nx rats received either a standard diet (0.6% phosphorus, Nx-Sd), or a high-phosphorus diet (0.9% phosphorus, Nx-Pho), or a high-phosphorus diet plus calcitriol (10 ng/kg 3 day/wk ip, Nx-Pho + Cal) for 12 wk. Two groups of So rats received either a standard diet or a high-phosphorus diet (So-Pho) over the same period. A multivariate analysis encompassing all fiber-type characteristics indicated that Nx-Pho + Cal rats displayed skeletal muscle phenotypes intermediate between Nx-Pho and So-Pho rats and that uremia-induced skeletal muscle changes were of greater magnitude in Nx-Pho than in Nx-Sd rats. In uremic rats, treatment with calcitriol preserved fiber-type composition, cross-sectional size, myonuclear domain size, oxidative capacity, and capillarity of muscle fibers. These data demonstrate that a high-phosphorus diet potentiates and low-dose calcitriol attenuates adverse skeletal muscle changes in long-term uremic rats. Copyright © 2016 the American Physiological Society.

  5. Horizontal study of vaccinia virus infections in an endemic area: epidemiologic, phylogenetic and economic aspects.

    Science.gov (United States)

    Assis, Felipe L; Franco-Luiz, Ana Paula M; Paim, Luis M; Oliveira, Graziele P; Pereira, Alexandre F; de Almeida, Gabriel M F; Figueiredo, Leandra B; Tanus, Adriano; Trindade, Giliane S; Ferreira, Paulo P; Kroon, Erna G; Abrahão, Jônatas S

    2015-11-01

    Vaccinia virus (VACV), the etiological agent of bovine vaccinia (BV), is widespread in Brazil and present in most of the milk-producing regions. We conducted a horizontal study of BV in Bahia, a state of Brazil in which the production of milk is increasing. During 2011, human and bovine clinical samples were collected during outbreaks for BV diagnosis, virus isolation and molecular analysis. We collected data for epidemiological inferences. Vaccinia virus was detected in 87.7% of the analyzed outbreaks, highlighting the effective circulation of VACV in Bahia. The molecular data showed the spreading of group 1 Brazilian VACV to Bahia. We observed a seasonal profile of BV, with its peak in the drier and cooler season. Manual milking was observed in 96 % of the visited properties, showing its importance to viral spread in herds. Under-notification of BV, ineffective animal trade surveillance, and bad milking practices have contributed to the spread of VACV in Brazil.

  6. Isoproterenol attenuates high vascular pressure-induced permeability increases in isolated rat lungs.

    Science.gov (United States)

    Parker, J C; Ivey, C L

    1997-12-01

    To separate the contributions of cellular and basement membrane components of the alveolar capillary barrier to the increased microvascular permeability induced by high pulmonary venous pressures (Ppv), we subjected isolated rat lungs to increases in Ppv, which increased capillary filtration coefficient (Kfc) without significant hemorrhage (31 cmH2O) and with obvious extravasation of red blood cells (43 cmH2O). Isoproterenol (20 microM) was infused in one group (Iso) to identify a reversible cellular component of injury, and residual blood volumes were measured to assess extravasation of red blood cells through ruptured basement membranes. In untreated lungs (High Ppv group), Kfc increased 6.2 +/- 1.3 and 38.3 +/- 15.2 times baseline during the 31 and 43 cmH2O Ppv states. In Iso lungs, Kfc was 36.2% (P Kfc increases at moderate Ppv, possibly because of an endothelial effect, but it did not affect red cell extravasation at higher vascular pressures.

  7. Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics.

    Science.gov (United States)

    Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H

    2013-09-17

    Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

  8. High intensity and reduced volume training attenuates stress and recovery levels in elite swimmers

    DEFF Research Database (Denmark)

    Elbe, Anne-Marie; Rasmussen, Camilla P; Nielsen, Glen

    2016-01-01

    This study investigated the effect of increased high-intensity interval training (HIT) at the expense of total training volume on the stress and recovery levels of elite swimmers. Forty-one elite swimmers participated in the study and were randomly assigned to either a HIT or a control group (CON...... for baseline values. No significant effects could be observed in sports-specific stress or sports-specific recovery. The results indicate that increasing training intensity and reducing training volume for 12 weeks can reduce general stress and increase general recovery levels in competitive swimmers.......). Eleven swimmers did not complete the questionnaires. For 12 weeks both groups trained ~12 h per week. The amount of HIT was ~5 h vs. 1 h, and total distance was ~17 km vs. ~35 km per week for HIT and CON, respectively. HIT was performed as 6-10 × 10-30 s maximal effort interspersed by 2-4 min of rest...

  9. N-Acetylneuraminic acid attenuates hypercoagulation on high fat diet-induced hyperlipidemic rats

    Directory of Open Access Journals (Sweden)

    Zhang Yida

    2015-12-01

    Full Text Available Background and objective: N-Acetylneuraminic acid (Neu5Ac, a type of sialic acid, has close links with cholesterol metabolism and is often used as a biomarker in evaluating the risk of cardiovascular diseases. However, most studies on the health implications of Neu5Ac have focused on its effects on the nervous system, while its effects on cardiovascular risk factors have largely been unreported. Thus, the effects of Neu5Ac on coagulation status in high fat diet (HFD-induced hyperlipidemic rats were evaluated in this study. Methods: Sprague Dawley male rats were divided into five different groups and fed with HFD alone, HFD low-dose Neu5Ac, HFD high-dose Neu5Ac, HFD simvastatin (10 mg/kg day, and normal pellet alone. Food was given ad libitum while body weight of rats was measured weekly. After 12 weeks of intervention, rats were sacrificed and serum and tissue samples were collected for biochemistry and gene expression analysis, respectively. Results: The results showed that Neu5Ac could improve lipid metabolism and hyperlipidemia-associated coagulation. Neu5Ac exerted comparable or sometimes better physiological effects than simvastatin, at biochemical and gene expression levels. Conclusions: The data indicated that Neu5Ac prevented HFD-induced hyperlipidemia and associated hypercoagulation in rats through regulation of lipid-related and coagulation-related genes and, by extension, induced metabolite and protein changes. The implications of the present findings are that Neu5Ac may be used to prevent coagulation-related cardiovascular events in hyperlipidemic conditions. These findings are worth studying further.

  10. Euphorbia kansui Attenuates Insulin Resistance in Obese Human Subjects and High-Fat Diet-Induced Obese Mice

    Directory of Open Access Journals (Sweden)

    Seung-Wook Lee

    2017-01-01

    Full Text Available Background. Obesity is a main cause of insulin resistance (IR, metabolic syndrome, and fatty liver diseases. This study evaluated Euphorbia kansui radix (Euphorbia as a potential treatment option for obesity and obesity-induced IR in obese human and high-fat diet- (HFD- induced obese mice. Methods. In the human study, we analyzed the body weight change of 14 patients who took a single dose of 6 g of Euphorbia powder. In the animal study, male mice were divided into three groups: normal chow, HFD, and Euphorbia (high-fat diet and 100 mg/Kg Euphorbia once per week. Body weight, epididymal fat pad weight, fasting blood glucose, fasting insulin, HOMA-IR, and oral glucose tolerance test were measured. Also, macrophage infiltration and expression of CD68, tumor necrosis factor- (TNF- α, interferon- (IFN- γ, and interleukin- (IL- 6 genes in the liver and adipose tissue were analyzed. Results. The human study showed that Euphorbia has a potential effect on body weight loss. In the in vivo study, body weight, epididymal fat weight, glucose level, IR, expression of CD68, TNF-α, IFN-r, and IL-6 genes, and macrophages in liver and adipose tissue were significantly reduced by Euphorbia. Conclusions. These results suggest that Euphorbia attenuates obesity and insulin resistance via anti-inflammatory effects.

  11. Boldine attenuates cholestasis associated with nonalcoholic fatty liver disease in hereditary hypertriglyceridemic rats fed by high-sucrose diet.

    Science.gov (United States)

    Zagorova, M; Prasnicka, A; Kadova, Z; Dolezelova, E; Kazdova, L; Cermanova, J; Rozkydalova, L; Hroch, M; Mokry, J; Micuda, S

    2015-01-01

    The aim of the current study was to clarify the effect of high sucrose diet (HSD) on bile formation (BF) in rats with hereditary hypertriglyceridemia (HHTg). Potentially positive effects were studied for boldine, a natural choleretic agent. Administration of HSD to HHTg rats led to increased triglyceride deposition in the liver. HSD reduced BF as a consequence of decreased biliary secretion of bile acids (BA) and glutathione. Responsible mechanism was down-regulation of hepatic transporters for BA and glutathione, Bsep and Mrp2, respectively. Moreover, gene expressions of transporters for other constituents of bile, namely Abcg5/8 for cholesterol, Abcb4 for phospholipids, and Oatp1a4 for xenobiotics, were also reduced by HSD. Boldine partially attenuated cholestatic effect of HSD by promotion of biliary secretion of BA through up-regulation of Bsep and Ntcp, and by increase in biliary secretion of glutathione as a consequence of its increased hepatic disposition. This study demonstrates mechanisms of impaired BF during nonalcoholic fatty liver disease induced by HSD. Altered function of responsible transporters suggests also potential for changes in kinetics of drugs, which may complicate pharmacotherapy in subjects with high intake of sucrose, and with fatty liver disease. Sucrose induced alterations in BF may be alleviated by administration of boldine.

  12. INTERFERENCE INDUCED AGAINST VACCINIA IN AN ADENOVIRUS-RHF-1 SYSTEM.

    Science.gov (United States)

    KHOOBYARIAN, N

    1964-01-01

    Khoobyarian, Newton (University of Illinois, Chicago). Interference induced against vaccinia in an adenovirus-RHF-1 system. J. Bacteriol. 87:24-32. 1964.-It was observed that a continuous line of rabbit heart cell culture (strain RHF-1), when overlaid with growth medium after infection of cultures with adenovirus types 2, 3, 4, and 7, would develop resistance to vaccinia plaque formation. Data are presented to provide some information on the nature of such resistance observed specifically in an adenovirus 2-RHF-1 system. An analysis of this phenomenon indicated the following. (i) At least 6 hr were required before the start of vaccinia inhibition, and 15 to 18 hr were necessary for the maximal occurrence of inhibition; the degree of interference established varied with the concentration of adenovirus. (ii) The site of interference action was inside rather than outside the cells, since hardly any difference could be shown in the rate of vaccinia adsorption on resistant and susceptible cells. (iii) The interaction of adenovirus with RHF-1 cells not only would inhibit cell infection with vaccinia but would also suppress the 24- to 48-hr yield of virus. (iv) When RHF-1 cells were overlaid with maintenance medium after their infection with a low multiplicity of RHF-1 passaged adenovirus 2 (to establish sublethal infection), an inhibitory substance of varied activity could be detected daily over a period of at least 10 days which, when transferred to normal RHF-1 cultures, would render them resistant to vaccinia infection. (v) Although limited growth of virus appeared to be responsible for the production of the inhibitor, increase in inhibitory activity did not seem to coincide with increase in virus titer. (vi) The inhibitor seemed to resemble interferons in inhibiting virus plaque production, but its exact identity and the mode of action remain to be determined.

  13. Attenuation of high sucrose diet-induced insulin resistance in tryptophan 2,3-dioxygenase deficient Drosophila melanogaster vermilion mutants.

    Science.gov (United States)

    Navrotskaya, Valeriya; Oxenkrug, Gregory; Vorobyova, Lyudmila; Summergrad, Paul

    Exposure to high sugar diet (HSD) serves as an experimental model of insulin resistance (IR) and type 2 diabetes (T2D) in mammals and insects. Peripheral IR induced by HSD delays emergence of pupae from larvae and decreases body weight of Drosophila imago. Understanding of mechanisms of IR/T2D is essential for refining T2D prevention and treatment strategies. Dysregulation of tryptophan (TRP) - kynurenine (KYN) pathway was suggested as one of the mechanisms of IR development. Rate-limiting enzyme of TRP - KYN pathway in Drosophila is TRP 2,3-dioxygenase (TDO), an evolutionary conserved ortholog of human TDO. In insects TDO is encoded by vermilion gene. TDO is not active in vermilion mutants. In order to evaluate the possible impact of deficient formation of KYN from TRP on the inducement of IR by HSD, we compared the effect of HSD in wild type (Oregon) and vermilion mutants of Drosophila melanogaster by assessing the time of white pupae emergence from larva and body weight of imago. Delay of emergence of pupae from larvae induced by high sucrose diet was less pronounced in vermilion (1.4 days) than in Oregon flies (3.3 days) in comparison with flies maintained on standard diet. Exposure to high sucrose diet decreased body weight of Oregon (but not vermilion) imago. Attenuation of high sucrose diet-induced IR/T2D in vermilion flies might depend on deficiency of TRP - KYN pathway. Besides IR/T2D, HSD induces obesity in Drosophila. Future studies of HSD-induced obesity and IR/T2D in TDO deficient vermilion mutants of Drosophila might help to understand the mechanisms of high association between IR/T2D and obesity. Modulation of TRP - KYN metabolism might be utilized for prevention and treatment of IR/T2D.

  14. Evidence of Chlorobenzene Natural Attenuation in Contaminated Sediments Using Compound Specific Isotope Analysis and High Resolution Pore Water Sampling

    Science.gov (United States)

    Passeport, E.; Landis, R.; Lacrampe Couloume, G.; Lutz, E. J.; Mack, E. E.; West, K.; Sherwood Lollar, B.

    2014-12-01

    Contaminated sediments can represent a significant risk for ecosystems and hinder drinking water production if contaminants discharge to surface and ground water. Understanding of contaminant fate and the potential for natural attenuation can help protect aquatic resources. In this study, the fate of chlorobenzene (MCB) and benzene was investigated in a contaminated canal sediment field site located in New Jersey, USA. Compound Specific Isotope Analysis (CSIA) was applied to sediment pore water samples collected with a peeper at high spatial resolution (3 cm) across the sediment - surface water interface (SWI). Samples were collected at three locations in canal sediments, all of which exhibited reducing redox conditions. The largest concentrations were observed in the bottommost portions of the sediment profile, with concentrations ranging from 300 to 2000 µg/L for MCB, and 16 to 180 µg/L for benzene. Conversely, concentrations were below detection limit in the surface water and in the top 6 cm of the sediment. In the zones of highest MCB concentrations, the δ13C values were -26.4 (location C) and -21.9 ‰ (location F), and became progressively more enriched in 13C while concentrations decreased, reaching -23.9 (at 12 cm below the SWI, location C) and -18.4 ‰ (at 16.5 cm below SWI, location F). Benzene was only detected in the bottom 6 cm of the sediment profiles. Benzene δ13C values were -27 (bottommost, i.e., 24 cm deep) to -29.7 ‰ (18 cm deep), in location C. Such significant isotopic enrichments in 13C (2.5 to 3.5 ‰) correlated with MCB and benzene concentration decrease are suggestive of in situ biodegradation. In addition, benzene δ13C values were systematically more depleted in 13C than MCB, suggesting that benzene found in these zones was likely produced from MCB via reductive dechlorination. This study combined for the first time CSIA with high spatial sampling resolution in surface water sediments. This setup enabled not only detection of

  15. Systemic treatment of xenografts with vaccinia virus GLV-1h68 reveals the immunologic facet of oncolytic therapy

    Directory of Open Access Journals (Sweden)

    Liu Hui

    2009-07-01

    Full Text Available Abstract Background GLV-1h68 is an attenuated recombinant vaccinia virus (VACV that selectively colonizes established human xenografts inducing their complete regression. Results Here, we explored xenograft/VACV/host interactions in vivo adopting organism-specific expression arrays and tumor cell/VACV in vitro comparing VACV replication patterns. There were no clear-cut differences in vitro among responding and non-responding tumors, however, tumor rejection was associated in vivo with activation of interferon-stimulated genes (ISGs and innate immune host's effector functions (IEFs correlating with VACV colonization of the xenografts. These signatures precisely reproduce those observed in humans during immune-mediated tissue-specific destruction (TSD that causes tumor or allograft rejection, autoimmunity or clearance of pathogens. We recently defined these common pathways in the "immunologic constant of rejection" hypothesis (ICR. Conclusion This study provides the first prospective validation of a universal mechanism associated with TSD. Thus, xenograft infection by oncolytic VACV, beyond offering a promising therapy of established cancers, may represent a reliable pre-clinical model to test therapeutic strategies aimed at modulating the central pathways leading to TSD; this information may lead to the identification of principles that could refine the treatment of cancer and chronic infection by immune stimulation or autoimmunity and allograft rejection through immune tolerance.

  16. Calculations of dose attenuation in slowly curving tunnel geometries at a high-energy proton accelerator

    CERN Document Server

    Vincke, Helmut H

    2003-01-01

    The CERN Neutrino beam to Gran Sasso (CNGS) project and the Large Hadron Collider (LHC) will receive 450 GeV/c protons extracted from the Super Proton Synchrotron (SPS). In the tunnels leading to the CNGS target and the LHC accelerator there is a 150 m straight section where a beam dump (TED) can be moved into the beam chamber, intercepting the proton beam. After the TED, the beam is routed into either the 700m slowly curving TT41 tunnel (CNGS) or the TI8 tunnel consisting of a 400 m straight section followed by a curved 1.5 km long tunnel (LHC). The curved tunnels have a radius of approximately 1 km. During tests a proton beam of 1.2 multiplied by 10**1**3 s**- **1 could be sent to the dump. The question posed was how close to the TED could access be allowed during dumping operations. Initial simulations using the FLUKA Monte-Carlo transport program were optimised assuming that the high-energy muon contribution dominates. Discrepancies with an analytically based calculation led to a revision of this optimisa...

  17. High intensity and reduced volume training attenuates stress and recovery levels in elite swimmers.

    Science.gov (United States)

    Elbe, Anne-Marie; Rasmussen, Camilla P; Nielsen, Glen; Nordsborg, Nikolai B

    2016-01-01

    This study investigated the effect of increased high-intensity interval training (HIT) at the expense of total training volume on the stress and recovery levels of elite swimmers. Forty-one elite swimmers participated in the study and were randomly assigned to either a HIT or a control group (CON). Eleven swimmers did not complete the questionnaires. For 12 weeks both groups trained ~12 h per week. The amount of HIT was ~5 h vs. 1 h, and total distance was ~17 km vs. ~35 km per week for HIT and CON, respectively. HIT was performed as 6-10 × 10-30 s maximal effort interspersed by 2-4 min of rest. The Recovery Stress Questionnaire - Sport was used to measure the swimmers' stress and recovery levels. After the 12 week intervention, the general stress level was 16.6% (2.6-30.7%; mean and 95% CI) lower and the general recovery level was 6.5% (0.7-12.4%) higher in HIT compared to the CON, after adjusting for baseline values. No significant effects could be observed in sports-specific stress or sports-specific recovery. The results indicate that increasing training intensity and reducing training volume for 12 weeks can reduce general stress and increase general recovery levels in competitive swimmers.

  18. Vaccinia Virus Recombinants: Expression of VSV Genes and Protective Immunization of Mice and Cattle

    Science.gov (United States)

    Mackett, M.; Yilma, T.; Rose, J. K.; Moss, B.

    1985-01-01

    Vesicular stomatitis virus (VSV) causes a contagious disease of horses, cattle, and pigs. When DNA copies of messenger RNA's for the G or N proteins of VSV were linked to a vaccinia virus promoter and inserted into the vaccinia genome, the recombinants retained infectivity and synthesized VSV polypeptides. After intradermal vaccination with live recombinant virus expressing the G protein, mice produced VSV-neutralizing antibodies and were protected against lethal encephalitis upon intravenous challenge with VSV. In cattle, the degree of protection against intradermalingually injected VSV was correlated with the level of neutralizing antibody produced following vaccination.

  19. Polyphenol Rich Extract of Garcinia pedunculata Fruit Attenuates the Hyperlipidemia induced by High Fat Diet

    Directory of Open Access Journals (Sweden)

    Rahul Sarma

    2016-08-01

    Full Text Available Fatty foods, the most common diet today are the crux of many metabolic disorders which need urgent attention. Garcinia pedunculata Roxb. (GP, Clusiaceae is a plant found available in Northeast (NE region of India, is considered to have versatile therapeutic properties. The people of this region has been using dried pulp of GP fruit for the treatment of different stomach related diseases traditionally. This study aimed at evaluating the potential therapeutic action of the polyphenol-rich methanolic extract (ME of the fruit in experimental induced obese rats. In vitro antioxidant and antidiabetic activity of GP extracts, i.e., fruit extract (GF and seed extract (GS were determined by using various methods viz., 1,1-diphenyl-2 picrylhydrazyl (DPPH, 2,2′-Azinobis (3-ethyl benzthiazoline-6-sulphonic acid (ABTS•+, nitroblue tetrazolium (NBT and α-glucosidase inhibition assay for detection of antihyperglycemic activity. In vivo antilipidemic and antiobesity activities were evaluated by administrating oral dose of GF for 60 days on a high-fat diet (HFD induced hyperlipidemia in the rat. GF showed higher antioxidant activity than GS by DPPH radical scavenging (IC50=4.01 µg/ml, ABTS•+ (IC50=0.82 µg/ml, NBT (IC50=0.07 µg/ml and also showed notable α-glucosidase inhibitory activity (IC50=19.26 µg/ml. Furthermore, GF treated rat revealed a reduction in the body weight (~60%, serum total cholesterol (33%, triglycerides (32%, low-density lipoprotein (38% and liver biomarker enzymes after 60 days HFD fed animals. Simultaneously, GF supplementation significantly protected the HFD induced changes in hematological parameters. Histological observations clearly differentiate the structural changes in liver of HFD and GF treated group. This novel dietary lipid adsorbing agent of GF exhibited prevention of hyperlipidemia induced by HFD in the rat.

  20. Laboratory Column Evaluation of High Explosives Attenuation in Grenade Range Soils.

    Science.gov (United States)

    Won, Jongho; Borden, Robert C

    2017-09-01

    High explosives (HEs) deposited on military ranges can leach through the soil and contaminate groundwater. We examined the transport and fate of HEs in laboratory columns containing soils from two hand grenade bays (Bays C and T) and the impact of organic amendments on biodegradation. Soil characteristics were similar; however, Bay C had somewhat higher clay and organic C. Experimental treatments included addition of crude glycerin and lignosulfonate, and parallel control columns. Experimental results showed extensive 2,4,6-trinitrotoluene (TNT) degradation with minimal leaching, consistent with prior batch microcosm results. Amendment addition enhanced TNT degradation in both Bays C and T compared with controls. Although hexahydro-1,3,5-trinitro-1,3,5-triazine (Royal Demolition Explosive, or RDX) did not biodegrade in prior aerobic batch microcosms, 64 to 77% of RDX biodegraded in untreated soil columns with O present in the mobile soil gas. The RDX biodegradation was likely associated with short-term anoxic conditions or anoxic micro-niches. In nearly saturated Bay C columns, RDX removal increased to >92%. Amendment addition to unsaturated Bay T columns increased RDX removal to >86%. In one column, the soil remained anoxic (O < 5% by volume) for about a year after amendment addition, significantly reducing RDX leaching. Nitroso degradation products were produced equivalent to 9 to 39% of the RDX degraded, with most retained in the soil (9-37%) and 0 to 3% in the effluent. These results demonstrate that RDX biodegradation can occur in soils with measurable O, and that amendment addition can reduce RDX leaching by stimulating anaerobic biodegradation. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  1. Momordica charantia (bitter melon attenuates high-fat diet-associated oxidative stress and neuroinflammation

    Directory of Open Access Journals (Sweden)

    Feher Domonkos

    2011-06-01

    Full Text Available Abstract Background The rising epidemic of obesity is associated with cognitive decline and is considered as one of the major risk factors for neurodegenerative diseases. Neuroinflammation is a critical component in the progression of several neurological and neurodegenerative diseases. Increased metabolic flux to the brain during overnutrition and obesity can orchestrate stress response, blood-brain barrier (BBB disruption, recruitment of inflammatory immune cells from peripheral blood and microglial cells activation leading to neuroinflammation. The lack of an effective treatment for obesity-associated brain dysfunction may have far-reaching public health ramifications, urgently necessitating the identification of appropriate preventive and therapeutic strategies. The objective of our study was to investigate the neuroprotective effects of Momordica charantia (bitter melon on high-fat diet (HFD-associated BBB disruption, stress and neuroinflammatory cytokines. Methods C57BL/6 female mice were fed HFD with and without bitter melon (BM for 16 weeks. BBB disruption was analyzed using Evans blue dye. Phosphate-buffered saline (PBS perfused brains were analyzed for neuroinflammatory markers such as interleukin-22 (IL-22, IL-17R, IL-16, NF-κB1, and glial cells activation markers such as Iba1, CD11b, GFAP and S100β. Additionally, antioxidant enzymes, ER-stress proteins, and stress-resistant transcription factors, sirtuin 1 (Sirt1 and forkhead box class O transcription factor (FoxO were analyzed using microarray, quantitative real-time RT-PCR, western immunoblotting and enzymatic assays. Systemic inflammation was analyzed using cytokine antibody array. Results BM ameliorated HFD-associated changes in BBB permeability as evident by reduced leakage of Evans blue dye. HFD-induced glial cells activation and expression of neuroinflammatory markers such as NF-κB1, IL-16, IL-22 as well as IL-17R were normalized in the brains of mice supplemented with BM

  2. Attenuation in silica-based optical fibers

    DEFF Research Database (Denmark)

    Wandel, Marie Emilie

    2006-01-01

    In this thesis on attenuation in silica based optical fibers results within three main topics are reported. Spectral attenuation measurements on transmission fibers are performed in the wide wavelength range 290 nm – 1700 nm. The measured spectral attenuation is analyzed with special emphasis...... on absorption peaks in order to investigate the cause of an unusual high attenuation in a series of transmission fibers. Strong indications point to Ni2+ in octahedral coordination as being the cause of the high attenuation. The attenuation of fibers having a high core refractive index is analyzed and the cause...... of the high attenuation measured in such fibers is described as being due to scattering of light on fluctuations of the core diameter. A novel semi-empirical model for predicting the attenuation of high index fibers is presented. The model is shown to be able to predict the attenuation of high index fibers...

  3. Donepezil attenuates high glucose-accelerated senescence in human umbilical vein endothelial cells through SIRT1 activation.

    Science.gov (United States)

    Zhang, Tao; Tian, Feng; Wang, Jing; Zhou, Shanshan; Dong, Xueqing; Guo, Kai; Jing, Jing; Zhou, Ying; Chen, Yundai

    2015-09-01

    Cellular senescence of endothelial cells is a damage and stress response which induces pro-inflammatory, pro-atherosclerotic, and pro-thrombotic phenotypes. Donepezil is a drug used for the treatment of mild to moderate dementia of the Alzheimer's disease (AD). The aim of the present study was to investigate the attenuation of endothelial cell senescence by donepezil and to explore the mechanisms underlying the anti-aging effects of donepezil. Our results indicated that high glucose (HG) markedly decreased cell viability of human umbilical vein endothelial cells (HUVECs), and this phenomenon was reversed by treatment with donepezil. Importantly, our results displayed that the frequency of senescent (SA-ß-gal-positive) cells and the expression level of senescence genes (PAI-1 and p21) were significantly higher in the HG group compared with the normal glucose (NG) group, and these changes were blocked by treatment with donepezil. Also, our results showed that donepezil inhibits the generation of reactive oxygen species (ROS), which promotes cellular senescence. Pretreatment with nicotinamide (NAM), a sirtuin 1 (SIRT1) inhibitor, inhibited the reduction in senescence associated with donepezil. Indeed, our results indicated that donepezil increased the SIRT1 enzyme activity. Therefore, these results show that donepezil delays cellular senescence that is promoted under HG condition via activation of SIRT1.

  4. Live-Cell Imaging of Vaccinia Virus Recombination.

    Directory of Open Access Journals (Sweden)

    Patrick Paszkowski

    2016-08-01

    Full Text Available Recombination between co-infecting poxviruses provides an important mechanism for generating the genetic diversity that underpins evolution. However, poxviruses replicate in membrane-bound cytoplasmic structures known as factories or virosomes. These are enclosed structures that could impede DNA mixing between co-infecting viruses, and mixing would seem to be essential for this process. We hypothesize that virosome fusion events would be a prerequisite for recombination between co-infecting poxviruses, and this requirement could delay or limit viral recombination. We have engineered vaccinia virus (VACV to express overlapping portions of mCherry fluorescent protein fused to a cro DNA-binding element. In cells also expressing an EGFP-cro fusion protein, this permits live tracking of virus DNA and genetic recombination using confocal microscopy. Our studies show that different types of recombination events exhibit different timing patterns, depending upon the relative locations of the recombining elements. Recombination between partly duplicated sequences is detected soon after post-replicative genes are expressed, as long as the reporter gene sequences are located in cis within an infecting genome. The same kinetics are also observed when the recombining elements are divided between VACV and transfected DNA. In contrast, recombination is delayed when the recombining sequences are located on different co-infecting viruses, and mature recombinants aren't detected until well after late gene expression is well established. The delay supports the hypothesis that factories impede inter-viral recombination, but even after factories merge there remain further constraints limiting virus DNA mixing and recombinant gene assembly. This delay could be related to the continued presence of ER-derived membranes within the fused virosomes, membranes that may once have wrapped individual factories.

  5. Myxoma and vaccinia viruses bind differentially to human leukocytes.

    Science.gov (United States)

    Chan, Winnie M; Bartee, Eric C; Moreb, Jan S; Dower, Ken; Connor, John H; McFadden, Grant

    2013-04-01

    Myxoma virus (MYXV) and vaccinia virus (VACV), two distinct members of the family Poxviridae, are both currently being developed as oncolytic virotherapeutic agents. Recent studies have demonstrated that ex vivo treatment with MYXV can selectively recognize and kill contaminating cancerous cells from autologous bone marrow transplants without perturbing the engraftment of normal CD34(+) hematopoietic stem and progenitor cells. However, the mechanism(s) by which MYXV specifically recognizes and eliminates the cancer cells in the autografts is not understood. While little is known about the cellular attachment factor(s) exploited by MYXV for entry into any target cells, VACV has been shown to utilize cell surface glycosaminoglycans such as heparan sulfate (HS), the extracellular matrix protein laminin, and/or integrin β1. We have constructed MYXV and VACV virions tagged with the Venus fluorescent protein and compared their characteristics of binding to various human cancer cell lines as well as to primary human leukocytes. We report that the binding of MYXV or VACV to some adherent cell lines could be partially inhibited by heparin, but laminin blocked only VACV binding. In contrast to cultured fibroblasts, the binding of MYXV and VACV to a wide spectrum of primary human leukocytes could not be competed by either HS or laminin. Additionally, MYXV and VACV exhibited very different binding characteristics against certain select human leukocytes, suggesting that the two poxviruses utilize different cell surface determinants for the attachment to these cells. These results indicate that VACV and MYXV can exhibit very different oncolytic tropisms against some cancerous human leukocytes.

  6. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA.

    Directory of Open Access Journals (Sweden)

    Matthew G Cottingham

    2008-02-01

    Full Text Available The production, manipulation and rescue of a bacterial artificial chromosome clone of Vaccinia virus (VAC-BAC in order to expedite construction of expression vectors and mutagenesis of the genome has been described (Domi & Moss, 2002, PNAS99 12415-20. The genomic BAC clone was 'rescued' back to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA, now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full-length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A46R or B7R did not significantly affect CD8(+ T cell immunogenicity in BALB/c mice, but deletion of B15R enhanced specific CD8(+ T cell responses to one of two endogenous viral epitopes (from the E2 and F2 proteins, in accordance with published work (Staib et al., 2005, J. Gen. Virol.86, 1997-2006. In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+ T cells against an epitope from Plasmodium berghei was created using GalK counterselection to insert an antigen expression cassette lacking a tandem marker gene into the traditional thymidine kinase locus of MVA-BAC. MVA continues to feature prominently in clinical trials of recombinant vaccines against diseases such as HIV-AIDS, malaria and tuberculosis. Here we demonstrate in proof-of-concept experiments that MVA-BAC recombineering is a viable route to more rapid and efficient generation of new candidate mutant and recombinant

  7. Viral-mediated oncolysis is the most critical factor in the late-phase of the tumor regression process upon vaccinia virus infection

    Directory of Open Access Journals (Sweden)

    Yu Yong A

    2011-02-01

    Full Text Available Abstract Background In principle, the elimination of malignancies by oncolytic virotherapy could proceed by different mechanisms - e.g. tumor cell specific oncolysis, destruction of the tumor vasculature or an anti-tumoral immunological response. In this study, we analyzed the contribution of these factors to elucidate the responsible mechanism for regression of human breast tumor xenografts upon colonization with an attenuated vaccinia virus (VACV. Methods Breast tumor xenografts were analyzed 6 weeks post VACV infection (p.i.; regression phase by immunohistochemistry and mouse-specific expression arrays. Viral-mediated oncolysis was determined by tumor growth analysis combined with microscopic studies of intratumoral virus distribution. The tumor vasculature was morphologically characterized by diameter and density measurements and vessel functionality was analyzed by lectin perfusion and extravasation studies. Immunological aspects of viral-mediated tumor regression were studied in either immune-deficient mouse strains (T-, B-, NK-cell-deficient or upon cyclophosphamide-induced immunosuppression (MHCII+-cell depletion in nude mice. Results Late stage VACV-infected breast tumors showed extensive necrosis, which was highly specific to cancer cells. The tumor vasculature in infected tumor areas remained functional and the endothelial cells were not infected. However, viral colonization triggers hyperpermeability and dilatation of the tumor vessels, which resembled the activated endothelium in wounded tissue. Moreover, we demonstrated an increased expression of genes involved in leukocyte-endothelial cell interaction in VACV-infected tumors, which orchestrate perivascular inflammatory cell infiltration. The immunohistochemical analysis of infected tumors displayed intense infiltration of MHCII-positive cells and colocalization of tumor vessels with MHCII+/CD31+ vascular leukocytes. However, GI-101A tumor growth analysis upon VACV-infection in

  8. Efficacy and Safety of Doubly-Regulated Vaccinia Virus in a Mouse Xenograft Model of Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Muneyoshi Futami

    2017-09-01

    Full Text Available Multiple myeloma is a malignancy of plasma cells of the bone marrow. Although the prognosis is variable, no curative therapy has been defined. Vaccinia virus infects cancer cells and kills such cells in a variety of ways. These include direct infection, triggering of immunomediated cell death, and vascular collapse. The potential of the vaccinia virus as an anti-tumor therapy has attracted the attention of oncologists. Interestingly, our preliminary experiments revealed that myeloma cells were particularly susceptible to vaccinia virus. To exploit this susceptibility and to render vaccinia more myeloma specific, we generated thymidine-kinase-deleted microRNA (miRNA-regulated vaccinia viruses in which the essential viral gene B5R was regulated by miRNAs of normal human cells. Of the miRNAs examined, let-7a was found to be the most reliable in terms of regulating viral transmission. Exposure to unregulated vaccinia virus killed myeloma-transplanted severe combined immunodeficiency (SCID mice; the animals succumbed to viral toxicity. In contrast, the thymidine-kinase-deleted let-7a-regulated virus remained localized within myeloma cells, triggering tumor regression and improving overall survival. In conclusion, a thymidine-kinase-deleted let-7a-regulated vaccinia virus was safe and effective for mice, warranting clinical trials in humans.

  9. Reduced-calorie avocado paste attenuates metabolic factors associated with a hypercholesterolemic-high fructose diet in rats.

    Science.gov (United States)

    Pahua-Ramos, María Elena; Garduño-Siciliano, Leticia; Dorantes-Alvarez, Lidia; Chamorro-Cevallos, German; Herrera-Martínez, Julieta; Osorio-Esquivel, Obed; Ortiz-Moreno, Alicia

    2014-03-01

    The objective of this study was to evaluate the effect of reduced-calorie avocado paste on lipid serum profile, insulin sensitivity, and hepatic steatosis in rats fed a hypercholesterolemic-high fructose diet. Thirty five male Wistar rats were randomly separated in five groups: Control group (ground commercial diet); hypercholesterolemic diet plus 60% fructose solution (HHF group); hypercholesterolemic diet plus 60% fructose solution supplemented with avocado pulp (HHF+A group); hypercholesterolemic diet plus 60% fructose solution supplemented with reduced-calorie avocado paste (HHF+P group); and hypercholesterolemic diet plus 60% fructose solution supplemented with a reduced-calorie avocado paste plus fiber (HHF+FP group). The A, P, and FP were supplemented at 2 g/kg/d. The study was carried out for seven weeks. Rats belonging to the HHF group exhibited significantly (P ≤ 0.05) higher total cholesterol, triglycerides, and insulin levels in serum as well as lower insulin sensitivity than the control group. Supplementation with reduced-calorie avocado paste showed a significant (P ≤ 0.05) decrease in total cholesterol (43.1%), low-density lipoprotein (45.4%), and triglycerides (32.8%) in plasma as well as elevated insulin sensitivity compared to the HHF group. Additionally, the liver enzymes alanine aminotransferase and aspartate aminotransferase decreased significantly in the HHF-P group (39.8 and 35.1%, respectively). These results are likely due to biocompounds present in the reduced-calorie avocado paste, such as polyphenols, carotenoids, chlorophylls, and dietary fibre, which are capable of reducing oxidative stress. Therefore, reduced-calorie avocado paste attenuates the effects of a hypercholesterolemic-high fructose diet in rats.

  10. Leptomeningeal high signal intensity (ivy sign) on fluid-attenuated inversion-recovery (FLAIR) MR images in moyamoya disease

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Hirokazu [Department of Diagnostic Radiology, School of Medicine, Keio University, Tokyo 1608582 (Japan)]. E-mail: hirokazu_fujiwara@ybb.ne.jp; Momoshima, Suketaka [Department of Diagnostic Radiology, School of Medicine, Keio University, Tokyo 1608582 (Japan); Kuribayashi, Sachio [Department of Diagnostic Radiology, School of Medicine, Keio University, Tokyo 1608582 (Japan)

    2005-08-01

    Purpose: There are a few reports on leptomeningeal high signal intensity (LMHI: ivy sign) on fluid-attenuated inversion-recovery (FLAIR) images in moyamoya disease, but the feature of this finding has not been completely understood. The purpose of this study was to characterize LMHI on FLAIR images in moyamoya disease and to assess usefulness of this finding in the diagnosis of moyamoya disease in conventional MR imaging. Material and methods: MR imaging of 28 patients with moyamoya disease was retrospectively reviewed. The grade of LMHI on FLAIR images was classified as 'absent,' 'minimal,' 'moderate' and 'marked.' Fifty-four hemispheres of 28 patients (2 patients had unilateral disease) were assessed for the frequency of visualization and distribution of LMHI. The correlations between LMHI on FLAIR images, moyamoya vessels on T1- and T2-weighted images and MR angiography findings were also analyzed. Results: Moderate and marked LMHI was seen in 31 out of 54 hemispheres (57%). LMHI was seen more prominently in the frontal and parietal lobes than in the temporal and occipital lobes. Although there was a tendency for LMHI on FLAIR images to be prominent in groups with moderate and marked moyamoya vessels on T1- and T2-weighted images, there was no significant correlation. More prominent LMHI was observed in the hemispheres in which cortical branches of the middle cerebral arteries were poorly visualized on MR angiography. Conclusion: Leptomeningeal high signal intensity (ivy sign) on FLAIR images is predominantly seen in the frontal and parietal lobes. Because this sign can be seen in patients with unremarkable moyamoya vessels, LMHI is a useful sign in conventional MR imaging for the diagnosis of moyamoya disease.

  11. Derepression of a novel class of vaccinia virus genes upon DNA replication

    NARCIS (Netherlands)

    Vos, J C; Stunnenberg, H.G.

    1988-01-01

    A novel class of vaccinia virus genes, called intermediate, is expressed immediately post-replication and prior to the onset of late gene transcription. Intermediate transcription is dependent on trans-acting factors which are present in an active state in virus-infected cells prior to the onset of

  12. Effective tumor immunotherapy directed against an oncogene-encoded product using a vaccinia virus vector

    NARCIS (Netherlands)

    Bernards, R.A.; Destree, A.; McKenzie, S.; Gordon, E.; Weinberg, R.A.; Panicali, D.

    1987-01-01

    We have constructed a vaccinia virus recombinant that expresses the extracellular domain of the rat neu oncogene-encoded protein, a 185-kDa transmembrane glycoprotein termed p185. Strain NFS mice immunized with this recombinant virus developed a strong antibody response against the neu oncogene

  13. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    OpenAIRE

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in...

