DEFF Research Database (Denmark)
Kokotovic, Branko; On, Stephen L.W.
1999-01-01
A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...
Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel
2011-01-01
A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014
Amplifier channel for a fission fragment semiconductor detector
International Nuclear Information System (INIS)
Tyurin, G.P.
1981-01-01
To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C
2018-01-01
Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.
[Recent advances of amplified fragment length polymorphism and its applications in forensic botany].
Li, Cheng-Tao; Li, Li
2008-10-01
Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.
Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.
Low-Power Amplifier-Discriminators for High Time Resolution Detection
Despeisse, M; Anghinolfi, F; Tiuraniemi, S; Osmic, F; Riedler, P; Kluge, A; Ceccucci, A
2009-01-01
Low-power amplifier-discriminators based on a so-called NINO architecture have been developed with high time resolution for the readout of radiation detectors. Two different circuits were integrated in the NINO13 chip, processed in IBM 130 nm CMOS technology. The LCO version (Low Capacitance and consumption Optimization) was designed for potential use as front-end electronics in the Gigatracker of the NA62 experiment at CERN. It was developed as pixel readout for solid-state pixel detectors to permit minimum ionizing particle detection with less than 180 ps rms resolution per pixel on the output pulse, for power consumption below 300 mu W per pixel. The HCO version (High Capacitance Optimization) was designed with 4 mW power consumption per channel to provide timing resolution below 20 ps rms on the output pulse, for charges above 10 fC. Results presented show the potential of the LCO and HCO circuits for the precise timing readout of solid-state detectors, vacuum tubes or gas detectors, for applications in h...
Population structure of Salmonella investigated by amplified fragment length polymorphism
DEFF Research Database (Denmark)
Torpdahl, M.; Ahrens, Peter
2004-01-01
Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping
DEFF Research Database (Denmark)
Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir
2008-01-01
A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...
March, Raymond E.; Miao, Xiu-Sheng
2004-02-01
A mass spectrometric method based on the combined use of electrospray ionization, collision-induced dissociation and tandem mass spectrometry at high mass resolution has been applied to an investigation of the structural characterization of protonated and deprotonated kaempferol (3,5,7,4'-tetrahydroxyflavone). Low-energy product ion mass spectra of [M+H]+ ions showed simple fragmentations of the C ring that permitted characterization of the substituents in the A and B rings. In addition, four rearrangement reactions accompanied by losses of C2H2O, CHO[radical sign], CO, and H2O were observed. Low-energy product ion mass spectra of [M-H]- ions showed only four rearrangement reactions accompanied by losses of OH[radical sign], CO, CH2O, and C2H2O. The use of elevated cone voltages permitted observation of product ion mass spectra of selected primary and secondary fragment ions so that each fragment ion reported was observed as a direct product of its immediate precursor ion. Product ion mass spectra examined at high mass resolution allowed unambiguous determination of the elemental composition of fragment ions and resolution of two pairs of isobars. Fragmentation mechanisms and ion structures have been proposed.
EROIC: a BiCMOS pseudo-gaussian shaping amplifier for high-resolution X-ray spectroscopy
Buzzetti, Siro; Guazzoni, Chiara; Longoni, Antonio
2003-10-01
We present the design and complete characterization of a fifth-order pseudo-gaussian shaping amplifier with 1 μs shaping time. The circuit is optimized for the read-out of signals coming from Silicon Drift Detectors for high-resolution X-ray spectroscopy. The novelty of the designed chip stands in the use of a current feedback loop to place the poles in the desired position on the s-plane. The amplifier has been designed in 0.8 μm BiCMOS technology and fully tested. The EROIC chip comprises also the peak stretcher, the peak detector, the output buffer to drive the external ADC and the pile-up rejection system. The circuit needs a single +5 V power supply and the dissipated power is 5 mW per channel. The digital outputs can be directly coupled to standard digital CMOS ICs. The measured integral-non-linearity of the whole chip is below 0.05% and the achieved energy resolution at the Mn Kα line detected by a 5 mm 2 Peltier-cooled Silicon Drift Detector is 167 eV FWHM.
EROIC: a BiCMOS pseudo-gaussian shaping amplifier for high-resolution X-ray spectroscopy
International Nuclear Information System (INIS)
Buzzetti, Siro; Guazzoni, Chiara; Longoni, Antonio
2003-01-01
We present the design and complete characterization of a fifth-order pseudo-gaussian shaping amplifier with 1 μs shaping time. The circuit is optimized for the read-out of signals coming from Silicon Drift Detectors for high-resolution X-ray spectroscopy. The novelty of the designed chip stands in the use of a current feedback loop to place the poles in the desired position on the s-plane. The amplifier has been designed in 0.8 μm BiCMOS technology and fully tested. The EROIC chip comprises also the peak stretcher, the peak detector, the output buffer to drive the external ADC and the pile-up rejection system. The circuit needs a single +5 V power supply and the dissipated power is 5 mW per channel. The digital outputs can be directly coupled to standard digital CMOS ICs. The measured integral-non-linearity of the whole chip is below 0.05% and the achieved energy resolution at the Mn Kα line detected by a 5 mm 2 Peltier-cooled Silicon Drift Detector is 167 eV FWHM
DEFF Research Database (Denmark)
Møller, Kristian; Jensen, Tim Kåre; Boye, Mette
1999-01-01
Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa
2010-01-01
Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.
Porter, R F; Kumar, N; Drapekin, J E; Gyawali, C P
2012-08-01
Esophageal peristalsis consists of a chain of contracting striated and smooth muscle segments on high resolution manometry (HRM). We compared smooth muscle contraction segments in symptomatic subjects with reflux disease to healthy controls. High resolution manometry Clouse plots were analyzed in 110 subjects with reflux disease (50 ± 1.4 years, 51.5% women) and 15 controls (27 ± 2.1 years, 60.0% women). Using the 30 mmHg isobaric contour tool, sequences were designated fragmented if either smooth muscle contraction segment was absent or if the two smooth muscle segments were separated by a pressure trough, and failed if both smooth muscle contraction segments were absent. The discriminative value of contraction segment analysis was assessed. A total of 1115 swallows were analyzed (reflux group: 965, controls: 150). Reflux subjects had lower peak and averaged contraction amplitudes compared with controls (P value to HRM analysis. Specifically, fragmented smooth muscle contraction segments may be a marker of esophageal hypomotility. © 2012 Blackwell Publishing Ltd.
DEFF Research Database (Denmark)
Kokotovic, Branko; Angen, Øystein
2007-01-01
Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...
Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui
2017-01-01
Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.
Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P
2008-07-22
Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.
Gamma Radiation from Fission Fragments Experimental Apparatus-Mass Spectrum Resolution
Energy Technology Data Exchange (ETDEWEB)
Higbie, Jack
1969-08-15
The gamma-radiation from fission fragments was studied as a function of the fragment mass. The mass was determined from the fragment energies using solid state detectors. The mass resolution which can be achieved by this method is treated in detail. The average initial fragment mass and the initial mass resolution is calculated as a function of the measured (apparent) mass yield for three different thicknesses of the fissile material deposit. This treatment gives a clear indication of those factors most important for good mass resolution work. A detailed description of the experimental apparatus is given in the appendices.
Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...
DEFF Research Database (Denmark)
On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.
2004-01-01
Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
DEFF Research Database (Denmark)
Kokotovic, Branko; Bolske, G.; Ahrens, Peter
2000-01-01
The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...
Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.
1999-01-01
The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
High resolution analysis of tropical forest fragmentation and its impact on the global carbon cycle
Brinck, Katharina; Fischer, Rico; Groeneveld, Jürgen; Lehmann, Sebastian; Dantas de Paula, Mateus; Pütz, Sandro; Sexton, Joseph O.; Song, Danxia; Huth, Andreas
2017-03-01
Deforestation in the tropics is not only responsible for direct carbon emissions but also extends the forest edge wherein trees suffer increased mortality. Here we combine high-resolution (30 m) satellite maps of forest cover with estimates of the edge effect and show that 19% of the remaining area of tropical forests lies within 100 m of a forest edge. The tropics house around 50 million forest fragments and the length of the world's tropical forest edges sums to nearly 50 million km. Edge effects in tropical forests have caused an additional 10.3 Gt (2.1-14.4 Gt) of carbon emissions, which translates into 0.34 Gt per year and represents 31% of the currently estimated annual carbon releases due to tropical deforestation. Fragmentation substantially augments carbon emissions from tropical forests and must be taken into account when analysing the role of vegetation in the global carbon cycle.
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
Elsheikha, H M; Schott, H C; Mansfield, L S
2006-06-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.
Kaufmann, Anton; Butcher, Patrick; Maden, Kathry; Walker, Stephan; Widmer, Mirjam
2017-07-15
A screening concept for residues in complex matrices based on liquid chromatography coupled to ion mobility high-resolution mass spectrometry LC/IMS-HRMS is presented. The comprehensive four-dimensional data (chromatographic retention time, drift time, mass-to-charge and ion abundance) obtained in data-independent acquisition (DIA) mode was used for data mining. An in silico fragmenter utilizing a molecular structure database was used for suspect screening, instead of targeted screening with reference substances. The utilized data-independent acquisition mode relies on the MS E concept; where two constantly alternating HRMS scans (low and high fragmentation energy) are acquired. Peak deconvolution and drift time alignment of ions from the low (precursor ion) and high (product ion) energy scan result in relatively clean product ion spectra. A bond dissociation in silico fragmenter (MassFragment) supplied with mol files of compounds of interest was used to explain the observed product ions of each extracted candidate component (chromatographic peak). Two complex matrices (fish and bovine liver extract) were fortified with 98 veterinary drugs. Out of 98 screened compounds 94 could be detected with the in silico based screening approach. The high correlation among drift time and m/z value of equally charged ions was utilized for an orthogonal filtration (ranking). Such an orthogonal ion mobility based filter removes multiply charged ions (e.g. peptides and proteins from the matrix) as well as noise and artefacts. Most significantly, this filtration dramatically reduces false positive findings but hardly increases false negative findings. The proposed screening approach may offer new possibilities for applications where reference compounds are hardly or not at all commercially available. Such areas may be the analysis of metabolites of drugs, pyrrolizidine alkaloids, marine toxins, derivatives of sildenafil or novel designer drugs (new psychoactive substances
DEFF Research Database (Denmark)
Fearnley, C.; On, S.L.W.; Kokotovic, Branko
2005-01-01
An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...
K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale
1994-01-01
A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...
HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS
International Nuclear Information System (INIS)
2005-01-01
Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department
Amplifier for nuclear spectrometry
International Nuclear Information System (INIS)
Suarez Canner, E.
1996-01-01
The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system
DEFF Research Database (Denmark)
Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe
2005-01-01
subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
A high resolution portable spectroscopy system
International Nuclear Information System (INIS)
Kulkarni, C.P.; Vaidya, P.P.; Paulson, M.; Bhatnagar, P.V.; Pande, S.S.; Padmini, S.
2003-01-01
Full text: This paper describes the system details of a High Resolution Portable Spectroscopy System (HRPSS) developed at Electronics Division, BARC. The system can be used for laboratory class, high-resolution nuclear spectroscopy applications. The HRPSS consists of a specially designed compact NIM bin, with built-in power supplies, accommodating a low power, high resolution MCA, and on-board embedded computer for spectrum building and communication. A NIM based spectroscopy amplifier and a HV module for detector bias are integrated (plug-in) in the bin. The system communicates with a host PC via a serial link. Along-with a laptop PC, and a portable HP-Ge detector, the HRPSS offers a laboratory class performance for portable applications
García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A
2012-05-01
Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Aviv Lutaty
2018-03-01
Full Text Available During the resolution of inflammation, macrophages engulf apoptotic polymorphonuclear cells (PMN and can accumulate large numbers of their corpses. Here, we report that resolution phase macrophages acquire the neutrophil-derived glycoprotein lactoferrin (Lf and fragments thereof in vivo and ex vivo. During the onset and resolving phases of inflammation in murine peritonitis and bovine mastitis, Lf fragments of 15 and 17 kDa occurred in various body fluids, and the murine fragmentation, accumulation, and release were mediated initially by neutrophils and later by efferocytic macrophages. The 17-kDa fragment contained two bioactive tripeptides, FKD and FKE that promoted resolution phase macrophage conversion to a pro-resolving phenotype. This resulted in a reduction in peritoneal macrophage numbers and an increase in the CD11blow subset of these cells. Moreover, FKE, but not FKD, peptides enhanced efferocytosis of apoptotic PMN, reduced TNFα and interleukin (IL-6, and increased IL-10 secretion by lipopolysaccharide-stimulated macrophages ex vivo. In addition, FKE promoted neutrophil-mediated resolution at high concentrations (100 µM by enhancing the formation of cytokine-scavenging aggregated NETs (tophi at a low cellular density. Thus, PMN Lf is processed, acquired, and “recycled” by neutrophils and macrophages during inflammation resolution to generate fragments and peptides with paramount pro-resolving activities.
Ren, Xueguang; Pflüger, Thomas; Weyland, Marvin; Baek, Woon Yoon; Rabus, Hans; Ullrich, Joachim; Dorn, Alexander
2014-10-01
We study the low-energy (E0 = 26 eV) electron-impact induced ionization and fragmentation of tetrahydrofuran using a reaction microscope. All three final-state charged particles, i.e., two outgoing electrons and one fragment ion, are detected in triple coincidence such that the momentum vectors and, consequently, the kinetic energies for charged reaction products are determined. The ionic fragments are clearly identified in the experiment with a mass resolution of 1 amu. The fragmentation pathways of tetrahydrofuran are investigated by measuring the ion kinetic energy spectra and the binding energy spectra where an energy resolution of 1.5 eV has been achieved using the recently developed photoemission electron source. Here, we will discuss the fragmentation reactions for the cations C4H8O+, C4H7O+, C2H3O+, C3H_6^+, C3H_5^+, C3H_3^+, CH3O+, CHO+, and C2H_3^+.
Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F
2016-06-01
To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine
Energy Technology Data Exchange (ETDEWEB)
Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)
2012-09-15
Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.
Carminati, M.; Gervasoni, G.; Sampietro, M.; Ferrari, G.
2016-02-01
The resolution of digital lock-in amplifiers working with a narrow bandwidth (automatic tuning of dummy references, allowing a 25-fold resolution improvement for enhanced long-term tracking of impedance sensors.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Directory of Open Access Journals (Sweden)
Yuming Lu
Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Johnsen, G; Kruse, H; Hofshagen, M
2006-12-01
We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional
Megawatt dye laser oscillator-amplifier system for high resolution spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Drell, P; Chu, S
1979-03-01
Peak powers in excess of 4 MW in the visible and 1.3 MW in the uv with linewidths as narrow as 80 MHz are generated with three YAG pumped amplifier stages following a cw dye oscillator. The laser pulses are nearly Fourier transform limited in frequency space and diffraction limited in coordinate space.
DEFF Research Database (Denmark)
Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko
2006-01-01
In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Ahrens, Peter
2002-01-01
, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...
Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan
2016-01-01
Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
Experimental and numerical studies of high-velocity impact fragmentation
Energy Technology Data Exchange (ETDEWEB)
Kipp, M.E.; Grady, D.E.; Swegle, J.W.
1993-08-01
Developments are reported in both experimental and numerical capabilities for characterizing the debris spray produced in penetration events. We have performed a series of high-velocity experiments specifically designed to examine the fragmentation of the projectile during impact. High-strength, well-characterized steel spheres (6.35 mm diameter) were launched with a two-stage light-gas gun to velocities in the range of 3 to 5 km/s. Normal impact with PMMA plates, thicknesses of 0.6 to 11 mm, applied impulsive loads of various amplitudes and durations to the steel sphere. Multiple flash radiography diagnostics and recovery techniques were used to assess size, velocity, trajectory and statistics of the impact-induced fragment debris. Damage modes to the primary target plate (plastic) and to a secondary target plate (aluminum) were also evaluated. Dynamic fragmentation theories, based on energy-balance principles, were used to evaluate local material deformation and fracture state information from CTH, a three-dimensional Eulerian solid dynamics shock wave propagation code. The local fragment characterization of the material defines a weighted fragment size distribution, and the sum of these distributions provides a composite particle size distribution for the steel sphere. The calculated axial and radial velocity changes agree well with experimental data, and the calculated fragment sizes are in qualitative agreement with the radiographic data. A secondary effort involved the experimental and computational analyses of normal and oblique copper ball impacts on steel target plates. High-resolution radiography and witness plate diagnostics provided impact motion and statistical fragment size data. CTH simulations were performed to test computational models and numerical methods.
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.
2002-01-01
Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...
Energy Technology Data Exchange (ETDEWEB)
Jeon, J. Y.; Kim, J. H.; Park, J. M.; Yang, J. Y.; Kim, K. Y.; Kim, Y. S. [RadTek Co., Daejeon (Korea, Republic of)
2010-06-15
- Design of discrete type charge sensitive amplifier for high resolution semi-conductor sensor - Design and develop the test board for the performance of charge sensitive amplifier with sensor - Performance of electrical test for the sensor and charge sensitive amplifier - Development of prototype 8 x 8 array type detector module - Noise equivalent charge test for the charge sensitive amplifier - Design and development of Micro SMD discrete type amplifier applying ASIC procedure - Development of Hybrid type charge sensitive amplifier including shape
Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.
Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F
2003-07-01
ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.
Gallart-Ayala, H; Courant, F; Severe, S; Antignac, J-P; Morio, F; Abadie, J; Le Bizec, B
2013-09-24
Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC-HRMS or LC-MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC-HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and "all ion fragmentation" (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale. Copyright © 2013 Elsevier B.V. All rights reserved.
Analog circuit design designing high performance amplifiers
Feucht, Dennis
2010-01-01
The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.
Class D audio amplifiers for high voltage capacitive transducers
DEFF Research Database (Denmark)
Nielsen, Dennis
of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...
International Nuclear Information System (INIS)
Gallart-Ayala, H.; Courant, F.; Severe, S.; Antignac, J.-P.; Morio, F.; Abadie, J.; Le Bizec, B.
2013-01-01
Graphical abstract: -- Highlights: •Lipidomics, high resolution mass spectrometry, polarity switching, serum, canine mammary cancer. -- Abstract: Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC–HRMS or LC–MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC–HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and “all ion fragmentation” (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale
Energy Technology Data Exchange (ETDEWEB)
Gallart-Ayala, H., E-mail: laberca@oniris-nantes.fr [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France); Courant, F.; Severe, S.; Antignac, J.-P. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France); Morio, F.; Abadie, J. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), Cancers Animaux, Modèles pour la Recherche en Oncologie Comparée (AMaROC), Site de la Chantrerie–CS50707, 44307 Nantes cedex 3 (France); Le Bizec, B. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France)
2013-09-24
Graphical abstract: -- Highlights: •Lipidomics, high resolution mass spectrometry, polarity switching, serum, canine mammary cancer. -- Abstract: Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC–HRMS or LC–MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC–HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and “all ion fragmentation” (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale.
Directory of Open Access Journals (Sweden)
Kotoka Masuyama
Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.
International Nuclear Information System (INIS)
Charon, Y.; Cuzon, J.C.; Tricoire, H.; Valentin, L.
1987-01-01
We present a detector which associates a charge coupled device to a light amplifier. This image sensor must detect weak β-activity, with a 10 μm resolution and should replace the autoradiographic films used for molecular hybridization. The best results are obtained with the 35 S emittor, for which the resolution and the efficiency are respectively 20 μm and 100% (relative to the measured standard source)
Brouat, C; McKey, D; Douzery, E J P
2004-05-01
Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.
Series-Tuned High Efficiency RF-Power Amplifiers
DEFF Research Database (Denmark)
Vidkjær, Jens
2008-01-01
An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits.......An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits....
International Nuclear Information System (INIS)
Drndarevic, V.; Ryge, P.; Gozani, T.
1989-01-01
An amplifier with trapezoidal pulse shaping was developed for high-rate high-energy gamma spectroscopy using NaI(T1) scintillation detectors. It employs a double delay-line technique for producing a nearly triangular pulse shape combined with a linear circuit for producing a flattopped pulse. Good energy resolution and short resolving time make this amplifier especially suitable for high count rate gamma ray spectroscopy. To provide a versatile high-performance system, it includes a pileup rejector based on inspection of a pileup signal obtained by combining the slow output signal and fast-shaped input signal. The trapezoidal shape provides a short resolving time for minimal occurrence of pileup with a width suitable for presentation to a standard multichannel analyzer. The performance of the system was tested, and the results are presented
International Nuclear Information System (INIS)
Knuepfer, W.; Frey, R.; Richter, A.; Schwierczinski, A.; Spamer, E.; Titze, O.
1977-12-01
High-resolution inelastic electron scattering (FWHM approximately equal to 33 keV) with 50 MeV and 63.5 MeV electrons on 208 Pb has been used to study magnetic excitations between Esub(x) = 6 MeV and 8 MeV. Angular distributions were analyzed in terms of the DWBA with RPA wave functions. Eight Isup(π) = 2- states carrying a total strength ΣB(M2) = 8500 μ 2 sub(K) fm 2 have been found. The strong fragmentation is in qualitative agreement with theoretical predictions. (orig.) [de
Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W
1999-09-01
Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.
Automated data processing of high-resolution mass spectra
DEFF Research Database (Denmark)
Hansen, Michael Adsetts Edberg; Smedsgaard, Jørn
of the massive amounts of data. We present an automated data processing method to quantitatively compare large numbers of spectra from the analysis of complex mixtures, exploiting the full quality of high-resolution mass spectra. By projecting all detected ions - within defined intervals on both the time...... infusion of crude extracts into the source taking advantage of the high sensitivity, high mass resolution and accuracy and the limited fragmentation. Unfortunately, there has not been a comparable development in the data processing techniques to fully exploit gain in high resolution and accuracy...... infusion analyses of crude extract to find the relationship between species from several species terverticillate Penicillium, and also that the ions responsible for the segregation can be identified. Furthermore the process can automate the process of detecting unique species and unique metabolites....
Amplified spontaneous emissions in a high-gain laser amplifier
International Nuclear Information System (INIS)
Osada, Hidenori; Gamo, Hideya.
1978-01-01
The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)
Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru
2017-01-01
Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096
Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.
2006-01-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...
The design of high performance weak current integrated amplifier
International Nuclear Information System (INIS)
Chen Guojie; Cao Hui
2005-01-01
A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)
Multi-Channel Amplifier-Discriminator for Highly Time-Resolved Detection
Despeisse, M; Lapington, J; Jarron, P
2011-01-01
A low-power multi-channel amplifier-discriminator was developed for application in highly time-resolved detection systems. The proposed circuit architecture, so-called Nino, is based on a time-over-threshold approach and shows a high potential for time-resolved readout of solid-state photo-detectors and of detectors based on vacuum technologies. The Irpics circuit was designed in a 250 nm CMOS technology, implementing 32 channels of a Nino version optimized to achieve high-time resolution on the output low-voltage differential signals (LVDS) while keeping a low power consumption of 10 mW per channel. Electrical characterizations of the circuit demonstrate a very low intrinsic time jitter on the output pulse leading edge, measured below 10 ps rms for each channel for high input signal charges (100 fC) and below 25 ps rms for low input signal charges (20-100 fC). The read-out architecture moreover permits to retrieve the input signal charge from the timing measurements, while a calibration procedure was develop...
TARC: Carlo Rubbia's Energy Amplifier
Laurent Guiraud
1997-01-01
Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.
DEFF Research Database (Denmark)
Fry, N K; Bangsborg, Jette Marie; Bernander, S
2000-01-01
The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...
International Nuclear Information System (INIS)
Tjutju, R.L.
1977-01-01
Pulse amplifier is standard significant part of spectrometer. Apart from other type of amplification, it's a combination of amplification and pulse shaping. Because of its special purpose the device should fulfill the following : High resolution is desired to gain a high yield comparable to its actual state of condition. High signal to noise is desired to nhν resolution. High linearity to facilitate calibration. A good overload recovery, in order to the device will capable of analizing a low energy radiation which appear joinly on the high energy fields. Other expections of the device are its economical and practical use its extentive application. For that reason it's built on a standard NIM principle. Taking also into account the above mentioned considerations. High quality component parts are used throughout, while its availability in the domestic market is secured. (author)
Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.
2002-01-01
The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...
A high-power two stage traveling-wave tube amplifier
International Nuclear Information System (INIS)
Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.
1991-01-01
Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length
International Nuclear Information System (INIS)
Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.
2012-12-01
Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number
Extension of least squares spectral resolution algorithm to high-resolution lipidomics data
Energy Technology Data Exchange (ETDEWEB)
Zeng, Ying-Xu [Department of Chemistry, University of Bergen, PO Box 7803, N-5020 Bergen (Norway); Mjøs, Svein Are, E-mail: svein.mjos@kj.uib.no [Department of Chemistry, University of Bergen, PO Box 7803, N-5020 Bergen (Norway); David, Fabrice P.A. [Bioinformatics and Biostatistics Core Facility, School of Life Sciences, Ecole Polytechnique Fédérale de Lausanne (EPFL) and Swiss Institute of Bioinformatics (SIB), Lausanne (Switzerland); Schmid, Adrien W. [Proteomics Core Facility, Ecole Polytechnique Fédérale de Lausanne (EPFL), 1015 Lausanne (Switzerland)
2016-03-31
Lipidomics, which focuses on the global study of molecular lipids in biological systems, has been driven tremendously by technical advances in mass spectrometry (MS) instrumentation, particularly high-resolution MS. This requires powerful computational tools that handle the high-throughput lipidomics data analysis. To address this issue, a novel computational tool has been developed for the analysis of high-resolution MS data, including the data pretreatment, visualization, automated identification, deconvolution and quantification of lipid species. The algorithm features the customized generation of a lipid compound library and mass spectral library, which covers the major lipid classes such as glycerolipids, glycerophospholipids and sphingolipids. Next, the algorithm performs least squares resolution of spectra and chromatograms based on the theoretical isotope distribution of molecular ions, which enables automated identification and quantification of molecular lipid species. Currently, this methodology supports analysis of both high and low resolution MS as well as liquid chromatography-MS (LC-MS) lipidomics data. The flexibility of the methodology allows it to be expanded to support more lipid classes and more data interpretation functions, making it a promising tool in lipidomic data analysis. - Highlights: • A flexible strategy for analyzing MS and LC-MS data of lipid molecules is proposed. • Isotope distribution spectra of theoretically possible compounds were generated. • High resolution MS and LC-MS data were resolved by least squares spectral resolution. • The method proposed compounds that are likely to occur in the analyzed samples. • The proposed compounds matched results from manual interpretation of fragment spectra.
Extension of least squares spectral resolution algorithm to high-resolution lipidomics data
International Nuclear Information System (INIS)
Zeng, Ying-Xu; Mjøs, Svein Are; David, Fabrice P.A.; Schmid, Adrien W.
2016-01-01
Lipidomics, which focuses on the global study of molecular lipids in biological systems, has been driven tremendously by technical advances in mass spectrometry (MS) instrumentation, particularly high-resolution MS. This requires powerful computational tools that handle the high-throughput lipidomics data analysis. To address this issue, a novel computational tool has been developed for the analysis of high-resolution MS data, including the data pretreatment, visualization, automated identification, deconvolution and quantification of lipid species. The algorithm features the customized generation of a lipid compound library and mass spectral library, which covers the major lipid classes such as glycerolipids, glycerophospholipids and sphingolipids. Next, the algorithm performs least squares resolution of spectra and chromatograms based on the theoretical isotope distribution of molecular ions, which enables automated identification and quantification of molecular lipid species. Currently, this methodology supports analysis of both high and low resolution MS as well as liquid chromatography-MS (LC-MS) lipidomics data. The flexibility of the methodology allows it to be expanded to support more lipid classes and more data interpretation functions, making it a promising tool in lipidomic data analysis. - Highlights: • A flexible strategy for analyzing MS and LC-MS data of lipid molecules is proposed. • Isotope distribution spectra of theoretically possible compounds were generated. • High resolution MS and LC-MS data were resolved by least squares spectral resolution. • The method proposed compounds that are likely to occur in the analyzed samples. • The proposed compounds matched results from manual interpretation of fragment spectra.
Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.
This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.
International Nuclear Information System (INIS)
Meuer, D.; Frey, R.; Hoffmann, D.H.H.; Richter, A.; Spamer, E.; Titze, O.; Knuepfer, W.
1980-01-01
High-resolution (FWHM approx. 30 keV) inelastic electron scattering on 90 Zr at low momentum transfer (0.20 -1 ) has been used to study magnetic transitions at excitation energies Esub(x) = 8-10 MeV. The experimental data were analyzed in the distorted-wave Born approximation (DWBA) with wave functions calculated in the random phase approximation (RPA). Three Jsup(π) = 1 + states have been identified Esub(x) = 8.233, 9.000 and 9.371 MeV. There is some indication of further very fragmented dipole strength and the upper limit for the total M1 strength in the investigated energy region is ΣB(M1)up 2 sub(K). It is much smaller than any theoretical prediction. Furthermore, a large number of 2 - states has been observed, with the center of gravity located at Esub(x) approx. 9 MeV. These states carry a total strength of ΣB(M2)up = 1000 μ 2 sub(K) x fm 2 . Their strong fragmentation is in qualitative agreement with theoretical calculations, but the deduced strength is much smaller than theoretically predicted. In addition the distributions of spacings and radiative widths of the 2 - states are consistent with a Wigner and a Porter-Thomas distribution, respectively. (orig.)
Resistor-less charge sensitive amplifier for semiconductor detectors
Energy Technology Data Exchange (ETDEWEB)
Pelczar, K., E-mail: krzysztof.pelczar@doctoral.uj.edu.pl; Panas, K.; Zuzel, G.
2016-11-01
A new concept of a Charge Sensitive Amplifier without a high-value resistor in the feedback loop is presented. Basic spectroscopic parameters of the amplifier coupled to a coaxial High Purity Germanium detector (HPGe) are discussed. The amplifier signal input is realized with an n-channel J-FET transistor. The feedback capacitor is discharged continuously by the second, forward biased n-channel J-FET, driven by an RC low–pass filter. Both the analog—with a standard spectroscopy amplifier and a multi-channel analyzer—and the digital—by applying a Flash Analog to Digital Converter—signal readouts were tested. The achieved resolution in the analog and the digital readouts was 0.17% and 0.21%, respectively, at the Full Width at Half Maximum of the registered {sup 60}Co 1332.5 keV gamma line.
High energy high repetition-rate thin-disk amplifier for OPCPA pumping
Energy Technology Data Exchange (ETDEWEB)
Schulz, Michael
2013-08-15
The development of a pump laser system for a high power and high repetition rate optical parametric chirped-pulse amplification (OPCPA) is presented in this thesis. The OPCPA system requires pump pulse energies in the range of tens of millijoules at high repetition rates with sub-picosecond pulse durations. This can be achieved to some extend with Innoslab amplifier technology. However, scaling to higher pulse energies at high repetition rates may be problematic. With the thin-disk amplifier presented in this thesis, output energies of 140 mJ at 100 kHz repetition rate could be achieved in burst-mode operation, which is a world record for this type of laser amplifier. Due to its material and spectral properties, ytterbium doped YAG (Yb:YAG) is used as a gain medium for the high power amplifier stages. The low quantum defect and the comparatively large emission bandwidth makes this material the choice for high power operation and sub-picosecond compressed pulse durations. The output beam profile as well as the shape of the output bursts is ideal to pump an OPCPA system. An OPCPA output energy in the millijoule range with repetition rates of 100 kHz to 1 MHz is needed to generate seed pulses for the FEL and for the application as pump-probe laser at the FEL facility. Since the development of this laser system needs to meet requirements set by the Free-Electron Laser in Hamburg (FLASH), the amplifier is conceived for burst-mode operation. The main requirement is a high intra-burst pulse repetition rate of more than 100 kHz and a uniform pulse train (burst) with equal properties for every pulse. The burst-mode is an operation mode where the laser never reaches a lasing equilibrium, which means that the behavior of the amplifier is similar to a switch-on of the laser system for every burst. This makes the development of the amplifier system difficult. Therefore, an analytical model has been developed to study the amplification process during the burst. This includes the
High energy high repetition-rate thin-disk amplifier for OPCPA pumping
International Nuclear Information System (INIS)
Schulz, Michael
2013-08-01
The development of a pump laser system for a high power and high repetition rate optical parametric chirped-pulse amplification (OPCPA) is presented in this thesis. The OPCPA system requires pump pulse energies in the range of tens of millijoules at high repetition rates with sub-picosecond pulse durations. This can be achieved to some extend with Innoslab amplifier technology. However, scaling to higher pulse energies at high repetition rates may be problematic. With the thin-disk amplifier presented in this thesis, output energies of 140 mJ at 100 kHz repetition rate could be achieved in burst-mode operation, which is a world record for this type of laser amplifier. Due to its material and spectral properties, ytterbium doped YAG (Yb:YAG) is used as a gain medium for the high power amplifier stages. The low quantum defect and the comparatively large emission bandwidth makes this material the choice for high power operation and sub-picosecond compressed pulse durations. The output beam profile as well as the shape of the output bursts is ideal to pump an OPCPA system. An OPCPA output energy in the millijoule range with repetition rates of 100 kHz to 1 MHz is needed to generate seed pulses for the FEL and for the application as pump-probe laser at the FEL facility. Since the development of this laser system needs to meet requirements set by the Free-Electron Laser in Hamburg (FLASH), the amplifier is conceived for burst-mode operation. The main requirement is a high intra-burst pulse repetition rate of more than 100 kHz and a uniform pulse train (burst) with equal properties for every pulse. The burst-mode is an operation mode where the laser never reaches a lasing equilibrium, which means that the behavior of the amplifier is similar to a switch-on of the laser system for every burst. This makes the development of the amplifier system difficult. Therefore, an analytical model has been developed to study the amplification process during the burst. This includes the
Note: A high dynamic range, linear response transimpedance amplifier.
Eckel, S; Sushkov, A O; Lamoreaux, S K
2012-02-01
We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.
High resolution capacitance detection circuit for rotor micro-gyroscope
Directory of Open Access Journals (Sweden)
Ming-Yuan Ren
2014-03-01
Full Text Available Conventional methods for rotor position detection of micro-gyroscopes include common exciting electrodes (single frequency and common sensing electrodes (frequency multiplex, but they have encountered some problems. So we present a high resolution and low noise pick-off circuit for micro-gyroscopes which utilizes the time multiplex method. The detecting circuit adopts a continuous-time current sensing circuit for capacitance measurement, and its noise analysis of the charge amplifier is introduced. The equivalent output noise power spectral density of phase-sensitive demodulation is 120 nV/Hz1/2. Tests revealed that the whole circuitry has a relative capacitance resolution of 1 × 10−8.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Gyrocon: a deflection-modulated, high-power microwave amplifier
International Nuclear Information System (INIS)
Tallerico, P.J.
1977-10-01
A large-signal, relativistic theory of the electron-field interaction in a new class of microwave amplifiers is presented and applied to the analysis of a high-power, 450-MHz amplifier for accelerator applications. The analysis indicates that electronic efficiencies in excess of 90 percent are obtainable and that overall efficiencies of 90 percent are possible. The amplifier is unique in several respects; the electron velocity is perpendicular to the circuit energy flow, the device uses a fast-wave circuit, and the electron beam is deflection modulated
Optimization of a high efficiency FEL amplifier
International Nuclear Information System (INIS)
Schneidmiller, E.A.; Yurkov, M.V.
2014-10-01
The problem of an efficiency increase of an FEL amplifier is now of great practical importance. Technique of undulator tapering in the post-saturation regime is used at the existing X-ray FELs LCLS and SACLA, and is planned for use at the European XFEL, Swiss FEL, and PAL XFEL. There are also discussions on the future of high peak and average power FELs for scientific and industrial applications. In this paper we perform detailed analysis of the tapering strategies for high power seeded FEL amplifiers. Application of similarity techniques allows us to derive universal law of the undulator tapering.
Embedded control system for high power RF amplifiers
International Nuclear Information System (INIS)
Sharma, Deepak Kumar; Gupta, Alok Kumar; Jain, Akhilesh; Hannurkar, P.R.
2011-01-01
RF power devices are usually very sensitive to overheat and reflected RF power; hence a protective interlock system is required to be embedded with high power solid state RF amplifiers. The solid state RF amplifiers have salient features of graceful degradation and very low mean time to repair (MTTR). In order to exploit these features in favour of lowest system downtime, a real-time control system is embedded with high power RF amplifiers. The control system is developed with the features of monitoring, measurement and network publishing of various parameters, historical data logging, alarm generation, displaying data to the operator and tripping the system in case of any interlock failure. This paper discusses the design philosophy, features, functions and implementation details of the embedded control system. (author)
The VERDI fission fragment spectrometer
Directory of Open Access Journals (Sweden)
Frégeau M.O.
2013-12-01
Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.
A high-power compact regenerative amplifier FEL
International Nuclear Information System (INIS)
Nguyen, D.C.; Sheffield, R.L.; Fortgang, C.M.; Kinross-Wright, J.M.; Ebrahim, N.A.; Goldstein, J.C.
1997-01-01
The Regenerative Amplifier FEL (RAFEL) is a new FEL approach aimed at achieving the highest optical power from a compact rf-linac FEL. The key idea is to feed back a small fraction ( 5 in single pass) wiggler to enable the FEL to reach saturation in a few passes. This paper summarizes the design of a high-power compact regenerative amplifier FEL and describes the first experimental demonstration of the RAFEL concept
A high-resolution time-of-flight spectrometer for fission fragments and ion beams
International Nuclear Information System (INIS)
Kosev, Krasimir Milchev
2007-01-01
For the purpose of fission-fragment detection a double time-of-flight (TOF) spectrometer has been developed. The key component of the TOF spectrometer is a TOF detector consisting of multichannel-plate (MCP) detectors with a position-sensitive readout, a foil for secondary electron (SE) production and an electrostatic mirror. The fission fragments are detected by measuring the SEs impinging on the position-sensitive anode after emission from the foil, acceleration and deflection by the electrostatic mirror. The functionality of the different detector components is proven in detail. Optimised schemes for the high-voltage supplies of the MCP detectors have been implemented successfully. In order to process the multichannel-plate detector signals optimally, a new state-of-the-art constant-fraction discriminator based on the amplitude and rise time compensated technique with very low threshold capabilities and optimised walk properties has been developed and incorporated into the setup. In a setup consisting of two mirror MCP detectors, we could successfully observe the TOF spectrum of a mixed ( 226 Ra, 222 Rn, 210 Po, 218 Po, 214 Po) α-source. Testing photo-fission experiments were performed at the bremsstrahlung facility at the ELBE accelerator. The setup consisted of two mirror detectors (first arm) and a 80 mm diameter MCP detector (second arm) with a 238 U target positioned in between. TOF measurements with two bremsstrahlung end-point energies of 12.9 and 16.0 MeV were carried out. A clear cut separation of the TOF peaks for the medium-mass and heavy fission fragments was observed. (orig.)
A high-resolution time-of-flight spectrometer for fission fragments and ion beams
Energy Technology Data Exchange (ETDEWEB)
Kosev, Krasimir Milchev
2007-07-01
For the purpose of fission-fragment detection a double time-of-flight (TOF) spectrometer has been developed. The key component of the TOF spectrometer is a TOF detector consisting of multichannel-plate (MCP) detectors with a position-sensitive readout, a foil for secondary electron (SE) production and an electrostatic mirror. The fission fragments are detected by measuring the SEs impinging on the position-sensitive anode after emission from the foil, acceleration and deflection by the electrostatic mirror. The functionality of the different detector components is proven in detail. Optimised schemes for the high-voltage supplies of the MCP detectors have been implemented successfully. In order to process the multichannel-plate detector signals optimally, a new state-of-the-art constant-fraction discriminator based on the amplitude and rise time compensated technique with very low threshold capabilities and optimised walk properties has been developed and incorporated into the setup. In a setup consisting of two mirror MCP detectors, we could successfully observe the TOF spectrum of a mixed ({sup 226}Ra,{sup 222}Rn,{sup 210}Po,{sup 218}Po,{sup 214}Po) {alpha}-source. Testing photo-fission experiments were performed at the bremsstrahlung facility at the ELBE accelerator. The setup consisted of two mirror detectors (first arm) and a 80 mm diameter MCP detector (second arm) with a {sup 238}U target positioned in between. TOF measurements with two bremsstrahlung end-point energies of 12.9 and 16.0 MeV were carried out. A clear cut separation of the TOF peaks for the medium-mass and heavy fission fragments was observed. (orig.)
