Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population

Directory of Open Access Journals (Sweden)

Simonas Juzėnas

2016-01-01

Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

Science.gov (United States)

Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

2016-01-01

Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

Directory of Open Access Journals (Sweden)

Rupreht Ruth

2007-11-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for

HFE C282Y/H63D compound heterozygotes are at low risk of hemochromatosis-related morbidity.

Science.gov (United States)

Gurrin, Lyle C; Bertalli, Nadine A; Dalton, Gregory W; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Nicoll, Amanda J; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J

2009-07-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, completed questionnaires and gave blood. Clinical examinations were blinded to HFE genotype. A total of 180 (84 males) clinically examined C282Y/H63D participants were compared with 330 (149 males) controls with neither HFE mutation; 132 (65 males) and 270 (122 males), respectively, had serum iron measures at both timepoints. Mean serum ferritin (SF) and transferrin saturation (TS) were significantly greater for male and female compound heterozygotes than for wild-types at baseline and follow-up (all P females who were premenopausal at baseline, where SF was similar in both genotype groups. For subjects with serum measures from both baseline and follow-up, mean SF and TS levels did not change significantly for men or for postmenopausal women, but for premenopausal women SF levels increased from 43 to 109 microg/L for compound heterozygotes and from 35 to 64 microg/L for wild-types (both P female compound heterozygotes had a similar prevalence of hemochromatosis-related morbidity to wild-types. One of 82 males and zero of 95 females had documented iron overload-related disease. For male compound heterozygotes, mean iron indices do not change during middle age but for female compound heterozygotes menopause results in increased mean SF. Although compound heterozygotes might maintain elevated iron indices during middle age, documented iron overload-related disease is rare.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.

Science.gov (United States)

Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

2015-03-01

A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia

Directory of Open Access Journals (Sweden)

Libia M Rodriguez

2015-03-01

Full Text Available A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH” and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

Molecular epidemiology of HFE gene polymorphic variants (C282Y, H63D and S65C) in the population of Espírito Santo, Brazil.

Science.gov (United States)

Alves, L N R; Santos, E V W; Stur, E; Silva Conforti, A M A; Louro, I D

2016-04-27

Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to progressive iron accumulation and may cause cirrhosis, hepatocellular carcinoma, diabetes, and heart failure. Most cases of HH have been linked to mutations in genes associated with iron homeostasis. There have been three major variants in the high Fe (HFE) gene associated with the disease: C282Y, H63D and S65C. In this context, we aimed to evaluate the prevalence of the polymorphic variants (C282Y, H63D and S65C) of the HFE gene in the population of the Espírito Santo State (ES), Brazil by analyzing three different groups: general population (N = 120), Pomeranian descendants (N = 59), and patients with HH (N = 20). Using genomic DNA extracted from peripheral blood, polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism. Statistically significant differences were observed for genotype distribution of C282Y (P HFE gene allele frequencies for the general population, Pomeranian subpopulation, and patients with HH of ES, Brazil.

Decreased iron burden in overweight C282Y homozygous women: Putative role of increased hepcidin production.

Science.gov (United States)

Desgrippes, Romain; Lainé, Fabrice; Morcet, Jeff; Perrin, Michèle; Manet, Ghislain; Jezequel, Caroline; Bardou-Jacquet, Edouard; Ropert, Martine; Deugnier, Yves

2013-05-01

An excess of visceral adipose tissue could be involved as a modulator of the penetrance of HFE hemochromatosis since fat mass is associated with overexpression of hepcidin and low transferrin saturation was found to be associated with being overweight in women. This study was aimed at assessing the relationship between body mass index (BMI), a surrogate marker of insulin resistance, and iron burden in HFE hemochromatosis. In all, 877 patients from a cohort of C282Y homozygotes were included in the study when BMI at diagnosis and amount of iron removed (AIR) by phlebotomy were available. No relationship between AIR and BMI was found in men, whereas 15.1% (52/345) of women with AIR lean (7.9 mmoL/L ± 4.3) women (P = 0.0005). In C282Y homozygous women, BMI ≥28 kg/m(2) is independently associated with a lower amount of iron removed by phlebotomy. BMI is likely a modulator factor of the phenotypic expression of C282Y homozygosity, likely through an increase of circulating levels of hepcidin. Copyright © 2013 American Association for the Study of Liver Diseases.

HFE mutations and hemochromatosis in Danish patients admitted for HFE genotyping

DEFF Research Database (Denmark)

Koefoed, P; Dalhoff, K; Dissing, J

2002-01-01

Analysis of the common C282Y and H63D mutations in the HFE gene is widely used to diagnose hereditary hemochromatosis (HH). The aim of this study was to evaluate the efficiency with which different hospitals and general practitioners select patients for HH genotype and to determine the distribution...... of HFE mutations in such patients. Nine hundred unrelated patients from Danish hospitals and general practitioners (group A) and 69 consecutive patients from a specialized liver unit (group B) were examined for HFE substitutions using multiplex real-time polymerase chain reaction. In group A we found 13...... in the H63D homozygotes or S65C heterozygotes. Moreover, 7 wild-type patients, 2 C282Y heterozygote patients and one H63D heterozygote patient fulfilled the criteria for HH. The significant enrichment of HH among associated genotype samples submitted for HFE testing indicates that the clinical selection...

HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Golchin

2015-04-01

Full Text Available Background Type 2 diabetes (T2D is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy. Objectives Regarding the relationship between type 2 diabetes and hereditary chromatists, we conducted a genetic analysis on two previously reported mutations C282Y and H63D related to the HFE gene in our population. Patients and Methods Altogether, 145 patients with type 2 diabetes and 145 healthy controls were examined. A genotyping assay performed using electrophoresis of the DNA digestion products from MboI and RsaI for H63D and C282Y, respectively. Results Results showed a significant difference between case and controls regarding C282Y (P value < 0.001 and H63D genotypes (P value = 0.013. We also found a relationship between both mutations and nephropathy. Moreover, the difference between C282Y genotypes of patients with retinopathy and healthy controls were statistically significant (P value = 0.020 while there was no association between H63D and retinopathy. In addition, observed differences of both mutations were significant when nephropathic patients compared to the controls. Conclusions Our study showed a significant association between H63D and C282Y mutations and the risk of type 2 diabetes in Iranian population.

The association between the C282Y and H63D polymorphisms of HFE gene and the risk of Parkinson's disease: A meta-analysis.