  14. Tea polyphenols alleviate high fat and high glucose-induced endothelial hyperpermeability by attenuating ROS production via NADPH oxidase pathway.

    Science.gov (United States)

    Zuo, Xuezhi; Tian, Chong; Zhao, Nana; Ren, Weiye; Meng, Yi; Jin, Xin; Zhang, Ying; Ding, Shibin; Ying, Chenjiang; Ye, Xiaolei

    2014-03-02

    Hyperglycemia-induced endothelial hyperpermeability is crucial to cardiovascular disorders and macro-vascular complications in diabetes mellitus. The objective of this study is to investigate the effects of green tea polyphenols (GTPs) on endothelial hyperpermeability and the role of nicotinamide adenine dinucleotide phosphate (NADPH) pathway. Male Wistar rats fed on a high fat diet (HF) were treated with GTPs (0, 0.8, 1.6, 3.2 g/L in drinking water) for 26 weeks. Bovine aortic endothelial cells (BAECs) were treated with high glucose (HG, 33 mmol/L) and GTPs (0.0, 0.4, or 4 μg/mL) for 24 hours in vitro. The endothelial permeabilities in rat aorta and monolayer BAECs were measured by Evans blue injection method and efflux of fluorescein isothiocyanate (FITC)-dextran, respectively. The reactive oxygen species (ROS) levels in rat aorta and monolayer BAECs were measured by dihydroethidium (DHE) and 2', 7'-dichloro-fluorescein diacetate (DCFH-DA) fluorescent probe, respectively. Protein levels of NADPH oxidase subunits were determined by Western-blot. HF diet-fed increased the endothelial permeability and ROS levels in rat aorta while HG treatments increased the endothelial permeability and ROS levels in cultured BAECs. Co-treatment with GTPs alleviated those changes both in vivo and in vitro. In in vitro studies, GTPs treatments protected against the HG-induced over-expressions of p22phox and p67phox. Diphenylene iodonium chloride (DPI), an inhibitor of NADPH oxidase, alleviated the hyperpermeability induced by HG. GTPs could alleviate endothelial hyperpermeabilities in HF diet-fed rat aorta and in HG treated BAECs. The decrease of ROS production resulting from down-regulation of NADPH oxidase contributed to the alleviation of endothelial hyperpermeability.

  15. An orally active Cannabis extract with high content in cannabidiol attenuates chemical induced intestinal inflammation and hypermotility in the mouse

    Directory of Open Access Journals (Sweden)

    Ester Pagano

    2016-10-01

    Full Text Available Anecdotal and scientific evidence suggests that Cannabis use may be beneficial in inflammatory bowel disease (IBD patients. Here, we have investigated the effect of a standardized Cannabis sativa extract with high content of cannabidiol (CBD, here named CBD BDS for CBD botanical drug substance, on mucosal inflammation and hypermotility in mouse models of intestinal inflammation. Colitis was induced in mice by intracolonic administration of dinitrobenzenesulfonic acid (DNBS. Motility was evaluated in the experimental model of intestinal hypermotility induced by irritant croton oil. CBD BDS or pure CBD were given - either intraperitoneally or by oral gavage - after the inflammatory insult (curative protocol. The amounts of CBD in the colon, brain and liver after the oral treatments were measured by HPLC coupled to ion trap-time of flight mass spectrometry. CBD BDS, both when given intraperitoneally and by oral gavage, decreased the extent of the damage (as revealed by the decrease in the colon weight/length ratio and myeloperoxidase activity in the DNBS model of colitis. It also reduced intestinal hypermotility (at doses lower than those required to affect transit in healthy mice in the croton oil model of intestinal hypermotility. Under the same experimental conditions, pure CBD did not ameliorate colitis while it normalized croton oil-induced hypermotility when given intraperitoneally (in a dose-related fashion or orally (only at one dose. In conclusion, CBD BDS, given after the inflammatory insult, attenuates injury and motility in intestinal models of inflammation. These findings sustain the rationale of combining CBD with other minor Cannabis constituents and support the clinical development of CBD BDS for IBD treatment.

  16. Diagnostic and Prognostic Significance of DSM-5 Attenuated Psychosis Syndrome in Services for Individuals at Ultra High Risk for Psychosis.

    Science.gov (United States)

    Fusar-Poli, Paolo; De Micheli, Andrea; Cappucciati, Marco; Rutigliano, Grazia; Davies, Cathy; Ramella-Cravaro, Valentina; Oliver, Dominic; Bonoldi, Ilaria; Rocchetti, Matteo; Gavaghan, Lauren; Patel, Rashmi; McGuire, Philip

    2017-05-17

    The diagnostic and prognostic significance of the DSM-5-defined Attenuated Psychosis Syndrome (DSM-5-APS) in individuals undergoing an ultra high risk (UHR) clinical assessment for suspicion of psychosis risk is unknown. Prospective cohort study including all consecutive help-seeking individuals undergoing both a DSM-5-APS and a Comprehensive Assessment of At Risk Mental States (CAARMS 12/2006) assessment for psychosis risk at the Outreach and Support in South London (OASIS) UHR service (March 2013-April 2014). The diagnostic significance of DSM-5-APS was assessed with percent overall agreement, prevalence bias adjusted kappa, Bowker's test, Stuart-Maxwell test, residual analysis; the prognostic significance with Cox regression, Kaplan-Meier failure function, time-dependent area under the curve (AUC) and net benefits analysis. The impact of specific revisions of the DSM-5-APS was further tested. In 203 help-seeking individuals undergoing UHR assessment, the agreement between the DSM-5-APS and the CAARMS 12/2006 was only moderate (kappa 0.59). Among 142 nonpsychotic cases, those meeting DSM-5-APS criteria had a 5-fold probability (HR = 5.379) of developing psychosis compared to those not meeting DSM-5-APS criteria, with a 21-month cumulative risk of psychosis of 28.17% vs 6.49%, respectively. The DSM-5-APS prognostic accuracy was acceptable (AUC 0.76 at 24 months) and similar to the CAARMS 12/2006. The DSM-5-APS designation may be clinically useful to guide the provision of indicated interventions within a 7%-35% (2-year) range of psychosis risk. The removal of the criterion E or C of the DSM-5-APS may improve its prognostic performance and transdiagnostic value. The DSM-5-APS designation may be clinically useful in individuals accessing clinical services for psychosis prevention.

  17. Cannabis-induced attenuated psychotic symptoms: implications for prognosis in young people at ultra-high risk for psychosis.

    Science.gov (United States)

    McHugh, M J; McGorry, P D; Yung, A R; Lin, A; Wood, S J; Hartmann, J A; Nelson, B

    2017-03-01

    Cannabis use shows a robust dose-dependent relationship with psychosis risk among the general population. Despite this, it has been difficult to link cannabis use with risk for transitioning to a psychotic disorder among individuals at ultra-high risk (UHR) for psychosis. The present study examined UHR transition risk as a function of cannabis use characteristics which vary substantially between individuals including age of first use, cannabis abuse severity and a history of cannabis-induced attenuated psychotic symptoms (APS). Participants were 190 UHR individuals (76 males) recruited at entry to treatment between 2000 and 2006. They completed a comprehensive baseline assessment including a survey of cannabis use characteristics during the period of heaviest use. Outcome was transition to a psychotic disorder, with mean time to follow-up of 5.0 years (range 2.4-8.7 years). A history of cannabis abuse was reported in 58% of the sample. Of these, 26% reported a history of cannabis-induced APS. These individuals were 4.90 (95% confidence interval 1.93-12.44) times more likely to transition to a psychotic disorder (p = 0.001). Greater severity of cannabis abuse also predicted transition to psychosis (p = 0.036). However, this effect was mediated by higher abuse severity among individuals with a history of cannabis-induced APS. Findings suggest that cannabis use poses risk in a subpopulation of UHR individuals who manifest cannabis-induced APS. Whether this reflects underlying genetic vulnerability requires further study. Nevertheless, findings reveal an important early marker of risk with potentially significant prognostic utility for UHR individuals.

  18. Fluid dynamics analysis of a gas attenuator for X-ray FELs under high-repetition-rate operation.

    Science.gov (United States)

    Yang, Bo; Wu, Juhao; Raubenheimer, Tor O; Feng, Yiping

    2017-05-01

    Newtonian fluid dynamics simulations were performed using the Navier-Stokes-Fourier formulations to elucidate the short time-scale (µs and longer) evolution of the density and temperature distributions in an argon-gas-filled attenuator for an X-ray free-electron laser under high-repetition-rate operation. Both hydrodynamic motions of the gas molecules and thermal conductions were included in a finite-volume calculation. It was found that the hydrodynamic wave motions play the primary role in creating a density depression (also known as a filament) by advectively transporting gas particles away from the X-ray laser-gas interaction region, where large pressure and temperature gradients have been built upon the initial energy deposition via X-ray photoelectric absorption and subsequent thermalization. Concurrent outward heat conduction tends to reduce the pressure in the filament core region, generating a counter gas flow to backfill the filament, but on an initially slower time scale. If the inter-pulse separation is sufficiently short so the filament cannot recover, the depth of the filament progressively increases as the trailing pulses remove additional gas particles. Since the rate of hydrodynamic removal decreases while the rate of heat conduction back flow increases as time elapses, the two competing mechanisms ultimately reach a dynamic balance, establishing a repeating pattern for each pulse cycle. By performing simulations at higher repetition rates but lower per pulse energies while maintaining a constant time-averaged power, the amplitude of the hydrodynamic motion per pulse becomes smaller, and the evolution of the temperature and density distributions approach asymptotically towards, as expected, those calculated for a continuous-wave input of the equivalent power.

  19. Lack of efficacy of aurintricarboxylic acid and ethacrynic acid against vaccinia virus respiratory infections in mice.

    Science.gov (United States)

    Smee, Donald F; Hurst, Brett L; Wong, Min-Hui

    2010-04-14

    Aurintricarboxylic acid (ATA) and ethacrynic acid (ECA) have been reported to exhibit antiviral activity against vaccinia virus infections in cell culture by inhibiting early and late gene transcription, respectively. The purpose of this work was to determine if these inhibitors would effectively treat vaccinia virus infections in mice, which has not previously been studied. ECA was investigated by cell culture plaque reduction assay for the inhibition of cowpox and vaccinia virus infections to clarify issues regarding its potency and selectivity. Mice infected intranasally with vaccinia virus were treated by intraperitoneal route twice daily for 5 days with ATA (10 and 30 mg/kg/day) and ECA (15 and 30 mg/kg/day) or once daily for 2 days with cidofovir (100 mg/kg/day). ECA caused 50% inhibition of virus plaque formation at 20-79 muM in four cultured cell lines, with 50% cytotoxicity at 84-173 muM, giving low (1.3-4.2) selectivity index values. Preliminary toxicity tests in uninfected mice indicated that ATA and ECA were both overtly toxic at 100 mg/kg/day. No protection from mortality was afforded by treatment of vaccinia virus infections with ATA or ECA, but 100% survival was achieved in the cidofovir group. ATA- and ECA-treated mice died significantly sooner than placebo-treated animals, indicating that these compounds exacerbated the infection. Both ATA and ECA lack antiviral potency and selectivity in cell culture. The compounds were ineffective in treating mice at intraperitoneal doses of

  20. STUDY ON THE EFFECT OF THE SELF-ATTENUATION COEFFICIENT ON γ-RAY DETECTOR EFFICIENCY CALCULATED AT LOW AND HIGH ENERGY REGIONS

    Directory of Open Access Journals (Sweden)

    AHMED. M. EL-KHATIB

    2014-04-01

    Full Text Available The present work used the efficiency transfer method used to calculate the full energy peak efficiency (FEPE curves of the (2“*2” & 3“*3” NaI (Tl detectors based on the effective solid angle subtended between the source and the detector. The study covered the effect of the self attenuation coefficient of the source matrix (with a radius greater than the detector's radius on the detector efficiency. 152 An Eu aqueous radioactive source covering the energy range from 121.78 keV up to 1408.01 keV was used. In this study an empirical formula was deduced to calculate the difference between the measured and the calculated efficiencies [without self attenuation] at low and high energy regions. A proper balance between the measured and calculated efficiencies [with self attenuation] was achieved with discrepancies less than 3%, while reaching 39% for calculating values [without self attenuation] due to working with large sources, or for low photon energies.

  1. Study on the effect of the self-attenuation on γ-ray detect or efficiency calculated at low and high energy regions

    Energy Technology Data Exchange (ETDEWEB)

    El-khatib, Ahmed M; Badawi, Mohamed S. [Physics Department, Faculty of Science, Alexandria University, Alexandria (Egypt); Thabet, Abouzeid A. [Dept. of Medical Equipment Technology, Pharos University, Alexandria (Egypt); Elazher, Mohamd A. [Arab Academy for Science, Technology and Maritime Transport, Alexandria (Egypt); Salem, Bohaysa A. [Basic Science Department, Faculty of Physical Therapy, Pharos University, Alexandria (Egypt)

    2014-04-15

    The present work used the efficiency transfer method used to calculate the full energy peak efficiency (FEPE) curves of the ({sup 2} x {sup 2} and {sup 3} x {sup 3}) NaI (Tl) detectors based on the effective solid angle subtended between the source and the detector. The study covered the effect of the self attenuation coefficient of the source matrix (with a radius greater than the detector's radius) on the detector efficiency. {sup 152}An Eu aqueous radioactive source covering the energy range from 121.78 keV up to 1408.01 keV was used. In this study an empirical formula was deduced to calculate the difference between the measured and the calculated efficiencies [without self attenuation] at low and high energy regions. A proper balance between the measured and calculated efficiencies [with self attenuation] was achieved with discrepancies less than 3%, while reaching 39% for calculating values [without self attenuation] due to working with large sources, or for low photon energies.

  2. A loss of function analysis of host factors influencing Vaccinia virus replication by RNA interference.

    Directory of Open Access Journals (Sweden)

    Philippa M Beard

    Full Text Available Vaccinia virus (VACV is a large, cytoplasmic, double-stranded DNA virus that requires complex interactions with host proteins in order to replicate. To explore these interactions a functional high throughput small interfering RNA (siRNA screen targeting 6719 druggable cellular genes was undertaken to identify host factors (HF influencing the replication and spread of an eGFP-tagged VACV. The experimental design incorporated a low multiplicity of infection, thereby enhancing detection of cellular proteins involved in cell-to-cell spread of VACV. The screen revealed 153 pro- and 149 anti-viral HFs that strongly influenced VACV replication. These HFs were investigated further by comparisons with transcriptional profiling data sets and HFs identified in RNAi screens of other viruses. In addition, functional and pathway analysis of the entire screen was carried out to highlight cellular mechanisms involved in VACV replication. This revealed, as anticipated, that many pro-viral HFs are involved in translation of mRNA and, unexpectedly, suggested that a range of proteins involved in cellular transcriptional processes and several DNA repair pathways possess anti-viral activity. Multiple components of the AMPK complex were found to act as pro-viral HFs, while several septins, a group of highly conserved GTP binding proteins with a role in sequestering intracellular bacteria, were identified as strong anti-viral VACV HFs. This screen has identified novel and previously unexplored roles for cellular factors in poxvirus replication. This advancement in our understanding of the VACV life cycle provides a reliable knowledge base for the improvement of poxvirus-based vaccine vectors and development of anti-viral theraputics.

  3. Moderate to High Levels of Cardiorespiratory Fitness Attenuate the Effects of Triglyceride to High-Density Lipoprotein Cholesterol Ratio on Coronary Heart Disease Mortality in Men.

    Science.gov (United States)

    Farrell, Stephen W; Finley, Carrie E; Barlow, Carolyn E; Willis, Benjamin L; DeFina, Laura F; Haskell, William L; Vega, Gloria L

    2017-12-01

    To examine the prospective relationships among cardiorespiratory fitness (CRF), fasting blood triglyceride to high density lipoprotein cholesterol ratio (TG:HDL-C), and coronary heart disease (CHD) mortality in men. A total of 40,269 men received a comprehensive baseline clinical examination between January 1, 1978, and December 31, 2010. Their CRF was determined from a maximal treadmill exercise test. Participants were divided into CRF categories of low, moderate, and high fit by age group and by TG:HDL-C quartiles. Hazard ratios for CHD mortality were computed using Cox regression analysis. A total of 556 deaths due to CHD occurred during a mean ± SD of 16.6±9.7 years (669,678 man-years) of follow-up. A significant positive trend in adjusted CHD mortality was shown across decreasing CRF categories (P for trendrisk of CHD mortality in each TG:HDL-C quartile was significantly attenuated in men with moderate to high CRF compared with men with low CRF. These results suggest that assessment of CRF and TG:HDL-C should be included for routine CHD mortality risk assessment and risk management. Copyright © 2017 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  4. Ultrasound imaging of immersed plates using high-order Lamb modes at their low attenuation frequency bands

    Science.gov (United States)

    Takiy, Aline E.; Kitano, Cláudio; Higuti, Ricardo T.; Granja, Silvio C. G.; Prado, Vander T.; Elvira, Luis; Martínez-Graullera, Oscar

    2017-11-01

    This paper focuses on the use of a Lamb wave-based methodology for ultrasound imaging of immersed plate structures. In these cases Lamb waves can be strongly attenuated due to leaky waves and viscous losses in the liquid, but there are low attenuation frequency bands that may be used for NDT applications. Experimental measurements were conducted to validate the existence of these low attenuation frequency bands, which were also theoretically predicted for some propagation modes, between the frequencies-thickness products of 0.5 MHz mm and 9.0 MHz mm. Using a 5 MHz linear-array and phased-array techniques, A1 and S1 modes are used to obtain images of an immersed aluminum plate with artificial defects. The signals are post-processed in order to select the desired propagation mode and to obtain an image with dynamic focusing in reception. While the A1 mode is strongly attenuated, the S1 mode, at 3.4 MHz mm, can be used to detect and localize defects in the immersed plate.

  5. Dixon Sequence with Superimposed Model-Based Bone Compartment Provides Highly Accurate PET/MR Attenuation Correction of the Brain.

    Science.gov (United States)

    Koesters, Thomas; Friedman, Kent P; Fenchel, Matthias; Zhan, Yiqiang; Hermosillo, Gerardo; Babb, James; Jelescu, Ileana O; Faul, David; Boada, Fernando E; Shepherd, Timothy M

    2016-06-01

    Simultaneous PET/MR of the brain is a promising technology for characterizing patients with suspected cognitive impairment or epilepsy. Unlike CT, however, MR signal intensities do not correlate directly with PET photon attenuation correction (AC), and inaccurate radiotracer SUV estimation can limit future PET/MR clinical applications. We tested a novel AC method that supplements standard Dixon-based tissue segmentation with a superimposed model-based bone compartment. We directly compared SUV estimation between MR-based AC and reference CT AC in 16 patients undergoing same-day PET/CT and PET/MR with a single (18)F-FDG dose for suspected neurodegeneration. Three Dixon-based MR AC methods were compared with CT: standard Dixon 4-compartment segmentation alone, Dixon with a superimposed model-based bone compartment, and Dixon with a superimposed bone compartment and linear AC optimized specifically for brain tissue. The brain was segmented using a 3-dimensional T1-weighted volumetric MR sequence, and SUV estimations were compared with CT AC for whole-image, whole-brain, and 91 FreeSurfer-based regions of interest. Modifying the linear AC value specifically for brain and superimposing a model-based bone compartment reduced the whole-brain SUV estimation bias of Dixon-based PET/MR AC by 95% compared with reference CT AC (P < 0.05), resulting in a residual -0.3% whole-brain SUVmean bias. Further, brain regional analysis demonstrated only 3 frontal lobe regions with an SUV estimation bias of 5% or greater (P < 0.05). These biases appeared to correlate with high individual variability in frontal bone thickness and pneumatization. Bone compartment and linear AC modifications result in a highly accurate MR AC method in subjects with suspected neurodegeneration. This prototype MR AC solution appears equivalent to other recently proposed solutions and does not require additional MR sequences and scanning time. These data also suggest that exclusively model-based MR AC

  6. Opuntia ficus-indica seed attenuates hepatic steatosis and promotes M2 macrophage polarization in high-fat diet-fed mice.

    Science.gov (United States)

    Kang, Jung-Woo; Shin, Jun-Kyu; Koh, Eun-Ji; Ryu, Hyojeong; Kim, Hyoung Ja; Lee, Sun-Mee

    2016-04-01

    Opuntia ficus-indica (L.) is a popular edible plant that possesses considerable nutritional value and exhibits diverse biological actions including anti-inflammatory and antidiabetic activities. In this study, we hypothesized that DWJ504, an extract of O ficus-indica seed, would ameliorate hepatic steatosis and inflammation by regulating hepatic de novo lipogenesis and macrophage polarization against experimental nonalcoholic steatohepatitis. Mice were fed a normal diet or a high-fat diet (HFD) for 10 weeks. DWJ504 (250, 500, and 1000 mg/kg) or vehicle (0.5% carboxymethyl cellulose) were orally administered for the last 4 weeks of the 10-week HFD feeding period. DWJ504 treatment remarkably attenuated HFD-induced increases in hepatic lipid content and hepatocellular damage. DWJ504 attenuated increases in sterol regulatory element-binding protein 1 and carbohydrate-responsive element-binding protein expression and a decrease in carnitine palmitoyltransferase 1A. Although DWJ504 augmented peroxisome proliferator-activated receptor α protein expression, it attenuated peroxisome proliferator-activated receptor γ expression. Moreover, DWJ504 promoted hepatic M2 macrophage polarization as indicated by attenuation of the M1 marker genes and enhancement of M2 marker genes. Finally, DWJ504 attenuated expression of toll-like receptor 4, nuclear factor κB, tumor necrosis factor α, interleukin 6, TIR-domain-containing adapter-inducing interferon β, and interferon β levels. Our results demonstrate that DWJ504 prevented intrahepatic lipid accumulation, induced M2 macrophage polarization, and suppressed the toll-like receptor 4-mediated inflammatory signaling pathway. Thus, DWJ504 has therapeutic potential in the prevention of nonalcoholic fatty liver disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Structure of vaccinia virus thymidine kinase in complex with dTTP: insights for drug design

    Directory of Open Access Journals (Sweden)

    Balzarini Jan

    2006-10-01

    Full Text Available Abstract Background Development of countermeasures to bioterrorist threats such as those posed by the smallpox virus (variola, include vaccination and drug development. Selective activation of nucleoside analogues by virus-encoded thymidine (dThd kinases (TK represents one of the most successful strategies for antiviral chemotherapy as demonstrated for anti-herpes drugs. Vaccinia virus TK is a close orthologue of variola TK but also shares a relatively high sequence identity to human type 2 TK (hTK, thus achieving drug selectivity relative to the host enzyme is challenging. Results In order to identify any differences compared to hTK that may be exploitable in drug design, we have determined the crystal structure of VVTK, in complex with thymidine 5'-triphosphate (dTTP. Although most of the active site residues are conserved between hTK and VVTK, we observe a difference in conformation of residues Asp-43 and Arg-45. The equivalent residues in hTK hydrogen bond to dTTP, whereas in subunit D of VVTK, Asp-43 and Arg-45 adopt a different conformation preventing interaction with this nucleotide. Asp-43 and Arg-45 are present in a flexible loop, which is disordered in subunits A, B and C. The observed difference in conformation and flexibility may also explain the ability of VVTK to phosphorylate (South-methanocarbathymine whereas, in contrast, no substrate activity with hTK is reported for this compound. Conclusion The difference in conformation for Asp-43 and Arg-45 could thus be used in drug design to generate VVTK/Variola TK-selective nucleoside analogue substrates and/or inhibitors that have lower affinity for hTK.

  8. Cellular expression of a functional nodavirus RNA replicon from vaccinia virus vectors.

    Science.gov (United States)

    Ball, L A

    1992-04-01

    RNA replication provides a powerful means for the amplification of RNA, but to date it has been found to occur naturally only among RNA viruses. In an attempt to harness this process for the amplification of heterologous mRNAs, both an RNA replicase and its corresponding RNA templates have been expressed in functional form, using vaccinia virus-bacteriophage T7 RNA polymerase vectors. Plasmids were constructed which contained in 5'-to-3' order (i) a bacteriophage T7 promoter; (ii) a full-length cDNA encoding either the RNA replicase (RNA 1) or the coat protein (RNA 2) of flock house virus (FHV), (iii) a cDNA sequence that encoded the self-cleaving ribozyme of satellite tobacco ringspot virus, and (iv) a T7 transcriptional terminator. Both in vitro and in vivo, circular plasmids of this structure were transcribed by T7 RNA polymerase to produce RNAs with sizes that closely resembled those of the two authentic FHV genomic RNAs, RNA 1 and RNA 2. In baby hamster kidney cells that expressed authentic FHV RNA replicase, the RNA 2 (coat protein) transcripts were accurately replicated. Moreover, the RNA 1 (replicase) transcripts directed the synthesis of an enzyme that could replicate not only authentic virion-derived FHV RNA but also the plasmid-derived transcripts themselves. Under the latter conditions, replicative amplification of the RNA transcripts ensued and resulted in a high rate of synthesis of the encoded proteins. This successful expression from a DNA vector of the complex biological process of RNA replication will greatly facilitate studies of its mechanism and is a major step towards the goal of harnessing RNA replication for mRNA amplification.

  9. Metformin attenuates the exacerbation of the allergic eosinophilic inflammation in high fat-diet-induced obesity in mice.

    Directory of Open Access Journals (Sweden)

    Marina Ciarallo Calixto

    Full Text Available A positive relationship between obesity and asthma has been well documented. The AMP-activated protein kinase (AMPK activator metformin reverses obesity-associated insulin resistance (IR and inhibits different types of inflammatory responses. This study aimed to evaluate the effects of metformin on the exacerbation of allergic eosinophilic inflammation in obese mice. Male C57BL6/J mice were fed for 10 weeks with high-fat diet (HFD to induce obesity. The cell infiltration and inflammatory markers in bronchoalveolar lavage (BAL fluid and lung tissue were evaluated at 48 h after ovalbumin (OVA challenge. HFD obese mice displayed peripheral IR that was fully reversed by metformin (300 mg/kg/day, two weeks. OVA-challenge resulted in higher influx of total cell and eosinophils in lung tissue of obese mice compared with lean group. As opposed, the cell number in BAL fluid of obese mice was reduced compared with lean group. Metformin significantly reduced the tissue eosinophil infiltration and prevented the reduction of cell counts in BAL fluid. In obese mice, greater levels of eotaxin, TNF-α and NOx, together with increased iNOS protein expression were observed, all of which were normalized by metformin. In addition, metformin nearly abrogated the binding of NF-κB subunit p65 to the iNOS promoter gene in lung tissue of obese mice. Lower levels of phosphorylated AMPK and its downstream target acetyl CoA carboxylase (ACC were found in lung tissue of obese mice, which were restored by metformin. In separate experiments, the selective iNOS inhibitor aminoguanidine (20 mg/kg, 3 weeks and the anti-TNF-α mAb (2 mg/kg significantly attenuated the aggravation of eosinophilic inflammation in obese mice. In conclusion, metformin inhibits the TNF-α-induced inflammatory signaling and NF-κB-mediated iNOS expression in lung tissue of obese mice. Metformin may be a good pharmacological strategy to control the asthma exacerbation in obese individuals.

  10. Mozart K.448 attenuates spontaneous absence seizure and related high-voltage rhythmic spike discharges in Long Evans rats.

    Science.gov (United States)

    Lin, Lung-Chang; Juan, Chun-Ting; Chang, Hsueh-Wen; Chiang, Ching-Tai; Wei, Ruey-Chang; Lee, Mei-Wen; Mok, Hin-Kiu; Yang, Rei-Cheng

    2013-05-01

    Recent research has revealed more evidence supporting the positive effects of music on humans and animals. However, evidence of music's effects on improving epilepsy in animals is sparse. This study aimed to clarify the influence of Mozart's music in Long Evans rats, which are characterized by spontaneous absence epilepsy (SAE) and high-voltage rhythmic spike (HVRS) discharges. Continuous electroencephalograms comprised of HVRS discharges, and behavioral performance were recorded in Long Evans rats (n=5) before, during, and after exposure to the Mozart's Sonata for Two Pianos in D Major, K.448 (Mozart K.448). The same evaluation was repeated after they had been subjected to daily exposure of the music for 20 days. Seizure frequencies and spontaneous HVRS discharges were reduced in all of the SAE rats during and after music exposure compared with the pre-music stage. The average seizure frequencies were 79.8±24.6, 48±15.2, and 33±12.1/h before, during, and after music exposure, respectively. The average run of spike episodes were 84.6±18.4, 52±17.8, and 36.8±16.9/h before, during, and after music exposure, respectively. The seizure frequencies and related run of spike episodes decreased by 39.8% and 38.5% during, and 58.6% and 56.6% post music exposure, respectively. The average run of spike durations and spike numbers also showed significant decreases (reduction by 47.1%, 47.8% during music and 60.8%, 61.3% post music). After daily music exposure for 20 days, the number of HVRS discharges and seizure frequencies during and after music exposure, however, showed no further accumulative reduction or adaptation effect. These results suggest that Mozart K.448 had a positive short-term effect in attenuating the spontaneous HVRS discharges in Long Evans rats. However, the mechanism needs further investigation. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Lung attenuation measurements in healthy young adults.

    NARCIS (Netherlands)

    Smit, H.J.M.; Golding, R.P.; Schramel, F.M.N.H.; Devillé, W.L.; Manoliu, R.A.; Postmus, P.E.

    2003-01-01

    Background: High-resolution computed tomography (HRCT) attenuation measurements may be more sensitive in finding early emphysematous changes in relatively young subjects than lung function measurements. Objectives: To define lung attenuation parameters in smokers and never-smokers. Methods: A

  12. Use of vaccinia virus vectors to study protein processing in human disease. Normal nerve growth factor processing and secretion in cultured fibroblasts from patients with familial dysautonomia.

    Science.gov (United States)

    Edwards, R H; Rutter, W J

    1988-07-01

    Familial dysautonomia is a hereditary disorder that affects autonomic and sensory neurons. Nerve growth factor (NGF) is required for the normal development of sympathetic and sensory neurons and it has been postulated that an abnormality involving NGF may be responsible for familial dysautonomia. Previous studies have shown that the beta-NGF gene is not linked to the disease. However, NGF appears to be abnormal by immunochemical assays; the putative altered form of NGF could result from a disturbance in the processing pathway. To study the processing of the 35-kD glycosylated NGF precursor and the secretion of NGF in familial dysautonomia, we have employed a recombinant vaccinia virus vector to express high levels of NGF mRNA in primary fibroblast cultures from patients with the disorder; the processing pathway was then studied directly. Cells from several unrelated patients all produce the same 35-kD NGF precursor, process this normally to NGF within the cell, and release NGF into the medium. There are no differences in the ability of cells from patients and from unaffected relatives to process and secrete NGF. The use of similar recombinant vaccinia virus vectors to express proteins at high level in primary cell lines should facilitate the detection of posttranslational processing defects in a variety of human disorders.

  13. Characterization and attenuation study on tannin-added Rhizophora spp. particleboard at high energy photon and electron

    Science.gov (United States)

    Yusof, Mohd Fahmi Mohd; Hamid, Puteri Nor Khatijah Abd; Tajuddin, Abd Aziz; Abdullah, Reduan; Hashim, Rokiah; Bauk, Sabar; Isa, Norriza Mohd; Isa, Muhammad Jamal Md

    2017-01-01

    The effective atomic number of tannin-added Rhizophora spp. particleboards was determined based on elemental composition using Energy Dispersive X-ray Analysis (EDXA). The value of mass attenuation coefficients were measured using 137Cs and 60Co gamma energies. The attenuation properties of PDD curves and beam profile of tannin-added Rhizophora spp. particleboards were investigated using Gafchromic EBT2 film at 6 MV photon and 6 MeV electrons and compared to the value in water and solid water phantoms. The results showed that tannin-added Rhizophora spp. particleboards having effective atomic number close to the value of water. The mass attenuation coefficients were near to the value of water with χ2 values of 0.018 and 0.357 to 137Cs and 60Co gamma energies respectively. The PDD of tannin-added Rhizophora spp. particleboards at 6 MV photons showed good agreement within 3.21 and 5.91% to that in solid water phantoms and water respectively. The PDD at 6 MeV electrons showed a good agreement within 3.32 and 3.12% to that in solid water phantoms and water respectively. The depth of R50 and R90 in tannin-added Rhizophora spp. also showed a good agreement to that in water and solid water pahtoms. Lower surface dose was observed in tannin-added Rhizophora spp. particleboards at electron beams in comparison to solid water phantoms and water.

  14. Cold-Adapted Viral Attenuation (CAVA: Highly Temperature Sensitive Polioviruses as Novel Vaccine Strains for a Next Generation Inactivated Poliovirus Vaccine.

    Directory of Open Access Journals (Sweden)

    Barbara P Sanders

    2016-03-01

    Full Text Available The poliovirus vaccine field is moving towards novel vaccination strategies. Withdrawal of the Oral Poliovirus Vaccine and implementation of the conventional Inactivated Poliovirus Vaccine (cIPV is imminent. Moreover, replacement of the virulent poliovirus strains currently used for cIPV with attenuated strains is preferred. We generated Cold-Adapted Viral Attenuation (CAVA poliovirus strains by serial passage at low temperature and subsequent genetic engineering, which contain the capsid sequences of cIPV strains combined with a set of mutations identified during cold-adaptation. These viruses displayed a highly temperature sensitive phenotype with no signs of productive infection at 37°C as visualized by electron microscopy. Furthermore, decreases in infectious titers, viral RNA, and protein levels were measured during infection at 37°C, suggesting a block in the viral replication cycle at RNA replication, protein translation, or earlier. However, at 30°C, they could be propagated to high titers (9.4-9.9 Log10TCID50/ml on the PER.C6 cell culture platform. We identified 14 mutations in the IRES and non-structural regions, which in combination induced the temperature sensitive phenotype, also when transferred to the genomes of other wild-type and attenuated polioviruses. The temperature sensitivity translated to complete absence of neurovirulence in CD155 transgenic mice. Attenuation was also confirmed after extended in vitro passage at small scale using conditions (MOI, cell density, temperature anticipated for vaccine production. The inability of CAVA strains to replicate at 37°C makes reversion to a neurovirulent phenotype in vivo highly unlikely, therefore, these strains can be considered safe for the manufacture of IPV. The CAVA strains were immunogenic in the Wistar rat potency model for cIPV, inducing high neutralizing antibody titers in a dose-dependent manner in response to D-antigen doses used for cIPV. In combination with the

  15. Detailed analysis of petroleum hydrocarbon attenuation in biopiles by high-performance liquid chromatography followed by comprehensive two-dimensional gas chromatography.

    Science.gov (United States)

    Mao, Debin; Lookman, Richard; Van De Weghe, Hendrik; Van Look, Dirk; Vanermen, Guido; De Brucker, Nicole; Diels, Ludo

    2009-02-27

    Enhanced bioremediation of petroleum hydrocarbons in two biopiles was quantified by high-performance liquid chromatography (HPLC) followed by comprehensive two-dimensional gas chromatography (GCXGC). The attenuation of 34 defined hydrocarbon classes was calculated by HPLC-GCXGC analysis of representative biopile samples at start-up and after 18 weeks of biopile operation. In general, a-cyclic alkanes were most efficiently removed from the biopiles, followed by monoaromatic hydrocarbons. Cycloalkanes and polycyclic aromatic hydrocarbons (PAHs) were more resistant to degradation. A-cyclic biomarkers farnesane, trimethyl-C13, norpristane, pristane and phytane dropped to only about 10% of their initial concentrations. On the other hand, C29-C31 hopane concentrations remained almost unaltered after 18 weeks of biopile operation, confirming their resistance to biodegradation. They are thus reliable indicators to estimate attenuation potential of petroleum hydrocarbons in biopile processed soils.

  16. Joint inflammation and early degeneration induced by high-force reaching are attenuated by ibuprofen in an animal model of work-related musculoskeletal disorder.

    Science.gov (United States)

    Driban, Jeffrey B; Barr, Ann E; Amin, Mamta; Sitler, Michael R; Barbe, Mary F

    2011-01-01

    We used our voluntary rat model of reaching and grasping to study the effect of performing a high-repetition and high-force (HRHF) task for 12 weeks on wrist joints. We also studied the effectiveness of ibuprofen, administered in the last 8 weeks, in attenuating HRHF-induced changes in these joints. With HRHF task performance, ED1+ and COX2+ cells were present in subchondral radius, carpal bones and synovium; IL-1alpha and TNF-alpha increased in distal radius/ulna/carpal bones; chondrocytes stained with Terminal deoxynucleotidyl Transferase- (TDT-) mediated dUTP-biotin nick end-labeling (TUNEL) increased in wrist articular cartilages; superficial structural changes (e.g., pannus) and reduced proteoglycan staining were observed in wrist articular cartilages. These changes were not present in normal controls or ibuprofen treated rats, although IL-1alpha was increased in reach limbs of trained controls. HRHF-induced increases in serum C1,2C (a biomarker of collagen I and II degradation), and the ratio of collagen degradation to synthesis (C1,2C/CPII; the latter a biomarker of collage type II synthesis) were also attenuated by ibuprofen. Thus, ibuprofen treatment was effective in attenuating HRHF-induced inflammation and early articular cartilage degeneration.

  17. Improved clinical workflow for simultaneous whole-body PET/MRI using high-resolution CAIPIRINHA-accelerated MR-based attenuation correction.

    Science.gov (United States)

    Freitag, Martin T; Fenchel, Matthias; Bäumer, Philipp; Heußer, Thorsten; Rank, Christopher M; Kachelrieß, Marc; Paech, Daniel; Kopka, Klaus; Bickelhaupt, Sebastian; Dimitrakopoulou-Strauss, Antonia; Maier-Hein, Klaus; Floca, Ralf; Ladd, Mark E; Schlemmer, Heinz-Peter; Maier, Florian

    2017-11-01

    To explore the value and reproducibility of a novel magnetic resonance based attenuation correction (MRAC) using a CAIPIRINHA-accelerated T1-weighted Dixon 3D-VIBE sequence for whole-body PET/MRI compared to the clinical standard. The PET raw data of 19 patients from clinical routine were reconstructed with standard MRAC (MRACstd) and the novel MRAC (MRACcaipi), a prototype CAIPIRINHA accelerated Dixon 3D-VIBE sequence, both acquired in 19 s/bed position. Volume of interests (VOIs) for liver, lung and all voxels of the total image stack were created to calculate standardized uptake values (SUVmean) followed by inter-method agreement (Passing-Bablok regression, Bland-Altman analysis). A voxel-wise SUV comparison per patient was performed for intra-individual correlation between MRACstd and MRACcaipi. Difference images (MRACstd-MRACcaipi) of attenuation maps and SUV images were calculated. The image quality of in/opposed-phase water and fat images obtained from MRACcaipi was assessed by two readers on a 5-point Likert-scale including intra-class coefficients for inter-reader agreement. SUVmean correlations of VOIs demonstrated high linearity (0.95attenuation correction by providing a high spatial resolution DIXON-based dataset suited for diagnostic assessment towards time-efficient whole-body PET/MRI. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous Group 1 Brazilian Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Felipe L Assis

    Full Text Available Since 1999, several Vaccinia virus (VACV isolates, the etiological agents of bovine vaccinia (BV, have been frequently isolated and characterized with various biological and molecular methods. The results from these approaches have grouped these VACV isolates into two different clusters. This dichotomy has elicited debates surrounding the origin of the Brazilian VACV and its epidemiological significance. To ascertain vital information to settle these debates, we and other research groups have made efforts to identify molecular markers to discriminate VACV from other viruses of the genus Orthopoxvirus (OPV and other VACV-BR groups. In this way, some genes have been identified as useful markers to discriminate between the VACV-BR groups. However, new markers are needed to infer ancestry and to correlate each sample or group with its unique epidemiological and biological features. The aims of this work were to characterize a new VACV isolate (VACV DMTV-2005 molecularly and biologically using conserved and non-conserved gene analyses for phylogenetic inference and to search for new genes that would elucidate the VACV-BR dichotomy. The VACV DMTV-2005 isolate reported in this study is biologically and phylogenetically clustered with other strains of Group 1 VACV-BR, the most prevalent VACV group that was isolated during the bovine vaccinia outbreaks in Brazil. Sequence analysis of C23L, the gene that encodes for the CC-chemokine-binding protein, revealed a ten-nucleotide deletion, which is a new Group 1 Brazilian VACV genetic marker. This deletion in the C23L open reading frame produces a premature stop-codon that is shared by all Group 1 VACV-BR strains and may also reflect the VACV-BR dichotomy; the deletion can also be considered to be a putative genetic marker for non-virulent Brazilian VACV isolates and may be used for the detection and molecular characterization of new isolates.