Boyle, Sarah A; Kennedy, Christina M; Torres, Julio; Colman, Karen; Pérez-Estigarribia, Pastor E; de la Sancha, Noé U
2014-01-01
Technological advances and increasing availability of high-resolution satellite imagery offer the potential for more accurate land cover classifications and pattern analyses, which could greatly improve the detection and quantification of land cover change for conservation. Such remotely-sensed products, however, are often expensive and difficult to acquire, which prohibits or reduces their use. We tested whether imagery of high spatial resolution (≤5 m) differs from lower-resolution imagery (≥30 m) in performance and extent of use for conservation applications. To assess performance, we classified land cover in a heterogeneous region of Interior Atlantic Forest in Paraguay, which has undergone recent and dramatic human-induced habitat loss and fragmentation. We used 4 m multispectral IKONOS and 30 m multispectral Landsat imagery and determined the extent to which resolution influenced the delineation of land cover classes and patch-level metrics. Higher-resolution imagery more accurately delineated cover classes, identified smaller patches, retained patch shape, and detected narrower, linear patches. To assess extent of use, we surveyed three conservation journals (Biological Conservation, Biotropica, Conservation Biology) and found limited application of high-resolution imagery in research, with only 26.8% of land cover studies analyzing satellite imagery, and of these studies only 10.4% used imagery ≤5 m resolution. Our results suggest that high-resolution imagery is warranted yet under-utilized in conservation research, but is needed to adequately monitor and evaluate forest loss and conversion, and to delineate potentially important stepping-stone fragments that may serve as corridors in a human-modified landscape. Greater access to low-cost, multiband, high-resolution satellite imagery would therefore greatly facilitate conservation management and decision-making.
Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun
2015-12-14
Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the
Jo, Ick-Hyun; Sung, Jwakyung; Hong, Chi-Eun; Raveendar, Sebastin; Bang, Kyong-Hwan; Chung, Jong-Wook
2018-05-01
Licorice ( Glycyrrhiza glabra ) is an important medicinal crop often used as health foods or medicine worldwide. The molecular genetics of licorice is under scarce owing to lack of molecular markers. Here, we have developed cleaved amplified polymorphic sequence (CAPS) and high-resolution melting (HRM) markers based on single nucleotide polymorphisms (SNP) by comparing the chloroplast genomes of two Glycyrrhiza species ( G. glabra and G. lepidota ). The CAPS and HRM markers were tested for diversity analysis with 24 Glycyrrhiza accessions. The restriction profiles generated with CAPS markers classified the accessions (2-4 genotypes) and melting curves (2-3) were obtained from the HRM markers. The number of alleles and major allele frequency were 2-6 and 0.31-0.92, respectively. The genetic distance and polymorphism information content values were 0.16-0.76 and 0.15-0.72, respectively. The phylogenetic relationships among the 24 accessions were estimated using a dendrogram, which classified them into four clades. Except clade III, the remaining three clades included the same species, confirming interspecies genetic correlation. These 18 CAPS and HRM markers might be helpful for genetic diversity assessment and rapid identification of licorice species.
Investigating the structure and fragmentation of a highly filamentary IRDC
Henshaw, J. D.; Caselli, P.; Fontani, F.; Jiménez-Serra, I.; Tan, J. C.; Longmore, S. N.; Pineda, J. E.; Parker, R. J.; Barnes, A. T.
2016-11-01
We present 3.7 arcsec (˜0.05 pc) resolution 3.2 mm dust continuum observations from the Institut de Radioastronomie Millimétrique Plateau de Bure Interferometer, with the aim of studying the structure and fragmentation of the filamentary infrared dark cloud (IRDC) G035.39-00.33. The continuum emission is segmented into a series of 13 quasi-regularly spaced (λobs ˜ 0.18 pc) cores, following the major axis of the IRDC. We compare the spatial distribution of the cores with that predicted by theoretical work describing the fragmentation of hydrodynamic fluid cylinders, finding a significant (a factor of ≳ 8) discrepancy between the two. Our observations are consistent with the picture emerging from kinematic studies of molecular clouds suggesting that the cores are harboured within a complex network of independent sub-filaments. This result emphasizes the importance of considering the underlying physical structure, and potentially, dynamically important magnetic fields, in any fragmentation analysis. The identified cores exhibit a range in (peak) beam-averaged column density (3.6 × 1023 cm-2 < NH, c < 8.0 × 1023 cm-2), mass (8.1 M⊙ < Mc < 26.1 M⊙), and number density (6.1 × 105 cm-3 < nH, c, eq < 14.7 × 105 cm-3). Two of these cores, dark in the mid-infrared, centrally concentrated, monolithic (with no traceable substructure at our PdBI resolution), and with estimated masses of the order ˜20-25 M⊙, are good candidates for the progenitors of intermediate-to-high-mass stars. Virial parameters span a range 0.2 < αvir < 1.3. Without additional support, possibly from dynamically important magnetic fields with strengths of the order of 230 μG < B < 670 μG, the cores are susceptible to gravitational collapse. These results may imply a multilayered fragmentation process, which incorporates the formation of sub-filaments, embedded cores, and the possibility of further fragmentation.
Application of amplified fragment length polymorphism (AFLPs) for ...
African Journals Online (AJOL)
Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...
DEFF Research Database (Denmark)
Jensen, Pernille Foged; Rand, Kasper Dyrberg
2016-01-01
are produced after precursor ion selection and thus do not add complexity to the LC-MS analysis. The key to obtaining optimal spatial resolution in a hydrogen exchange mass spectrometry (HX-MS) experiment is the fragmentation efficiency. This chapter discusses common fragmentation techniques like collision....../D scrambling, thus making them suitable for HX applications. By combining the classic bottom-up HX-MS workflow with gas-phase fragmentation by ETD, detailed information on protein HX can be obtained....
Efficiency of random amplified polymorphic DNA (RAPD) and inter ...
African Journals Online (AJOL)
Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.
A high performance electrometer amplifier of hybrid design
International Nuclear Information System (INIS)
Rao, N.V.; Nazare, C.K.
1979-01-01
A high performance, reliable, electrometer amplifier of hybrid design for low current measurements in mass spectrometers has been developed. The short term instability with a 5 x 10 11 ohms input resistor is less than 1 x 10sup(-15) Amp. The drift is better than 1 mV/hour. The design steps are illustrated with a typical amplifier performance details. (auth.)
Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.
2005-01-01
An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073
Cochems, P; Kirk, A; Zimmermann, S
2014-12-01
Parasitic elements play an important role in the development of every high performance circuit. In the case of high gain, high bandwidth transimpedance amplifiers, the most important parasitic elements are parasitic capacitances at the input and in the feedback path, which significantly influence the stability, the frequency response, and the noise of the amplifier. As these parasitic capacitances range from a few picofarads down to only a few femtofarads, it is nearly impossible to measure them accurately using traditional LCR meters. Unfortunately, they also cannot be easily determined from the transfer function of the transimpedance amplifier, as it contains several overlapping effects and its measurement is only possible when the circuit is already stable. Therefore, we developed an in-circuit measurement method utilizing minimal modifications to the input stage in order to measure its parasitic capacitances directly and with unconditional stability. Furthermore, using the data acquired with this measurement technique, we both proposed a model for the complicated frequency response of high value thick film resistors as they are used in high gain transimpedance amplifiers and optimized our transimpedance amplifier design.
Al-Khalifah, Nasser S; Shanavaskhan, A E
2017-01-01
Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.
Li, Gao-De
2015-01-01
It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...
Biological effectiveness of high-energy protons - Target fragmentation
International Nuclear Information System (INIS)
Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.
1991-01-01
High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs
Qiu, T; Jiang, L L; Yang, Y F
2016-08-19
The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.
A Compact Two-Stage 120 W GaN High Power Amplifier for SweepSAR Radar Systems
Thrivikraman, Tushar; Horst, Stephen; Price, Douglas; Hoffman, James; Veilleux, Louise
2014-01-01
This work presents the design and measured results of a fully integrated switched power two-stage GaN HEMT high-power amplifier (HPA) achieving 60% power-added efficiency at over 120Woutput power. This high-efficiency GaN HEMT HPA is an enabling technology for L-band SweepSAR interferometric instruments that enable frequent repeat intervals and high-resolution imagery. The L-band HPA was designed using space-qualified state-of-the-art GaN HEMT technology. The amplifier exhibits over 34 dB of power gain at 51 dBm of output power across an 80 MHz bandwidth. The HPA is divided into two stages, an 8 W driver stage and 120 W output stage. The amplifier is designed for pulsed operation, with a high-speed DC drain switch operating at the pulsed-repetition interval and settles within 200 ns. In addition to the electrical design, a thermally optimized package was designed, that allows for direct thermal radiation to maintain low-junction temperatures for the GaN parts maximizing long-term reliability. Lastly, real radar waveforms are characterized and analysis of amplitude and phase stability over temperature demonstrate ultra-stable operation over temperature using integrated bias compensation circuitry allowing less than 0.2 dB amplitude variation and 2 deg phase variation over a 70 C range.
International Nuclear Information System (INIS)
Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.
1990-01-01
A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map
The spectroscopy of fission fragments
International Nuclear Information System (INIS)
Phillips, W.R.
1998-01-01
High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)
High-power piezo drive amplifier for large stack and PFC applications
Clingman, Dan J.; Gamble, Mike
2001-08-01
This paper describes the continuing development of Boeing High Power Piezo Drive Amplifiers. Described is the development and testing of a 1500 Vpp, 8 amp switching amplifier. This amplifier is used to drive a piezo stack driven rotor blade trailing edge flap on a full size helicopter. Also discuss is a switching amplifier designed to drive a Piezo Fiber Composite (PFC) active twist rotor blade. This amplifier was designed to drive the PFC material at 2000 Vpp and 0.5 amps. These amplifiers recycle reactive energy, allowing for a power and weight efficient amplifier design. This work was done in conjunction with the DARPA sponsored Phase II Smart Rotor Blade program and the NASA Langley Research Center sponsored Active Twist Rotor (ATR) blade program.
Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C
2015-12-02
Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.
High Efficiency S-Band 20 Watt Amplifier
National Aeronautics and Space Administration — This project includes the design and build of a prototype 20 W, high efficiency, S-Band amplifier. The design will incorporate the latest semiconductor technology,...
Global patterns of fragmentation and connectivity of mammalian carnivore habitat
Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; Rondinini, Carlo; Boitani, Luigi
2011-01-01
Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges...
High-resolution mapping and ablation of recurrent left lateral accessory pathway conduction
Directory of Open Access Journals (Sweden)
Francesco Solimene, MD
2017-08-01
Full Text Available Proper localization of the anatomical target during ablation of the accessory pathways (AP and the ability to detect clear AP potentials on the ablation catheter are crucial for successful AP ablation. We report a case of recurring AP conduction that was finally eliminated using a novel ablation catheter equipped with high-resolution mini-electrodes. Smaller and closer electrodes result in high mapping resolution with less signal averaging and cancellation effects. Owing to improved sensitivity, the new catheter seems effective in detecting fragmented and high frequency signals, thus allowing more effective radiofrequency application and improving ablation success.
Simulations of High Speed Fragment Trajectories
Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis
2017-11-01
Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.
Li, Xiangrui; Lu, Zhong-Lin; Xu, Pengjing; Jin, Jianzhong; Zhou, Yifeng
2003-11-30
Display systems based on conventional computer graphics cards are capable of generating images with about 8-bit luminance resolution. However, most vision experiments require more than 12 bits of luminance resolution. Pelli and Zhang [Spatial Vis. 10 (1997) 443] described a video attenuator for generating high luminance resolution displays on a monochrome monitor, or for driving just the green gun of a color monitor. Here we show how to achieve a white display by adding video amplifiers to duplicate the monochrome signal to drive all three guns of any color monitor. Because of the lack of the availability of high quality monochrome monitors, our method provides an inexpensive way to achieve high-resolution monochromatic displays using conventional, easy-to-get equipment. We describe the design principles, test results, and a few additional functionalities.
A Review of High Voltage Drive Amplifiers for Capacitive Actuators
DEFF Research Database (Denmark)
Huang, Lina; Zhang, Zhe; Andersen, Michael A. E.
2012-01-01
This paper gives an overview of the high voltage amplifiers, which are used to drive capacitive actuators. The amplifiers for both piezoelectric and DEAP (dielectric electroactive polymer) actuator are discussed. The suitable topologies for driving capacitive actuators are illustrated in detail...
The spectroscopy of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)
1998-12-31
High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.
DEFF Research Database (Denmark)
Borri, P.; Langbein, W.; Hvam, Jørn Märcher
2001-01-01
The ultrafast gain dynamics in an electrically pumped InAs/InGaAs/GaAs quantum-dot amplifier are measured at room temperature with femtosecond resolution, and compared with results on an InGaAsP bulk amplifier. The role of spectral hole burning and carrier heating in the recovery of the gain...
Theoretical analysis of quantum dot amplifiers with high saturation power and low noise figure
DEFF Research Database (Denmark)
Berg, Tommy Winther; Mørk, Jesper
2002-01-01
Semiconductor quantum dot amplifiers are predicted to exhibit superior characteristics such as high gain, and output power and low noise. The analysis provides criteria and design guidelines for the realization of high quality amplifiers.......Semiconductor quantum dot amplifiers are predicted to exhibit superior characteristics such as high gain, and output power and low noise. The analysis provides criteria and design guidelines for the realization of high quality amplifiers....
DEFF Research Database (Denmark)
Priemé, Anders; Wolsing, Martin
2004-01-01
Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...
Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul
2001-01-01
Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Optimal control of a high-frequency class-D amplifier
DEFF Research Database (Denmark)
Dahl, Nicolai J.; Iversen, Niels Elkjær; Knott, Arnold
2018-01-01
Control loops have been used with switch-mode audio amplifiers to improve the sound quality of the amplifier. Because these amplifiers use a high-frequency modulation, precautions in the controller design must be taken. Further, the quality factor of the output filter can have a great impact...... on the controller's capabilities to suppress noise and track the audio signal. In this paper design methods for modern control are presented. The control method proves to easily overcome the challenge of designing a good performing controller when the output filter has a high quality factor. The results show...... that the controller is able to produce a clear improvement in the Total Harmonic Distortion with up to a 30 times improvement compared to open-loop with a clear reduction in the noise. This places the audio quality on pair with current solutions....
Picosecond mid-infrared amplifier for high average power.
CSIR Research Space (South Africa)
Botha, LR
2007-04-01
Full Text Available High pressure CO2 lasers are good candidates for amplifying picosecond mid infrared pulses. High pressure CO2 lasers are notorious for being unreliable and difficult to operate. In this paper a high pressure CO2 laser is presented based on well...
High sensitivity amplifier/discriminator for PWC's
International Nuclear Information System (INIS)
Hansen, S.
1983-01-01
The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design
Cryogenic cooling for high power laser amplifiers
Directory of Open Access Journals (Sweden)
Perin J.P.
2013-11-01
Full Text Available Using DPSSL (Diode Pumped Solid State Lasers as pumping technology, PW-class lasers with enhanced repetition rates are developed. Each of the Yb YAG amplifiers will be diode-pumped at a wavelength of 940 nm. This is a prerequisite for achieving high repetition rates (light amplification duration 1 millisecond and repetition rate 10 Hz. The efficiency of DPSSL is inversely proportional to the temperature, for this reason the slab amplifier have to be cooled at a temperature in the range of 100 K–170 K with a heat flux of 1 MW*m−2. This paper describes the thermo-mechanical analysis for the design of the amplification laser head, presents a preliminary proposal for the required cryogenic cooling system and finally outlines the gain of cryogenic operation for the efficiency of high pulsed laser.
High performance current generator with one-picoampere resolution
International Nuclear Information System (INIS)
Grillo, L.; Manfredi, P.F.; Marchesini, R.
1975-01-01
A high-performance current generator for the picoampere region is presented. Although it was primarily developed as a part of an automatic test system to calibrate charge integrators for accelerating machines. It can suit a wide range of applications. It consists basically of a positive feedback loop of controlled gain which includes a varactor bridge operational amplifier. The essential features of the instrument are a 1 pA resolution and a 10 15 Ω output impedance. The output is guarded and floating between - 120 V and + 120 V, and the voltage across the external loads is measured without affecting the delivered current by a digital panel meter on the front panel. The unit can therefore operate as a high-accuracy dc impedance meter. (Auth.)
High power pulsed sources based on fiber amplifiers
Canat, Guillaume; Jaouën, Yves; Mollier, Jean-Claude; Bouzinac, Jean-Pierre; Cariou, Jean-Pierre
2017-11-01
Cladding-pumped rare-earth-doped fiber laser technologies are currently among the best sources for high power applications. Theses extremely compact and robust sources appoint them as good candidate for aeronautical and space applications. The double-clad (DC) fiber converts the poor beamquality of high-power large-area pump diodes from the 1st cladding to laser light at another wavelength guided in an active single-mode core. High-power coherent MOPA (Master Oscillator Power Amplifier) sources (several 10W CW or several 100W in pulsed regime) will soon be achieved. Unfortunately it also brings nonlinear effects which quickly impairs output signal distortions. Stimulated Brillouin scattering (SBS) and optical parametric amplification (OPA) have been shown to be strong limitations. Based on amplifier modeling and experiments we discuss the performances of these sources.
Rakha, Emad A; Armour, John A L; Pinder, Sarah E; Paish, Claire E; Ellis, Ian O
2005-05-01
Loss of the chromosomal material at 16q22.1 is one of the most frequent genetic aberrations found in both lobular and low-grade nonlobular invasive carcinoma of the breast, indicating the presence of a tumour suppressor gene (TSG) at this region in these tumours. However, the TSG (s) at the 16q22.1 in the more frequent nonlobular carcinomas is still unknown. Multiplex Amplifiable Probe Hybridisation (MAPH) is a simple, accurate and a high-resolution technique that provides an alternative approach to DNA copy-number measurement. The aim of our study was to examine the most likely candidate genes at 16q22.1 using MAPH assay combined with protein expression analysis by immunohistochemistry. We identified deletion at 16q22.1 that involves some or all of these genes. We also noticed that the smallest region of deletion at 16q22.1 could be delineated to a 3 Mb region centromeric to the P-cadherin gene. Apart from the correlation between E-cadherin protein expression and its gene copy number, no correlation was detected between the expression of E2F-4, CTCF, TRF2 or P-cadherin with their gene's copy number. In the malignant tissues, no significant loss or decrease of protein expression of any gene other than E-cadherin was seen in association with any specific tumour type. No expression of VE-cadherin or Ksp-cadherin was detected in the normal and/or malignant tissues of the breast in these cases. However, there was a correlation between increased nuclear expression of E2F-4 and tumours with higher histological grade (p = 0.04) and positive lymph node disease (p = 0.02), suggesting that it may have an oncogenic rather than a tumour suppressor role. The malignant breast tissues also showed abnormal cytoplasmic cellular localisation of CTCF, compared to its expression in the normal parenchymal cells. In conclusion, we have demonstrated that MAPH is a potential technique for assessment of genomic imbalances in malignant tissues. Although our results support E-cadherin as the
High-throughput fragment screening by affinity LC-MS.
Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten
2013-02-01
Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.
High efficiency class-I audio power amplifier using a single adaptive supply
International Nuclear Information System (INIS)
Peng Zhenfei; Yang Shanshand; Feng Yong; Hong Zhiliang; Liu Yang
2012-01-01
A high efficiency class-I linear audio power amplifier (PA) with an adaptive supply is presented. Its efficiency is improved by a dynamic supply to reduce the power transistors' voltage drop. A gain compression technique is adopted to make the amplifier accommodate a single positive supply. Circuit complicity and chip area are reduced because no charge pump is necessary for the negative supply. A common shared mode voltage and a symmetric layout pattern are used to minimize the non-linearity. A peak efficiency of 80% is reached at peak output power. The measured THD+N before and after the supply switching point are 0.01% and 0.05%, respectively. The maximum output power is 410 mW for an 8 Ω speaker load. Unlike switching amplifiers, the class-I amplifier operates as a linear amplifier and hence has a low EMI. The advantage of a high efficiency and low EMI makes the class-I amplifier suitable for portable and RF sensitive applications. (semiconductor integrated circuits)
High-performace cladding-pumped erbium-doped fibre laser and amplifier
International Nuclear Information System (INIS)
Kotov, L V; Likhachev, M E; Bubnov, M M; Medvedkov, O I; Lipatov, D S; Vechkanov, N N; Guryanov, Aleksei N
2012-01-01
We report cladding-pumped erbium-doped fibre laser and amplifier configurations. Through fibre design optimisation, we have achieved a record-high laser slope efficiency, 40 % with respect to absorbed pump power (λ = 976 nm), and an output power of 7.5 W. The erbium-doped fibre amplifier efficiency reaches 32 %.
Directory of Open Access Journals (Sweden)
Shumeng Kou
2018-03-01
, Methylophilus methylotrophus, Nitrosospira, and Lysobacter mobilis. The capacity to track alterations of an amplified microbial community at high taxonomic resolution using modern bioinformatic approaches, as well as identifying where that resolution is lost for technical or biological reasons, provides an insight into the complexity of the microbial world resisting anthropogenic pollution. While functional assessment of uncharacterized organisms within environmental samples is technically challenging, an important step is observing those organisms able to tolerate extreme stress and to recognize the extent to which important amplifiable community members still require characterization.
Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B
2018-01-01
methylotrophus , Nitrosospira , and Lysobacter mobilis . The capacity to track alterations of an amplified microbial community at high taxonomic resolution using modern bioinformatic approaches, as well as identifying where that resolution is lost for technical or biological reasons, provides an insight into the complexity of the microbial world resisting anthropogenic pollution. While functional assessment of uncharacterized organisms within environmental samples is technically challenging, an important step is observing those organisms able to tolerate extreme stress and to recognize the extent to which important amplifiable community members still require characterization.
A High-Voltage Class D Audio Amplifier for Dielectric Elastomer Transducers
DEFF Research Database (Denmark)
Nielsen, Dennis; Knott, Arnold; Andersen, Michael A. E.
2014-01-01
Dielectric Elastomer (DE) transducers have emerged as a very interesting alternative to the traditional electrodynamic transducer. Lightweight, small size and high maneuverability are some of the key features of the DE transducer. An amplifier for the DE transducer suitable for audio applications...... is proposed and analyzed. The amplifier addresses the issue of a high impedance load, ensuring a linear response over the midrange region of the audio bandwidth (100 Hz – 3.5 kHz). THD+N below 0.1% are reported for the ± 300 V prototype amplifier producing a maximum of 125 Var at a peak efficiency of 95 %....
Directory of Open Access Journals (Sweden)
Lieschen De Vos
Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.
High Energy Single Frequency Resonant Amplifier, Phase I
National Aeronautics and Space Administration — This SBIR phase I project proposes a single frequency high energy resonant amplifier for remote sensing. Current state-of-art technologies can not provide all...
Directory of Open Access Journals (Sweden)
Carlos M Restrepo
Full Text Available American Tegumentary Leishmaniasis is caused by parasites of the genus Leishmania, and causes significant health problems throughout the Americas. In Panama, Leishmania parasites are endemic, causing thousands of new cases every year, mostly of the cutaneous form. In the last years, the burden of the disease has increased, coincident with increasing disturbances in its natural sylvatic environments. The study of genetic variation in parasites is important for a better understanding of the biology, population genetics, and ultimately the evolution and epidemiology of these organisms. Very few attempts have been made to characterize genetic polymorphisms of parasites isolated from Panamanian patients of cutaneous leishmaniasis. Here we present data on the genetic variability of local isolates of Leishmania, as well as specimens from several other species, by means of Amplified Fragment Length Polymorphisms (AFLP, a technique seldom used to study genetic makeup of parasites. We demonstrate that this technique allows detection of very high levels of genetic variability in local isolates of Leishmania panamensis in a highly reproducible manner. The analysis of AFLP fingerprints generated by unique selective primer combinations in L. panamensis suggests a predominant clonal mode of reproduction. Using fluorescently labeled primers, many taxon-specific fragments were identified which may show potential as species diagnostic fragments. The AFLP permitted a high resolution genetic analysis of the Leishmania genus, clearly separating certain groups among L. panamensis specimens and highly related species such as L. panamensis and L. guyanensis. The phylogenetic networks reconstructed from our AFLP data are congruent with established taxonomy for the genus Leishmania, even when using single selective primer combinations. Results of this study demonstrate that AFLP polymorphisms can be informative for genetic characterization in Leishmania parasites, at
Quadruplex MAPH: improvement of throughput in high-resolution copy number screening.
Tyson, Jess; Majerus, Tamsin Mo; Walker, Susan; Armour, John Al
2009-09-28
Copy number variation (CNV) in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Multiplex Amplifiable Probe Hybridisation (MAPH) is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH") that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC) samples. QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.
Solid state high power amplifier for driving the SLC injector klystron
International Nuclear Information System (INIS)
Judkins, J.G.; Clendenin, J.E.; Schwarz, H.D.
1985-03-01
The SLC injector klystron rf drive is now provided by a recently developed solid-state amplifier. The high gain of the amplifier permits the use of a fast low-power electronic phase shifter. Thus the SLC computer control system can be used to shift the phase of the high-power rf rapidly during the fill time of the injector accelerator section. These rapid phase shifts are used to introduce a phase-energy relationship in the accelerated electron pulse in conjunction with the operation of the injector bunch compressor. The amplifier, the method of controlling the rf phase, and the operational characteristics of the system are described. 5 refs., 4 figs
A high time resolution x-ray diagnostic on the Madison Symmetric Torus
DuBois, Ami M.; Lee, John David; Almagri, Abdulgadar F.
2015-07-01
A new high time resolution x-ray detector has been installed on the Madison Symmetric Torus (MST) to make measurements around sawtooth events. The detector system is comprised of a silicon avalanche photodiode, a 20 ns Gaussian shaping amplifier, and a 500 MHz digitizer with 14-bit sampling resolution. The fast shaping time diminishes the need to restrict the amount of x-ray flux reaching the detector, limiting the system dead-time. With a much higher time resolution than systems currently in use in high temperature plasma physics experiments, this new detector has the versatility to be used in a variety of discharges with varying flux and the ability to study dynamics on both slow and fast time scales. This paper discusses the new fast x-ray detector recently installed on MST and the improved time resolution capabilities compared to the existing soft and hard x-ray diagnostics. In addition to the detector hardware, improvements to the detector calibration and x-ray pulse identification software, such as additional fitting parameters and a more sophisticated fitting routine are discussed. Finally, initial data taken in both high confinement and standard reversed-field pinch plasma discharges are compared.
Energy Technology Data Exchange (ETDEWEB)
Tsai, Andy; Kleinman, Paul K. [Boston Children' s Hospital, Department of Radiology, Boston, MA (United States); McDonald, Anna G. [Office of the Chief Medical Examiner, Boston, MA (United States); Rosenberg, Andrew E. [University of Miami Hospital, Department of Pathology, Miami, FL (United States); Gupta, Rajiv [Massachusetts General Hospital, Department of Radiology, Boston, MA (United States)
2014-02-15
The classic metaphyseal lesion (CML) is a common high specificity indicator of infant abuse and its imaging features have been correlated histopathologically in infant fatalities. High-resolution CT imaging and histologic correlates were employed to (1) characterize the normal infant anatomy surrounding the chondro-osseous junction, and (2) confirm the 3-D model of the CML previously inferred from planar radiography and histopathology. Long bone specimens from 5 fatally abused infants, whose skeletal survey showed definite or suspected CMLs, were studied postmortem. After skeletal survey, selected specimens were resected and imaged with high-resolution digital radiography. They were then scanned with micro-CT (isotropic resolution of 45 μm{sup 3}) or with high-resolution flat-panel CT (isotropic resolutions of 200 μm{sup 3}). Visualization of the bony structures was carried out using image enhancement, segmentation and isosurface extraction, together with volume rendering and multiplanar reformatting. These findings were then correlated with histopathology. Study of normal infant bone clarifies the 3-D morphology of the subperiosteal bone collar (SPBC) and the radiographic zone of provisional calcification (ZPC). Studies on specimens with CML confirm that this lesion is a fracture extending in a planar fashion through the metaphysis, separating a mineralized fragment. This disk-like mineralized fragment has two components: (1) a thick peripheral component encompassing the SPBC; and (2) a thin central component comprised predominantly of the radiologic ZPC. By manipulating the 3-D model, the varying appearances of the CML are displayed. High-resolution CT coupled with histopathology provides elucidation of the morphology of the CML, a strong indicator of infant abuse. This new information may prove useful in assessing the biomechanical factors that produce this strong indicator of abusive assaults in infants. (orig.)
International Nuclear Information System (INIS)
Tsai, Andy; Kleinman, Paul K.; McDonald, Anna G.; Rosenberg, Andrew E.; Gupta, Rajiv
2014-01-01
The classic metaphyseal lesion (CML) is a common high specificity indicator of infant abuse and its imaging features have been correlated histopathologically in infant fatalities. High-resolution CT imaging and histologic correlates were employed to (1) characterize the normal infant anatomy surrounding the chondro-osseous junction, and (2) confirm the 3-D model of the CML previously inferred from planar radiography and histopathology. Long bone specimens from 5 fatally abused infants, whose skeletal survey showed definite or suspected CMLs, were studied postmortem. After skeletal survey, selected specimens were resected and imaged with high-resolution digital radiography. They were then scanned with micro-CT (isotropic resolution of 45 μm 3 ) or with high-resolution flat-panel CT (isotropic resolutions of 200 μm 3 ). Visualization of the bony structures was carried out using image enhancement, segmentation and isosurface extraction, together with volume rendering and multiplanar reformatting. These findings were then correlated with histopathology. Study of normal infant bone clarifies the 3-D morphology of the subperiosteal bone collar (SPBC) and the radiographic zone of provisional calcification (ZPC). Studies on specimens with CML confirm that this lesion is a fracture extending in a planar fashion through the metaphysis, separating a mineralized fragment. This disk-like mineralized fragment has two components: (1) a thick peripheral component encompassing the SPBC; and (2) a thin central component comprised predominantly of the radiologic ZPC. By manipulating the 3-D model, the varying appearances of the CML are displayed. High-resolution CT coupled with histopathology provides elucidation of the morphology of the CML, a strong indicator of infant abuse. This new information may prove useful in assessing the biomechanical factors that produce this strong indicator of abusive assaults in infants. (orig.)
International Nuclear Information System (INIS)
Sojfer, V.N.; Petrova, N.V.; Timofeeva, O.A.; Filipenko, M.L.; Solov'eva, N.A.; Popovskij, A.V.; Vlasko, V.V.
1998-01-01
To study DNA at the nucleotide level of resolution in residents of settlements located along the Techa river, studies are performed by direct sequencing of gene sequences preliminary amplified and selected by means of analysis of changes of the conformation of DNA unifilament fragments (SSCP-method). Results are presented in details [ru
Albrodt, P.; Hanna, M.; Moron, F.; Decker, J.; Winterfeldt, M.; Blume, G.; Erbert, G.; Crump, P.; Georges, P.; Lucas-Leclin, G.
2018-02-01
Improved diode laser beam combining techniques are in strong demand for applications in material processing. Coherent beam combining (CBC) is the only combining approach that has the potential to maintain or even improve all laser properties, and thus has high potential for future systems. As part of our ongoing studies into CBC of diode lasers, we present recent progress in the coherent superposition of high-power single-pass tapered laser amplifiers. The amplifiers are seeded by a DFB laser at λ = 976 nm, where the seed is injected into a laterally single-mode ridge-waveguide input section. The phase pistons on each beam are actively controlled by varying the current in the ridge section of each amplifier, using a sequential hill-climbing algorithm, resulting in a combined beam with power fluctuations of below 1%. The currents into the tapered sections of the amplifiers are separately controlled, and remain constant. In contrast to our previous studies, we favour a limited number of individual high-power amplifiers, in order to preserve a high extracted power per emitter in a simple, low-loss coupling arrangement. Specifically, a multi-arm interferometer architecture with only three devices is used, constructed using 6 mm-long tapered amplifiers, mounted junction up on C-mounts, to allow separate contact to single mode and amplifier sections. A maximum coherently combined power of 12.9 W is demonstrated in a nearly diffraction-limited beam, corresponding to a 65% combining efficiency, with power mainly limited by the intrinsic beam quality of the amplifiers. Further increased combined power is currently sought.
Neutron multiplicity of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)
1995-10-01
The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.
Keeports, David
2006-12-01
By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.
A novel VLSI processor for high-rate, high resolution spectroscopy
Pullia, Antonio; Gatti, E; Longoni, A; Buttler, W
2000-01-01
A novel time-variant VLSI shaper amplifier, suitable for multi-anode Silicon Drift Detectors or other multi-element solid-state X-ray detection systems, is proposed. The new read-out scheme has been conceived for demanding applications with synchrotron light sources, such as X-ray holography or EXAFS, where both high count-rates and high-energy resolutions are required. The circuit is of the linear time-variant class, accepts randomly distributed events and features: a finite-width (1-10 mu s) quasi-optimal weight function, an ultra-low-level energy discrimination (approx 150 eV), and a full compatibility for monolithic integration in CMOS technology. Its impulse response has a staircase-like shape, but the weight function (which is in general different from the impulse response in time-variant systems) is quasi trapezoidal. The operation principles of the new scheme as well as the first experimental results obtained with a prototype of the circuit are presented and discussed in the work.
DEFF Research Database (Denmark)
Dalsgaard, Petur Weihe; Mollerup, Christian Brinch; Mardal, Marie
/Discussions: . The overlapping entries of the database verify that similar fragment ions can be observed from identical compounds across different LC-HRMS systems. The inclusion of fragment ions from other labs can reduce false positive identifications, when no reference standard is available in-house. HighResNPS can serve......Background/Introduction: The number of new psychoactive substances (NPS) is constantly increasing which makes it challenging to keep the screening libraries updated with the relevant analytical targets. Liquid chromatography coupled High Resolution Mass Spectrometry (LC-HRMS) screening methods...... with most screening platforms after minor formatting. Results: Currently, 11 users from 9 laboratories in 7 counties have contributed with 318 entries to the database with experimental data containing at least one fragment ion. 66% of the uploaded data were based on reference standards. Synthetic...
Short pulse mid-infrared amplifier for high average power
CSIR Research Space (South Africa)
Botha, LR
2006-09-01
Full Text Available High pressure CO2 lasers are good candidates for amplifying picosecond mid infrared pulses. High pressure CO2 lasers are notorious for being unreliable and difficult to operate. In this paper a high pressure CO2 laser is presented based on well...
ASIC-enabled High Resolution Optical Time Domain Reflectometer
Skendzic, Sandra
Fiber optics has become the preferred technology in communication systems because of what it has to offer: high data transmission rates, immunity to electromagnetic interference, and lightweight, flexible cables. An optical time domain reflectometer (OTDR) provides a convenient method of locating and diagnosing faults (e.g. break in a fiber) along a fiber that can obstruct crucial optical pathways. Both the ability to resolve the precise location of the fault and distinguish between two discrete, closely spaced faults are figures of merit. This thesis presents an implementation of a high resolution OTDR through the use of a compact and programmable ASIC (application specific integrated circuit). The integration of many essential OTDR functions on a single chip is advantageous over existing commercial instruments because it enables small, lightweight packaging, and offers low power and cost efficiency. Furthermore, its compactness presents the option of placing multiple ASICs in parallel, which can conceivably ease the characterization of densely populated fiber optic networks. The OTDR ASIC consists of a tunable clock, pattern generator, precise timer, electrical receiver, and signal sampling circuit. During OTDR operation, the chip generates narrow electrical pulse, which can then be converted to optical format when coupled with an external laser diode driver. The ASIC also works with an external photodetector to measure the timing and amplitude of optical reflections in a fiber. It has a 1 cm sampling resolution, which allows for a 2 cm spatial resolution. While this OTDR ASIC has been previously demonstrated for multimode fiber fault diagnostics, this thesis focuses on extending its functionality to single mode fiber. To validate this novel approach to OTDR, this thesis is divided into five chapters: (1) introduction, (2) implementation, (3), performance of ASIC-based OTDR, (4) exploration in optical pre-amplification with a semiconductor optical amplifier, and
International Nuclear Information System (INIS)
Zhao, B.; Zheng, X.Z.
2015-01-01
Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)
Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro
2017-03-01
High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .
Advances in high-power rf amplifiers
International Nuclear Information System (INIS)
Tallerico, P.J.
1979-01-01
Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems
Gallium nitride based transistors for high-efficiency microwave switch-mode amplifiers
Energy Technology Data Exchange (ETDEWEB)
Maroldt, Stephan
2012-07-01
Highly-efficient switch-mode power amplifiers form key elements in future fully-digital base stations for mobile communication. This novel digital base station concept reduces system energy consumption, complexity, size and costs, while the flexibility in terms of multi-band operation and signal modulation improves. In this work, innovative core circuits for digital high-efficiency class-D and class-S power amplifiers based on gallium nitride (GaN) technology were developed for the application in digital base stations. A combination of optimized GaN devices and improvements in circuit design allow a highly-efficient switch-mode operation at mobile communication frequencies between 0.45 GHz and 2 GHz. Transistor device modeling for switch-mode operation, the simulation environment, and a broadband measurement system were established for the design and evaluation of digital switchmode power amplifiers. The design of broadband core circuits for switch-mode amplifier concepts was analyzed for dual-stage amplifier circuits, using an initial GaN technology with a gate length of 0.25 {mu}m. A speed-enhanced driver stage improved the circuit switching speed sufficiently above 1 GHz. Speed and efficiency of the amplifier core circuits were studied related to transistor parameters like cut-off frequency or gate capacitance. A reduced gate length was found to improve the switching speed, while a lower on-resistance allows the reduction of the inherent static losses of the GaN-based switches. Apart from this, the restriction of a 50 Ohm environment was found to be a major output power and switching speed limitation, due to a poor switching drive capability of the input capacitance of the GaN circuit. Finally, the optimized transistor and circuit design with an output gate width of 1.2 mm were effectively implemented in the given environment for an operation up to 2 GHz with a high drain efficiency of >65% and a digital output power of 5 W. A maximum output power of 9.7 W and a
High brightness photonic lantern kW-class amplifier
Montoya, Juan; Hwang, Chris; Aleshire, Chris; Reed, Patricia; Martz, Dale; Riley, Mike; Trainor, Michael; Belley, Catherine; Shaw, Scot; Fan, T. Y.; Ripin, Dan
2018-02-01
Pump-limited kW-class operation in a multimode fiber amplifier using adaptive mode control was achieved. A photonic lantern front end was used to inject an arbitrary superposition of modes on the input to a kW-class fiber amplifier to achieve a nearly diffraction-limited output. We report on the adaptive spatial mode control architecture which allows for compensating transverse-mode disturbances at high power. We also describe the advantages of adaptive spatial mode control for optical phased array systems. In particular, we show that the additional degrees of freedom allow for broader steering and improved atmospheric turbulence compensation relative to piston-only optical phased arrays.
High resolution imaging detectors and applications
Saha, Swapan K
2015-01-01
Interferometric observations need snapshots of very high time resolution of the order of (i) frame integration of about 100 Hz or (ii) photon-recording rates of several megahertz (MHz). Detectors play a key role in astronomical observations, and since the explanation of the photoelectric effect by Albert Einstein, the technology has evolved rather fast. The present-day technology has made it possible to develop large-format complementary metal oxide–semiconductor (CMOS) and charge-coupled device (CCD) array mosaics, orthogonal transfer CCDs, electron-multiplication CCDs, electron-avalanche photodiode arrays, and quantum-well infrared (IR) photon detectors. The requirements to develop artifact-free photon shot noise-limited images are higher sensitivity and quantum efficiency, reduced noise that includes dark current, read-out and amplifier noise, smaller point-spread functions, and higher spectral bandwidth. This book aims to address such systems, technologies and design, evaluation and calibration, control...
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
A broadband high-efficiency Doherty power amplifier using symmetrical devices
Cheng, Zhiqun; Zhang, Ming; Li, Jiangzhou; Liu, Guohua
2018-04-01
This paper proposes a method for broadband and high-efficiency amplification of Doherty power amplifier (DPA) using symmetric devices. In order to achieve the perfect load modulation, the carrier amplifier output circuit total power length is designed to odd multiple of 90°, and the peak amplifier output total power length is designed to even multiple of 180°. The proposed method is demonstrated by designing a broadband high-efficiency DPA using identical 10-W packaged GaN HEMT devices. Measurement results show that over 51% drain efficiency is achieved at 6-dB back-off power, over the frequency band of 1.9–2.4 GHz. Project supported by the National Natural Science Foundation of China (No. 60123456), the Zhejiang Provincial Natural Science Foundation of China (No. LZ16F010001), and the Zhejiang Provincial Public Technology Research Project (No. 2016C31070).