Science.gov (United States)

Xia, Jianjian; Xu, Huamin; Jiang, Hong; Xie, Junxia

2015-05-19

Impaired brain iron homeostasis has been considered as an important mechanism in Parkinson's diseases (PD). There are indications that C282Y and H63D polymorphisms of HFE genes involved in iron metabolism might contribute to the pathogenesis of PD in some cases. However, the investigation of the relationship between PD and the two polymorphisms had produced contradictory results. We performed a meta-analysis to assess the C282Y and H63D polymorphisms of HFE in PD susceptibility. PubMed, EMBASE and Web of Science were systematically searched to identify relevant researches. The strict selection criteria and exclusion standard were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed-effect or random-effect model was selected, depending on the results of the heterogeneity test. Fifteen studies were included in the meta-analysis (eight studies with 1631 cases and 4548 controls for C282Y; seven studies with 1192 cases and 4065 controls for H63D). For the C282Y polymorphism, significant associations were observed in the Recessive model (YY vs CY+CC: OR=0.22, 95% CI=0.09-0.57, P=0.002). This indicated that the C282Y polymorphism in HFE might be a potential protective factor for PD. However, no significant associations were found for any genetic model for the H63D polymorphism, suggesting that the H63D polymorphism might not be associated with PD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

Directory of Open Access Journals (Sweden)

Selma Ünal

2014-09-01

Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

[ALLELES C282Y AND H63D HFE GENE, INSULIN RESISTANCE AND SUSCEPTIBILITY TO DISTURBANCE OF PORPHYRIN METABOLISM IN NON-ALCOHOLIC FATTY LIVER DISEASE].

Science.gov (United States)

Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V

2015-01-01

The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.

Predicting C282Y Homozygote Genotype for Hemochromatosis Using Serum Ferritin and Transferrin Saturation Values from 44,809 Participants of the HEIRS Study

Directory of Open Access Journals (Sweden)

Andrew Lim

2014-01-01

Full Text Available INTRODUCTION: The simultaneous interpretation of serum ferritin level and transferrin saturation has been used as a clinical guide to diagnose genetic hemochromatosis. The Hemochromatosis and Iron Overload Screening (HEIRS Study screened 101,168 North American participants for serum ferritin level and transferrin saturation, and C282Y genotyping for the HFE gene.

Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis Prevalência das mutações C282Y e H63D no gene HFE em indivíduos brasileiros com suspeita clínica de hemocromatose hereditária

Directory of Open Access Journals (Sweden)

Alessandro C. S. Ferreira

2008-10-01

Full Text Available Classical hereditary hemochromatosis is a recessive autosomal disease related to a systemic iron overload that is frequently related to C282Y and H63D mutations in the HFE gene. In Brazil, reports on HFE gene mutation frequencies are rare, mainly in regards to a representative sample population. This study intended to determine the prevalence of C282Y and H63D mutations among individuals with clinical suspicion of hereditary hemochromatosis. A total of 1955 patients were studied with C282Y and H63D mutations being detected by the polymerase chain reaction technique followed by enzymatic restriction. The sample consisted of 76.6% men and 23.4% women. The highest percentage of analyzed individuals (56.9% was concentrated in the 41 to 60-year-old age group. Although there were no genic or genotypic differences between genders, a higher number of over 60-year-old women was observed. The C282Y mutation was found as homozygous in 2.9% of the cases and as heterozygous in 10.1%, while the H63D was homozygous in 4.3% and heterozygous in 30.6%. The C282Y and H63D mutant allele frequencies were 0.079 and 0.196, respectively. The highest frequency was observed for H63D which was in genetic equilibrium. This work is important to determine the genetic profile of the population with hereditary hemochromatosis in Brazi.A hemocromatose hereditária clássica (HH é uma doença autossômica recessiva caracterizada por uma sobrecarga sistêmica de ferro, a qual está freqüentemente relacionada às mutações C282Y e H63D no gene HFE. No Brasil, registros das freqüências das mutações no gene HFE são raros, principalmente envolvendo uma amostra representativa da população. Este estudo teve como objetivo a determinação da prevalência das mutações C282Y e H63D em indivíduos com suspeita clínica de HH. Para isto, foram estudados 1955 pacientes para os quais as mutações C282Y e H63D foram pesquisadas pela técnica de Reação em Cadeia da Polimerase

Frequency of the HFE C282Y and H63D mutations in Danish patients with clinical haemochromatosis initially diagnosed by phenotypic methods

DEFF Research Database (Denmark)

Milman, Nils; Koefoed, Pernille; Pedersen, Palle

2003-01-01

AIM: To assess the frequency of the C282Y and H63D mutations on the HFE gene in Danish patients with clinical hereditary haemochromatosis initially diagnosed by phenotypic methods. METHODS: In the period 1950-1985, an epidemiological survey in Denmark identified 179 patients with clinical...... diagnosis of clinical idiopathic haemochromatosis was made before blood samples were taken for HFE genotyping. The total series consisted of 58 patients (40 men and 18 women) with a median age of 60 yrs (range 18-74). HFE genotyping was performed by the polymerase chain reaction (PCR) technique. RESULTS...

Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

Science.gov (United States)

Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

2009-10-01

Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age.

Science.gov (United States)

Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J

2009-07-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

Hemochromatosis (HFE) gene mutations and response to chloroquine in porphyria cutanea tarda.

Science.gov (United States)

Stölzel, Ulrich; Köstler, Erich; Schuppan, Detlef; Richter, Matthias; Wollina, Uwe; Doss, Manfred O; Wittekind, Christian; Tannapfel, Andrea

2003-03-01

To examine the role of hemochromatosis (HFE) gene mutations, which are associated with porphyria cutanea tarda (PCT), in the therapeutic response to chloroquine. We retrospectively analyzed a database (Excel version 2001 [Microsoft Excel, Redmond, Wash]; date range of search, 1985-1999) of chloroquine-treated patients with PCT on whether HFE mutations (C282Y and H63D) might have influenced the clinical response, urinary porphyrin excretion, liver enzyme activities, and serum iron markers. Serum samples and corresponding complete sets of data before and after therapy were available in 62 of 207 patients with PCT who were treated exclusively with chloroquine. Academic teaching hospital. For treatment, low-dose chloroquine diphosphate, 125 to 250 mg twice weekly, was used during a median time of 16 months (range, 12-26 months). Of the 62 German patients with PCT, 37 (60%) carries HFE mutations. Chloroquine therapy was accompanied by clinical remission and reduced urinary porphyrin excretion (P<.001) in the 24 patients (39%) with HFE wild type as well as in 35 HFE heterozygous patients with PCT (56%). Decreases of serum iron markers following chloroquine therapy were limited to patients with PCT and HFE wild type. All patients homozygous for the C282Y mutation (3 [5%] of 62) had high serum iron, ferritin, and transferrin saturation and failed to respond to chloroquine treatment. The therapeutic response to chloroquine was not compromised by C282Y heterozygosity and compound heterozygosity of HFE mutations. Because HFE C282Y homozygotes (+/+) did not respond to chloroquine and a decrease in serum iron concentration was limited to patients with PCT and HFE wild type, phlebotomy should be first-line therapy in patients with PCT and HFE mutations.

HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

Science.gov (United States)

Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

2017-07-01

Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls

Science.gov (United States)

Yin, Wei-Li; Wang, Feng-Mei; Han, Tao

2016-01-01

Background Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D) of human HFE (hereditary hemochromatosis) gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD), liver cirrhosis and hepatocellular carcinoma (HCC). Methods An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis. Results In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, PassociationHFE C282Y and H63D (all Passociation>0.05). In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, PassociationHFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion. PMID:27657935

Association Studies of HFE C282Y and H63D Variants with Oral Cancer Risk and Iron Homeostasis Among Whites and Blacks

Directory of Open Access Journals (Sweden)

Nathan R. Jones

2015-12-01

Full Text Available Background: Polymorphisms in the hemochromatosis (HFE gene are associated with excessive iron absorption from the diet, and pro-oxidant effects of iron accumulation are thought to be a risk factor for several types of cancer. Methods: The C282Y (rs1800562 and H63D (rs1799945 polymorphisms were genotyped in 301 oral cancer cases and 437 controls and analyzed in relation to oral cancer risk, and serum iron biomarker levels from a subset of 130 subjects. Results: Individuals with the C282Y allele had lower total iron binding capacity (TIBC (321.2 ± 37.2 µg/dL vs. 397.7 ± 89.0 µg/dL, p = 0.007 and higher percent transferrin saturation (22.0 ± 8.7 vs. 35.6 ± 22.9, p = 0.023 than wild type individuals. Iron and ferritin levels approached significantly higher levels for the C282Y allele (p = 0.0632 and p = 0.0588, respectively. Conclusions: Iron biomarker levels were elevated by the C282Y allele, but neither (rs1800562 nor (rs1799945 was associated with oral cancer risk in blacks and whites.

Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis

Directory of Open Access Journals (Sweden)

Shen Xi-Zhong

2010-03-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is an autosomal recessive disorder mainly associated with homozygosity for the C282Y and H63D mutations in the hemochromatosis (HFE gene. The reports about the C282Y and H63D mutations and hepatocellular carninoma (HCC were controversial. To clarify the relationship between C282Y and H63D mutations and HCC, a meta-analysis including nine studies (1102 HCC cases and 3766 controls, mainly came from European populations was performed. Methods The association was measured using random-effect (RE or fixed-effect (FE odds ratios (ORs combined with 95% confidence intervals (CIs according to the studies' heterogeneity. Results Meta-analysis of nine studies showed that Y allele of C282Y was associated with HCC risk: RE OR reached 1.50 (95%CI: 1.05-2.14, p for heterogeneity = 0.02, I2 = 0.57. Subgroup analysis of seven studies also showed Y allele was associated with HCC risk in healthy populations: RE OR reached 1.61 (95%CI: 1.08-2.39, p for heterogeneity = 0.04, I2 = 0.55. We further did subgroup analysis in alcoholic liver cirrhosis (LC patients of four studies (224 cases and 380 controls and found that both the dominant model and Y allele of C282Y were associated with HCC risk (FE OR reached 4.06, 95%CI: 2.08-7.92 and 3.41, 95%CI: 1.81-6.41, respectively. There was no distinct heterogeneity among the studies (I2 = 0. Sensitivity analyses showed the results were robust in the subgroup analysis of alcoholic LC patients. Conclusions C282Y mutation was associated with HCC in European alcoholic LC patients.

Sample-to-SNP kit: a reliable, easy and fast tool for the detection of HFE p.H63D and p.C282Y variations associated to hereditary hemochromatosis.

Science.gov (United States)

Nielsen, Peter B; Petersen, Maja S; Ystaas, Viviana; Andersen, Rolf V; Hansen, Karin M; Blaabjerg, Vibeke; Refstrup, Mette

2012-10-01

Classical hereditary hemochromatosis involves the HFE-gene and diagnostic analysis of the DNA variants HFE p.C282Y (c.845G>A; rs1800562) and HFE p.H63D (c.187C>G; rs1799945). The affected protein alters the iron homeostasis resulting in iron overload in various tissues. The aim of this study was to validate the TaqMan-based Sample-to-SNP protocol for the analysis of the HFE-p.C282Y and p.H63D variants with regard to accuracy, usefulness and reproducibility compared to an existing SNP protocol. The Sample-to-SNP protocol uses an approach where the DNA template is made accessible from a cell lysate followed by TaqMan analysis. Besides the HFE-SNPs other eight SNPs were used as well. These SNPs were: Coagulation factor II-gene F2 c.20210G>A, Coagulation factor V-gene F5 p.R506Q (c.1517G>A; rs121917732), Mitochondria SNP: mt7028 G>A, Mitochondria SNP: mt12308 A>G, Proprotein convertase subtilisin/kexin type 9-gene PCSK9 p.R46L (c.137G>T), Plutathione S-transferase pi 1-gene GSTP1 p.I105V (c313A>G; rs1695), LXR g.-171 A>G, ZNF202 g.-118 G>T. In conclusion the Sample-to-SNP kit proved to be an accurate, reliable, robust, easy to use and rapid TaqMan-based SNP detection protocol, which could be quickly implemented in a routine diagnostic or research facility. Copyright © 2012. Published by Elsevier B.V.

Genome-wide association study identifies TF as a significant modifier gene of iron metabolism in HFE hemochromatosis.

Science.gov (United States)

de Tayrac, Marie; Roth, Marie-Paule; Jouanolle, Anne-Marie; Coppin, Hélène; le Gac, Gérald; Piperno, Alberto; Férec, Claude; Pelucchi, Sara; Scotet, Virginie; Bardou-Jacquet, Edouard; Ropert, Martine; Bouvet, Régis; Génin, Emmanuelle; Mosser, Jean; Deugnier, Yves

2015-03-01

Hereditary hemochromatosis (HH) is the most common form of genetic iron loading disease. It is mainly related to the homozygous C282Y/C282Y mutation in the HFE gene that is, however, a necessary but not a sufficient condition to develop clinical and even biochemical HH. This suggests that modifier genes are likely involved in the expressivity of the disease. Our aim was to identify such modifier genes. We performed a genome-wide association study (GWAS) using DNA collected from 474 unrelated C282Y homozygotes. Associations were examined for both quantitative iron burden indices and clinical outcomes with 534,213 single nucleotide polymorphisms (SNP) genotypes, with replication analyses in an independent sample of 748 C282Y homozygotes from four different European centres. One SNP met genome-wide statistical significance for association with transferrin concentration (rs3811647, GWAS p value of 7×10(-9) and replication p value of 5×10(-13)). This SNP, located within intron 11 of the TF gene, had a pleiotropic effect on serum iron (GWAS p value of 4.9×10(-6) and replication p value of 3.2×10(-6)). Both serum transferrin and iron levels were associated with serum ferritin levels, amount of iron removed and global clinical stage (pHFE-associated HH (HFE-HH) patients, identified the rs3811647 polymorphism in the TF gene as the only SNP significantly associated with iron metabolism through serum transferrin and iron levels. Because these two outcomes were clearly associated with the biochemical and clinical expression of the disease, an indirect link between the rs3811647 polymorphism and the phenotypic presentation of HFE-HH is likely. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Association between the HFE C282Y, H63D Polymorphisms and the Risks of Non-Alcoholic Fatty Liver Disease, Liver Cirrhosis and Hepatocellular Carcinoma: An Updated Systematic Review and Meta-Analysis of 5,758 Cases and 14,741 Controls.