  19. Mutations conferring resistance to viral DNA polymerase inhibitors in camelpox virus give different drug-susceptibility profiles in vaccinia virus.

    Science.gov (United States)

    Duraffour, Sophie; Andrei, Graciela; Topalis, Dimitri; Krečmerová, Marcela; Crance, Jean-Marc; Garin, Daniel; Snoeck, Robert

    2012-07-01

    Cidofovir or (S)-HPMPC is one of the three antiviral drugs that might be used for the treatment of orthopoxvirus infections. (S)-HPMPC and its 2,6-diaminopurine counterpart, (S)-HPMPDAP, have been described to select, in vitro, for drug resistance mutations in the viral DNA polymerase (E9L) gene of vaccinia virus (VACV). Here, to extend our knowledge of drug resistance development among orthopoxviruses, we selected, in vitro, camelpox viruses (CMLV) resistant to (S)-HPMPDAP and identified a single amino acid change, T831I, and a double mutation, A314V+A684V, within E9L. The production of recombinant CMLV and VACV carrying these amino acid substitutions (T831I, A314V, or A314V+A684V) demonstrated clearly their involvement in conferring reduced sensitivity to viral DNA polymerase inhibitors, including (S)-HPMPDAP. Both CMLV and VACV harboring the A314V change showed comparable drug-susceptibility profiles to various antivirals and similar impairments in viral growth. In contrast, the single change T831I and the double change A314V+A684V in VACV were responsible for increased levels of drug resistance and for cross-resistance to viral DNA polymerase antivirals that were not observed with their CMLV counterparts. Each amino acid change accounted for an attenuated phenotype of VACV in vivo. Modeling of E9L suggested that the T→I change at position 831 might abolish hydrogen bonds between E9L and the DNA backbone and have a direct impact on the incorporation of the acyclic nucleoside phosphonates. Our findings demonstrate that drug-resistance development in two related orthopoxvirus species may impact drug-susceptibility profiles and viral fitness differently.

  20. Analysis of vaccinia virus temperature-sensitive I7L mutants reveals two potential functional domains

    Directory of Open Access Journals (Sweden)

    Byrd Chelsea M

    2006-08-01

    Full Text Available Abstract As an approach to initiating a structure-function analysis of the vaccinia virus I7L core protein proteinase, a collection of conditional-lethal mutants in which the mutation had been mapped to the I7L locus were subjected to genomic sequencing and phenotypic analyses. Mutations in six vaccinia virus I7L temperature sensitive mutants fall into two groups: changes at three positions at the N-terminal end between amino acids 29 and 37 and two different substitutions at amino acid 344, near the catalytic domain. Regardless of the position of the mutation, mutants at the non-permissive temperature failed to cleave core protein precursors and had their development arrested prior to core condensation. Thus it appears that the two clusters of mutations may affect two different functional domains required for proteinase activity.

  1. A high-fat, high-protein diet attenuates the negative impact of casein-induced chronic inflammation on testicular steroidogenesis and sperm parameters in adult mice.

    Science.gov (United States)

    Zhao, Jing-Lu; Zhao, Yu-Yun; Zhu, Wei-Jie

    2017-10-01

    RNA and protein levels of the StAR and 3β-HSD in group HFPD+CS were both higher than those of in group ND+CS. These results indicated that Kunming male mice with high-fat, high-protein diet and casein injection for 8weeks can be used to establish a diet-induced obesity and chronic systemic inflammation. The sperm parameters in groups ND+CS and HFPD+SI decreased accompanied by pathological changes of testicular tissue. This resultant effect of reduced serum testosterone levels was associated with the overproduction of TNF-α and IL-10 and down-regulation of StAR and CYP11A1. Under the same casein-induced chronic inflammation condition, the mice with high-fat, high-protein diet had better testicular steroidogenesis activity and sperm parameters compared with the mice in normal diet, indicating that the mice with casein-induced inflammatory injury consuming a high-fat, high-protein diet gained weight normally, reduced serum adiponectin level and increased testosterone production by an upregulation of 3β-HSD expression. High-fat, high-protein diet attenuated the negative impact of casein-induced chronic inflammation on testicular steroidogenesis and sperm parameters. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Attenuation and Immunogenicity of a Live High Pathogenic PRRSV Vaccine Candidate with a 32-Amino Acid Deletion in the nsp2 Protein

    Directory of Open Access Journals (Sweden)

    Wenhui Lu

    2014-01-01

    Full Text Available A porcine reproductive and respiratory syndrome virus (PRRSV QY1 was serially passed on Marc-145 cells. Virulence of different intermediate derivatives of QY1 (P5, P60, P80, and P100 were determined. The study found that QY1 had been gradually attenuated during the in vitro process. Pathogenicity study showed that pigs inoculated with QY1 P100 and P80 did not develop any significant PRRS clinic symptoms. However, mild-to-moderate clinical signs and acute HP-PRRSV symptoms of infection were observed in pigs inoculated with QY1 P60 and P5, respectively. Furthermore, we determined the whole genome sequences of these four intermediate viruses. The results showed that after 100 passages, compared to QY1 P5, a total of 32 amino acid mutations were found. Moreover, there were one nucleotide deletion and a unique 34-amino acid deletion found at 5′UTR and in nsp2 gene during the attenuation process, respectively. Such deletions were genetically stable in vivo. Following PRRSV experimental challenge, pigs inoculated with a single dose of QY1 P100 developed no significant clinic symptoms and well tolerated lethal challenge, while QY1 P80 group still developed mild fever in the clinic trial after challenge. Thus, we concluded that QY1 P100 was a promising and highly attenuated PRRSV vaccine candidate.

  3. ZnS and ZnSe immersion gratings for astronomical high-resolution spectroscopy - evaluation of internal attenuation of bulk materials in the short NIR region

    Energy Technology Data Exchange (ETDEWEB)

    Ikeda, Y; Kobayashi, N; Kondo, S; Yasui, C; Kuzmenko, P J; Tokoro, H; Terada, H

    2009-08-12

    We measure the internal attenuation of bulk crystals of CVD-ZnS, CVD-ZnSe, Si, and GaAs, in the short near-infrared (sNIR) region to evaluate the possibility of astronomical immersion gratings with those high refractive index materials. We confirm that multispectral grade CVD-ZnS and CVD-ZnSe are best suited for the immersion gratings, with the smallest internal attenuation of {alpha}{sub att} = 0.01-0.03 cm{sup -1} among the major candidates. The measured attenuation is roughly in proportion to {lambda}{sup -2}, suggesting it is dominated by bulk scattering due to the polycrystalline grains rather than by absorption. The total transmittance in the immersion grating is estimated to be at least > 80 %, even for the spectral resolution of R = 300,000. Two potential problems, the scattered light by the bulk material and the degradation of the spectral resolution due to the gradient illumination in the diffracted beam, are investigated and found to be negligible for usual astronomical applications. Since the remaining problem, the difficulty of cutting grooves on CVD-ZnS and CVD-ZnSe, has recently been overcome by the nanoprecision fly-cutting technique, ZnS and ZnSe immersion gratings for astronomy can be technically realized.

  4. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  5. Sequence-Independent Targeting of Transmembrane Proteins Synthesized within Vaccinia Virus Factories to Nascent Viral Membranes▿

    OpenAIRE

    Husain, Matloob; Weisberg, Andrea S.; Moss, Bernard

    2006-01-01

    The primary membrane of vaccinia virus, as well as those of other poxviruses, forms within a discrete cytoplasmic factory region. We recently determined the existence of an operative pathway from the endoplasmic reticulum within the virus factory to nascent viral membranes and demonstrated that a viral protein could be diverted from this pathway to Golgi membranes by the addition of COPII-binding sites (M. Husain, A. S. Weisberg, and B. Moss, Proc. Natl. Acad. Sci. USA, 103:19506-19511, 2006)...

  6. Modulation of the Myxoma Virus Plaque Phenotype by Vaccinia Virus Protein F11

    OpenAIRE

    Irwin, Chad R; Evans, David H.

    2012-01-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments...

  7. The vaccinia virus E6 protein influences virion protein localization during virus assembly

    Energy Technology Data Exchange (ETDEWEB)

    Condit, Richard C., E-mail: condit@mgm.ufl.edu; Moussatche, Nissin

    2015-08-15

    Vaccinia virus mutants in which expression of the virion core protein gene E6R is repressed are defective in virion morphogenesis. E6 deficient infections fail to properly package viroplasm into viral membranes, resulting in an accumulation of empty immature virions and large aggregates of viroplasm. We have used immunogold electron microscopy and immunofluorescence confocal microscopy to assess the intracellular localization of several virion structural proteins and enzymes during E6R mutant infections. We find that during E6R mutant infections virion membrane proteins and virion transcription enzymes maintain a normal localization within viral factories while several major core and lateral body proteins accumulate in aggregated virosomes. The results support a model in which vaccinia virions are assembled from at least three substructures, the membrane, the viroplasm and a “pre-nucleocapsid”, and that the E6 protein is essential for maintaining proper localization of the seven-protein complex and the viroplasm during assembly. - Highlights: • Mutation of E6 disrupts association of viral membranes with viral core proteins • Mutation of E6 does not perturb viral membrane biosynthesis • Mutation of E6 does not perturb localization of viral transcription enzymes • Mutation of E6 causes mis-localization and aggregation of viral core proteins • Vaccinia assembly uses three subassemblies: membranes, viroplasm, prenucleocapsid.

  8. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Science.gov (United States)

    Slike, Bonnie M; Creegan, Matthew; Marovich, Mary; Ngauy, Viseth

    2017-01-01

    Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years) and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity) may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb) responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT) of 250 to baseline (vaccination. This contrasted with a comparator group of adults, ages 35-49, who were vaccinated with Dryvax® as children. In the childhood vaccinees, titers persisted for >30 years with a GMT of 210 (range 112-3234). This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  9. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Directory of Open Access Journals (Sweden)

    Bonnie M Slike

    Full Text Available Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT of 250 to baseline (30 years with a GMT of 210 (range 112-3234. This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  10. Parameter oscillations in a very high gravity medium continuous ethanol fermentation and their attenuation on a multistage packed column bioreactor system.

    Science.gov (United States)

    Bai, F W; Chen, L J; Anderson, W A; Moo-Young, M

    2004-12-05

    The quasi-steady-states, marked by small fluctuations of residual glucose, ethanol, and biomass concentrations, and sustainable oscillations marked by big fluctuations of these monitored fermentation parameters were observed during the continuous ethanol fermentation of Saccharomyces cerevisiae when very high gravity media were fed and correspondingly high ethanol concentrations reached. A high ethanol concentration was shown to be one of the main factors that incited these oscillations, although the residual glucose level affected the patterns of these oscillations to some extent. The lag response of S. cerevisiae to high ethanol stress that causes the shifts of morphology, viability loss, and death of yeast cells is assumed to be one of the probable mechanisms behind these oscillations. It was predicted that the longer the delay of this response was, the longer the oscillation periods would be, which was validated by the experimental data and the comparison with the oscillatory behaviors reported for the ethanologen bacterium, Zymomonas mobilis. Furthermore, three tubular bioreactors in series were arranged to follow a stirred tank bioreactor to attenuate these oscillations. However, exaggerated oscillations were observed for the residual glucose, ethanol, and biomass concentrations measured in the broth from these tubular bioreactors. After the tubular reactors were packed with Intalox ceramic saddle packing, these oscillations were effectively attenuated and quasi-steady-states were observed during which there were very small fluctuations of residual glucose, ethanol, and biomass within the entire experimental run.

  11. In vivo Biodistribution of a Highly Attenuated Recombinant Vesicular Stomatitis Virus Expressing HIV-1 Gag Following Intramuscular, Intranasal, or Intravenous Inoculation

    Science.gov (United States)

    Johnson, J. Erik; Coleman, John W.; Kalyan, Narender K.; Calderon, Priscilla; Wright, Kevin J.; Obregon, Jennifer; Ogin-Wilson, Eleanor; Natuk, Robert J.; Clarke, David K.; Udem, Stephen A.; Cooper, David; Hendry, R. Michael

    2009-01-01

    Recombinant vesicular stomatitis viruses (rVSVs) are being developed as potential HIV-1 vaccine candidates. To characterize the in vivo replication and dissemination of rVSV vectors in mice, high doses of a highly attenuated vector expressing HIV-1 Gag, rVSVIN- N4CT9-Gag1, and a prototypic reference virus, rVSVIN-HIVGag5, were delivered intramuscularly (IM), intranasally (IN), or intravenously (IV). We used quantitative, real-time RT-PCR (Q-PCR) and standard plaque assays to measure the temporal dissemination of these viruses to various tissues. Following IM inoculation, both viruses were detected primarily at the injection site as well as in draining lymph nodes; neither virus induced significant weight loss, pathologic signs, or evidence of neuroinvasion. In contrast, following IN inoculation, the prototypic virus was detected in all tissues tested and caused significant weight loss leading to death. IN administration of rVSVIN- N4CT9-Gag1 resulted in detection in numerous tissues (brain, lung, nasal turbinates, and lymph nodes) albeit in significantly reduced levels, which caused little or no weight loss nor any mortality. Following IV inoculation, both prototypic and attenuated viruses were detected by Q-PCR in all tissues tested. In contrast to the prototype, rVSVIN-N4CT9-Gag1 viral loads were significantly lower in all organs tested, and no infectious virus was detected in the brain following IV inoculation, despite the presence of viral RNA. These studies demonstrated significant differences in the biodistribution patterns of and the associated pathogenicity engendered by the prototypic and attenuated vectors in a highly susceptible host. PMID:19428903

  12. Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus.

    Science.gov (United States)

    Marín-López, Alejandro; Ortego, Javier

    2016-01-01

    Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

  13. Assessment of the CALIPSO Lidar 532 nm attenuated backscatter calibration using the NASA LaRC airborne High Spectral Resolution Lidar

    Directory of Open Access Journals (Sweden)

    R. R. Rogers

    2011-02-01

    Full Text Available The Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP instrument on the Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observations (CALIPSO spacecraft has provided global, high-resolution vertical profiles of aerosols and clouds since it became operational on 13 June 2006. On 14 June 2006, the NASA Langley Research Center (LaRC High Spectral Resolution Lidar (HSRL was deployed aboard the NASA Langley B-200 aircraft for the first of a series of 86 underflights of the CALIPSO satellite to provide validation measurements for the CALIOP data products. To better assess the range of conditions under which CALIOP data products are produced, these validation flights were conducted under both daytime and nighttime lighting conditions, in multiple seasons, and over a large range of latitudes and aerosol and cloud conditions. This paper presents a quantitative assessment of the CALIOP 532 nm calibration (through the 532 nm total attenuated backscatter using internally calibrated airborne HSRL underflight data and is the most extensive study of CALIOP 532 nm calibration. Results show that HSRL and CALIOP 532 nm total attenuated backscatter agree on average within 2.7% ± 2.1% (CALIOP lower at night and within 2.9% ± 3.9% (CALIOP lower during the day, demonstrating the accuracy of the CALIOP 532 nm calibration algorithms. Additionally, comparisons with HSRL show consistency of the CALIOP calibration before and after the laser switch in 2009 as well as improvements in the daytime version 3.01 calibration scheme compared with the version 2 calibration scheme. Potential biases and uncertainties in the methodology relevant to validating satellite lidar measurements with an airborne lidar system are discussed and found to be less than 4.5% ± 3.2% for this validation effort with HSRL. Results from this study are also compared with prior assessments of the CALIOP 532 nm attenuated backscatter calibration.

  14. Oncolytic and immunologic cancer therapy with GM-CSF-armed vaccinia virus of Tian Tan strain Guang9.

    Science.gov (United States)

    Deng, Lili; Fan, Jun; Guo, Mingming; Huang, Biao

    2016-03-28

    Targeted oncolytic vaccinia viruses are being developed as a novel strategy in cancer therapy. Arming vaccinia viruses with immunostimulatory cytokines can enhance antitumor efficacy. Such engineered oncolytic viruses, like JX-594, a Wyeth strain vaccinia virus modified with human granulocyte-macrophage colony-stimulating factor (GM-CSF), have shown promising results and have proceeded rapidly in clinical trials. However, the oncolytic potential of the Chinese vaccine strain Tian Tan (VTT) has not been explored. In this study, we constructed a targeted oncolytic vaccinia virus of Tian Tan strain Guang9 (VG9) expressing murine GM-CSF (VG9-GMCSF) and evaluated the antitumor effect of this recombinant vaccinia virus in a murine melanoma model. In vitro, viral replication and cytotoxicity of VG9-GMCSF was as potent as VG9; in vivo, VG9-GMCSF significantly inhibited the growth of subcutaneously implanted melanoma tumors, prolonged the survival of tumor-bearing mice, and produced an antitumor cytotoxic response. Such antitumor effect may be due to the lytic nature of virus as well as the stimulation of immune activity by GM-CSF production. Our results indicate that VG9-GMCSF induces strong tumoricidal activity, providing a potential therapeutic strategy for combating cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Comparison of the Cowpox Virus and Vaccinia Virus Mature Virion Proteome: Analysis of the Species- and Strain-Specific Proteome.

    Directory of Open Access Journals (Sweden)

    Joerg Doellinger

    Full Text Available Cowpox virus (CPXV causes most zoonotic orthopoxvirus (OPV infections in Europe and Northern as well as Central Asia. The virus has the broadest host range of OPV and is transmitted to humans from rodents and other wild or domestic animals. Increasing numbers of human CPXV infections in a population with declining immunity have raised concerns about the virus' zoonotic potential. While there have been reports on the proteome of other human-pathogenic OPV, namely vaccinia virus (VACV and monkeypox virus (MPXV, the protein composition of the CPXV mature virion (MV is unknown. This study focused on the comparative analysis of the VACV and CPXV MV proteome by label-free single-run proteomics using nano liquid chromatography and high-resolution tandem mass spectrometry (nLC-MS/MS. The presented data reveal that the common VACV and CPXV MV proteome contains most of the known conserved and essential OPV proteins and is associated with cellular proteins known to be essential for viral replication. While the species-specific proteome could be linked mainly to less genetically-conserved gene products, the strain-specific protein abundance was found to be of high variance in proteins associated with entry, host-virus interaction and protein processing.

  16. Immunogenicity of the candidate malaria vaccines FP9 and modified vaccinia virus Ankara encoding the pre-erythrocytic antigen ME-TRAP in 1-6 year old children in a malaria endemic area.

    Science.gov (United States)

    Bejon, Philip; Mwacharo, Jedidah; Kai, Oscar K; Todryk, Stephen; Keating, Sheila; Lang, Trudie; Gilbert, Sarah C; Peshu, Norbert; Marsh, Kevin; Hill, Adrian V S

    2006-05-29

    In a phase 1 trial, 22 children in a malaria endemic area were immunised with candidate malaria vaccination regimes. The regimes used two recombinant viral vectors, attenuated fowlpox strain FP9 and modified vaccinia virus Ankara (MVA). Both encoded the pre-erythrocytic malaria antigen construct ME-TRAP. Strong T cell responses were detected by both ex vivo and cultured ELISpot assays. Data from phase 1 trials in adults on anti-vector responses raised by FP9 is presented. These responses partially cross-reacted with MVA, and detectably reduced the immunogenicity of vaccination with MVA. This prompted the comparison of half dose and full dose FP9 priming vaccinations in children. Regimes using half dose FP9 priming tended to be more immunogenic than full dose. The potential for enhanced immunogenicity with half doses of priming vectors warrants further investigation, and larger studies to determine protection against malaria in children are required.

  17. [Salidroside attenuates high glucose-induced apoptosis in human umbilical vein endothelial cells via activating the Ca(2)+/CaM/CAMKIIδ/eNOS pathway].

    Science.gov (United States)

    Chen, Ziwei; Wu, Xiang

    2014-04-01

    Endothelial oxidative stress plays an important role in the pathogenesis of cardiovascular disease. Salidroside, a phenylpropanoid glycoside isolated from Rhodiola rosea L, could exert potent antioxidant properties. In this study, we investigated the protective effects, and related mechanism of salidroside against high glucose (33 mmol/L)-induced cell damage in human umbilical vein endothelial cells (HUVECs). HUVECs were cultured in normal glucose (5.5 mmol/L), high glucose (33 mmol/L), high salidroside (10 µg/ml+33 mmol/L glucose), moderate salidroside (4 µg/ml+33 mmol/L glucose), low salidroside (1 µg/ml+33 mmol/L glucose) and very low salidroside (0.1 µg/ml+33 mmol/L glucose) for 48 h. Cell viability, the level of malondialdehyde (MDA) , reactive oxygen species (ROS) , nitric oxide (NO) , [Ca(2)+]i, calmodulin (CaM) , calmodulin-dependent kinase (CaMK) IIδ, endothelial nitric oxide synthase (eNOS) , active caspase-3 protein expression and eNOS ser 1177 phosphorylation of HUVECs post various treatments were measured. The cell viability was assessed with MTT assay, and the level of ROS, and [Ca(2)+]i was analyzed using flow cytometry. Nitric oxide and MDA was detected by Nitric Oxide Assay Kit and MDA Assay Kit. Western blot was performed to detect the protein expressions of eNOS, active caspase-3 and eNOS ser 1177 phosphorylation. Comparing to the normal glucose group, high glucose treatment increased the cell damage, the level of NO and [Ca(2)+]i (P Salidroside treatment significantly attenuated high glucose-induce cell damage on cultured HUVECs in a dose-dependent manner. Comparing to the high glucose group, 10 µg/ml Salidroside significantly increased cell viability (P salidroside could attenuate high glucose induced apoptosis in HUVEC, partly through activating the Ca(2)+/CaM/CAMKIIδ/eNOS pathway.

  18. A study of self-attenuation correction for geological measures of Parana state, Brazil, granites with high resolution gamma-ray spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Ademar de O.; Pecequilo, Brigitte R.S., E-mail: aoferreira@ipen.b, E-mail: brigitte@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    In high resolution gamma-ray spectrometry correct determination of {sup 226}Ra, {sup 232}Th and {sup 40}K activities concentrations involve, beside accurate areas determinations, the use of precise efficiency calibration curves. As the efficiency calibration curve used for activities calculations was obtained with an aqueous standard multiradionuclides solution and the geological samples have apparent densities higher than the efficiency standard one, a correction of the efficiency curve is necessary. In this work, the self-attenuation correction factors were measured for sixteen geological samples from the Parana State Brazil crystalline shield, including lithotypes like rhyolite, granite, sienite and basalt, with apparent densities varying from 1.42 g cm-3 to 2.02 g cm-3. The self-attenuation factors were determined by the transmission technique and a high-resolution gamma-ray spectrometry facility, using {sup 60}Co, {sup 133}Ba, {sup 137}Cs and {sup 152}Eu punctual sources with well-known energies. For each density, a curve is fitted, allowing to correct the efficiency of the gamma transitions used in the determination of the {sup 226}Ra, {sup 232}Th and {sup 40}K activities concentrations. (author)

  19. Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus.

    Science.gov (United States)

    Aldabe, R; Feduchi, E; Novoa, I; Carrasco, L

    1995-10-24

    Poliovirus protease 2A cleaves p220, a component of initiation factor eIF-4F. Polyclonal antibodies that recognize p220 and the cleaved products from different species have been raised. Transfection of several cell lines with poliovirus 2Apro cloned in different plasmids leads to efficient cleavage of p220 upon infection with VT7, a recombinant vaccinia virus that expresses the T7 RNA polymerase. Under these conditions vaccinia virus protein synthesis is severely inhibited, while expression of poliovirus protein 2C from a similar plasmid has no effect. These results show by the first time the effects of p220 cleavage on vaccinia virus translation in the infected cells.

  20. Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice.

    Science.gov (United States)

    Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F

    2017-10-01

    Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

  1. Comparison of the genome sequence of FP9, an attenuated, tissue culture-adapted European strain of Fowlpox virus, with those of virulent American and European viruses.

    Science.gov (United States)

    Laidlaw, Stephen M; Skinner, Michael A

    2004-02-01

    The 266 kbp genome sequence of plaque-purified, tissue culture-adapted, attenuated European Fowlpox virus FP9 has been determined and compared with the 288 kbp sequence of a pathogenic US strain (FPVUS). FP9 carries 244 of the 260 reported FPVUS ORFs (both viruses also have an unreported orthologue of conserved poxvirus gene A14.5L). Relative to FPVUS, FP9 differed by 118 mutations (26 deletions, 15 insertions and 77 base substitutions), affecting FP9 equivalents of 71 FPVUS ORFs. To help to identify mutations involved in adaptation and attenuation, the virulent parent of FP9, HP1, was sequenced at positions where FP9 differed from FPVUS. At 68 positions, FP9 and HP1 sequences were identical, reflecting differences between American and European lineages. Mutations at the remaining 50 positions in FP9 relative to FPVUS and HP1, involving 46 ORFs, therefore accounted for adaptation and attenuation. ORFs deleted during passage included those encoding members of multigene families: 12 ankyrin repeat proteins, three C-type lectin-like proteins, two C4L/C10L-like proteins, one G-protein coupled receptor protein, one V-type Ig domain protein, two N1R/p28 proteins and one EFc family protein. Tandem ORFs encoding Variola virus B22R orthologues were fused by a 5.8 kbp deletion. Single-copy genes disrupted or deleted during passage included those encoding a homologue of murine T10, a conserved DNA/pantothenate metabolism flavoprotein, photolyase, the A-type inclusion protein and an orthologue of vaccinia A47L. Gene assignments have been updated for DNase II/DLAD, binding proteins for IL-18 and interferon-gamma, phospholipid hydroperoxide glutathione peroxidase (PHGPX/GPX-4) and for a highly conserved homologue of ELOVL4.

  2. Cambios en virus vaccinia durante la síntesis de RNA in vitro

    Directory of Open Access Journals (Sweden)

    Julio Enrique Ospina

    1971-01-01

    Full Text Available Observaciones al microscopio electrónico de virus vaccinia previamente incubados en una mezcla para la reacción de RNA polimerasa in vitro, demuestran características alteraciones morfológicas en los virus. Estructuras similares a vesículas y ocasionalmente túbulos se formaron a partir de la membrana externa del virus. Uno de los sustituyentes de la reacción de RNA polimerasa in vitro, mercaptoetanol 0.007M, es el causante de esta alteración. El cambio morfológico se acompaña de pérdida de la infectividad viral. La presencia de grupos sulfhidrilo en la mezcla de la reacción enzimática es esencial para la ocurrencia de la síntesis de RNA de vaccinia in vitro. Esta condición no se pudo sustituir por choque térmico a 70C. ni por digestión parcial del virus por tripsina. Una gran variedad de compuestos con grupos sulfhidrilo pueden reemplazar el mercaptoetanol con efectividad variable. El más activo de ellos fué el ditiotreitol. Un período de latencia de 8 minutos ocurre entre la adición de vaccinia a la mezcla completa para la reacción de RNA polimerasa y la detección de síntesis de RNA. Los datos recolectados sugieren que cambios dependientes del mercaptoetanol ocurren durante este período.

  3. The role of signalling and the cytoskeleton during Vaccinia Virus egress.

    Science.gov (United States)

    Leite, Flavia; Way, Michael

    2015-11-02

    Viruses are obligate intracellular parasites that are critically dependent on their hosts to replicate and generate new progeny. To achieve this goal, viruses have evolved numerous elegant strategies to subvert and utilise the different cellular machineries and processes of their unwilling hosts. Moreover, they often accomplish this feat with a surprisingly limited number of proteins. Among the different systems of the cell, the cytoskeleton is often one of the first to be hijacked as it provides a convenient transport system for viruses to reach their site of replication with relative ease. At the latter stages of their replication cycle, the cytoskeleton also provides an efficient means for newly assembled viral progeny to reach the plasma membrane and leave the infected cell. In this review we discuss how Vaccinia virus takes advantage of the microtubule and actin cytoskeletons of its host to promote the spread of infection into neighboring cells. In particular, we highlight how analysis of actin-based motility of Vaccinia has provided unprecedented insights into how a phosphotyrosine-based signalling network is assembled and functions to stimulate Arp2/3 complex-dependent actin polymerization. We also suggest that the formin FHOD1 promotes actin-based motility of the virus by capping the fast growing ends of actin filaments rather than directly promoting filament assembly. We have come a long way since 1976, when electron micrographs of vaccinia-infected cells implicated the actin cytoskeleton in promoting viral spread. Nevertheless, there are still many unanswered questions concerning the role of signalling and the host cytoskeleton in promoting viral spread and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Vaccinia Virus B1 Kinase Is Required for Postreplicative Stages of the Viral Life Cycle in a BAF-Independent Manner in U2OS Cells

    Science.gov (United States)

    Jamin, Augusta; Ibrahim, Nouhou; Wicklund, April; Weskamp, Kaitlin

    2015-01-01

    ABSTRACT The vaccinia virus B1R gene encodes a highly conserved protein kinase that is essential for the poxviral life cycle. As demonstrated in many cell types, B1 plays a critical role during viral DNA replication when it inactivates the cellular host defense effector barrier to autointegration factor (BAF or BANF1). To better understand the role of B1 during infection, we have characterized the growth of a B1-deficient temperature-sensitive mutant virus (Cts2 virus) in U2OS osteosarcoma cells. In contrast to all other cell lines tested to date, we found that in U2OS cells, Cts2 viral DNA replication is unimpaired at the nonpermissive temperature. However, the Cts2 viral yield in these cells was reduced more than 10-fold, thus indicating that B1 is required at another stage of the vaccinia virus life cycle. Our results further suggest that the host defense function of endogenous BAF may be absent in U2OS cells but can be recovered through either overexpression of BAF or fusion of U2OS cells with mouse cells in which the antiviral function of BAF is active. Interestingly, examination of late viral proteins during Cts2 virus infection demonstrated that B1 is required for optimal processing of the L4 protein. Finally, execution point analyses as well as electron microscopy studies uncovered a role for B1 during maturation of poxviral virions. Overall, this work demonstrates that U2OS cells are a novel model system for studying the cell type-specific regulation of BAF and reveals a role for B1 beyond DNA replication during the late stages of the viral life cycle. IMPORTANCE The most well characterized role for the vaccinia virus B1 kinase is to facilitate viral DNA replication by phosphorylating and inactivating BAF, a cellular host defense responsive to foreign DNA. Additional roles for B1 later in the viral life cycle have been postulated for decades but are difficult to examine directly due to the importance of B1 during DNA replication. Here, we demonstrate that

  5. Mindfulness training attenuates the increase in salivary cortisol concentration associated with competition in highly trained wheelchair-basketball players.

    Science.gov (United States)

    MacDonald, Luke A; Minahan, Clare L

    2018-02-01

    This study determined the effect of 8 wk of mindfulness training (MT) on salivary cortisol (sCort) and rate of salivary Immunoglobulin-A (sIgA) secretion in wheelchair-basketball players during a competition period. The mindful group completed 8 weeks of MT in addition to training and competition. sCort and rate of sIgA secretion were measured at baseline, at 2-week intervals, the end and 2 weeks following the intervention. A significant time and group interaction was observed for sCort (F = 3.297, P = 0.040, ES = 0.191); sCort increased in the control group from MT-BL to MT-2wk (P = 0.001) and remained significantly elevated at MT-4wk (P = 0.013) and MT-6wk (P = 0.002). sCort decreased from MT-6wk to MT-8wk (P  0.05). Mindful group sCort increased from MT-BL to MT-2wk (P = 0.042) but decreased to concentrations no different to MT-BL for the rest of the intervention period (P > 0.05). There were no group differences in rate of sIgA secretion during the intervention (P = 0.810). It was concluded that 8 weeks of MT attenuated the increase in sCort associated with the competition period.

  6. An E2?F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    OpenAIRE

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 ?m s?1, consistent with...

  7. Vectores recombinantes basados en el virus Vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis

    OpenAIRE

    Pérez Jiménez, Eva; Larraga, Vicente; Esteban, Mariano

    2005-01-01

    Vectores recombinantes basados en el virus vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis. Los vectores de la invención contienen secuencias codificantes de la proteína LACK, preferentemente insertadas en el locus de hemaglutinina del virus y bajo el control de un promotor que permite su expresión a lo largo del ciclo de infección del virus. Son vectores seguros, estables, que dan lugar a una potente respuesta inmune que confiere protección frente a la leishmaniasis,...

  8. High-Methionine Diet Attenuates Severity of Arthritis and Modulates IGF-I Related Gene Expressions in an Adjuvant Arthritis Rats Model

    Directory of Open Access Journals (Sweden)

    Mingxin Li

    2016-01-01

    Full Text Available Rheumatoid arthritis, a synthesized form of adjuvant arthritis exhibited throughout many animal species, inhibits liver function and circulation of IGF-I and contributes to the degradation of skeletal muscle mass. One of the primary goals of the present study is determining whether a high-Methionine (high-Met diet is capable of reducing the adverse effects of arthritis, namely, loss of body mass. Following adjuvant injection, forty arthritic rats were randomly assigned to either a control group with a basal diet or a high-Met group with the same basal diet + 0.5% Methionine. After 14 days all rats were terminated. The high-Met group exhibited an increase in body weight and food intake in comparison with the control group (P<0.05. High-Met diet debilitated arthritis-induced surges in the gastrocnemius in both atrogin-1 and the MuRF1 expressions; however, it was observed to have little to no effect on atrogin-1 and MuRF1 gene expression in soleus. At the same time, high-Met diet rats experienced a rise in IGF-I, with lowering of IGFBP-3 gene expression in the gastrocnemius and the soleus. These data suggest that arthritis severity can be partly attenuated by high-Met diet.

  9. A novel chalcone derivative attenuates the diabetes-induced renal injury via inhibition of high glucose-mediated inflammatory response and macrophage infiltration

    Energy Technology Data Exchange (ETDEWEB)

    Fang, Qilu [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Zhao, Leping [Department of Pharmacy, the Affiliated Yueqing Hospital, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wang, Yi; Zhang, Yali [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Li, Zhaoyu [Department of International High School, Shanghai Jiaotong University Nanyang Affiliated (Kunshan) School, Minhang District, Shanghai (China); Pan, Yong; Kanchana, Karvannan; Wang, Jingying; Tong, Chao [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Li, Dan, E-mail: yqyyld@163.com [Department of Nephrology, the Affiliated Yueqing Hospital, Wenzhou Medical University, Wenzhou, Zhejiang (China); Liang, Guang, E-mail: wzmcliangguang@163.com [Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China)

    2015-01-15

    Inflammation plays a central role in the development and progression of diabetic nephropathy (DN). Researches on novel anti-inflammatory agents may offer new opportunities for the treatment of DN. We previously found a chalcone derivative L6H21 could inhibit LPS-induced cytokine release from macrophages. The aim of this study was to investigate whether L6H21 could ameliorate the high glucose-mediated inflammation in NRK-52E cells and attenuate the inflammation-mediated renal injury. According to the results, L6H21 showed a great inhibitory effect on the expression of pro-inflammatory cytokines, cell adhesion molecules, chemokines, and macrophage adhesion via down-regulation of NF-κB/MAPKs activity in high glucose-stimulated renal NRK-52E cells. Further, in vivo oral administration with L6H21 at a dosage of 20 mg/kg/2 days showed a decreased expression of pro-inflammatory cytokines, cell adhesion molecules, which subsequently contributed to the inhibition on renal macrophage infiltration, the reduction of serum creatinine and BUN levels, and the improvement on the fibrosis and pathological changes in the renal tissues of diabetic mice. These findings provided that chalcone derived L6H21 may be a promising anti-inflammatory agent and have the potential in the therapy of diabetic nephropathy, and importantly, MAPK/NF-κB signaling system may be a novel therapeutic target for human DN in the future. - Highlights: • Inflammation plays a central role in the development of diabetic nephropathy. • Compound L6H21 reduced the high glucose-mediated inflammation in NRK-52E cells. • Compound L6H21 attenuated the inflammation-mediated renal injury. • L6H21 exhibited anti-inflammatory effects via inactivation of NF-κB/MAPKs. • MAPKs/NF-κB may be a novel therapeutic target in diabetic nephropathy treatment.

  10. Efficacy of vaccination with recombinant vaccinia and fowlpox vectors expressing NY-ESO-1 antigen in ovarian cancer and melanoma patients.

    Science.gov (United States)

    Odunsi, Kunle; Matsuzaki, Junko; Karbach, Julia; Neumann, Antje; Mhawech-Fauceglia, Paulette; Miller, Austin; Beck, Amy; Morrison, Carl D; Ritter, Gerd; Godoy, Heidi; Lele, Shashikant; duPont, Nefertiti; Edwards, Robert; Shrikant, Protul; Old, Lloyd J; Gnjatic, Sacha; Jäger, Elke

    2012-04-10

    Recombinant poxviruses (vaccinia and fowlpox) expressing tumor-associated antigens are currently being evaluated in clinical trials as cancer vaccines to induce tumor-specific immune responses that will improve clinical outcome. To test whether a diversified prime and boost regimen targeting NY-ESO-1 will result in clinical benefit, we conducted two parallel phase II clinical trials of recombinant vaccinia-NY-ESO-1 (rV-NY-ESO-1), followed by booster vaccinations with recombinant fowlpox-NY-ESO-1 (rF-NY-ESO-1) in 25 melanoma and 22 epithelial ovarian cancer (EOC) patients with advanced disease who were at high risk for recurrence/progression. Integrated NY-ESO-1-specific antibody and CD4(+) and CD8(+) T cells were induced in a high proportion of melanoma and EOC patients. In melanoma patients, objective response rate [complete and partial response (CR+PR)] was 14%, mixed response was 5%, and disease stabilization was 52%, amounting to a clinical benefit rate (CBR) of 72% in melanoma patients. The median PFS in the melanoma patients was 9 mo (range, 0-84 mo) and the median OS was 48 mo (range, 3-106 mo). In EOC patients, the median PFS was 21 mo (95% CI, 16-29 mo), and median OS was 48 mo (CI, not estimable). CD8(+) T cells derived from vaccinated patients were shown to lyse NY-ESO-1-expressing tumor targets. These data provide preliminary evidence of clinically meaningful benefit for diversified prime and boost recombinant pox-viral-based vaccines in melanoma and ovarian cancer and support further evaluation of this approach in these patient populations.

  11. Emodin attenuates high glucose-induced TGF-β1 and fibronectin expression in mesangial cells through inhibition of NF-κB pathway

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jie [Department of Pharmacology, School of Pharmacy, Guangxi Medical University, Nanning, Guangxi (China); Zeng, Zhi [Department of Physiology, School of Basic Courses, Guangdong Pharmaceutical University, Guangzhou, Guangdong (China); Wu, Teng [Vascular Biology Research Institute, Guangdong Pharmaceutical University, Guangzhou (China); Yang, Zhicheng [Department of Pharmacology, School of Pharmaceutical Science, Guangdong Pharmaceutical University, Guangzhou, Guangdong (China); Liu, Bing, E-mail: liubing52000@163.com [Department of Pharmacology, School of Pharmaceutical Science, Guangdong Pharmaceutical University, Guangzhou, Guangdong (China); Lan, Tian, E-mail: lantiansci@yahoo.com [Vascular Biology Research Institute, Guangdong Pharmaceutical University, Guangzhou (China)

    2013-12-10

    The activation of nuclear factor-κB (NF-κB) and the subsequent overexpression of its downstream targets transforming growth factor-β1 (TGF-β1) and fibronectin (FN) are among the hallmarks for the progressive diabetic nephropathy. Our previous studies demonstrated that emodin ameliorated renal injury and inhibited extracellular matrix accumulation in kidney and mesangial cells under diabetic condition. However, the molecular mechanism has not been fully elucidated. Here, we showed that emodin significantly attenuated high glucose-induced NF-κB nuclear translocation in mesangial cells. Interestingly, emodin also inhibited the DNA-binding activity and transcriptional activity of NF-κB. Furthermore, NF-κB-mediated TGF-β1 and FN expression was significantly decreased by emodin. These results demonstrated that emodin suppressed TGF-β1 and FN overexpression through inhibition of NF-κB activation, suggesting that emodin-mediated inhibition of the NF-κB pathway could protect against diabetic nephropathy. - Highlights: • Emodin decreased high glucose-induced p65 phosphorylation in MCs. • Emodin decreased high glucose-induced IκB-α degradation in MCs. • Emodin decreased high glucose-induced p65 translocation in MCs. • Emodin blocked high glucose-induced NF-κB activity. • Emodin blocked high glucose-induced the expression of TGF-β1 and FN.