A high efficiency PWM CMOS class-D audio power amplifier
Energy Technology Data Exchange (ETDEWEB)
Zhu Zhangming; Liu Lianxi; Yang Yintang [Institute of Microelectronics, Xidian University, Xi' an 710071 (China); Lei Han, E-mail: zmyh@263.ne [Xi' an Power-Rail Micro Co., Ltd, Xi' an 710075 (China)
2009-02-15
Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 mum CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 muA. The active area of the class-D audio power amplifier is about 1.47 x 1.52 mm{sup 2}. With the good performance, the class-D audio power amplifier can be applied to several audio power systems.
A high efficiency PWM CMOS class-D audio power amplifier
International Nuclear Information System (INIS)
Zhu Zhangming; Liu Lianxi; Yang Yintang; Lei Han
2009-01-01
Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 μm CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 μA. The active area of the class-D audio power amplifier is about 1.47 x 1.52 mm 2 . With the good performance, the class-D audio power amplifier can be applied to several audio power systems.
A high efficiency PWM CMOS class-D audio power amplifier
Zhangming, Zhu; Lianxi, Liu; Yintang, Yang; Han, Lei
2009-02-01
Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 μm CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 μA. The active area of the class-D audio power amplifier is about 1.47 × 1.52 mm2. With the good performance, the class-D audio power amplifier can be applied to several audio power systems.
Microchannel plates as detectors and amplifiers of x-ray images
International Nuclear Information System (INIS)
Wiedwald, J.D.
1992-08-01
Two decades of development driven largely by military night vision applications has led to the availability of a wide selection of microchannel plates for use by the scientific community. Microchannel plates (MCPs) are electron multipliers which retain a high degree of spatial resolution making it possible to amplify electron images by factors of 1,000 or more. Plates having 40 mm diameter and intrinsic spatial resolution of 8 μm are readily available. By coating the front surface of a microchannel plate with an x-ray sensitive photocathode material, x-ray images can be detected and amplified. While the detective quantum efficiency is relatively low, the low noise of the MCP (including the ability to construct images by single photon detection) and its high dynamic range make it suitable for some x-ray microscopy applications. The principles of MCP operation and typical performance are discussed. Examples of related applications and commercial capabilities are also presented
Directory of Open Access Journals (Sweden)
C. Yao
2017-09-01
Full Text Available With the rapid development of Precision Agriculture (PA promoted by high-resolution remote sensing, it makes significant sense in management and estimation of agriculture through crop classification of high-resolution remote sensing image. Due to the complex and fragmentation of the features and the surroundings in the circumstance of high-resolution, the accuracy of the traditional classification methods has not been able to meet the standard of agricultural problems. In this case, this paper proposed a classification method for high-resolution agricultural remote sensing images based on convolution neural networks(CNN. For training, a large number of training samples were produced by panchromatic images of GF-1 high-resolution satellite of China. In the experiment, through training and testing on the CNN under the toolbox of deep learning by MATLAB, the crop classification finally got the correct rate of 99.66 % after the gradual optimization of adjusting parameter during training. Through improving the accuracy of image classification and image recognition, the applications of CNN provide a reference value for the field of remote sensing in PA.
Directory of Open Access Journals (Sweden)
Fernando Andreacci
2017-12-01
Full Text Available In the Atlantic Forest, land use and land-use change are partly determined based on a classification of the successional stages of forests. Different regeneration stages are limited to different amounts and types of use. The parameters used to define the successional stages of forests are described in specific resolutions for each of the states. CONAMA 04/94 is the resolution for the forests of Santa Catarina. The aim of this study was to evaluate the quantitative parameters in CONAMA 04/94 for classifying successional stages of forests in the northern coastal plains of the state. Six forest fragments with different soil types were evaluated using average DBH and average height of individuals, as well as basal area and indicator species. The results show that CONAMA 04/94 disregards certain phytophysiognomic characteristics of the northern coastal plains of the state. They also show that the CONAMA 04/94 text is incoherent regarding structural parameters and indicator species. The results suggest the urgent need to review the CONAMA 04/94 resolution because forest fragments could qualify for incorrect land uses according to what is defined in the current policy.
Quadruplex MAPH: improvement of throughput in high-resolution copy number screening
Directory of Open Access Journals (Sweden)
Walker Susan
2009-09-01
Full Text Available Abstract Background Copy number variation (CNV in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Results Multiplex Amplifiable Probe Hybridisation (MAPH is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH" that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC samples. Conclusion QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.
Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator
Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.
2018-04-01
The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.
Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun
2006-07-01
The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971
Study of a high-order-mode gyrotron traveling-wave amplifier
International Nuclear Information System (INIS)
Chiu, C. C.; Tsai, C. Y.; Kao, S. H.; Chu, K. R.; Barnett, L. R.; Luhmann, N. C. Jr.
2010-01-01
Physics and performance issues of a TE 01 -mode gyrotron traveling-wave amplifier are studied in theory. For a high order mode, absolute instabilities on neighboring modes at the fundamental and higher cyclotron harmonic frequencies impose severe constraints to the device capability. Methods for their stabilization are outlined, on the basis of which the performance characteristics are examined in a multidimensional parameter space under the marginal stability criterion. The results demonstrate the viability of a high-order-mode traveling-wave amplifier and provide a roadmap for design tradeoffs among power, bandwidth, and efficiency. General trends are observed and illustrated with specific examples.
Structure of a tropomyosin N-terminal fragment at 0.98 Å resolution
International Nuclear Information System (INIS)
Meshcheryakov, Vladimir A.; Krieger, Inna; Kostyukova, Alla S.; Samatey, Fadel A.
2011-01-01
The crystal structure of the N-terminal fragment of the short nonmuscle α-tropomyosin has been determined at a resolution of 0.98 Å. Tropomyosin (TM) is an elongated two-chain protein that binds along actin filaments. Important binding sites are localized in the N-terminus of tropomyosin. The structure of the N-terminus of the long muscle α-TM has been solved by both NMR and X-ray crystallography. Only the NMR structure of the N-terminus of the short nonmuscle α-TM is available. Here, the crystal structure of the N-terminus of the short nonmuscle α-TM (αTm1bZip) at a resolution of 0.98 Å is reported, which was solved from crystals belonging to space group P3 1 with unit-cell parameters a = b = 33.00, c = 52.03 Å, α = β = 90, γ = 120°. The first five N-terminal residues are flexible and residues 6–35 form an α-helical coiled coil. The overall fold and the secondary structure of the crystal structure of αTM1bZip are highly similar to the NMR structure and the atomic coordinates of the corresponding C α atoms between the two structures superimpose with a root-mean-square deviation of 0.60 Å. The crystal structure validates the NMR structure, with the positions of the side chains being determined precisely in our structure
Structure of a tropomyosin N-terminal fragment at 0.98 Å resolution
Energy Technology Data Exchange (ETDEWEB)
Meshcheryakov, Vladimir A. [Okinawa Institute of Science and Technology, Okinawa (Japan); Krieger, Inna [Texas A& M University, College Station, Texas (United States); Kostyukova, Alla S. [Robert Wood Johnson Medical School, Piscataway, New Jersey (United States); Samatey, Fadel A., E-mail: f.a.samatey@oist.jp [Okinawa Institute of Science and Technology, Okinawa (Japan)
2011-09-01
The crystal structure of the N-terminal fragment of the short nonmuscle α-tropomyosin has been determined at a resolution of 0.98 Å. Tropomyosin (TM) is an elongated two-chain protein that binds along actin filaments. Important binding sites are localized in the N-terminus of tropomyosin. The structure of the N-terminus of the long muscle α-TM has been solved by both NMR and X-ray crystallography. Only the NMR structure of the N-terminus of the short nonmuscle α-TM is available. Here, the crystal structure of the N-terminus of the short nonmuscle α-TM (αTm1bZip) at a resolution of 0.98 Å is reported, which was solved from crystals belonging to space group P3{sub 1} with unit-cell parameters a = b = 33.00, c = 52.03 Å, α = β = 90, γ = 120°. The first five N-terminal residues are flexible and residues 6–35 form an α-helical coiled coil. The overall fold and the secondary structure of the crystal structure of αTM1bZip are highly similar to the NMR structure and the atomic coordinates of the corresponding C{sup α} atoms between the two structures superimpose with a root-mean-square deviation of 0.60 Å. The crystal structure validates the NMR structure, with the positions of the side chains being determined precisely in our structure.
A high-efficiency superconductor distributed amplifier
Energy Technology Data Exchange (ETDEWEB)
Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)
2010-02-15
A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)
Multi-pass amplifier architecture for high power laser systems
Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C
2014-04-01
A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.
High efficiency hydrodynamic DNA fragmentation in a bubbling system
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling
2017-01-01
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling
High power X-band coaxial amplifier experiments
International Nuclear Information System (INIS)
Davis, T.J.; Nation, J.A.
1991-01-01
Studies are continuing on the development of X-band coaxial microwave amplifiers as a source for next generation linear colliders. Coaxial amplifiers employ an annular electron beam propagating between inner and outer drift tube conductors, a configuration which allows large increases in beam current over standard pencil beam amplifiers. Large average diameter systems may still be used without mode competition since TM mode cutoff frequencies are controlled by the separation between conductors. A number of amplifier configurations are being studied, all primed by a driven initial cavity which resonates around 9 GHz. Simple theory of coaxial systems and particle-in-cell simulations are presented, as well as initial experimental results using a 420 keV, 7-8 kA, 9 cm diameter annular beam
Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S
2016-01-01
Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Highly pH-responsive sensor based on amplified spontaneous emission coupled to colorimetry.
Zhang, Qi; Castro Smirnov, Jose R; Xia, Ruidong; Pedrosa, Jose M; Rodriguez, Isabel; Cabanillas-Gonzalez, Juan; Huang, Wei
2017-04-07
We demonstrated a simple, directly-readable approach for high resolution pH sensing. The method was based on sharp changes in Amplified Spontaneous Emission (ASE) of a Stilbene 420 (ST) laser dye triggered by the pH-dependent absorption of Bromocresol Green (BG). The ASE threshold of BG:ST solution mixtures exhibited a strong dependence on BG absorption, which was drastically changed by the variations of the pH of BG solution. As a result, ASE on-off or off-on was observed with different pH levels achieved by ammonia doping. By changing the concentration of the BG solution and the BG:ST blend ratio, this approach allowed to detect pH changes with a sensitivity down to 0.05 in the 10-11 pH range.
High Power Narrow Linewidth 1.26 Micron Ho-Doped Fiber Amplifier, Phase II
National Aeronautics and Space Administration — This proposal is for the development of an innovative, high power, and extremely reliable 1.26-micron Ho-doped fluoride fiber amplifier. The proposed fiber amplifier...
High Power Narrow Linewidth 1.26 Micron Ho-Doped Fiber Amplifier, Phase I
National Aeronautics and Space Administration — This proposal is for the development of an innovative, high power, and extremely reliable 1.26-micron Ho-doped fluoride fiber amplifier. The proposed fiber amplifier...
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)
1999-09-01
Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)
High efficiency RF amplifier development over wide dynamic range for accelerator application
Mishra, Jitendra Kumar; Ramarao, B. V.; Pande, Manjiri M.; Joshi, Gopal; Sharma, Archana; Singh, Pitamber
2017-10-01
Superconducting (SC) cavities in an accelerating section are designed to have the same geometrical velocity factor (βg). For these cavities, Radio Frequency (RF) power needed to accelerate charged particles varies with the particle velocity factor (β). RF power requirement from one cavity to other can vary by 2-5 dB within the accelerating section depending on the energy gain in the cavity and beam current. In this paper, we have presented an idea to improve operating efficiency of the SC RF accelerators using envelope tracking technique. A study on envelope tracking technique without feedback is carried out on a 1 kW, 325 MHz, class B (conduction angle of 180 degrees) tuned load power amplifier (PA). We have derived expressions for the efficiency and power output for tuned load amplifier operating on the envelope tracking technique. From the derived expressions, it is observed that under constant load resistance to the device (MOSFET), optimum amplifier efficiency is invariant whereas output power varies with the square of drain bias voltage. Experimental results on 1 kW PA module show that its optimum efficiency is always greater than 62% with variation less than 5% from mean value over 7 dB dynamic range. Low power amplifier modules are the basic building block for the high power amplifiers. Therefore, results for 1 kW PA modules remain valid for the high power solid state amplifiers built using these PA modules. The SC RF accelerators using these constant efficiency power amplifiers can improve overall accelerator efficiency.
Application of ultra-fast high-resolution gated-image intensifiers to laser fusion studies
International Nuclear Information System (INIS)
Lieber, A.J.; Benjamin, R.F.; Sutphin, H.D.; McCall, G.H.
1975-01-01
Gated-image intensifiers for fast framing have found high utility in laser-target interaction studies. X-ray pinhole camera photographs which can record asymmetries of laser-target interactions have been instrumental in further system design. High-resolution high-speed x-ray images of laser irradiated targets are formed using pinhole optics and electronically amplified by proximity focused channelplate intensifiers before being recorded on film. Spectral resolution is obtained by filtering. In these applications shutter duration is determined by source duration. Electronic gating serves to reduce background thereby enhancing signal-to-noise ratio. Cameras are used to view the self light of the interaction but may also be used for shadowgraphs. Sources for shadowgraphs may be sequenced to obtain a series of pictures with effective rates of 10 10 frame/s. Multiple aperatures have been used to obtain stereo x-ray views, yielding three dimensional information about the interactions. (author)
Masny, Aleksander; Jagiełło, Agata; Płucienniczak, Grażyna; Golab, Elzbieta
2012-09-01
Ribo HRM, a single-tube PCR and high resolution melting (HRM) assay for detection of polymorphisms in the large subunit ribosomal DNA expansion segment V, was developed on a Trichinella model. Four Trichinella species: T. spiralis (isolates ISS3 and ISS160), T. nativa (isolates ISS10 and ISS70), T. britovi (isolates ISS2 and ISS392) and T. pseudospiralis (isolates ISS13 and ISS1348) were genotyped. Cloned allelic variants of the expansion segment V were used as standards to prepare reference HRM curves characteristic for single sequences and mixtures of several cloned sequences imitating allelic composition detected in Trichinella isolates. Using the primer pair Tsr1 and Trich1bi, it was possible to amplify a fragment of the ESV and detect PCR products obtained from the genomic DNA of pools of larvae belonging to the four investigated species: T. pseudospiralis, T. spiralis, T. britovi and T. nativa, in a single tube Real-Time PCR reaction. Differences in the shape of the HRM curves of Trichinella isolates suggested the presence of differences between examined isolates of T. nativa, T. britovi and T. pseudospiralis species. No differences were observed between T. spiralis isolates. The presence of polymorphisms within the amplified ESV sequence fragment of T. nativa T. britovi and T. pseudospiralis was confirmed by sequencing of the cloned PCR products. Novel sequences were discovered and deposited in GenBank (GenBank IDs: JN971020-JN971027, JN120902.1, JN120903.1, JN120904.1, JN120906.1, JN120905.1). Screening the ESV region of Trichinella for polymorphism is possible using the genotyping assay Ribo HRM at the current state of its development. The Ribo HRM assay could be useful in phylogenetic studies of the Trichinella genus. Copyright © 2012 Elsevier B.V. All rights reserved.
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
Use of a New High Resolution Melting Method for Genotyping Pathogenic Leptospira spp.
Directory of Open Access Journals (Sweden)
Florence Naze
Full Text Available Leptospirosis is a worldwide zoonosis that is endemic in tropical areas, such as Reunion Island. The species Leptospira interrogans is the primary agent in human infections, but other pathogenic species, such as L. kirschner and L. borgpetersenii, are also associated with human leptospirosis.In this study, a melting curve analysis of the products that were amplified with the primer pairs lfb1 F/R and G1/G2 facilitated an accurate species classification of Leptospira reference strains. Next, we combined an unsupervised high resolution melting (HRM method with a new statistical approach using primers to amplify a two variable-number tandem-repeat (VNTR for typing at the subspecies level. The HRM analysis, which was performed with ScreenClust Software, enabled the identification of genotypes at the serovar level with high resolution power (Hunter-Gaston index 0.984. This method was also applied to Leptospira DNA from blood samples that were obtained from Reunion Island after 1998. We were able to identify a unique genotype that is identical to that of the L. interrogans serovars Copenhageni and Icterohaemorrhagiae, suggesting that this genotype is the major cause of leptospirosis on Reunion Island.Our simple, rapid, and robust genotyping method enables the identification of Leptospira strains at the species and subspecies levels and supports the direct genotyping of Leptospira in biological samples without requiring cultures.
DEFF Research Database (Denmark)
Studer, Bruno; Jensen, Louise Bach; Fiil, Alice
2009-01-01
High resolution melting curve analysis (HRM) measures dissociation of double stranded DNA of a PCR product amplified in the presence of a saturating fluorescence dye. Recently, HRM proved successful to genotype DNA sequence polymorphisms such as SSRs and SNPs based on the shape of the melting...... curves. In this study, HRM was used for simultaneous screening and genotyping of genic DNA sequence polymorphisms identified in the Lolium perenne F2 mapping population VrnA. Melting profiles of PCR products amplified from previously published gene loci and from a novel gene putatively involved...
High peak power picosecond hybrid fiber and solid-state amplifier system
International Nuclear Information System (INIS)
Wushouer, X; Yan, P; Yu, H; Liu, Q; Fu, X; Yan, X; Gong, M
2010-01-01
We report the high peak power picosecond hybrid fiber and solid-state laser amplifier system. The passively mode-locked solid-state seed source produced an average power of 1.8 W with pulse width of 14 ps and repetition rate of 86 MHz. It was directly coupled into the first Yb-doped polarized photonic crystal fiber amplifier stage. To avoid the nonlinear effects in fiber, the output power from the first stage was merely amplified to 24 W with the narrow spectra broadening of 0.21 nm. For the improvement of the peak power, the dual-end pumped composite Nd:YVO 4 amplifier system has been chosen at the second stage. To reduce the serious thermal effect, the thermally bonded composite YVO 4 – Nd:YVO 4 – YVO 4 rod crystal was used as the gain medium. The 53 W TEM 00 mode with the peak power of 40 kW, beam quality of M 2 < 1.15, corresponding to the optical-optical efficiency of 42.4% was obtained at the hybrid amplifier laser system. The system allows using a low power seed source and demonstrates an increase in the peak power beyond a fiber master oscillator power amplifier's (MOPA's) limit
International Nuclear Information System (INIS)
Xie, M.; Kim, K.J.
1995-01-01
In a high gain free electron laser amplifier based on Self-Amplified Spontaneous Emission (SASE) the spontaneous radiation generated by an electron beam near the undulator entrance is amplified many orders of magnitude along the undulator. The transverse coherence properties of the amplified radiation depends on both the amplification process and the coherence of the seed radiation (the undulator radiation generated in the first gain length or so). The evolution of the transverse coherence in the amplification process is studied based on the solution of the coupled Maxwell-Vlasov equations including higher order transverse modes. The coherence of the seed radiation is determined by the number of coherent modes in the phase space area of the undulator radiation. We discuss the criterion of transverse coherence and identify governing parameters over a broad range of parameters. In particular we re-examine the well known emittance criterion for the undulator radiation, which states that full transverse coherence is guaranteed if the rms emittance is smaller than the wavelength divided by 4π. It is found that this criterion is modified for SASE because of the different optimization conditions required for the electron beam. Our analysis is a generalization of the previous study by Yu and Krinsky for the case of vanishing emittance with parallel electron beam. Understanding the transverse coherence of SASE is important for the X-ray free electron laser projects now under consideration at SLAC and DESY
Benet, James
1993-01-01
The final report describes the work performed from 9 Jun. 1992 to 31 Jul. 1993 on the NASA Satellite Communications Application Research (SCAR) Phase 2 program, Efficient High Power, Solid State Amplifier for EHF Communications. The purpose of the program was to demonstrate the feasibility of high-efficiency, high-power, EHF solid state amplifiers that are smaller, lighter, more efficient, and less costly than existing traveling wave tube (TWT) amplifiers by combining the output power from up to several hundred solid state amplifiers using a unique orthomode spatial power combiner (OSPC).
Impact of gain saturation on the mode instability threshold in high-power fiber amplifiers
DEFF Research Database (Denmark)
Hansen, Kristian Rymann; Lægsgaard, Jesper
2014-01-01
We present a coupled-mode model of transverse mode instability in high-power fiber amplifiers, which takes the effect of gain saturation into account. The model provides simple semi-analytical formulas for the mode instability threshold, which are valid also for highly saturated amplifiers...
Very fast, high peak-power, planar triode amplifiers for driving optical gates
International Nuclear Information System (INIS)
Howland, M.M.; Davis, S.J.; Gagnon, W.L.
1979-01-01
Recent extensions of the peak power capabilities of planar triodes have made possible the latter's use as very fast pulse amplifiers, to drive optical gates within high-power Nd:glass laser chains. These pulse amplifiers switch voltages in the 20 kV range with rise times of a few nanoseconds, into crystal optical gates that are essentially capacitive loads. This paper describes a simplified procedure for designing these pulse amplifiers. It further outlines the use of bridged-T constant resistance networks to transform load capacitance into pure resistance, independent of frequency
Directory of Open Access Journals (Sweden)
Yanbin Hou
2016-01-01
Full Text Available Compared with conventional Class-A, Class-B, and Class-AB amplifiers, Class-D amplifier, also known as switching amplifier, employs pulse width modulation (PWM technology and solid-state switching devices, capable of achieving much higher efficiency. However, PWM-based switching amplifier is usually designed for low-voltage application, offering a maximum output voltage of several hundred Volts. Therefore, a step-up transformer is indispensably adopted in PWM-based Class-D amplifier to produce high-voltage output. In this paper, a switching amplifier without step-up transformer is developed based on digital pulse step modulation (PSM and hybrid multilevel converter. Under the control of input signal, cascaded power converters with separate DC sources operate in PSM switch mode to directly generate high-voltage and high-power output. The relevant topological structure, operating principle, and design scheme are introduced. Finally, a prototype system is built, which can provide power up to 1400 Watts and peak voltage up to ±1700 Volts. And the performance, including efficiency, linearity, and distortion, is evaluated by experimental tests.
Development of high sensitivity transimpedance amplifier module for self powered neutron detectors
International Nuclear Information System (INIS)
Khan, T.K.; Tamboli, P.K.; Antony, J.; Balasubramanian, R.; Agilandaeswari, K.; Pramanik, M.
2010-01-01
This paper describes design and development of a Transimpedance Amplifier for amplification of very low current from in core Self Powered Neutron Detectors (SPND). Measurement of neutron flux is very important for operation, control and protection of Nuclear Power Plant (NPP). SPND is used to measure Reactor incore flux/power. Based on sensitivity of emitter material used in SPND, pitch length and neutron flux (power level); the current output from SPND varies from few pA to few μA. The described amplifier is suitable to use for this current range. The amplifier provides a very high gain using a resistive T network feedback topology. The amplifier is designed in two stages using ultra low bias current FET OPAMPs. Design of Transimpedance amplifier is carefully done to include ultra low input bias current, low offset voltage and noise. The amplifier has in built test facility for calibration and on line test facility for measurement of insulation resistance (IR). The amplifier module has on board isolated DC-DC converter circuit complying MIL/STD/461C/D which generate isolated +/-15V and +12V supply to provide parameter to parameter ground isolation and independence among each module/signal.The output from the amplifier is 0V to 6V for 0 to 150%FP. The design is simulated in computer and amplifier used at TAPS-3 was modified as per new design and has been tested at TAPS-3 site. The amplifier performed satisfactorily. The results showed that the IR measurement technique adopted in the design can tolerate lower IR of SPND in existing design. (author)
Pan, Hsuan-yu
2010-01-01
This research work aims on exploiting SiGe HBT technologies in high dynamic range wideband RF linear-in- dB envelope detectors and linear amplifiers. First, an improved all-npn broadband highly linear SiGe HBT differential amplifier is presented based on a variation of Caprio's Quad. A broadband linear amplifier with 46dBm OIP₃ at 20MHz, 34dBm OIP₃ at 1GHz, 6dB noise figure and 10.3dBm P₁dB is demonstrated. Second, an improved exact dynamic model of a fast-settling linear-in-dB Automatic Gain...
Pulse amplifier with high 'common mode rejection'
International Nuclear Information System (INIS)
Ijlst, P.
1987-01-01
The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)
Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley
Directory of Open Access Journals (Sweden)
Bartoš Jan
2008-06-01
Full Text Available Abstract Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA. Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which
Near-Atomic Resolution Structure of a Highly Neutralizing Fab Bound to Canine Parvovirus.
Organtini, Lindsey J; Lee, Hyunwook; Iketani, Sho; Huang, Kai; Ashley, Robert E; Makhov, Alexander M; Conway, James F; Parrish, Colin R; Hafenstein, Susan
2016-11-01
Canine parvovirus (CPV) is a highly contagious pathogen that causes severe disease in dogs and wildlife. Previously, a panel of neutralizing monoclonal antibodies (MAb) raised against CPV was characterized. An antibody fragment (Fab) of MAb E was found to neutralize the virus at low molar ratios. Using recent advances in cryo-electron microscopy (cryo-EM), we determined the structure of CPV in complex with Fab E to 4.1 Å resolution, which allowed de novo building of the Fab structure. The footprint identified was significantly different from the footprint obtained previously from models fitted into lower-resolution maps. Using single-chain variable fragments, we tested antibody residues that control capsid binding. The near-atomic structure also revealed that Fab binding had caused capsid destabilization in regions containing key residues conferring receptor binding and tropism, which suggests a mechanism for efficient virus neutralization by antibody. Furthermore, a general technical approach to solving the structures of small molecules is demonstrated, as binding the Fab to the capsid allowed us to determine the 50-kDa Fab structure by cryo-EM. Using cryo-electron microscopy and new direct electron detector technology, we have solved the 4 Å resolution structure of a Fab molecule bound to a picornavirus capsid. The Fab induced conformational changes in regions of the virus capsid that control receptor binding. The antibody footprint is markedly different from the previous one identified by using a 12 Å structure. This work emphasizes the need for a high-resolution structure to guide mutational analysis and cautions against relying on older low-resolution structures even though they were interpreted with the best methodology available at the time. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
An 8–18 GHz broadband high power amplifier
International Nuclear Information System (INIS)
Wang Lifa; Yang Ruixia; Li Yanlei; Wu Jingfeng
2011-01-01
An 8–18 GHz broadband high power amplifier (HPA) with a hybrid integrated circuit (HIC) is designed and fabricated. This HPA is achieved with the use of a 4-fingered micro-strip Lange coupler in a GaAs MMIC process. In order to decrease electromagnetic interference, a multilayer AlN material with good heat dissipation is adopted as the carrier of the power amplifier. When the input power is 25 dBm, the saturated power of the continuous wave (CW) outputted by the power amplifier is more than 39 dBm within the frequency range of 8–13 GHz, while it is more than 38.6 dBm within other frequency ranges. We obtain the peak power output, 39.4 dBm, at the frequency of 11.9 GHz. In the whole frequency band, the power-added efficiency is more than 18%. When the input power is 18 dBm, the small signal gain is 15.7 ± 0.7 dB. The dimensions of the HPA are 25 × 15 × 1.5 mm 3 . (semiconductor integrated circuits)
Rapid detection of Echinococcus species by a high-resolution melting (HRM) approach.
Santos, Guilherme Brzoskowski; Espínola, Sergio Martín; Ferreira, Henrique Bunselmeyer; Margis, Rogerio; Zaha, Arnaldo
2013-11-14
High-resolution melting (HRM) provides a low-cost, fast and sensitive scanning method that allows the detection of DNA sequence variations in a single step, which makes it appropriate for application in parasite identification and genotyping. The aim of this work was to implement an HRM-PCR assay targeting part of the mitochondrial cox1 gene to achieve an accurate and fast method for Echinococcus spp. differentiation. For melting analysis, a total of 107 samples from seven species were used in this study. The species analyzed included Echinococcus granulosus (n = 41) and Echinococcus ortleppi (n = 50) from bovine, Echinococcus vogeli (n = 2) from paca, Echinococcus oligarthra (n = 3) from agouti, Echinococcus multilocularis (n = 6) from monkey and Echinococcus canadensis (n = 2) and Taenia hydatigena (n = 3) from pig. DNA extraction was performed, and a 444-bp fragment of the cox1 gene was amplified. Two approaches were used, one based on HRM analysis, and a second using SYBR Green Tm-based. In the HRM analysis, a specific profile for each species was observed. Although some species exhibited almost the same melting temperature (Tm) value, the HRM profiles could be clearly discriminated. The SYBR Green Tm-based analysis showed differences between E. granulosus and E. ortleppi and between E. vogeli and E. oligarthra. In this work, we report the implementation of HRM analysis to differentiate species of the genus Echinococcus using part of the mitochondrial gene cox1. This method may be also potentially applied to identify other species belonging to the Taeniidae family.
Development of amplifier and shaper for high-rate MWPC
International Nuclear Information System (INIS)
Kamiji, Ichinori; Nanjo, Hajime; Kawasaki, Naoki; Maeda, Yosuke; Naito, Daichi; Seki, Shigeto; Nakagiri, Kota; Sasao, Noboru; Nomura, Tadashi
2015-01-01
A multi-wire proportional chamber (MWPC) will be used as an in-beam charged particle detector for the J-PARC E14 (KOTO) experiment. The maximum counting rate of the MWPC is expected to be up to 1 MHz per channel due to the high neutron and photon flux, expected to be 1 GHz for the 30 x 30 cm"2 area. An amplifier to cope with such high counting-rate is required. We developed a prototype of such amplifier, which has a charge preamplifier with the integration time of 3 ns and a pulse shaping part with three pole-zero cancellation networks. The shaper reduced the characteristic long tail lasting tens of microseconds in the signal of MWPC to 150 ns. Its performance has been tested by using a single-channel MWPC which has almost the same geometrical parameters as the MWPC to be installed in the KOTO experiment. (author)
The Fragmentation Criteria in Local Vertically Stratified Self-gravitating Disk Simulations
Energy Technology Data Exchange (ETDEWEB)
Baehr, Hans; Klahr, Hubert [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Kratter, Kaitlin M., E-mail: baehr@mpia.de [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States)
2017-10-10
Massive circumstellar disks are prone to gravitational instabilities, which trigger the formation of spiral arms that can fragment into bound clumps under the right conditions. Two-dimensional simulations of self-gravitating disks are useful starting points for studying fragmentation because they allow high-resolution simulations of thin disks. However, convergence issues can arise in 2D from various sources. One of these sources is the 2D approximation of self-gravity, which exaggerates the effect of self-gravity on small scales when the potential is not smoothed to account for the assumed vertical extent of the disk. This effect is enhanced by increased resolution, resulting in fragmentation at longer cooling timescales β . If true, it suggests that the 3D simulations of disk fragmentation may not have the same convergence problem and could be used to examine the nature of fragmentation without smoothing self-gravity on scales similar to the disk scale height. To that end, we have carried out local 3D self-gravitating disk simulations with simple β cooling with fixed background irradiation to determine if 3D is necessary to properly describe disk fragmentation. Above a resolution of ∼40 grid cells per scale height, we find that our simulations converge with respect to the cooling timescale. This result converges in agreement with analytic expectations which place a fragmentation boundary at β {sub crit} = 3.
Integration of fragment screening and library design.
Siegal, Gregg; Ab, Eiso; Schultz, Jan
2007-12-01
With more than 10 years of practical experience and theoretical analysis, fragment-based drug discovery (FBDD) has entered the mainstream of the pharmaceutical and biotech industries. An array of biophysical techniques has been used to detect the weak interaction between a fragment and the target. Each technique presents its own requirements regarding the fragment collection and the target; therefore, in order to optimize the potential of FBDD, the nature of the target should be a driving factor for simultaneous development of both the library and the screening technology. A roadmap is now available to guide fragment-to-lead evolution when structural information is available. The next challenge is to apply FBDD to targets for which high-resolution structural information is not available.
Thomas, N.; Rueda, X.; Lambin, E.; Mendenhall, C. D.
2012-12-01
Large intact forested regions of the world are known to be critical to maintaining Earth's climate, ecosystem health, and human livelihoods. Remote sensing has been successfully implemented as a tool to monitor forest cover and landscape dynamics over broad regions. Much of this work has been done using coarse resolution sensors such as AVHRR and MODIS in combination with moderate resolution sensors, particularly Landsat. Finer scale analysis of heterogeneous and fragmented landscapes is commonly performed with medium resolution data and has had varying success depending on many factors including the level of fragmentation, variability of land cover types, patch size, and image availability. Fine scale tree cover in mixed agricultural areas can have a major impact on biodiversity and ecosystem sustainability but may often be inadequately captured with the global to regional (coarse resolution and moderate resolution) satellite sensors and processing techniques widely used to detect land use and land cover changes. This study investigates whether advanced remote sensing methods are able to assess and monitor percent tree canopy cover in spatially complex human-dominated agricultural landscapes that prove challenging for traditional mapping techniques. Our study areas are in high altitude, mixed agricultural coffee-growing regions in Costa Rica and the Colombian Andes. We applied Random Forests regression tree analysis to Landsat data along with additional spectral, environmental, and spatial variables to predict percent tree canopy cover at 30m resolution. Image object-based texture, shape, and neighborhood metrics were generated at the Landsat scale using eCognition and included in the variable suite. Training and validation data was generated using high resolution imagery from digital aerial photography at 1m to 2.5 m resolution. Our results are promising with Pearson's correlation coefficients between observed and predicted percent tree canopy cover of .86 (Costa
Exploration of the fragmentation of laser shock-melted aluminum using x-ray backlighting
Directory of Open Access Journals (Sweden)
Lin Zhang
2016-05-01
Full Text Available The fragmentation of shock-melted metal material is an important scientific problem in shock physics and is suitable for experimentally investigating by the laser-driven x-ray backlighting technique. This letter reports on the exploration of laser shock-melted aluminum fragmentation by means of x-ray backlighting at the SGII high energy facility in China. High-quality and high-resolution radiographs with negligible motion blur were obtained and these images enabled analysis of the mass distribution of the fragmentation product.
Hek, A.P. de; Hunneman, P.A.H.; Demmler, M.; Hulsmann, A.
1999-01-01
ln this paper the development and measurement results of a compact broadband 9-Watt high efficient X-band high-power amplifier are discussed. The described amplifier has the following state-of-the art performance: an average ouput power of 9 Watt, a gain of 20 dB and an average Power Added
Giant Pulse Phenomena in a High Gain Erbium Doped Fiber Amplifier
Li, Stephen X.; Merritt, Scott; Krainak, Michael A.; Yu, Anthony
2018-01-01
High gain Erbium Doped Fiber Amplifiers (EDFAs) are vulnerable to optical damage when unseeded, e.g. due to nonlinear effects that produce random, spontaneous Q-switched (SQS) pulses with high peak power, i.e. giant pulses. Giant pulses can damage either the components within a high gain EDFA or external components and systems coupled to the EDFA. We explore the conditions under which a reflective, polarization-maintaining (PM), core-pumped high gain EDFA generates giant pulses, provide details on the evolution of normal pulses into giant pulses, and provide results on the transient effects of giant pulses on an amplifier's fused-fiber couplers, an effect which we call Fiber Overload Induced Leakage (FOIL). While FOIL's effect on fused-fiber couplers is temporary, its damage to forward pump lasers in a high gain EDFA can be permanent.
Amplified OTDR Systems for Multipoint Corrosion Monitoring
Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.
2012-01-01
We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017
High-resolution X-ray television and high-resolution video recorders
International Nuclear Information System (INIS)
Haendle, J.; Horbaschek, H.; Alexandrescu, M.
1977-01-01
The improved transmission properties of the high-resolution X-ray television chain described here make it possible to transmit more information per television image. The resolution in the fluoroscopic image, which is visually determined, depends on the dose rate and the inertia of the television pick-up tube. This connection is discussed. In the last few years, video recorders have been increasingly used in X-ray diagnostics. The video recorder is a further quality-limiting element in X-ray television. The development of function patterns of high-resolution magnetic video recorders shows that this quality drop may be largely overcome. The influence of electrical band width and number of lines on the resolution in the X-ray television image stored is explained in more detail. (orig.) [de
International Nuclear Information System (INIS)
Bagnoud, V.
2004-01-01
We report on a high-energy, high-average-power optical parametric chirped-pulse amplifier developed as the front end for the OMEGA EP laser. The amplifier provides a gain larger than 109 in two stages leading to a total energy of 400 mJ with a pump-to-signal conversion efficiency higher than 25%
Ma, Wenxiu; Ay, Ferhat; Lee, Choli; Gulsoy, Gunhan; Deng, Xinxian; Cook, Savannah; Hesson, Jennifer; Cavanaugh, Christopher; Ware, Carol B; Krumm, Anton; Shendure, Jay; Blau, C Anthony; Disteche, Christine M; Noble, William S; Duan, ZhiJun
2018-06-01
The folding and three-dimensional (3D) organization of chromatin in the nucleus critically impacts genome function. The past decade has witnessed rapid advances in genomic tools for delineating 3D genome architecture. Among them, chromosome conformation capture (3C)-based methods such as Hi-C are the most widely used techniques for mapping chromatin interactions. However, traditional Hi-C protocols rely on restriction enzymes (REs) to fragment chromatin and are therefore limited in resolution. We recently developed DNase Hi-C for mapping 3D genome organization, which uses DNase I for chromatin fragmentation. DNase Hi-C overcomes RE-related limitations associated with traditional Hi-C methods, leading to improved methodological resolution. Furthermore, combining this method with DNA capture technology provides a high-throughput approach (targeted DNase Hi-C) that allows for mapping fine-scale chromatin architecture at exceptionally high resolution. Hence, targeted DNase Hi-C will be valuable for delineating the physical landscapes of cis-regulatory networks that control gene expression and for characterizing phenotype-associated chromatin 3D signatures. Here, we provide a detailed description of method design and step-by-step working protocols for these two methods. Copyright © 2018 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gaudefroy, L., E-mail: laurent.gaudefroy@cea.fr [CEA, DAM, DIF, F-91297 Arpajon (France); Roger, T., E-mail: roger@ganil.fr [GANIL, CEA/DSM-CNRS/IN2P3, BP 55027, F-14076 Caen (France); Pancin, J., E-mail: pancin@ganil.fr [GANIL, CEA/DSM-CNRS/IN2P3, BP 55027, F-14076 Caen (France); Spitaels, C. [GANIL, CEA/DSM-CNRS/IN2P3, BP 55027, F-14076 Caen (France); Aupiais, J. [CEA, DAM, DIF, F-91297 Arpajon (France); Mottier, J. [Institut de Physique Nucléaire, Université Paris-Sud-11-CNRS-IN2P3, F-91406 Orsay (France)
2017-05-21
We present a twin Frisch-grid ionization chamber. The detector is meant to provide high selective power for the study of delayed gamma-ray spectroscopy of fission fragments produced via {sup 252}Cf spontaneous fission. A mean energy resolution on the kinetic energy of fission fragments of 675 keV (FWHM) is achieved and allows us to resolve masses of fragments for fission events where neutron emission is not energetically possible. The mean mass resolution measured for these particular events amounts to 0.54 mass units (FWHM). For fission events with neutron emission a resolution of 4 mass units (FWHM) is reported. Information on fragment emission angle is measured with a resolution of 0.1 on the difference of the cosines determined for both halves of the detector. A charge resolution of 4.5 charge units (FWHM) is also demonstrated.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].
Chen, Suiqing; Lu, Xiaolei; Wang, Lili
2011-05-01
To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.
International Nuclear Information System (INIS)
Bidwell, S.W.; Radack, D.J.; Antonsen, T.M. Jr.; Booske, J.H.; Carmel, Y.; Destler, W.W.; Granatstein, V.L.; Levush, B.; Latham, P.E.; Zhang, Z.X.
1990-01-01
A high-average-power FEL amplifier operating at submillimeter frequencies is under development at the University of Maryland. Program goals are to produce a CW, ∼1 MW, FEL amplifier source at frequencies between 280 GHz and 560 GHz. To this end, a high-gain, high-efficiency, tapered FEL amplifier using a sheet electron beam and a short-period (superconducting) wiggler has been chosen. Development of this amplifier is progressing in three stages: (1) beam propagation through a long length (∼1 m) of short period (λ ω = 1 cm) wiggler, (2) demonstration of a proof-of-principle amplifier experiment at 98 GHz, and (3) designs of a superconducting tapered FEL amplifier meeting the ultimate design goal specifications. 17 refs., 1 fig., 1 tab
Stress Recovery Effects of High- and Low-Frequency Amplified Music on Heart Rate Variability.