Directory of Open Access Journals (Sweden)

Qing Ye

Full Text Available Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D of human HFE (hereditary hemochromatosis gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD, liver cirrhosis and hepatocellular carcinoma (HCC.An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis.In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, Passociation0.05. In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, Passociation<0.05. Moreover, a positive association between compound heterozygosity for C282Y/H63D and the risk of NAFLD and HCC, but not liver cirrhosis, was observed.Our meta-analysis provides evidence that the HFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion.

Relationship of Baseline Hemoglobin Level with Serum Ferritin, Postphlebotomy Hemoglobin Changes, and Phlebotomy Requirements among HFE C282Y Homozygotes

Directory of Open Access Journals (Sweden)

Seyed Ali Mousavi

2015-01-01

Full Text Available Objectives. We aimed to examine whether baseline hemoglobin levels in C282Y-homozygous patients are related to the degree of serum ferritin (SF elevation and whether patients with different baseline hemoglobin have different phlebotomy requirements. Methods. A total of 196 patients (124 males and 72 females who had undergone therapeutic phlebotomy and had SF and both pre- and posttreatment hemoglobin values were included in the study. Results. Bivariate correlation analysis suggested that baseline SF explains approximately 6 to 7% of the variation in baseline hemoglobin. The results also showed that males who had higher (≥150 g/L baseline hemoglobin levels had a significantly greater reduction in their posttreatment hemoglobin despite requiring fewer phlebotomies to achieve iron depletion than those who had lower (<150 g/L baseline hemoglobin, regardless of whether baseline SF was below or above 1000 µg/L. There were no significant differences between hemoglobin subgroups regarding baseline and treatment characteristics, except for transferrin saturation between male subgroups with SF above 1000 µg/L. Similar differences were observed when females with higher (≥138 g/L baseline hemoglobin were compared with those with lower (<138 g/L baseline hemoglobin. Conclusion. Dividing C282Y-homozygous patients into just two subgroups according to the degree of baseline SF elevation may obscure important subgroup variations.

Relationship of Baseline Hemoglobin Level with Serum Ferritin, Postphlebotomy Hemoglobin Changes, and Phlebotomy Requirements among HFE C282Y Homozygotes

Science.gov (United States)

Mousavi, Seyed Ali; Mahmood, Faiza; Aandahl, Astrid; Knutsen, Teresa Risopatron; Llohn, Abid Hussain

2015-01-01

Objectives. We aimed to examine whether baseline hemoglobin levels in C282Y-homozygous patients are related to the degree of serum ferritin (SF) elevation and whether patients with different baseline hemoglobin have different phlebotomy requirements. Methods. A total of 196 patients (124 males and 72 females) who had undergone therapeutic phlebotomy and had SF and both pre- and posttreatment hemoglobin values were included in the study. Results. Bivariate correlation analysis suggested that baseline SF explains approximately 6 to 7% of the variation in baseline hemoglobin. The results also showed that males who had higher (≥150 g/L) baseline hemoglobin levels had a significantly greater reduction in their posttreatment hemoglobin despite requiring fewer phlebotomies to achieve iron depletion than those who had lower (baseline hemoglobin, regardless of whether baseline SF was below or above 1000 µg/L. There were no significant differences between hemoglobin subgroups regarding baseline and treatment characteristics, except for transferrin saturation between male subgroups with SF above 1000 µg/L. Similar differences were observed when females with higher (≥138 g/L) baseline hemoglobin were compared with those with lower (baseline hemoglobin. Conclusion. Dividing C282Y-homozygous patients into just two subgroups according to the degree of baseline SF elevation may obscure important subgroup variations. PMID:26380265

Using iron studies to predict HFE mutations in New Zealand: implications for laboratory testing.

Science.gov (United States)

O'Toole, Rebecca; Romeril, Kenneth; Bromhead, Collette

2017-04-01

The diagnosis of hereditary haemochromatosis (HH) is not straightforward because symptoms are often absent or non-specific. Biochemical markers of iron-overloading may be affected by other conditions. To measure the correlation between iron studies and HFE genotype to inform evidence-based recommendations for laboratory testing in New Zealand. Results from 2388 patients genotyped for C282Y, H63D and S65C in Wellington, New Zealand from 2007 to 2013 were compared with their biochemical phenotype as quantified by serum ferritin (SF), transferrin saturation (TS), serum iron (SI) and serum transferrin (ST). The predictive power of these markers was evaluated by receiver operator characteristic (ROC) curve analysis, and if a statistically significant association for a variable was seen, sensitivity, specificity and predictive values were calculated. Test ordering patterns showed that 62% of HFE genotyping tests were ordered because of an elevated SF alone and only 11% of these had a C-reactive protein test to rule out an acute phase reaction. The association between SF and significant HFE genotypes SF was low. However, TS values ≥45% predicted HH mutations with the highest sensitivity and specificity. A SF of >1000 µg/L was found in one at-risk patient (C282Y homozygote) who had a TS <45%. Our analysis highlights the need for clear guidelines for investigation of hyperferritinaemia and HH in New Zealand. Using our findings, we developed an evidence-based laboratory testing algorithm based on a TS ≥45%, a SF ≥1000 µg/L and/or a family history of HH which identified all C282Y homozygotes in this study. © 2016 Royal Australasian College of Physicians.

The Study of HFE Genotypes and Its Expression Effect on Iron Status of Iranian Haemochromatosis, Iron Deficiency Anemia Patients, Iron-Taker and Non Iron-Taker Controls.

Science.gov (United States)

Beiranvand, Elham; Abediankenari, Saeid; Rostamian, Mosayeb; Beiranvand, Behnoush; Naazeri, Saeed

2015-01-01

The role of HFE gene mutations or its expression in regulation of iron metabolism of hereditary haemochromatosis (HH) patients is remained controversial. Therefore here the correlation between two common HFE genotype (p.C282Y, p.H63D) and HFE gene expression with iron status in HH, iron deficiency anemia (IDA) and healthy Iranian participants was studied. For this purpose genotype determination was done by polymerase chain reaction--restriction fragment length polymorphism (PCR-RFLP). Real-Time PCR was applied for evaluation of HFE gene expression. Biochemical parameters and iron consumption were also assessed. Homozygote p.H63D mutation was seen in all HH patients and p.C282Y was not observed in any member of the population. A significant correlation was observed between serum ferritin (SF) level and gender or age of HH patients. p.H63D homozygote was seen to be able to significantly increase SF and transferrin saturation (TS) level without affecting on liver function. Our results also showed that iron consumption affects on TS level increasing. HFE gene expression level of IDA patients was significantly higher than other groups. Also the HFE gene expression was negatively correlated with TS. Finally, the main result of our study showed that loss of HFE function in HH is not derived from its gene expression inhibition and much higher HFE gene expression might lead to IDA. However we propose repeating of the study for more approval of our finding.