  12. Oral vaccination of wildlife using a vaccinia-rabies-glycoprotein recombinant virus vaccine (RABORAL V-RG®): a global review.

    Science.gov (United States)

    Maki, Joanne; Guiot, Anne-Laure; Aubert, Michel; Brochier, Bernard; Cliquet, Florence; Hanlon, Cathleen A; King, Roni; Oertli, Ernest H; Rupprecht, Charles E; Schumacher, Caroline; Slate, Dennis; Yakobson, Boris; Wohlers, Anne; Lankau, Emily W

    2017-09-22

    RABORAL V-RG® is an oral rabies vaccine bait that contains an attenuated ("modified-live") recombinant vaccinia virus vector vaccine expressing the rabies virus glycoprotein gene (V-RG). Approximately 250 million doses have been distributed globally since 1987 without any reports of adverse reactions in wildlife or domestic animals since the first licensed recombinant oral rabies vaccine (ORV) was released into the environment to immunize wildlife populations against rabies. V-RG is genetically stable, is not detected in the oral cavity beyond 48 h after ingestion, is not shed by vaccinates into the environment, and has been tested for thermostability under a range of laboratory and field conditions. Safety of V-RG has been evaluated in over 50 vertebrate species, including non-human primates, with no adverse effects observed regardless of route or dose. Immunogenicity and efficacy have been demonstrated under laboratory and field conditions in multiple target species (including fox, raccoon, coyote, skunk, raccoon dog, and jackal). The liquid vaccine is packaged inside edible baits (i.e., RABORAL V-RG, the vaccine-bait product) which are distributed into wildlife habitats for consumption by target species. Field application of RABORAL V-RG has contributed to the elimination of wildlife rabies from three European countries (Belgium, France and Luxembourg) and of the dog/coyote rabies virus variant from the United States of America (USA). An oral rabies vaccination program in west-central Texas has essentially eliminated the gray fox rabies virus variant from Texas with the last case reported in a cow during 2009. A long-term ORV barrier program in the USA using RABORAL V-RG is preventing substantial geographic expansion of the raccoon rabies virus variant. RABORAL V-RG has also been used to control wildlife rabies in Israel for more than a decade. This paper: (1) reviews the development and historical use of RABORAL V-RG; (2) highlights wildlife rabies control

  13. Model-data comparison of high frequency compressional wave attenuation in water-saturated granular medium with bimodal grain size distribution.

    Science.gov (United States)

    Yang, Haesang; Seong, Woojae; Lee, Keunhwa

    2018-01-01

    Several acoustic models, such as the poro-elastic model, visco-elastic model, and multiple scattering model, have been used for describing the dispersion relation in a porous granular medium. However, these models are based on continuum or scattering theory, and therefore cannot explain the broadband measurements in cases where scattering and non-scattering losses co-exist. Additionally, since the models assume that the porous granular medium consists of grains of identical size (unimodal size distribution), the models does not account for the behavior of wave dispersion in a medium that has a distribution of differing grain sizes. As an alternative approach, this study proposes a new broadband attenuation model that describes the high frequency dispersion relation for the p-wave in the case of elastic grain scatterers existing in the background fluid medium. The broadband model combines the Biot-Stoll plus grain contact squirt and shear flow (BICSQS) model and the quasicrystalline approximation (QCA) multiple scattering model. Additionally, distribution of grain size effect is examined rudimentarily through consideration of bimodal grain size distribution. Through the quantitative analysis of the broadband model and measured data, it is shown that the model can explain the attenuation dependencies of frequency and grain size distribution for a water-saturated granular medium in the frequency range from 350kHz to 1.1MHz. This study can be applied to the high frequency acoustic SONAR modeling and design in the water-saturated environment. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Mechanical ventilation with high tidal volumes attenuates myocardial dysfunction by decreasing cardiac edema in a rat model of LPS-induced peritonitis

    Directory of Open Access Journals (Sweden)

    Smeding Lonneke

    2012-03-01

    Full Text Available Abstract Background Injurious mechanical ventilation (MV may augment organ injury remote from the lungs. During sepsis, myocardial dysfunction is common and increased endothelial activation and permeability can cause myocardial edema, which may, among other factors, hamper myocardial function. We investigated the effects of MV with injuriously high tidal volumes on the myocardium in an animal model of sepsis. Methods Normal rats and intraperitoneal (i.p. lipopolysaccharide (LPS-treated rats were ventilated with low (6 ml/kg and high (19 ml/kg tidal volumes (Vt under general anesthesia. Non-ventilated animals served as controls. Mean arterial pressure (MAP, central venous pressure (CVP, cardiac output (CO and pulmonary plateau pressure (Pplat were measured. Ex vivo myocardial function was measured in isolated Langendorff-perfused hearts. Cardiac expression of endothelial vascular cell adhesion molecule (VCAM-1 and edema were measured to evaluate endothelial inflammation and leakage. Results MAP decreased after LPS-treatment and Vt-dependently, both independent of each other and with interaction. MV Vt-dependently increased CVP and Pplat and decreased CO. LPS-induced peritonitis decreased myocardial function ex vivo but MV attenuated systolic dysfunction Vt-dependently. Cardiac endothelial VCAM-1 expression was increased by LPS treatment independent of MV. Cardiac edema was lowered Vt-dependently by MV, particularly after LPS, and correlated inversely with systolic myocardial function parameters ex vivo. Conclusion MV attenuated LPS-induced systolic myocardial dysfunction in a Vt-dependent manner. This was associated with a reduction in cardiac edema following a lower transmural coronary venous outflow pressure during LPS-induced coronary inflammation.

  15. Comparative Proteomics of Human Monkeypox and Vaccinia Intracellular Mature and Extracellular Enveloped Virions

    Energy Technology Data Exchange (ETDEWEB)

    Manes, Nathan P.; Estep, Ryan D.; Mottaz, Heather M.; Moore, Ronald J.; Clauss, Therese RW; Monroe, Matthew E.; Du, Xiuxia; Adkins, Joshua N.; Wong, Scott; Smith, Richard D.

    2008-03-07

    Orthopoxviruses are the largest and most complex of the animal viruses. In response to the recent emergence of monkeypox in Africa and the threat of smallpox bioterrorism, virulent (monkeypox virus) and benign (vaccinia virus) orthopoxviruses were proteomically compared with the goal of identifying proteins required for pathogenesis. Orthopoxviruses were grown in HeLa cells to two different viral forms (intracellular mature virus and extracellular enveloped virus), purified by sucrose gradient ultracentrifugation, denatured using RapiGest™ surfactant, and digested with trypsin. Unfractionated samples and strong cation exchange HPLC fractions were analyzed by reversed-phase LC-MS/MS, and analyses of the MS/MS spectra using SEQUEST® and X! Tandem resulted in the identification of hundreds of monkeypox, vaccinia, and copurified host proteins. The unfractionated samples were additionally analyzed by LC-MS on an LTQ-Orbitrap™, and the accurate mass and elution time tag approach was used to perform quantitative comparisons. Possible pathophysiological roles of differentially expressed orthopoxvirus genes are discussed.

  16. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2017-05-01

    Full Text Available Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy.

  17. Vaccinia virus protein F12 associates with intracellular enveloped virions through an interaction with A36.

    Science.gov (United States)

    Johnston, Sara C; Ward, Brian M

    2009-02-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress.

  18. Vaccinia Virus Natural Infections in Brazil: The Good, the Bad, and the Ugly

    Directory of Open Access Journals (Sweden)

    Jaqueline Silva de Oliveira

    2017-11-01

    Full Text Available The orthopoxviruses (OPV comprise several emerging viruses with great importance to human and veterinary medicine, including vaccinia virus (VACV, which causes outbreaks of bovine vaccinia (BV in South America. Historically, VACV is the most comprehensively studied virus, however, its origin and natural hosts remain unknown. VACV was the primary component of the smallpox vaccine, largely used during the smallpox eradication campaign. After smallpox was declared eradicated, the vaccination that conferred immunity to OPV was discontinued, favoring a new contingent of susceptible individuals to OPV. VACV infections occur naturally after direct contact with infected dairy cattle, in recently vaccinated individuals, or through alternative routes of exposure. In Brazil, VACV outbreaks are frequently reported in rural areas, affecting mainly farm animals and humans. Recent studies have shown the role of wildlife in the VACV transmission chain, exploring the role of wild rodents as reservoirs that facilitate VACV spread throughout rural areas. Furthermore, VACV circulation in urban environments and the significance of this with respect to public health, have also been explored. In this review, we discuss the history, epidemiological, ecological and clinical aspects of natural VACV infections in Brazil, also highlighting alternative routes of VACV transmission, the factors involved in susceptibility to infection, and the natural history of the disease in humans and animals, and the potential for dissemination to urban environments.

  19. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Science.gov (United States)

    Haddad, Dana

    2017-01-01

    Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV) strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy. PMID:28589082

  20. Expression of CCL19 from Oncolytic Vaccinia Enhances Immunotherapeutic Potential while Maintaining Oncolytic Activity

    Directory of Open Access Journals (Sweden)

    Jun Li

    2012-12-01

    Full Text Available Promising phase II clinical results have been reported recently for several oncolytic viral therapeutics, including strains based on vaccinia virus. One reason for this has been an increased appreciation of the critical therapeutic importance of the immune response raised by these viruses. However, the most commonly used approaches to enhance these immunotherapeutic effects in oncolytic viruses, typically though expression of cytokine transgenes, often also result in a reduction in oncolytic activity and premature clearance of the virotherapy from the tumor. Approaches that enhance the immunotherapeutic effects while maintaining oncolytic activity would therefore be beneficial. Here, it is demonstrated that the expression of the chemokine CCL19 (ELC from an oncolytic vaccinia virus (vvCCL19 results in increased antitumor effects in syngeneic mouse tumor models. This corresponded with increased t cell and dendritic cell infiltration into the tumor. However, vvCCL19 persisted in the tumor at equivalent levels to a control virus without CCL19, demonstrating that oncolytic activity was not curtailed. Instead, vvCCL19 was cleared rapidly and selectively from normal tissues and organs, indicating a potentially increased safety profile. The therapeutic activity of vvCCL19 could be further significantly increased through combination with adoptive transfer of therapeutic immune cells expressing CCR7, the receptor for CCL19. This approach therefore represents a means to increase the safety and therapeutic benefit of oncolytic viruses, used alone or in combination with immune cell therapies.

  1. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  2. Crosstalk between immune cell and oncolytic vaccinia therapy enhances tumor trafficking and antitumor effects.

    Science.gov (United States)

    Sampath, Padma; Li, Jun; Hou, Weizhou; Chen, Hannah; Bartlett, David L; Thorne, Steve H

    2013-03-01

    The combination of an oncolytic virus, that directly destroys tumor cells and mediates an acute immune response, with an immune cell therapy, capable of further enlisting and enhancing the host immune response, has the potential to create a potent therapeutic effect. We have previously developed several strategies for optimizing the delivery of oncolytic vaccinia virus vectors to their tumor targets, including the use of immune cell-based carrier vehicles and the incorporation of mutations that increase production of the enveloped form of vaccinia (extracellular enveloped viral (EEV)) that is better adapted to spread within a host. Here, we initially combine these approaches to create a novel therapeutic, consisting of an immune cell (cytokine-induced killer, CIK) preloaded with an oncolytic virus that is EEV enhanced. This resulted in direct interaction between the viral and immune cell components with each assisting the other in directing the therapy to the tumor and so enhancing the antitumor effects. This effect could be further improved through CCL5 expression from the virus. The resulting multicomponent therapy displays the ability for synergistic crosstalk between components, so significantly enhancing tumor trafficking and antitumor effects.

  3. Whole cell cryo-electron tomography reveals distinct disassembly intermediates of vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Marek Cyrklaff

    Full Text Available At each round of infection, viruses fall apart to release their genome for replication, and then reassemble into stable particles within the same host cell. For most viruses, the structural details that underlie these disassembly and assembly reactions are poorly understood. Cryo-electron tomography (cryo-ET, a unique method to investigate large and asymmetric structures at the near molecular resolution, was previously used to study the complex structure of vaccinia virus (VV. Here we study the disassembly of VV by cryo-ET on intact, rapidly frozen, mammalian cells, infected for up to 60 minutes. Binding to the cell surface induced distinct structural rearrangements of the core, such as a shape change, the rearrangement of its surface spikes and de-condensation of the viral DNA. We propose that the cell surface induced changes, in particular the decondensation of the viral genome, are a prerequisite for the subsequent release of the vaccinia DNA into the cytoplasm, which is followed by its cytoplasmic replication. Generally, this is the first study that employs whole cell cryo-ET to address structural details of pathogen-host cell interaction.

  4. CD40 ligand and tdTomato-armed vaccinia virus for induction of antitumor immune response and tumor imaging.

    Science.gov (United States)

    Parviainen, S; Ahonen, M; Diaconu, I; Hirvinen, M; Karttunen, Å; Vähä-Koskela, M; Hemminki, A; Cerullo, V

    2014-02-01

    Oncolytic vaccinia virus is an attractive platform for immunotherapy. Oncolysis releases tumor antigens and provides co-stimulatory danger signals. However, arming the virus can improve efficacy further. CD40 ligand (CD40L, CD154) can induce apoptosis of tumor cells and it also triggers several immune mechanisms. One of these is a T-helper type 1 (Th1) response that leads to activation of cytotoxic T-cells and reduction of immune suppression. Therefore, we constructed an oncolytic vaccinia virus expressing hCD40L (vvdd-hCD40L-tdTomato), which in addition features a cDNA expressing the tdTomato fluorochrome for detection of virus, potentially important for biosafety evaluation. We show effective expression of functional CD40L both in vitro and in vivo. In a xenograft model of bladder carcinoma sensitive to CD40L treatment, we show that growth of tumors was significantly inhibited by the oncolysis and apoptosis following both intravenous and intratumoral administration. In a CD40-negative model, CD40L expression did not add potency to vaccinia oncolysis. Tumors treated with vvdd-mCD40L-tdtomato showed enhanced efficacy in a syngenic mouse model and induced recruitment of antigen-presenting cells and lymphocytes at the tumor site. In summary, oncolytic vaccinia virus coding for CD40L mediates multiple antitumor effects including oncolysis, apoptosis and induction of Th1 type T-cell responses.

  5. Mutations Conferring Resistance to Viral DNA Polymerase Inhibitors in Camelpox Virus Give Different Drug-Susceptibility Profiles in Vaccinia Virus

    Czech Academy of Sciences Publication Activity Database

    Duraffour, S.; Andrei, G.; Topalis, D.; Krečmerová, Marcela; Crance, J. M.; Garin, D.; Snoeck, R.

    2012-01-01

    Roč. 86, č. 13 (2012), s. 7310-7325 ISSN 0022-538X Institutional support: RVO:61388963 Keywords : camelpox virus * CMLV * vaccinia virus VACV * acyclic nucleoside phosphonates * HPMPDAP * cidofovir * drug resistance Subject RIV: CC - Organic Chemistry Impact factor: 5.076, year: 2012

  6. Chemical inactivation of recombinant vaccinia viruses and the effects on antigenicity and immunogenicity of recombinant simian immunodeficiency virus envelope glycoproteins.

    NARCIS (Netherlands)

    E.G.J. Hulskotte (Ellen); M.E.M. Dings (Marlinda); S.G. Norley (Stephen); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractThe efficiency of paraformaldehyde (PFA) and binary ethylenimine (BEI) in inactivating recombinant vaccinia virus (rVV), present in baby hamster kidney cells expressing simian immunodeficiency virus envelope glycoproteins (SIV-Env), was measured in a series of inactivation studies. Both

  7. Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader

    NARCIS (Netherlands)

    Schwer, B; Visca, P.; Vos, J C; Stunnenberg, H.G.

    1987-01-01

    We have demonstrated by primer elongation and cap analysis that mature vaccinia virus late transcripts are discontinuously synthesized. We have shown that RNA transcripts from a translocated 11K and from the authentic 11K and 4b late promoters are extended by approximately 35 nucleotides beyond the

  8. Immunogenicity and protective efficacy of recombinant Modified Vaccinia virus Ankara candidate vaccines delivering West Nile virus envelope antigens

    NARCIS (Netherlands)

    Volz, Asisa; Lim, Stephanie; Kaserer, Martina; Pijlman, Gorben P.

    2016-01-01

    West Nile virus (WNV) cycles between insects and wild birds, and is transmitted via mosquito vectors to horses and humans, potentially causing severe neuroinvasive disease. Modified Vaccinia virus Ankara (MVA) is an advanced viral vector for developing new recombinant vaccines against infectious

  9. Identification of sites phosphorylated by the vaccinia virus B1R kinase in viral protein H5R

    Directory of Open Access Journals (Sweden)

    Hardie Grahame

    2000-09-01

    Full Text Available Abstract Background Vaccinia virus gene B1R encodes a serine/threonine protein kinase. In vitro this protein kinase phosphorylates ribosomal proteins Sa and S2 and vaccinia virus protein H5R, proteins that become phosphorylated during infection. Nothing is known about the sites phosphorylated on these proteins or the general substrate specificity of the kinase. The work described is the first to address these questions. Results Vaccinia virus protein H5R was phosphorylated by the B1R protein kinase in vitro, digested with V8 protease, and phosphopeptides separated by HPLC. The N-terminal sequence of one radioactively labelled phosphopeptide was determined and found to correspond to residues 81-87 of the protein, with Thr-84 and Thr-85 being phosphorylated. A synthetic peptide based on this region of the protein was shown to be a substrate for the B1R protein kinase, and the extent of phosphorylation was substantially decreased if either Thr residue was replaced by an Ala. Conclusions We have identified the first phosphorylation site for the vaccinia virus B1R protein kinase. This gives important information about the substrate-specificity of the enzyme, which differs from that of other known protein kinases. It remains to be seen whether the same site is phosphorylated in vivo.

  10. Concanavalin A-mediated cell agglutinability induced by Vaccinia virions. [Uv radiation, /sup 125/I tracer technique

    Energy Technology Data Exchange (ETDEWEB)

    Mbuy, G.; Bubel, H.C.

    1978-12-01

    The induction of enhanced concanavalin A (Con A)-mediated cellular agglutinability by purified vaccinia virus was examined quantitatively. Increased HEp-2 cell agglutinability by the lectin occurred within the first hour of infection and persisted without further change throughout the virus infectious cycle. Ultraviolet, but not heat-inactivated, virus was as effective as infectious virus in causing increased Con A agglutinability. Inhibition of viral and host cell protein synthesis by Streptovitacin A failed to alter the lectin response to vaccinia virus infection. Fluorescein-labeled Con A was observed to form clusters and large fluorescent patches on the infected cell surface during the earliest stage of infection. Studies with /sup 125/I-labeled Con A revealed an early but minimal increase in lectin binding to infected cells. After the first hour of infection, no further increase in Con A binding was observed. When cells were exposed to purified vaccinia virus surface tubules increased Con A agglutinability comparable to that obtained with native virus was demonstrated. Con A-mediated agglutinability of cells was temperature-dependent and displayed a higher temperature transition in infected cells. These data suggest that upon contact with the host cell, vaccinia virions or surface tubules induce alterations in the plasma membrane which are reflected in an enhanced agglutinability by Con A.

  11. Pressure surge attenuator

    Science.gov (United States)

    Christie, Alan M.; Snyder, Kurt I.

    1985-01-01

    A pressure surge attenuation system for pipes having a fluted region opposite crushable metal foam. As adapted for nuclear reactor vessels and heads, crushable metal foam is disposed to attenuate pressure surges.

  12. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein.

    Science.gov (United States)

    Remy-Ziller, Christelle; Germain, Claire; Spindler, Anita; Hoffmann, Chantal; Silvestre, Nathalie; Rooke, Ronald; Bonnefoy, Jean-Yves; Préville, Xavier

    2014-02-01

    Women showing normal cytology but diagnosed with a persistent high-risk human papillomavirus (HR-HPV) infection have a higher risk of developing high-grade cervical intraepithelial neoplasia and cervical cancer than noninfected women. As no therapeutic management other than surveillance is offered to these women, there is a major challenge to develop novel targeted therapies dedicated to the treatment of these patients. As such, E1 and E2 antigens, expressed early in the HPV life cycle, represent very interesting candidates. Both proteins are necessary for maintaining coordinated viral replication and gene synthesis during the differentiation process of the epithelium and are essential for the virus to complete its normal and propagative replication cycle. In the present study, we evaluated a new active targeted immunotherapeutic, a modified vaccinia virus Ankara (MVA) vector containing the E1 sequence of HPV16, aimed at inducing cellular immune responses with the potential to help and clear persistent HPV16-related infection. We carried out an extensive comparative time course analysis of the cellular immune responses induced by different schedules of immunization in C57BL/6 mice. We showed that multiple injections of MVA-E1 allowed sustained HPV16 E1-specific cellular immune responses in vaccinated mice and had no impact on the exhaustion phenotype of the generated HPV16 E1-specific CD8⁺ T cells, but they led to the differentiation of multifunctional effector T cells with high cytotoxic capacity. This study provides proof of concept that an MVA expressing HPV16 E1 can induce robust and long-lasting E1-specific responses and warrants further development of this candidate.

  13. Hydrogen sulfide in paraventricular nucleus attenuates blood pressure by regulating oxidative stress and inflammatory cytokines in high salt-induced hypertension.

    Science.gov (United States)

    Liang, Yan-Feng; Zhang, Dong-Dong; Yu, Xiao-Jing; Gao, Hong-Li; Liu, Kai-Li; Qi, Jie; Li, Hong-Bao; Yi, Qiu-Yue; Chen, Wen-Sheng; Cui, Wei; Zhu, Guo-Qing; Kang, Yu-Ming

    2017-03-15

    Hydrogen sulfide (H2S) is an important gaseous signaling molecule in neuro-modulation, anti-inflammatory, anti-oxidant and anti-hypertensive effects. The paraventricular nucleus (PVN) is a major integrative nucleus in regulating BP and SNA. The aim of this study is to explore whether endogenous or exogenous H2S changed by hydroxylamine hydrochloride (HA) or GYY4137 infused in the PVN affects RSNA and MAP by regulating oxidative stress or the balance between pro-inflammatory cytokines (PICs) and anti-inflammatory cytokines in high salt-induced hypertensive rats. Male Dahl rats were fed by high-salt or normal-salt diet. At the end of the 4th week, GYY4137, HA or vehicle was microinjected into bilateral PVN for 6 weeks. The levels of MAP, HR, plasma norepinephrine (NE), reactive oxygen species (ROS), NOX2, NOX4 and IL-1β were increased significantly in high salt-induced hypertensive rats. Higher levels of these parameters were detected in the group treated by HA, but lower levels in the GYY4137 group. The trends of H2S, CBS, IL-10 and Cu/Zn SOD were opposite to the parameters described above. These findings suggest that endogenous or exogenous H2S in the PVN attenuates sympathetic activity and hypertensive response, which are partly due to decrease of ROS and PICs within the PVN in high salt-induced hypertension. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Glycyrrhizic Acid Can Attenuate Metabolic Deviations Caused by a High-Sucrose Diet without Causing Water Retention in Male Sprague-Dawley Rats

    Directory of Open Access Journals (Sweden)

    Hamish Alexander Fernando

    2014-11-01

    Full Text Available Glycyrrhizic acid (GA ameliorates many components of the metabolic syndrome, but its potential therapeutic use is marred by edema caused by inhibition of renal 11β-hydroxysteroid dehydrogenase 2 (11β-HSD2. We assessed whether 100 mg/kg per day GA administered orally could promote metabolic benefits without causing edema in rats fed on a high-sucrose diet. Groups of eight male rats were fed on one of three diets for 28 days: normal diet, a high-sucrose diet, or a high-sucrose diet supplemented with GA. Rats were then culled and renal 11β-HSD2 activity, as well as serum sodium, potassium, angiotensin II and leptin levels were determined. Histological analyses were performed to assess changes in adipocyte size in visceral and subcutaneous depots, as well as hepatic and renal tissue morphology. This dosing paradigm of GA attenuated the increases in serum leptin levels and visceral, but not subcutaneous adipocyte size caused by the high-sucrose diet. Although GA decreased renal 11β-HSD2 activity, it did not affect serum electrolyte or angiotensin II levels, indicating no onset of edema. Furthermore, there were no apparent morphological changes in the liver or kidney, indicating no toxicity. In conclusion, it is possible to reap metabolic benefits of GA without edema using the current dosage and treatment time.

  15. Glycyrrhizic acid can attenuate metabolic deviations caused by a high-sucrose diet without causing water retention in male Sprague-Dawley rats.

    Science.gov (United States)

    Fernando, Hamish Alexander; Chandramouli, Chanchal; Rosli, Dayang; Lam, Yi Lyn; Yong, Sheau Ting; Yaw, Hui Ping; Ton, So Ha; Kadir, Khalid Abdul; Sainsbury, Amanda

    2014-11-04

    Glycyrrhizic acid (GA) ameliorates many components of the metabolic syndrome, but its potential therapeutic use is marred by edema caused by inhibition of renal 11β-hydroxysteroid dehydrogenase 2 (11β-HSD2). We assessed whether 100 mg/kg per day GA administered orally could promote metabolic benefits without causing edema in rats fed on a high-sucrose diet. Groups of eight male rats were fed on one of three diets for 28 days: normal diet, a high-sucrose diet, or a high-sucrose diet supplemented with GA. Rats were then culled and renal 11β-HSD2 activity, as well as serum sodium, potassium, angiotensin II and leptin levels were determined. Histological analyses were performed to assess changes in adipocyte size in visceral and subcutaneous depots, as well as hepatic and renal tissue morphology. This dosing paradigm of GA attenuated the increases in serum leptin levels and visceral, but not subcutaneous adipocyte size caused by the high-sucrose diet. Although GA decreased renal 11β-HSD2 activity, it did not affect serum electrolyte or angiotensin II levels, indicating no onset of edema. Furthermore, there were no apparent morphological changes in the liver or kidney, indicating no toxicity. In conclusion, it is possible to reap metabolic benefits of GA without edema using the current dosage and treatment time.

  16. Green Tea Extract Supplementation Induces the Lipolytic Pathway, Attenuates Obesity, and Reduces Low-Grade Inflammation in Mice Fed a High-Fat Diet

    Directory of Open Access Journals (Sweden)

    Cláudio A. Cunha

    2013-01-01

    Full Text Available The aim of this study was to evaluate the effects of green tea Camellia sinensis extract on proinflammatory molecules and lipolytic protein levels in adipose tissue of diet-induced obese mice. Animals were randomized into four groups: CW (chow diet and water; CG (chow diet and water + green tea extract; HW (high-fat diet and water; HG (high-fat diet and water + green tea extract. The mice were fed ad libitum with chow or high-fat diet and concomitantly supplemented (oral gavage with 400 mg/kg body weight/day of green tea extract (CG and HG, resp.. The treatments were performed for eight weeks. UPLC showed that in 10 mg/mL green tea extract, there were 15 μg/mg epigallocatechin, 95 μg/mg epigallocatechin gallate, 20.8 μg/mg epicatechin gallate, and 4.9 μg/mg gallocatechin gallate. Green tea administered concomitantly with a high-fat diet increased HSL, ABHD5, and perilipin in mesenteric adipose tissue, and this was associated with reduced body weight and adipose tissue gain. Further, we observed that green tea supplementation reduced inflammatory cytokine TNFα levels, as well as TLR4, MYD88, and TRAF6 proinflammatory signalling. Our results show that green tea increases the lipolytic pathway and reduces adipose tissue, and this may explain the attenuation of low-grade inflammation in obese mice.

  17. Fruit vinegars attenuate cardiac injury via anti-inflammatory and anti-adiposity actions in high-fat diet-induced obese rats.

    Science.gov (United States)

    Bounihi, Abdenour; Bitam, Arezki; Bouazza, Asma; Yargui, Lyece; Koceir, Elhadj Ahmed

    2017-12-01

    Fruit vinegars (FVs) are used in Mediterranean folk medicine for their hypolipidemic and weight-reducing properties. To investigate the preventive effects of three types of FV, commonly available in Algeria, namely prickly pear [Opuntia ficus-indica (L.) Mill (Cectaceae)], pomegranate [Punica granatum L. (Punicaceae)], and apple [Malus domestica Borkh. (Rosaceae)], against obesity-induced cardiomyopathy and its underlying mechanisms. Seventy-two male Wistar rats were equally divided into 12 groups. The first group served as normal control (distilled water, 7 mL/kg bw), and the remaining groups were respectively treated with distilled water (7 mL/kg bw), acetic acid (0.5% w/v, 7 mL/kg bw) and vinegars of pomegranate, apple or prickly pear (at doses of 3.5, 7 and 14 mL/kg bw, acetic acid content as mentioned above) along with a high-fat diet (HFD). The effects of the oral administration of FV for 18 weeks on the body and visceral adipose tissue (VAT) weights, plasma inflammatory and cardiac enzymes biomarkers, and in heart tissue were evaluated. Vinegars treatments significantly (p < .05) attenuated the HFD-induced increase in bw (0.2-0.5-fold) and VAT mass (0.7-1.8-fold), as well as increase in plasma levels of CRP (0.1-0.3-fold), fibrinogen (0.2-0.3-fold), leptin (1.7-3.7-fold), TNF-α (0.1-0.6-fold), AST (0.9-1.4-fold), CK-MB (0.3-1.4-fold) and LDH (2.7-6.7-fold). Moreover, vinegar treatments preserved myocardial architecture and attenuated cardiac fibrosis. These findings suggest that pomegranate, apple and prickly pear vinegars may prevent HFD-induced obesity and obesity-related cardiac complications, and that this prevention may result from the potent anti-inflammatory and anti-adiposity properties of these vinegars.

  18. Lung attenuation measurements in healthy young adults.

    OpenAIRE

    Smit, H.J.M.; Golding, R.P.; Schramel, F.M.N.H.; Devillé, W.L.; Manoliu, R.A.; Postmus, P. E.

    2003-01-01

    Background: High-resolution computed tomography (HRCT) attenuation measurements may be more sensitive in finding early emphysematous changes in relatively young subjects than lung function measurements. Objectives: To define lung attenuation parameters in smokers and never-smokers. Methods: A prospective comparative study in a university hospital setting was designed with 20 healthy smoking and 20 nonsmoking volunteers. Attenuation measurements on spirometrically controlled HRCT at three leve...

  19. Resistant starch and exercise independently attenuate weight regain on a high fat diet in a rat model of obesity

    OpenAIRE

    Johnson Ginger C; Brown Ian L; Jackman Matthew R; Higgins Janine A; Steig Amy; Wyatt Holly R; Hill James O; MacLean Paul S

    2011-01-01

    Abstract Background Long-term weight reduction remains elusive for many obese individuals. Resistant starch (RS) and exercise may be useful for weight maintenance. The effects of RS, with or without exercise, on weight regain was examined during relapse to obesity on a high carbohydrate, high fat (HC/HF) diet. Methods Obesity-prone rats were fed ad libitum for 16 weeks then weight reduced on a low fat diet to induce a 17% body weight loss (weight reduced rats). Weight reduced rats were mainta...

  20. Infecções humanas causadas por poxvirus relacionados ao vírus vaccinia no Brasil Human infections caused by vaccinia-like poxviruses in Brazil

    Directory of Open Access Journals (Sweden)

    Hermann G. Schatzmayr

    2009-12-01

    Full Text Available A partir de 1999, infecções humanas por Orthopoxvirus vem sendo observadas em pelo menos oito estados no país, com a formação de vesículas as quais evoluem para pústulas e crostas, principalmente nos membros superiores e face, após contacto com bovinos apresentando lesões semelhantes no úbere. Alem das lesões na pele, foram descritas nos pacientes reações ganglionares axilares por vezes dolorosas, febre, cefaléia, fadiga, desidratação, anorexia, sudorese, artralgia e mialgia, evoluindo o quadro por três a quatro semanas. Lesão vulvar bem como transmissão intrafamiliar foram igualmente descritas. Estudos moleculares demonstraram que os poxvirus identificados são geneticamente relacionados a amostras do vírus vaccinia utilizadas no passado, nas campanhas de vacinação. Especimens clínicos de 80 infecções humanas foram estudados no laboratório e a infecção por orthopoxvirus confirmada em 68 casos. São apresentadas lesões observadas em pacientes bem como discutidas as implicações desta zoonose no Brasil.Since 1999, human infection caused by Orthopoxvirus has been observed in at least eight Brazilian states, with the presence of vesicles that evolve to pustules and crusts, especially on the hands, arms and face, after contact with cows showing comparable lesions on the udder. In addition to the skin lesions, there have been descriptions of patients with axillary ganglionic reactions that are sometimes painful, along with fever, headache, fatigue, dehydration, anorexia, sudoresis, arthralgia and muscle pain. The condition evolves over a three to four-week period. Vulvar lesions and transmission within families have also been described. Molecular studies have shown that the poxviruses identified are genetically related to vaccinia virus samples that were used in vaccination campaigns in the past. Clinical specimens from 80 human infections were studied in the laboratory, and orthopoxvirus infections were confirmed in 68

  1. Chlorella Protein Hydrolysate Attenuates Glucose Metabolic Disorder and Fatty Liver in High-fat Diet-induced Obese Mice.

    Science.gov (United States)

    Noguchi, Naoto; Yanagita, Teruyoshi; Rahman, Shaikh Mizanoor; Ando, Yotaro

    2016-07-01

    Chlorella (Parachlorella beijerinckii) powder is reported to show a preventive effect against metabolic syndromes such as arteriosclerosis, hyperlipidemia, and hypertension. Approximately 60% of the chlorella content is protein. In order to understand the role of chlorella protein, we prepared a chlorella protein hydrolysate (CPH) by protease treatment. Male C57BL/6 mice were divided into three groups: a normal diet group, high-fat diet (HFD) group, and high-fat diet supplemented with CPH (HFD+CPH) group. The CPH administration improved glucose intolerance, insulin sensitivity, and adipose tissue hypertrophy in the high-fat diet-fed mice. In addition, the HFD+CPH group had significantly decreased liver total cholesterol and triglyceride levels compared with those in the HFD group. Furthermore, the HFD+CPH group had a decreased level of monocyte chemotactic protein-1 (MCP-1) in serum and a lower MCP-1 mRNA expression level in adipose tissue compared with the HFD group. The present study suggests that chlorella protein hydrolysate can prevent a high-fat diet-induced glucose disorder and fatty liver by inhibiting adipocyte hypertrophy and reducing the MCP-1 protein and gene expression.

  2. High-fat diet enhances and plasminogen activator inhibitor-1 deficiency attenuates bone loss in mice with Lewis Lung carcinoma

    Science.gov (United States)

    This study determined the effects of a high-fat diet and plasminogen activator inhibitor-1 deficiency (PAI-1-/-) on bone structure in mice bearing Lewis lung carcinoma (LLC) in lungs. Reduction in bone volume fraction (BV/TV) by 22% and 21%, trabecular number (Tb.N) by 8% and 4% and bone mineral de...

  3. Mori Folium and Mori Fructus Mixture Attenuates High-Fat Diet-Induced Cognitive Deficits in Mice

    Directory of Open Access Journals (Sweden)

    Hyo Geun Kim

    2015-01-01

    Full Text Available Obesity has become a global health problem, contributing to various diseases including diabetes, hypertension, cancer, and dementia. Increasing evidence suggests that obesity can also cause neuronal damage, long-term memory loss, and cognitive impairment. The leaves and the fruits of Morus alba L., containing active phytochemicals, have been shown to possess antiobesity and hypolipidemic properties. Thus, in the present study, we assessed their effects on cognitive functioning in mice fed a high-fat diet by performing immunohistochemistry, using antibodies against c-Fos, synaptophysin, and postsynaptic density protein 95 and a behavioral test. C57BL/6 mice fed a high-fat diet for 21 weeks exhibited increased body weight, but mice coadministered an optimized Mori Folium and Mori Fructus extract mixture (2 : 1; MFE for the final 12 weeks exhibited significant body weight loss. Additionally, obese mice exhibited not only reduced neural activity, but also decreased presynaptic and postsynaptic activities, while MFE-treated mice exhibited recovery of these activities. Finally, cognitive deficits induced by the high-fat diet were recovered by cotreatment with MFE in the novel object recognition test. Our findings suggest that the antiobesity effects of MFE resulted in recovery of the cognitive deficits induced by the high-fat diet by regulation of neural and synaptic activities.

  4. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    Directory of Open Access Journals (Sweden)

    Sonia T Wennier

    Full Text Available Modified vaccinia virus Ankara (MVA has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines.

  5. High-level activation of cyclic AMP signaling attenuates bone morphogenetic protein 2-induced sympathoadrenal lineage development and promotes melanogenesis in neural crest cultures.

    Science.gov (United States)

    Ji, Ming; Andrisani, Ourania M

    2005-06-01

    The intensity of cyclic AMP (cAMP) signaling is a differential instructive signal in neural crest (NC) cell specification. By an unknown mechanism, sympathoadrenal lineage specification is suppressed by high-level activation of cAMP signaling. In NC cultures, high-level activation of cAMP signaling mediates protein kinase A (PKA)-dependent Rap1-B-Raf-ERK1/2 activation, leading to cytoplasmic accumulation of phospho-Smad1, thus terminating bone morphogenetic protein 2 (BMP2)-induced sympathoadrenal cell development. Concurrently, cAMP signaling induces transcription of the melanocyte-determining transcription factor Mitf and melanogenesis. dnACREB and E1A inhibit Mitf expression and melanogenesis, supporting the notion that CREB activation is necessary for melanogenesis. However, constitutively active CREB(DIEDML) without PKA activation is insufficient for Mitf expression and melanogenesis, indicating PKA regulates additional aspects of Mitf transcription. Thus, high-level activation of cAMP signaling plays a dual role in NC cell differentiation: attenuation of BMP2-induced sympathoadrenal cell development and induction of melanogenesis. We conclude the intensity of activation of signal transduction cascades determines cell lineage segregation mechanisms.

  6. Safety of Live Attenuated High-Titer Varicella-Zoster Virus Vaccine in Pediatric Allogeneic Hematopoietic Stem Cell Transplantation Recipients.

    Science.gov (United States)

    Aoki, Takahiro; Koh, Katsuyoshi; Kawano, Yutaka; Mori, Makiko; Arakawa, Yuki; Kato, Motohiro; Hanada, Ryoji

    2016-04-01

    Hematopoietic stem cell transplantation (HSCT) recipients have a high risk of varicella-zoster virus (VZV) infections. Although VZV vaccination may be beneficial in preventing VZV infections, data on safety and efficacy of VZV vaccines in HSCT recipients, particularly of zoster vaccine, are limited. We report our experience with the use of a single dose of an Oka strain high-titer zoster-equivalent varicella vaccine in pediatric allogeneic HSCT recipients. We administered the high-titer VZV vaccine to 31 pediatric allogeneic HSCT recipients without vaccine-type VZV infections. One patient developed varicella due to wild-type VZV 13 days after vaccination. No zoster developed after vaccination during a median follow-up period of 4.8 years from vaccination. No other adverse effects were observed. Eighteen of the 31 patients (58.1%) were seropositive after vaccination. Seventeen patients were vaccinated within 24 months after HSCT; the seropositivity of these patients did not significantly differ from that of patients vaccinated > 24 months after HSCT. VZV vaccination may be a safe and beneficial approach in preventing VZV infections after HSCT. Copyright © 2016 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  7. Rosemary Extract-Mediated Lifespan Extension and Attenuated Oxidative Damage in Drosophila melanogaster Fed on High-Fat Diet.