Nakajima, Yoshie; Tanaka, Naofumi; Mima, Tatsuya; Izumi, Shin-Ichi
Sounds can induce autonomic responses in listeners. However, the modulatory effect of specific frequency components of music is not fully understood. Here, we examined the role of the frequency component of music on autonomic responses. Specifically, we presented music that had been amplified in the high- or low-frequency domains. Twelve healthy women listened to white noise, a stress-inducing noise, and then one of three versions of a piece of music: original, low-, or high-frequency amplified. To measure autonomic response, we calculated the high-frequency normalized unit (HFnu), low-frequency normalized unit, and the LF/HF ratio from the heart rate using electrocardiography. We defined the stress recovery ratio as the value obtained after participants listened to music following scratching noise, normalized by the value obtained after participants listened to white noise after the stress noise, in terms of the HFnu, low-frequency normalized unit, LF/HF ratio, and heart rate. Results indicated that high-frequency amplified music had the highest HFnu of the three versions. The stress recovery ratio of HFnu under the high-frequency amplified stimulus was significantly larger than that under the low-frequency stimulus. Our results suggest that the high-frequency component of music plays a greater role in stress relief than low-frequency components.
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
International Nuclear Information System (INIS)
Thorngate, J.H.; Christian, D.J.
1977-01-01
The performance of various reflector geometries, light coupling liquids, photomultiplier tubes, preamplifiers and linear amplifiers were compared and the configuration found that optimized the combination of pulse-height resolution and pulse-shape discrimination. The best combination used a hemispherical reflector, filled with distilled water, coupled to an 8575 photomultiplier tube, the output of which was conditioned by a special integrating preamplifier and a double-delay-line linear amplifier. Careful choice of the scintillator, sample preparation procedures, and electronic apparatus can produce liquid-scintillation alpha spectroscopy with a pulse-height resolution of 300 keV, or less, and, by using pulse-shape discrimination, background levels as low as 0.01 counts/min. (author)
Development of High Power Amplifiers for Space and Ground-based Applications
DEFF Research Database (Denmark)
Hernández, Carlos Cilla
The power amplifier used in the transmitter of a microwave system is a key issue, and it derermines the system performance, cost, power consumption and reliability to a considerable extent. Traditionally, most of high power amplifiers used in military and commercial applications were tube......, the device was delivering power levels larger than 75 W, PAE >35% and gain oscillating between 7.5 +/- 0.5 dB. Measurements were shifted down in frequency 1 GHz, but simulations predicted maximum power levels similar to the ones measured....
Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters
DEFF Research Database (Denmark)
Wang, Z.; Durhuus, T.; Mikkelsen, Benny
1994-01-01
A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....
Quantification of habitat fragmentation reveals extinction risk in terrestrial mammals
Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; King, Sarah R. B.; Rondinini, Carlo; Boitani, Luigi
2017-01-01
Although habitat fragmentation is often assumed to be a primary driver of extinction, global patterns of fragmentation and its relationship to extinction risk have not been consistently quantified for any major animal taxon. We developed high-resolution habitat fragmentation models and used phylogenetic comparative methods to quantify the effects of habitat fragmentation on the world’s terrestrial mammals, including 4,018 species across 26 taxonomic Orders. Results demonstrate that species with more fragmentation are at greater risk of extinction, even after accounting for the effects of key macroecological predictors, such as body size and geographic range size. Species with higher fragmentation had smaller ranges and a lower proportion of high-suitability habitat within their range, and most high-suitability habitat occurred outside of protected areas, further elevating extinction risk. Our models provide a quantitative evaluation of extinction risk assessments for species, allow for identification of emerging threats in species not classified as threatened, and provide maps of global hotspots of fragmentation for the world’s terrestrial mammals. Quantification of habitat fragmentation will help guide threat assessment and strategic priorities for global mammal conservation. PMID:28673992
Enhanced timing channel for spectroscopy amplifiers
Energy Technology Data Exchange (ETDEWEB)
Ianakiev, K; Grigorov, N [Inst. for Nuclear Research and Nuclear Energy, Sofia (Bulgaria)
1996-12-31
Purpose of this paper is to analyze noise and timing performance of some methods of filtering in the fast channel. Implementation of RLC-filter into a semi-Gaussian amplifier allows to obtain the time resolution of 420 ns. 5 refs.
A high gain wide dynamic range transimpedance amplifier for optical receivers
International Nuclear Information System (INIS)
Liu Lianxi; Zou Jiao; Liu Shubin; Niu Yue; Zhu Zhangming; Yang Yintang; En Yunfei
2014-01-01
As the front-end preamplifiers in optical receivers, transimpedance amplifiers (TIAs) are commonly required to have a high gain and low input noise to amplify the weak and susceptible input signal. At the same time, the TIAs should possess a wide dynamic range (DR) to prevent the circuit from becoming saturated by high input currents. Based on the above, this paper presents a CMOS transimpedance amplifier with high gain and a wide DR for 2.5 Gbit/s communications. The TIA proposed consists of a three-stage cascade pull push inverter, an automatic gain control circuit, and a shunt transistor controlled by the resistive divider. The inductive-series peaking technique is used to further extend the bandwidth. The TIA proposed displays a maximum transimpedance gain of 88.3 dBΩ with the −3 dB bandwidth of 1.8 GHz, exhibits an input current dynamic range from 100 nA to 10 mA. The output voltage noise is less than 48.23 nV/√Hz within the −3 dB bandwidth. The circuit is fabricated using an SMIC 0.18 μm 1P6M RFCMOS process and dissipates a dc power of 9.4 mW with 1.8 V supply voltage. (semiconductor integrated circuits)
Note: A temperature-stable low-noise transimpedance amplifier for microcurrent measurement
Xie, Kai; Shi, Xueyou; Zhao, Kai; Guo, Lixin; Zhang, Hanlu
2017-02-01
Temperature stability and noise characteristics often run contradictory in microcurrent (e.g., pA-scale) measurement instruments because low-noise performance requires high-value resistors with relatively poor temperature coefficients. A low-noise transimpedance amplifier with high-temperature stability, which involves an active compensation mechanism to overcome the temperature drift mainly caused by high-value resistors, is presented. The implementation uses a specially designed R-2R compensating network to provide programmable current gain with extra-fine trimming resolution. The temperature drifts of all components (e.g., feedback resistors, operational amplifiers, and the R-2R network itself) are compensated simultaneously. Therefore, both low-temperature drift and ultra-low-noise performance can be achieved. With a current gain of 1011 V/A, the internal current noise density was about 0.4 fA/√Hz, and the average temperature coefficient was 4.3 ppm/K at 0-50 °C. The amplifier module maintains accuracy across a wide temperature range without additional thermal stabilization, and its compact size makes it especially suitable for high-precision, low-current measurement in outdoor environments for applications such as electrochemical emission supervision, air pollution particles analysis, radiation monitoring, and bioelectricity.
Performance characteristics of high resolution semiconductor gamma ray spectrometry system
International Nuclear Information System (INIS)
Ko Ko Naing
1994-05-01
A high purity germanium (HPGe) gamma-ray detector has been used in Nuclear Research Laboratory, Department of Physics, Yangon University for over fourteen years. Now it is still being used and it is coupled to new peripheral devices, such as spectroscopy amplifier, analog to digital converter and computer fit-in S-100 multichannel analyser. Therefore, it is necessary to determine the important parameters: energy resolution, detecting efficiency and relative efficiency of the system. In the present work, these parameters were obtained by using mixed calibrated source. The results were compared to the data given by the manufacturer. Moreover, the parameters of another γ-ray detecting system NaI(T1) were also determined. In conclusion the results obtained from the above two measurements were compared and discussed
Performance characteristics of high resolution semiconductor gamma ray spectrometry system
Energy Technology Data Exchange (ETDEWEB)
Naing, Ko Ko
1994-05-01
A high purity germanium (HPGe) gamma-ray detector has been used in Nuclear Research Laboratory, Department of Physics, Yangon University for over fourteen years. Now it is still being used and it is coupled to new peripheral devices, such as spectroscopy amplifier, analog to digital converter and computer fit-in S-100 multichannel analyser. Therefore, it is necessary to determine the important parameters: energy resolution, detecting efficiency and relative efficiency of the system. In the present work, these parameters were obtained by using mixed calibrated source. The results were compared to the data given by the manufacturer. Moreover, the parameters of another {gamma}-ray detecting system NaI(T1) were also determined. In conclusion the results obtained from the above two measurements were compared and discussed
Electrospun amplified fiber optics.
Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario
2015-03-11
All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.
Andeer, Peter; Strand, Stuart E; Stahl, David A
2012-01-01
Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.
High-resolution melting (HRM) for genotyping bovine ephemeral fever virus (BEFV).
Erster, Oran; Stram, Rotem; Menasherow, Shopia; Rubistein-Giuni, Marisol; Sharir, Binyamin; Kchinich, Evgeni; Stram, Yehuda
2017-02-02
In recent years there have been several major outbreaks of bovine ephemeral disease in the Middle East, including Israel. Such occurrences raise the need for quick identification of the viruses responsible for the outbreaks, in order to rapidly identify the entry of viruses that do not belong to the Middle-East BEFV lineage. This challenge was met by the development of a high-resolution melt (HRM) assay. The assay is based on the viral G gene sequence and generation of an algorithm that calculates and evaluates the GC content of various fragments. The algorithm was designed to scan 50- to 200-base-long segments in a sliding-window manner, compare and rank them using an Order of Technique of Preference by Similarity to Ideal Solution (TOPSIS) the technique for order preference by similarity to ideal solution technique, according to the differences in GC content of homologous fragments. Two fragments were selected, based on a match to the analysis criteria, in terms of size and GC content. These fragments were successfully used in the analysis to differentiate between different virus lineages, thus facilitating assignment of the viruses' geographical origins. Moreover, the assay could be used for differentiating infected from vaccinated animales (DIVA). The new algorithm may therefore be useful for development of improved genotyping studies for other viruses and possibly other microorganisms. Copyright © 2016. Published by Elsevier B.V.
Studies of fission fragment yields via high-resolution γ-ray spectroscopy
Wilson, J. N.; Lebois, M.; Qi, L.; Amador-Celdran, P.; Bleuel, D.; Briz, J. A.; Carroll, R.; Catford, W.; Witte, H. De; Doherty, D. T.; Eloirdi, R.; Georgiev, G.; Gottardo, A.; Goasduff, A.; Hadyñska-Klek, K.; Hauschild, K.; Hess, H.; Ingeberg, V.; Konstantinopoulos, T.; Ljungvall, J.; Lopez-Martens, A.; Lorusso, G.; Lozeva, R.; Lutter, R.; Marini, P.; Matea, I.; Materna, T.; Mathieu, L.; Oberstedt, A.; Oberstedt, S.; Panebianco, S.; Podolyak, Zs.; Porta, A.; Regan, P. H.; Reiter, P.; Rezynkina, K.; Rose, S. J.; Sahin, E.; Seidlitz, M.; Serot, O.; Shearman, R.; Siebeck, B.; Siem, S.; Smith, A. G.; Tveten, G. M.; Verney, D.; Warr, N.; Zeiser, F.; Zielinska, M.
2018-03-01
Precise spectroscopic information on the fast neutron induced fission of the 238U(n,f) reaction was recently gained using a new technique which involved coupling of the Miniball high resolution y-ray spectrometer and the LICORNE directional neutron source. The experiment allowed measurement of the isotopic fission yields for around 40 even-even nuclei at an incident neutron energy of around 2 MeV where yield data are very sparse. In addition spectroscopic information on very neutron-rich fission products was obtained. Results were compared to models, both the JEFF-3.1.1 data base and the GEF code, and large discrepancies for the S1 fission mode in the Sn/Mo isotope pair were discovered. This suggests that current models are overestimating the role played by spherical shell effects in fast neutron induced fission. In late 2017 and 2018 the nu-ball hybrid spectrometer will be constructed at the IPN Orsay to perform further experimental investigations with directional neutrons coupled to a powerful hybrid Ge/LaBr3 detector array. This will open up new possibilities for measurements of fission yields for fast-neutron-induced fission using the spectroscopic technique and will be complimentary to other methods being developed.
Studies of fission fragment yields via high-resolution γ-ray spectroscopy
Directory of Open Access Journals (Sweden)
Wilson J.N.
2018-01-01
Full Text Available Precise spectroscopic information on the fast neutron induced fission of the 238U(n,f reaction was recently gained using a new technique which involved coupling of the Miniball high resolution y-ray spectrometer and the LICORNE directional neutron source. The experiment allowed measurement of the isotopic fission yields for around 40 even-even nuclei at an incident neutron energy of around 2 MeV where yield data are very sparse. In addition spectroscopic information on very neutron-rich fission products was obtained. Results were compared to models, both the JEFF-3.1.1 data base and the GEF code, and large discrepancies for the S1 fission mode in the Sn/Mo isotope pair were discovered. This suggests that current models are overestimating the role played by spherical shell effects in fast neutron induced fission. In late 2017 and 2018 the nu-ball hybrid spectrometer will be constructed at the IPN Orsay to perform further experimental investigations with directional neutrons coupled to a powerful hybrid Ge/LaBr3 detector array. This will open up new possibilities for measurements of fission yields for fast-neutron-induced fission using the spectroscopic technique and will be complimentary to other methods being developed.
Giannini, F.; Limiti, E.; Orengo, G.; Serino, A.; De Dominicis, M.
2002-01-01
This paper reports a distributed baseband transimpedance amplifier for optical links up to 10 Gb/s. The amplifier operates as a baseband amplifier with a transimpedance gain of 48 dB Ω and a DC-to-9 GHz bandwidth. Some innovative design techniques to improve gain-bandwidth performance at low and high frequency with an available low-cost GaAs MESFET technology have been developed.
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Structure Annotation and Quantification of Wheat Seed Oxidized Lipids by High-Resolution LC-MS/MS.
Riewe, David; Wiebach, Janine; Altmann, Thomas
2017-10-01
Lipid oxidation is a process ubiquitous in life, but the direct and comprehensive analysis of oxidized lipids has been limited by available analytical methods. We applied high-resolution liquid chromatography-mass spectrometry (LC-MS) and tandem mass spectrometry (MS/MS) to quantify oxidized lipids (glycerides, fatty acids, phospholipids, lysophospholipids, and galactolipids) and implemented a platform-independent high-throughput-amenable analysis pipeline for the high-confidence annotation and acyl composition analysis of oxidized lipids. Lipid contents of 90 different naturally aged wheat ( Triticum aestivum ) seed stocks were quantified in an untargeted high-resolution LC-MS experiment, resulting in 18,556 quantitative mass-to-charge ratio features. In a posthoc liquid chromatography-tandem mass spectrometry experiment, high-resolution MS/MS spectra (5 mD accuracy) were recorded for 8,957 out of 12,080 putatively monoisotopic features of the LC-MS data set. A total of 353 nonoxidized and 559 oxidized lipids with up to four additional oxygen atoms were annotated based on the accurate mass recordings (1.5 ppm tolerance) of the LC-MS data set and filtering procedures. MS/MS spectra available for 828 of these annotations were analyzed by translating experimentally known fragmentation rules of lipids into the fragmentation of oxidized lipids. This led to the identification of 259 nonoxidized and 365 oxidized lipids by both accurate mass and MS/MS spectra and to the determination of acyl compositions for 221 nonoxidized and 295 oxidized lipids. Analysis of 15-year aged wheat seeds revealed increased lipid oxidation and hydrolysis in seeds stored in ambient versus cold conditions. © 2017 The author(s). All Rights Reserved.
Mode control in a high gain relativistic klystron amplifier with 3 GW output power
Wu, Yang; Xie, Hong-Quan; Xu, Zhou
2014-01-01
Higher mode excitation is very serious in the relativistic klystron amplifier, especially for the high gain relativistic amplifier working at tens of kilo-amperes. The mechanism of higher mode excitation is explored in the PIC simulation and it is shown that insufficient separation of adjacent cavities is the main cause of higher mode excitation. So RF lossy material mounted on the drift tube wall is adopted to suppress higher mode excitation. A high gain S-band relativistic klystron amplifier is designed for the beam current of 13 kA and the voltage of 1 MV. PIC simulation shows that the output power is 3.2 GW when the input power is only 2.8 kW.
Comparative Study of Si and SiC MOSFETs for High Voltage Class D Audio Amplifiers
DEFF Research Database (Denmark)
Nielsen, Dennis; Knott, Arnold; Andersen, Michael A. E.
2014-01-01
Silicon (Si) Metal-Oxide-Semiconductor Field-Effect Transistors (MOSFETs) are traditional utilised in class D audio amplifiers. It has been proposed to replace the traditional inefficient electrodynamic transducer with the electrostatic transducer. This imposes new high voltage requirements...... on the MOSFETs of class D amplifiers, and significantly reduces the selection of suitable MOSFETs. As a consequence it is investigated, if Silicon-Carbide (SiC) MOSFETs could represent a valid alternative. The theory of pulse timing errors are revisited for the application of high voltage and capactive loaded...... class D amplifiers. It is shown, that SiC MOSFETs can compete with Si MSOFETs in terms of THD. Validation is done using simulations and a 500 V amplifier driving a 100 nF load. THD+N below 0.3 % is reported...
An optical parametric chirped-pulse amplifier for seeding high repetition rate free-electron lasers
International Nuclear Information System (INIS)
Höppner, H; Hage, A; Tanikawa, T; Schulz, M; Faatz, B; Riedel, R; Prandolini, M J; Teubner, U; Tavella, F
2015-01-01
High repetition rate free-electron lasers (FEL), producing highly intense extreme ultraviolet and x-ray pulses, require new high power tunable femtosecond lasers for FEL seeding and FEL pump-probe experiments. A tunable, 112 W (burst mode) optical parametric chirped-pulse amplifier (OPCPA) is demonstrated with center frequencies ranging from 720–900 nm, pulse energies up to 1.12 mJ and a pulse duration of 30 fs at a repetition rate of 100 kHz. Since the power scalability of this OPCPA is limited by the OPCPA-pump amplifier, we also demonstrate a 6.7–13.7 kW (burst mode) thin-disk OPCPA-pump amplifier, increasing the possible OPCPA output power to many hundreds of watts. Furthermore, third and fourth harmonic generation experiments are performed and the results are used to simulate a seeded FEL with high-gain harmonic generation. (paper)
Modeling of semiconductor optical amplifiers
DEFF Research Database (Denmark)
Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther
We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....
Complex fragment emission at low and high excitation energy
International Nuclear Information System (INIS)
Moretto, L.G.
1986-08-01
Complex fragment emission has been certified as a compound nucleus process at low energies. An extension of the measurements to heavy ion reactions up to 50 MeV/u shows that most complex fragments are emitted by highly excited compound nuclei formed in incomplete fusion reactions. 12 refs., 26 figs
Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer
International Nuclear Information System (INIS)
Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.
2011-01-01
Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)
DEFF Research Database (Denmark)
Fry, N K; Bangsborg, Jette Marie; Bergmans, A
2002-01-01
The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....
BARNARD 59: NO EVIDENCE FOR FURTHER FRAGMENTATION
Energy Technology Data Exchange (ETDEWEB)
Roman-Zuniga, C. G. [Instituto de Astronomia, Universidad Nacional Autonoma de Mexico, Km 103 Carr. Tijuana-Ensenada, Ensenada BC 22860 (Mexico); Frau, P.; Girart, J. M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB, Facultat de Ciencies, Torre C-5p, 08193 Bellaterra, Catalunya (Spain); Alves, Joao F., E-mail: croman@astrosen.unam.mx [Institute of Astronomy, University of Vienna, Tuerkenschanzstr. 17, 1180 Vienna (Austria)
2012-03-10
The dense molecular clump at the center of the Barnard 59 (B59) complex is the only region in the Pipe Nebula that has formed a small, stellar cluster. The previous analysis of a high-resolution near-IR dust extinction map revealed that the nuclear region in B59 is a massive, mostly quiescent clump of 18.9 M{sub Sun }. The clump shows a monolithic profile, possibly indicating that the clump is on the way to collapse, with no evident fragmentation that could lead to another group of star systems. In this paper, we present new analysis that compares the dust extinction map with a new dust emission radio-continuum map of higher spatial resolution. We confirm that the clump does not show any significant evidence for prestellar fragmentation at scales smaller than those probed previously.
BARNARD 59: NO EVIDENCE FOR FURTHER FRAGMENTATION
International Nuclear Information System (INIS)
Román-Zúñiga, C. G.; Frau, P.; Girart, J. M.; Alves, João F.
2012-01-01
The dense molecular clump at the center of the Barnard 59 (B59) complex is the only region in the Pipe Nebula that has formed a small, stellar cluster. The previous analysis of a high-resolution near-IR dust extinction map revealed that the nuclear region in B59 is a massive, mostly quiescent clump of 18.9 M ☉ . The clump shows a monolithic profile, possibly indicating that the clump is on the way to collapse, with no evident fragmentation that could lead to another group of star systems. In this paper, we present new analysis that compares the dust extinction map with a new dust emission radio-continuum map of higher spatial resolution. We confirm that the clump does not show any significant evidence for prestellar fragmentation at scales smaller than those probed previously.
NASA developments in solid state power amplifiers
Leonard, Regis F.
1990-01-01
Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.
Global patterns of fragmentation and connectivity of mammalian carnivore habitat.
Crooks, Kevin R; Burdett, Christopher L; Theobald, David M; Rondinini, Carlo; Boitani, Luigi
2011-09-27
Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation.
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
Study and development of a high resolution β minus radio imager
International Nuclear Information System (INIS)
Charon, Y.
1989-01-01
Charge coupled device (C.C.D.), have already been used to track charged particle beams. We now present another application which combines this sensor with a light-amplifier to develop an imaging detector. This image sensor must detect various β - emittors, at very low counting rates. Furthermore it must perform a 10 μm resolution in order to replace the autoradiograpic films used for molecular hybridization. The first tests were performed on this first configuration (uncooled light amplifier, NE 102 sheets, 60 mm 2 analysis surface). This tests brought forward the light yield and intrisic resolution for various plastic thickness, and for each of the three usual β - emittors: 35 S, 32 P, 3 H. We have then proceeded to modifications: increasing photocathode's sensibility, cooling L.A., trying various scintillating plastics, using various software discrimination techniques. These modifications were gradually and succesfully introduced and the best results were obtained with the 35 S emittor, for which the resolution and the efficiency are respectively 15 μm and 99% (relative to the measured standard sources). Right now, the detector is good enough to produce images of biological slides with nearly the requested resolution and an efficiency more than three thousands times greater than films. Nevertheless, in order to propose the most valuable product, it is necessary to trig the C.C.D. with a coincidence signal, to increase the photocathode sensibility down to the U.V.. All those parameters have been integrated in a new prototype design and will be tested after this publication [fr
High Resolution Melting (HRM) applied to wine authenticity.
Pereira, Leonor; Gomes, Sónia; Castro, Cláudia; Eiras-Dias, José Eduardo; Brazão, João; Graça, António; Fernandes, José R; Martins-Lopes, Paula
2017-02-01
Wine authenticity methods are in increasing demand mainly in Denomination of Origin designations. The DNA-based methodologies are a reliable means of tracking food/wine varietal composition. The main aim of this work was the study of High Resolution Melting (HRM) application as a screening method for must and wine authenticity. Three sample types (leaf, must and wine) were used to validate the three developed HRM assays (Vv1-705bp; Vv2-375bp; and Vv3-119bp). The Vv1 HRM assay was only successful when applied to leaf and must samples. The Vv2 HRM assay successfully amplified all sample types, allowing genotype discrimination based on melting temperature values. The smallest amplicon, Vv3, produced a coincident melting curve shape in all sample types (leaf and wine) with corresponding genotypes. This study presents sensitive, rapid and efficient HRM assays applied for the first time to wine samples suitable for wine authenticity purposes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kato, T.; Kataoka, J.; Nakamori, T.; Kishimoto, A.; Yamamoto, S.; Sato, K.; Ishikawa, Y.; Yamamura, K.; Kawabata, N.; Ikeda, H.; Kamada, K.
2013-05-01
We report the development of a high spatial resolution tweezers-type coincidence gamma-ray camera for medical imaging. This application consists of large-area monolithic Multi-Pixel Photon Counters (MPPCs) and submillimeter pixelized scintillator matrices. The MPPC array has 4 × 4 channels with a three-side buttable, very compact package. For typical operational gain of 7.5 × 105 at + 20 °C, gain fluctuation over the entire MPPC device is only ± 5.6%, and dark count rates (as measured at the 1 p.e. level) amount to acrylic light guide measuring 1 mm thick, and with summing operational amplifiers that compile the signals into four position-encoded analog outputs being used for signal readout. Spatial resolution of 1.1 mm was achieved with the coincidence imaging system using a 22Na point source. These results suggest that the gamma-ray imagers offer excellent potential for applications in high spatial medical imaging.
Design Methodology of High Power Distributed Amplifier Employing Broadband Impedance Transformer
DEFF Research Database (Denmark)
Narendra, Kumar; Zhurbenko, Vitaliy; Collantes, Juan Mari
2009-01-01
A novel topology of a high power distributed amplifier (DA) in combination with a broadband impedance transformer is presented. The advantages of the proposed topology are explored analytically and verified by a full-wave 3D simulations. Stability of the high power DA is verified with the pole...
Development of a high power millimeter wave free-electron laser amplifier
International Nuclear Information System (INIS)
Bidwell, S.W.; Zhang, Z.X.; Antonsen, T.M. Jr.; Destler, W.W.; Granatstein, V.L.; Levush, B.; Rodgers, J.; Freund, H.P.
1992-01-01
Progress on the development of a high-average-power millimeter wave free-electron laser amplifier is reported. Successful sheet electron beam propagation has been observed through a 54 cm long wiggler magnet. One hundred percent transport efficiency is reported with a 15 A, 0.1 cm x 2.0 cm, sheet electron beam through B w = 5.1 kG, λ w = 0.96 cm, planar electromagnet wiggler. Preliminary success with a novel, yet simple, method of side focusing using offset poles is reported. Status of development on a 94 GHz, 180 kW, pulsed amplifier is discussed with results from numerical simulation
High-energy nuclear reaction mechanisms - fission, fragmentation and spallation
International Nuclear Information System (INIS)
Kaufman, S.B.
1987-01-01
Measurements of the correlations in kinetic energy, mass, charge, and angle of coincident fragments formed in high-energy nuclear reactions have helped to characterize the processes of fission, fragmentation and spallation. For example, fission or fission-like two-body breakup mechanisms result in a strong angular correlation between two heavy fragments; in addition, the momentum transfer in the reaction can be deduced from the correlation. Another example is the multiplicity of light charged particles associated with a given heavy fragment, which is a measure of the violence of the collision, thus distinguishing between central and peripheral collisions. A summary of what has been learned about these processes from such studies will be given, along with some suggestions for further experiments
International Nuclear Information System (INIS)
Minehara, E.; Kutschera, W.; Hartog, P.D.; Billquist, P.
1985-01-01
The ANL (Argonne National Laboratory) high-resolution injector has been installed to obtain higher mass resolution and higher preacceleration, and to utilize effectively the full mass range of ATLAS (Argonne Tandem Linac Accelerator System). Preliminary results of the first beam test are reported briefly. The design and performance, in particular a high-mass-resolution magnet with aberration compensation, are discussed. 7 refs., 5 figs., 2 tabs
Quark and gluon fragmentation in high energy e+e- annihilation
International Nuclear Information System (INIS)
Saxon, D.H.
1986-07-01
The paper on quark and gluon fragmentation in high energy e + e - annihilation is based on lectures given at the International School of High Energy Physics, Yugoslavia, 1986. Fragmentation Models, charged particle multiplicity, Bose-Einstein correlations, single particle inclusive distributions, hadrons in jets, leading particle effects, baryon production, comparison of quark and gluon jets, and the string effect, are all discussed. (UK)
Millimeter-wave power amplifiers
du Preez, Jaco
2017-01-01
This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.
Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques
Acar, M.
2011-01-01
In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high
Wide bandwidth transimpedance amplifier for extremely high sensitivity continuous measurements.
Ferrari, Giorgio; Sampietro, Marco
2007-09-01
This article presents a wide bandwidth transimpedance amplifier based on the series of an integrator and a differentiator stage, having an additional feedback loop to discharge the standing current from the device under test (DUT) to ensure an unlimited measuring time opportunity when compared to switched discharge configurations while maintaining a large signal amplification over the full bandwidth. The amplifier shows a flat response from 0.6 Hz to 1.4 MHz, the capability to operate with leakage currents from the DUT as high as tens of nanoamperes, and rail-to-rail dynamic range for sinusoidal current signals independent of the DUT leakage current. Also available is a monitor output of the stationary current to track experimental slow drifts. The circuit is ideal for noise spectral and impedance measurements of nanodevices and biomolecules when in the presence of a physiological medium and in all cases where high sensitivity current measurements are requested such as in scanning probe microscopy systems.
International Nuclear Information System (INIS)
Lau, K.H.
1985-01-01
This thesis has two major parts. The first part of the thesis will describe a high energy cosmic ray detector - the High Energy Isotope Spectrometer Telescope (HEIST). HEIST is a large area (0.25 m 2 sr) balloon-borne isotope spectrometer designed to make high-resolution measurements of isotopes in the element range from neon to nickel (10 less than or equal to Z less than or equal to 28) at energies of about 2 GeV/nucleon. The instrument consists of a stack of 12 NaI(Tl) scintillators, two Cerenkov counters, and two plastic scintillators. The second part of this thesis presents an experimental measurement of the isotopic composition of the fragments from the breakup of high energy 40 Ar and 56 Fe nuclei. Cosmic ray composition studies rely heavily on semi-empirical estimates of the cross-sections for the nuclear fragmentation reactions which alter the composition during propagation through the interstellar medium. Experimentally measured yields of isotopes from the fragmentation of 40 Ar and 56 Fe are compared with calculated yields based on semi-empirical cross-section formulae
High rate amplifier-digitizer system for liquid argon calorimeters
International Nuclear Information System (INIS)
Droege, T.F.; Lobkowicz, F.; Fukushima, Y.
1978-01-01
A low-cost charge amplifier for a liquid argon photon detector and a new method for pulse height analysis are described. This scheme is suitable for high-energy photon detection with high counting rate. Samples of preamplifer output are taken just before and just after the arrival of the charge from the detector. The difference of these samples provides a stable pedestal and rejects low frequency noise. Short two-pulse resolving time (approximately equal to 200ns) is achieved. 6 refs
Amplification of deoxyribonucleic acid (DNA) fragment using two ...
African Journals Online (AJOL)
user
2011-04-11
Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...
Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems
Strategies for dereplication of natural compounds using high-resolution tandem mass spectrometry.
Kind, Tobias; Fiehn, Oliver
2017-09-01
Complete structural elucidation of natural products is commonly performed by nuclear magnetic resonance spectroscopy (NMR), but annotating compounds to most likely structures using high-resolution tandem mass spectrometry is a faster and feasible first step. The CASMI contest 2016 (Critical Assessment of Small Molecule Identification) provided spectra of eighteen compounds for the best manual structure identification in the natural products category. High resolution precursor and tandem mass spectra (MS/MS) were available to characterize the compounds. We used the Seven Golden Rules, Sirius2 and MS-FINDER software for determination of molecular formulas, and then we queried the formulas in different natural product databases including DNP, UNPD, ChemSpider and REAXYS to obtain molecular structures. We used different in-silico fragmentation tools including CFM-ID, CSI:FingerID and MS-FINDER to rank these compounds. Additional neutral losses and product ion peaks were manually investigated. This manual and time consuming approach allowed for the correct dereplication of thirteen of the eighteen natural products.
Tulsiani, S M; Craig, S B; Graham, G C; Cobbold, R C; Dohnt, M F; Burns, M-A; Jansen, C C; Leung, L K-P; Field, H E; Smythe, L D
2010-07-01
High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) is a novel technology that has emerged as a possible method to characterise leptospires to serovar level. RAPD-HRM has recently been used to measure intra-serovar convergence between strains of the same serovar as well as inter-serovar divergence between strains of different serovars. The results indicate that intra-serovar heterogeneity and inter-serovar homogeneity may limit the application of RAPD-HRM in routine diagnostics. They also indicate that genetic attenuation of aged, high-passage-number isolates could undermine the use of RAPD-HRM or any other molecular technology. Such genetic attenuation may account for a general decrease seen in titres of rabbit hyperimmune antibodies over time. Before RAPD-HRM can be further advanced as a routine diagnostic tool, strains more representative of the wild-type serovars of a given region need to be identified. Further, RAPD-HRM analysis of reference strains indicates that the routine renewal of reference collections, with new isolates, may be needed to maintain the genetic integrity of the collections.
Crystal structure of an Okazaki fragment at 2-A resolution
Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.
1992-01-01
In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.
Energy Technology Data Exchange (ETDEWEB)
Shen, Yufeng; Tolic, Nikola; Piehowski, Paul D.; Shukla, Anil K.; Kim, Sangtae; Zhao, Rui; Qu, Yi; Robinson, E. W.; Smith, Richard D.; Pasa-Tolic, Ljiljana
2017-05-01
We report development of an approach providing high-resolution RPLC of proteins and its utility for mass spectrometry-based top-down proteomics. A chromatographic peak capacity of ~450 was achieved for proteins and large polypeptides having MWs up to 43 kDa in the context of proteomics applications. RPLC column lengths from 20 to 200 cm, particle sizes from 1.5 to 5 m, bonding alkyl chains from C1 to C2, C4, C8, and C18, and particle surface structures that spanned porous, superficially porous (porous shell, core-shell), and nonporous were investigated at pressures up to14K psi. Column length was found as the most important factor for >20 kDa proteins in gradient RPLC, and shortening column length degraded RPLC resolution and sensitivity regardless of the size and surface structure of the packing particles used. The alkyl chains bonded to the silica particle surface significantly affected the RPLC recovery and efficiency, and short alkyl C1-C4 phases provided higher sensitivity and resolution than C8 and C18 phases. Long gradient separations (e.g., >10 hours) with long columns (e.g., 100 cm) were particularly effective in conjunction with use of high accuracy mass spectrometers (e.g., the Orbitrap Elite) for top-down proteomics with improved proteoform coverage by allowing multiple HCD, CID, and ETD dissociation modes. It was also found that HCD produced small fragments useful for proteoform identification, while low energy CID and ETD often complemented HCD by providing large fragments.
The design of a linear L-band high power amplifier for mobile communication satellites
Whittaker, N.; Brassard, G.; Li, E.; Goux, P.
1990-01-01
A linear L-band solid state high power amplifier designed for the space segment of the Mobile Satellite (MSAT) mobile communication system is described. The amplifier is capable of producing 35 watts of RF power with multitone signal at an efficiency of 25 percent and with intermodulation products better than 16 dB below carrier.
Mode control in a high-gain relativistic klystron amplifier
Li, Zheng-Hong; Zhang, Hong; Ju, Bing-Quan; Su, Chang; Wu, Yang
2010-05-01
Middle cavities between the input and output cavity can be used to decrease the required input RF power for the relativistic klystron amplifier. Meanwhile higher modes, which affect the working mode, are also easy to excite in a device with more middle cavities. In order for the positive feedback process for higher modes to be excited, a special measure is taken to increase the threshold current for such modes. Higher modes' excitation will be avoided when the threshold current is significantly larger than the beam current. So a high-gain S-band relativistic klystron amplifier is designed for the beam of current 5 kA and beam voltage 600 kV. Particle in cell simulations show that the gain is 1.6 × 105 with the input RF power of 6.8 kW, and that the output RF power reaches 1.1 GW.
Thermo-optical effects in high-power Ytterbium-doped fiber amplifiers
DEFF Research Database (Denmark)
Hansen, Kristian Rymann; Alkeskjold, Thomas Tanggaard; Broeng, Jes
2011-01-01
We investigate the effect of temperature gradients in high-power Yb-doped fiber amplifiers by a numerical beam propagation model, which takes thermal effects into account in a self-consistent way. The thermally induced change in the refractive index of the fiber leads to a thermal lensing effect...
MMIC for High-Efficiency Ka-BAnd GaN Power Amplifiers (2007043), Phase I
National Aeronautics and Space Administration — This proposal addresses the need for high-efficiency, high-output power amplifiers operating in the Ka-band frequencies. For space communications, the power...
A high efficiency Ku-band radial line relativistic klystron amplifier
Energy Technology Data Exchange (ETDEWEB)
Dang, Fangchao; Zhang, Xiaoping, E-mail: zhangxiaoping@nudt.edu.cn; Zhong, Huihuang; Zhang, Jun; Ju, Jinchuan [College of Optoelectronic Science and Engineering, National University of Defense Technology, Changsha 410073 (China)
2016-07-15
To achieve the gigawatt-level microwave amplification output at Ku-band, a radial-line relativistic klystron amplifier is proposed and investigated in this paper. Different from the annular electron beam in conventional axial relativistic klystron amplifiers, a radial-radiated electron beam is employed in this proposed klystron. Owing to its radially spreading speciality, the electron density and space charge effect are markedly weakened during the propagation in the radial line drift tube. Additionally, the power capacity, especially in the output cavity, is enhanced significantly because of its large volume, which is profitable for the long pulse operation. Particle-in-cell simulation results demonstrate that a high power microwave with the power of 3 GW and the frequency of 14.25 GHz is generated with a 500 kV, 12 kA electron beam excitation and the 30 kW radio-frequency signal injection. The power conversion efficiency is 50%, and the gain is about 50 dB. Meanwhile, there is insignificant electron beam self-excitation in the proposed structure by the adoption of two transverse electromagnetic reflectors. The relative phase difference between the injected signals and output microwaves keeps stable after the amplifier saturates.
Kuptsov, G. V.; Petrov, V. V.; Petrov, V. A.; Laptev, A. V.; Kirpichnikov, A. V.; Pestryakov, E. V.
2018-04-01
The source of instabilities in the multidisk diode-pumped high power Yb:YAG laser amplifier with cryogenic closed-loop cooling in the laser amplification channel of the high-intensity laser system with 1 kHz repetition rate was determined. Dissected copper mounts were designed and used to suppress instabilities and to achieve repeatability of the system. The equilibrium temperature dependency of the active elements on average power was measured. The seed laser for the multidisk amplifier was numerically simulated and designed to allow one to increase pulses output energy after the amplifier up to 500 mJ.
Production of light fragments in hA collisions at high energies
International Nuclear Information System (INIS)
Braun, M.A.; Vechernin, V.V.
1988-12-01
Production of fast relativistic light fragments in hA collisions at high energies is considered. Direct coalescence of produced nucleons into fragments is shown to be the main mechanism for fragment production. The influence of the nuclear field is small and is not described by the well-known Butler-Pearson formulas. The coalescence coefficient strongly depends on the angle and on the behaviour of the fragment wave function at small internucleon distances. (author). 14 refs, 7 figs
Ka-Band AlGaN/GaN HEMT high power and driver amplifier MMICs
Heijningen, M. van; Vliet, F.E. van; Quay, R.; Raay, F. van; Kiefer, R.; Mueller, S.; Krausse, D.; Seelmann-Eggebert, M.; Mikulla, M.; Schlechtweg, M.
2005-01-01
In this paper the MMIC technology, design and characterization of a high power amplifier and driver amplifier MMIC at 30 GHz in AlGaN/GaN HEMT technology are presented. The MMICs are designed using CPW technology on a 390 μm thick SiC substrate. The measured small-signal gain of the driver is 14 dB
International Nuclear Information System (INIS)
Yamagishi, Hideshi; Toh, Kentaro; Nakamura, Tatsuya; Sakasai, Kaoru; Soyama, Kazuhiko
2012-02-01
An ASD-ASIC (Amplifier-Shaper-Discriminator ASIC) with fast response and low noise performances has been designed for two-dimensional position sensitive neutron gas detectors (InSPaD). The InSPaD is a 2D neutron detector system with 3 He gas and provides a high spatial resolution by making distinction between proton and triton particles generated in the gas chamber. The new ASD-ASIC is required to have very low noise, a wide dynamic range, good output linearity and high counting rate. The new ASD-ASIC has been designed by using CMOS and consisted of 64-channel ASDs, a 16-channel multiplexer with LVTTL drivers and sum amplifier system for summing all analog signals. The performances were evaluated by the Spice simulation. It was confirmed that the new ASD-ASIC had very low noise performance, wide dynamic range and fast signal processing functions. (author)
FDML swept source at 1060 nm using a tapered amplifier
DEFF Research Database (Denmark)
Marschall, Sebastian; Klein, Thomas; Wieser, Wolfgang
2010-01-01
We present a novel frequency-swept light source working at 1060nm that utilizes a tapered amplifier as gain medium. These devices feature significantly higher saturation power than conventional semiconductor optical amplifiers and can thus improve the limited output power of swept sources in this...... an axial resolution of 15 µm in air (~11µm in tissue) for OCT applications can be achieved....