Lack of association of C282Y and H63D mutations in the hemochromatosis (HFE) gene with diabetes mellitus type 2 in a case-control study of women in Brazil.

Science.gov (United States)

Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P

2009-10-27

Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.

Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

Science.gov (United States)

Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

2015-05-01

Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

Science.gov (United States)

Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

2009-01-01

Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo Lisboa Bittencourt

2009-01-01

Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

C282Y and H63D Mutation Frequencies in a Population from Central Spain

Directory of Open Access Journals (Sweden)

S. Alvarez

2001-01-01

Full Text Available Objectives: To determine the frequency of hereditary hemochromatosis gene mutations, C282Y and H63D, from 125 autochthonous blood donors originating from a Central region of Spain, to provide epidemiological data about HFE gene in the Iberian Peninsula.

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

HFE gene mutations and iron status of Brazilian blood donors.

Science.gov (United States)

Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M

2010-01-01

Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

HFE gene mutations and iron status of Brazilian blood donors

Directory of Open Access Journals (Sweden)

P.C.J.L. Santos

2010-01-01

Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

HFE gene mutations in patients with primary iron overload: is there a significant improvement in molecular diagnosis yield with HFE sequencing?

Science.gov (United States)

Santos, Paulo C J L; Pereira, Alexandre C; Cançado, Rodolfo D; Schettert, Isolmar T; Sobreira, Tiago J P; Oliveira, Paulo S L; Hirata, Rosario D C; Hirata, Mario H; Figueiredo, Maria Stella; Chiattone, Carlos S; Krieger, Jose E; Guerra-Shinohara, Elvira M

2010-12-15

Rare HFE variants have been shown to be associated with hereditary hemochromatosis (HH), an iron overload disease. The low frequency of the HFE p.C282Y mutation in HH-affected Brazilian patients may suggest that other HFE-related mutations may also be implicated in the pathogenesis of HH in this population. The main aim was to screen for new HFE mutations in Brazilian individuals with primary iron overload and to investigate their relationship with HH. Fifty Brazilian patients with primary iron overload (transferrin saturation>50% in females and 60% in males) were selected. Subsequent bidirectional sequencing for each HFE exon was performed. The effect of HFE mutations on protein structure were analyzed by molecular dynamics simulation and free binding energy calculations. p.C282Y in homozygosis or in heterozygosis with p.H63D were the most frequent genotypic combinations associated with HH in our sample population (present in 17 individuals, 34%). Thirty-six (72.0%) out of the 50 individuals presented at least one HFE mutation. The most frequent genotype associated with HH was the homozygous p.C282Y mutation (n=11, 22.0%). One novel mutation (p.V256I) was indentified in heterozygosis with the p.H63D mutation. In silico modeling analysis of protein behavior indicated that the p.V256I mutation does not reduce the binding affinity between HFE and β2-microglobulin (β2M) in the same way the p.C282Y mutation does compared with the native HFE protein. In conclusion, screening of HFE through direct sequencing, as compared to p.C282Y/p.H63D genotyping, was not able to increase the molecular diagnosis yield of HH. The novel p.V256I mutation could not be implicated in the molecular basis of the HH phenotype, although its role cannot be completely excluded in HH-phenotype development. Our molecular modeling analysis can help in the analysis of novel, previously undescribed, HFE mutations. Copyright © 2010 Elsevier Inc. All rights reserved.

Hemochromatosis C282Y gene mutation as a potential susceptibility factor for iron-overload in Egyptian beta-thalassemia patients

Directory of Open Access Journals (Sweden)

G.M. Mokhtar

2018-04-01

Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian

HFE Genotyping in Patients with Elevated Serum Iron Indices and Liver Diseases

Directory of Open Access Journals (Sweden)

Andreia Silva Evangelista

2015-01-01

Full Text Available Iron abnormalities in chronic liver disease may be the result of genetic diseases or secondary factors. The present study aimed to identify subjects with HFE-HH in order to describe the frequency of clinical manifestations, identify risk factors for iron elevation, and compare the iron profile of HFE-HH to other genotypes in liver disease patients. A total of 108 individuals with hepatic disease, transferrin saturation (TS > 45%, and serum ferritin (SF > 350 ng/mL were tested for HFE mutations. Two groups were characterized: C282Y/C282Y or C282Y/H63D genotypes (n=16 were the HFE hereditary hemochromatosis (HFE-HH group; and C282Y and H63D single heterozygotes, the H63D/H63D genotype, and wild-type were considered group 2 (n=92. Nonalcoholic liver disease, alcoholism, and chronic hepatitis C were detected more frequently in group 2, whereas arthropathy, hepatocarcinoma, diabetes, and osteoporosis rates were significantly higher in the HFE-HH group. TS > 82%, SF > 2685 ng/mL, and serum iron > 178 μg/dL were the cutoffs for diagnosis of HFE-HH in patients with liver disease. Thus, in non-Caucasian populations with chronic liver disease, HFE-HH diagnosis is more predictable in those with iron levels higher than those proposed in current guidelines for the general population.

Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo Delfini Cançado

Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

HFE polymorphisms influence the response to chemotherapeutic agents via induction of p16INK4A.

Science.gov (United States)

Lee, Sang Y; Liu, Siying; Mitchell, Ryan M; Slagle-Webb, Becky; Hong, Young-Soo; Sheehan, Jonas M; Connor, James R

2011-11-01

HFE is a protein that impacts cellular iron uptake. HFE gene variants are identified as risk factors or modifiers for multiple diseases. Using HFE stably transfected human neuroblastoma cells, we found that cells carrying the C282Y HFE variant do not differentiate when exposed to retinoic acid. Therefore, we hypothesized HFE variants would impact response to therapeutic agents. Both the human neuroblastoma and glioma cells that express the C282Y HFE variant are resistant to Temodar, geldanamycin and γ-radiation. A gene array analysis revealed that p16INK4A (p16) expression was increased in association with C282Y expression. Decreasing p16 protein by siRNA resulted in increased vulnerability to all of the therapeutic agents suggesting that p16 is responsible for the resistance. Decreasing HFE expression by siRNA resulted in a 85% decrease in p16 expression in the neuroblastoma cells but not the astrocytoma cells. These data suggest a potential direct relationship between HFE and p16 that may be cell specific or mediated by different pathways in the different cell types. In conclusion, the C282Y HFE variant impacts the vulnerability of cancer cells to current treatment strategies apparently by increasing expression of p16. Although best known as a tumor suppressor, there are multiple reports that p16 is elevated in some forms of cancer. Given the frequency of the HFE gene variants, as high as 10% of the Caucasian population, these data provide compelling evidence that the C282Y HFE variant should be part of a pharmacogenetic strategy for evaluating treatment efficacy in cancer cells. Copyright © 2011 UICC.