    Science.gov (United States)

    Wang, Hua-Li; Sun, Zhen-Ou; Rehman, Rizwan-Ur; Wang, Hong; Wang, Yi-Fei; Wang, Hao

    2017-04-01

    Rosemary extract has a potent antioxidant activity and is widely used in the food industry. In this study, the lifespan prolonging and antioxidant activity of rosemary extract was evaluated by high-fat-induced oxidative damage in Drosophila melanogaster. The results revealed that the lifespan and climbing ability of fruit flies was enhanced significantly by feeding rosemary extract. Furthermore, feeding with rosemary extract significantly increased the enzyme activity of superoxide dismutase (SOD) and catalase (CAT), and significantly decreased the level of malonaldehyde. The gene expression of SOD, CAT, and nuclear factor erythroid-2 related factor 2 was enhanced and that for methuselah was significantly reduced. The comet assay showed that high-fat diet-induced DNA lesion was significantly reduced in larvae treated with the rosemary extract. Our results suggest that feeding with rosemary extract is effective to the extended lifespan in fruit flies by strengthening of the resistance to high-fat-induced oxidative stress and by stimulating, at least in part, the endogenous antioxidant response. © 2017 Institute of Food Technologists®.

  8. Use of dicarboxylic acids and polyphenols to attenuate reticular pH drop and acute phase response in dairy heifers fed a high grain diet.

    Science.gov (United States)

    De Nardi, Roberta; Marchesini, Giorgio; Plaizier, Jan C; Li, Shucong; Khafipour, Ehsan; Ricci, Rebecca; Andrighetto, Igino; Segato, Severino

    2014-11-26

    The aim of this study was to determine the ability of two feed additives, a fumarate-malate (FM) and a polyphenol-essential oil mixture (PM), in attenuating the drop of ruminal pH and the metabolic and immune response resulting from an excessively high grain diet. Six heifers were used in a 3 × 3 Latin square experiment and fed a low starch (LS) diet for 14 d, followed by a high starch (HS) diet for 8 d (NDF 33.6%, starch 30.0% DM). In the last 5 days of each period, barley meal was added to decrease rumen pH. During HS feeding all animals were randomly assigned to one of the following three dietary treatments: no supplement/control (CT), a daily dose of 60 g/d of FM, or 100 g/d of PM. Reticular pH was continuously recorded using wireless boluses. On d 21 of each period, rumen fluid was collected by rumenocentesis (1400 h), together with blood (0800 h) and fecal samples (0800, 1400, and 2100 h). The correlation coefficient of pH values obtained using the boluses and rumenocentesis was 0.83. Compared with CT and PM, the FM treatment led to a lower DMI. Nadir pH was lowest during CT (5.40, 5.69, and 5.62 for CT, FM and PM, respectively), confirming the effectiveness of both supplements in reducing the pH drop caused by high grain feeding. This result was confirmed by the highest average time spent daily below 5.6 pH (199, 16 and 18 min/d) and by the highest acetate to propionate ratio of the CT fed heifers. The PM decreased the concentrations of neutrophils (2.9, 3.2, and 2.8 10(9)/L) and acute phase proteins: SAA (37.1, 28.6 and 20.1 μg/mL), LBP (4.1, 3.8, and 2.9 μg/mL), and Hp (675, 695 and 601 μg/mL). Free lipopolysaccharides (LPS) were detected in blood and feces, but their concentrations were not affected by treatments, as the remaining blood variables. Data suggest that both additives could be useful in attenuating the effects of excessive grain feeding on rumen pH, but the PM supplement was more effective than FM in reducing the inflammatory response

  9. The human CD8+ T cell responses induced by a live attenuated tetravalent dengue vaccine are directed against highly conserved epitopes.

    Science.gov (United States)

    Weiskopf, Daniela; Angelo, Michael A; Bangs, Derek J; Sidney, John; Paul, Sinu; Peters, Bjoern; de Silva, Aruna D; Lindow, Janet C; Diehl, Sean A; Whitehead, Stephen; Durbin, Anna; Kirkpatrick, Beth; Sette, Alessandro

    2015-01-01

    The incidence of infection with any of the four dengue virus serotypes (DENV1 to -4) has increased dramatically in the last few decades, and the lack of a treatment or vaccine has contributed to significant morbidity and mortality worldwide. A recent comprehensive analysis of the human T cell response against wild-type DENV suggested an human lymphocyte antigen (HLA)-linked protective role for CD8(+) T cells. We have collected one-unit blood donations from study participants receiving the monovalent or tetravalent live attenuated DENV vaccine (DLAV), developed by the U.S. National Institutes of Health. Peripheral blood mononuclear cells from these donors were screened in gamma interferon enzyme-linked immunosorbent spot assays with pools of predicted, HLA-matched, class I binding peptides covering the entire DENV proteome. Here, we characterize for the first time CD8(+) T cell responses after live attenuated dengue vaccination and show that CD8(+) T cell responses in vaccinees were readily detectable and comparable to natural dengue infection. Interestingly, whereas broad responses to structural and nonstructural (NS) proteins were observed after monovalent vaccination, T cell responses following tetravalent vaccination were, dramatically, focused toward the highly conserved NS proteins. Epitopes were highly conserved in a vast variety of field isolates and able to elicit multifunctional T cell responses. Detailed knowledge of the T cell response will contribute to the identification of robust correlates of protection in natural immunity and following vaccination against DENV. The development of effective vaccination strategies against dengue virus (DENV) infection and clinically significant disease is a task of high global public health value and significance, while also being a challenge of significant complexity. A recent efficacy trial of the most advanced dengue vaccine candidate, demonstrated only partial protection against all four DENV serotypes, despite

  10. The Human CD8+ T Cell Responses Induced by a Live Attenuated Tetravalent Dengue Vaccine Are Directed against Highly Conserved Epitopes

    Science.gov (United States)

    Angelo, Michael A.; Bangs, Derek J.; Sidney, John; Paul, Sinu; Peters, Bjoern; de Silva, Aruna D.; Lindow, Janet C.; Diehl, Sean A.; Whitehead, Stephen; Durbin, Anna; Kirkpatrick, Beth; Sette, Alessandro

    2014-01-01

    ABSTRACT The incidence of infection with any of the four dengue virus serotypes (DENV1 to -4) has increased dramatically in the last few decades, and the lack of a treatment or vaccine has contributed to significant morbidity and mortality worldwide. A recent comprehensive analysis of the human T cell response against wild-type DENV suggested an human lymphocyte antigen (HLA)-linked protective role for CD8+ T cells. We have collected one-unit blood donations from study participants receiving the monovalent or tetravalent live attenuated DENV vaccine (DLAV), developed by the U.S. National Institutes of Health. Peripheral blood mononuclear cells from these donors were screened in gamma interferon enzyme-linked immunosorbent spot assays with pools of predicted, HLA-matched, class I binding peptides covering the entire DENV proteome. Here, we characterize for the first time CD8+ T cell responses after live attenuated dengue vaccination and show that CD8+ T cell responses in vaccinees were readily detectable and comparable to natural dengue infection. Interestingly, whereas broad responses to structural and nonstructural (NS) proteins were observed after monovalent vaccination, T cell responses following tetravalent vaccination were, dramatically, focused toward the highly conserved NS proteins. Epitopes were highly conserved in a vast variety of field isolates and able to elicit multifunctional T cell responses. Detailed knowledge of the T cell response will contribute to the identification of robust correlates of protection in natural immunity and following vaccination against DENV. IMPORTANCE The development of effective vaccination strategies against dengue virus (DENV) infection and clinically significant disease is a task of high global public health value and significance, while also being a challenge of significant complexity. A recent efficacy trial of the most advanced dengue vaccine candidate, demonstrated only partial protection against all four DENV

  11. High fat diet attenuates hyperglycemia, body composition changes, and bone loss in male streptozotocin-induced type 1 diabetic mice.

    Science.gov (United States)

    Carvalho, Adriana Lelis; DeMambro, Victoria E; Guntur, Anyonya R; Le, Phuong; Nagano, Kenichi; Baron, Roland; de Paula, Francisco José Albuquerque; Motyl, Katherine J

    2018-02-01

    There is a growing and alarming prevalence of obesity and the metabolic syndrome in type I diabetic patients (T1DM), particularly in adolescence. In general, low bone mass, higher fracture risk, and increased marrow adipose tissue (MAT) are features of diabetic osteopathy in insulin-deficient subjects. On the other hand, type 2 diabetes (T2DM) is associated with normal or high bone mass, a greater risk of peripheral fractures, and no change in MAT. Therefore, we sought to determine the effect of weight gain on bone turnover in insulin-deficient mice. We evaluated the impact of a 6-week high-fat (HFD) rich in medium chain fatty acids or low-fat diet (LFD) on bone mass and MAT in a streptozotocin (STZ)-induced model using male C57BL/6J mice at 8 weeks of age. Dietary intervention was initiated after diabetes confirmation. At the endpoint, lower non-fasting glucose levels were observed in diabetic mice fed with high fat diet compared to diabetic mice fed the low fat diet (STZ-LFD). Compared to euglycemic controls, the STZ-LFD had marked polydipsia and polyphagia, as well as reduced lean mass, fat mass, and bone parameters. Interestingly, STZ-HFD mice had higher bone mass, namely less cortical bone loss and more trabecular bone than STZ-LFD. Thus, we found that a HFD, rich in medium chain fatty acids, protects against bone loss in a T1DM mouse model. Whether this may also translate to T1DM patients who are overweight or obese in respect to maintenance of bone mass remains to be determined through longitudinal studies. © 2017 Wiley Periodicals, Inc.

  12. The kielin/chordin-like protein (KCP) attenuates high-fat diet-induced obesity and metabolic syndrome in mice.

    Science.gov (United States)

    Soofi, Abdul; Wolf, Katherine I; Emont, Margo P; Qi, Nathan; Martinez-Santibanez, Gabriel; Grimley, Edward; Ostwani, Wesam; Dressler, Gregory R

    2017-06-02

    Obesity and its associated complications such as insulin resistance and non-alcoholic fatty liver disease are reaching epidemic proportions. In mice, the TGF-β superfamily is implicated in the regulation of white and brown adipose tissue differentiation. The kielin/chordin-like protein (KCP) is a secreted regulator of the TGF-β superfamily pathways that can inhibit both TGF-β and activin signals while enhancing bone morphogenetic protein (BMP) signaling. However, KCP's effects on metabolism and obesity have not been studied in animal models. Therefore, we examined the effects of KCP loss or gain of function in mice that were maintained on either a regular or a high-fat diet. KCP loss sensitized the mice to obesity and associated complications such as glucose intolerance and adipose tissue inflammation and fibrosis. In contrast, transgenic mice that expressed KCP in the kidney, liver, and adipose tissues were resistant to developing high-fat diet-induced obesity and had significantly reduced white adipose tissue. Moreover, KCP overexpression shifted the pattern of SMAD signaling in vivo, increasing the levels of phospho (P)-SMAD1 and decreasing P-SMAD3. Adipocytes in culture showed a cell-autonomous effect in response to added TGF-β1 or BMP7. Metabolic profiling indicated increased energy expenditure in KCP-overexpressing mice and reduced expenditure in the KCP mutants with no effect on food intake or activity. These findings demonstrate that shifting the TGF-β superfamily signaling with a secreted protein can alter the physiology and thermogenic properties of adipose tissue to reduce obesity even when mice are fed a high-fat diet. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. A highly purified vegetal fraction able to modulate HMGB1 and to attenuate septic shock in mice.

    Science.gov (United States)

    Apetrei, Natalia Simona; Călugăru, Ana; Kerek, F; Panteli, Minerva; Rasit, I; Cremer, Lidia; Szegli, G; Lupu, Andreea-Roxana

    2011-01-01

    High-mobility group box protein 1 (HMGB1) is an intracellular protein that may be released actively from monocytes and macrophages or passively from necrotic or damaged cells. Its inhibition in animal experiments, even in the late phase of septic shock, significantly enhanced the survival rate of rodents. The aim of our study was to investigate the effect of a vegetal fraction isolated and highly purified from Helleborus purpurascens regarding the modulation of HMGB1 release either from tumor cells or human blood mononuclear cells. Our results showed that the vegetal fraction was able to down-regulate the release of HMGB1 from activated human blood mononuclear cells (PBMCs) and tumor cells. By combining the purified fraction with Cyclophosphamide the release of HMGB1 from tumor cells was strongly decreased. This synergism was not noticed when the ve getal product was associated with Doxorubicin. We also studied the effect of the purified fraction in mice with septic shock induced by cecal ligation and puncture (CLP) method. The tested vegetal product increased significantly the survival rate of animals compared to the mice not treated with it. Our data suggest that the purified vegetal fraction may modulate inflammation by down-regulating the HMGB1, which can also explain its efficacy in septic shock in mice.

  14. GOODS-HERSCHEL MEASUREMENTS OF THE DUST ATTENUATION OF TYPICAL STAR-FORMING GALAXIES AT HIGH REDSHIFT: OBSERVATIONS OF ULTRAVIOLET-SELECTED GALAXIES AT z {approx} 2

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, N.; Dickinson, M.; Kartaltepe, J. [National Optical Astronomy Observatory, 950 N Cherry Ave, Tucson, AZ 85719 (United States); Elbaz, D.; Daddi, E.; Magdis, G.; Aussel, H.; Dannerbauer, H.; Dasyra, K.; Hwang, H. S. [Laboratoire AIM-Paris-Saclay, CEA/DSM/Irfu-CNRS-Universite Paris Diderot, CE-Saclay, F-91191, Gif-sur-Yvette (France); Morrison, G. [Institute for Astronomy, University of Hawaii, Honolulu, HI 96822 (United States); Giavalisco, M. [Astronomy Department, University of Massachusetts, Amherst, Amherst, MA 01003 (United States); Ivison, R. [UK Astronomy Technology Centre, Science and Technology Facilities Council, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Papovich, C. [Department of Physics and Astronomy, Texas A and M University, College Station, TX 77845 (United States); Scott, D. [Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1 (Canada); Buat, V.; Burgarella, D. [Laboratoire d' Astrophysique de Marseille, OAMP, Universite Aix-Marseille, CNRS, 38 Rue Frederic Joliot-Curie, 13388 Marseille Cedex 13 (France); Charmandaris, V. [Department of Physics and Institute of Theoretical and Computational Physics, University of Crete, GR-71003, Heraklion (Greece); Murphy, E. [Spitzer Science Center, MC 314-6, California Institute of Technology, Pasadena, CA 91125 (United States); Altieri, B. [Herschel Science Centre, European Space Astronomy Centre, Villanueva de la Canada, 28691 Madrid (Spain); and others

    2012-01-10

    50 {mu}m fluxes validate on average the use of the local UV attenuation curve to recover the dust attenuation of typical star-forming galaxies at high redshift. In the simplest interpretation, the agreement between the local and high-redshift UV attenuation curves suggests a similarity in the dust production and stellar and dust geometries of starburst galaxies over the last 10 billion years.

  15. Expression Profiling during Arabidopsis/Downy Mildew Interaction Reveals a Highly-Expressed Effector That Attenuates Responses to Salicylic Acid

    Science.gov (United States)

    Asai, Shuta; Caillaud, Marie-Cécile; Furzer, Oliver J.; Ishaque, Naveed; Wirthmueller, Lennart; Fabro, Georgina; Shirasu, Ken; Jones, Jonathan D. G.

    2014-01-01

    Plants have evolved strong innate immunity mechanisms, but successful pathogens evade or suppress plant immunity via effectors delivered into the plant cell. Hyaloperonospora arabidopsidis (Hpa) causes downy mildew on Arabidopsis thaliana, and a genome sequence is available for isolate Emoy2. Here, we exploit the availability of genome sequences for Hpa and Arabidopsis to measure gene-expression changes in both Hpa and Arabidopsis simultaneously during infection. Using a high-throughput cDNA tag sequencing method, we reveal expression patterns of Hpa predicted effectors and Arabidopsis genes in compatible and incompatible interactions, and promoter elements associated with Hpa genes expressed during infection. By resequencing Hpa isolate Waco9, we found it evades Arabidopsis resistance gene RPP1 through deletion of the cognate recognized effector ATR1. Arabidopsis salicylic acid (SA)-responsive genes including PR1 were activated not only at early time points in the incompatible interaction but also at late time points in the compatible interaction. By histochemical analysis, we found that Hpa suppresses SA-inducible PR1 expression, specifically in the haustoriated cells into which host-translocated effectors are delivered, but not in non-haustoriated adjacent cells. Finally, we found a highly-expressed Hpa effector candidate that suppresses responsiveness to SA. As this approach can be easily applied to host-pathogen interactions for which both host and pathogen genome sequences are available, this work opens the door towards transcriptome studies in infection biology that should help unravel pathogen infection strategies and the mechanisms by which host defense responses are overcome. PMID:25329884

  16. Biocompounds Attenuating the Development of Obesity and Insulin Resistance Produced by a High-fat Sucrose Diet.

    Science.gov (United States)

    Etxeberria, Usune; de la Garza, Ana Laura; Martíinez, J Alfredo; Milagro, I

    2015-08-01

    The use of biocompounds as agents with potential anti-obesity effects might be a feasible alternative to the prescription of traditional drugs in the near future. The goal of the present study was to screen five different compounds in relation to their ability to prevent body weight gain and ameliorate obesity-associated metabolic impairments, namely insulin resistance. For this purpose, seventy Wistar rats were randomly assigned into seven experimental groups. A standard diet-fed control group (control, n=10); a high-fat, high-sucrose diet-fed group (HFS, n=10) and five experimental groups which were fed the HFS diet supplemented with one of the following biocompounds; curcumin (100 mg/kg bw, n=10), chlorogenic acid (50 mg/kg bw, n=10), coumaric acid (100 mg/kg bw, n=10), naringin (100 mg/kg bw, n=10) and leucine (1% of diet, n=10). These results confirm the effectiveness of all the compounds to reduce significantly food efficiency, despite the significant higher food intake. Moreover, visceral fat mass percentage was significantly decreased after naringin and coumaric acid supplementation. In fact, this finding might be related to the considerable amelioration of HOMA-IR index detected in naringin-treated animals. A significant reduction in serum insulin levels and an improvement in the intraperitoneal glucose tolerance test and AUC were found in leucine- and coumaric acid-treated rats, respectively. In summary, the tested biocompounds, particularly naringin, coumaric acid and leucine, showed potential benefits in the prevention of obesity-related complications in rats, at least at the proved doses.

  17. Niflumic Acid Attenuated Pulmonary Artery Tone and Vascular Structural Remodeling of Pulmonary Arterial Hypertension Induced by High Pulmonary Blood Flow In Vivo.

    Science.gov (United States)

    Wang, Kai; Ma, Jianfa; Pang, Yusheng; Lao, Jinquan; Pan, Xuanren; Tang, Qiaoyun; Zhang, Feng; Su, Danyan; Qin, Suyuan; Shrestha, Arnav Prasad

    2015-10-01

    Calcium-activated chloride channels (CaCCs) play a vital role in regulating pulmonary artery tone during pulmonary arterial hypertension (PAH) induced by high blood flow. The role of CaCCs inhibitor niflumic acid (NFA) in vivo during this process requires further investigation. We established the PAH model by abdominal shunt surgery and treated with NFA in vivo. Fifty rats were randomly divided into normal, sham, shunt, NFA group 1 (0.2 mg/kg), and NFA group 2 (0.4 mg/kg). Pathological changes, right ventricle hypertrophy index, arterial wall area/vessel area, and arterial wall thickness/vessel external diameter were analyzed. Then contraction reactions of pulmonary arteries were measured. Finally, the electrophysiological characteristics of pulmonary arterial smooth muscle cells were investigated using patch-clamp technology. After 11 weeks of shunting, PAH developed, accompanied with increased right ventricle hypertrophy index, arterial wall area/vessel area, and arterial wall thickness/vessel external diameter. In the NFA treatment groups, the pressure and pathological changes were alleviated. The pulmonary artery tone in the shunt group increased, whereas it decreased after NFA treatment. The current density of CaCC was higher in the shunt group, and it was decreased in the NFA treatment groups. In conclusion, NFA attenuated pulmonary artery tone and structural remodeling in PAH induced by high pulmonary blood flow in vivo. CaCCs were involved and the augmented current density was alleviated by NFA treatment.

  18. Vaccinia Virus Immunomodulator A46: A Lipid and Protein-Binding Scaffold for Sequestering Host TIR-Domain Proteins.

    Directory of Open Access Journals (Sweden)

    Sofiya Fedosyuk

    2016-12-01

    Full Text Available Vaccinia virus interferes with early events of the activation pathway of the transcriptional factor NF-kB by binding to numerous host TIR-domain containing adaptor proteins. We have previously determined the X-ray structure of the A46 C-terminal domain; however, the structure and function of the A46 N-terminal domain and its relationship to the C-terminal domain have remained unclear. Here, we biophysically characterize residues 1-83 of the N-terminal domain of A46 and present the X-ray structure at 1.55 Å. Crystallographic phases were obtained by a recently developed ab initio method entitled ARCIMBOLDO_BORGES that employs tertiary structure libraries extracted from the Protein Data Bank; data analysis revealed an all β-sheet structure. This is the first such structure solved by this method which should be applicable to any protein composed entirely of β-sheets. The A46(1-83 structure itself is a β-sandwich containing a co-purified molecule of myristic acid inside a hydrophobic pocket and represents a previously unknown lipid-binding fold. Mass spectrometry analysis confirmed the presence of long-chain fatty acids in both N-terminal and full-length A46; mutation of the hydrophobic pocket reduced the lipid content. Using a combination of high resolution X-ray structures of the N- and C-terminal domains and SAXS analysis of full-length protein A46(1-240, we present here a structural model of A46 in a tetrameric assembly. Integrating affinity measurements and structural data, we propose how A46 simultaneously interferes with several TIR-domain containing proteins to inhibit NF-κB activation and postulate that A46 employs a bipartite binding arrangement to sequester the host immune adaptors TRAM and MyD88.

  19. Safety and immunogenicity of novel recombinant BCG and modified vaccinia virus Ankara vaccines in neonate rhesus macaques.

    Science.gov (United States)

    Rosario, Maximillian; Fulkerson, John; Soneji, Shamit; Parker, Joe; Im, Eung-Jun; Borthwick, Nicola; Bridgeman, Anne; Bourne, Charles; Joseph, Joan; Sadoff, Jerald C; Hanke, Tomás

    2010-08-01

    Although major inroads into making antiretroviral therapy available in resource-poor countries have been made, there is an urgent need for an effective vaccine administered shortly after birth, which would protect infants from acquiring human immunodeficiency virus type 1 (HIV-1) through breast-feeding. Bacillus Calmette-Guérin (BCG) is given to most infants at birth, and its recombinant form could be used to prime HIV-1-specific responses for a later boost by heterologous vectors delivering the same HIV-1-derived immunogen. Here, two groups of neonate Indian rhesus macaques were immunized with either novel candidate vaccine BCG.HIVA(401) or its parental strain AERAS-401, followed by two doses of recombinant modified vaccinia virus Ankara MVA.HIVA. The HIVA immunogen is derived from African clade A HIV-1. All vaccines were safe, giving local reactions consistent with the expected response at the injection site. No systemic adverse events or gross abnormality was seen at necropsy. Both AERAS-401 and BCG.HIVA(401) induced high frequencies of BCG-specific IFN-gamma-secreting lymphocytes that declined over 23 weeks, but the latter failed to induce detectable HIV-1-specific IFN-gamma responses. MVA.HIVA elicited HIV-1-specific IFN-gamma responses in all eight animals, but, except for one animal, these responses were weak. The HIV-1-specific responses induced in infants were lower compared to historic data generated by the two HIVA vaccines in adult animals but similar to other recombinant poxviruses tested in this model. This is the first time these vaccines were tested in newborn monkeys. These results inform further infant vaccine development and provide comparative data for two human infant vaccine trials of MVA.HIVA.

  20. Intrarectal vaccination with recombinant vaccinia virus expressing carcinoembronic antigen induces mucosal and systemic immunity and prevents progression of colorectal cancer.

    Science.gov (United States)

    Kim-Schulze, Seunghee; Kim, Hong Sung; Wainstein, Alberto; Kim, Dae Won; Yang, Wein Cui; Moroziewicz, Dorota; Mong, Phyllus Y; Bereta, Michal; Taback, Bret; Wang, Qin; Kaufman, Howard L

    2008-12-01

    The gastrointestinal mucosa contains an intact immune system that protects the host from pathogens and communicates with the systemic immune system. Absorptive epithelial cells in the mucosa give rise to malignant tumors although the interaction between tumor cells and the mucosal immune system is not well defined. The pathophysiology of colorectal cancer has been elucidated through studies of hereditary syndromes, such as familial adenomatous polyposis, a cancer predisposition syndrome caused by germline mutations in the adenomatous polyposis coli tumor suppressor gene. Patients with FAP develop adenomas and inevitably progress to invasive carcinomas by the age of 40. To better delineate the role of mucosal immunity in colorectal cancer, we evaluated the efficacy of intrarectal recombinant vaccinia virus expressing the human carcinoembryonic Ag (CEA) in a murine FAP model in which mice are predisposed to colorectal cancer and also express human CEA in the gut. Mucosal vaccination reduced the incidence of spontaneous adenomas and completely prevented progression to invasive carcinoma. The therapeutic effects were associated with induction of mucosal CEA-specific IgA Ab titers and CD8(+) CTLs. Mucosal vaccination was also associated with an increase in systemic CEA-specific IgG Ab titers, CD4(+) and CD8(+) T cell responses and resulted in growth inhibition of s.c. implanted CEA-expressing tumors suggesting communication between mucosal and systemic immune compartments. Thus, intrarectal vaccination induces mucosal and systemic antitumor immunity and prevents progression of spontaneous colorectal cancer. These results have implications for the prevention of colorectal cancer in high-risk individuals.

  1. Cannabinoid receptor 2 agonist attenuates pain related behavior in rats with chronic alcohol/high fat diet induced pancreatitis.

    Science.gov (United States)

    Zhang, Liping; Kline, Robert H; McNearney, Terry A; Johnson, Michael P; Westlund, Karin N

    2014-11-17

    Chronic Pancreatitis (CP) is a complex and multifactorial syndrome. Many contributing factors result in development of dysfunctional pain in a significant number of patients. Drugs developed to treat a variety of pain states fall short of providing effective analgesia for patients with chronic pancreatitis, often providing minimal to partial pain relief over time with significant side effects. Recently, availability of selective pharmacological tools has enabled great advances in our knowledge of the role of the cannabinoid receptors in pathophysiology. In particular, cannabinoid receptor 2 (CB2) has emerged as an attractive target for management of chronic pain, as demonstrated in several studies with inflammatory and neuropathic preclinical pain models. In this study, the analgesic efficacy of a novel, highly selective CB2 receptor agonist, LY3038404 HCl, is investigated in a chronic pancreatitis pain model, induced with an alcohol/high fat (AHF) diet. Rats fed the AHF diet developed visceral pain-like behaviors detectable by week 3 and reached a maximum at week 5 that persists as long as the diet is maintained. Rats with AHF induced chronic pancreatitis were treated with LY3038404 HCl (10 mg/kg, orally, twice a day for 9 days). The treated animals demonstrated significantly alleviated pain related behaviors after 3 days of dosing, including increased paw withdrawal thresholds (PWT), prolonged abdominal withdrawal latencies (ABWL), and decreased nocifensive responses to noxious 44°C hotplate stimuli. Terminal histological analysis of pancreatic tissue sections from the AHF chronic pancreatitis animals demonstrated extensive injury, including a global pancreatic gland degeneration (cellular atrophy), vacuolization (fat deposition), and fibrosis. After the LY3038404 HCl treatment, pancreatic tissue was significantly protected from severe damage and fibrosis. LY3038404 HCl affected neither open field exploratory behaviors nor dark/light box preferences as measures

  2. Controllable Fabricating Dielectric-Dielectric SiC@C Core-Shell Nanowires for High-Performance Electromagnetic Wave Attenuation.

    Science.gov (United States)

    Liang, Caiyun; Wang, Zhijiang

    2017-11-22

    Heterostructured dielectric-dielectric nanowires of SiC core and carbon shell (SiC@C) with high-performance electromagnetic wave absorption were synthesized by combining an interfacial in situ polymer encapsulation and carbonization process. This approach overcomes the shortcomings of previous reported methods to prepare carbon shell that both carbon shell and free carbon particles are formed simultaneously. In our developed approach, the core of SiC nanowires are first positively charged. Then the negative resorcinol-formaldehyde polymers as the carbon source are anchored on SiC nanowires under the attraction of electrostatic force, which well suppresses the nucleation of free carbon particles. The thickness of the carbon shell could be modulated from 4 to 20 nm by simply adjusting the moral ratio of resorcinol to SiC nanowires. The resulting SiC@C core-shell nanostructures without free carbon particles offer synergism among the SiC nanowires and the carbon shells, generating multiple dipolar polarization, surfaced polarization, and associated relaxations, which endow SiC@C hybrid nanowires with a minimum reflection loss (RL) value of -50 dB at the frequency of 12 GHz and an effective absorption bandwidth of 8 GHz with RL value under -10 dB at the optimized state. Our results demonstrate that SiC@C hybrid nanowires are promising candidates for electromagnetic wave absorption applications.

  3. Ethanolic Extract of Taheebo Attenuates Increase in Body Weight and Fatty Liver in Mice Fed a High-Fat Diet

    Directory of Open Access Journals (Sweden)

    Won Hee Choi

    2014-10-01

    Full Text Available We evaluated whether intake of an ethanolic extract of Taheebo (TBE from Tabebuia avellanedae protects against body weight increase and fat accumulation in mice with high-fat diet (HFD-induced obesity. Four-week old male C57BL/6 mice were fed a HFD (25% fat, w/w for 11 weeks. The diet of control (HFD mice was supplemented with vehicle (0.5% sodium carboxymethyl cellulose by gavage; the diet of experimental (TBE mice was supplemented with TBE (150 mg/kg body weight/day by gavage. Mice administered TBE had significantly reduced body weight gain, fat accumulation in the liver, and fat pad weight, compared to HFD mice. Reduced hypertrophy of fat cells was also observed in TBE mice. Mice administered TBE also showed significantly lower serum levels of triglycerides, insulin, and leptin. Lipid profiles and levels of mRNAs and proteins related to lipid metabolism were determined in liver and white adipose tissue of the mice. Expression of mRNA and proteins related to lipogenesis were decreased in TBE-administered mice compared to mice fed HFD alone. These results suggest that TBE inhibits obesity and fat accumulation by regulation of gene expression related to lipid metabolism in HFD-induced obesity in mice.

  4. Attenuation of hyperglycemia and hyperlipidemia in high calorie fed/streptozotocin-treated rats by hydromethanolic extract of Padina tetrastromatica

    Directory of Open Access Journals (Sweden)

    Divya S. Mohan

    2014-03-01

    Full Text Available In the present study, the effect of defatted hydromethanolic extract of Padina tetrastromatica on carbohydrate metabolism and serum lipid profile were evaluated. Diabetes mellitus was induced in male Wistar rats by feeding high calorie/energy diet for two months followed by a single intraperitoneal injecttion of streptozotocin. Diabetic rats were administered with the extract intragastrically at doses of 150, 300, 450, and 600 mg/kg body weight daily for 45 days. Treatment with graded doses showed a dose dependent reduction in blood glucose and glycated hemoglobin levels. Treatment significantly increased the activity of hexokinase, glucose-6-phosphate dehydrogenase and glycogen content while there was significant reduction in the activity of glucose-6-phosphatase and fructose-1,6-bisphosphatase. Serum lipid profile was also brought back to near normal levels in a dose dependent manner. The present study clearly indicates the antihyperglycemic and hypolipidemic effects of P. tetrastromatica at an optimum dose of 450 mg/kg body weight.

  5. Phlorizin Supplementation Attenuates Obesity, Inflammation, and Hyperglycemia in Diet-Induced Obese Mice Fed a High-Fat Diet

    Directory of Open Access Journals (Sweden)

    Su-Kyung Shin

    2016-02-01

    Full Text Available Obesity, along with its related complications, is a serious health problem worldwide. Many studies reported the anti-diabetic effect of phlorizin, while little is known about its anti-obesity effect. We investigated the beneficial effects of phlorizin on obesity and its complications, including diabetes and inflammation in obese animal. Male C57BL/6J mice were divided into three groups and fed their respective experimental diets for 16 weeks: a normal diet (ND, 5% fat, w/w, high-fat diet (HFD, 20% fat, w/w, or HFD supplemented with phlorizin (PH, 0.02%, w/w. The findings revealed that the PH group had significantly decreased visceral and total white adipose tissue (WAT weights, and adipocyte size compared to the HFD. Plasma and hepatic lipids profiles also improved in the PH group. The decreased levels of hepatic lipids in PH were associated with decreased activities of enzymes involved in hepatic lipogenesis, cholesterol synthesis and esterification. The PH also suppressed plasma pro-inflammatory adipokines levels such as leptin, adipsin, tumor necrosis factor-α, monocyte chemoattractant protein-1, interferon-γ, and interleukin-6, and prevented HFD-induced collagen accumulation in the liver and WAT. Furthermore, the PH supplementation also decreased plasma glucose, insulin, glucagon, and homeostasis model assessment of insulin resistance levels. In conclusion, phlorizin is beneficial for preventing diet-induced obesity, hepatic steatosis, inflammation, and fibrosis, as well as insulin resistance.

  6. Korean Pine Nut Oil Attenuated Hepatic Triacylglycerol Accumulation in High-Fat Diet-Induced Obese Mice

    Directory of Open Access Journals (Sweden)

    Soyoung Park

    2016-01-01

    Full Text Available Korean pine nut oil (PNO has been reported to influence weight gain and lipid metabolism. We examined whether PNO replacement in a high-fat diet (HFD can ameliorate HFD-induced hepatic steatosis. Five-week-old male C57BL mice were fed control diets containing 10% of the energy from fat from PNO or soybean oil (SBO (PC, SC or HFDs with 45% of the energy from fat, with 10% from PNO or SBO and 35% from lard (PHFD, SHFD, for 12 weeks. Body weight gain and amount of white adipose tissue were lower in PHFD (10% and 18% lower, respectively compared with SHFD. Hepatic triacylglycerol (TG level was significantly lower in PHFD than the SHFD (26% lower. PNO consumption upregulated hepatic ACADL mRNA levels. The hepatic PPARG mRNA level was lower in the PC than in the SC. Expression of the sirtuin (SIRT 3 protein in white adipose tissue was down-regulated in the SHFD and restored in the PHFD to the level in the lean control mice. SIRT 3 was reported to be upregulated under conditions of caloric restriction (CR and plays a role in regulating mitochondrial function. PNO consumption resulted in lower body fat and hepatic TG accumulation in HFD-induced obesity, which seemed to be associated with the CR-mimetic response.

  7. Shugan Xiaozhi Decoction Attenuates Nonalcoholic Steatohepatitis by Enhancing PPARα and L-FABP Expressions in High-Fat-Fed Rats

    Directory of Open Access Journals (Sweden)

    Yu-feng Xing

    2016-01-01

    Full Text Available This study aimed to investigate the effects of Shugan Xiaozhi decoction (SX on nonalcoholic steatohepatitis (NASH induced by high-fat diet in rats. The rats were randomly divided into 6 groups, namely, control, model, fenofibrate, and three different dosage of SX (10, 20, and 40 g/kg/day, p.o.. After establishing the NASH model, at 8 weeks of the experiment, treatments were administrated intragastrically to the fenofibrate and SX groups. All rats were killed after 4 weeks of treatment. Compared with the model group, alanine aminotransferase (ALT, aspartate aminotransferase (AST, free fatty acid (FFA, total cholesterol (TC, triacylglycerol (TG, and low-density lipoprotein cholesterol (LDL serum in the serum were significantly reduced in all SX treatment groups in a dose-dependent manner. Evidence showed that SX could protect the liver by upregulating the gene and protein expressions of peroxisome proliferator-activated receptor alpha (PPARα and liver fatty acid binding protein (L-FABP in a dose-dependent manner. Chemical constituents of SX were further analyzed by ultraperformance liquid chromatography coupled with electrospray ionization mass spectrometry (UPLC-ESI-MS and 30 chemicals in the ethanolic extract were tentatively identified. To conclude, our results clearly indicated that SX could protect liver functions and relieve hepatic steatosis and inflammation.

  8. Curcumin attenuates cardiomyocyte hypertrophy induced by high glucose and insulin via the PPARγ/Akt/NO signaling pathway.

    Science.gov (United States)

    Chen, Rongchun; Peng, Xiaofeng; Du, Weimin; Wu, Yang; Huang, Bo; Xue, Lai; Wu, Qin; Qiu, Hongmei; Jiang, Qingsong

    2015-05-01

    To investigate the potential effect of curcumin on cardiomyocyte hypertrophy and a possible mechanism involving the PPARγ/Akt/NO signaling pathway in diabetes. The cardiomyocyte hypertrophy induced by high glucose (25.5mmol/L) and insulin (0.1μmol/L) (HGI) and the antihypertrophic effect of curcumin were evaluated in primary culture by measuring the cell surface area, protein content and atrial natriuretic factor (ANF) mRNA expression. The mRNA and protein expressions were assayed by reverse transcription PCR and Western blotting, whereas the NO concentration and endothelial NO synthase (eNOS) activity were determined using nitrate reduction and ELISA methods, respectively. The cardiomyocyte hypertrophy induced by HGI was characterized by increasing ANF mRNA expression, total protein content, and cell surface area, with downregulated mRNA and protein expressions of both PPARγ and Akt, which paralleled the declining eNOS mRNA expression, eNOS content, and NO concentration. The effects of HGI were inhibited by curcumin (1, 3, 10μmol/L) in a concentration-dependent manner. GW9662 (10μmol/L), a selective PPARγ antagonist, could abolish the effects of curcumin. LY294002 (20μmol/L), an Akt blocker, and N(G)-nitro-l-arginine-methyl ester (100μmol/L), a NOS inhibitor, could also diminish the effects of curcumin. The results suggested that curcumin supplementation can improve HGI-induced cardiomyocytes hypertrophy in vitro through the activation of PPARγ/Akt/NO signaling pathway. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Apple Cider Vinegar Attenuates Oxidative Stress and Reduces the Risk of Obesity in High-Fat-Fed Male Wistar Rats.

    Science.gov (United States)

    Halima, Ben Hmad; Sonia, Gara; Sarra, Khlifi; Houda, Ben Jemaa; Fethi, Ben Slama; Abdallah, Aouidet

    2018-01-01

    Metabolic syndrome is a serious consequence of obesity characterized by increased cardiovascular risk factors such as hypertension, dyslipidemia, and glucose intolerance. While diets enriched with natural antioxidants showed beneficial effects on oxidative stress, blood pressure, and serum lipid composition, diet supplementation with synthetic antioxidants showed contradictive results. Thus, we tested, in this study, whether a daily dosage of Apple Cider Vinegar (ACV) would affect cardiovascular risk factor associated with obesity in high-fat diet (HFD)-induced hyperlipidemic Wistar rats. Obese rats showed increased serum total cholesterol, triglyceride, low-density lipoprotein-cholesterol (LDL-C), very low density lipoprotein (VLDL) and atherogenic index after 6 and 9 weeks of being fed an HFD. Importantly, ACV ameliorated all of these parameters significantly. Oxidative stress already developed after 6 weeks of HFD and was significantly reduced by daily doses of ACV. Oral administration of ACV normalized various biochemical and metabolic changes since it exhibited a very significant (P < .001) reduction in malondialdehyde levels, whereas an increase in thiol group concentrations and antioxidant status (superoxide dismutase [SOD], glutathione peroxidase [GPx], and catalase [CAT] activities and vitamin E concentrations). In addition, a modulation in trace element levels was observed when compared with HFD groups. These findings suggested that HFD alters the oxidant-antioxidant balance, as evidenced by a reduction in the antioxidant enzyme activities and vitamin E level, and enhanced lipid peroxidation. ACV can be beneficial for the suppression of obesity-induced oxidative stress in HFD rats through the modulating antioxidant defense system and reduces the risk of obesity-associated diseases by preventing the atherogenic risk.

  10. Prevalence of antibodies to Vaccinia virus after smallpox vaccination in Italy.

    Science.gov (United States)

    Pütz, Mike M; Alberini, Isabella; Midgley, Claire M; Manini, Ilaria; Montomoli, Emanuele; Smith, Geoffrey L

    2005-11-01

    Decades after smallpox was eradicated and vaccination discontinued, the level of residual immunity in today's population is largely unknown. This study describes an epidemiological assessment in Italians of antibodies against the intracellular mature virus (IMV) and extracellular envelope virus (EEV) forms of Vaccinia virus. Serum samples (n = 642) were taken in 1993 and 2003 from people between 11 and 102 years old. Most citizens >27 years old were positive for antibodies to IMV and EEV. These antibodies were long-lasting and similar titres were present in citizens between 30 and 100 years old. Serum samples from 1993 and 2003 displayed very similar EEV- and IMV-specific antibody titres. By using these data and demographic considerations, it was predicted that, in 2003, 46 % of the Italian population were positive for both IMV and EEV, 42 % were negative for both and 12 % were positive for one antigen.