Characterization of ceramic archaeological by high resolution X ray microtomography
International Nuclear Information System (INIS)
Machado, Alessandra C.; Freitas, Renato; Calza, Cristiane F.; Lopes, Ricardo T.; Lima, Inaya; Carvalho, Daniele D.; Gaspar, Maria D.
2013-01-01
Characterization of ceramic fragments is a very important area of research in art and archeometry area because it enables a greater understanding of how ancient civilizations behave and what were their traditions and customs. Petrography and chemical analyses are commonly used, but these techniques are destructive, which is not interesting for this type of sample. Through the exchange of multidisciplinary scientific knowledge and new partnerships, high resolution X-ray microtomography has been introduced in archaeological area as a great possibility of 3D inspection in a non-destructive way. The goal of this work is to investigate the internal microstructures of four samples of archeological ceramic, from the Archaeological Site of Macacu - RJ. The X-ray microtomography were performed in a high resolution setup, and can be used to infer the nature of organic temper even with all plant remains completely burnt out during the firing process and also to ensure the homogeneity of samples envisaged for geochemical analyses, especially with respect to the distribution of chemically diverse fabric compounds. In this way this study intends to contribute to our understanding of the archaeological and historical formations of this region. (author)
Characterization of ceramic archaeological by high resolution X ray microtomography
Energy Technology Data Exchange (ETDEWEB)
Machado, Alessandra C.; Freitas, Renato; Calza, Cristiane F.; Lopes, Ricardo T.; Lima, Inaya, E-mail: alecastro@lin.ufrj.br [Coordenacao dos Programas de Pos-Graduacao de Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Instrumentacao Nuclear; Carvalho, Daniele D.; Gaspar, Maria D. [Museu Nacional (MN/UFRJ), RJ (Brazil). Centro de Tecnologia
2013-07-01
Characterization of ceramic fragments is a very important area of research in art and archeometry area because it enables a greater understanding of how ancient civilizations behave and what were their traditions and customs. Petrography and chemical analyses are commonly used, but these techniques are destructive, which is not interesting for this type of sample. Through the exchange of multidisciplinary scientific knowledge and new partnerships, high resolution X-ray microtomography has been introduced in archaeological area as a great possibility of 3D inspection in a non-destructive way. The goal of this work is to investigate the internal microstructures of four samples of archeological ceramic, from the Archaeological Site of Macacu - RJ. The X-ray microtomography were performed in a high resolution setup, and can be used to infer the nature of organic temper even with all plant remains completely burnt out during the firing process and also to ensure the homogeneity of samples envisaged for geochemical analyses, especially with respect to the distribution of chemically diverse fabric compounds. In this way this study intends to contribute to our understanding of the archaeological and historical formations of this region. (author)
α spectrometer of parallel plate grid ionization chamber of high energy resolution
International Nuclear Information System (INIS)
Tong Boting; Wang Jianqing; Dong Mingli; Tang Peijia; Wang Xiaorong; Lin Cansheng
2000-01-01
Parallel plate grid ionization chamber with cathode area of 300 cm 2 was developed and applied to detect minimum α-emitters. It consist of a vacuum system, a gas cycle system of the parallel plate grid ionization chamber, electronics (a high voltage supply, a pre-amplifier and a main amplifier) and a computer-multichannel analyzer. The energy resolution is 23 keV FWHM for the 244 Cm electrostatic precipitated source. The integral background is typically 10 counts/h between 4 and 6 MeV. The detector efficiency is 50%. The minimum detecting activity is 3 x 10 -4 Bq (3σ, 30 hours). This spectrometer is suitable for detecting various samples, such as samples of the soil, water, air, bion, food, structural material, geology, archaeology, α-emitters of after processing and measuring α activity of accounting for and control of nuclear material and monitoring the artificial radioactivity nuclides of environment samples around nuclear facilities. The spectrometer is equipped with apparatus for preparing large area α source by using vacuum deposition or ultrasonic pulverization. The operating program of preparing source is simple. The source thickness can be kept in 40-60 μm/cm 2
Lee, Ann S. G.; Tang, Lynn L. H.; Lim, Irene H. K.; Bellamy, Richard; Wong, Sin-Yew
2002-01-01
Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.
Lee, Ann S G; Tang, Lynn L H; Lim, Irene H K; Bellamy, Richard; Wong, Sin-Yew
2002-02-01
Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.
Directory of Open Access Journals (Sweden)
Daniel W. H. Robarts
2014-07-01
Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.
High-Performance BiCMOS Transimpedance Amplifiers for Fiber-Optic Receivers
Directory of Open Access Journals (Sweden)
F. Touati
2007-12-01
Full Text Available High gain, wide bandwidth, low noise, and low-power transimpedance amplifiers based on new BiCMOS common- base topologies have been designed for fiber-optic receivers. In particular a design approach, hereafter called "A more- FET approach", added a new dimension to effectively optimize performance tradeoffs inherent in such circuits. Using conventional silicon 0.8 μm process parameters, simulated performance features of a total-FET transimpedance amplifier operating at 7.2 GHz, which is close to the technology fT of 12 GHz, are presented. The results are superior to those of similar recent designs and comparable to IC designs using GaAs technology. A detailed analysis of the design architecture, including a discussion on the effects of moving toward more FET-based designs is presented.
High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions
DEFF Research Database (Denmark)
Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob
2014-01-01
In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High......-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized...... that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide...
Nie, H-T; Li, Q; Kong, L-F
2014-06-01
Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.
Radar Waveform Pulse Analysis Measurement System for High-Power GaN Amplifiers
Thrivikraman, Tushar; Perkovic-Martin, Dragana; Jenabi, Masud; Hoffman, James
2012-01-01
This work presents a measurement system to characterize the pulsed response of high-power GaN amplifiers for use in space-based SAR platforms that require very strict amplitude and phase stability. The measurement system is able to record and analyze data on three different time scales: fast, slow, and long, which allows for greater detail of the mechanisms that impact amplitude and phase stability. The system is fully automated through MATLAB, which offers both instrument control capability and in-situ data processing. To validate this system, a high-power GaN HEMT amplifier operated in saturation was characterized. The fast time results show that variations to the amplitude and phase are correlated to DC supply transients, while long time characteristics are correlated to temperature changes.
Experimental and theoretical study on chemically semi-amplified resist AR-P 6200
Kostic, I.; Vutova, K.; Andok, R.; Barak, V.; Bencurova, A.; Ritomsky, R.; Tanaka, T.
2018-03-01
Experimental and simulation results are presented and discussed on electron-beam lithography (EBL) nano-structuring using the positive chemically semi-amplified electron-beam resist AR-P 6200 (CSAR 62), which provides high sensitivity and allows achievement of high resolutions (sub-100 nm). The influence of the e-beam lithography process parameters, namely, exposure dose, development process conditions, and proximity effects on the obtained developed images was studied for the case of 40-keV electron energy.
Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)
International Nuclear Information System (INIS)
Budtz-Joergensen, C.; Knitter, H.H.
1986-01-01
The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)
A compact high resolution ion mobility spectrometer for fast trace gas analysis.
Kirk, Ansgar T; Allers, Maria; Cochems, Philipp; Langejuergen, Jens; Zimmermann, Stefan
2013-09-21
Drift tube ion mobility spectrometers (IMS) are widely used for fast trace gas detection in air, but portable compact systems are typically very limited in their resolving power. Decreasing the initial ion packet width improves the resolution, but is generally associated with a reduced signal-to-noise-ratio (SNR) due to the lower number of ions injected into the drift region. In this paper, we present a refined theory of IMS operation which employs a combined approach for the analysis of the ion drift and the subsequent amplification to predict both the resolution and the SNR of the measured ion current peak. This theoretical analysis shows that the SNR is not a function of the initial ion packet width, meaning that compact drift tube IMS with both very high resolution and extremely low limits of detection can be designed. Based on these implications, an optimized combination of a compact drift tube with a length of just 10 cm and a transimpedance amplifier has been constructed with a resolution of 183 measured for the positive reactant ion peak (RIP(+)), which is sufficient to e.g. separate the RIP(+) from the protonated acetone monomer, even though their drift times only differ by a factor of 1.007. Furthermore, the limits of detection (LODs) for acetone are 180 pptv within 1 s of averaging time and 580 pptv within only 100 ms.
High resolution Cerenkov light imaging of induced positron distribution in proton therapy
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Seiichi, E-mail: s-yama@met.nagoya-u.ac.jp; Fujii, Kento; Morishita, Yuki; Okumura, Satoshi; Komori, Masataka [Radiological and Medical Laboratory Sciences, Nagoya University Graduate School of Medicine, Aichi 461-8673 (Japan); Toshito, Toshiyuki [Department of Proton Therapy Physics, Nagoya Proton Therapy Center, Nagoya City West Medical Center, Aichi 462-8508 (Japan)
2014-11-01
Purpose: In proton therapy, imaging of the positron distribution produced by fragmentation during or soon after proton irradiation is a useful method to monitor the proton range. Although positron emission tomography (PET) is typically used for this imaging, its spatial resolution is limited. Cerenkov light imaging is a new molecular imaging technology that detects the visible photons that are produced from high-speed electrons using a high sensitivity optical camera. Because its inherent spatial resolution is much higher than PET, the authors can measure more precise information of the proton-induced positron distribution with Cerenkov light imaging technology. For this purpose, they conducted Cerenkov light imaging of induced positron distribution in proton therapy. Methods: First, the authors evaluated the spatial resolution of our Cerenkov light imaging system with a {sup 22}Na point source for the actual imaging setup. Then the transparent acrylic phantoms (100 × 100 × 100 mm{sup 3}) were irradiated with two different proton energies using a spot scanning proton therapy system. Cerenkov light imaging of each phantom was conducted using a high sensitivity electron multiplied charge coupled device (EM-CCD) camera. Results: The Cerenkov light’s spatial resolution for the setup was 0.76 ± 0.6 mm FWHM. They obtained high resolution Cerenkov light images of the positron distributions in the phantoms for two different proton energies and made fused images of the reference images and the Cerenkov light images. The depths of the positron distribution in the phantoms from the Cerenkov light images were almost identical to the simulation results. The decay curves derived from the region-of-interests (ROIs) set on the Cerenkov light images revealed that Cerenkov light images can be used for estimating the half-life of the radionuclide components of positrons. Conclusions: High resolution Cerenkov light imaging of proton-induced positron distribution was possible. The
High resolution Cerenkov light imaging of induced positron distribution in proton therapy
International Nuclear Information System (INIS)
Yamamoto, Seiichi; Fujii, Kento; Morishita, Yuki; Okumura, Satoshi; Komori, Masataka; Toshito, Toshiyuki
2014-01-01
Purpose: In proton therapy, imaging of the positron distribution produced by fragmentation during or soon after proton irradiation is a useful method to monitor the proton range. Although positron emission tomography (PET) is typically used for this imaging, its spatial resolution is limited. Cerenkov light imaging is a new molecular imaging technology that detects the visible photons that are produced from high-speed electrons using a high sensitivity optical camera. Because its inherent spatial resolution is much higher than PET, the authors can measure more precise information of the proton-induced positron distribution with Cerenkov light imaging technology. For this purpose, they conducted Cerenkov light imaging of induced positron distribution in proton therapy. Methods: First, the authors evaluated the spatial resolution of our Cerenkov light imaging system with a 22 Na point source for the actual imaging setup. Then the transparent acrylic phantoms (100 × 100 × 100 mm 3 ) were irradiated with two different proton energies using a spot scanning proton therapy system. Cerenkov light imaging of each phantom was conducted using a high sensitivity electron multiplied charge coupled device (EM-CCD) camera. Results: The Cerenkov light’s spatial resolution for the setup was 0.76 ± 0.6 mm FWHM. They obtained high resolution Cerenkov light images of the positron distributions in the phantoms for two different proton energies and made fused images of the reference images and the Cerenkov light images. The depths of the positron distribution in the phantoms from the Cerenkov light images were almost identical to the simulation results. The decay curves derived from the region-of-interests (ROIs) set on the Cerenkov light images revealed that Cerenkov light images can be used for estimating the half-life of the radionuclide components of positrons. Conclusions: High resolution Cerenkov light imaging of proton-induced positron distribution was possible. The authors
Energy Technology Data Exchange (ETDEWEB)
Zawadzka-Kazimierczuk, Anna; Kozminski, Wiktor [University of Warsaw, Faculty of Chemistry (Poland); Billeter, Martin, E-mail: martin.billeter@chem.gu.se [University of Gothenburg, Biophysics Group, Department of Chemistry and Molecular Biology (Sweden)
2012-09-15
While NMR studies of proteins typically aim at structure, dynamics or interactions, resonance assignments represent in almost all cases the initial step of the analysis. With increasing complexity of the NMR spectra, for example due to decreasing extent of ordered structure, this task often becomes both difficult and time-consuming, and the recording of high-dimensional data with high-resolution may be essential. Random sampling of the evolution time space, combined with sparse multidimensional Fourier transform (SMFT), allows for efficient recording of very high dimensional spectra ({>=}4 dimensions) while maintaining high resolution. However, the nature of this data demands for automation of the assignment process. Here we present the program TSAR (Tool for SMFT-based Assignment of Resonances), which exploits all advantages of SMFT input. Moreover, its flexibility allows to process data from any type of experiments that provide sequential connectivities. The algorithm was tested on several protein samples, including a disordered 81-residue fragment of the {delta} subunit of RNA polymerase from Bacillus subtilis containing various repetitive sequences. For our test examples, TSAR achieves a high percentage of assigned residues without any erroneous assignments.
Importance of riparian remnants for frog species diversity in a highly fragmented rainforest.
Rodríguez-Mendoza, Clara; Pineda, Eduardo
2010-12-23
Tropical forests undergo continuous transformation to other land uses, resulting in landscapes typified by forest fragments surrounded by anthropogenic habitats. Small forest fragments, specifically strip-shaped remnants flanking streams (referred to as riparian remnants), can be particularly important for the maintenance and conservation of biodiversity within highly fragmented forests. We compared frog species diversity between riparian remnants, other forest fragments and cattle pastures in a tropical landscape in Los Tuxtlas, Mexico. We found similar species richness in the three habitats studied and a similar assemblage structure between riparian remnants and forest fragments, although species composition differed by 50 per cent. Frog abundance was halved in riparian remnants compared with forest fragments, but was twice that found in pastures. Our results suggest that riparian remnants play an important role in maintaining a portion of frog species diversity in a highly fragmented forest, particularly during environmentally stressful (hot and dry) periods. In this regard, however, the role of riparian remnants is complementary, rather than substitutive, with respect to the function of other forest fragments within the fragmented forest.
Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei
2013-01-01
A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746
On-line high-resolution mass spectroscopy. Progress report, July 1, 1975--July 1, 1976
International Nuclear Information System (INIS)
Macfarlane, R.D.; Torgerson, D.F.
1976-08-01
The search for second-class currents in nuclear beta decay continued with measurements of beta--gamma correlations for the mirror decays 20 F(β - ) 20 Ne*(1.63) and 20 Na(β + ) 20 Ne*(1.63). The 20 F beta--gamma correlation was measured in beam, and the results are being compared with values obtained using the He-jet method. A careful analysis of ion velocity distributions emitted from fission fragment tracks in solids yielded new information on the nature of the process. The temperature of the microplasma formed by a fission fragment was determined to be of the order 10 4 K, and the temperature is dependent on the fission fragment's energy. A mass reflectron is being developed for high mass resolution using time-of-flight mass spectroscopy. The application of 252 Cf-PDMS (plasma desorption mass spectroscopy) to new classes of involatile compounds continued. Techniques are being studied for the routine analysis of involatile species of mass greater than 2000. The report is basically descriptive in nature. 5 figures, 1 table
International Nuclear Information System (INIS)
Moraes, Marco Antonio Proenca Vieira de; Pugliesi, Reinaldo
1996-01-01
The objective of the present work was to establish simple criteria to choose the best combination of electronic modules to achieve an adequate high resolution gamma spectrometer. Linearity, live time correction factors and softwares of a gamma spectrometric system composed by a Hp Ge detector have been studied by using several kinds of spectrometric amplifiers: Canberra 2021, Canberra 2025, Ortec 673 and Tennelec 244 and the MCA cards Ortec and Nucleus. The results showed low values of integral non-linearity for all spectrometric amplifiers connected to the Ortec and Nucleus boards. The MCA card should be able to correct amplifier dead time for 17 kcps count rates. (author)
Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K
2002-04-01
The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.
Energy Technology Data Exchange (ETDEWEB)
Shanglian, Bao; Jinquan, Liu [Beijing Univ., BJ (China); Batenkov, O I; Blinov, M V; Smirnov, S N [V.G. Khlopin Radium Institute, ST. Petersburg (Russian Federation)
1994-09-01
The {sup 252}Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of `forward` and `backward` for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process.
High-Performance Operational and Instrumentation Amplifiers
Shahi, B.
2015-01-01
This thesis describes techniques to reduce the offset error in precision instrumentation and operational amplifiers. The offset error which is considered a major error source associated with gain blocks, together with other errors are reviewed. Conventional and newer approaches to remove offset and
Directory of Open Access Journals (Sweden)
Daehyeok Kim
2015-03-01
Full Text Available In order to increase the operating speed of a CMOS image sensor (CIS, a new technique of digital correlated double sampling (CDS is described. In general, the fixed pattern noise (FPN of a CIS has been reduced with the subtraction algorithm between the reset signal and pixel signal. This is because a single-slope analog-to-digital converter (ADC has been normally adopted in the conventional digital CDS with the reset ramp and signal ramp. Thus, the operating speed of a digital CDS is much slower than that of an analog CDS. In order to improve the operating speed, we propose a novel digital CDS based on a differential difference amplifier (DDA that compares the reset signal and the pixel signal using only one ramp. The prototype CIS has been fabricated with 0.13 µm CIS technology and it has the VGA resolution of 640 × 480. The measured conversion time is 16 µs, and a high frame rate of 131 fps is achieved at the VGA resolution.
Robarts, Daniel W. H.; Wolfe, Andrea D.
2014-01-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637
Robarts, Daniel W H; Wolfe, Andrea D
2014-07-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.
DEFF Research Database (Denmark)
Winkel, Bo G; Hollegaard, Mads V; Olesen, Morten S
2011-01-01
BACKGROUND: The use of dried blood spots (DBS) samples in genomic workup has been limited by the relative low amounts of genomic DNA (gDNA) they contain. It remains to be proven that whole genome amplified DNA (wgaDNA) from stored DBS samples, constitutes a reliable alternative to gDNA.We wanted...
Radially resolved simulation of a high-gain free electron laser amplifier
International Nuclear Information System (INIS)
Fawley, W.M.; Prosnitz, D.; Doss, S.; Gelinas, R.
1983-01-01
The results of a two-dimensional simulation of a high-gain free electron laser (FEL) amplifier is presented. The simulation solves the inhomogeneous paraxial wave equation. The source term is radially resolved and is obtained by tracking the interaction of the laser field with localized macroparticles
Benet, James
1994-01-01
This document is an addendum to the NASA Satellite Communications Application Research (SCAR) Phase 2 Final Report, 'Efficient High Power, Solid State Amplifier for EHF Communications.' This report describes the work performed from 1 August 1993 to 11 March 1994, under contract number NASW-4513. During this reporting period an array of transistor amplifiers was repaired by replacing all MMIC amplifier chips. The amplifier array was then tested using three different feedhorn configurations. Descriptions, procedures, and results of this testing are presented in this report, and conclusions are drawn based on the test results obtained.
Ultra-high resolution protein crystallography
International Nuclear Information System (INIS)
Takeda, Kazuki; Hirano, Yu; Miki, Kunio
2010-01-01
Many protein structures have been determined by X-ray crystallography and deposited with the Protein Data Bank. However, these structures at usual resolution (1.5< d<3.0 A) are insufficient in their precision and quantity for elucidating the molecular mechanism of protein functions directly from structural information. Several studies at ultra-high resolution (d<0.8 A) have been performed with synchrotron radiation in the last decade. The highest resolution of the protein crystals was achieved at 0.54 A resolution for a small protein, crambin. In such high resolution crystals, almost all of hydrogen atoms of proteins and some hydrogen atoms of bound water molecules are experimentally observed. In addition, outer-shell electrons of proteins can be analyzed by the multipole refinement procedure. However, the influence of X-rays should be precisely estimated in order to derive meaningful information from the crystallographic results. In this review, we summarize refinement procedures, current status and perspectives for ultra high resolution protein crystallography. (author)
Dasa, Manoj Kumar; Markos, Christos; Maria, Michael; Petersen, Christian R; Moselund, Peter M; Bang, Ole
2018-04-01
We propose a cost-effective high-pulse energy supercontinuum (SC) source based on a telecom range diode laser-based amplifier and a few meters of standard single-mode optical fiber, with a pulse energy density as high as ~25 nJ/nm in the 1650-1850 nm regime (factor >3 times higher than any SC source ever used in this wavelength range). We demonstrate how such an SC source combined with a tunable filter allows high-resolution spectroscopic photoacoustic imaging and the spectroscopy of lipids in the first overtone transition band of C-H bonds (1650-1850 nm). We show the successful discrimination of two different lipids (cholesterol and lipid in adipose tissue) and the photoacoustic cross-sectional scan of lipid-rich adipose tissue at three different locations. The proposed high-pulse energy SC laser paves a new direction towards compact, broadband and cost-effective source for spectroscopic photoacoustic imaging.
Reset charge sensitive amplifier for NaI(Tl) gamma-ray spectrometer
International Nuclear Information System (INIS)
Zeng, Guoqiang; Tan, Chengjun; Li, Qiang; Ge, Liangquan; Liu, Xiyao; Luo, Qun
2015-01-01
The time constant of the output signal of the front-end readout circuit of a traditional gamma-ray spectrometer with a NaI(Tl)+PMT structure is affected by temperature, measurement environment and the signal transmission cable, so it is difficult to get a good resolution spectrum, especially at higher counting rates. In this paper, a reset charge sensitive amplifier (RCSA) is designed for the gamma-ray spectrometer with a NaI(Tl)+PMT structure. The designed RCSA outputs a step signal, thus enabling the acquisition of double-exponential signals with a stable time constant by using the next stage of a CR differentiating circuit. The designed RCSA is mainly composed of a basic amplifying circuit, a reset circuit and a dark current compensation circuit. It provides the output step signal through the integration of the PMT output charge signal. When the amplitude of the step signal exceeds a preset voltage threshold, it triggers the reset circuit to generate a reset pulse (about 5 µs pulse width) to reset the output signal. Experimental results demonstrated that the designed RCSA achieves a charge sensitivity of 4.26×10 10 V/C, with a zero capacitance noise of 51.09 fC and a noise slope of 1.98 fC/pF. Supported by the digital shaping algorithm of the digital multi-channel analyzer (DMCA), it can maintain good energy resolution with high counting rates up to 150 kcps and with a temperature range from −19 °C to 50 °C. - Highlights: • A new reset type charge sensitive amplifier for gamma-ray spectrometer based on a photomultiplier tube is proposed. • Reset circuit formed by constant current source output a fixed width pulse to reset charge sensitive amplifier. • Photomultiplier tube dark current compensation circuit could increase the pulse through rate by decreasing reset frequency. • This amplifier outputs a step function signal that could match next stage circuit easily
An S-band high gain relativistic klystron amplifier with high phase stability
Energy Technology Data Exchange (ETDEWEB)
Wu, Y. [Institute of Applied Electronics, China Academy of Engineering Physics, Mianyang 621900 (China); Science and Technology on High Power Microwave Laboratory, Mianyang 621900 (China); Li, Z. H.; Xu, Z.; Ma, Q. S. [Institute of Applied Electronics, China Academy of Engineering Physics, Mianyang 621900 (China); Xie, H. Q. [College of Science, Southwestern University of Science and Technology, Mianyang 621010 (China)
2014-11-15
For the purpose of coherent high power microwave combining, an S-band high gain relativistic klystron amplifier with high phase stability is presented and studied. By the aid of 3D particle-in-cell code and circuit simulation software, the mechanism of parasitic oscillation in the device is investigated. And the RF lossy material is adopted in the simulation and experiment to suppress the oscillation. The experimental results show that with an input RF power of 10 kW, a microwave pulse with power of 1.8 GW is generated with a gain of 52.6 dB. And the relative phase difference fluctuation between output microwave and input RF signal is less than ±10° in 90 ns.
High-Efficiency, Ka-Band Solid-State Power Amplifier Utilizing GaN Technology, Phase II
National Aeronautics and Space Administration — QuinStar Technology proposes to develop a high-efficiency, solid-state power amplifier (SSPA), operating at Ka-band frequencies, for high data rate, long range space...
DEFF Research Database (Denmark)
Rottwitt, Karsten
2017-01-01
The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....
Directory of Open Access Journals (Sweden)
Emma Suryati
2013-03-01
Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.
High resolution solar observations
International Nuclear Information System (INIS)
Title, A.
1985-01-01
Currently there is a world-wide effort to develop optical technology required for large diffraction limited telescopes that must operate with high optical fluxes. These developments can be used to significantly improve high resolution solar telescopes both on the ground and in space. When looking at the problem of high resolution observations it is essential to keep in mind that a diffraction limited telescope is an interferometer. Even a 30 cm aperture telescope, which is small for high resolution observations, is a big interferometer. Meter class and above diffraction limited telescopes can be expected to be very unforgiving of inattention to details. Unfortunately, even when an earth based telescope has perfect optics there are still problems with the quality of its optical path. The optical path includes not only the interior of the telescope, but also the immediate interface between the telescope and the atmosphere, and finally the atmosphere itself
High speed, High resolution terahertz spectrometers
International Nuclear Information System (INIS)
Kim, Youngchan; Yee, Dae Su; Yi, Miwoo; Ahn, Jaewook
2008-01-01
A variety of sources and methods have been developed for terahertz spectroscopy during almost two decades. Terahertz time domain spectroscopy (THz TDS)has attracted particular attention as a basic measurement method in the fields of THz science and technology. Recently, asynchronous optical sampling (AOS)THz TDS has been demonstrated, featuring rapid data acquisition and a high spectral resolution. Also, terahertz frequency comb spectroscopy (TFCS)possesses attractive features for high precision terahertz spectroscopy. In this presentation, we report on these two types of terahertz spectrometer. Our high speed, high resolution terahertz spectrometer is demonstrated using two mode locked femtosecond lasers with slightly different repetition frequencies without a mechanical delay stage. The repetition frequencies of the two femtosecond lasers are stabilized by use of two phase locked loops sharing the same reference oscillator. The time resolution of our terahertz spectrometer is measured using the cross correlation method to be 270 fs. AOS THz TDS is presented in Fig. 1, which shows a time domain waveform rapidly acquired on a 10ns time window. The inset shows a zoom into the signal with 100ps time window. The spectrum obtained by the fast Fourier Transformation (FFT)of the time domain waveform has a frequency resolution of 100MHz. The dependence of the signal to noise ratio (SNR)on the measurement time is also investigated
High linearity 5.2-GHz power amplifier MMIC using CPW structure technology with a linearizer circuit
International Nuclear Information System (INIS)
Wu Chiasong; Lin Tah-Yeong; Wu Hsien-Ming
2010-01-01
A built-in linearizer was applied to improve the linearity in a 5.2-GHz power amplifier microwave monolithic integrated circuit (MMIC), which was undertaken with 0.15-μm AlGaAs/InGaAs D-mode PHEMT technology. The power amplifier (PA) was studied taking into account the linearizer circuit and the coplanar waveguide (CPW) structures. Based on these technologies, the power amplifier, which has a chip size of 1.44 x 1.10 mm 2 , obtained an output power of 13.3 dBm and a power gain of 14 dB in the saturation region. An input third-order intercept point (HP 3 ) of -3 dBm, an output third-order intercept point (OIP 3 ) of 21.1 dBm and a power added efficiency (PAE) of 22% were attained, respectively. Finally, the overall power characterization exhibited high gain and high linearity, which illustrates that the power amplifier has a compact circuit size and exhibits favorable RF characteristics. This power circuit demonstrated high RF characterization and could be used for microwave power circuit applications at 5.2 GHz. (semiconductor integrated circuits)
Meniscus tears of the knee: Postarthrogram high resolution CT
International Nuclear Information System (INIS)
Kim, Jae Hyoung; Do, Young Soo; You, Jin Jong; Gong, Jae Chul; Kim, Hyung Jin; Chung, Sung Hoon
1990-01-01
Thirty-eight knees with clinically suspected meniscal tears were examined with high resolution computed tomography(HRCT) immediately following double contrast arthrography. All subsequently underwent arthroscopy. The findings of postarthrogram HRCT and arthroscopy were compared to evaluated the usefulness of postarthrogram HRCT in diagnosis of the meniscal tears. The sensitivity, specificity and accuracy of HRCT were 96.2%. 83.3% and 92.1% respectively. The anatomic details of the meniscal tears were clearly visible on the HRCT scans. Sagittal and coronal reformation views well visualized the horizontal tears and the relationship of torn meniscal fragments, and well differential the peripheral tears from the synovial recess. Our result indicate that postarthrogram HRCT not only is a sensitive and effective method for the detection and characterization of the meniscal tears, but also provides arthroscopists with the appropriate surgical plans
Metagenome Fragment Classification Using -Mer Frequency Profiles
Directory of Open Access Journals (Sweden)
Gail Rosen
2008-01-01
Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.
International Nuclear Information System (INIS)
Louter, G.J.
1982-01-01
During the last decade Collision Activated Dissociation Mass Spectrometry (CAD-MS) has developed into an important and sometimes unique technique for the structure elucidation of ions. An extensive description of the double stage MS is given, which has been especially devloped for CAD-MS. A high mass resolution and a very high sensitivity are obtained by application of special techniques like post-acceleration of fragment ions, quadrupole (Q-pole) lenses and an electro-optical, simultaneous ion detection system. The operation of the rather complex ion-optics is demonstrated by application of a computer simulation of the tandem MS. Special attention is given to the action of the four Q-pole lenses and the second sector magnet upon curvature and position of the mass focal plane. Two mass calibration methods are described for the fragment spectra. The so-called polynomial-method applies a fifth-order polynomial approximation of the functional relation between position on the detector and corresponding relative momentum of fragment ions. The second method uses the matrix model of the instrument. The detector consists of two channelplates (CEMA), a fibre optics slab, coated with a phosphor layer, a camera objective and a 1024-channels photodiode-array. A bio-chemical and an organic-chemical application of the instrument are given. As bio-chemical application the peak m/z 59 in the pyrolysis mass spectrum of complete mycobacteria is identified. As an example of organic-chemical application the fragmentation process of 2,3-butadienoic acid has been investigated. (Auth.)
European Research on THz Vacuum Amplifiers
DEFF Research Database (Denmark)
Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.
2010-01-01
The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....
International Nuclear Information System (INIS)
Stappel, M; Steinborn, R; Kolbe, D; Walz, J
2013-01-01
We present a high power single-frequency ytterbium fiber amplifier system with an output power of 30 W at 1091 nm. The amplifier system consists of two stages, a preamplifier stage in which amplified spontaneous emission is efficiently suppressed (>40 dB) and a high power amplifier with an efficiency of 52%. Two different approaches to frequency doubling are compared. We achieve 8.6 W at 545.5 nm by single-pass frequency doubling in a MgO-doped periodically poled stoichiometric LiTaO 3 crystal and up to 19.3 W at 545.5 nm by frequency doubling with a lithium-triborate crystal in an external enhancement cavity. (paper)
High-Resolution Sonars: What Resolution Do We Need for Target Recognition?
Directory of Open Access Journals (Sweden)
Pailhas Yan
2010-01-01
Full Text Available Target recognition in sonar imagery has long been an active research area in the maritime domain, especially in the mine-counter measure context. Recently it has received even more attention as new sensors with increased resolution have been developed; new threats to critical maritime assets and a new paradigm for target recognition based on autonomous platforms have emerged. With the recent introduction of Synthetic Aperture Sonar systems and high-frequency sonars, sonar resolution has dramatically increased and noise levels decreased. Sonar images are distance images but at high resolution they tend to appear visually as optical images. Traditionally algorithms have been developed specifically for imaging sonars because of their limited resolution and high noise levels. With high-resolution sonars, algorithms developed in the image processing field for natural images become applicable. However, the lack of large datasets has hampered the development of such algorithms. Here we present a fast and realistic sonar simulator enabling development and evaluation of such algorithms.We develop a classifier and then analyse its performances using our simulated synthetic sonar images. Finally, we discuss sensor resolution requirements to achieve effective classification of various targets and demonstrate that with high resolution sonars target highlight analysis is the key for target recognition.
High resolution line for secondary radioactive beams at the U400M cyclotron
International Nuclear Information System (INIS)
Rodin, A.M.; Sidorchuk, S.I.; Stepantsov, S.V.
1996-01-01
For implementation of an experimental program for studying nuclear reactions with radioactive ion beams in the energy domain of 20 through 80 MeV · A the high resolution beam line ACCULINNA was put into commissioning on a primary beam line of the JINR U-400M cyclotron. By means of nuclear fragmentation of the 14 N beam with the energy of 51 MeV · A on the 170 mg/cm 2 carbon target radioactive beams of 6 He, 8 He and 8 B were obtained. Possibilities of further development of the set-up are discussed. 6 refs., 7 figs., 2 tabs
Quantitative analysis of 39 polybrominated diphenyl ethers by isotope dilution GC/low-resolution MS.
Ackerman, Luke K; Wilson, Glenn R; Simonich, Staci L
2005-04-01
A GC/low-resolution MS method for the quantitative isotope dilution analysis of 39 mono- to heptabrominated diphenyl ethers was developed. The effects of two different ionization sources, electron impact (EI) and electron capture negative ionization (ECNI), and the effects of their parameters on production of high-mass fragment ions [M - xH - yBr](-) specific to PBDEs were investigated. Electron energy, emission current, source temperature, ECNI system pressure, and choice of ECNI reagent gases were optimized. Previously unidentified enhancement of PBDE high-mass fragment ion [M - xH - yBr](-) abundance was achieved. Electron energy had the largest impact on PBDE high-mass fragment ion abundance for both the ECNI and EI sources. By monitoring high-mass fragment ions of PBDEs under optimized ECNI source conditions, quantitative isotope dilution analysis of 39 PBDEs was conducted using nine (13)C(12) labeled PBDEs on a low-resolution MS with low picogram to femtogram instrument detection limits.
Semiconductor quantum-dot lasers and amplifiers
DEFF Research Database (Denmark)
Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.
2002-01-01
-power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...
Flashlamp excited fluid laser amplified
International Nuclear Information System (INIS)
1976-01-01
The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation
High-current relativistic klystron amplifier development for microsecond pulse lengths
International Nuclear Information System (INIS)
Fazio, M.V.; Carlsten, B.E.; Faehl, R.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.
1991-01-01
Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To data the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modeling are presented
High-current relativistic klystron amplifier development for microsecond pulse lengths
International Nuclear Information System (INIS)
Fazio, M.V.; Carlsten, B.E.; Faehl, R.J.; Kwan, T.J.; Rickel, D.G.; Stringfield, R.M.; Tallerico, P.J.
1991-01-01
Los Alamos is extending the performance of the Friedman-type, high-current relativistic klystron amplifier (RKA) to the microsecond regime while attempting to achieve the gigawatt-level peak power capability that has been characteristic of the RKA at shorter pulse lengths. Currently the electron beam power into the device is about 1 GW in microsecond duration pulses, with an effort underway to increase the beam power to 2.5 GW. To date the device has yielded an rf modulated electron beam power of 350 MW, with up to 50 MW coupled into waveguide. Several aspects of RKA operation under investigation that affect RKA beam bunching efficiency and amplifier gain include cavity tuning, beam diameter, beam current, and input rf drive power, and the development of an output coupler that efficiently couples the microwave power from the low impedance beam into rectangular waveguide operating in the dominant mode. Current results from experimental testing and code modelling are presented. 5 refs., 5 figs
DEFF Research Database (Denmark)
Tulsiani, Suhella; Craig, S B; Graham, G C
2010-01-01
A new test for pathogenic Leptospira isolates, based on RAPD-PCR and high-resolution melt (HRM) analysis (which measures the melting temperature of amplicons in real time, using a fluorescent DNA-binding dye), has recently been developed. A characteristic profile of the amplicons can be used...... typed against 13 previously published RAPD primers, using a real-time cycler (the Corbett Life Science RotorGene 6000) and the optimised reagents from a commercial kit (Quantace SensiMix). RAPD-HRM at specific temperatures generated defining amplicon melt profiles for each of the tested serovars....... These profiles were evaluated as difference-curve graphs generated using the RotorGene software package, with a cut-off of at least 8 'U' (plus or minus). The results demonstrated that RAPD-HRM can be used to measure serovar diversity and establish identity, with a high degree of stability. The characterisation...
A high gain energy amplifier operated with fast neutrons
Energy Technology Data Exchange (ETDEWEB)
Rubbia, C. [CERN, Geneva (Switzerland)
1995-10-01
The basic concept and the main practical considerations of an Energy Amplifier (EA) have been exhaustively described elsewhere. Here the concept of the EA is further explored and additional schemes are described which offer a higher gain, a larger maximum power density and an extended burn-up. All these benefits stem from the use of fast neutrons, instead of thermal or epithermal ones, which was the case in the original study. The higher gain is due both to a more efficient high energy target configuration and to a larger, practical value of the multiplication factor. The higher power density results from the higher permissible neutron flux, which in turn is related to the reduced rate of {sup 233}Pa neutron captures (which, as is well known, suppress the formation of the fissile {sup 233}U fuel) and the much smaller k variations after switch-off due to {sup 233}Pa decays for a given burn-up rate. Finally a longer integrated burn-up is made possible by reduced capture rate by fission fragments of fast neutrons. In practice a 20 MW proton beam (20 mA @ 1 GeV) accelerated by a cyclotron will suffice to operate a compact EA at the level of {approx} 1 GW{sub e}. The integrated fuel burn-up can be extended in excess of 100 GW d/ton, limited by the mechanical survival of the fuel elements. Radio-Toxicity accumulated at the end of the cycle is found to be largely inferior to the one of an ordinary Reactor for the same energy produced. Schemes are proposed which make a {open_quotes}melt-down{close_quotes} virtually impossible. The conversion ratio, namely the rate of production of {sup 233}U relative to consumption is generally larger than unity, which permits production of fuel for other uses. Alternatively the neutron excess can be used to transform unwanted {open_quotes}ashes{close_quotes} into more acceptable elements.
Measurement of locus copy number by hybridisation with amplifiable probes
Armour, John A. L.; Sismani, Carolina; Patsalis, Philippos C.; Cross, Gareth
2000-01-01
Despite its fundamental importance in genome analysis, it is only recently that systematic approaches have been developed to assess copy number at specific genetic loci, or to examine genomic DNA for submicroscopic deletions of unknown location. In this report we show that short probes can be recovered and amplified quantitatively following hybridisation to genomic DNA. This simple observation forms the basis of a new approach to determining locus copy number in complex genomes. The power and specificity of multiplex amplifiable probe hybridisation is demonstrated by the simultaneous assessment of copy number at a set of 40 human loci, including detection of deletions causing Duchenne muscular dystrophy and Prader–Willi/Angelman syndromes. Assembly of other probe sets will allow novel, technically simple approaches to a wide variety of genetic analyses, including the potential for extension to high resolution genome-wide screens for deletions and amplifications. PMID:10606661
Measurement of locus copy number by hybridisation with amplifiable probes.
Armour, J A; Sismani, C; Patsalis, P C; Cross, G
2000-01-15
Despite its fundamental importance in genome analysis, it is only recently that systematic approaches have been developed to assess copy number at specific genetic loci, or to examine genomic DNA for submicro-scopic deletions of unknown location. In this report we show that short probes can be recovered and amplified quantitatively following hybridisation to genomic DNA. This simple observation forms the basis of a new approach to determining locus copy number in complex genomes. The power and specificity of multiplex amplifiable probe hybridisation is demonstrated by the simultaneous assessment of copy number at a set of 40 human loci, including detection of deletions causing Duchenne muscular dystrophy and Prader-Willi/Angelman syndromes. Assembly of other probe sets will allow novel, technically simple approaches to a wide variety of genetic analyses, including the potential for extension to high resolution genome-wide screens for deletions and amplifications.