Variation in the HFE gene is associated with the development of bleomycin-induced pulmonary toxicity in testicular cancer patients.

Science.gov (United States)

van der Schoot, Gabriela G F; Westerink, Nico-Derk L; Lubberts, Sjoukje; Nuver, Janine; Zwart, Nynke; Walenkamp, Annemiek M E; Wempe, Johan B; Meijer, Coby; Gietema, Jourik A

2016-05-01

Bleomycin and cisplatin are of key importance in testicular cancer treatment. Known potential serious adverse effects are bleomycin-induced pulmonary toxicity (BIP) and cisplatin-induced renal toxicity. Iron handling may play a role in development of this toxicity. Carriage of allelic variants of the HFE gene induces altered iron metabolism and may contribute to toxicity. We investigated the association between two common allelic variants of the HFE gene, H63D and C282Y, with development of pulmonary and renal toxicity during and after treatment with bleomycin- and cisplatin-containing chemotherapy. In 369 testicular cancer patients treated with bleomycin and cisplatin at the University Medical Center Groningen between 1978 and 2006, H63D and/or C282Y genotypes were determined with an allelic discrimination assay. Data were collected on development of BIP, pulmonary function parameters, renal function, and survival. BIP developed more frequently in patients who were heterozygote (16 in 75, 21%) and homozygote (2 in 4, 50%) for the H63D variant, compared with those who had the HFE wild-type gene (31 in 278, 11%) (p = 0.012). Overall survival, testicular cancer-related survival, and change in renal function were not associated with the H63D variant. We observed an association between presence of one or both H63D alleles and development of BIP in testicular cancer patients treated with bleomycin combination chemotherapy. In patients heterozygote and homozygote for the H63D variant, BIP occurred more frequently compared with wild-type patients. When validated and confirmed, HFE H63D genotyping may be used to identify patients with increased risk for pulmonary bleomycin toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

Effect of C282Y genotype on self-reported musculoskeletal complications in hereditary hemochromatosis.

Science.gov (United States)

Camacho, António; Funck-Brentano, Thomas; Simão, Márcio; Cancela, Leonor; Ottaviani, Sébastien; Cohen-Solal, Martine; Richette, Pascal

2015-01-01

Arthropathy that mimics osteoarthritis (OA) and osteoporosis (OP) is considered a complication of hereditary hemochromatosis (HH). We have limited data comparing OA and OP prevalence among HH patients with different hemochromatosis type 1 (HFE) genotypes. We investigated the prevalence of OA and OP in patients with HH by C282Y homozygosity and compound heterozygosity (C282Y/H63D) genotype. A total of 306 patients with HH completed a questionnaire. Clinical and demographic characteristics and presence of OA, OP and related complications were compared by genotype, adjusting for age, sex, body mass index (BMI), current smoking and menopausal status. In total, 266 of the 306 patients (87%) were homozygous for C282Y, and 40 (13%) were compound heterozygous. The 2 groups did not differ by median age [60 (interquartile range [IQR] 53 to 68) vs. 61 (55 to 67) years, P=0.8], sex (female: 48.8% vs. 37.5%, P=0.18) or current smoking habits (12.4% vs. 10%, P=0.3). As compared with compound heterozygous patients, C282Y homozygous patients had higher median serum ferritin concentration at diagnosis [1090 (IQR 610 to 2210) vs. 603 (362 to 950) µg/L, P<0.001], higher median transferrin saturation [80% (IQR 66 to 91%) vs. 63% (55 to 72%), P<0.001]) and lower median BMI [24.8 (22.1 to 26.9) vs. 26.2 (23.5 to 30.3) kg/m2, P<0.003]. The overall prevalence of self-reported OA was significantly higher with C282Y homozygosity than compound heterozygosity (53.4% vs. 32.5%; adjusted odds ratio [aOR] 2.4 [95% confidence interval 1.2-5.0]), as was self-reported OP (25.6% vs. 7.5%; aOR 3.5 [1.1-12.1]). Patients with C282Y homozygosity may be at increased risk of musculoskeletal complications of HH.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Science.gov (United States)

Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

2017-01-01

Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

Directory of Open Access Journals (Sweden)

Sang Y Lee

Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

HFE gene mutation and iron overload in Egyptian pediatric acute lymphoblastic leukemia survivors: a single-center study.

Science.gov (United States)

El-Rashedi, Farida H; El-Hawy, Mahmoud A; El-Hefnawy, Sally M; Mohammed, Mona M

2017-08-01

Hereditary hemochromatosis gene (HFE) mutations have a role in iron overload in pediatric acute lymphoblastic leukemia (ALL) survivors. We aimed to evaluate the genotype frequency and allelic distribution of the two HFE gene mutations (C282Y and H63D) in a sample of Egyptian pediatric ALL survivors and to detect the impact of these two mutations on their iron profile. This study was performed on 35 ALL survivors during their follow-up visits to the Hematology and Oncology Unit, Pediatric Department, Menoufia University Hospitals. Thirty-five healthy children of matched age and sex were chosen as controls. After completing treatment course, ALL survivors were screened for the prevalence of these two mutations by polymerase chain reaction-restriction fragment length polymorphism. Serum ferritin levels were measured by an enzyme-linked immunosorbent assay technique (ELISA). C282Y mutation cannot be detected in any of the 35 survivors or the 35 controls. The H63D heterozygous state (CG) was detected in 28.6% of the survivors group and in 20% of controls, while the H63D homozygous (GG) state was detected in 17.1% of survivors. No compound heterozygosity (C282Y/H63D) was detected at both groups with high G allele frequency (31.4%) in survivors more than controls (10%). There were significant higher levels of iron parameters in homozygote survivors than heterozygotes and the controls. H63D mutation aggravates the iron overload status in pediatric ALL survivors.

Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin.

Science.gov (United States)

Coelho-Borges, Silvia; Cheinquer, Hugo; Wolff, Fernando Herz; Cheinquer, Nelson; Krug, Luciano; Ashton-Prolla, Patricia

2012-01-01

Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2) and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week) and ribavirin (1.000 mg, daily) for 24 weeks. Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis) and BclI (H63D mutation analysis) in 16 (37%) patients, all heterozygous (11 H63D, 2 C282Y and 3 both). Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41%) of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test). Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin

Directory of Open Access Journals (Sweden)

Silvia Coelho-Borges

2012-03-01

Full Text Available CONTEXT: Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. OBJECTIVE: To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. METHODS: A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2 and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week and ribavirin (1.000 mg, daily for 24 weeks. RESULTS: Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis and BclI (H63D mutation analysis in 16 (37% patients, all heterozygous (11 H63D, 2 C282Y and 3 both. Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41% of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test. CONCLUSION: Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.

Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

Directory of Open Access Journals (Sweden)

F.V. Perícole

2005-09-01

Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

Serum ferritin concentrations and body iron stores in a multicenter, multiethnic primary-care population.