  11. Successful pseudorabies vaccination in maternally immune piglets using recombinant vaccinia virus vaccines.

    Science.gov (United States)

    Brockmeier, S I; Lager, K M; Mengeling, W L

    1997-01-01

    Three gilts were vaccinated with a NYVAC vaccinia recombinant expressing glycoprotein gD of pseudorabies virus (PRV) (NYVAC/gD). After farrowing, the piglets were allowed to nurse normally to obtain colostral immunity and then were divided into four groups, receiving NYVAC/gD, a NYVAC recombinant expressing glycoprotein gB of PRV (NYVAC/gB), an inactivated PRV vaccine (iPRV), or no vaccine. The piglets were vaccinated twice, three weeks apart beginning at approximately two weeks of age and later challenged with virulent PRV oronasally. Piglets that received NYVAC/gB or iPRV were the best protected based on lack of mortality, lower temperature responses, decreased weight loss and decreased viral shedding after challenge. These results indicate effective strategies for stimulating active immune response while still under the protection of maternal immunity.

  12. Myxoma and vaccinia virus exploit different mechanisms to enter and infect human cancer cells

    Science.gov (United States)

    Villa, Nancy Y.; Bartee, Eric; Mohamed, Mohamed R.; Rahman, Masmudur M.; Barrett, John W.; McFadden, Grant

    2010-01-01

    Myxoma (MYXV) and vaccinia virus (VACV) have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1- Low pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2- The tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3- Knockdown of PAK1 revealed that it is required for a late stage downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. PMID:20334889

  13. Vaccinia virus Transmission through Experimentally Contaminated Milk Using a Murine Model.

    Directory of Open Access Journals (Sweden)

    Izabelle Silva Rehfeld

    Full Text Available Bovine vaccinia (BV is a zoonosis caused by Vaccinia virus (VACV, which affects dairy cattle and humans. Previous studies have detected the presence of viable virus particles in bovine milk samples naturally and experimentally contaminated with VACV. However, it is not known whether milk contaminated with VACV could be a route of viral transmission. However, anti-Orthopoxvirus antibodies were detected in humans from BV endemic areas, whom had no contact with affected cows, which suggest that other VACV transmission routes are possible, such as consumption of contaminated milk and dairy products. Therefore, it is important to study the possibility of VACV transmission by contaminated milk. This study aimed to examine VACV transmission, pathogenesis and shedding in mice orally inoculated with experimentally contaminated milk. Thirty mice were orally inoculated with milk containing 107 PFU/ml of VACV, and ten mice were orally inoculated with uncontaminated milk. Clinical examinations were performed for 30 consecutive days, and fecal samples and oral swabs (OSs were collected every other day. Mice were euthanized on predetermined days, and tissue and blood samples were collected. Nested-PCR, plaque reduction neutralization test (PRNT, viral isolation, histopathology, and immunohistochemistry (IHC methods were performed on the collected samples. No clinical changes were observed in the animals. Viral DNA was detected in feces, blood, OSs and tissues, at least in one of the times tested. The lungs displayed moderate to severe interstitial lymphohistiocytic infiltrates, and only the heart, tonsils, tongue, and stomach did not show immunostaining at the IHC analysis. Neutralizing antibodies were detected at the 20th and 30th days post infection in 50% of infected mice. The results revealed that VACV contaminated milk could be a route of viral transmission in mice experimentally infected, showing systemic distribution and shedding through feces and oral

  14. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA*

    Science.gov (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric

    2015-01-01

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  15. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Science.gov (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Modulation of the myxoma virus plaque phenotype by vaccinia virus protein F11.

    Science.gov (United States)

    Irwin, Chad R; Evans, David H

    2012-07-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments that promote VACV exit and spread. This suggested that although MYXV carries homologs of the required genes (A33R, A34R, A36R, and B5R), they are dysfunctional. To test this, we produced MYXV recombinants expressing these genes, but we could not enhance actin projectile formation even in cells expressing all four VACV proteins. Another notable difference between these viruses is that MYXV lacks a homolog of the F11L gene. F11 inhibits the RhoA-mDia signaling that maintains the integrity of the cortical actin layer. We constructed an MYXV strain encoding F11L and observed that, unlike wild-type MYXV, the recombinant virus disrupted actin stress fibers and produced plaques up to 4-fold larger than those of controls, and these plaques expanded ∼6-fold faster. These viruses also grew to higher titers in multistep growth conditions, produced higher levels of actin projectiles, and promoted infected cell movement, although neither process was to the extent of that observed in VACV-infected cells. Thus, one reason for why MYXV produces small plaques is that it cannot spread via actin filaments, although the reason for this deficiency remains obscure. A second reason is that leporipoxviruses lack vaccinia's capacity to disrupt cortical actin.

  17. Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon

    Directory of Open Access Journals (Sweden)

    Hoddevik Gunnar

    2007-03-01

    Full Text Available Abstract Background The project was initiated to describe the response of a human embryonic fibroblast cell line to the replication of two different viruses, and, more specifically, to look for candidate genes involved in viral defense. For this purpose, the cells were synchronously infected with poliovirus in the absence or presence of interferon-alpha, or with vaccinia virus, a virus that is not inhibited by interferon. By comparing the changes in transcriptosome due to these different challenges, it should be possible to suggest genes that might be involved in defense. Results The viral titers were sufficient to yield productive infection in a majority of the cells. The cells were harvested in triplicate at various time-points, and the transcriptosome compared with mock infected cells using oligo-based, global 35 k microarrays. While there was very limited similarities in the response to the different viruses, a large proportion of the genes up-regulated by interferon-alpha were also up-regulated by poliovirus. Interferon-alpha inhibited poliovirus replication, but there were no signs of any interferons being induced by poliovirus. The observations suggest that the cells do launch an antiviral response to poliovirus in the absence of interferon. Analyses of the data led to a list of candidate antiviral genes. Functional information was limited, or absent, for most of the candidate genes. Conclusion The data are relevant for our understanding of how the cells respond to poliovirus and vaccinia virus infection. More annotations, and more microarray studies with related viruses, are required in order to narrow the list of putative defence-related genes.

  18. Brucella abortus 2308ΔNodVΔNodW double-mutant is highly attenuated and confers protection against wild-type challenge in BALB/c mice.

    Science.gov (United States)

    Li, Zhiqiang; Wang, Shuli; Zhang, Jinliang; Yang, Guangli; Yuan, Baodong; Huang, Jie; Han, Jincheng; Xi, Li; Xiao, Yanren; Chen, Chuangfu; Zhang, Hui

    2017-05-01

    Brucellosis is an important zoonotic disease of worldwide distribution, which causes animal and human disease. However, the current Brucella abortus (B. abortus) vaccines (S19 and RB51) have several drawbacks, including residual virulence for animals and humans. Moreover, S19 cannot allow serological differentiation between infected and vaccinated animals. We constructed double deletion (ΔNodVΔNodW) mutant from virulent B. abortus 2308 (S2308) by deleting the genes encoding two-component regulatory system (TCS) in chromosome II in S2308.2308ΔNodVΔNodW was significantly reduced survival in murine macrophages (RAW 264.7) and BALB/c mice. Moreover, the inoculated mice showed no splenomegaly. The mutant induced high protective immunity in BALB/c mice against challenge with S2308, and elicited an anti-Brucella-specific immunoglobulin G (IgG) response and induced the secretion of gamma interferon (IFN-γ) and interleukin-4 (IL-4). Moreover, NODV and NODW antigens would allow the serological differentiation between infected and vaccinated animals. These results suggest that 2308ΔNodVΔNodW mutant is a potential live attenuated vaccine candidate and can be used effectively against bovine brucellosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. A High Antioxidant Spice Blend Attenuates Postprandial Insulin and Triglyceride Responses and Increases Some Plasma Measures of Antioxidant Activity in Healthy, Overweight Men123

    Science.gov (United States)

    Skulas-Ray, Ann C.; Kris-Etherton, Penny M.; Teeter, Danette L.; Chen, C-Y. Oliver; Vanden Heuvel, John P.; West, Sheila G.

    2011-01-01

    There is much interest in the potential of dietary antioxidants to attenuate in vivo oxidative stress, but little characterization of the time course of plasma effects exists. Culinary spices have demonstrated potent in vitro antioxidant properties. The objective of this study was to examine whether adding 14 g of a high antioxidant spice blend to a 5060-kJ (1200 kcal) meal exerted significant postprandial effects on markers of plasma antioxidant status and metabolism. Healthy overweight men (n = 6) consumed a control and spiced meal in a randomized crossover design with 1 wk between testing sessions. Blood was sampled prior to the meal and at 30-min intervals for 3.5 h (total of 8 samples). Mixed linear models demonstrated a treatment × time interaction (P < 0.05) for insulin and TG, corresponding with 21 and 31% reductions in postprandial levels with the spiced meal, respectively. Adding spices to the meal significantly increased the ferric reducing antioxidant power, such that postprandial increases following the spiced meal were 2-fold greater than after the control meal (P = 0.009). The hydrophilic oxygen radical absorbance capacity (ORAC) of plasma also was increased by spices (P = 0.02). There were no treatment differences in glucose, total thiols, lipophilic ORAC, or total ORAC. The incorporation of spices into the diet may help normalize postprandial insulin and TG and enhance antioxidant defenses. PMID:21697300

  20. Electroacupuncture Decreases the Leukocyte Infiltration to White Adipose Tissue and Attenuates Inflammatory Response in High Fat Diet-Induced Obesity Rats

    Directory of Open Access Journals (Sweden)

    Chorng-Kai Wen

    2014-01-01

    Full Text Available Suppression of white adipose tissue inflammatory signaling may contribute to the pathogenesis of obesity-induced inflammatory response. However, the precise mechanism of efficacy of acupuncture related to adipose tissue remains poorly understood. In the present study we evaluated the anti-inflammatory activities of 10 Hz electroacupuncture (EA which was applied at the acupoint Zusanli (ST36 for 20 min per day in high-fat diet- (HFD- induced obesity model. Treatment lasted for one week. Obese rats treated with EA showed significantly reduced body weight compared with the rats in HFD group. EA decreased the number of F4/80 and CD11b-positive macrophages in epididymal adipose tissue. We found that 10 Hz EA given 7 days/week at ST36 acupoints significantly alleviated macrophage recruitment and then improved the obesity-associated factors of sterol regulatory element-binding protein-1 (SREBP-1 and target genes expression in rats with HFD. Adipose tissue inflammatory responses indicated by tumor necrosis factor-α (TNF-α, IL-6, monocyte chemotactic protein-1 (MCP-1, and CD68 mRNA expression were significantly reduced by EA in obese rats. Additionally, EA was found to significantly reduced serum levels of TNF-α, IL-6, and IL-1 in this model. These results indicated that EA improved adipose tissue inflammatory response in obese rats, at least partly, via attenuation of lipogenesis signaling.

  1. Troxerutin Attenuates Enhancement of Hepatic Gluconeogenesis by Inhibiting NOD Activation-Mediated Inflammation in High-Fat Diet-Treated Mice.

    Science.gov (United States)

    Zhang, Zifeng; Wang, Xin; Zheng, Guihong; Shan, Qun; Lu, Jun; Fan, Shaohua; Sun, Chunhui; Wu, Dongmei; Zhang, Cheng; Su, Weitong; Sui, Junwen; Zheng, Yuanlin

    2016-12-25

    Recent evidence suggests that troxerutin, a trihydroxyethylated derivative of natural bioflavonoid rutin, exhibits beneficial effects on diabetes-related symptoms. Here we investigated the effects of troxerutin on the enhancement of hepatic gluconeogenesis in high-fat diet (HFD)-treated mice and the mechanisms underlying these effects. Mice were divided into four groups: Control group, HFD group, HFD + Troxerutin group, and Troxerutin group. Troxerutin was treated by daily oral administration at doses of 150 mg/kg/day for 20 weeks. Tauroursodeoxycholic acid (TUDCA) was used to inhibit endoplasmic reticulum stress (ER stress). Our results showed that troxerutin effectively improved obesity and related metabolic parameters, and liver injuries in HFD-treated mouse. Furthermore, troxerutin significantly attenuated enhancement of hepatic gluconeogenesis in HFD-fed mouse. Moreover, troxerutin notably suppressed nuclear factor-κB (NF-κB) p65 transcriptional activation and release of inflammatory cytokines in HFD-treated mouse livers. Mechanismly, troxerutin dramatically decreased Nucleotide oligomerization domain (NOD) expression, as well as interaction between NOD1/2 with interacting protein-2 (RIP2), by abating oxidative stress-induced ER stress in HFD-treated mouse livers, which was confirmed by TUDCA treatment. These improvement effects of troxerutin on hepatic glucose disorders might be mediated by its anti-obesity effect. In conclusion, troxerutin markedly diminished HFD-induced enhancement of hepatic gluconeogenesis via its inhibitory effects on ER stress-mediated NOD activation and consequent inflammation, which might be mediated by its anti-obesity effect.

  2. MVA.85A boosting of BCG and an attenuated, phoP deficient M. tuberculosis vaccine both show protective efficacy against tuberculosis in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Frank A W Verreck

    Full Text Available Continuous high global tuberculosis (TB mortality rates and variable vaccine efficacy of Mycobacterium bovis Bacille Calmette-Guérin (BCG motivate the search for better vaccine regimes. Relevant models are required to downselect the most promising vaccines entering clinical efficacy testing and to identify correlates of protection.Here, we evaluated immunogenicity and protection against Mycobacterium tuberculosis in rhesus monkeys with two novel strategies: BCG boosted by modified vaccinia virus Ankara expressing antigen 85A (MVA.85A, and attenuated M. tuberculosis with a disrupted phoP gene (SO2 as a single-dose vaccine. Both strategies were well tolerated, and immunogenic as evidenced by induction of specific IFNgamma responses. Antigen 85A-specific IFNgamma secretion was specifically increased by MVA.85A boosting. Importantly, both MVA.85A and SO2 treatment significantly reduced pathology and chest X-ray scores upon infectious challenge with M. tuberculosis Erdman strain. MVA.85A and SO2 treatment also showed reduced average lung bacterial counts (1.0 and 1.2 log respectively, compared with 0.4 log for BCG and significant protective effect by reduction in C-reactive protein levels, body weight loss, and decrease of erythrocyte-associated hematologic parameters (MCV, MCH, Hb, Ht as markers of inflammatory infection, all relative to non-vaccinated controls. Lymphocyte stimulation revealed Ag85A-induced IFNgamma levels post-infection as the strongest immunocorrelate for protection (spearman's rho: -0.60.Both the BCG/MVA.85A prime-boost regime and the novel live attenuated, phoP deficient TB vaccine candidate SO2 showed significant protective efficacy by various parameters in rhesus macaques. Considering the phylogenetic relationship between macaque and man and the similarity in manifestations of TB disease, these data support further development of these primary and combination TB vaccine candidates.

  3. TLR4 knockout attenuated high fat diet-induced cardiac dysfunction via NF-κB/JNK-dependent activation of autophagy.

    Science.gov (United States)

    Hu, Nan; Zhang, Yingmei

    2017-08-01

    Obesity is commonly associated with a low grade systemic inflammation, which may contribute to the onset and development of myocardial remodeling and contractile dysfunction. Toll-like receptor 4 (TLR4) plays an important role in innate immunity and inflammation although its role in high fat diet-induced obesity cardiac dysfunction remains elusive. This study was designed to examine the effect of TLR4 ablation on high fat diet intake-induced cardiac anomalies, if any, and underlying mechanism(s) involved. Wild-type (WT) and TLR4 knockout mice were fed normal or high fat (60% calorie from fat) diet for 12weeks prior to assessment of mechanical and intracellular Ca(2+) properties. The inflammatory signaling proteins (TLR4, NF-κB, and JNK) and autophagic markers (Atg5, Atg12, LC3B and p62) were evaluated. Our results revealed that high fat diet intake promoted obesity, marked decrease in fractional shortening, and cardiomyocyte contractile capacity with dampened intracellular Ca(2+) release and clearance, elevated ROS generation and oxidative stress as measured by aconitase activity, the effects of which were significantly attenuated by TLR4 knockout. In addition, high fat intake downregulated levels of Atg5, Atg12 and LC3B, while increasing p62 accumulation. TLR4 knockout itself did not affect Atg5, Atg12, LC3B and p62 levels while it reconciled high fat diet intake-induced changes in autophagy. In addition, TLR4 knockout alleviated high fat diet-induced phosphorylation of IKKβ, JNK and mTOR. In vitro study revealed that palmitic acid suppressed cardiomyocyte contractile function, the effect of which was inhibited the TLR4 inhibitor CLI-095, the JNK inhibitor AS601245 or the NF-κB inhibitor Celastrol. Taken together, these data showed that TLR4 knockout ameliorated high fat diet-induced cardiac contractile and intracellular Ca(2+) anomalies through inhibition of inflammation and ROS, possibly through a NF-κB/JNK-dependent activation of autophagy. This article is

  4. Myrciaria cauliflora extracts attenuate diabetic nephropathy involving the Ras signaling pathway in streptozotocin/nicotinamide mice on a high fat diet

    Directory of Open Access Journals (Sweden)

    Chia-Chun Wu

    2016-01-01

    Full Text Available Diabetic nephropathy (DN is a major cause of end-stage renal disease and its mortality is continuously increasing worldwide. Previous studies indicate that reactive oxygen species play an important role in high glucose-induced renal injury. Myrciaria cauliflora has been reported as a functional food rich in anthocyanins possessing anti-oxidative and anti-inflammatory properties. This study examined whether M. cauliflora extracts (MCE can attenuate diabetic nephropathy progression in type 2 diabetes mellitus mice. First, the composition of the anthocyanins and polyphenols of MCE were determined by high-performance liquid chromatography and spectrophotometry. One hundred mg/kg of streptozotocin and 240 mg/kg nicotinamide were administered to C57BL/6J mice fed a high fat diet and varied concentrations of MCE. The plasma glucose concentration, body weight, oral glucose tolerance, blood pressure, renal ultrasound ultrasonic wave were monitored every 2 weeks. Following euthanasia, the kidneys of the mice were analyzed using hematoxylin–eosin, periodic acid Schiff, Masson's trichrome, and immunohistochemistry staining. The results showed that MCE stabilized the plasma glucose and indirectly improved insulin sensitivity in diabetic mice. In addition, diabetes-caused glomerular atrophy, accumulation of saccharide, and formation of collagen IV were recovered or reduced under treatment with MCE in diabetic mice. Our results indicate that MCE has beneficial effects in DN and the mechanism has been confirmed to inhibit Ras/PI3K/Akt and kidney fibrosis related proteins. This work illustrates the potential of MCE rich in anthocyanins and polyphenols as a natural food to inhibit DN.

  5. Sanguis draconis, a Dragon’s Blood Resin, Attenuates High Glucose-Induced Oxidative Stress and Endothelial Dysfunction in Human Umbilical Vein Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Yi Chang

    2014-01-01

    Full Text Available Hyperglycaemia, a characteristic feature of diabetes mellitus, induces endothelial dysfunction and vascular complications by limiting the proliferative potential of these cells. Here we aimed to investigate the effect of an ethanolic extract of Sanguis draconis (SD, a kind of dragon’s blood resin that is obtained from Daemonorops draco (Palmae, on human umbilical vein endothelial cells (HUVEC under high-glucose (HG stimulation and its underlying mechanism. Concentration-dependent (0–50 μg/mL assessment of cell viability showed that SD does not affect cell viability with a similar trend up to 48 h. Remarkably, SD (10–50 μg/mL significantly attenuated the high-glucose (25 and 50 mM induced cell toxicity in a concentration-dependent manner. SD inhibited high glucose-induced nitrite (NO and lipid peroxidation (MDA production and reactive oxygen species (ROS formation in HUVEC. Western blot analysis revealed that SD treatments abolished HG-induced phosphorylation of extracellular signal-regulated kinase 1/2 (ERK 1/2, nuclear transcription factor, κB (NF-κB, VCAM-1, and E-selectin, and it also blocked the breakdown of PARP-116 kDa protein in a dose-dependent manner. Furthermore, we found that SD increased the expression of Bcl-2 and decreased Bax protein expression in HG-stimulated HUVEC. Thus, these results of this study demonstrate for the first time that SD inhibits glucose induced oxidative stress and vascular inflammation in HUVEC by inhibiting the ERK/NF-κB/PARP-1/Bax signaling cascade followed by suppressing the activation of VCAM-1 and E-selectin. These data suggest that SD may have a therapeutic potential in vascular inflammation due to the decreased levels of oxidative stress, apoptosis, and PARP-1 activation.

  6. Sanguis draconis, a dragon's blood resin, attenuates high glucose-induced oxidative stress and endothelial dysfunction in human umbilical vein endothelial cells.

    Science.gov (United States)

    Chang, Yi; Chang, Ting-Chen; Lee, Jie-Jen; Chang, Nen-Chung; Huang, Yung-Kai; Choy, Cheuk-Sing; Jayakumar, Thanasekaran

    2014-01-01

    Hyperglycaemia, a characteristic feature of diabetes mellitus, induces endothelial dysfunction and vascular complications by limiting the proliferative potential of these cells. Here we aimed to investigate the effect of an ethanolic extract of Sanguis draconis (SD), a kind of dragon's blood resin that is obtained from Daemonorops draco (Palmae), on human umbilical vein endothelial cells (HUVEC) under high-glucose (HG) stimulation and its underlying mechanism. Concentration-dependent (0-50 μg/mL) assessment of cell viability showed that SD does not affect cell viability with a similar trend up to 48 h. Remarkably, SD (10-50 μg/mL) significantly attenuated the high-glucose (25 and 50 mM) induced cell toxicity in a concentration-dependent manner. SD inhibited high glucose-induced nitrite (NO) and lipid peroxidation (MDA) production and reactive oxygen species (ROS) formation in HUVEC. Western blot analysis revealed that SD treatments abolished HG-induced phosphorylation of extracellular signal-regulated kinase 1/2 (ERK 1/2), nuclear transcription factor, κB (NF-κB), VCAM-1, and E-selectin, and it also blocked the breakdown of PARP-116 kDa protein in a dose-dependent manner. Furthermore, we found that SD increased the expression of Bcl-2 and decreased Bax protein expression in HG-stimulated HUVEC. Thus, these results of this study demonstrate for the first time that SD inhibits glucose induced oxidative stress and vascular inflammation in HUVEC by inhibiting the ERK/NF-κB/PARP-1/Bax signaling cascade followed by suppressing the activation of VCAM-1 and E-selectin. These data suggest that SD may have a therapeutic potential in vascular inflammation due to the decreased levels of oxidative stress, apoptosis, and PARP-1 activation.

  7. Vaccinia virus protein C6 is a virulence factor that binds TBK-1 adaptor proteins and inhibits activation of IRF3 and IRF7.

    Directory of Open Access Journals (Sweden)

    Leonie Unterholzner

    2011-09-01

    Full Text Available Recognition of viruses by pattern recognition receptors (PRRs causes interferon-β (IFN-β induction, a key event in the anti-viral innate immune response, and also a target of viral immune evasion. Here the vaccinia virus (VACV protein C6 is identified as an inhibitor of PRR-induced IFN-β expression by a functional screen of select VACV open reading frames expressed individually in mammalian cells. C6 is a member of a family of Bcl-2-like poxvirus proteins, many of which have been shown to inhibit innate immune signalling pathways. PRRs activate both NF-κB and IFN regulatory factors (IRFs to activate the IFN-β promoter induction. Data presented here show that C6 inhibits IRF3 activation and translocation into the nucleus, but does not inhibit NF-κB activation. C6 inhibits IRF3 and IRF7 activation downstream of the kinases TANK binding kinase 1 (TBK1 and IκB kinase-ε (IKKε, which phosphorylate and activate these IRFs. However, C6 does not inhibit TBK1- and IKKε-independent IRF7 activation or the induction of promoters by constitutively active forms of IRF3 or IRF7, indicating that C6 acts at the level of the TBK1/IKKε complex. Consistent with this notion, C6 immunoprecipitated with the TBK1 complex scaffold proteins TANK, SINTBAD and NAP1. C6 is expressed early during infection and is present in both nucleus and cytoplasm. Mutant viruses in which the C6L gene is deleted, or mutated so that the C6 protein is not expressed, replicated normally in cell culture but were attenuated in two in vivo models of infection compared to wild type and revertant controls. Thus C6 contributes to VACV virulence and might do so via the inhibition of PRR-induced activation of IRF3 and IRF7.

  8. Immunization with a recombinant vaccinia virus that encodes nonstructural proteins of the hepatitis C virus suppresses viral protein levels in mouse liver.

    Directory of Open Access Journals (Sweden)

    Satoshi Sekiguchi

    Full Text Available Chronic hepatitis C, which is caused by infection with the hepatitis C virus (HCV, is a global health problem. Using a mouse model of hepatitis C, we examined the therapeutic effects of a recombinant vaccinia virus (rVV that encodes an HCV protein. We generated immunocompetent mice that each expressed multiple HCV proteins via a Cre/loxP switching system and established several distinct attenuated rVV strains. The HCV core protein was expressed consistently in the liver after polyinosinic acid-polycytidylic acid injection, and these mice showed chronic hepatitis C-related pathological findings (hepatocyte abnormalities, accumulation of glycogen, steatosis, liver fibrosis, and hepatocellular carcinoma. Immunization with one rVV strain (rVV-N25, which encoded nonstructural HCV proteins, suppressed serum inflammatory cytokine levels and alleviated the symptoms of pathological chronic hepatitis C within 7 days after injection. Furthermore, HCV protein levels in liver tissue also decreased in a CD4 and CD8 T-cell-dependent manner. Consistent with these results, we showed that rVV-N25 immunization induced a robust CD8 T-cell immune response that was specific to the HCV nonstructural protein 2. We also demonstrated that the onset of chronic hepatitis in CN2-29((+/-/MxCre((+/- mice was mainly attributable to inflammatory cytokines, (tumor necrosis factor TNF-α and (interleukin IL-6. Thus, our generated mice model should be useful for further investigation of the immunological processes associated with persistent expression of HCV proteins because these mice had not developed immune tolerance to the HCV antigen. In addition, we propose that rVV-N25 could be developed as an effective therapeutic vaccine.

  9. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid, Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene

    Science.gov (United States)

    Casimiro, Danilo R.; Chen, Ling; Fu, Tong-Ming; Evans, Robert K.; Caulfield, Michael J.; Davies, Mary-Ellen; Tang, Aimin; Chen, Minchun; Huang, Lingyi; Harris, Virginia; Freed, Daniel C.; Wilson, Keith A.; Dubey, Sheri; Zhu, De-Min; Nawrocki, Denise; Mach, Henryk; Troutman, Robert; Isopi, Lynne; Williams, Donna; Hurni, William; Xu, Zheng; Smith, Jeffrey G.; Wang, Su; Liu, Xu; Guan, Liming; Long, Romnie; Trigona, Wendy; Heidecker, Gwendolyn J.; Perry, Helen C.; Persaud, Natasha; Toner, Timothy J.; Su, Qin; Liang, Xiaoping; Youil, Rima; Chastain, Michael; Bett, Andrew J.; Volkin, David B.; Emini, Emilio A.; Shiver, John W.

    2003-01-01

    Cellular immune responses, particularly those associated with CD3+ CD8+ cytotoxic T lymphocytes (CTL), play a primary role in controlling viral infection, including persistent infection with human immunodeficiency virus type 1 (HIV-1). Accordingly, recent HIV-1 vaccine research efforts have focused on establishing the optimal means of eliciting such antiviral CTL immune responses. We evaluated several DNA vaccine formulations, a modified vaccinia virus Ankara vector, and a replication-defective adenovirus serotype 5 (Ad5) vector, each expressing the same codon-optimized HIV-1 gag gene for immunogenicity in rhesus monkeys. The DNA vaccines were formulated with and without one of two chemical adjuvants (aluminum phosphate and CRL1005). The Ad5-gag vector was the most effective in eliciting anti-Gag CTL. The vaccine produced both CD4+ and CD8+ T-cell responses, with the latter consistently being the dominant component. To determine the effect of existing antiadenovirus immunity on Ad5-gag-induced immune responses, monkeys were exposed to adenovirus subtype 5 that did not encode antigen prior to immunization with Ad5-gag. The resulting anti-Gag T-cell responses were attenuated but not abolished. Regimens that involved priming with different DNA vaccine formulations followed by boosting with the adenovirus vector were also compared. Of the formulations tested, the DNA-CRL1005 vaccine primed T-cell responses most effectively and provided the best overall immune responses after boosting with Ad5-gag. These results are suggestive of an immunization strategy for humans that are centered on use of the adenovirus vector and in which existing adenovirus immunity may be overcome by combined immunization with adjuvanted DNA and adenovirus vector boosting. PMID:12743287

  10. Phase 1 safety and immunogenicity evaluation of ADMVA, a multigenic, modified vaccinia Ankara-HIV-1 B'/C candidate vaccine.

    Directory of Open Access Journals (Sweden)

    Sandhya Vasan

    Full Text Available BACKGROUND: We conducted a Phase I dose-escalation trial of ADMVA, a Clade-B'/C-based HIV-1 candidate vaccine expressing env, gag, pol, nef, and tat in a modified vaccinia Ankara viral vector. Sequences were derived from a prevalent circulating HIV-1 recombinant form in Yunnan, China, an area of high HIV incidence. The objective was to evaluate the safety and immunogenicity of ADMVA in human volunteers. METHODOLOGY/PRINCIPAL FINDINGS: ADMVA or placebo was administered intramuscularly at months 0, 1 and 6 to 50 healthy adult volunteers not at high risk for HIV-1. In each dosage group [1x10(7 (low, 5x10(7 (mid, or 2.5x10(8 pfu (high] volunteers were randomized in a 3:1 ratio to receive ADMVA or placebo in a double-blinded design. Subjects were followed for local and systemic reactogenicity, adverse events including cardiac adverse events, and clinical laboratory parameters. Study follow up was 18 months. Humoral immunogenicity was evaluated by anti-gp120 binding ELISA, immunoflourescent staining, and HIV-1 neutralization. Cellular immunogenicity was assessed by a validated IFNgamma ELISpot assay and intracellular cytokine staining. Anti-vaccinia binding titers were measured by ELISA. ADMVA was generally well-tolerated, with no vaccine-related serious adverse events or cardiac adverse events. Local or systemic reactogenicity events were reported by 77% and 78% of volunteers, respectively. The majority of events were of mild intensity. The IFNgamma ELISpot response rate to any HIV antigen was 0/12 (0% in the placebo group, 3/12 (25% in the low dosage group, 6/12 (50% in the mid dosage group, and 8/13 (62% in the high dosage group. Responses were often multigenic and occasionally persisted up to one year post vaccination. Antibodies to gp120 were detected in 0/12 (0%, 8/13 (62%, 6/12 (50% and 10/13 (77% in the placebo, low, mid, and high dosage groups, respectively. Antibodies persisted up to 12 months after vaccination, with a trend toward agreement

  11. Supplementation of Lactobacillus plantarum K68 and Fruit-Vegetable Ferment along with High Fat-Fructose Diet Attenuates Metabolic Syndrome in Rats with Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Hui-Yu Huang

    2013-01-01

    Full Text Available Lactobacillus plantarum K68 (isolated from fu-tsai and fruit-vegetable ferment (FVF have been tested for antidiabetic, anti-inflammatory, and antioxidant properties in a rat model of insulin resistance, induced by chronic high fat-fructose diet. Fifty rats were equally assigned into control (CON, high fat-fructose diet (HFFD, HFFD plus K68, HFFD plus FVF, and HFFD plus both K68 and FVF (MIX groups. Respective groups were orally administered with K68 (1×109 CFU/0.5 mL or FVF (180 mg/kg or MIX for 8 weeks. We found that HFFD-induced increased bodyweights were prevented, and progressively increased fasting blood glucose and insulin levels were reversed (P<0.01 by K68 and FVF treatments. Elevated glycated hemoglobin (HbA1c and HOMA-IR values were controlled in supplemented groups. Furthermore, dyslipidemia, characterized by elevated total cholesterol (TC, triglyceride (TG, and low-density lipoproteins (LDLs with HFFD, was significantly (P<0.01 attenuated with MIX. Elevated pro-inflammatory cytokines, interleukin-1β (IL-1β, IL-6, and tumor necrosis factor-α (TNF-α, were controlled (P<0.01 by K68, FVF, and MIX treatments. Moreover, decreased superoxide dismutase (SOD, catalase (CAT, and glutathione peroxidase (GPx activities were substantially (P<0.01 restored by all treatments. Experimental evidences demonstrate that K68 and FVF may be effective alternative medicine to prevent HFFD-induced hyperglycemia, hyperinsulinemia, and hyperlipidemia, possibly associated with anti-inflammatory and antioxidant efficacies.

  12. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era.

    Science.gov (United States)

    Figueiredo, Poliana de Oliveira; Silva-Fernandes, André Tavares da; Mota, Bruno Eduardo Fernandes; Costa, Galileu Barbosa; Borges, Iara Apolinário; Ferreira, Paulo César Peregrino; Abrahão, Jônatas Santos; Braga, Erika Martins; Kroon, Erna Geessien; Trindade, Giliane de Souza

    2015-09-01

    Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV). We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132) with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  13. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era

    Directory of Open Access Journals (Sweden)

    Poliana de Oliveira Figueiredo

    2015-09-01

    Full Text Available Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV. We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132 with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  14. Vaccinia virus-mediated melanin production allows MR and optoacoustic deep tissue imaging and laser-induced thermotherapy of cancer.

    Science.gov (United States)

    Stritzker, Jochen; Kirscher, Lorenz; Scadeng, Miriam; Deliolanis, Nikolaos C; Morscher, Stefan; Symvoulidis, Panagiotis; Schaefer, Karin; Zhang, Qian; Buckel, Lisa; Hess, Michael; Donat, Ulrike; Bradley, William G; Ntziachristos, Vasilis; Szalay, Aladar A

    2013-02-26

    We reported earlier the delivery of antiangiogenic single chain antibodies by using oncolytic vaccinia virus strains to enhance their therapeutic efficacy. Here, we provide evidence that gene-evoked production of melanin can be used as a therapeutic and diagnostic mediator, as exemplified by insertion of only one or two genes into the genome of an oncolytic vaccinia virus strain. We found that produced melanin is an excellent reporter for optical imaging without addition of substrate. Melanin production also facilitated deep tissue optoacoustic imaging as well as MRI. In addition, melanin was shown to be a suitable target for laser-induced thermotherapy and enhanced oncolytic viral therapy. In conclusion, melanin as a mediator for thermotherapy and reporter for different imaging modalities may soon become a versatile alternative to replace fluorescent proteins also in other biological systems. After ongoing extensive preclinical studies, melanin overproducing oncolytic virus strains might be used in clinical trials in patients with cancer.

  15. Brucella abortusΔcydCΔcydD and ΔcydCΔpurD double-mutants are highly attenuated and confer long-term protective immunity against virulent Brucella abortus.

    Science.gov (United States)

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Kim, Kiju; Hahn, Tae-Wook

    2016-01-04

    We constructed double deletion (ΔcydCΔcydD and ΔcydCΔpurD) mutants from virulent Brucella abortus biovar 1 field isolate (BA15) by deleting the genes encoding an ATP-binding cassette-type transporter (cydC and cydD genes) and a phosphoribosylamine-glycine ligase (purD). Both BA15ΔcydCΔcydD and BA15ΔcydCΔpurD double-mutants exhibited significant attenuation of virulence when assayed in murine macrophages or in BALB/c mice. Both double-mutants were readily cleared from spleens by 4 weeks post-inoculation even when inoculated at the dose of 10(8) CFU per mouse. Moreover, the inoculated mice showed no splenomegaly, which indicates that the mutants are highly attenuated. Importantly, the attenuation of in vitro and in vivo growth did not impair the ability of these mutants to confer long-term protective immunity in mice against challenge with B. abortus strain 2308. Vaccination of mice with either mutant induced humoral and cell-mediated immune responses, and provided significantly better protection than commercial B. abortus strain RB51 vaccine. These results suggest that highly attenuated BA15ΔcydCΔcydD and BA15ΔcydCΔpurD mutants can be used effectively as potential live vaccine candidates against bovine brucellosis. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors

    Directory of Open Access Journals (Sweden)

    Moss Bernard

    2005-03-01

    Full Text Available Abstract Background Replication of the vaccinia virus genome occurs in cytoplasmic factory areas and is dependent on the virus-encoded DNA polymerase and at least four additional viral proteins. DNA synthesis appears to start near the ends of the genome, but specific origin sequences have not been defined. Surprisingly, transfected circular DNA lacking specific viral sequences is also replicated in poxvirus-infected cells. Origin-independent plasmid replication depends on the viral DNA polymerase, but neither the number of additional viral proteins nor the site of replication has been determined. Results Using a novel real-time polymerase chain reaction assay, we detected a >400-fold increase in newly replicated plasmid in cells infected with vaccinia virus. Studies with conditional lethal mutants of vaccinia virus indicated that each of the five proteins known to be required for viral genome replication was also required for plasmid replication. The intracellular site of replication was determined using a plasmid containing 256 repeats of the Escherichia coli lac operator and staining with an E. coli lac repressor-maltose binding fusion protein followed by an antibody to the maltose binding protein. The lac operator plasmid was localized in cytoplasmic viral factories delineated by DNA staining and binding of antibody to the viral uracil DNA glycosylase, an essential replication protein. In addition, replication of the lac operator plasmid was visualized continuously in living cells infected with a recombinant vaccinia virus that expresses the lac repressor fused to enhanced green fluorescent protein. Discrete cytoplasmic fluorescence was detected in cytoplasmic juxtanuclear sites at 6 h after infection and the area and intensity of fluorescence increased over the next several hours. Conclusion Replication of a circular plasmid lacking specific poxvirus DNA sequences mimics viral genome replication by occurring in cytoplasmic viral factories

  17. High attenuation in MgSiO3 post-perovskite due to [100] dislocation glide under D'' conditions: an atomic scale study

    Science.gov (United States)

    Cordier, P.; Goryaeva, A.; Carrez, P.

    2016-12-01

    Dislocation motion in crystalline materials represents one of the most efficient mechanisms to produce plastic shear, the key mechanism for CPO development. Previous atomistic simulations show that MgSiO3 ppv is characterized by remarkably low lattice friction opposed to the glide of straight [100] screw dislocations in (010), while glide in (001) requires one order of magnitude larger stress values [1]. At finite temperature, dislocation glide occurs through nucleation and propagation of kink-pairs, i.e. dislocation does not move as a straight line, but partly bows out over the Peierls potential. We propose a theoretical study of a kink-pair formation mechanism for [100] screw dislocations in MgSiO3 ppv employing the line tension (LT) model [2] in conjunction with ab-initio atomic-scale modeling. The dislocation line tension, which plays a key role in dislocation dynamics, is computed at atomic scale as the energy increase resulting from individual atomic displacements due to the nucleation of a bow out. The estimated kink-pair formation enthalpy gives an access to evolution of critical resolved shear stress (CRSS) with temperature. Our results clearly demonstrate that at the lower mantle conditions, lattice friction in ppv vanishes for temperatures above ca. 600 K, i.e. ppv deforms in the athermal regime in contrast to the high-lattice friction bridgmanite [3]. Moreover, in the Earth's mantle, high-pressure Mg-ppv can be expected to be as ductile as MgO. Our simulations demonstrate that ppv contributes to a weak layer at the base of the mantle which is likely to promote alignment of (010) planes. In addition to that, we show that the high mobility of [100] dislocations results in a decrease of the apparent shear modulus (up to 15%) which contributes to a decrease of the shear wave velocity of about 7% and suggest that ppv induces energy dissipation and strong seismic attenuation in the D" layer. References[1] Goryaeva A, Carrez Ph & Cordier P (2015) Modeling

  18. PTP1B deficiency improves hypothalamic insulin sensitivity resulting in the attenuation of AgRP mRNA expression under high-fat diet conditions.