Andersen, T V; Schmidt, O; Bruchmann, C; Limpert, J; Aguergaray, C; Cormier, E; Tünnermann, A
2006-05-29
We report on the generation of high energy femtosecond pulses at 1 MHz repetition rate from a fiber laser pumped optical parametric amplifier (OPA). Nonlinear bandwidth enhancement in fibers provides the intrinsically synchronized signal for the parametric amplifier. We demonstrate large tunability extending from 700 nm to 1500 nm of femtosecond pulses with pulse energies as high as 1.2 muJ when the OPA is seeded by a supercontinuum generated in a photonic crystal fiber. Broadband amplification over more than 85 nm is achieved at a fixed wavelength. Subsequent compression in a prism sequence resulted in 46 fs pulses. With an average power of 0.5 W these pulses have a peak-power above 10 MW. In particular, the average power and pulse energy scalability of both involved concepts, the fiber laser and the parametric amplifier, will enable easy up-scaling to higher powers.
International Nuclear Information System (INIS)
Kato, T; Kataoka, J; Nakamori, T; Kishimoto, A; Yamamoto, S; Sato, K; Ishikawa, Y; Yamamura, K; Kawabata, N; Ikeda, H; Kamada, K
2013-01-01
We report the development of a high spatial resolution tweezers-type coincidence gamma-ray camera for medical imaging. This application consists of large-area monolithic Multi-Pixel Photon Counters (MPPCs) and submillimeter pixelized scintillator matrices. The MPPC array has 4 × 4 channels with a three-side buttable, very compact package. For typical operational gain of 7.5 × 10 5 at + 20 °C, gain fluctuation over the entire MPPC device is only ± 5.6%, and dark count rates (as measured at the 1 p.e. level) amount to ≤ 400 kcps per channel. We selected Ce-doped (Lu,Y) 2 (SiO 4 )O (Ce:LYSO) and a brand-new scintillator, Ce-doped Gd 3 Al 2 Ga 3 O 12 (Ce:GAGG) due to their high light yield and density. To improve the spatial resolution, these scintillators were fabricated into 15 × 15 matrices of 0.5 × 0.5 mm 2 pixels. The Ce:LYSO and Ce:GAGG scintillator matrices were assembled into phosphor sandwich (phoswich) detectors, and then coupled to the MPPC array along with an acrylic light guide measuring 1 mm thick, and with summing operational amplifiers that compile the signals into four position-encoded analog outputs being used for signal readout. Spatial resolution of 1.1 mm was achieved with the coincidence imaging system using a 22 Na point source. These results suggest that the gamma-ray imagers offer excellent potential for applications in high spatial medical imaging.
Neutron emission and fragment yield in high-energy fission
International Nuclear Information System (INIS)
Grudzevich, O. T.; Klinov, D. A.
2013-01-01
The KRIS special library of spectra and emission probabilities in the decays of 1500 nuclei excited up to energies between 150 and 250 MeV was developed for correctly taking into account the decay of highly excited nuclei appearing as fission fragments. The emission of neutrons, protons, and photons was taken into account. Neutron emission fromprimary fragments was found to have a substantial effect on the formation of yields of postneutron nuclei. The library was tested by comparing the calculated and measured yields of products originating from the fission of nuclei that was induced by high-energy protons. The method for calculating these yields was tested on the basis of experimental data on the thermal-neutroninduced fission of 235 U nuclei
Souda, Puneet; Ryan, Christopher M.; Cramer, William A.; Whitelegge, Julian
2011-01-01
Integral membrane proteins pose challenges to traditional proteomics approaches due to unique physicochemical properties including hydrophobic transmembrane domains that limit solubility in aqueous solvents. A well resolved intact protein molecular mass profile defines a protein’s native covalent state including post-translational modifications, and is thus a vital measurement toward full structure determination. Both soluble loop regions and transmembrane regions potentially contain post-translational modifications that must be characterized if the covalent primary structure of a membrane protein is to be defined. This goal has been achieved using electrospray-ionization mass spectrometry (ESI-MS) with low-resolution mass analyzers for intact protein profiling, and high-resolution instruments for top-down experiments, toward complete covalent primary structure information. In top-down, the intact protein profile is supplemented by gas-phase fragmentation of the intact protein, including its transmembrane regions, using collisionally activated and/or electroncapture dissociation (CAD/ECD) to yield sequence-dependent high-resolution MS information. Dedicated liquid chromatography systems with aqueous/organic solvent mixtures were developed allowing us to demonstrate that polytopic integral membrane proteins are amenable to ESI-MS analysis, including top-down measurements. Covalent post-translational modifications are localized regardless of their position in transmembrane domains. Top-down measurements provide a more detail oriented high-resolution description of post-transcriptional and post-translational diversity for enhanced understanding beyond genomic translation. PMID:21982782
Molecular phylogeny of Fusarium species by AFLP fingerprint ...
African Journals Online (AJOL)
The high-resolution genotyping method of amplified fragment length polymorphism (AFLP) analysis was used to study the genetic relationships within and between natural populations of five Fusarium spp. AFLP templates were prepared by the digestion of Fusarium DNA with EcoRI and MseI restriction endonucleases and ...
Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation
International Nuclear Information System (INIS)
An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun
2007-01-01
We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously
Global-Scale Patterns of Forest Fragmentation
Directory of Open Access Journals (Sweden)
Kurt Riitters
2000-12-01
Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.
Global-scale patterns of forest fragmentation
Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.
2000-01-01
We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.
Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang
2014-10-21
Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.
International Nuclear Information System (INIS)
Lepetit, J.; Poussier, E.
1984-01-01
This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr
Dual-range linearized transimpedance amplifier system
Wessendorf, Kurt O.
2010-11-02
A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).
Observation of the dynamic movement of fragmentations by high-speed camera and high-speed video
Suk, Chul-Gi; Ogata, Yuji; Wada, Yuji; Katsuyama, Kunihisa
1995-05-01
The experiments of blastings using mortal concrete blocks and model concrete columns were carried out in order to obtain technical information on fragmentation caused by the blasting demolition. The dimensions of mortal concrete blocks were 1,000 X 1,000 X 1,000 mm. Six kinds of experimental blastings were carried out using mortal concrete blocks. In these experiments precision detonators and No. 6 electric detonators with 10 cm detonating fuse were used and discussed the control of fragmentation. As the results of experiment it was clear that the flying distance of fragmentation can be controlled using a precise blasting system. The reinforced concrete model columns for typical apartment houses in Japan were applied to the experiments. The dimension of concrete test column was 800 X 800 X 2400 mm and buried 400 mm in the ground. The specified design strength of the concrete was 210 kgf/cm2. These columns were exploded by the blasting with internal loading of dynamite. The fragmentation were observed by two kinds of high speed camera with 500 and 2000 FPS and a high speed video with 400 FPS. As one of the results in the experiments, the velocity of fragmentation, blasted 330 g of explosive with the minimum resisting length of 0.32 m, was measured as much as about 40 m/s.
EARLY STAGES OF CLUSTER FORMATION: FRAGMENTATION OF MASSIVE DENSE CORES DOWN TO {approx}< 1000 AU
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciencies, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Fuente, Asuncion [Observatorio Astronomico Nacional, P.O. Box 112, E-28803 Alcala de Henares, Madrid (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciencies del Cosmos, Universitat de Barcelona, Marti Franques, 1, E-08028 Barcelona (Spain); Ho, Paul T. P.; Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Sanchez-Monge, Alvaro; Fontani, Francesco; Cesaroni, Riccardo [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Commercon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, Ecole Normale Superieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Boissier, Jeremie [Istituto di Radioastronomia, INAF, Via Gobetti 101, I-40129 Bologna (Italy); Zapata, Luis A., E-mail: palau@ieec.uab.es [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, P.O. Box 3-72, 58090 Morelia, Michoacan (Mexico)
2013-01-10
In order to study the fragmentation of massive dense cores, which constitute the cluster cradles, we observed the continuum at 1.3 mm and the CO (2-1) emission of four massive cores with the Plateau de Bure Interferometer in the most extended configuration. We detected dust condensations down to {approx}0.3 M {sub Sun} and separate millimeter sources down to 0.''4 or {approx}< 1000 AU, comparable to the sensitivities and separations reached in optical/infrared studies of clusters. The CO (2-1) high angular resolution images reveal high-velocity knots usually aligned with previously known outflow directions. This, in combination with additional cores from the literature observed at similar mass sensitivity and spatial resolution, allowed us to build a sample of 18 protoclusters with luminosities spanning three orders of magnitude. Among the 18 regions, {approx}30% show no signs of fragmentation, while 50% split up into {approx}> 4 millimeter sources. We compiled a list of properties for the 18 massive dense cores, such as bolometric luminosity, total mass, and mean density, and found no correlation of any of these parameters with the fragmentation level. In order to investigate the combined effects of the magnetic field, radiative feedback, and turbulence in the fragmentation process, we compared our observations to radiation magnetohydrodynamic simulations and found that the low-fragmented regions are reproduced well in the magnetized core case, while the highly fragmented regions are consistent with cores where turbulence dominates over the magnetic field. Overall, our study suggests that the fragmentation in massive dense cores could be determined by the initial magnetic field/turbulence balance in each particular core.
The water retention of a granite rock fragments in High Tatras stony soils
Novák, Viliam; Šurda, Peter
2010-01-01
The water retention capacity of coarse rock fragments is usually considered negligible. But the presence of rock fragments in a soil can play an important role in both water holding capacity and in hydraulic conductivity as well. This paper presents results of maximum water holding capacity measured in coarse rock fragments in the soil classified as cobbly sandy loam sampled at High Tatra mountains. It is shown, that those coarse rock (granite) fragments have the maximum retention capacity up...
Multiple excitation regenerative amplifier inertial confinement system
International Nuclear Information System (INIS)
George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.
1980-01-01
The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation
International Nuclear Information System (INIS)
Diamond, R.M.
1984-10-01
Criteria for a high-resolution γ-ray system are discussed. Desirable properties are high resolution, good response function, and moderate solid angle so as to achieve not only double- but triple-coincidences with good statistics. The Berkeley High-Resolution Ball involved the first use of bismuth germanate (BGO) for anti-Compton shield for Ge detectors. The resulting compact shield permitted rather close packing of 21 detectors around a target. In addition, a small central BGO ball gives the total γ-ray energy and multiplicity, as well as the angular pattern of the γ rays. The 21-detector array is nearly complete, and the central ball has been designed, but not yet constructed. First results taken with 9 detector modules are shown for the nucleus 156 Er. The complex decay scheme indicates a transition from collective rotation (prolate shape) to single- particle states (possibly oblate) near spin 30 h, and has other interesting features
Femtosecond Ti:sapphire cryogenic amplifier with high gain and MHz repetition rate
DEFF Research Database (Denmark)
Dantan, Aurelien Romain; Laurat, Julien; Ourjoumtsev, Alexei
2007-01-01
We demonstrate high gain amplification of 160-femtosecond pulses in a compact double-pass cryogenic Ti:sapphire amplifier. The setup involves a negative GVD mirrors recompression stage, and operates with a repetition rate between 0.2 and 4 MHz with a continuous pump laser. Amplification factors a...... as high as 17 and 320 nJ Fourier-limited pulses are obtained at a 800 kHz repetition rate....
Light nuclides observed in the fission and fragmentation of 238U
International Nuclear Information System (INIS)
Ricciardi, M.V.; Schmidt, K.H.; Benlliure, J.
2001-05-01
Light nuclides produced in collisions of 1 A.GeV 238 U with protons and titanium have been fully identified with a high-resolution forward magnetic spectrometer, the fragment separator (FRS), at GSI, and for each nuclide an extremely precise determination of the velocity has been performed. The so-obtained information on the velocity shows that the very asymmetric fission of uranium, in the 238 U + p reaction, produces neutron-rich isotopes of elements down to around charge 10. New important features of the fragmentation of 238 U, concerning the velocity and the N/Z-ratio of these light fragments, and a peculiar even-odd structure in N=Z nuclei, have also been observed. (orig.)
High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.
Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong
2017-12-01
High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.
1-MHz high power femtosecond Yb-doped fiber chirped-pulse amplifier
Hu, Zhong-Qi; Yang, Pei-Long; Teng, Hao; Zhu, Jiang-Feng; Wei, Zhi-Yi
2018-01-01
A practical femtosecond polarization-maintaining Yb-doped fiber amplifier enabling 153 fs transform-limited pulse duration with 32 μJ pulse energy at 1 MHz repetition rate corresponding to a peak power of 0.21 GW is demonstrated. The laser system based on chirped-pulse amplification (CPA) technique is seeded by a dispersion managed, nonlinear polarization evolution (NPE) mode-locked oscillator with spectrum bandwidth of 31 nm at 1040 nm and amplified by three fiber pre-amplifying stages and a rod type fiber main amplifying stage. The laser works with beam quality of M2 of 1.3 and power stability of 0.63% (root mean square, RMS) over 24 hours will be stable sources for industrial micromachining, medical therapy and scientific research.
With a 2k-ADC to 4k-spectrometry via two biased amplifiers
Energy Technology Data Exchange (ETDEWEB)
Goerner, W; Kleeberg, H [Zentralinstitut fuer Kernforschung, Rossendorf bei Dresden (German Democratic Republic)
1978-01-12
In order to obtain the double digital spread in high resolution nuclear spectrometry, two biased amplifiers were linked in parallel mode to the 10 V-input of a 2k-ADC. The arrangement works like a hybrid (1 bit scale - 11 bits Wilkinson) converter. A careful adjustment of the two bias levels (approximately 0V and approximately 6V) and the post-amplification (approximately 2) delivered a good linearity of the 4k-spectrum.
CERN-group conceptual design of a fast neutron operated high power energy amplifier
International Nuclear Information System (INIS)
Rubbia, C.; Rubio, J.A.; Buono, S.
1997-01-01
The practical feasibility of an Energy Amplifier (EA) with power and power density which are comparable to the ones of the present generation of large PWR is discussed in this paper. This is only possible with fast neutrons. Schemes are described which offer a high gain, a large maximum power density and an extended burn-up, well in excess of 100 GW x d/t corresponding to about five years at full power operation with no intervention on the fuel core. The following topics are discussed: physics considerations and parameter definition, the accelerator complex, the energy amplifier unit, computer simulated operation, and fuel cycle closing
CERN-group conceptual design of a fast neutron operated high power energy amplifier
Energy Technology Data Exchange (ETDEWEB)
Rubbia, C; Rubio, J A [European Organization for Nuclear Research, CERN, Geneva (Switzerland); Buono, S [Laboratoire du Cyclotron, Nice (France); and others
1997-11-01
The practical feasibility of an Energy Amplifier (EA) with power and power density which are comparable to the ones of the present generation of large PWR is discussed in this paper. This is only possible with fast neutrons. Schemes are described which offer a high gain, a large maximum power density and an extended burn-up, well in excess of 100 GW x d/t corresponding to about five years at full power operation with no intervention on the fuel core. The following topics are discussed: physics considerations and parameter definition, the accelerator complex, the energy amplifier unit, computer simulated operation, and fuel cycle closing. 84 refs, figs, tabs.
A parallel input composite transimpedance amplifier
Kim, D. J.; Kim, C.
2018-01-01
A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.
Multicharged Ion-induced simple molecule fragmentation dynamics
International Nuclear Information System (INIS)
Tarisien, M.
2003-10-01
The aim of this work is to study the dynamics of swift multicharged ion-induced fragmentation of diatomic (CO) and triatomic (CO 2 ) molecules. Performed at the GANIL facility, this study used the Recoil Ion Momentum Spectroscopy technique (RIMS), which consists of a time-of-flight mass spectrometer, coupled with a multi-hit capability position sensitive detector (delay line anode). The high-resolution measurement of the kinetic energy distribution released (KER) during the CO fragmentation points out the limitation of the Coulomb Explosion Model, revealing, for example, the di-cation CO 2 + electronic state contribution in the case of C + /O + fragmentation pathway. Furthermore, the multi-ionization cross section dependence with the orientation of the internuclear axis of CO is compared with a geometrical model calculation. Finally, different behaviours are observed for the dissociation dynamics of a triatomic molecule (CO 2 ). While triple ionization leads mainly to a synchronous concerted fragmentation dynamics, a weak fraction of dissociating molecule follows a sequential dynamics involving CO 2 + metastable states. In the case of double ionization, (CO 2 ) 2+ di-cation dissociation dynamics is asynchronously concerted and has been interpreted using a simple model involving an asymmetrical vibration of the molecule. (author)
Directory of Open Access Journals (Sweden)
Joanna Fietz
Full Text Available Habitat loss and fragmentation represent the most serious extinction threats for many species and have been demonstrated to be especially detrimental for mammals. Particularly, highly specialized species with low dispersal abilities will encounter a high risk of extinction in fragmented landscapes. Here we studied the edible dormouse (Glis glis, a small arboreal mammal that is distributed throughout Central Europe, where forests are mostly fragmented at different spatial scales. The aim of this study was to investigate the effect of habitat fragmentation on genetic population structures using the example of edible dormouse populations inhabiting forest fragments in south western Germany. We genotyped 380 adult individuals captured between 2001 and 2009 in four different forest fragments and one large continuous forest using 14 species-specific microsatellites. We hypothesised, that populations in small forest patches have a lower genetic diversity and are more isolated compared to populations living in continuous forests. In accordance with our expectations we found that dormice inhabiting forest fragments were isolated from each other. Furthermore, their genetic population structure was more unstable over the study period than in the large continuous forest. Even though we could not detect lower genetic variability within individuals inhabiting forest fragments, strong genetic isolation and an overall high risk to mate with close relatives might be precursors to a reduced genetic variability and the onset of inbreeding depression. Results of this study highlight that connectivity among habitat fragments can already be strongly hampered before genetic erosion within small and isolated populations becomes evident.
Fundamentals of RF and microwave transistor amplifiers
Bahl, Inder J
2009-01-01
A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read
Coyle, D. Barry
1991-01-01
In the design of space qualifiable laser systems for ranging and altimetry, such as NASA's Geodynamic Laser Ranging System (GLRS), the transmitter must be kept small, powerful yet efficient, and must consist of as few components as possible. A novel preamplifier design is examined which requires no external beam steering optics, yielding a compact component with simple alignment procedures. The gains achieved are comparable to multipass zigzag amplifiers using two or more sets of external optics for extra passes through the amplifying medium.
Coyle, D. B.
1991-01-01
In the design of space-qualifiable laser systems for ranging and altimetry, such as NASA's Geodynamic Laser Ranging System (GLRS), the transmitter must be kept small, powerful yet efficient, and must consist of as few components as possible. A novel preamplifier design is examined which requires no external beam steering optics, yielding a compact component with simple alignment procedures. The gains achieved are comparable to multipass zigzag amplifiers using two or more sets of external optics for extra passes through the amplifying medium.
Ben Ali, Sina-Elisabeth; Madi, Zita Erika; Hochegger, Rupert; Quist, David; Prewein, Bernhard; Haslberger, Alexander G.; Brandes, Christian
2014-01-01
Genetic mutations must be avoided during the production and use of seeds. In the European Union (EU), Directive 2001/18/EC requires any DNA construct introduced via transformation to be stable. Establishing genetic stability is critical for the approval of genetically modified organisms (GMOs). In this study, genetic stability of two GMOs was examined using high resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) employing Scorpion primers for amplification. The genetic variability of the transgenic insert and that of the flanking regions in a single oilseed rape variety (GT73) and a stacked maize (MON88017 × MON810) was studied. The GT73 and the 5' region of MON810 showed no instabilities in the examined regions. However; two out of 100 analyzed samples carried a heterozygous point mutation in the 3' region of MON810 in the stacked variety. These results were verified by direct sequencing of the amplified PCR products as well as by sequencing of cloned PCR fragments. The occurrence of the mutation suggests that the 5' region is more suitable than the 3' region for the quantification of MON810. The identification of the single nucleotide polymorphism (SNP) in a stacked event is in contrast to the results of earlier studies of the same MON810 region in a single event where no DNA polymorphism was found. PMID:25365178
Analysis of the positon resolution in centroid measurements in MWPC
International Nuclear Information System (INIS)
Gatti, E.; Longoni, A.
1981-01-01
Resolution limits in avalanche localization along the anode wires of an MWPC with cathodes connected by resistors and equally spaced amplifiers, are evaluated. A simple weighted-centroid method and a highly linear method based on a linear centroid finding filter, are considered. The contributions to the variance of the estimator of the avalanche position, due to the series noise of the amplifiers and to the thermal noise of the resistive line are separately calculated and compared. A comparison is made with the resolution of the MWPC with isolated cathodes. The calculations are performed with a distributed model of the diffusive line formed by the cathodes and the resistors. A comparison is also made with the results obtained with a simple lumped model of the diffusive line. A number of graphs useful in determining the best parameters of a MWPC, with a specified position and time resolution, are given. It has been found that, for short resolution times, an MWPC with cathodes connected by resitors presents better resolution (lower variance of the estimator of the avalanche position) than an MWPC with isolated cathodes. Conversely, for long resolution times, the variance of the estimator of the avalanche position is lower in an MWPC with isolated cathodes. (orig.)
High-Resolution PET Detector. Final report
International Nuclear Information System (INIS)
Karp, Joel
2014-01-01
The objective of this project was to develop an understanding of the limits of performance for a high resolution PET detector using an approach based on continuous scintillation crystals rather than pixelated crystals. The overall goal was to design a high-resolution detector, which requires both high spatial resolution and high sensitivity for 511 keV gammas. Continuous scintillation detectors (Anger cameras) have been used extensively for both single-photon and PET scanners, however, these instruments were based on NaI(Tl) scintillators using relatively large, individual photo-multipliers. In this project we investigated the potential of this type of detector technology to achieve higher spatial resolution through the use of improved scintillator materials and photo-sensors, and modification of the detector surface to optimize the light response function.We achieved an average spatial resolution of 3-mm for a 25-mm thick, LYSO continuous detector using a maximum likelihood position algorithm and shallow slots cut into the entrance surface
Semiconductor optical amplifier-based all-optical gates for high-speed optical processing
DEFF Research Database (Denmark)
Stubkjær, Kristian
2000-01-01
Semiconductor optical amplifiers are useful building blocks for all-optical gates as wavelength converters and OTDM demultiplexers. The paper reviews the progress from simple gates using cross-gain modulation and four-wave mixing to the integrated interferometric gates using cross-phase modulation....... These gates are very efficient for high-speed signal processing and open up interesting new areas, such as all-optical regeneration and high-speed all-optical logic functions...
High-Efficiency, Ka-band Solid-State Power Amplifier Utilizing GaN Technology, Phase I
National Aeronautics and Space Administration — QuinStar Technology proposes to develop an efficient, solid-state power amplifier (SSPA), operating at Ka-band frequencies, for high data rate, long range space...
Single image super resolution algorithm based on edge interpolation in NSCT domain
Zhang, Mengqun; Zhang, Wei; He, Xinyu
2017-11-01
In order to preserve the texture and edge information and to improve the space resolution of single frame, a superresolution algorithm based on Contourlet (NSCT) is proposed. The original low resolution image is transformed by NSCT, and the directional sub-band coefficients of the transform domain are obtained. According to the scale factor, the high frequency sub-band coefficients are amplified by the interpolation method based on the edge direction to the desired resolution. For high frequency sub-band coefficients with noise and weak targets, Bayesian shrinkage is used to calculate the threshold value. The coefficients below the threshold are determined by the correlation among the sub-bands of the same scale to determine whether it is noise and de-noising. The anisotropic diffusion filter is used to effectively enhance the weak target in the low contrast region of the target and background. Finally, the high-frequency sub-band is amplified by the bilinear interpolation method to the desired resolution, and then combined with the high-frequency subband coefficients after de-noising and small target enhancement, the NSCT inverse transform is used to obtain the desired resolution image. In order to verify the effectiveness of the proposed algorithm, the proposed algorithm and several common image reconstruction methods are used to test the synthetic image, motion blurred image and hyperspectral image, the experimental results show that compared with the traditional single resolution algorithm, the proposed algorithm can obtain smooth edges and good texture features, and the reconstructed image structure is well preserved and the noise is suppressed to some extent.
International Nuclear Information System (INIS)
Stringfield, R.M.; Fazio, M.V.; Rickel, D.G.; Kwan, T.J.T.; Peratt, A.L.; Kinross-Wright, J.; Van Haaften, F.W.; Hoeberling, R.F.; Faehl, R.; Carlsten, B.; Destler, W.W.; Warner, L.B.
1991-01-01
Los Alamos is investigating a number of high power microwave (HPM) sources for their potential to power advanced accelerators. Included in this investigation are the large orbit gyrotron amplifier and oscillator (LOG) and the relativistic klystron amplifier (RKA). LOG amplifier development is newly underway. Electron beam power levels of 3 GW, 70 ns duration, are planned, with anticipated conversion efficiencies into RF on the order of 20 percent. Ongoing investigations on this device include experimental improvement of the electron beam optics (to allow injection of a suitable fraction of the electron beam born in the gun into the amplifier structure), and computational studies of resonator design and RF extraction. Recent RKA studies have operated at electron beam powers into the device of 1.35 GW in microsecond duration pulses. The device has yielded modulated electron beam power approaching 300 MW using 3-5 kW of RF input drive. RF powers extracted into waveguide have been up to 70 MW, suggesting that more power is available from the device than has been converted to-date in the extractor
Energy Technology Data Exchange (ETDEWEB)
Giachero, A; Gotti, C; Maino, M; Pessina, G, E-mail: claudio.gotti@mib.infn.it [INFN - Sezione di Milano-Bicocca, I-20126, Milano (Italy)
2011-05-01
Fast charge sensitive preamplifiers were built using commercial current feedback operational amplifiers for fast read out of charge pulses from a photomultiplier tube. Current feedback opamps prove to be particularly well suited for this application where the charge from the detector is large, of the order of one million electrons, and high timing resolution is required. A proper circuit arrangement allows very fast signals, with rise times down to one nanosecond, while keeping the amplifier stable. After a review of current feedback circuit topology and stability constraints, we provide a 'recipe' to build stable and very fast charge sensitive preamplifiers from any current feedback opamp by adding just a few external components. The noise performance of the circuit topology has been evaluated and is reported in terms of equivalent noise charge.
An Implantable CMOS Amplifier for Nerve Signals
DEFF Research Database (Denmark)
Nielsen, Jannik Hammel; Lehmann, Torsten
2003-01-01
In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...
Isomer Information from Ion Mobility Separation of High-Mannose Glycan Fragments.
Harvey, David J; Seabright, Gemma E; Vasiljevic, Snezana; Crispin, Max; Struwe, Weston B
2018-05-01
Extracted arrival time distributions of negative ion CID-derived fragments produced prior to traveling-wave ion mobility separation were evaluated for their ability to provide structural information on N-linked glycans. Fragmentation of high-mannose glycans released from several glycoproteins, including those from viral sources, provided over 50 fragments, many of which gave unique collisional cross-sections and provided additional information used to assign structural isomers. For example, cross-ring fragments arising from cleavage of the reducing terminal GlcNAc residue on Man 8 GlcNAc 2 isomers have unique collision cross-sections enabling isomers to be differentiated in mixtures. Specific fragment collision cross-sections enabled identification of glycans, the antennae of which terminated in the antigenic α-galactose residue, and ions defining the composition of the 6-antenna of several of the glycans were also found to have different cross-sections from isomeric ions produced in the same spectra. Potential mechanisms for the formation of the various ions are discussed and the estimated collisional cross-sections are tabulated. Graphical Abstract ᅟ.
Gao, Yang; Fang, Xiaoliang; Tan, Jianping; Lu, Ting; Pan, Likun; Xuan, Fuzhen
2018-06-08
Wearable strain sensors based on nanomaterial/elastomer composites have potential applications in flexible electronic skin, human motion detection, human-machine interfaces, etc. In this research, a type of high performance strain sensors has been developed using fragmentized carbon nanotube/polydimethylsiloxane (CNT/PDMS) composites. The CNT/PDMS composites were ground into fragments, and a liquid-induced densification method was used to fabricate the strain sensors. The strain sensors showed high sensitivity with gauge factors (GFs) larger than 200 and a broad strain detection range up to 80%, much higher than those strain sensors based on unfragmentized CNT/PDMS composites (GF sensors is ascribed to the sliding of individual fragmentized-CNT/PDMS-composite particles during mechanical deformation, which causes significant resistance change in the strain sensors. The strain sensors can differentiate mechanical stimuli and monitor various human body motions, such as bending of the fingers, human breathing, and blood pulsing.
Development of high-resolution gamma detector using sub-mm GAGG crystals coupled to TSV-MPPC array
International Nuclear Information System (INIS)
Lipovec, A.; Shimazoe, K.; Takahashi, H.
2016-01-01
In this study a high-resolution gamma detector based on an array of sub-millimeter Ce:GAGG (Cerium doped Gd 3 Al 2 Ga 3 O 12 ) crystals read out by an array of surface-mount type of TSV-MPPC was developed. MPPC sensor from Hamamatsu which has a 26 by 26 mm 2 detector area with 64 channels was used. One channel has a 3 by 3 mm 2 photosensitive area with 50 μ m pitch micro cells. MPPC sensor provides 576 mm 2 sensing area and was used to decode 48 by 48 array with 0.4 by 0.4 by 20 mm 3 Ce:GAGG crystals of 500 μ m pitch. The base of the detector with the crystal module was mounted to a read out board which consists of charge division circuit, thus allowing for a read out of four channels to identify the position of the incident event on the board. The read out signals were amplified using charge sensitive amplifiers. The four amplified signals were digitized and analyzed to produce a position sensitive event. For the performance analysis a 137 Cs source was used. The produced events were used for flood histogram and energy analysis. The effects of the glass thickness between the Ce:GAGG and MPPC were analyzed using the experimental flood diagrams and Geant4 simulations. The glass between the scintillator and the detector allows the spread of the light over different channels and is necessary if the channel's sensitive area is bigger than the scintillator's area. The initial results demonstrate that this detector module is promising and could be used for applications requiring compact and high-resolution detectors. Experimental results show that the detectors precision increases using glass guide thickness of 1.35 mm and 1.85 mm; however the precision using 2.5 mm are practically the same as if using 0.8 mm or 1.0 mm glass guide thicknesses. In addition, simulations using Geant4 indicate that the light becomes scarcer if thicker glass is used, thus reducing the ability to indicate which crystal was targeted. When 2.5 mm glass thickness is used, the scarce
Slow Light at High Frequencies in an Amplifying Semiconductor Waveguide
DEFF Research Database (Denmark)
Öhman, Filip; Yvind, Kresten; Mørk, Jesper
2006-01-01
We demonstrate slow-down of a modulated light signal in a semiconductor waveguide. Concatenated amplifying and absorbing sections simultaneously achieve both amplification and a controllable time delay at 15 GHz.......We demonstrate slow-down of a modulated light signal in a semiconductor waveguide. Concatenated amplifying and absorbing sections simultaneously achieve both amplification and a controllable time delay at 15 GHz....
Fiber Based Optical Amplifier for High Energy Laser Pulses Final Report CRADA No. TC02100.0
Energy Technology Data Exchange (ETDEWEB)
Messerly, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Cunningham, P. [Boeing Company, Springfield, VA (United States)
2017-09-06
This was a collaborative effort between Lawrence Livermore National Security, LLC (formerly The Regents of the University of California)/Lawrence Livermore National Laboratory (LLNL), and The Boeing Company to develop an optical fiber-based laser amplifier capable of producing and sustaining very high-energy, nanosecond-scale optical pulses. The overall technical objective of this CRADA was to research, design, and develop an optical fiber-based amplifier that would meet specific metrics.
The design study of the high power solid-state amplifier in S-band
International Nuclear Information System (INIS)
Tozyo, E.; Kobayashi, K.; Yoshida, K.
1976-01-01
We have designed the 500W high power solid-state amplifier for the microwave system of INS electron linac. In this design study the output pulse power level of each module is set as possible as high, so the total number of elements is well reduced within the present microwave technics. In comparison with TWTA highly stabilized and maintenance-free operations are expected with 5 years' MTF. (auth.)
High resolution sequence stratigraphy in China
International Nuclear Information System (INIS)
Zhang Shangfeng; Zhang Changmin; Yin Yanshi; Yin Taiju
2008-01-01
Since high resolution sequence stratigraphy was introduced into China by DENG Hong-wen in 1995, it has been experienced two development stages in China which are the beginning stage of theory research and development of theory research and application, and the stage of theoretical maturity and widely application that is going into. It is proved by practices that high resolution sequence stratigraphy plays more and more important roles in the exploration and development of oil and gas in Chinese continental oil-bearing basin and the research field spreads to the exploration of coal mine, uranium mine and other strata deposits. However, the theory of high resolution sequence stratigraphy still has some shortages, it should be improved in many aspects. The authors point out that high resolution sequence stratigraphy should be characterized quantitatively and modelized by computer techniques. (authors)
Zhang, Wei; Ju, Jinchuan; Zhang, Jun; Zhong, Huihuang
2017-12-01
To achieve GW-level amplification output radiation at the X-band, a relativistic triaxial klystron amplifier with two-stage cascaded double-gap bunching cavities is investigated. The input cavity is optimized to obtain a high absorption rate of the external injection microwave. The cascaded bunching cavities are optimized to achieve a high depth of the fundamental harmonic current. A double-gap standing wave extractor is designed to improve the beam wave conversion efficiency. Two reflectors with high reflection coefficients both to the asymmetric mode and the TEM mode are employed to suppress the asymmetric mode competition and TEM mode microwave leakage. Particle-in-cell simulation results show that a high power microwave with a power of 2.53 GW and a frequency of 8.4 GHz is generated with a 690 kV, 9.3 kA electron beam excitation and a 25 kW seed microwave injection. Particularly, the achieved power conversion efficiency is about 40%, and the gain is as high as 50 dB. Meanwhile, there is insignificant self-excitation of the parasitic mode in the proposed structure by adopting the reflectors. The relative phase difference between the injected signals and the output microwaves keeps locked after the amplifier becomes saturated.
Small signal microwave amplifier design
Grosch, Theodore
2000-01-01
This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book
Development of AMS high resolution injector system
International Nuclear Information System (INIS)
Bao Yiwen; Guan Xialing; Hu Yueming
2008-01-01
The Beijing HI-13 tandem accelerator AMS high resolution injector system was developed. The high resolution energy achromatic system consists of an electrostatic analyzer and a magnetic analyzer, which mass resolution can reach 600 and transmission is better than 80%. (authors)
International Nuclear Information System (INIS)
Perevertaylo, V.L.; Zaitsevsky, I.L.; Tarasenko, L.I.; Perevertaylo, A.V.; Shkirenko, E.A.
2012-01-01
Developments of new spectrometric channel electronics on the basis of microassemblies, which allowed to reduce the noise and increase of signal-to-noise ratio, lowering power consumption and dimensions. The complete line of front-end electronics for CZT detectors implemented as micro-assemblies is described, the design concept, operation details and application features of charge sensitive amplifier and shaping amplifier microassemblies are discussed, and the results obtained when registering low energy X-ray spectra are shown. It has a high energy resolution δE at the level of the leading companies. For direct detection with silicon p-i-n-diode new electronic channel can resolve 241 Am peaks up to 8 keV with a resolution of about 2 keV at room temperature. New electronics is universal and can be used with different semiconductor detectors - Si, CdZnTe, Scintillator-photodiode, as shown in the spectra. Low power consumption and reduced dimensions allows the using in portable equipment. Manufacturability of micro assembly opens up the possibility for mass production and low cost opens up the possibility to supply them with detectors as S tart kit f or the construction of radiometric and spectrometric devices
Resolution enhancement of low quality videos using a high-resolution frame
Pham, T.Q.; Van Vliet, L.J.; Schutte, K.
2006-01-01
This paper proposes an example-based Super-Resolution (SR) algorithm of compressed videos in the Discrete Cosine Transform (DCT) domain. Input to the system is a Low-Resolution (LR) compressed video together with a High-Resolution (HR) still image of similar content. Using a training set of
A Highly Responsive Silicon Nanowire/Amplifier MOSFET Hybrid Biosensor.
Lee, Jieun; Jang, Jaeman; Choi, Bongsik; Yoon, Jinsu; Kim, Jee-Yeon; Choi, Yang-Kyu; Kim, Dong Myong; Kim, Dae Hwan; Choi, Sung-Jin
2015-07-21
This study demonstrates a hybrid biosensor comprised of a silicon nanowire (SiNW) integrated with an amplifier MOSFET to improve the current response of field-effect-transistor (FET)-based biosensors. The hybrid biosensor is fabricated using conventional CMOS technology, which has the potential advantage of high density and low noise performance. The biosensor shows a current response of 5.74 decades per pH for pH detection, which is 2.5 × 10(5) times larger than that of a single SiNW sensor. In addition, we demonstrate charged polymer detection using the biosensor, with a high current change of 4.5 × 10(5) with a 500 nM concentration of poly(allylamine hydrochloride). In addition, we demonstrate a wide dynamic range can be obtained by adjusting the liquid gate voltage. We expect that this biosensor will be advantageous and practical for biosensor applications which requires lower noise, high speed, and high density.
High resolution, high speed ultrahigh vacuum microscopy
International Nuclear Information System (INIS)
Poppa, Helmut
2004-01-01
The history and future of transmission electron microscopy (TEM) is discussed as it refers to the eventual development of instruments and techniques applicable to the real time in situ investigation of surface processes with high resolution. To reach this objective, it was necessary to transform conventional high resolution instruments so that an ultrahigh vacuum (UHV) environment at the sample site was created, that access to the sample by various in situ sample modification procedures was provided, and that in situ sample exchanges with other integrated surface analytical systems became possible. Furthermore, high resolution image acquisition systems had to be developed to take advantage of the high speed imaging capabilities of projection imaging microscopes. These changes to conventional electron microscopy and its uses were slowly realized in a few international laboratories over a period of almost 40 years by a relatively small number of researchers crucially interested in advancing the state of the art of electron microscopy and its applications to diverse areas of interest; often concentrating on the nucleation, growth, and properties of thin films on well defined material surfaces. A part of this review is dedicated to the recognition of the major contributions to surface and thin film science by these pioneers. Finally, some of the important current developments in aberration corrected electron optics and eventual adaptations to in situ UHV microscopy are discussed. As a result of all the path breaking developments that have led to today's highly sophisticated UHV-TEM systems, integrated fundamental studies are now possible that combine many traditional surface science approaches. Combined investigations to date have involved in situ and ex situ surface microscopies such as scanning tunneling microscopy/atomic force microscopy, scanning Auger microscopy, and photoemission electron microscopy, and area-integrating techniques such as x-ray photoelectron
Fragmentation of molecular ions in slow electron collisions
International Nuclear Information System (INIS)
Novotny, Steffen
2008-01-01
The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD + the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2 nd order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H 2 + produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)
Fragmentation of molecular ions in slow electron collisions
Energy Technology Data Exchange (ETDEWEB)
Novotny, Steffen
2008-06-25
The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD{sup +} the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2{sup nd} order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H{sub 2}{sup +} produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)
Model of Structural Fragmentation Induced by High Pressure Torsion
Czech Academy of Sciences Publication Activity Database
Kratochvíl, J.; Kružík, Martin; Sedláček, R.
2010-01-01
Roč. 25, č. 1 (2010), s. 88-98 ISSN 1606-5131 Institutional research plan: CEZ:AV0Z10750506 Keywords : High-pressure torsion * intergranular glide * homogeneous deformation mode Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.649, year: 2010 http://library.utia.cas.cz/separaty/2010/MTR/kruzik-model of structural fragmentation induced by high pressure torsion.pdf
Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.
Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong
2015-11-01
The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.
Mechanical Amplifier for a Piezoelectric Transducer
Moore, James; Swain, Mark; Lawson, Peter; Calvet, Robert
2003-01-01
A mechanical amplifier has been devised to multiply the stroke of a piezoelectric transducer (PZT) intended for use at liquid helium temperatures. Interferometry holds the key to high angular resolution imaging and astrometry in space. Future space missions that will detect planets around other solar systems and perform detailed studies of the evolution of stars and galaxies will use new interferometers that observe at mid- and far-infrared wavelengths. Phase-measurement interferometry is key to many aspects of astronomical interferometry, and PZTs are ideal modulators for most methods of phase measurement, but primarily at visible wavelengths. At far infrared wavelengths of 150 to 300 m, background noise is a severe problem and all optics must be cooled to about 4 K. Under these conditions, piezos are ill-suited as modulators, because their throw is reduced by as much as a factor of 2, and even a wavelength or two of modulation is beyond their capability. The largest commercially available piezo stacks are about 5 in. (12.7 cm) long and have a throw of about 180 m at room temperature and only 90 m at 4 K. It would seem difficult or impossible to use PZTs for phase measurements in the far infrared were it not for the new mechanical amplifier that was designed and built.