Science.gov (United States)

Gordeuk, Victor R; Reboussin, David M; McLaren, Christine E; Barton, James C; Acton, Ronald T; McLaren, Gordon D; Harris, Emily L; Reiss, Jacob A; Adams, Paul C; Speechley, Mark; Phatak, Pradyumna D; Sholinsky, Phyliss; Eckfeldt, John H; Chen, Wen-Pin; Passmore, Leah; Dawkins, Fitzroy W

2008-08-01

How often elevated serum ferritin in primary-care patients reflects increased iron stores (normally 0.8 g in men, 0.4 g in women) is not known. The Hereditary Hemochromatosis and Iron Overload Screening (HEIRS) study screened 101,168 primary-care participants (44% Caucasians, 27% African-Americans, 14% Asians/Pacific Islanders, 13% Hispanics, 2% others). Follow-up clinical evaluation was performed in 302 of 333 HFE C282Y homozygotes regardless of iron measures and 1,375 of 1,920 nonhomozygotes with serum ferritin >300 microg/L (men), >200 microg/L (women) and transferrin saturation >50% (men), >45% (women). Quantitative phlebotomy was conducted in 122 of 175 C282Y homozygotes and 122 of 1,102 nonhomozygotes with non-transfusional serum ferritin elevation at evaluation. The estimated prevalence in the Caucasian population of C282Y homozygotes with serum ferritin >900 microg/L at evaluation was 20 per 10,000 men and 4 per 10,000 women; this constellation was predictive of iron stores >4 g in men and >2 g in women. The estimated prevalence per 10,000 of non-C282Y homozygotes with serum ferritin >900 microg/L at evaluation was 7 among Caucasians, 13 among Hispanics, 20 among African Americans, and 38 among Asians and Pacific Islanders, and this constellation was predictive of iron stores >2 g but 900 microg/L after initial elevations of both serum ferritin and transferrin saturation is predictive of mildly increased iron stores in multiple ethnic populations regardless of HFE genotype. Serum ferritin >900 microg/L in male C282Y homozygotes is predictive of moderately increased iron stores. Copyright 2008 Wiley-Liss, Inc.

Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

Science.gov (United States)

Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

2016-10-31

To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

HFE gene variants affect iron in the brain.

Science.gov (United States)

Nandar, Wint; Connor, James R

2011-04-01

Iron accumulation in the brain and increased oxidative stress are consistent observations in many neurodegenerative diseases. Thus, we have begun examination into gene mutations or allelic variants that could be associated with loss of iron homeostasis. One of the mechanisms leading to iron overload is a mutation in the HFE gene, which is involved in iron metabolism. The 2 most common HFE gene variants are C282Y (1.9%) and H63D (8.9%). The C282Y HFE variant is more commonly associated with hereditary hemochromatosis, which is an autosomal recessive disorder, characterized by iron overload in a number of systemic organs. The H63D HFE variant appears less frequently associated with hemochromatosis, but its role in the neurodegenerative diseases has received more attention. At the cellular level, the HFE mutant protein resulting from the H63D HFE gene variant is associated with iron dyshomeostasis, increased oxidative stress, glutamate release, tau phosphorylation, and alteration in inflammatory response, each of which is under investigation as a contributing factor to neurodegenerative diseases. Therefore, the HFE gene variants are proposed to be genetic modifiers or a risk factor for neurodegenerative diseases by establishing an enabling milieu for pathogenic agents. This review will discuss the current knowledge of the association of the HFE gene variants with neurodegenerative diseases: amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and ischemic stroke. Importantly, the data herein also begin to dispel the long-held view that the brain is protected from iron accumulation associated with the HFE mutations.

An extensive analysis of the hereditary hemochromatosis gene HFE and neighboring histone genes: associations with childhood leukemia.

Science.gov (United States)

Davis, Charronne F; Dorak, M Tevfik

2010-04-01

The most common mutation of the HFE gene C282Y has shown a risk association with childhood acute lymphoblastic leukemia (ALL) in Welsh and Scottish case-control studies. This finding has not been replicated outside Britain. Here, we present a thorough analysis of the HFE gene in a panel of HLA homozygous reference cell lines and in the original population sample from South Wales (117 childhood ALL cases and 414 newborn controls). The 21 of 24 variants analyzed were from the HFE gene region extending 52 kb from the histone gene HIST1H1C to HIST1H1T. We identified the single-nucleotide polymorphism (SNP) rs807212 as a tagging SNP for the most common HFE region haplotype, which contains wild-type alleles of all HFE variants examined. This intergenic SNP rs807212 yielded a strong male-specific protective association (per allele OR = 0.38, 95% CI = 0.22-0.64, P (trend) = 0.0002; P = 0.48 in females), which accounted for the original C282Y risk association. In the HapMap project data, rs807212 was in strong linkage disequilibrium with 25 other SNPs spanning 151 kb around HFE. Minor alleles of these 26 SNPs characterized the most common haplotype for the HFE region, which lacked all disease-associated HFE variants. The HapMap data suggested positive selection in this region even in populations where the HFE C282Y mutation is absent. These results have implications for the sex-specific associations observed in this region and suggest the inclusion of rs807212 in future studies of the HFE gene and the extended HLA class I region.

[Molecular genetic diagnostics and screening of hereditary hemochromatosis].

Science.gov (United States)

Zlocha, J; Kovács, L; Pozgayová, S; Kupcová, V; Durínová, S

2006-06-01

Hereditary hemochromatosis is considered one of the most common hereditary diseases in population of Caucasian origin. In recent years, a candidate gene for HLA-linked hemochromatosis, HFE, has been cloned, and a single G-to-A mutation resulting in a cysteine-to-tyrosine substitution (C282Y) has been identified in up to 80% of study patients with type 1 hereditary hemochromatosis. The purpose of the paper was to confirm the importance of genetic testing for HFE mutations in making the diagnosis of hemochromatosis and find out a suitable diagnostic algorithm for the indication of this form of diagnostics in patients suspected of hereditary hemochromatosis. The examination of C282Y mutation was conducted in 500 subjects. The most frequent indications for DNA analysis were hepatopathy of unknown ethiology, liver cirrhosis, diabetes mellitus, bronze skin pigmentation in connection with high serum iron concentration, elevated transferrin saturation and elevated serum ferritin levels. In our group of patients, 29 homozygotes and 75 heterozygotes for C282Y mutation were identified, 10 patients carried both C282Y and H63D mutations of HFE gene (compound heterozygotes), whereas in 386 subjects the mutation was not found. The genotype-phenotype correlation showed that 22 homozygotes had liver affection proved by imaging and/or histologic methods. Except the liver disorders, the most common symptoms of these patients were type 2 diabetes mellitus or glucose tolerance disorder (10 patients), arthritis or joint pain (9 patients) and cardiovascular disorders, such as cardiomyopathy (2 patients). Bronze skin pigmentation was present in 9 homozygotes. Transferin saturation values were significantly higher in homozygotes for C282Y mutation as compared to C282Y heterozygotes (p diagnostics of this severe, but in early recognition curable disease. Early detection and phlebotomy treatment prior to the onset of cirrhosis can reduce morbidity and normalize life expectancy. It is readily

Study of the effect of HFE gene mutations on iron overload in ...