    Science.gov (United States)

    Sugiyama, Mariko; Banno, Ryoichi; Mizoguchi, Akira; Tominaga, Takashi; Tsunekawa, Taku; Onoue, Takeshi; Hagiwara, Daisuke; Ito, Yoshihiro; Morishita, Yoshiaki; Iwama, Shintaro; Goto, Motomitsu; Suga, Hidetaka; Arima, Hiroshi

    2017-06-17

    Hypothalamic insulin receptor signaling regulates energy balance and glucose homeostasis via agouti-related protein (AgRP). While protein tyrosine phosphatase 1B (PTP1B) is classically known to be a negative regulator of peripheral insulin signaling by dephosphorylating both insulin receptor β (IRβ) and insulin receptor substrate, the role of PTP1B in hypothalamic insulin signaling remains to be fully elucidated. In the present study, we investigated the role of PTP1B in hypothalamic insulin signaling using PTP1B deficient (KO) mice in vivo and ex vivo. For the in vivo study, hypothalamic insulin resistance induced by a high-fat diet (HFD) improved in KO mice compared to wild-type (WT) mice. Hypothalamic AgRP mRNA expression levels were also significantly decreased in KO mice independent of body weight changes. In an ex vivo study using hypothalamic organotypic cultures, insulin treatment significantly increased the phosphorylation of both IRβ and Akt in the hypothalamus of KO mice compared to WT mice, and also significantly decreased AgRP mRNA expression levels in KO mice. While incubation with inhibitors of phosphatidylinositol-3 kinase (PI3K) had no effect on basal levels of Akt phosphorylation, these suppressed insulin induction of Akt phosphorylation to almost basal levels in WT and KO mice. The inhibition of the PI3K-Akt pathway blocked the downregulation of AgRP mRNA expression in KO mice treated with insulin. These data suggest that PTP1B acts on the hypothalamic insulin signaling via the PI3K-Akt pathway. Together, our results suggest a deficiency of PTP1B improves hypothalamic insulin sensitivity resulting in the attenuation of AgRP mRNA expression under HFD conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Eating meals before wheel-running exercise attenuate high fat diet-driven obesity in mice under two meals per day schedule.

    Science.gov (United States)

    Sasaki, Hiroyuki; Hattori, Yuta; Ikeda, Yuko; Kamagata, Mayo; Shibata, Shigenobu

    2015-06-01

    Mice that exercise after meals gain less body weight and visceral fat compared to those that exercised before meals under a one meal/exercise time per day schedule. Humans generally eat two or three meals per day, and rarely have only one meal. To extend our previous observations, we examined here whether a "two meals, two exercise sessions per day" schedule was optimal in terms of maintaining a healthy body weight. In this experiment, "morning" refers to the beginning of the active phase (the "morning" for nocturnal animals). We found that 2-h feeding before 2-h exercise in the morning and evening (F-Ex/F-Ex) resulted in greater attenuation of high fat diet (HFD)-induced weight gain compared to other combinations of feeding and exercise under two daily meals and two daily exercise periods. There were no significant differences in total food intake and total wheel counts, but feeding before exercise in the morning groups (F-Ex/F-Ex and F-Ex/Ex-F) increased the morning wheel counts. These results suggest that habitual exercise after feeding in the morning and evening is more effective for preventing HFD-induced weight gain. We also determined whether there were any correlations between food intake, wheel rotation, visceral fat volume and skeletal muscle volumes. We found positive associations between gastrocnemius muscle volumes and morning wheel counts, as well as negative associations between morning food intake volumes/body weight and morning wheel counts. These results suggest that morning exercise-induced increase of muscle volume may refer to anti-obesity. Evening exercise is negatively associated with fat volume increases, suggesting that this practice may counteract fat deposition. Our multifactorial analysis revealed that morning food intake helps to increase exercise, and that evening exercise reduced fat volumes. Thus, exercise in the morning or evening is important for preventing the onset of obesity.

  20. Hyperbaric oxygen treatment attenuated the decrease in regional glucose metabolism of rats subjected to focal cerebral ischemia: a high resolution positron emission tomography study.

    Science.gov (United States)

    Lou, M; Zhang, H; Wang, J; Wen, S-Q; Tang, Z-Q; Chen, Y-Z; Yan, W-Q; Ding, M-P

    2007-05-11

    Cerebral hypoxia may be the main component of cell damage caused by ischemia. Previous studies demonstrated a neuroprotective effect of early hyperbaric oxygen (HBO) treatment in various animal models of focal cerebral ischemia. Neuropathologic study showed that exposure of HBO may prevent cell death in ischemic cortex. In the present study, we aimed to assess cellular function of ischemic rat brain after HBO treatment by means of a high-resolution positron emission tomography scanner (microPET) used specifically for small animal imaging. The male Sprague-Dawley rats were subjected to permanent middle cerebral artery occlusion (MCAO), with the regional cerebral blood flow monitored in vivo by laser Doppler flowmetry. One hour after ischemia, HBO therapy (3 atm absolute, 1 h) was initiated. Local cerebral glucose utilization in the ischemic area was measured before, 1 h and 3 h after ischemia, with 2-[(18)F]-fluoro-2-deoxy-d-glucose (FDG) as a tracer. Neurological deficits and infarct volumes were assessed at 24 h after ischemia. Our study showed that early HBO therapy significantly reduced infarct volume of brain 24 h after ischemia. Moreover, glucose utilization in the ischemic area underwent a severe decrease during 1-3 h after MCAO, while the early HBO treatment significantly attenuated the decrease in cerebral metabolic rate of glucose in the ischemic core of the cortex compared with controls. We report for the first time the application of microPET to quantify the rates of glucose metabolism in the ischemic core of rats exposed to HBO. Our results suggest that the early exposure of HBO can partially reverse the downward trend for glucose utilization in the ischemic core, which might contribute to the reported beneficial effects of early HBO therapy on permanent cerebral ischemia.

  1. Characterization of attenuated food motivation in high-fat diet-induced obesity: Critical roles for time on diet and reinforcer familiarity.

    Science.gov (United States)

    Tracy, Andrea L; Wee, Colin J M; Hazeltine, Grace E; Carter, Rebecca A

    2015-03-15

    Prior work using animal models to study the effects of obesogenic diets on food motivation have generated inconsistent results, with some reporting increases and others reporting decreases in responding on food-reinforced tasks. Here, we identified two specific variables that may account for these discrepant outcomes - the length of time on the obesigenic diet and the familiarity of the food reinforcer - and examined the independent roles of these factors. Time on diet was found to be inversely related to food motivation, as rats consuming a 40% high-fat diet (HFD) for only 3weeks did not differ from chow-fed rats when responding for a sucrose reinforcer on a progressive ratio (PR) schedule, but responding was suppressed after 6weeks of ad lib HFD consumption. Explicitly manipulating experience with the sucrose reinforcer by pre-exposing half the rats prior to 10weeks of HFD consumption attenuated the motivational deficit seen in the absence of this familiarity, resulting in obese rats performing at the same level as lean rats. Finally, after 8weeks on a HFD, rats did not express a conditioned place preference for sucrose, indicating a decrement in reward value independent of motivation. These findings are consistent with prior literature showing an increase in food motivation for rats with a shorter time consuming the obesigenic diet, and for those with more prior experience with the reinforcer. This account also helps reconcile these findings with increased food motivation in obese humans due to extensive experience with palatable food and suggests that researchers engaging in non-human animal studies of obesity would better model the conditions under which human obesity develops by using a varied, cafeteria-style diet to increase the breadth of food experiences. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Alcohol administration attenuates hypothalamic-pituitary-adrenal (HPA) activity in healthy men at low genetic risk for alcoholism, but not in high-risk subjects.

    Science.gov (United States)

    Mick, Inge; Spring, Konstanze; Uhr, Manfred; Zimmermann, Ulrich S

    2013-09-01

    Acute alcohol challenge studies in rodents and naturalistic observations in drinking alcoholics suggest that alcohol stimulates the hypothalamic-pituitary-adrenal (HPA) system. The literature on respective studies in healthy volunteers is more inconsistent, suggesting differential alcohol effects depending on dosage, recent drinking history, family history of alcoholism and alcohol-induced side effects. These papers and the putative pharmacologic mechanisms underlying alcohol effects on the HPA system are reviewed here and compared with a new study, in which we investigated how secretion of adrenocorticotrophin (ACTH) and cortisol is affected by ingestion of 0.6 g/kg ethanol in 33 young healthy socially drinking males with a paternal history of alcoholism (PHP) versus 30 family history negative (FHN) males. Alcohol and placebo were administered in a 2-day, double-blind, placebo controlled crossover design with randomized administration sequence. After administration of placebo, ACTH and cortisol decreased steadily over 130 minutes. In FHN subjects, secretion of both hormones was even more attenuated after alcohol, resulting in significantly lower levels compared with placebo. In PHP subjects, no alcohol effect on hormone secretion could be detected. The ratio of cortisol to ACTH secretion, each expressed as area under the secretion curve, was significantly increased by alcohol in FHN and PHP participants. These results argue against HPA stimulation being a mechanism that promotes the transition from moderate to dependent drinking. The fact that alcohol-induced HPA suppression was not detected in PHP males is consistent with the general concept that subjects at high risk for alcoholism exhibit less-pronounced alcohol effects. © 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction.

  3. Dihydrocapsaicin Attenuates Plaque Formation through a PPARγ/LXRα Pathway in apoE(-/- Mice Fed a High-Fat/High-Cholesterol Diet.

    Directory of Open Access Journals (Sweden)

    Yan-Wei Hu

    Full Text Available Atherosclerosis is a chronic inflammatory disease and represents the major cause of cardiovascular morbidity and mortality. There is evidence that dihydrocapsaicin (DHC can exert multiple pharmacological and physiological effects. Here, we explored the effect of DHC in atherosclerotic plaque progression in apoE(-/- mice fed a high-fat/high-cholesterol diet.apoE(-/- mice were randomly divided into two groups and fed a high-fat/high-cholesterol diet with or without DHC for 12 weeks. We demonstrated that cellular cholesterol content was significantly decreased while apoA1-mediated cholesterol efflux was significantly increased following treatment with DHC in THP-1 macrophage-derived foam cells. We also observed that plasma levels of TG, LDL-C, VLDL-C, IL-1β, IL-6, TNF-α and CRP were markedly decreased while plasma levels of apoA1 and HDL-C were significantly increased, and consistent with this, atherosclerotic lesion development was significantly inhibited by DHC treatment of apoE(-/- mice fed a high-fat/high-cholesterol diet. Moreover, treatment with both LXRα siRNA and PPARγ siRNA made the up-regulation of DHC on ABCA1, ABCG1, ABCG5, SR-B1, NPC1, CD36, LDLR, HMGCR, apoA1 and apoE expression notably abolished while made the down-regulation of DHC on SRA1 expression markedly compensated. And treatment with PPARγ siRNA made the DHC-induced up-regulation of LXRα expression notably abolished while treatment with LXRα siRNA had no effect on DHC-induced PPARγ expression.These observations provide direct evidence that DHC can significantly decrease atherosclerotic plaque formation involving in a PPARγ/LXRα pathway and thus DHC may represent a promising candidate for a therapeutic agent for the treatment or prevention of atherosclerosis.

  4. Associations of obesity with triglycerides and C-reactive protein are attenuated in adults with high red blood cell eicosapentaenoic and docosahexaenoic acids

    Science.gov (United States)

    Makhoul, Zeina; Kristal, Alan R.; Gulati, Roman; Luick, Bret; Bersamin, Andrea; O'Brien, Diane; Hopkins, Scarlett E.; Stephensen, Charles B.; Stanhope, Kimber L.; Havel, Peter J.; Boyer, Bert

    2011-01-01

    Background N-3 fatty acids are associated with favorable, and obesity with unfavorable, concentrations of chronic disease risk biomarkers. Objective We examined whether high eicosapentaenoic (EPA) and docosahexaenoic (DHA) acid intakes, measured as percentages of total red blood cell (RBC) fatty acids, modify associations of obesity with chronic disease risk biomarkers. Methods In a cross-sectional study of 330 Yup'ik Eskimos, generalized additive models (GAM) and linear and quadratic regression models were used to examine associations of BMI with biomarkers across RBC EPA and DHA categories. Results Median (5th–95th percentile) RBC EPA and DHA were 2.6% (0.5–5.9%) and 7.3% (3.3–8.9%), respectively. In regression models, associations of BMI with triglycerides, glucose, insulin, C-reactive protein (CRP) and leptin differed significantly by RBC EPA and DHA. The GAM confirmed regression results for triglycerides and CRP: At low RBC EPA and RBC DHA, the predicted increases in triglycerides and CRP concentrations associated with a BMI increase from 25 to 35 were 99.5±45.3 mg/dl (106%) and 137.8±71.0 mg/dl (156%), respectively, for triglycerides and 1.2±0.7 mg/l (61%) and 0.8±1.0 mg/l (35%), respectively, for CRP. At high RBC EPA and RBC DHA, these predicted increases were 13.9±8.1 mg/dl (23%) and 12.0±12.3 mg/dl (18%), respectively, for triglycerides and 0.5±0.5 mg/l (50%) and −0.5±0.6 mg/l (−34%), respectively, for CRP. Conclusions In this population, high RBC EPA and DHA were associated with attenuated dyslipidemia and low-grade systemic inflammation among overweight and obese persons. This may help inform recommendations for n-3 fatty acid intakes in the reduction of obesity-related disease risk. PMID:21427737

  5. Inner Core Anisotropy in Attenuation

    Science.gov (United States)

    Yu, W.; Wen, L.

    2004-12-01

    and the direction of high attenuation correlates with that of high P velocity. Different anisotropic behaviors in velocity and attenuation can be best explained by different alignments of iron crystals under the hypothesis that iron crystals are anisotropic in both velocity and attenuation and their axes of high P velocity correspond to those of high attenuation.

  6. Reverse Genetics of SARS-Related Coronavirus Using Vaccinia Virus-Based Recombination

    Science.gov (United States)

    Zevenhoven, Jessika C.; Weber, Friedemann; Züst, Roland; Kuri, Thomas; Dijkman, Ronald; Chang, Guohui; Siddell, Stuart G.; Snijder, Eric J.; Thiel, Volker; Davidson, Andrew D.

    2012-01-01

    Severe acute respiratory syndrome (SARS) is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV) that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime) as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV). Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs). In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E). Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs. PMID:22412934

  7. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Science.gov (United States)

    Mota, Bruno E F; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A; Vieira, Leda Q; da Fonseca, Flávio G; Ferreira, Paulo C P; Bonjardim, Cláudio A; Damon, Inger K; Kroon, Erna G

    2011-04-15

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/-)) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/-) with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-), and passive transfer of WT T cells to Rag1(-/-) animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals with

  8. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Bruno E F Mota

    Full Text Available Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/- produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/- with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-, and passive transfer of WT T cells to Rag1(-/- animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify

  9. Adverse Events Post Smallpox-Vaccination: Insights from Tail Scarification Infection in Mice with Vaccinia virus

    Science.gov (United States)

    Mota, Bruno E. F.; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M. Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A.; Vieira, Leda Q.; da Fonseca, Flávio G.; Ferreira, Paulo C. P.; Bonjardim, Cláudio A.; Damon, Inger K.; Kroon, Erna G.

    2011-01-01

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1−/−) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1−/− with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1−/−, and passive transfer of WT T cells to Rag1−/− animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals

  10. Reverse genetics of SARS-related coronavirus using vaccinia virus-based recombination.

    Directory of Open Access Journals (Sweden)

    Sjoerd H E van den Worm

    Full Text Available Severe acute respiratory syndrome (SARS is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV. Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs. In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E. Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs.

  11. Landing gear noise attenuation

    Science.gov (United States)

    Moe, Jeffrey W. (Inventor); Whitmire, Julia (Inventor); Kwan, Hwa-Wan (Inventor); Abeysinghe, Amal (Inventor)

    2011-01-01

    A landing gear noise attenuator mitigates noise generated by airframe deployable landing gear. The noise attenuator can have a first position when the landing gear is in its deployed or down position, and a second position when the landing gear is in its up or stowed position. The noise attenuator may be an inflatable fairing that does not compromise limited space constraints associated with landing gear retraction and stowage. A truck fairing mounted under a truck beam can have a compliant edge to allow for non-destructive impingement of a deflected fire during certain conditions.

  12. Calorie Restriction with a High-Fat Diet Effectively Attenuated Inflammatory Response and Oxidative Stress-Related Markers in Obese Tissues of the High Diet Fed Rats

    Directory of Open Access Journals (Sweden)

    Seungae Park

    2012-01-01

    Full Text Available Obesity characterized by increased mass of adipose tissue leads to systemic inflammation. Calorie restriction (CR improves parameters associated with immune response and antioxidant defense. We hypothesized that CR with a high fat diet (HFCR regulates local and systemic inflammation and oxidative stress damage in a high fat diet induced obesity (HF group. We investigated effect of HFCR on inflammation and oxidative stress-related markers in liver and adipose tissues as well as adipokines in plasma. HFCR lowered liver triglyceride levels, total cholesterol levels, and the plasma leptin/adiponectin ratio to normal levels and improved glucose tolerance. HFCR also improved fatty liver and normalized adipocyte size and morphology. HFCR reduced lipid peroxidation and decreased the expression levels of inducible nitric oxide synthetase, cyclooxygenase-2, NF-E2-related factor, and heme oxygenase-1 in the liver. Moreover, HFCR suppressed the expression levels of C- reactive protein and manganese superoxide dismutase in the adipose tissue in the HF group. These results suggest that HFCR may have beneficial effects on inflammation and oxidative stress as well as lipid profiles in the HF diet induced obesity. Moreover, HFCR may be a good way to increase compliance in obese patients and to prevent obesity induced complications without changes in dietary pattern.

  13. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.

    1986-07-15

    The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells.

  14. Broad protection against avian influenza virus by using a modified vaccinia Ankara virus expressing a mosaic hemagglutinin gene.

    Science.gov (United States)

    Kamlangdee, Attapon; Kingstad-Bakke, Brock; Anderson, Tavis K; Goldberg, Tony L; Osorio, Jorge E

    2014-11-01

    A critical failure in our preparedness for an influenza pandemic is the lack of a universal vaccine. Influenza virus strains diverge by 1 to 2% per year, and commercially available vaccines often do not elicit protection from one year to the next, necessitating frequent formulation changes. This represents a major challenge to the development of a cross-protective vaccine that can protect against circulating viral antigenic diversity. We have constructed a recombinant modified vaccinia virus Ankara (MVA) that expresses an H5N1 mosaic hemagglutinin (H5M) (MVA-H5M). This mosaic was generated in silico using 2,145 field-sourced H5N1 isolates. A single dose of MVA-H5M provided 100% protection in mice against clade 0, 1, and 2 avian influenza viruses and also protected against seasonal H1N1 virus (A/Puerto Rico/8/34). It also provided short-term (10 days) and long-term (6 months) protection postvaccination. Both neutralizing antibodies and antigen-specific CD4(+) and CD8(+) T cells were still detected at 5 months postvaccination, suggesting that MVA-H5M provides long-lasting immunity. Influenza viruses infect a billion people and cause up to 500,000 deaths every year. A major problem in combating influenza is the lack of broadly effective vaccines. One solution from the field of human immunodeficiency virus vaccinology involves a novel in silico mosaic approach that has been shown to provide broad and robust protection against highly variable viruses. Unlike a consensus algorithm which picks the most frequent residue at each position, the mosaic method chooses the most frequent T-cell epitopes and combines them to form a synthetic antigen. These studies demonstrated that a mosaic influenza virus H5 hemagglutinin expressed by a viral vector can elicit full protection against diverse H5N1 challenges as well as induce broader immunity than a wild-type hemagglutinin. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  16. Vaccinia-Related Kinase 2 Modulates the Stress Response to Hypoxia Mediated by TAK1▿

    Science.gov (United States)

    Blanco, Sandra; Santos, Claudio; Lazo, Pedro A.

    2007-01-01

    Hypoxia represents a major stress that requires an immediate cellular response in which different signaling pathways participate. Hypoxia induces an increase in the activity of TAK1, an atypical mitogen-activated protein kinase kinase kinase (MAPKKK), which responds to oxidative stress by triggering cascades leading to the activation of c-Jun N-terminal kinase (JNK). JNK activation by hypoxia requires assembly with the JIP1 scaffold protein, which might also interact with other intracellular proteins that are less well known but that might modulate MAPK signaling. We report that TAK1 is able to form a stable complex with JIP1 and thus regulate the activation of JNK, which in turn determines the cellular stress response to hypoxia. This activation of TAK1-JIP1-JNK is suppressed by vaccinia-related kinase 2 (VRK2). VRK2A is able to interact with TAK1 by its C-terminal region, forming stable complexes. The kinase activity of VRK2 is not necessary for this interaction or the downregulation of AP1-dependent transcription. Furthermore, reduction of the endogenous VRK2 level with short hairpin RNA can increase the response induced by hypoxia, suggesting that the intracellular levels of VRK2 can determine the magnitude of this stress response. PMID:17709393

  17. Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization.

    Science.gov (United States)

    Mockett, B; Binns, M M; Boursnell, M E; Skinner, M A

    1992-10-01

    We have derived a restriction enzyme map for the fowlpox virus FP9 strain. Sites for BamHI, PvuII, PstI and NcoI have been mapped mainly by Southern blotting. The size of the genome derived from the restriction maps (254 kb) corresponds to the figure of 260 +/- 8 kb determined from analysis of genomic DNA by pulsed-field electrophoresis. The map can be compared with a previously published map for a different strain of fowlpox virus using the PstI digest which is common to both studies. Some 65 kb of fowlpox virus sequence, in 11 blocks, as well as individual M13 clones have been aligned with the map. Where those blocks correspond with blocks of homologous genes in vaccinia virus, it is possible to compare the genomic locations for those genes in the two viruses. This comparison reveals that, whereas there are blocks of sequence within which genes exist in the same relative position in the two viruses, the genomic location of those sequence blocks differs widely between the two viruses.

  18. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Science.gov (United States)

    Salgado, Ana Paula Carneiro; Soares-Martins, Jamária Adriana Pinheiro; Andrade, Luciana Garcia; Albarnaz, Jonas Dutra; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien; Bonjardim, Cláudio Antônio

    2013-01-01

    Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV) and Cowpox (CPXV) and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN) Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication. PMID:23903969

  19. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Carneiro Salgado

    2013-08-01

    Full Text Available Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV and Cowpox (CPXV and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication.

  20. Potential effect of prior raccoonpox virus infection in raccoons on vaccinia-based rabies immunization

    Directory of Open Access Journals (Sweden)

    MacCarthy Kathleen A

    2008-10-01

    Full Text Available Abstract Background The USDA, Wildlife Services cooperative oral rabies vaccination (ORV program uses a live vaccinia virus-vectored (genus Orthopoxvirus vaccine, Raboral V-RG® (V-RG, to vaccinate specific wildlife species against rabies virus in several regions of the U.S. Several naturally occurring orthopoxviruses have been found in North America, including one isolated from asymptomatic raccoons (Procyon lotor. The effect of naturally occurring antibodies to orthopoxviruses on successful V-RG vaccination in raccoons is the focus of this study. Results Overall, raccoons pre-immunized (n = 10 with a recombinant raccoonpox virus vaccine (RCN-F1 responded to vaccination with V-RG with lower rabies virus neutralizing antibody (VNA titers than those which were not pre-immunized (n = 10 and some failed to seroconvert for rabies VNA to detectable levels. Conclusion These results suggest that the success of some ORV campaigns may be hindered where raccoonpox virus or possibly other orthopoxvirus antibodies are common in wildlife species targeted for ORV. If these areas are identified, different vaccination strategies may be warranted.

  1. Increased ATP generation in the host cell is required for efficient vaccinia virus production

    Directory of Open Access Journals (Sweden)

    Hsu Che-Fang

    2009-09-01

    Full Text Available Abstract To search for cellular genes up-regulated by vaccinia virus (VV infection, differential display-reverse transcription-polymerase chain reaction (ddRT-PCR assays were used to examine the expression of mRNAs from mock-infected and VV-infected HeLa cells. Two mitochondrial genes for proteins that are part of the electron transport chain that generates ATP, ND4 and CO II, were up-regulated after VV infection. Up-regulation of ND4 level by VV infection was confirmed by Western blotting analysis. Up-regulation of ND4 was reduced by the MAPK inhibitor, apigenin, which has been demonstrated elsewhere to inhibit VV replication. The induction of ND4 expression occurred after viral DNA replication since ara C, an inhibitor of poxviral DNA replication, could block this induction. ATP production was increased in the host cells after VV infection. Moreover, 4.5 μM oligomycin, an inhibitor of ATP production, reduced the ATP level 13 hr after virus infection to that of mock-infected cells and inhibited viral protein expression and virus production, suggesting that increased ATP production is required for efficient VV production. Our results further suggest that induction of ND4 expression is through a Bcl-2 independent pathway.

  2. Hazard Characterization of Modified Vaccinia Virus Ankara Vector: What Are the Knowledge Gaps?

    Directory of Open Access Journals (Sweden)

    Malachy I. Okeke

    2017-10-01

    Full Text Available Modified vaccinia virus Ankara (MVA is the vector of choice for human and veterinary applications due to its strong safety profile and immunogenicity in vivo. The use of MVA and MVA-vectored vaccines against human and animal diseases must comply with regulatory requirements as they pertain to environmental risk assessment, particularly the characterization of potential adverse effects to humans, animals and the environment. MVA and recombinant MVA are widely believed to pose low or negligible risk to ecosystem health. However, key aspects of MVA biology require further research in order to provide data needed to evaluate the potential risks that may occur due to the use of MVA and MVA-vectored vaccines. The purpose of this paper is to identify knowledge gaps in the biology of MVA and recombinant MVA that are of relevance to its hazard characterization and discuss ongoing and future experiments aimed at providing data necessary to fill in the knowledge gaps. In addition, we presented arguments for the inclusion of uncertainty analysis and experimental investigation of verifiable worst-case scenarios in the environmental risk assessment of MVA and recombinant MVA. These will contribute to improved risk assessment of MVA and recombinant MVA vaccines.

  3. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

  4. Silver nanoparticles inhibit vaccinia virus infection by preventing viral entry through a macropinocytosis-dependent mechanism.

    Science.gov (United States)

    Trefry, John C; Wooley, Dawn P

    2013-09-01

    Silver nanoparticles have been shown to inhibit viruses. However, very little is known about the mechanism of antiviral activity. This study tested the hypothesis that 25-nm silver nanoparticles inhibited Vaccinia virus replication by preventing viral entry. Plaque reduction, confocal microscopy, and beta-galactosidase reporter gene assays were used to examine viral attachment and entry in the presence and absence of silver nanoparticles. To explore the mechanism of inhibition, viral entry experiments were conducted with silver nanoparticles and small interfering RNAs designed to silence the gene coding for p21-activated kinase 1, a key mediator of macropinocytosis. The silver nanoparticles caused a 4- to 5-log reduction in viral titer at concentrations that were not toxic to cells. Virus was capable of adsorbing to cells but could not enter cells in the presence of silver nanoparticles. Virus particles that had adsorbed to cells in the presence of silver nanoparticles were found to be infectious upon removal from the cells, indicating lack of direct virucidal effect. The half maximal inhibitory concentration for viral entry in the presence of silver nanoparticles was 27.4+/-3.3 microg/ml. When macropinocytosis was blocked, this inhibition was significantly reduced. Thus, macropinocytosis was required for the full antiviral effect. For the first time, this study points to the novel result that a cellular process involved in viral entry is responsible for the antiviral effects of silver nanoparticles.

  5. Oncolytic vaccinia virus as an adjuvant treatment to cytoreductive surgery for malignant peritoneal mesothelioma.

    Science.gov (United States)

    Acuna, Sergio A; Ottolino-Perry, Kathryn; Çako, Besmira; Tang, Nan; Angarita, Fernando A; McCart, J Andrea

    2014-07-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive cancer with a dismal prognosis. Oncolytic viruses are a promising new therapy for cancer because of their ability to kill tumor cells with minimal toxicity to normal tissues. This experimental study aimed to examine the potential of modified vaccinia virus (VV) to treat MPM when administered alone or as an adjuvant treatment to surgery. Two aggressive murine mesothelioma cell lines (AC29, AB12), were used. Cell viability and viral cytopathic effects were assessed using MTS and crystal violet assays. Immunocompetent mice were injected intraperitoneally with MPM cells and treated with intraperitoneal VV. Tumor-bearing mice also underwent cytoreductive surgery (CRS) followed by VV (or control) therapy. The cytotoxic effects of VV on MPM cell lines was significantly increased compared with the control non-cancer cell line. In both orthotopic models, VV induced tumor regression, prolonging median and long-term survival. VV treatment after incomplete CRS was not superior to VV alone; however, when mice with microscopic disease were treated with VV, further prolongation of median and long-term survivals was observed. VV selectively kills MPM cells in vitro and leads to improved survival and cures in immunocompetent murine models. Higher efficacy of the virus in the microscopic disease context suggests the use of the virus as an adjuvant treatment to complete surgical resection. These promising results justify further studies of VV in humans as a novel treatment for MPM.

  6. Brazilian vaccinia virus strains show a classical orthopoxvirus in-fection course and cross-protection

    Institute of Scientific and Technical Information of China (English)

    Betania Paiva Drumond; Jonatas Santos Abraho; Zlia Ins Portela Lobato; Cludio Antonio Bonjardim; Paulo Csar Peregrino Ferreira; Erna Geessien Kroon

    2009-01-01

    Objectives:The purpose of this work was to study the infection course and cross-protection in mice after intra-dermal injection of Vaccinia virus (VACV ) strain Western Reserve and three Brazilian VACV strains:Araatuba,Muriaéand BeAn58058 isolated from cow,human and rodent,respectively.Methods:Balb /c mice were inoculated by footpad and back scarification and daily monitored regarding lesion development and weight loss.To check cross protection after intradermal VACV inoculation,mice were subsequently infected with different VACV strains and monitored to check lesion development.Serum neutralization assays were per-formed to check for the presence of antibodies against Orthopoxvirus.Results:After VACV intradermal inocu-lation the lesion development pattern was similar in mice infected with the different virus strains.By using the footpad scarification model,cross-protection among VACV strains was observed.Moreover,neutralizing anti-bodies against Orthopoxvirus were detected in sera from mice infected with all VACV strains.Conclusion:Al-though it was not possible to observe virulence differences among VACV strains isolated from cow,rodent and human using the murine model,this inoculation route showed to be an appropriated model to study lesions de-velopment since it mimics natural infections by VACV in nature.

  7. Myxoma and vaccinia viruses exploit different mechanisms to enter and infect human cancer cells.

    Science.gov (United States)

    Villa, Nancy Y; Bartee, Eric; Mohamed, Mohamed R; Rahman, Masmudur M; Barrett, John W; McFadden, Grant

    2010-06-05

    Myxoma (MYXV) and vaccinia (VACV) viruses have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1--low-pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2--the tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3--knockdown of PAK1 revealed that it is required for a late stage event downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. 2010 Elsevier Inc. All rights reserved.

  8. Oncolytic gene therapy with recombinant vaccinia strain GLV-2b372 efficiently kills hepatocellular carcinoma.

    Science.gov (United States)

    Ady, Justin W; Johnsen, Clark; Mojica, Kelly; Heffner, Jacqueline; Love, Damon; Pugalenthi, Amudhan; Belin, Laurence J; Chen, Nanhai G; Yu, Yong A; Szalay, Aladar A; Fong, Yuman

    2015-08-01

    Hepatocellular carcinoma (HCC) commonly presents at a late stage when surgery is no longer a curative option. As such, novel therapies for advanced HCC are needed. Oncolytic viruses are a viable option for cancer therapy owing to their ability to specifically infect, replicate within, and kill cancer cells. In this study, we have investigated the ability of GLV-2b372, a novel light-emitting recombinant vaccinia virus derived from a wild-type Lister strain, to kill HCC. Four human HCC cell lines were assayed in vitro for infectivity and cytotoxicity. Viral replication was quantified via standard viral plaque assays. Flank HCC xenografts generated in athymic nude mice were treated with intratumoral GLV-2b372 to assess for tumor growth inhibition and viral biodistribution. Infectivity occurred in a time- and concentration-dependent manner with 70% cell death in all cell lines by day 5. All cell lines supported efficient viral replication. At 25 days after infection, flank tumor volumes decreased by 50% whereas controls increased by 400%. Tumor tissue demonstrated substantial GLV-2b372 infection at 24 hours, 48 hours, and 2 weeks. We demonstrate that GLV-2b372 efficiently kills human HCC in vitro and in vivo and is a viable treatment option for patients with HCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. RAB1A promotes Vaccinia virus replication by facilitating the production of intracellular enveloped virions

    Energy Technology Data Exchange (ETDEWEB)

    Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.; Brown, Helen K. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); James, John; Prescott, Alan [Division of Cell Signalling and Immunology, College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Haga, Ismar R. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); Beard, Philippa M., E-mail: pip.beard@roslin.ed.ac.uk [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom)

    2015-01-15

    Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore be added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.

  10. Antigen Gene Transfer to Human Plasmacytoid Dendritic Cells Using Recombinant Adenovirus and Vaccinia Virus Vectors

    Directory of Open Access Journals (Sweden)

    Hetty J. Bontkes

    2005-01-01

    Full Text Available Recombinant adenoviruses (RAd and recombinant vaccinia viruses (RVV expressing tumour-associated antigens (TAA are used as anti-tumour vaccines. It is important that these vaccines deliver the TAA to dendritic cells (DC for the induction of a strong immune response. Infection of myeloid DC (MDC with RAd alone is relatively inefficient but CD40 retargeting significantly increases transduction efficiency and DC maturation. Infection with RVV is efficient without DC maturation. Plasmacytoid dendritic cells (PDC play a role in the innate immune response to viral infections through the secretion of IFNα but may also play a role in specific T-cell induction. The aim of our study was to investigate whether PDC are better targets for RAd and RVV based vaccines. RAd alone hardly infected PDC (2% while CD40 retargeting did not improve transduction efficiency, but it did increase PDC maturation (25% CD83 positive cells. Accordingly, specific CTL activation by RAd infected PDC was limited (the number of IFNγ producing CTL was reduced by 75% compared to stimulation with peptide loaded PDC. RVV infected PDC specifically stimulated CTL but PDC were not activated. These Results indicate that PDC are not ideal targets for RAd and RVV based vaccines. However, PDC induced specific CTL activation after pulsing with recombinant protein, indicating that PDC can also cross-present antigens released from surrounding infected cells.

  11. Live attenuated vaccines: Historical successes and current challenges

    Energy Technology Data Exchange (ETDEWEB)

    Minor, Philip D., E-mail: Philip.Minor@nibsc.org

    2015-05-15

    Live attenuated vaccines against human viral diseases have been amongst the most successful cost effective interventions in medical history. Smallpox was declared eradicated in 1980; poliomyelitis is nearing global eradication and measles has been controlled in most parts of the world. Vaccines function well for acute diseases such as these but chronic infections such as HIV are more challenging for reasons of both likely safety and probable efficacy. The derivation of the vaccines used has in general not been purely rational except in the sense that it has involved careful clinical trials of candidates and subsequent careful follow up in clinical use; the identification of the candidates is reviewed. - Highlights: • Live vaccines against human diseases caused by viruses have been very successful. • They have been developed by empirical clinical studies and problems identified in later use. • It can be difficult to balance ability to cause disease and ability to immunise for a strain. • There is currently no reliable basis for predicting success from pure virological studies. • Vaccinia, which eradicated smallpox, is the paradigm for all successes and issues.

  12. [Construction and identification of non-replication recombinant vaccinia virus co-expressing human papillomavirus type 16 L1/L2/E6/E7 proteins].

    Science.gov (United States)

    Huang, Wei; Tian, Hou-wen; Ren, Jiao; Fan, Jiang-tao; Zhao, Li; Bian, Tao; Lu, Zhen-hua; Ruan, Li

    2005-09-01

    To generate a human papillomavirus (HPV16) prophylactic and therapeutic vaccine candidate for cervical cancer. HPV16 major capsid protein L1 gene/minor capsid protein L2 gene and HPV16 early E6/E7 genes were inserted into a vaccinia virus expression vector. A strain of non-recombinant vaccinia virus containing the sequences was obtained through a homologous recombination and identified. DNA hybridization confirmed that the HPV16L1/L2/E6/E7 genes were integrated into vaccinia virus DNA. Western Blot result showed that full-length L1/L2/E6/E7 proteins were co-expressed in CEF cells infected with the recombinant virus. NTVJE6E7CKL1L2 could be taken as a candidate of prophylactic and therapeutic vaccine for HPV-associated tumors and their precancerous transformations.

  13. Elicitation of both anti HIV-1 Env humoral and cellular immunities by replicating vaccinia prime Sendai virus boost regimen and boosting by CD40Lm.

    Directory of Open Access Journals (Sweden)

    Xianfeng Zhang

    Full Text Available For protection from HIV-1 infection, a vaccine should elicit both humoral and cell-mediated immune responses. A novel vaccine regimen and adjuvant that induce high levels of HIV-1 Env-specific T cell and antibody (Ab responses was developed in this study. The prime-boost regimen that used combinations of replication-competent vaccinia LC16m8Δ (m8Δ and Sendai virus (SeV vectors expressing HIV-1 Env efficiently produced both Env-specific CD8(+ T cells and anti-Env antibodies, including neutralizing antibodies (nAbs. These results sharply contrast with vaccine regimens that prime with an Env expressing plasmid and boost with the m8Δ or SeV vector that mainly elicited cellular immunities. Moreover, co-priming with combinations of m8Δs expressing Env or a membrane-bound human CD40 ligand mutant (CD40Lm enhanced Env-specific CD8(+ T cell production, but not anti-Env antibody production. In contrast, priming with an m8Δ that coexpresses CD40Lm and Env elicited more anti-Env Abs with higher avidity, but did not promote T cell responses. These results suggest that the m8Δ prime/SeV boost regimen in conjunction with CD40Lm expression could be used as an immunization platform for driving both potent cellular and humoral immunities against pathogens such as HIV-1.

  14. Evaluating the orthopoxvirus type I interferon-binding molecule as a vaccine target in the vaccinia virus intranasal murine challenge model.

    Science.gov (United States)

    Golden, Joseph W; Hooper, Jay W

    2010-11-01

    The biological threat imposed by orthopoxviruses warrants the development of safe and effective vaccines. We developed a candidate orthopoxvirus DNA-based vaccine, termed 4pox, which targets four viral structural components, A33, B5, A27, and L1. While this vaccine protects mice and nonhuman primates from lethal infections, we are interested in further enhancing its potency. One approach to enhance potency is to include additional orthopoxvirus immunogens. Here, we investigated whether vaccination with the vaccinia virus (VACV) interferon (IFN)-binding molecule (IBM) could protect BALB/c mice against lethal VACV challenge. We found that vaccination with this molecule failed to significantly protect mice from VACV when delivered alone. IBM modestly augmented protection when delivered together with the 4pox vaccine. All animals receiving the 4pox vaccine plus IBM lived, whereas only 70% of those receiving a single dose of 4pox vaccine survived. Mapping studies using truncated mutants revealed that vaccine-generated antibodies spanned the immunoglobulin superfamily domains 1 and 2 and, to a lesser extent, 3 of the IBM. These antibodies inhibited IBM cell binding and IFN neutralization activity, indicating that they were functionally active. This study shows that DNA vaccination with the VACV IBM results in a robust immune response but that this response does not significantly enhance protection in a high-dose challenge model.

  15. Transient dominant host-range selection using Chinese hamster ovary cells to generate marker-free recombinant viral vectors from vaccinia virus.

    Science.gov (United States)

    Liu, Liang; Cooper, Tamara; Eldi, Preethi; Garcia-Valtanen, Pablo; Diener, Kerrilyn R; Howley, Paul M; Hayball, John D

    2017-04-01

    Recombinant vaccinia viruses (rVACVs) are promising antigen-delivery systems for vaccine development that are also useful as research tools. Two common methods for selection during construction of rVACV clones are (i) co-insertion of drug resistance or reporter protein genes, which requires the use of additional selection drugs or detection methods, and (ii) dominant host-range selection. The latter uses VACV variants rendered replication-incompetent in host cell lines by the deletion of host-range genes. Replicative ability is restored by co-insertion of the host-range genes, providing for dominant selection of the recombinant viruses. Here, we describe a new method for the construction of rVACVs using the cowpox CP77 protein and unmodified VACV as the starting material. Our selection system will expand the range of tools available for positive selection of rVACV during vector construction, and it is substantially more high-fidelity than approaches based on selection for drug resistance.