A high resolution solar atlas for fluorescence calculations
Hearn, M. F.; Ohlmacher, J. T.; Schleicher, D. G.
1983-01-01
The characteristics required of a solar atlas to be used for studying the fluorescence process in comets are examined. Several sources of low resolution data were combined to provide an absolutely calibrated spectrum from 2250 A to 7000A. Three different sources of high resolution data were also used to cover this same spectral range. The low resolution data were then used to put each high resolution spectrum on an absolute scale. The three high resolution spectra were then combined in their overlap regions to produce a single, absolutely calibrated high resolution spectrum over the entire spectral range.
Development of FIR arrays with integrating amplifiers
Young, Erick T.
1988-08-01
The development of optimized photoconductor arrays suitable for far infrared space astronomical applications are described. Although the primary impetus is the production of a 16 by 16 element Ge:Ga demonstration array for SIRTF, the extension of this technology to Large Deployable Reflector (LDR) is considered. The optimization of Ge:Ga and Ge:Be photoconductor materials is discussed. In collaboration with Lawrence Berkeley Laboratory, measurements of FIR photoconductors with quantum efficiencies greater than 20 percent at 100 micrometers, and dark currents below 300 electrons/s are presented. Integrating J-FET amplifier technology is discussed. The current generation of integrating amplifiers has a demonstrated read noise of less than 20 electrons for an integration time of 100 s. The design is shown for a stackable 16 x n Ge:Ga array that utilizes a 16-channel monolithic version of the J-FET integrator. A part of the design is the use of a thin, thermally insulating substrate that allows the electronics to operate at the optimum temperature of 50 K while maintaining thermal and optical isolation from the detectors at 2 K. The power dissipation for the array is less than 16 mW. The array design may particularly be applicable to high resolution imaging spectrometers for LDR.
Tetsuya, Saito; Nauta, Bram
2008-01-01
To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;
High-Resolution Melting (HRM) of Hypervariable Mitochondrial DNA Regions for Forensic Science.
Dos Santos Rocha, Alípio; de Amorim, Isis Salviano Soares; Simão, Tatiana de Almeida; da Fonseca, Adenilson de Souza; Garrido, Rodrigo Grazinoli; Mencalha, Andre Luiz
2018-03-01
Forensic strategies commonly are proceeding by analysis of short tandem repeats (STRs); however, new additional strategies have been proposed for forensic science. Thus, this article standardized the high-resolution melting (HRM) of DNA for forensic analyzes. For HRM, mitochondrial DNA (mtDNA) from eight individuals were extracted from mucosa swabs by DNAzol reagent, samples were amplified by PCR and submitted to HRM analysis to identify differences in hypervariable (HV) regions I and II. To confirm HRM, all PCR products were DNA sequencing. The data suggest that is possible discriminate DNA from different samples by HRM curves. Also, uncommon dual-dissociation was identified in a single PCR product, increasing HRM analyzes by evaluation of melting peaks. Thus, HRM is accurate and useful to screening small differences in HVI and HVII regions from mtDNA and increase the efficiency of laboratory routines based on forensic genetics. © 2017 American Academy of Forensic Sciences.
Bandwidth tunable amplifier for recording biopotential signals.
Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer
2010-01-01
This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.
Tan, Ming-pu
2010-01-01
Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.
On the nuclear fragmentation mechanisms in nuclear collisions at intermediate and high energies
International Nuclear Information System (INIS)
Jipa, Al; Besliu, C.; Felea, D.
2004-01-01
The nuclear fragmentation mechanisms can be discussed by taking into account different scales related to the fragment sizes. Considering two fragmentation mechanisms of the nuclei at the same incident energy an analysis of the experimental results obtained was done. Goldhaber formula was improved by analyzing the discrepancies between data and theories concerning the projectile fragmentation. We implied that the projectile fragmentation process would be governed by the distribution of nucleon momenta in the projectile after the collision occurred. We used in our analysis protons from the 4 He + 7 Li at 4.5 GeV/c per nucleon incident momentum, as well as from 40 Ar + 12 C at 213 AMeV bombarding energy. We proved that in order to proceed in analyzing the projectile fragmentation process at intermediate and high energies one has to consider the dependence σ 0 on the apparent temperature of projectile nucleus after the collision took place. The generalized Bertsch correction for light projectile nuclei and fragments was used and the number of spatial correlations between identical nucleons having anticorrelated momenta was found. Thus we found apparent temperature values close to the separation energies of the considered fragments per number of fragments. The temperatures associated to kinetic energy spectra of the projectile fragments were calculated following two methods. The results from Bauer's method were compared with those obtained by fitting the kinetic energy distributions of the projectile fragments in the rest frame of the projectile with a Maxwellian curve. We also accomplished the comparison of the experimental results with similar events simulated with RQMD 2.4. All the results obtained suggested two nuclear fragmentation mechanisms: a sudden fragmentation by explosive mechanisms, like shock waves and a slow fragmentation by the 'fission' of the spectator regions, mainly because of the interactions with the particles or fragments emitted from the
High-resolution SPECT for small-animal imaging
International Nuclear Information System (INIS)
Qi Yujin
2006-01-01
This article presents a brief overview of the development of high-resolution SPECT for small-animal imaging. A pinhole collimator has been used for high-resolution animal SPECT to provide better spatial resolution and detection efficiency in comparison with a parallel-hole collimator. The theory of imaging characteristics of the pinhole collimator is presented and the designs of the pinhole aperture are discussed. The detector technologies used for the development of small-animal SPECT and the recent advances are presented. The evolving trend of small-animal SPECT is toward a multi-pinhole and a multi-detector system to obtain a high resolution and also a high detection efficiency. (authors)
Realization of OFCC based Transimpedance Mode Instrumentation Amplifier
Directory of Open Access Journals (Sweden)
Neeta Pandey
2016-01-01
Full Text Available The paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three Operational Floating Current Conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematicThe paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three operational floating current conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematic.
Cui, Xiaoyan; Sun, Can; Zhao, Pei; Wang, Yanyan; Guo, Yanchun; Zhao, Yufen; Cao, Shuxia
2018-04-01
The fragmentation pathways of pentacoordinated phenoxyspirophosphoranes were investigated in the positive mode by electrospray ionization multistage mass spectrometry. The results demonstrate that the sodium adducts of the title compounds undergo two competitive fragmentation pathways, and the fragmentation patterns are heavily dependent on the various substituent patterns at the phenolic group. An electron-withdrawing substituent at the ortho-position always results in the removal of a corresponding phenol analogue, while cleavage by spiroring opening becomes the predominant fragmentation pathway if an electron-donating substituent is at the phenolic group. The substituent effects on the competitive fragmentation pathways were further elucidated by theoretical calculations, single crystal structure analysis, and high-resolution mass spectrometry. The results contribute to the understanding of the gas-phase fragmentation reactions and the structure identification of spirophosphorane analogues by electrospray ionization multistage mass spectrometry. Copyright © 2018 John Wiley & Sons, Ltd.
An Implantable CMOS Amplifier for Nerve Signals
DEFF Research Database (Denmark)
Nielsen, Jannik Hammel; Lehmann, Torsten
2001-01-01
In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...
The OPTHER Project: Progress toward the THz Amplifier
DEFF Research Database (Denmark)
Paoloni, C; Brunetti, F; Di Carlo, A
2011-01-01
This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....
Zhu, Yufeng; Yin, Yanfei; Yang, Keqiang; Li, Jihong; Sang, Yalin; Huang, Long; Fan, Shu
2015-08-18
Walnut (Juglans regia, 2n = 32, approximately 606 Mb per 1C genome) is an economically important tree crop. Resistance to anthracnose, caused by Colletotrichum gloeosporioides, is a major objective of walnut genetic improvement in China. The recently developed specific length amplified fragment sequencing (SLAF-seq) is an efficient strategy that can obtain large numbers of markers with sufficient sequence information to construct high-density genetic maps and permits detection of quantitative trait loci (QTLs) for molecular breeding. SLAF-seq generated 161.64 M paired-end reads. 153,820 SLAF markers were obtained, of which 49,174 were polymorphic. 13,635 polymorphic markers were sorted into five segregation types and 2,577 markers of them were used to construct genetic linkage maps: 2,395 of these fell into 16 linkage groups (LGs) for the female map, 448 markers for the male map, and 2,577 markers for the integrated map. Taking into account the size of all LGs, the marker coverage was 2,664.36 cM for the female map, 1,305.58 cM for the male map, and 2,457.82 cM for the integrated map. The average intervals between two adjacent mapped markers were 1.11 cM, 2.91 cM and 0.95 cM for three maps, respectively. 'SNP_only' markers accounted for 89.25% of the markers on the integrated map. Mapping markers contained 5,043 single nucleotide polymorphisms (SNPs) loci, which corresponded to two SNP loci per SLAF marker. According to the integrated map, we used interval mapping (Logarithm of odds, LOD > 3.0) to detect our quantitative trait. One QTL was detected for anthracnose resistance. The interval of this QTL ranged from 165.51 cM to 176.33 cM on LG14, and ten markers in this interval that were above the threshold value were considered to be linked markers to the anthracnose resistance trait. The phenotypic variance explained by each marker ranged from 16.2 to 19.9%, and their LOD scores varied from 3.22 to 4.04. High-density genetic maps for walnut containing 16
Design considerations of a MW-scale, high-efficiency, industrial-use, ultraviolet FEL amplifier
International Nuclear Information System (INIS)
Pagani, C.; Saldin, E.L.; Schneidmiller, E.A.; Yurkov, M.V.
2000-01-01
Theoretical and experimental work in free electron laser (FEL) physics, and the physics of particle accelerators over the last 10 years has pointed to the possibility of the generation of MW-level optical beams with laser-like characteristics in the ultraviolet (UV) spectral range. The concept is based on generation of the radiation in the master oscillator-power FEL amplifier (MOPA) configuration. The FEL amplifier concept eliminates the need for an optical cavity. As a result, there are no thermal loading limitations to increase the average output power of this device up to the MW-level. The problem of a tunable master oscillator can be solved with available conventional quantum lasers. The use of a superconducting energy-recovery linac could produce a major, cost-effective facility with wall plug power to output optical power efficiency of about 20% that spans wavelengths from the visible to the deep ultraviolet regime. The stringent electron beam qualities required for UV FEL amplifier operation can be met with a conservative injector design (using a conventional thermionic gun and subharmonic bunchers) and the beam compression and linear acceleration technology, recently developed in connection with high-energy linear collider and X-ray FEL programs
Theoretical analysis of mode instability in high-power fiber amplifiers
DEFF Research Database (Denmark)
Hansen, Kristian Rymann; Alkeskjold, Thomas Tanggaard; Broeng, Jes
2013-01-01
We present a simple theoretical model of transverse mode instability in high-power rare-earth doped fiber amplifiers. The model shows that efficient power transfer between the fundamental and higher-order modes of the fiber can be induced by a nonlinear interaction mediated through the thermo......-optic effect, leading to transverse mode instability. The temporal and spectral characteristics of the instability dynamics are investigated, and it is shown that the instability can be seeded by both quantum noise and signal intensity noise, while pure phase noise of the signal does not induce instability...
Fragmentation structure on high-p sub (T) events
International Nuclear Information System (INIS)
Bengtsson, H.-U.; Maansson, O.
1982-11-01
We desrcibe a scheme for handling the different topologies that result from a string model for the final state hadron fragmentation in high-p sub (T) events. Calculations are presented for all order α sub (em) x α sub (s)- and α sub (s) x α sub (s)- processes with a view to serve as a back-ground to the Lund Monte Carlo for promt photon and high-p sub (T) physics. We also discuss briefly the characteristics of some string models other than the Lund model, the transition of K-factors in high-p sub (T) reactions. (Author)
High resolution time integration for SN radiation transport
International Nuclear Information System (INIS)
Thoreson, Greg; McClarren, Ryan G.; Chang, Jae H.
2009-01-01
First-order, second-order, and high resolution time discretization schemes are implemented and studied for the discrete ordinates (S N ) equations. The high resolution method employs a rate of convergence better than first-order, but also suppresses artificial oscillations introduced by second-order schemes in hyperbolic partial differential equations. The high resolution method achieves these properties by nonlinearly adapting the time stencil to use a first-order method in regions where oscillations could be created. We employ a quasi-linear solution scheme to solve the nonlinear equations that arise from the high resolution method. All three methods were compared for accuracy and convergence rates. For non-absorbing problems, both second-order and high resolution converged to the same solution as the first-order with better convergence rates. High resolution is more accurate than first-order and matches or exceeds the second-order method
Self-oscillating modulators for direct energy conversion audio power amplifiers
Energy Technology Data Exchange (ETDEWEB)
Ljusev, P.; Andersen, Michael A.E.
2005-07-01
Direct energy conversion audio power amplifier represents total integration of switching-mode power supply and Class D audio power amplifier into one compact stage, achieving high efficiency, high level of integration, low component count and eventually low cost. This paper presents how self-oscillating modulators can be used with the direct switching-mode audio power amplifier to improve its performance by providing fast hysteretic control with high power supply rejection ratio, open-loop stability and high bandwidth. Its operation is thoroughly analyzed and simulated waveforms of a prototype amplifier are presented. (au)
High tracking resolution detectors. Final Technical Report
International Nuclear Information System (INIS)
Vasile, Stefan; Li, Zheng
2010-01-01
High-resolution tracking detectors based on Active Pixel Sensor (APS) have been valuable tools in Nuclear Physics and High-Energy Physics research, and have contributed to major discoveries. Their integration time, radiation length and readout rate is a limiting factor for the planed luminosity upgrades in nuclear and high-energy physics collider-based experiments. The goal of this program was to demonstrate and develop high-gain, high-resolution tracking detector arrays with faster readout, and shorter radiation length than APS arrays. These arrays may operate as direct charged particle detectors or as readouts of high resolution scintillating fiber arrays. During this program, we developed in CMOS large, high-resolution pixel sensor arrays with integrated readout, and reset at pixel level. Their intrinsic gain, high immunity to surface and moisture damage, will allow operating these detectors with minimal packaging/passivation requirements and will result in radiation length superior to APS. In Phase I, we designed and fabricated arrays with calorimetric output capable of sub-pixel resolution and sub-microsecond readout rate. The technical effort was dedicated to detector and readout structure development, performance verification, as well as to radiation damage and damage annealing.
Directory of Open Access Journals (Sweden)
Dolores González
2012-12-01
Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m
Ultra high resolution tomography
Energy Technology Data Exchange (ETDEWEB)
Haddad, W.S.
1994-11-15
Recent work and results on ultra high resolution three dimensional imaging with soft x-rays will be presented. This work is aimed at determining microscopic three dimensional structure of biological and material specimens. Three dimensional reconstructed images of a microscopic test object will be presented; the reconstruction has a resolution on the order of 1000 A in all three dimensions. Preliminary work with biological samples will also be shown, and the experimental and numerical methods used will be discussed.
Li, Rao; Qiao, Zhi; Wang, Xiaochao; Fan, Wei; Lin, Zunqi
2017-10-01
With the development of fiber technologies, fiber lasers are able to deliver very high power beams and high energy pulses which can be used not only in scientific researches but industrial fields (laser marking, welding,…). The key of high power fiber laser is fiber amplifier. In this paper, we present a two-level master-oscillator power amplifier system at 1053 nm based on Yb-doped photonic crystal fibers. The system is used in the front-end of high power laser facility for the amplification of nano-second pulses to meet the high-level requirements. Thanks to the high gain of the system which is over 50 dB, the pulse of more than 0.89 mJ energy with the nearly diffraction-limited beam quality has been obtained.
Quantification of DNA fragmentation in processed foods using real-time PCR.
Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi
2017-07-01
DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kozawa, Takahiro; Watanabe, Kyoko; Matsuoka, Kyoko; Yamamoto, Hiroki; Komuro, Yoshitaka; Kawana, Daisuke; Yamazaki, Akiyoshi
2017-08-01
The resolution of lithography used for the high-volume production of semiconductor devices has been improved to meet the market demands for highly integrated circuits. With the reduction in feature size, the molecular size becomes non-negligible in the resist material design. In this study, the excluded volume effects caused by adding high-concentration acid generators were investigated for triphenylsulfonium nonaflate. The resist film density was measured by X-ray diffractometry. The dependences of absorption coefficient and protected unit concentration on acid generator weight ratio were calculated from the measured film density. Using these values, the effects on the decomposition yield of acid generators, the protected unit fluctuation, and the line edge roughness (LER) were evaluated by simulation on the basis of sensitization and reaction mechanisms of chemically amplified extreme ultraviolet resists. The positive effects of the increase in acid generator weight ratio on LER were predominant below the acid generator weight ratio of 0.3, while the negative effects became equivalent to the positive effects above the acid generator weight ratio of 0.3 owing to the excluded volume effects.
International Nuclear Information System (INIS)
Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi
2008-01-01
An RNA aptamer in complex with the human IgG Fc fragment have been crystallized. The stirring technique with a rotary shaker was used to improve the crystals and to ensure that they were of high quality and single, resulting in crystals that diffracted to 2.2 Å resolution. Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution
DEFF Research Database (Denmark)
Rand, Kasper Dyrberg; Zehl, Martin; Jørgensen, Thomas J D
2014-01-01
, and eventually all of the protecting hydrogen bonds will transiently break as the protein-according to thermodynamic principles-cycles through partially unfolded states that correspond to excited free energy levels. As a result, all of the backbone amides will eventually become temporarily solvent....../dysfunction and conformational dynamics requires in many cases higher resolution and ultimately single-residue resolution. In this Account, we summarize our efforts to achieve single-residue deuterium levels in proteins by electron-based or laser-induced gas-phase fragmentation methods. A crucial analytical requirement...
Bossolini, Eligio; Klahre, Ulrich; Brandenburg, Anna; Reinhardt, Didier; Kuhlemeier, Cris
2011-01-01
Two linkage maps were constructed for the model plant Petunia. Mapping populations were obtained by crossing the wild species Petunia axillaris subsp. axillaris with Petunia inflata, and Petunia axillaris subsp. parodii with Petunia exserta. Both maps cover the seven chromosomes of Petunia, and span 970 centimorgans (cM) and 700 cM of the genomes, respectively. In total, 207 markers were mapped. Of these, 28 are multilocus amplified fragment length polymorphism (AFLP) markers and 179 are gene...
International Nuclear Information System (INIS)
Nelson, Brian A.
2006-01-01
Limited resources force most smaller fusion energy research experiments to have little or no feedback control of their operational parameters, preventing achievement of their full operational potential. Recent breakthroughs in high-power switching technologies have greatly reduced feedback-controlled power supply costs, primarily those classified as switching power amplifiers. However, inexpensive and flexible controllers for these power supplies have not been developed. A uClinux-based micro-controller (Analog Devices Blackfin BF537) was identified as having the capabilities to form the base of a digital control system for switching power amplifiers. A control algorithm was created, and a Linux character device driver was written to realize the algorithm. The software and algorithm were successfully tested on a switching power amplifier and magnetic field coil using University of Washington (subcontractor) resources
CARM and harmonic gyro-amplifier experiments at 17 GHz
International Nuclear Information System (INIS)
Menninger, W.L.; Danly, B.G.; Alberti, S.; Chen, C.; Rullier, J.L.; Temkin, R.J.
1993-01-01
Cyclotron resonance maser amplifiers are possible sources for applications such as electron cyclotron resonance heating of fusion plasmas and driving high-gradient rf linear accelerators. For accelerator drivers, amplifiers or phase locked-oscillators are required. A 17 GHz cyclotron autoresonance maser (CARM) amplifier experiment and a 17 GHz third harmonic gyro-amplifier experiment are presently underway at the MIT Plasma Fusion Center. Using the SRL/MIT SNOMAD II introduction accelerator to provide a 380 kV, 180 A, 30 ns flat top electron beam, the gyro-amplifier experiment has produced 5 MW of rf power with over 50 dB of gain at 17 GHz. The gyro-amplifier operates in the TE 31 mode using a third harmonic interaction. Because of its high power output, the gyro-amplifier will be used as the rf source for a photocathode rf electron gun experiment also taking place at MIT. Preliminary gyro-amplifier results are presented, including measurement of rf power, gain versus interaction length, and the far-field pattern. A CARM experiment designed to operate in the TE 11 mode is also discussed
Spectral hole-burning and carrier-heating dynamics in InGaAs quantum-dot amplifiers
DEFF Research Database (Denmark)
Borri, Paola; Langbein, Wolfgang Werner; Hvam, Jørn Märcher
2000-01-01
recovery of the spectral hole within ~100 fs is measured, comparable to bulk and quantum-well amplifiers, which is contradicting a carrier relaxation bottleneck in electrically pumped QD devices. The CH dynamics in the QD is quantitatively compared with results on an InGaAsP bulk amplifier. Reduced CH......The ultrafast gain and index dynamics in a set of InAs-InGaAs-GaAs quantum-dot (QD) amplifiers are measured at room temperature with femtosecond resolution. The role of spectral hole-burning (SHB) and carrier heating (CH) in the recovery of gain compression is investigated in detail. An ultrafast...
Zhu, Lili; Wu, Jingping; Lin, Guimin; Hu, Liangjun; Li, Hui
2016-10-01
With high spatial resolution of ultrasonic location and high sensitivity of optical detection, ultrasound-modulated optical tomography (UOT) is a promising noninvasive biological tissue imaging technology. In biological tissue, the ultrasound-modulated light signals are very weak and are overwhelmed by the strong unmodulated light signals. It is a difficulty and key to efficiently pick out the weak modulated light from strong unmodulated light in UOT. Under the effect of an ultrasonic field, the scattering light intensity presents a periodic variation as the ultrasonic frequency changes. So the modulated light signals would be escape from the high unmodulated light signals, when the modulated light signals and the ultrasonic signal are processed cross correlation operation by a lock-in amplifier and without a chopper. Experimental results indicated that the signal-to-noise ratio of UOT is significantly improved by a lock-in amplifier, and the higher the repetition frequency of pulsed ultrasonic wave, the better the signal-to-noise ratio of UOT.
Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments
International Nuclear Information System (INIS)
Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.
1983-11-01
Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)
Birds communities of fragmented forest within highly urbanized landscape in Kuala Lumpur, Malaysia
Mohd-Taib, F. S.; Rabiatul-Adawiyah, S.; Md-Nor, S.
2014-09-01
Urbanization is one form of forest modification for development purposes. It produces forest fragments scattered in the landscape with different intensity of disturbance. We want to determine the effect of forest fragmentation towards bird community in urbanized landscapes in Kuala Lumpur, namely Sungai Besi Forest Reserve (FR), Bukit Nenas FR and Bukit Sungei Puteh FR. We used mist-netting and direct observation method along established trails. These forests differ in size, vegetation composition and land use history. Results show that these forests show relatively low number of species compared to other secondary forest with only 39 bird species recorded. The largest fragment, Sg. Besi encompassed the highest species richness and abundance with 69% species but lower in diversity. Bukit Nenas, the next smallest fragment besides being the only remaining primary forest has the highest diversity index with 1.866. Bkt. Sg. Puteh the smallest fragment has the lowest species richness and diversity with Shanon diversity index of 1.332. The presence of introduced species such as Corvus splendens (House crow) in all study areas suggest high disturbance encountered by these forests. Nonetheless, these patches comprised of considerably high proportion of native species. In conclusion, different intensity of disturbance due to logging activities and urbanization surrounding the forest directly influenced bird species richness and diversity. These effects however can be compensated by maintaining habitat complexity including high vegetation composition and habitat structure at the landscape level.
Silicon drift detectors for high resolution room temperature X-ray spectroscopy
International Nuclear Information System (INIS)
Lechner, P.; Eckbauer, S.; Hauff, D.; Strueder, L.; Gatti, E.; Longoni, A.; Sampietro, M.
1996-01-01
New cylindrical silicon drift detectors have been designed, fabricated and tested. They comprise an integrated on-chip amplifier system with continuous reset, on-chip voltage divider, electron accumulation layer stabilizer, large area, homogeneous radiation entrance window and a drain for surface generated leakage current. The test of the 3.5 mm 2 large individual devices, which have also been grouped together to form a sensitive area up to 21 mm 2 have shown the following spectroscopic results: at room temperature (300 K) the devices have shown a full width at half maximum at the Mn Kα line of a radioactive 55 Fe source of 225 eV with shaping times of 250 to 500 ns. At -20 C the resolution improves to 152 eV at 2 μs Gaussian shaping. At temperatures below 200 K the energy resolution is below 140 eV. With the implementation of a digital filtering system the resolution approaches 130 eV. The system was operated with count rates up to 800 000 counts per second and per readout node, still conserving the spectroscopic qualities of the detector system. (orig.)
High Resolution Elevation Contours
Minnesota Department of Natural Resources — This dataset contains contours generated from high resolution data sources such as LiDAR. Generally speaking this data is 2 foot or less contour interval.
Musenga, Alessandro; Cowan, David A
2013-05-03
We describe a sensitive, comprehensive and fast screening method based on liquid chromatography-high resolution mass spectrometry for the detection of a large number of analytes in sports samples. UHPLC coupled to high resolution mass spectrometry with polarity switching capability is applied for the rapid screening of a large number of analytes in human urine samples. Full scan data are acquired alternating both positive and negative ionisation. Collision-induced dissociation with positive ionisation is also performed to produce fragment ions to improve selectivity for some analytes. Data are reviewed as extracted ion chromatograms based on narrow mass/charge windows (±5ppm). A simple sample preparation method was developed, using direct enzymatic hydrolysis of glucuronide conjugates, followed by solid phase extraction with mixed mode ion-exchange cartridges. Within a 10min run time (including re-equilibration) the method presented allows for the analysis of a large number of analytes from most of the classes in the World Anti-Doping Agency (WADA) Prohibited List, including anabolic agents, β2-agonists, hormone antagonists and modulators, diuretics, stimulants, narcotics, glucocorticoids and β-blockers, and does so while meeting the WADA sensitivity requirements. The high throughput of the method and the fast sample pre-treatment reduces analysis cost and increases productivity. The method presented has been used for the analysis of over 5000 samples in about one month and proved to be reliable. Copyright © 2013 Elsevier B.V. All rights reserved.
Laboratory experiments on fragmentation of highly-viscous bubbly syrup
Kurihara, H.; Kameda, M.; Ichihara, M.
2006-12-01
Fragmentation of vesicular magma by rapid decompression is a key process in explosive eruptions. To determine the fragmentation criteria, we carried out laboratory experiments on magma fragmentation using analogous materials. We used commercial syrup as an analogous material of magma, because the viscosity was widely altered by adding or subtracting water contents in the syrup. We made the bubbly syrup by adding hydrogen peroxide with manganese oxide in the syrup. The amount of hydrogen peroxide is proportional to the gas volume fraction in the syrup. We measured the rheological properties of the syrup. Zero shear viscosity η was measured by a rotating viscometer and a fiber elongation technique. Glass transition temperature was measured by differential scanning calorimetry. The measured data indicated that the temperature dependence of viscosity was described well using Williams-Landel-Ferry (WLF) equation. The solid content of syrup alters the viscosity as well as the glass transition temperature, though it may hardly affect the rigidity μ, which was measured by ultrasonic test in our previous work. We used a pressurized vertical tube with a large vacuum vessel to apply the rapid decompression on the material. An acrylic container, filled with the bubbly syrup, was placed in the bottom of the pressurized tube. By rupturing the diaphragms inserted between the tube and the vacuum vessel, the bubbly syrup is rapidly decompressed due to expansion of the pressurized gas in the tube. A high-speed video camera was used to obtain sequential images of the materials. Pressure transducers were mounted on the sidewall of the tube and the bottom of the container. The initial pressure was varied from 1 MPa to 5 MPa. The gas-volume fraction of the syrup under pressure was fixed as 2 % to 20%. The viscosity varied from 105 Pa·s to 108 Pa·s. We successfully observed three principal behaviors using the present analogous material; brittle fragmentation, partial fracture and
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Thermal effects in high average power optical parametric amplifiers.
Rothhardt, Jan; Demmler, Stefan; Hädrich, Steffen; Peschel, Thomas; Limpert, Jens; Tünnermann, Andreas
2013-03-01
Optical parametric amplifiers (OPAs) have the reputation of being average power scalable due to the instantaneous nature of the parametric process (zero quantum defect). This Letter reveals serious challenges originating from thermal load in the nonlinear crystal caused by absorption. We investigate these thermal effects in high average power OPAs based on beta barium borate. Absorption of both pump and idler waves is identified to contribute significantly to heating of the nonlinear crystal. A temperature increase of up to 148 K with respect to the environment is observed and mechanical tensile stress up to 40 MPa is found, indicating a high risk of crystal fracture under such conditions. By restricting the idler to a wavelength range far from absorption bands and removing the crystal coating we reduce the peak temperature and the resulting temperature gradient significantly. Guidelines for further power scaling of OPAs and other nonlinear devices are given.
Ultra-high resolution coded wavefront sensor
Wang, Congli
2017-06-08
Wavefront sensors and more general phase retrieval methods have recently attracted a lot of attention in a host of application domains, ranging from astronomy to scientific imaging and microscopy. In this paper, we introduce a new class of sensor, the Coded Wavefront Sensor, which provides high spatio-temporal resolution using a simple masked sensor under white light illumination. Specifically, we demonstrate megapixel spatial resolution and phase accuracy better than 0.1 wavelengths at reconstruction rates of 50 Hz or more, thus opening up many new applications from high-resolution adaptive optics to real-time phase retrieval in microscopy.
Design and test of a capacitance detection circuit based on a transimpedance amplifier
International Nuclear Information System (INIS)
Mu Linfeng; Zhang Wendong; He Changde; Zhang Rui; Song Jinlong; Xue Chenyang
2015-01-01
This paper presents a transimpedance amplifier (TIA) capacitance detection circuit aimed at detecting micro-capacitance, which is caused by ultrasonic stimulation applied to the capacitive micro-machined ultrasonic transducer (CMUT). In the capacitance interface, a TIA is adopted to amplify the received signal with a center frequency of 400 kHz, and finally detect ultrasound pressure. The circuit has a strong anti-stray property and this paper also studies the calculation of compensation capacity in detail. To ensure high resolution, noise analysis is conducted. After optimization, the detected minimum ultrasound pressure is 2.1 Pa, which is two orders of magnitude higher than the former. The test results showed that the circuit was sensitive to changes in ultrasound pressure and the distance between the CMUT and stumbling block, which also successfully demonstrates the functionality of the developed TIA of the analog-front-end receiver. (paper)
Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S
2003-02-01
ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.
Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles
Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin
2010-01-01
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be
A high-power millimeter-wave sheet beam free-electron laser amplifier
International Nuclear Information System (INIS)
Cheng, S.; Destler, W.W.; Granatstein, V.L.; Antonsen, T.M.; Levush, B.; Rodgers, J.; Zhang, Z.X.
1996-01-01
The results of experiments with a short period (9.6 mm) wiggler sheet electron beam (1.0 mm x 2.0 cm) millimeter-wave free electron laser (FEL) amplifier are presented. This FEL amplifier utilized a strong wiggler field for sheet beam confinement in the narrow beam dimension and an offset-pole side-focusing technique for the wide dimension beam confinement. The beam analysis herein includes finite emittance and space-charge effects. High-current beam propagation was achieved as a result of extensive analytical studies and experimental optimization. A design optimization resulted in a low sensitivity to structure errors and beam velocity spread, as well as a low required beam energy. A maximum gain of 24 dB was achieved with a 1-kW injected signal power at 86 GHz, a 450-kV beam voltage, 17-A beam current, 3.8-kG wiggler magnetic field, and a 74-period wiggler length. The maximum gain with a one-watt injected millimeter-wave power was observed to be over 30 dB. The lower gain at higher injection power level indicates that the device has approached saturation. The device was studied over a broad range of experimental parameters. The experimental results have a good agreement with expectations from a one-dimensional simulation code. The successful operation of this device has proven the feasibility of the original concept and demonstrated the advantages of the sheet beam FEL amplifier. The results of the studies will provide guidelines for the future development of sheet beam FEL's and/or other kinds of sheet beam devices. These devices have fusion application
International Nuclear Information System (INIS)
Arzi, E.; Hassani, A.; Esmaili Seraji, F.
2000-01-01
Recently, the Erbium-Doped Fiber Amplifier has been shown to have a great potentiality in Fiber-Optics Communication. A model is suggested for calculating the E r-density profile, using the propagation and rate equations of a homogeneous two-level laser medium in Erbium-Doped Fiber Amplifier, such that efficient pumping and high signal gain is achieved for different fiber waveguide structure. The result of this numerical calculation shows that the gain, compared with the gain of the existing Erbium-Doped Fiber Amplifier, is higher by a factor of 3.5. This model is applicable in all active waveguides and any other dopant as well
Bingga, Gali; Liu, Zhicheng; Zhang, Jianfeng; Zhu, Yujun; Lin, Lifeng; Ding, Shuangyang; Guo, Pengju
2014-01-01
A high resolution melting (HRM) curve method was developed to identify canine parvovirus type 2 (CPV-2) strains by nested PCR. Two sets of primers, CPV-426F/426R and CPV-87R/87F, were designed that amplified a 52 bp and 53 bp product from the viral VP2 capsid gene. The region amplified by CPV-426F/426R included the A4062G and T4064A mutations in CPV-2a, CPV-2b and CPV-2c. The region amplified by CPV-87F/87R included the A3045T mutation in the vaccine strains of CPV-2 and CPV-2a, CPV-2b and CPV-2c. Faecal samples were obtained from 30 dogs that were CPV antigen-positive. The DNA was isolated from the faecal samples and PCR-amplified using the two sets of primers, and genotyped by HRM curve analysis. The PCR-HRM assay was able to distinguish single nucleotide polymorphisms between CPV-2a, CPV-2b and CPV-2c using CPV-426F/426R. CPV-2a was distinguished from CPV-2b and CPV-2c by differences in the melting temperature. CPV-2b and CPV-2c could be distinguished based on the shape of the melting curve after generating heteroduplexes using a CPV-2b reference sample. The vaccine strains of CPV-2 were identified using CPV-87F/87R. Conventional methods for genotyping CPV strains are labor intensive, expensive or time consuming; the present PCR-based HRM assay might be an attractive alternative. Copyright © 2014 Elsevier Ltd. All rights reserved.
Development and energization of IOT based RF amplifier
International Nuclear Information System (INIS)
Mandal, A.; Som, S.; Raj, P.R.; Manna, S.K.; Ghosh, S.; Seth, S.; Thakurta, S.; Thakur, S.K.; Saha, S.; Panda, U.S.
2013-01-01
A 704 MHz IOT based CW RF amplifier has been developed in VECC. It can also be used with proper tuning to power cavity modules operating at 650 MHz in high energy high intensity proton linear accelerator proposed to be built for ADSS/SNS programme in India and Project-X at Fermilab, USA. This IOT based amplifier provides up to 60 kW continuous wave RF power at 700 MHz. It required various power supplies, LCW cooling and forced air cooling for its operation. The auxiliary power supplies like Grid, Filament and Ion-pump, are floated and mounted on an isolated frame, i.e., HV deck. The mains inputs are electrically isolated by means of isolation transformer. Also, a Programmable Logic Controller (PLC) based interlocks along with high voltage collector power supply has been designed and developed for the safe operation of the RF amplifier. This paper discusses about various developments and energization of the IOT based RF amplifier with high power dummy load. (author)
Wu, Tao; Zhao, Dong-zhi; Zhang, Feng-shou; Wei, Bao-quan
2011-07-01
Based on the comprehensive consideration of the high resolution characteristics of remote sensing data and the current situation of land cover and land use in Dayang River Estuary wetland, a classification system with different resolutions of wetland landscape in the Estuary was established. The landscape pattern indices and landscape transition matrix were calculated by using the high resolution remote sensing data, and the dynamic changes of the landscape pattern from 1984 to 2008 were analyzed. In the study period, the wetland landscape components changed drastically. Wetland landscape transferred from natural wetland into artificial wetland, and wetland core regional area decreased. Natural wetland's largest patch area index descended, and the fragmentation degree ascended; while artificial wetland area expanded, its patch number decreased, polymerization degree increased, and the maximum patch area index had an obvious increasing trend. Increasing human activities, embankment construction, and reclamation for aquaculture were the main causes for the decrease of wetland area and the degradation of the ecological functions of Dayang River Estuary. To constitute long-term scientific and reasonable development plan, establish wetland nature reserves, protect riverway, draft strict inspective regimes for aquaculture reclamation, and energetically develop resource-based tourism industry would be the main strategies for the protection of the estuarine wetland.
A megajoule class krypton fluoride amplifier for single shot, high gain ICF application
International Nuclear Information System (INIS)
Rose, E.; Hanson, D.; Krohn, B.; McLeod, J.; Kang, M.
1988-01-01
A design study is underway to define the optimal architecture for a KrF laser system which will deliver 10 MJ of 248-nm light to an ICF target. We present one approach which incorporates final power amplifiers in the megajoule class, achieving 10 MJ with four final amplifiers. Each double-pass laser amplifier employs two-sided electron-beam pumping of the laser gas medium. Details of the design are based on a Monte-Carlo electron-beam deposition code, a one-dimensional, time-dependent kinetics code, and pulsed power circuit modeling. Linear dimensions of the amplifier's extracted gain volume are 6.25 m in height and length and 5.12 m in width. Each amplifier handles 160 angularly multiplexed laser channels. The one-amagat, krypton-rich laser medium is e-beam pumped at 60-kW cm/sup /minus/3/ (4-MA at3.3-MV) over the 2-microsecond duration of the laser beam pulse train. 5 refs., 4 figs
Schollée, Jennifer E.; Schymanski, Emma L.; Stravs, Michael A.; Gulde, Rebekka; Thomaidis, Nikolaos S.; Hollender, Juliane
2017-12-01
High-resolution tandem mass spectrometry (HRMS2) with electrospray ionization is frequently applied to study polar organic molecules such as micropollutants. Fragmentation provides structural information to confirm structures of known compounds or propose structures of unknown compounds. Similarity of HRMS2 spectra between structurally related compounds has been suggested to facilitate identification of unknown compounds. To test this hypothesis, the similarity of reference standard HRMS2 spectra was calculated for 243 pairs of micropollutants and their structurally related transformation products (TPs); for comparison, spectral similarity was also calculated for 219 pairs of unrelated compounds. Spectra were measured on Orbitrap and QTOF mass spectrometers and similarity was calculated with the dot product. The influence of different factors on spectral similarity [e.g., normalized collision energy (NCE), merging fragments from all NCEs, and shifting fragments by the mass difference of the pair] was considered. Spectral similarity increased at higher NCEs and highest similarity scores for related pairs were obtained with merged spectra including measured fragments and shifted fragments. Removal of the monoisotopic peak was critical to reduce false positives. Using a spectral similarity score threshold of 0.52, 40% of related pairs and 0% of unrelated pairs were above this value. Structural similarity was estimated with the Tanimoto coefficient and pairs with higher structural similarity generally had higher spectral similarity. Pairs where one or both compounds contained heteroatoms such as sulfur often resulted in dissimilar spectra. This work demonstrates that HRMS2 spectral similarity may indicate structural similarity and that spectral similarity can be used in the future to screen complex samples for related compounds such as micropollutants and TPs, assisting in the prioritization of non-target compounds. [Figure not available: see fulltext.
Fragmentation of neutral carbon clusters formed by high velocity atomic collision
International Nuclear Information System (INIS)
Martinet, G.
2004-05-01
The aim of this work is to understand the fragmentation of small neutral carbon clusters formed by high velocity atomic collision on atomic gas. In this experiment, the main way of deexcitation of neutral clusters formed by electron capture with ionic species is the fragmentation. To measure the channels of fragmentation, a new detection tool based on shape analysis of current pulse delivered by semiconductor detectors has been developed. For the first time, all branching ratios of neutral carbon clusters are measured in an unambiguous way for clusters size up to 10 atoms. The measurements have been compared to a statistical model in microcanonical ensemble (Microcanonical Metropolis Monte Carlo). In this model, various structural properties of carbon clusters are required. These data have been calculated with Density Functional Theory (DFT-B3LYP) to find the geometries of the clusters and then with Coupled Clusters (CCSD(T)) formalism to obtain dissociation energies and other quantities needed to compute fragmentation calculations. The experimental branching ratios have been compared to the fragmentation model which has allowed to find an energy distribution deposited in the collision. Finally, specific cluster effect has been found namely a large population of excited states. This behaviour is completely different of the atomic carbon case for which the electron capture in the ground states predominates. (author)
High resolution data acquisition
Thornton, Glenn W.; Fuller, Kenneth R.