  16. Rapid Generation of Multiple Loci-Engineered Marker-free Poxvirus and Characterization of a Clinical-Grade Oncolytic Vaccinia Virus

    Directory of Open Access Journals (Sweden)

    Zong Sheng Guo

    2017-12-01

    Full Text Available Recombinant poxviruses, utilized as vaccine vectors and oncolytic viruses, often require manipulation at multiple genetic loci in the viral genome. It is essential for viral vectors to possess no adventitious mutations and no (antibiotic selection marker in the final product for human patients in order to comply with the guidance from the regulatory agencies. Rintoul et al. have previously developed a selectable and excisable marker (SEM system for the rapid generation of recombinant vaccinia virus. In the current study, we describe an improved methodology for rapid creation and selection of recombinant poxviruses with multiple genetic manipulations solely based on expression of a fluorescent protein and with no requirement for drug selection that can lead to cellular stress and the risk of adventitious mutations throughout the viral genome. Using this improved procedure combined with the SEM system, we have constructed multiple marker-free oncolytic poxviruses expressing different cytokines and other therapeutic genes. The high fidelity of inserted DNA sequences validates the utility of this improved procedure for generation of therapeutic viruses for human patients. We have created an oncolytic poxvirus expressing human chemokine CCL5, designated as vvDD-A34R-hCCL5, with manipulations at two genetic loci in a single virus. Finally, we have produced and purified this virus in clinical grade for its use in a phase I clinical trial and presented data on initial in vitro characterization of the virus.

  17. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  18. Unintentional transfer of vaccinia virus associated with smallpox vaccines: ACAM2000(®) compared with Dryvax(®).

    Science.gov (United States)

    Tack, Danielle M; Karem, Kevin L; Montgomery, Jay R; Collins, Limone; Bryant-Genevier, Marthe G; Tiernan, Rosemary; Cano, Maria; Lewis, Paige; Engler, Renata J M; Damon, Inger K; Reynolds, Mary G

    2013-07-01

    Routine vaccination against smallpox (variola) ceased in the US in 1976. However, in 2002 limited coverage for military personnel and some healthcare workers was reinstituted. In March 2008, ACAM2000® replaced Dryvax® as the vaccine used in the United States against smallpox. Unintentional transfer of vaccinia virus from a vaccination site by autoinoculation or contact transmission, can have significant public health implications. We summarize unintentional virus transfer AEs associated with ACAM2000® since March 2008 and compare with Dryvax®. We identified 309 reports for ACAM2000® with skin or ocular involvement, of which 93 were autoinoculation cases and 20 were contact transmission cases. The rate for reported cases of autoinoculation was 20.6 per 100,000 vaccinations and for contact transmission was 4.4 per 100,000 vaccinations. Eighteen contact transmission cases could be attributed to contact during a sporting activity (45%) or intimate contact (45%). Of the 113 unintentional transfer cases, 6 met the case definition for ocular vaccinia. The most common locations for all autoinoculation and contact cases were arm/elbow/shoulder (35/113; 31%) and face (24/113; 21%). Methods We reviewed 753 reports associated with smallpox in the Vaccine Adverse Event Reporting System and CDC Poxvirus consultation log, reported from March 2008 to August 2010. Reports were classified into categories based upon standard case definitions. Overall, unintentional transfer events for ACAM2000® and Dryvax® are similar. We recommend continued efforts to prevent transfer events and continuing education for healthcare providers focused on recognition of vaccinia lesions, proper sample collection, and laboratory testing to confirm diagnosis.

  19. Immunogenicity of oncolytic vaccinia viruses JX-GFP and TG6002 in a human melanoma in vitro model: studying immunogenic cell death, dendritic cell maturation and interaction with cytotoxic T lymphocytes

    Directory of Open Access Journals (Sweden)

    Heinrich B

    2017-05-01

    Full Text Available B Heinrich,1 J Klein,1 M Delic,1 K Goepfert,1 V Engel,1 L Geberzahn,1 M Lusky,2 P Erbs,2 X Preville,3 M Moehler1 1First Department of Internal Medicine, University Medical Center Mainz, Mainz, Germany; 2Transgene SA, Illkirch-Graffenstaden, 3Amoneta Diagnostics, Huningue, France Abstract: Oncolytic virotherapy is an emerging immunotherapeutic modality for cancer treatment. Oncolytic viruses with genetic modifications can further enhance the oncolytic effects on tumor cells and stimulate antitumor immunity. The oncolytic vaccinia viruses JX-594-GFP+/hGM-CSF (JX-GFP and TG6002 are genetically modified by secreting granulocyte-macrophage colony-stimulating factor (GM-CSF or transforming 5-fluorocytosine (5-FC into 5-fluorouracil (5-FU. We compared their properties to kill tumor cells and induce an immunogenic type of cell death in a human melanoma cell model using SK29-MEL melanoma cells. Their influence on human immune cells, specifically regarding the activation of dendritic cells (DCs and the interaction with the autologous cytotoxic T lymphocyte (CTL clone, was investigated. Melanoma cells were infected with either JX-GFP or TG6002 alone or in combination with 5-FC and 5-FU. The influence of viral infection on cell viability followed a time- and multiplicity of infection dependent manner. Combination of virus treatment with 5-FU resulted in stronger reduction of cell viability. TG6002 in combination with 5-FC did not significantly strengthen the reduction of cell viability in this setting. Expression of calreticulin and high mobility group 1 protein (HMGB1, markers of immunogenic cell death (ICD, could be detected after viral infection. Accordingly, DC maturation was noted after viral oncolysis. DCs presented stronger expression of activation and maturation markers. The autologous CTL clone IVSB expressed the activation marker CD69, but viral treatment failed to enhance cytotoxicity marker. In summary, vaccinia viruses JX-GFP and TG6002 lyse

  20. Identification of Protective Brucella Antigens and their Expressions in Vaccinia Virus to Prevent Disease in Animals and Humans.

    Science.gov (United States)

    1996-05-01

    selected antigens is through fractionation of Brucella strain RB51 or E.coli recombinants expressing the appropriateBrucella antigen. Briefly, the method...animal species infected with Brucella spp. It is also able to induce the in vitro production of INF-y with lymphocytes of RB51 vaccinated mice (Table...SOD RB51 1IkDa 20 15 x0 0- 10 E 0- Uve Acetone Buffer Void 0-0.1 0.1-0-25 0.25->0.5 0.5-0.75 0.75->1.0 Klled 14 Preparation of new vaccinia/ Brucella

  1. Radiofrequency attenuator and method

    Science.gov (United States)

    Warner, Benjamin P [Los Alamos, NM; McCleskey, T Mark [Los Alamos, NM; Burrell, Anthony K [Los Alamos, NM; Agrawal, Anoop [Tucson, AZ; Hall, Simon B [Palmerston North, NZ

    2009-01-20

    Radiofrequency attenuator and method. The attenuator includes a pair of transparent windows. A chamber between the windows is filled with molten salt. Preferred molten salts include quarternary ammonium cations and fluorine-containing anions such as tetrafluoroborate (BF.sub.4.sup.-), hexafluorophosphate (PF.sub.6.sup.-), hexafluoroarsenate (AsF.sub.6.sup.-), trifluoromethylsulfonate (CF.sub.3SO.sub.3.sup.-), bis(trifluoromethylsulfonyl)imide ((CF.sub.3SO.sub.2).sub.2N.sup.-), bis(perfluoroethylsulfonyl)imide ((CF.sub.3CF.sub.2SO.sub.2).sub.2N.sup.-) and tris(trifluoromethylsulfonyl)methide ((CF.sub.3SO.sub.2).sub.3C.sup.-). Radicals or radical cations may be added to or electrochemically generated in the molten salt to enhance the RF attenuation.

  2. Attenuation limits in longitudinal phononic crystals

    Science.gov (United States)

    Luschi, L.; Iannaccone, G.; Pieri, F.

    2017-12-01

    The acoustic attenuation inside the bandgaps is, together with the bandgap width, a fundamental design parameter for phononic-crystal-based systems. We discuss approximate expressions for the maximum attenuation inside the bandgaps of one-dimensional longitudinal phononic crystals and its dependence on the acoustic contrast and the fractional bandwidth. We provide different approximations at small and large fractional bandwidths, computed from the trace of the transmission matrix of the crystal elementary cell. We show that, for relatively small gaps, the attenuation is roughly proportional to the fractional bandwidth, in analogy with the flexural case. For larger gaps, a large attenuation can be obtained only for high (and possibly impractical) acoustic contrasts. Approximate expressions are validated through comparison with FEM results. We also derive asymptotic upper limits for the bandgap borders and show that high contrasts do not necessarily lead to wide bandgaps, a fact connected to geometrical phase inversion for the acoustic wave in the crystal. We finally compare the attenuation of flexural and longitudinal waves at a fixed fractional bandwidth and derive regions of optimum attenuation for the two propagation modes.

  3. Combinational deletion of three membrane protein-encoding genes highly attenuates yersinia pestis while retaining immunogenicity in a mouse model of pneumonic plague.

    Science.gov (United States)

    Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K

    2015-04-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a

  4. Combinational Deletion of Three Membrane Protein-Encoding Genes Highly Attenuates Yersinia pestis while Retaining Immunogenicity in a Mouse Model of Pneumonic Plague

    Science.gov (United States)

    Tiner, Bethany L.; Kirtley, Michelle L.; Erova, Tatiana E.; Popov, Vsevolod L.; Baze, Wallace B.; van Lier, Christina J.; Ponnusamy, Duraisamy; Andersson, Jourdan A.; Motin, Vladimir L.; Chauhan, Sadhana

    2015-01-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a

  5. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Directory of Open Access Journals (Sweden)

    Qicheng Zhang

    Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  6. Antibody against extracellular vaccinia virus (EV protects mice through complement and Fc receptors.

    Directory of Open Access Journals (Sweden)

    Matthew E Cohen

    Full Text Available Protein-based subunit smallpox vaccines have shown their potential as effective alternatives to live virus vaccines in animal model challenge studies. We vaccinated mice with combinations of three different vaccinia virus (VACV proteins (A33, B5, L1 and examined how the combined antibody responses to these proteins cooperate to effectively neutralize the extracellular virus (EV infectious form of VACV. Antibodies against these targets were generated in the presence or absence of CpG adjuvant so that Th1-biased antibody responses could be compared to Th2-biased responses to the proteins with aluminum hydroxide alone, specifically with interest in looking at the ability of anti-B5 and anti-A33 polyclonal antibodies (pAb to utilize complement-mediated neutralization in vitro. We found that neutralization of EV by anti-A33 or anti-B5 pAb can be enhanced in the presence of complement if Th1-biased antibody (IgG2a is generated. Mechanistic differences found for complement-mediated neutralization showed that anti-A33 antibodies likely result in virolysis, while anti-B5 antibodies with complement can neutralize by opsonization (coating. In vivo studies found that mice lacking the C3 protein of complement were less protected than wild-type mice after passive transfer of anti-B5 pAb or vaccination with B5. Passive transfer of anti-B5 pAb or monoclonal antibody into mice lacking Fc receptors (FcRs found that FcRs were also important in mediating protection. These results demonstrate that both complement and FcRs are important effector mechanisms for antibody-mediated protection from VACV challenge in mice.

  7. A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication.

    Science.gov (United States)

    Verardi, Paulo H; Titong, Allison; Hagen, Caitlin J

    2012-07-01

    In 1796, Edward Jenner introduced the concept of vaccination with cowpox virus, an Orthopoxvirus within the family Poxviridae that elicits cross protective immunity against related orthopoxviruses, including smallpox virus (variola virus). Over time, vaccinia virus (VACV) replaced cowpox virus as the smallpox vaccine, and vaccination efforts eventually led to the successful global eradication of smallpox in 1979. VACV has many characteristics that make it an excellent vaccine and that were crucial for the successful eradication of smallpox, including (1) its exceptional thermal stability (a very important but uncommon characteristic in live vaccines), (2) its ability to elicit strong humoral and cell-mediated immune responses, (3) the fact that it is easy to propagate, and (4) that it is not oncogenic, given that VACV replication occurs exclusively within the host cell cytoplasm and there is no evidence that the viral genome integrates into the host genome. Since the eradication of smallpox, VACV has experienced a renaissance of interest as a viral vector for the development of recombinant vaccines, immunotherapies, and oncolytic therapies, as well as the development of next-generation smallpox vaccines. This revival is mainly due to the successful use and extensive characterization of VACV as a vaccine during the smallpox eradication campaign, along with the ability to genetically manipulate its large dsDNA genome while retaining infectivity and immunogenicity, its wide mammalian host range, and its natural tropism for tumor cells that allows its use as an oncolytic vector. This review provides an overview of new uses of VACV that are currently being explored for the development of vaccines, immunotherapeutics, and oncolytic virotherapies.

  8. Tagging of the vaccinia virus protein F13 with mCherry causes aberrant virion morphogenesis.

    Science.gov (United States)

    Carpentier, David C J; Hollinshead, Michael S; Ewles, Helen A; Lee, Stacey-Ann; Smith, Geoffrey L

    2017-09-20

    Vaccinia virus produces two distinct infectious virions; the single-enveloped intracellular mature virus (IMV), which remains in the cell until cell lysis, and the double-enveloped extracellular enveloped virus (EEV), which mediates virus spread. The latter is derived from a triple-enveloped intracellular enveloped virus (IEV) precursor, which is transported to the cell periphery by the kinesin-1 motor complex. This transport involves the viral protein A36 as well as F12 and E2. A36 is an integral membrane protein associated with the outer virus envelope and is the only known direct link between virion and kinesin-1 complex. Yet in the absence of A36 virion egress still occurs on microtubules, albeit at reduced efficiency. In this paper double-fluorescent labelling of the capsid protein A5 and outer-envelope protein F13 was exploited to visualize IEV transport by live-cell imaging in the absence of either A36 or F12. During the generation of recombinant viruses expressing both A5-GFP and F13-mCherry a plaque size defect was identified that was particularly severe in viruses lacking A36. Electron microscopy showed that this phenotype was caused by abnormal wrapping of IMV to form IEV, and this resulted in reduced virus egress to the cell surface. The aberrant wrapping phenotype suggests that the fluorescent fusion protein interferes with an interaction of F13 with the IMV surface that is required for tight association between IMVs and wrapping membranes. The severity of this defect suggests that these viruses are imperfect tools for characterizing virus egress.

  9. An E2-F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection.

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-05-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s(-1) , consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.

  10. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

    Directory of Open Access Journals (Sweden)

    DeLucas Lawrence

    2007-07-01

    Full Text Available Abstract Background Uracil-DNA glycosylases (UDGs catalyze excision of uracil from DNA. Vaccinia virus, which is the prototype of poxviruses, encodes a UDG (vvUDG that is significantly different from the UDGs of other organisms in primary, secondary and tertiary structure and characteristic motifs. It adopted a novel catalysis-independent role in DNA replication that involves interaction with a viral protein, A20, to form the processivity factor. UDG:A20 association is essential for assembling of the processive DNA polymerase complex. The structure of the protein must have provisions for such interactions with A20. This paper provides the first glimpse into the structure of a poxvirus UDG. Results Results of dynamic light scattering experiments and native size exclusion chromatography showed that vvUDG is a dimer in solution. The dimeric assembly is also maintained in two crystal forms. The core of vvUDG is reasonably well conserved but the structure contains one additional β-sheet at each terminus. A glycerol molecule is found in the active site of the enzyme in both crystal forms. Interaction of this glycerol molecule with the protein possibly mimics the enzyme-substrate (uracil interactions. Conclusion The crystal structures reveal several distinctive features of vvUDG. The new structural features may have evolved for adopting novel functions in the replication machinery of poxviruses. The mode of interaction between the subunits in the dimers suggests a possible model for binding to its partner and the nature of the processivity factor in the polymerase complex.

  11. Cleavage of Dicer protein by I7 protease during vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Jhih-Si Chen

    Full Text Available Dicer is the key component in the miRNA pathway. Degradation of Dicer protein is facilitated during vaccinia virus (VV infection. A C-terminal cleaved product of Dicer protein was detected in the presence of MG132 during VV infection. Thus, it is possible that Dicer protein is cleaved by a viral protease followed by proteasome degradation of the cleaved product. There is a potential I7 protease cleavage site in the C-terminus of Dicer protein. Indeed, reduction of Dicer protein was detected when Dicer was co-expressed with I7 protease but not with an I7 protease mutant protein lack of the protease activity. Mutation of the potential I7 cleavage site in the C-terminus of Dicer protein resisted its degradation during VV infection. Furthermore, Dicer protein was reduced dramatically by recombinant VV vI7Li after the induction of I7 protease. If VV could facilitate the degradation of Dicer protein, the process of miRNA should be affected by VV infection. Indeed, accumulation of precursor miR122 was detected after VV infection or I7 protease expression. Reduction of miR122 would result in the suppression of HCV sub-genomic RNA replication, and, in turn, the amount of viral proteins. As expected, significant reduction of HCVNS5A protein was detected after VV infection and I7 protease expression. Therefore, our results suggest that VV could cleave Dicer protein through I7 protease to facilitate Dicer degradation, and in turn, suppress the processing of miRNAs. Effect of Dicer protein on VV replication was also studied. Exogenous expression of Dicer protein suppresses VV replication slightly while knockdown of Dicer protein does not affect VV replication significantly.

  12. Apoptosis and necrosis in vaccinia virus-infected HeLa G and BSC-40 cells.

    Science.gov (United States)

    Liskova, Jana; Knitlova, Jarmila; Honner, Richard; Melkova, Zora

    2011-09-01

    In most cells, vaccinia virus (VACV) infection is considered to cause a lytic cell death, an equivalent of necrosis. However, upon infection of the epithelial cell lines HeLa G and BSC-40 with VACV strain Western Reserve (WR), we have previously observed an increased activation of and activity attributable to caspases, a typical sign of apoptosis. In this paper, we have further analyzed the type of cell death in VACV-infected cells HeLa G and BSC-40. In a cell-based flow cytometric assay, we showed a specific activation of caspase-2 and 4 in HeLa G and BSC-40 cells infected with VACV, strain WR, while we did not find any effects of inhibitors of calpain and cathepsin D and E. The actual activity of the two caspases, but also of caspase-3, was then confirmed in lysates of infected HeLa G, but not in BSC-40 cells. Accordingly, poly(ADP)-ribose polymerase (PARP) cleavage was found increased only in infected HeLa G cells. Consequently, we have determined morphological features of apoptosis and/or activity of the executioner caspase-3 in infected HeLa G cells in situ, while only a background apoptosis was observed in infected BSC-40 cells. Finally, vaccination strains Dryvax and Praha were found to induce apoptosis in both HeLa G and BSC-40 cells, as characterized morphologically and by PARP cleavage. These findings may be important for understanding the differences in VACV-host interactions and post-vaccination complications in different individuals. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Immune properties of recombinant vaccinia virus encoding CD154 (CD40L) are determined by expression of virally encoded CD40L and the presence of CD40L protein in viral particles.

    Science.gov (United States)

    Bereta, Michal; Bereta, Joanna; Park, Jonas; Medina, Freddy; Kwak, Heesun; Kaufman, Howard L

    2004-12-01

    Expression of costimulatory molecules by recombinant poxviruses is a promising strategy for enhancing therapeutic vaccines. CD40-CD40L interactions are critical for conditioning dendritic cells (DC) and priming T- and B-cell immunity. We constructed a vaccinia virus expressing murine CD40L (rV-CD40L) and studied its immunomodulatory properties in vitro. Direct DC infection with control vaccinia or psoralen/UV-inactivated rV-CD40L stimulated high levels of interleukin 12 (IL-12) release. However, replication-competent rV-CD40L did not stimulate IL-12 under similar conditions. We observed a high level of CD40L protein on purified viral particles and demonstrated that induction of IL-12 by nonreplicating rV-CD40L was blocked by anti-CD40 antibodies suggesting that functional CD40L on viral particles contributed to alterations in IL-12 synthesis. Since cross-presentation of tumor-associated antigens by DC is augmented by viral infection of tumor cells, we infected MC38 murine colon carcinoma cells with rV-CD40L. Infected cells stimulated IL-12 secretion by DC and proliferation of B cells and DX5(+) (NK/NKT) cells through direct CD40-CD40L interaction. A subpopulation of NKT cells expressing CD40 (NK1.1(+), CD3(lo)) appeared to be a major effector population responding to MC38/rV-CD40L. These results highlight the complex immune regulatory effects of rV-CD40L defined by the cumulative effects of CD40L expression, presence of CD40L protein in viral particles, and the replication potential of the virus.

  14. Fructose 1,6-bisphosphate, a high-energy intermediate of glycolysis, attenuates experimental arthritis by activating anti-inflammatory adenosinergic pathway.

    Science.gov (United States)

    Veras, Flávio P; Peres, Raphael S; Saraiva, André L L; Pinto, Larissa G; Louzada-Junior, Paulo; Cunha, Thiago M; Paschoal, Jonas A R; Cunha, Fernando Q; Alves-Filho, José C

    2015-10-19

    Fructose 1,6-bisphosphate (FBP) is an endogenous intermediate of the glycolytic pathway. Exogenous administration of FBP has been shown to exert protective effects in a variety of ischemic injury models, which are attributed to its ability to sustain glycolysis and increase ATP production. Here, we demonstrated that a single treatment with FBP markedly attenuated arthritis, assessed by reduction of articular hyperalgesia, joint swelling, neutrophil infiltration and production of inflammatory cytokines, TNF and IL-6, while enhancing IL-10 production in two mouse models of arthritis. Our mechanistic studies showed that FBP reduces joint inflammation through the systemic generation of extracellular adenosine and subsequent activation of adenosine receptor A2a (A2aR). Moreover, we showed that FBP-induced adenosine generation requires hydrolysis of extracellular ATP through the activity of the ectonucleosides triphosphate diphosphohydrolase-1 (ENTPD1, also known as CD39) and ecto-5'-nucleotidase (E5NT, also known as CD73). In accordance, inhibition of CD39 and CD73 abolished anti-arthritic effects of FBP. Taken together, our findings provide a new insight into the molecular mechanism underlying the anti-inflammatory effect of FBP, showing that it effectively attenuates experimental arthritis by activating the anti-inflammatory adenosinergic pathway. Therefore, FBP may represent a new therapeutic strategy for treatment of rheumatoid arthritis (RA).

  15. Innate immune sensing of modified vaccinia virus Ankara (MVA is mediated by TLR2-TLR6, MDA-5 and the NALP3 inflammasome.

    Directory of Open Access Journals (Sweden)

    Julie Delaloye

    2009-06-01

    Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated double-stranded DNA poxvirus currently developed as a vaccine vector against HIV/AIDS. Profiling of the innate immune responses induced by MVA is essential for the design of vaccine vectors and for anticipating potential adverse interactions between naturally acquired and vaccine-induced immune responses. Here we report on innate immune sensing of MVA and cytokine responses in human THP-1 cells, primary human macrophages and mouse bone marrow-derived macrophages (BMDMs. The innate immune responses elicited by MVA in human macrophages were characterized by a robust chemokine production and a fairly weak pro-inflammatory cytokine response. Analyses of the cytokine production profile of macrophages isolated from knockout mice deficient in Toll-like receptors (TLRs or in the adapter molecules MyD88 and TRIF revealed a critical role for TLR2, TLR6 and MyD88 in the production of IFNbeta-independent chemokines. MVA induced a marked up-regulation of the expression of RIG-I like receptors (RLR and the IPS-1 adapter (also known as Cardif, MAVS or VISA. Reduced expression of RIG-I, MDA-5 and IPS-1 by shRNAs indicated that sensing of MVA by RLR and production of IFNbeta and IFNbeta-dependent chemokines was controlled by the MDA-5 and IPS-1 pathway in the macrophage. Crosstalk between TLR2-MyD88 and the NALP3 inflammasome was essential for expression and processing of IL-1beta. Transcription of the Il1b gene was markedly impaired in TLR2(-/- and MyD88(-/- BMDM, whereas mature and secreted IL-1beta was massively reduced in NALP3(-/- BMDMs or in human THP-1 macrophages with reduced expression of NALP3, ASC or caspase-1 by shRNAs. Innate immune sensing of MVA and production of chemokines, IFNbeta and IL-1beta by macrophages is mediated by the TLR2-TLR6-MyD88, MDA-5-IPS-1 and NALP3 inflammasome pathways. Delineation of the host response induced by MVA is critical for improving our understanding of poxvirus

  16. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupational Exposure to Orthopoxviruses - Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2015.

    Science.gov (United States)

    Petersen, Brett W; Harms, Tiara J; Reynolds, Mary G; Harrison, Lee H

    2016-03-18

    On June 25, 2015, the Advisory Committee on Immunization Practices (ACIP) recommended routine vaccination with live smallpox (vaccinia) vaccine (ACAM2000) for laboratory personnel who directly handle 1) cultures or 2) animals contaminated or infected with replication-competent vaccinia virus, recombinant vaccinia viruses derived from replication-competent vaccinia strains (i.e., those that are capable of causing clinical infection and producing infectious virus in humans), or other orthopoxviruses that infect humans (e.g., monkeypox, cowpox, and variola) (recommendation category: A, evidence type 2 [Box]). Health care personnel (e.g., physicians and nurses) who currently treat or anticipate treating patients with vaccinia virus infections and whose contact with replication-competent vaccinia viruses is limited to contaminated materials (e.g., dressings) and persons administering ACAM2000 smallpox vaccine who adhere to appropriate infection prevention measures can be offered vaccination with ACAM2000 (recommendation category: B, evidence type 2 [Box]). These revised recommendations update the previous ACIP recommendations for nonemergency use of vaccinia virus smallpox vaccine for laboratory and health care personnel at risk for occupational exposure to orthopoxviruses (1). Since 2001, when the previous ACIP recommendations were developed, ACAM2000 has replaced Dryvax as the only smallpox vaccine licensed by the U.S. Food and Drug Administration (FDA) and available for use in the United States (2). These recommendations contain information on ACAM2000 and its use in laboratory and health care personnel at risk for occupational exposure to orthopoxviruses.

  17. Natural attenuation of herbicides

    DEFF Research Database (Denmark)

    Tuxen, Nina; Højberg, Anker Lajer; Broholm, Mette Martina

    2002-01-01

    A field injection experiment in a sandy, aerobic aquifer showed that two phenoxy acids MCPP (mecoprop) and dichlorprop were degraded within I in downgradient of the injection wells after an apparent lag period. The plume development and microbial measurements indicated that microbial growth....... The observations may be important for application of natural attenuation as a remedy in field scale systems....

  18. Protective Effect of Surfactant Protein D in Pulmonary Vaccinia Virus Infection: Implication of A27 Viral Protein

    Directory of Open Access Journals (Sweden)

    Julien Perino

    2013-03-01

    Full Text Available Vaccinia virus (VACV was used as a surrogate of variola virus (VARV (genus Orthopoxvirus, the causative agent of smallpox, to study Orthopoxvirus infection. VARV is principally transmitted between humans by aerosol droplets. Once inhaled, VARV first infects the respiratory tract where it could encounter surfactant components, such as soluble pattern recognition receptors. Surfactant protein D (SP-D, constitutively present in the lining fluids of the respiratory tract, plays important roles in innate host defense against virus infection. We investigated the role of SP-D in VACV infection and studied the A27 viral protein involvement in the interaction with SP-D. Interaction between SP-D and VACV caused viral inhibition in a lung cell model. Interaction of SP-D with VACV was mediated by the A27 viral protein. Binding required Ca2+ and interactions were blocked in the presence of excess of SP-D saccharide ligands. A27, which lacks glycosylation, directly interacted with SP-D. The interaction between SP-D and the viral particle was also observed using electron microscopy. Infection of mice lacking SP-D (SP-D-/- resulted in increased mortality compared to SP-D+/+ mice. Altogether, our data show that SP-D participates in host defense against the vaccinia virus infection and that the interaction occurs with the viral surface protein A27.

  19. Safety and biodistribution of a double-deleted oncolytic vaccinia virus encoding CD40 ligand in laboratory Beagles

    Directory of Open Access Journals (Sweden)

    Karoliina Autio

    2014-01-01

    Full Text Available We evaluated adverse events, biodistribution and shedding of oncolytic vaccinia virus encoding CD40 ligand in two Beagles, in preparation for a phase 1 trial in canine cancer patients. Dog 1 received one dose of vaccinia virus and was euthanized 24 hours afterwards, while dog 2 received virus four times once weekly and was euthanized 7 days after that. Dogs were monitored for adverse events and underwent a detailed postmortem examination. Blood, saliva, urine, feces, and organs were collected for virus detection. Dog 1 had mild fever and lethargy while dog 2 experienced a possible seizure 5.5 hours after first virus administration. Viral DNA declined quickly in the blood after virus administration in both dogs but was still detectable 1 week later by quantitative polymerase chain reaction. Only samples taken directly after virus infusion contained infectious virus. Small amounts of viral DNA, but no infectious virus, were detected in a few saliva and urine samples. Necropsies did not reveal any relevant pathological changes and virus DNA was detected mainly in the spleen. The dogs in the study did not have cancer, and thus adverse events could be more common and viral load higher in dogs with tumors which allow viral amplification.

  20. Vaccinia Virus Protein F12 Associates with Intracellular Enveloped Virions through an Interaction with A36▿

    Science.gov (United States)

    Johnston, Sara C.; Ward, Brian M.

    2009-01-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress. PMID:19052096

  1. Expression of DAI by an oncolytic vaccinia virus boosts the immunogenicity of the virus and enhances antitumor immunity

    Directory of Open Access Journals (Sweden)

    Mari Hirvinen

    2016-01-01

    Full Text Available In oncolytic virotherapy, the ability of the virus to activate the immune system is a key attribute with regard to long-term antitumor effects. Vaccinia viruses bear one of the strongest oncolytic activities among all oncolytic viruses. However, its capacity for stimulation of antitumor immunity is not optimal, mainly due to its immunosuppressive nature. To overcome this problem, we developed an oncolytic VV that expresses intracellular pattern recognition receptor DNA-dependent activator of IFN-regulatory factors (DAI to boost the innate immune system and to activate adaptive immune cells in the tumor. We showed that infection with DAI-expressing VV increases expression of several genes related to important immunological pathways. Treatment with DAI-armed VV resulted in significant reduction in the size of syngeneic melanoma tumors in mice. When the mice were rechallenged with the same tumor, DAI-VV-treated mice completely rejected growth of the new tumor, which indicates immunity established against the tumor. We also showed enhanced control of growth of human melanoma tumors and elevated levels of human T-cells in DAI-VV-treated mice humanized with human peripheral blood mononuclear cells. We conclude that expression of DAI by an oncolytic VV is a promising way to amplify the vaccine potency of an oncolytic vaccinia virus to trigger the innate—and eventually the long-lasting adaptive immunity against cancer.

  2. Biophysical analysis of bacterial and viral systems. A shock tube study of bio-aerosols and a correlated AFM/nanosims investigation of vaccinia virus

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Sean Damien [Stanford Univ., CA (United States)

    2013-05-01

    The work presented herein is concerned with the development of biophysical methodology designed to address pertinent questions regarding the behavior and structure of select pathogenic agents. Two distinct studies are documented: a shock tube analysis of endospore-laden bio-aerosols and a correlated AFM/NanoSIMS study of the structure of vaccinia virus.

  3. Molecular network, pathway, and functional analysis of time-dependent gene changes associated with pancreatic cancer susceptibility to oncolytic vaccinia virotherapy

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2016-01-01

    Conclusions: Our study reveals the ability to assess time-dependent changes in gene expression patterns in pancreatic cancer cells associated with infection and susceptibility to vaccinia viruses. This suggests that molecular assays may be useful to develop safer and more efficacious oncolyticvirotherapies and support the idea that these treatments may target pathways implicated in pancreatic cancer resistance to conventional therapies.

  4. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes.

    Science.gov (United States)

    Bourquain, Daniel; Dabrowski, Piotr Wojtek; Nitsche, Andreas

    2013-02-20

    Animal-borne orthopoxviruses, like monkeypox, vaccinia and the closely related cowpox virus, are all capable of causing zoonotic infections in humans, representing a potential threat to human health. The disease caused by each virus differs in terms of symptoms and severity, but little is yet know about the reasons for these varying phenotypes. They may be explained by the unique repertoire of immune and host cell modulating factors encoded by each virus. In this study, we analysed the specific modulation of the host cell's gene expression profile by cowpox, monkeypox and vaccinia virus infection. We aimed to identify mechanisms that are either common to orthopoxvirus infection or specific to certain orthopoxvirus species, allowing a more detailed description of differences in virus-host cell interactions between individual orthopoxviruses. To this end, we analysed changes in host cell gene expression of HeLa cells in response to infection with cowpox, monkeypox and vaccinia virus, using whole-genome gene expression microarrays, and compared these to each other and to non-infected cells. Despite a dominating non-responsiveness of cellular transcription towards orthopoxvirus infection, we could identify several clusters of infection-modulated genes. These clusters are either commonly regulated by orthopoxvirus infection or are uniquely regulated by infection with a specific orthopoxvirus, with major differences being observed in immune response genes. Most noticeable was an induction of genes involved in leukocyte migration and activation in cowpox and monkeypox virus-infected cells, which was not observed following vaccinia virus infection. Despite their close genetic relationship, the expression profiles induced by infection with different orthopoxviruses vary significantly. It may be speculated that these differences at the cellular level contribute to the individual characteristics of cowpox, monkeypox and vaccinia virus infections in certain host species.

  5. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis.

    Directory of Open Access Journals (Sweden)

    Don B Gammon

    2010-07-01

    Full Text Available Ribonucleotide reductases (RRs are evolutionarily-conserved enzymes that catalyze the rate-limiting step during dNTP synthesis in mammals. RR consists of both large (R1 and small (R2 subunits, which are both required for catalysis by the R1(2R2(2 heterotetrameric complex. Poxviruses also encode RR proteins, but while the Orthopoxviruses infecting humans [e.g. vaccinia (VACV, variola, cowpox, and monkeypox viruses] encode both R1 and R2 subunits, the vast majority of Chordopoxviruses encode only R2 subunits. Using plaque morphology, growth curve, and mouse model studies, we investigated the requirement of VACV R1 (I4 and R2 (F4 subunits for replication and pathogenesis using a panel of mutant viruses in which one or more viral RR genes had been inactivated. Surprisingly, VACV F4, but not I4, was required for efficient replication in culture and virulence in mice. The growth defects of VACV strains lacking F4 could be complemented by genes encoding other Chordopoxvirus R2 subunits, suggesting conservation of function between poxvirus R2 proteins. Expression of F4 proteins encoding a point mutation predicted to inactivate RR activity but still allow for interaction with R1 subunits, caused a dominant negative phenotype in growth experiments in the presence or absence of I4. Co-immunoprecipitation studies showed that F4 (as well as other Chordopoxvirus R2 subunits form hybrid complexes with cellular R1 subunits. Mutant F4 proteins that are unable to interact with host R1 subunits failed to rescue the replication defect of strains lacking F4, suggesting that F4-host R1 complex formation is critical for VACV replication. Our results suggest that poxvirus R2 subunits form functional complexes with host R1 subunits to provide sufficient dNTPs for viral replication. Our results also suggest that R2-deficient poxviruses may be selective oncolytic agents and our bioinformatic analyses provide insights into how poxvirus nucleotide metabolism proteins may

  6. Reactions of Cre with methylphosphonate DNA: similarities and contrasts with Flp and vaccinia topoisomerase.

    Directory of Open Access Journals (Sweden)

    Chien-Hui Ma

    2009-09-01

    Full Text Available Reactions of vaccinia topoisomerase and the tyrosine site-specific recombinase Flp with methylphosphonate (MeP substituted DNA substrates, have provided important insights into the electrostatic features of the strand cleavage and strand joining steps catalyzed by them. A conserved arginine residue in the catalytic pentad, Arg-223 in topoisomerase and Arg-308 in Flp, is not essential for stabilizing the MeP transition state. Topoisomerase or its R223A variant promotes cleavage of the MeP bond by the active site nucleophile Tyr-274, followed by the rapid hydrolysis of the MeP-tyrosyl intermediate. Flp(R308A, but not wild type Flp, mediates direct hydrolysis of the activated MeP bond. These findings are consistent with a potential role for phosphate electrostatics and active site electrostatics in protecting DNA relaxation and site-specific recombination, respectively, against abortive hydrolysis.We have examined the effects of DNA containing MeP substitution in the Flp related Cre recombination system. Neutralizing the negative charge at the scissile position does not render the tyrosyl intermediate formed by Cre susceptible to rapid hydrolysis. Furthermore, combining the active site R292A mutation in Cre (equivalent to the R223A and R308A mutations in topoisomerase and Flp, respectively with MeP substitution does not lead to direct hydrolysis of the scissile MeP bond in DNA. Whereas Cre follows the topoisomerase paradigm during the strand cleavage step, it follows the Flp paradigm during the strand joining step.Collectively, the Cre, Flp and topoisomerase results highlight the contribution of conserved electrostatic complementarity between substrate and active site towards transition state stabilization during site-specific recombination and DNA relaxation. They have potential implications for how transesterification reactions in nucleic acids are protected against undesirable abortive side reactions. Such protective mechanisms are significant

  7. Fluid dynamic bowtie attenuators

    Science.gov (United States)

    Szczykutowicz, Timothy P.; Hermus, James

    2015-03-01

    Fluence field modulated CT allows for improvements in image quality and dose reduction. To date, only 1-D modulators have been proposed, the extension to 2-D modulation is difficult with solid-metal attenuation-based modulators. This work proposes to use liquids and gas to attenuate the x-ray beam which can be arrayed allowing for 2-D fluence modulation. The thickness of liquid and the pressure for a given path length of gas were determined that provided the same attenuation as 30 cm of soft tissue at 80, 100, 120, and 140 kV. Gaseous Xenon and liquid Iodine, Zinc Chloride, and Cerium Chloride were studied. Additionally, we performed some proof-of-concept experiments in which (1) a single cell of liquid was connected to a reservoir which allowed the liquid thickness to be modulated and (2) a 96 cell array was constructed in which the liquid thickness in each cell was adjusted manually. Liquid thickness varied as a function of kV and chemical composition, with Zinc Chloride allowing for the smallest thickness; 1.8, 2.25, 3, and 3.6 cm compensated for 30 cm of soft tissue at 80, 100, 120, and 140 kV respectively. The 96 cell Iodine attenuator allowed for a reduction in both dynamic range to the detector and scatter to primary ratio. Successful modulation of a single cell was performed at 0, 90, and 130 degrees using a simple piston/actuator. The thickness of liquids and the Xenon gas pressure seem logistically implementable within the constraints of CBCT and diagnostic CT systems.

  8. Elevated High-Sensitivity C-Reactive Protein as a Risk Marker of the Attenuated Relationship Between Serum Cholesterol and Cardiovascular Events at Older Age

    Science.gov (United States)

    Whelton, Seamus P.; Roy, Probal; Astor, Brad C.; Zhang, Lin; Hoogeveen, Ron C.; Ballantyne, Christie M.; Coresh, Josef

    2013-01-01

    The relationship between cholesterol and coronary heart disease (CHD) is attenuated at older age. We analyzed cholesterol level as a predictor of CHD in 8,947 participants from the Atherosclerosis Risk in Communities (ARIC) Study, a large multicenter cohort study that enrolled participants in 1987–1989 at 4 field centers in Washington County, Maryland; Forsyth County, North Carolina; Jackson, Mississippi; and Minneapolis, Minnesota. Participants in the present analysis had no history of CHD and were stratified by age (Cholesterol level was significantly associated with CHD among younger participants, and cholesterol level was similarly predictive of CHD among older participants with an hs-CRP level of cholesterol level was borderline significant (hazard ratio = 1.14, 95% confidence interval: 1.00, 1.29), and the association of CHD with low-density lipoprotein cholesterol level was nonsignificant (hazard ratio = 1.10; 95% confidence interval: 0.96, 1.26). Among older persons with an elevated hs-CRP level, cholesterol level was significantly less predictive of CHD (P cholesterol level with CHD was strong when hs-CRP level was not elevated and weak when hs-CRP level was elevated. Therefore, hs-CRP level could be useful for stratifying the young-old to assess the strength of cholesterol level in CHD risk prediction. PMID:24026395

  9. Interactions between