1993-01-01
A high resolution event interval timing system measures short time intervals such as occur in high energy physics or laser ranging. Timing is provided from a clock (38) pulse train (37) and analog circuitry (44) for generating a triangular wave (46) synchronously with the pulse train (37). The triangular wave (46) has an amplitude and slope functionally related to the time elapsed during each clock pulse in the train. A converter (18, 32) forms a first digital value of the amplitude and slope of the triangle wave at the start of the event interval and a second digital value of the amplitude and slope of the triangle wave at the end of the event interval. A counter (26) counts the clock pulse train (37) during the interval to form a gross event interval time. A computer (52) then combines the gross event interval time and the first and second digital values to output a high resolution value for the event interval.
High resolution time integration for Sn radiation transport
International Nuclear Information System (INIS)
Thoreson, Greg; McClarren, Ryan G.; Chang, Jae H.
2008-01-01
First order, second order and high resolution time discretization schemes are implemented and studied for the S n equations. The high resolution method employs a rate of convergence better than first order, but also suppresses artificial oscillations introduced by second order schemes in hyperbolic differential equations. All three methods were compared for accuracy and convergence rates. For non-absorbing problems, both second order and high resolution converged to the same solution as the first order with better convergence rates. High resolution is more accurate than first order and matches or exceeds the second order method. (authors)
Structure of high-resolution NMR spectra
Corio, PL
2012-01-01
Structure of High-Resolution NMR Spectra provides the principles, theories, and mathematical and physical concepts of high-resolution nuclear magnetic resonance spectra.The book presents the elementary theory of magnetic resonance; the quantum mechanical theory of angular momentum; the general theory of steady state spectra; and multiple quantum transitions, double resonance and spin echo experiments.Physicists, chemists, and researchers will find the book a valuable reference text.
International Nuclear Information System (INIS)
Mohania, Praveen; Shrivastava, Purushottam; Hannurkar, P.R.
2005-01-01
S-Band Microwave electron accelerators like microtrons and linear accelerators need pulsed microwaves from few megawatts to tens of megawatts to accelerator the electrons to desired energy and intensity. Klystron tube based driver amplifiers were used to drive the high power klystrons, which need microwave power from few tens of watts to 1 kW depending on tube output power and gain. A endeavour was initiated at Centre for Advanced Technology to develop state of art solid state S-band microwave amplifiers indigenously to drive the klystron tubes. A modular design approach was used and individual modules up to 160 W power levels were developed and tested. Finally combining 160 W modules will give up to 300 W output power. Several more modules can be combined to achieve even high power levels. Present paper describes the developmental efforts of 300 W S-band solid-state amplifiers and related microwave technologies. (author)
Energy Technology Data Exchange (ETDEWEB)
Tarisien, M
2003-10-01
The aim of this work is to study the dynamics of swift multicharged ion-induced fragmentation of diatomic (CO) and triatomic (CO{sub 2}) molecules. Performed at the GANIL facility, this study used the Recoil Ion Momentum Spectroscopy technique (RIMS), which consists of a time-of-flight mass spectrometer, coupled with a multi-hit capability position sensitive detector (delay line anode). The high-resolution measurement of the kinetic energy distribution released (KER) during the CO fragmentation points out the limitation of the Coulomb Explosion Model, revealing, for example, the di-cation CO{sub 2}{sup +} electronic state contribution in the case of C{sup +}/O{sup +} fragmentation pathway. Furthermore, the multi-ionization cross section dependence with the orientation of the internuclear axis of CO is compared with a geometrical model calculation. Finally, different behaviours are observed for the dissociation dynamics of a triatomic molecule (CO{sub 2}). While triple ionization leads mainly to a synchronous concerted fragmentation dynamics, a weak fraction of dissociating molecule follows a sequential dynamics involving CO{sub 2}{sup +} metastable states. In the case of double ionization, (CO{sub 2}){sup 2+} di-cation dissociation dynamics is asynchronously concerted and has been interpreted using a simple model involving an asymmetrical vibration of the molecule. (author)
High efficiency fourth-harmonic generation from nanosecond fiber master oscillator power amplifier
Mu, Xiaodong; Steinvurzel, Paul; Rose, Todd S.; Lotshaw, William T.; Beck, Steven M.; Clemmons, James H.
2016-03-01
We demonstrate high power, deep ultraviolet (DUV) conversion to 266 nm through frequency quadrupling of a nanosecond pulse width 1064 nm fiber master oscillator power amplifier (MOPA). The MOPA system uses an Yb-doped double-clad polarization-maintaining large mode area tapered fiber as the final gain stage to generate 0.5-mJ, 10 W, 1.7- ns single mode pulses at a repetition rate of 20 kHz with measured spectral bandwidth of 10.6 GHz (40 pm), and beam qualities of Mx 2=1.07 and My 2=1.03, respectively. Using LBO and BBO crystals for the second-harmonic generation (SHG) and fourth-harmonic generation (FHG), we have achieved 375 μJ (7.5 W) and 92.5 μJ (1.85 W) at wavelengths of 532 nm and 266 nm, respectively. To the best of our knowledge these are the highest narrowband infrared, green and UV pulse energies obtained to date from a fully spliced fiber amplifier. We also demonstrate high efficiency SHG and FHG with walk-off compensated (WOC) crystal pairs and tightly focused pump beam. An SHG efficiency of 75%, FHG efficiency of 47%, and an overall efficiency of 35% from 1064 nm to 266 nm are obtained.
Sekar, Sandhya; Karanth, Praveen
2013-01-01
High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.
Houin, G.J.R.; Duez, F.; Garcia, L.; Cantatore, E.; Torricelli, F.; Hirsch, L.; Belot, D.; Pellet, C.; Abbas, M.
2016-01-01
The high performance air stable organic semiconductor small molecule dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT) was chosen as active layer for field effect transistors built to realize flexible amplifier circuits. Initial device on rigid Si/SiO2 substrate showed appreciable performance
Influence of core NA on thermal-induced mode instabilities in high power fiber amplifiers
International Nuclear Information System (INIS)
Tao, Rumao; Ma, Pengfei; Wang, Xiaolin; Zhou, Pu; Liu, Zejin
2015-01-01
We report on the influence of core NA on thermal-induced mode instabilities (MI) in high power fiber amplifiers. The influence of core NA and the V-parameter on MI has been investigated numerically. It shows that core NA has a larger influence on MI for fibers with a smaller core-cladding-ratio, and the influence of core NA on the threshold is more obvious when the amplifiers are pumped at 915 nm. The dependence of the threshold on the V-parameter revealed that the threshold increases linearly as the V-parameter decreases when the V-parameter is larger than 3.5, and the threshold shows an exponential increase as the V-parameter decreases when the V-parameter is less than 3.5. We also discussed the effect of linewidth on MI, which indicates that the influence of linewidth can be neglected for a linewidth smaller than 1 nm when the fiber core NA is smaller than 0.07 and the fiber length is shorter than 20 m. Fiber amplifiers with different core NA were experimentally analyzed, which agreed with the theoretical predictions. (letter)
High-resolution multi-slice PET
International Nuclear Information System (INIS)
Yasillo, N.J.; Chintu Chen; Ordonez, C.E.; Kapp, O.H.; Sosnowski, J.; Beck, R.N.
1992-01-01
This report evaluates the progress to test the feasibility and to initiate the design of a high resolution multi-slice PET system. The following specific areas were evaluated: detector development and testing; electronics configuration and design; mechanical design; and system simulation. The design and construction of a multiple-slice, high-resolution positron tomograph will provide substantial improvements in the accuracy and reproducibility of measurements of the distribution of activity concentrations in the brain. The range of functional brain research and our understanding of local brain function will be greatly extended when the development of this instrumentation is completed
High resolution NMR spectroscopy of synthetic polymers in bulk
International Nuclear Information System (INIS)
Komorski, R.A.
1986-01-01
The contents of this book are: Overview of high-resolution NMR of solid polymers; High-resolution NMR of glassy amorphous polymers; Carbon-13 solid-state NMR of semicrystalline polymers; Conformational analysis of polymers of solid-state NMR; High-resolution NMR studies of oriented polymers; High-resolution solid-state NMR of protons in polymers; and Deuterium NMR of solid polymers. This work brings together the various approaches for high-resolution NMR studies of bulk polymers into one volume. Heavy emphasis is, of course, given to 13C NMR studies both above and below Tg. Standard high-power pulse and wide-line techniques are not covered
High-voltage pulsed generator for dynamic fragmentation of rocks.
Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
High-voltage pulsed generator for dynamic fragmentation of rocks
Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
High resolution integral holography using Fourier ptychographic approach.
Li, Zhaohui; Zhang, Jianqi; Wang, Xiaorui; Liu, Delian
2014-12-29
An innovative approach is proposed for calculating high resolution computer generated integral holograms by using the Fourier Ptychographic (FP) algorithm. The approach initializes a high resolution complex hologram with a random guess, and then stitches together low resolution multi-view images, synthesized from the elemental images captured by integral imaging (II), to recover the high resolution hologram through an iterative retrieval with FP constrains. This paper begins with an analysis of the principle of hologram synthesis from multi-projections, followed by an accurate determination of the constrains required in the Fourier ptychographic integral-holography (FPIH). Next, the procedure of the approach is described in detail. Finally, optical reconstructions are performed and the results are demonstrated. Theoretical analysis and experiments show that our proposed approach can reconstruct 3D scenes with high resolution.
International Nuclear Information System (INIS)
Desai, U.D.; Orwig, L.E.
1988-01-01
In the areas of high spatial resolution, the evaluation of a hard X-ray detector with 65 micron spatial resolution for operation in the energy range from 30 to 400 keV is proposed. The basic detector is a thick large-area scintillator faceplate, composed of a matrix of high-density scintillating glass fibers, attached to a proximity type image intensifier tube with a resistive-anode digital readout system. Such a detector, combined with a coded-aperture mask, would be ideal for use as a modest-sized hard X-ray imaging instrument up to X-ray energies as high as several hundred keV. As an integral part of this study it was also proposed that several techniques be critically evaluated for X-ray image coding which could be used with this detector. In the area of high spectral resolution, it is proposed to evaluate two different types of detectors for use as X-ray spectrometers for solar flares: planar silicon detectors and high-purity germanium detectors (HPGe). Instruments utilizing these high-spatial-resolution detectors for hard X-ray imaging measurements from 30 to 400 keV and high-spectral-resolution detectors for measurements over a similar energy range would be ideally suited for making crucial solar flare observations during the upcoming maximum in the solar cycle
Auto-Zero Differential Amplifier
Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)
2017-01-01
An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.
An investigation of tropical Atlantic bias in a high-resolution coupled regional climate model
Energy Technology Data Exchange (ETDEWEB)
Patricola, Christina M.; Saravanan, R.; Hsieh, Jen-Shan [Texas A and M University, Department of Atmospheric Sciences, College Station, TX (United States); Li, Mingkui; Xu, Zhao [Texas A and M University, Department of Oceanography, College Station, TX (United States); Ocean University of China, Key Laboratory of Physical Oceanography of Ministry of Education, Qingdao (China); Chang, Ping [Texas A and M University, Department of Oceanography, College Station, TX (United States); Ocean University of China, Key Laboratory of Physical Oceanography of Ministry of Education, Qingdao (China); Second Institute of Oceanography, State Key Laboratory of Satellite Ocean Environment Dynamics, Hangzhou, Zhejiang (China)
2012-11-15
Coupled atmosphere-ocean general circulation models (AOGCMs) commonly fail to simulate the eastern equatorial Atlantic boreal summer cold tongue and produce a westerly equatorial trade wind bias. This tropical Atlantic bias problem is investigated with a high-resolution (27-km atmosphere represented by the Weather Research and Forecasting Model, 9-km ocean represented by the Regional Ocean Modeling System) coupled regional climate model. Uncoupled atmospheric simulations test climate sensitivity to cumulus, land-surface, planetary boundary layer, microphysics, and radiation parameterizations and reveal that the radiation scheme has a pronounced impact in the tropical Atlantic. The CAM radiation simulates a dry precipitation (up to -90%) and cold land-surface temperature (up to -8 K) bias over the Amazon related to an over-representation of low-level clouds and almost basin-wide westerly trade wind bias. The Rapid Radiative Transfer Model and Goddard radiation simulates doubled Amazon and Congo Basin precipitation rates and a weak eastern Atlantic trade wind bias. Season-long high-resolution coupled regional model experiments indicate that the initiation of the warm eastern equatorial Atlantic sea surface temperature (SST) bias is more sensitive to the local rather than basin-wide trade wind bias and to a wet Congo Basin instead of dry Amazon - which differs from AOGCM simulations. Comparisons between coupled and uncoupled simulations suggest a regional Bjerknes feedback confined to the eastern equatorial Atlantic amplifies the initial SST, wind, and deepened thermocline bias, while barrier layer feedbacks are relatively unimportant. The SST bias in some CRCM simulations resembles the typical AOGCM bias indicating that increasing resolution is unlikely a simple solution to this problem. (orig.)
A study on the high-order mode oscillation in a four-cavity intense relativistic klystron amplifier
Energy Technology Data Exchange (ETDEWEB)
Liu, Ying-Hui; Niu, Xin-Jian; Wang, Hui [School of Physical Electronics, University of Electronic Science and Technology of China, Chengdu (China); Jia, Nan; Duan, Yaoyong [The Chinese People' s Armed Police Force Academy, Hebei (China); Li, Zheng-Hong [Science and Technology on High Power Microwave Laboratory, Institute of Applied Electronics, CAEP, Mianyang (China); Cheng, Hui [Microwave Department, Sichuan Jiuzhou Electric Appliance Group Co., Ltd., Mianyang (China); Yang, Xiao-Chuan [Computational Aerodynamics Institute, China Aerodynamics Research and Development Center, Mianyang (China)
2016-07-15
The high-order mode oscillation is studied in designing a four-cavity intense relativistic klystron amplifier. The reason for the oscillation caused by high-order modes and a method to suppress these kinds of spurious modes are found through theoretical analyses and the study on the influence of major parameters of a high frequency structure (such as the oscillation frequency of cavities, the cavity Q value, the length of drift tube section, and the characteristic impedance). Based on much simulation, a four-cavity intense relativistic klystron amplifier with a superior performance has been designed, built, and tested. An output power of 2.22 GW corresponding to 27.4% efficiency and 61 dB gain has been obtained. Moreover, the high-order mode oscillation is suppressed effectively, and an output power of 1.95 GW corresponding to 26% efficiency and 62 dB gain has been obtained in our laboratory.
An audio FIR-DAC in a BCD process for high power Class-D amplifiers
Doorn, T.S.; van Tuijl, Adrianus Johannes Maria; Schinkel, Daniel; Annema, Anne J.; Berkhout, M.; Berkhout, M.; Nauta, Bram
A 322 coefficient semi-digital FIR-DAC using a 1-bit PWM input signal was designed and implemented in a high voltage, audio power bipolar CMOS DMOS (BCD) process. This facilitates digital input signals for an analog class-D amplifier in BCD. The FIR-DAC performance depends on the ISI-resistant
High resolution photoelectron spectroscopy
International Nuclear Information System (INIS)
Arko, A.J.
1988-01-01
Photoelectron Spectroscopy (PES) covers a very broad range of measurements, disciplines, and interests. As the next generation light source, the FEL will result in improvements over the undulator that are larger than the undulater improvements over bending magnets. The combination of high flux and high inherent resolution will result in several orders of magnitude gain in signal to noise over measurements using synchrotron-based undulators. The latter still require monochromators. Their resolution is invariably strongly energy-dependent so that in the regions of interest for many experiments (h upsilon > 100 eV) they will not have a resolving power much over 1000. In order to study some of the interesting phenomena in actinides (heavy fermions e.g.) one would need resolving powers of 10 4 to 10 5 . These values are only reachable with the FEL
Integrated circuit amplifiers for multi-electrode intracortical recording.
Jochum, Thomas; Denison, Timothy; Wolf, Patrick
2009-02-01
Significant progress has been made in systems that interpret the electrical signals of the brain in order to control an actuator. One version of these systems senses neuronal extracellular action potentials with an array of up to 100 miniature probes inserted into the cortex. The impedance of each probe is high, so environmental electrical noise is readily coupled to the neuronal signal. To minimize this noise, an amplifier is placed close to each probe. Thus, the need has arisen for many amplifiers to be placed near the cortex. Commercially available integrated circuits do not satisfy the area, power and noise requirements of this application, so researchers have designed custom integrated-circuit amplifiers. This paper presents a comprehensive survey of the neural amplifiers described in publications prior to 2008. Methods to achieve high input impedance, low noise and a large time-constant high-pass filter are reviewed. A tutorial on the biological, electrochemical, mechanical and electromagnetic phenomena that influence amplifier design is provided. Areas for additional research, including sub-nanoampere electrolysis and chronic cortical heating, are discussed. Unresolved design concerns, including teraohm circuitry, electrical overstress and component failure, are identified.
Real-time Tracking of DNA Fragment Separation by Smartphone.
Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori
2017-06-01
Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.
Reliable discrimination of 10 ungulate species using high resolution melting analysis of faecal DNA.
Directory of Open Access Journals (Sweden)
Ana Ramón-Laca
Full Text Available Identifying species occupying an area is essential for many ecological and conservation studies. Faecal DNA is a potentially powerful method for identifying cryptic mammalian species. In New Zealand, 10 species of ungulate (Order: Artiodactyla have established wild populations and are managed as pests because of their impacts on native ecosystems. However, identifying the ungulate species present within a management area based on pellet morphology is unreliable. We present a method that enables reliable identification of 10 ungulate species (red deer, sika deer, rusa deer, fallow deer, sambar deer, white-tailed deer, Himalayan tahr, Alpine chamois, feral sheep, and feral goat from swabs of faecal pellets. A high resolution melting (HRM assay, targeting a fragment of the 12S rRNA gene, was developed. Species-specific primers were designed and combined in a multiplex PCR resulting in fragments of different length and therefore different melting behaviour for each species. The method was developed using tissue from each of the 10 species, and was validated in blind trials. Our protocol enabled species to be determined for 94% of faecal pellet swabs collected during routine monitoring by the New Zealand Department of Conservation. Our HRM method enables high-throughput and cost-effective species identification from low DNA template samples, and could readily be adapted to discriminate other mammalian species from faecal DNA.
Class-D audio amplifiers with negative feedback
Cox, Stephen M.; Candy, B. H.
2006-01-01
There are many different designs for audio amplifiers. Class-D, or switching, amplifiers generate their output signal in the form of a high-frequency square wave of variable duty cycle (ratio of on time to off time). The square-wave nature of the output allows a particularly efficient output stage, with minimal losses. The output is ultimately filtered to remove components of the spectrum above the audio range. Mathematical models are derived here for a variety of related class-D amplifier de...
A Kinetics Model for KrF Laser Amplifiers
Giuliani, J. L.; Kepple, P.; Lehmberg, R.; Obenschain, S. P.; Petrov, G.
1999-11-01
A computer kinetics code has been developed to model the temporal and spatial behavior of an e-beam pumped KrF laser amplifier. The deposition of the primary beam electrons is assumed to be spatially uniform and the energy distribution function of the nascent electron population is calculated to be near Maxwellian below 10 eV. For an initial Kr/Ar/F2 composition, the code calculates the densities of 24 species subject to over 100 reactions with 1-D spatial resolution (typically 16 zones) along the longitudinal lasing axis. Enthalpy accounting for each process is performed to partition the energy into internal, thermal, and radiative components. The electron as well as the heavy particle temperatures are followed for energy conservation and excitation rates. Transport of the lasing photons is performed along the axis on a dense subgrid using the method of characteristics. Amplified spontaneous emission is calculated using a discrete ordinates approach and includes contributions to the local intensity from the whole amplifier volume. Specular reflection off side walls and the rear mirror are included. Results of the model will be compared with data from the NRL NIKE laser and other published results.
International Nuclear Information System (INIS)
Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.
2017-01-01
The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)
Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen
2000-01-01
An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214
High-resolution regional climate model evaluation using variable-resolution CESM over California
Huang, X.; Rhoades, A.; Ullrich, P. A.; Zarzycki, C. M.
2015-12-01
Understanding the effect of climate change at regional scales remains a topic of intensive research. Though computational constraints remain a problem, high horizontal resolution is needed to represent topographic forcing, which is a significant driver of local climate variability. Although regional climate models (RCMs) have traditionally been used at these scales, variable-resolution global climate models (VRGCMs) have recently arisen as an alternative for studying regional weather and climate allowing two-way interaction between these domains without the need for nudging. In this study, the recently developed variable-resolution option within the Community Earth System Model (CESM) is assessed for long-term regional climate modeling over California. Our variable-resolution simulations will focus on relatively high resolutions for climate assessment, namely 28km and 14km regional resolution, which are much more typical for dynamically downscaled studies. For comparison with the more widely used RCM method, the Weather Research and Forecasting (WRF) model will be used for simulations at 27km and 9km. All simulations use the AMIP (Atmospheric Model Intercomparison Project) protocols. The time period is from 1979-01-01 to 2005-12-31 (UTC), and year 1979 was discarded as spin up time. The mean climatology across California's diverse climate zones, including temperature and precipitation, is analyzed and contrasted with the Weather Research and Forcasting (WRF) model (as a traditional RCM), regional reanalysis, gridded observational datasets and uniform high-resolution CESM at 0.25 degree with the finite volume (FV) dynamical core. The results show that variable-resolution CESM is competitive in representing regional climatology on both annual and seasonal time scales. This assessment adds value to the use of VRGCMs for projecting climate change over the coming century and improve our understanding of both past and future regional climate related to fine
Section on High Resolution Optical Imaging (HROI)
Federal Laboratory Consortium — The Section on High Resolution Optical Imaging (HROI) develops novel technologies for studying biological processes at unprecedented speed and resolution. Research...
Automatic error compensation in dc amplifiers
International Nuclear Information System (INIS)
Longden, L.L.
1976-01-01
When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks
Cichalewski, w
2010-01-01
The high power amplifiers transfer characteristics nonlinearities can have a negative influence on the overall system performance. This is also true for the TESLA superconducting cavities accelerating field parameters control systems. This Low Level Radio Frequency control systems uses microwave high power amplifiers (like 10 MW klystrons) as actuators in the mentioned feedback loops. The amplitude compression and phase deviations phenomena introduced to the control signals can reduce the feedback performance and cause electron beam energy instabilities. The transfer characteristics deviations in the Free Electron Laser in Hamburg experiment have been investigated. The outcome of this study together with the description of the developed linearization method based on the digital predistortion approach have been described in this paper. Additionally, the results from the linearization tool performance tests in the FLASH's RF systems have been placed.
HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS
International Nuclear Information System (INIS)
Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.
2013-01-01
We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.
Ultrafast gain dynamics in InAs/InGaAs quantum dot amplifiers
DEFF Research Database (Denmark)
Borri, Paola; Langbein, Wolfgang; Hvam, Jørn Märcher
2000-01-01
The ultrafast dynamics of gain and refractive index in an electrically pumped InAs-InGaAs quantum-dot (QD) optical amplifier are measured at room temperature using differential transmission with femtosecond time resolution. Both absorption and gain regions are investigated. While the absorption...
High angular resolution at LBT
Conrad, A.; Arcidiacono, C.; Bertero, M.; Boccacci, P.; Davies, A. G.; Defrere, D.; de Kleer, K.; De Pater, I.; Hinz, P.; Hofmann, K. H.; La Camera, A.; Leisenring, J.; Kürster, M.; Rathbun, J. A.; Schertl, D.; Skemer, A.; Skrutskie, M.; Spencer, J. R.; Veillet, C.; Weigelt, G.; Woodward, C. E.
2015-12-01
High angular resolution from ground-based observatories stands as a key technology for advancing planetary science. In the window between the angular resolution achievable with 8-10 meter class telescopes, and the 23-to-40 meter giants of the future, LBT provides a glimpse of what the next generation of instruments providing higher angular resolution will provide. We present first ever resolved images of an Io eruption site taken from the ground, images of Io's Loki Patera taken with Fizeau imaging at the 22.8 meter LBT [Conrad, et al., AJ, 2015]. We will also present preliminary analysis of two data sets acquired during the 2015 opposition: L-band fringes at Kurdalagon and an occultation of Loki and Pele by Europa (see figure). The light curves from this occultation will yield an order of magnitude improvement in spatial resolution along the path of ingress and egress. We will conclude by providing an overview of the overall benefit of recent and future advances in angular resolution for planetary science.
A method for generating high resolution satellite image time series
Guo, Tao
2014-10-01
There is an increasing demand for satellite remote sensing data with both high spatial and temporal resolution in many applications. But it still is a challenge to simultaneously improve spatial resolution and temporal frequency due to the technical limits of current satellite observation systems. To this end, much R&D efforts have been ongoing for years and lead to some successes roughly in two aspects, one includes super resolution, pan-sharpen etc. methods which can effectively enhance the spatial resolution and generate good visual effects, but hardly preserve spectral signatures and result in inadequate analytical value, on the other hand, time interpolation is a straight forward method to increase temporal frequency, however it increase little informative contents in fact. In this paper we presented a novel method to simulate high resolution time series data by combing low resolution time series data and a very small number of high resolution data only. Our method starts with a pair of high and low resolution data set, and then a spatial registration is done by introducing LDA model to map high and low resolution pixels correspondingly. Afterwards, temporal change information is captured through a comparison of low resolution time series data, and then projected onto the high resolution data plane and assigned to each high resolution pixel according to the predefined temporal change patterns of each type of ground objects. Finally the simulated high resolution data is generated. A preliminary experiment shows that our method can simulate a high resolution data with a reasonable accuracy. The contribution of our method is to enable timely monitoring of temporal changes through analysis of time sequence of low resolution images only, and usage of costly high resolution data can be reduces as much as possible, and it presents a highly effective way to build up an economically operational monitoring solution for agriculture, forest, land use investigation
Portable musical instrument amplifier
Christian, David E.
1990-07-24
The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.
Laser amplification of optical images using a CW Nd:YAG amplifier
International Nuclear Information System (INIS)
Aman, H
2013-01-01
In this paper a scheme for the amplification of optical images is described, using a continuous wave (CW) diode-pumped Nd:YAG (yttrium aluminum garnet) laser module. A passively q-switched end-pumped Nd:YAG laser is used as a pump source, which carries the optical image distribution as an input which is transmitted towards the amplifier at a distance of about ten feet. For amplification, a three-side-pumped CW Nd:YAG laser module is utilized without the cavity mirrors. In this way, optical images are amplified by a factor of 3.2 and imaged at a distance of ten feet with a spatial resolution of 500 μm. (paper)
A reconsideration of fission fragment angular distributions from nuclei of high spin
International Nuclear Information System (INIS)
Vaz, L.C.; Alexander, J.M.
1983-01-01
It has often been stated that fission fragment angular anisotropy, as predicted by equilibrium statistical theory, should disappear with increasing spin of the composite nucleus. However, several recent experimental studies reveal strong anisotropies for fission fragments from high-spin nuclear systems. We discuss this apparent discrepancy and its relationship to the rigid-rotor approximation used in the standard theory. A systematic comparison is given for fission fragment anisotropies from many experiments via the empirical parameters K 0 2 and Ssub(eff). These systematics indicate a strong regularity, provided one allows for the perturbing effects of fission after transfer reactions. Many of the observed anisotropies exceed the predictions of the standard theory, but, as these predictions are based on a rigid rotor model, this does not seem particularly noteworthy. (orig.)
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
Progress on the gyrocon deflection-modulated amplifier
International Nuclear Information System (INIS)
Tallerico, P.J.
1982-01-01
The gyrocon is a high-power deflection-modulated amplifier that can have excellent spatial bunching and, hence, high dc-to-rf conversion efficiency. A program to design and build a prototype amplifier at 450 MHz is discussed. Peak powers of 150 kW and conversion efficiencies of 23% have been measured; the testing program is being pursued to improve this performance. Some possible mechanisms for the difference between the experimental and calculated performance are discussed
DEFF Research Database (Denmark)
Høyerby, Mikkel Christian Wendelboe; Andersen, Michael Andreas E.
2005-01-01
This paper presents a high-performance power conversion scheme for power supply applications that require very high output voltage slew rates (dV/dt). The concept is to parallel 2 switching bandpass current sources, each optimized for its passband frequency space and the expected load current....... The principle is demonstrated with a power supply, designed for supplying a 40 W linear RF power amplifier for efficient amplification of a 16-QAM modulated data stream...
Gao, Yang; Fang, Xiaoliang; Tan, Jianping; Lu, Ting; Pan, Likun; Xuan, Fuzhen
2018-06-01
Wearable strain sensors based on nanomaterial/elastomer composites have potential applications in flexible electronic skin, human motion detection, human–machine interfaces, etc. In this research, a type of high performance strain sensors has been developed using fragmentized carbon nanotube/polydimethylsiloxane (CNT/PDMS) composites. The CNT/PDMS composites were ground into fragments, and a liquid-induced densification method was used to fabricate the strain sensors. The strain sensors showed high sensitivity with gauge factors (GFs) larger than 200 and a broad strain detection range up to 80%, much higher than those strain sensors based on unfragmentized CNT/PDMS composites (GF composite particles during mechanical deformation, which causes significant resistance change in the strain sensors. The strain sensors can differentiate mechanical stimuli and monitor various human body motions, such as bending of the fingers, human breathing, and blood pulsing.
Compact Aberration-Free Relay-Imaging Multi-Pass Layouts for High-Energy Laser Amplifiers
Directory of Open Access Journals (Sweden)
Jörg Körner
2016-11-01
Full Text Available We present the results from a theoretical investigation of laser beam propagation in relay imaging multi-pass layouts, which recently found application in high-energy laser amplifiers. Using a method based on the well-known ABCD-matrix formalism and proven by ray tracing, it was possible to derive a categorization of such systems. Furthermore, basic rules for the setup of such systems and the compensation for low order aberrations are derived. Due to the introduced generalization and parametrization, the presented results can immediately be applied to any system of the investigated kinds for a wide range of parameters, such as number of round-trips, focal lengths and optics sizes. It is shown that appropriate setups allow a close-to-perfect compensation of defocus caused by a thermal lens and astigmatism caused by non-normal incidence on the imaging optics, as well. Both are important to avoid intensity spikes leading to damages of optics in multi-pass laser amplifiers.
Linear and nonlinear analysis of high-power rf amplifiers
International Nuclear Information System (INIS)
Puglisi, M.
1983-01-01
After a survey of the state variable analysis method the final amplifier for the CBA is analyzed taking into account the real beam waveshape. An empirical method for checking the stability of a non-linear system is also considered
Scale-Aware Pansharpening Algorithm for Agricultural Fragmented Landscapes
Directory of Open Access Journals (Sweden)
Mario Lillo-Saavedra
2016-10-01
Full Text Available Remote sensing (RS has played an important role in extensive agricultural monitoring and management for several decades. However, the current spatial resolution of satellite imagery does not have enough definition to generalize its use in highly-fragmented agricultural landscapes, which represents a significant percentage of the world’s total cultivated surface. To characterize and analyze this type of landscape, multispectral (MS images with high and very high spatial resolutions are required. Multi-source image fusion algorithms are normally used to improve the spatial resolution of images with a medium spatial resolution. In particular, pansharpening (PS methods allow one to produce high-resolution MS images through a coherent integration of spatial details from a panchromatic (PAN image with spectral information from an MS. The spectral and spatial quality of source images must be preserved to be useful in RS tasks. Different PS strategies provide different trade-offs between the spectral and the spatial quality of the fused images. Considering that agricultural landscape images contain many levels of significant structures and edges, the PS algorithms based on filtering processes must be scale-aware and able to remove different levels of detail in any input images. In this work, a new PS methodology based on a rolling guidance filter (RGF is proposed. The main contribution of this new methodology is to produce artifact-free pansharpened images, improving the MS edges with a scale-aware approach. Three images have been used, and more than 150 experiments were carried out. An objective comparison with widely-used methodologies shows the capability of the proposed method as a powerful tool to obtain pansharpened images preserving the spatial and spectral information.
Cusp Guns for Helical-Waveguide Gyro-TWTs of a High-Gain High-Power W-Band Amplifier Cascade
Manuilov, V. N.; Samsonov, S. V.; Mishakin, S. V.; Klimov, A. V.; Leshcheva, K. A.
2018-02-01
The evaluation, design, and simulations of two different electron guns generating the beams for W-band second cyclotron harmonic gyro-TWTs forming a high-gain powerful amplifier cascade are presented. The optimum configurations of the systems creating nearly axis-encircling electron beams having velocity pitch-factor up to 1.5, voltage/current of 40 kV/0.5 A, and 100 kV/13 A with acceptable velocity spreads have been found and are presented.
Resolution enhancement of low-quality videos using a high-resolution frame
Pham, Tuan Q.; van Vliet, Lucas J.; Schutte, Klamer
2006-01-01
This paper proposes an example-based Super-Resolution (SR) algorithm of compressed videos in the Discrete Cosine Transform (DCT) domain. Input to the system is a Low-Resolution (LR) compressed video together with a High-Resolution (HR) still image of similar content. Using a training set of corresponding LR-HR pairs of image patches from the HR still image, high-frequency details are transferred from the HR source to the LR video. The DCT-domain algorithm is much faster than example-based SR in spatial domain 6 because of a reduction in search dimensionality, which is a direct result of the compact and uncorrelated DCT representation. Fast searching techniques like tree-structure vector quantization 16 and coherence search1 are also key to the improved efficiency. Preliminary results on MJPEG sequence show promising result of the DCT-domain SR synthesis approach.
van Agthoven, Maria A; Barrow, Mark P; Chiron, Lionel; Coutouly, Marie-Aude; Kilgour, David; Wootton, Christopher A; Wei, Juan; Soulby, Andrew; Delsuc, Marc-André; Rolando, Christian; O'Connor, Peter B
2015-12-01
Two-dimensional Fourier transform ion cyclotron resonance mass spectrometry is a data-independent analytical method that records the fragmentation patterns of all the compounds in a sample. This study shows the implementation of atmospheric pressure photoionization with two-dimensional (2D) Fourier transform ion cyclotron resonance mass spectrometry. In the resulting 2D mass spectrum, the fragmentation patterns of the radical and protonated species from cholesterol are differentiated. This study shows the use of fragment ion lines, precursor ion lines, and neutral loss lines in the 2D mass spectrum to determine fragmentation mechanisms of known compounds and to gain information on unknown ion species in the spectrum. In concert with high resolution mass spectrometry, 2D Fourier transform ion cyclotron resonance mass spectrometry can be a useful tool for the structural analysis of small molecules. Graphical Abstract ᅟ.
An integral whole circuit of amplifying and discriminating suited to high counting rate
International Nuclear Information System (INIS)
Dong Chengfu; Su Hong; Wu Ming; Li Xiaogang; Peng Yu; Qian Yi; Liu Yicai; Xu Sijiu; Ma Xiaoli
2007-01-01
A hybrid circuit consists of charge sensitive preamplifier, main amplifier, discriminator and shaping circuit was described. This instrument has characteristics of low power consumption, small volume, high sensitivity, potable and so on, and is convenient for use in field. The output pulse of this instrument may directly consist with CMOS or TTL logic level. This instrument was mainly used for count measurement, for example, for high sensitive 3 He neutron detector, meanwhile also may used for other heavy ion detectors, the highest counting rate can reach 10 6 /s. (authors)
De novo analysis of electron impact mass spectra using fragmentation trees
International Nuclear Information System (INIS)
Hufsky, Franziska; Rempt, Martin; Rasche, Florian; Pohnert, Georg; Böcker, Sebastian
2012-01-01
Highlights: ► We present a method for de novo analysis of accurate mass EI mass spectra of small molecules. ► This method identifies the molecular ion and thus the molecular formula where the molecular ion is present in the spectrum. ► Fragmentation trees are constructed by automated signal extraction and evaluation. ► These trees explain relevant fragmentation reactions. ► This method will be very helpful in the automated analysis of unknown metabolites. - Abstract: The automated fragmentation analysis of high resolution EI mass spectra based on a fragmentation tree algorithm is introduced. Fragmentation trees are constructed from EI spectra by automated signal extraction and evaluation. These trees explain relevant fragmentation reactions and assign molecular formulas to fragments. The method enables the identification of the molecular ion and the molecular formula of a metabolite if the molecular ion is present in the spectrum. These identifications are independent of existing library knowledge and, thus, support assignment and structural elucidation of unknown compounds. The method works even if the molecular ion is of very low abundance or hidden under contaminants with higher masses. We apply the algorithm to a selection of 50 derivatized and underivatized metabolites and demonstrate that in 78% of cases the molecular ion can be correctly assigned. The automatically constructed fragmentation trees correspond very well to published mechanisms and allow the assignment of specific relevant fragments and fragmentation pathways even in the most complex EI-spectra in our dataset. This method will be very helpful in the automated analysis of metabolites that are not included in common libraries and it thus has the potential to support the explorative character of metabolomics studies.
Sedano, Fernando; Kempeneers, Pieter; Strobl, Peter; Kucera, Jan; Vogt, Peter; Seebach, Lucia; San-Miguel-Ayanz, Jesús
2011-09-01
This study presents a novel cloud masking approach for high resolution remote sensing images in the context of land cover mapping. As an advantage to traditional methods, the approach does not rely on thermal bands and it is applicable to images from most high resolution earth observation remote sensing sensors. The methodology couples pixel-based seed identification and object-based region growing. The seed identification stage relies on pixel value comparison between high resolution images and cloud free composites at lower spatial resolution from almost simultaneously acquired dates. The methodology was tested taking SPOT4-HRVIR, SPOT5-HRG and IRS-LISS III as high resolution images and cloud free MODIS composites as reference images. The selected scenes included a wide range of cloud types and surface features. The resulting cloud masks were evaluated through visual comparison. They were also compared with ad-hoc independently generated cloud masks and with the automatic cloud cover assessment algorithm (ACCA). In general the results showed an agreement in detected clouds higher than 95% for clouds larger than 50 ha. The approach produced consistent results identifying and mapping clouds of different type and size over various land surfaces including natural vegetation, agriculture land, built-up areas, water bodies and snow.
Tetsuya, Saito; Nauta, Bram
2011-01-01
PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a
Tetsuya, S.; Nauta, Bram
2007-01-01
PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a
AlphaSpace: Fragment-Centric Topographical Mapping To Target Protein–Protein Interaction Interfaces
2016-01-01
Inhibition of protein–protein interactions (PPIs) is emerging as a promising therapeutic strategy despite the difficulty in targeting such interfaces with drug-like small molecules. PPIs generally feature large and flat binding surfaces as compared to typical drug targets. These features pose a challenge for structural characterization of the surface using geometry-based pocket-detection methods. An attractive mapping strategy—that builds on the principles of fragment-based drug discovery (FBDD)—is to detect the fragment-centric modularity at the protein surface and then characterize the large PPI interface as a set of localized, fragment-targetable interaction regions. Here, we introduce AlphaSpace, a computational analysis tool designed for fragment-centric topographical mapping (FCTM) of PPI interfaces. Our approach uses the alpha sphere construct, a geometric feature of a protein’s Voronoi diagram, to map out concave interaction space at the protein surface. We introduce two new features—alpha-atom and alpha-space—and the concept of the alpha-atom/alpha-space pair to rank pockets for fragment-targetability and to facilitate the evaluation of pocket/fragment complementarity. The resulting high-resolution interfacial map of targetable pocket space can be used to guide the rational design and optimization of small molecule or biomimetic PPI inhibitors. PMID:26225450
High-Resolution Mass Spectrometers
Marshall, Alan G.; Hendrickson, Christopher L.
2008-07-01
Over the past decade, mass spectrometry has been revolutionized by access to instruments of increasingly high mass-resolving power. For small molecules up to ˜400 Da (e.g., drugs, metabolites, and various natural organic mixtures ranging from foods to petroleum), it is possible to determine elemental compositions (CcHhNnOoSsPp…) of thousands of chemical components simultaneously from accurate mass measurements (the same can be done up to 1000 Da if additional information is included). At higher mass, it becomes possible to identify proteins (including posttranslational modifications) from proteolytic peptides, as well as lipids, glycoconjugates, and other biological components. At even higher mass (˜100,000 Da or higher), it is possible to characterize posttranslational modifications of intact proteins and to map the binding surfaces of large biomolecule complexes. Here we review the principles and techniques of the highest-resolution analytical mass spectrometers (time-of-flight and Fourier transform ion cyclotron resonance and orbitrap mass analyzers) and describe some representative high-resolution applications.