African Journals Online (AJOL)

Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

Study of the HFE gene common polymorphisms in French patients with sporadic amyotrophic lateral sclerosis.

Science.gov (United States)

Praline, Julien; Blasco, Hélène; Vourc'h, Patrick; Rat, Valérian; Gendrot, Chantal; Camu, William; Andres, Christian R

2012-06-15

Our objective was to investigate whether the C282Y (p.Cys 282 Tyr) and H63D (p. His 63 Asp) HFE polymorphisms were associated with sporadic amyotrophic lateral sclerosis (SALS) in the French population. We searched for a relation of HFE polymorphisms with the clinical characteristics of the disease. The HFE polymorphisms were studied in 824 patients with SALS and 583 controls. We compared the frequency of the polymorphisms between SALS and controls groups by univariate and multivariate statistics, taking into account gender, site, age-at-onset and survival. We did not observe significant difference in the frequency of H63D polymorphism between SALS and control group. We observed a significant difference for C282Y between patients and controls with a low frequency of the Y allele in patients (3.2%) compared to our control group (5.9%). Disease duration, distribution of gender, site-of-onset, age-at-onset did not differ between groups taking into account genotypes of each polymorphism. Our results in this large cohort of ALS patients indicate that H63D polymorphism is not associated with SALS in the French population. This conclusion does not exclude a weak effect of the HFE gene polymorphisms in certain ALS populations, or an effect of other rare HFE gene variants. Copyright © 2012 Elsevier B.V. All rights reserved.

Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies

Directory of Open Access Journals (Sweden)

M. Li

2014-03-01

Full Text Available Iron homeostasis dysregulation has been regarded as an important mechanism in neurodegenerative diseases. The H63D and C282Y polymorphisms in the HFE gene may be involved in the development of sporadic amyotrophic lateral sclerosis (ALS through the disruption of iron homeostasis. However, studies investigating the relationship between ALS and these two polymorphisms have yielded contradictory outcomes. We performed a meta-analysis to assess the roles of the H63D and C282Y polymorphisms of HFE in ALS susceptibility. PubMed, MEDLINE, EMBASE, and Cochrane Library databases were systematically searched to identify relevant studies. Strict selection criteria and exclusion criteria were applied. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of associations. A fixed- or random-effect model was selected, depending on the results of the heterogeneity test. Fourteen studies were included in the meta-analysis (six studies with 1692 cases and 8359 controls for C282Y; 14 studies with 5849 cases and 13,710 controls for H63D. For the C282Y polymorphism, significant associations were observed in the allele model (Y vs C: OR=0.76, 95%CI=0.62-0.92, P=0.005 and the dominant model (YY+CY vs CC: OR=0.75, 95%CI=0.61-0.92, P=0.006. No associations were found for any genetic model for the H63D polymorphism. The C282Y polymorphism in HFE could be a potential protective factor for ALS in Caucasians. However, the H63D polymorphism does not appear to be associated with ALS.

Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

Science.gov (United States)

Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

2012-01-01

The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

Influence of HFE variants and cellular iron on monocyte chemoattractant protein-1

Directory of Open Access Journals (Sweden)

Simmons Zachary

2009-02-01

Full Text Available Abstract Background Polymorphisms in the MHC class 1-like gene known as HFE have been proposed as genetic modifiers of neurodegenerative diseases that include neuroinflammation as part of the disease process. Variants of HFE are relatively common in the general population and are most commonly associated with iron overload, but can promote subclinical cellular iron loading even in the absence of clinically identified disease. The effects of the variants as well as the resulting cellular iron dyshomeostasis potentially impact a number of disease-associated pathways. We tested the hypothesis that the two most common HFE variants, H63D and C282Y, would affect cellular secretion of cytokines and trophic factors. Methods We screened a panel of cytokines and trophic factors using a multiplexed immunoassay in human neuroblastoma SH-SY5Y cells expressing different variants of HFE. The influence of cellular iron secretion on the potent chemokine monocyte chemoattractant protein-1 (MCP-1 was assessed using ferric ammonium citrate and the iron chelator, desferroxamine. Additionally, an antioxidant, Trolox, and an anti-inflammatory, minocycline, were tested for their effects on MCP-1 secretion in the presence of HFE variants. Results Expression of the HFE variants altered the labile iron pool in SH-SY5Y cells. Of the panel of cytokines and trophic factors analyzed, only the release of MCP-1 was affected by the HFE variants. We further examined the relationship between iron and MCP-1 and found MCP-1 secretion tightly associated with intracellular iron status. A potential direct effect of HFE is considered because, despite having similar levels of intracellular iron, the association between HFE genotype and MCP-1 expression was different for the H63D and C282Y HFE variants. Moreover, HFE genotype was a factor in the effect of minocycline, a multifaceted antibiotic used in treating a number of neurologic conditions associated with inflammation, on MCP-1

HFE H63D mutation frequency shows an increase in Turkish women with breast cancer

Directory of Open Access Journals (Sweden)

Guler Emine

2006-02-01

Full Text Available Abstract Background The hereditary hemochromatosis gene HFE plays a pivotal role in iron homeostasis. The association between cancer and HFE hetero- or homozygosity has previously been shown including hepatocellular and nonhepatocellular malignancies. This study was performed to compare frequencies of HFE C282Y and H63D variants in Turkish women with breast cancer and healthy controls. Methods Archived DNA samples of Hacettepe University Oncology Institute were used in this study. The HFE gene was investigated by PCR-RFLP. Results All subjects studied were free from C282Y mutation. Thirty-nine patients had H63D mutation and were all heterozygous. H63D allele frequency was 22.2% (39/176 in the breast cancer patients, and 14% (28/200 in the healthy volunteers. Statistical analysis of cases with HFE H63D phenotype showed significant difference between breast cancer and healthy volunteers (P = 0.02. Conclusion Our results suggest that HFE H63D mutation frequencies were increased in the breast cancer patients in comparison to those in the general population. Also, odds ratios (odds ratio = 2.05 computed in this study suggest that H63D has a positive association with breast cancer.

Effects of highly conserved major histocompatibility complex (MHC extended haplotypes on iron and low CD8+ T lymphocyte phenotypes in HFE C282Y homozygous hemochromatosis patients from three geographically distant areas.

Directory of Open Access Journals (Sweden)

Mónica Costa

Full Text Available Hereditary Hemochromatosis (HH is a recessively inherited disorder of iron overload occurring commonly in subjects homozygous for the C282Y mutation in HFE gene localized on chromosome 6p21.3 in linkage disequilibrium with the human leukocyte antigen (HLA-A locus. Although its genetic homogeneity, the phenotypic expression is variable suggesting the presence of modifying factors. One such genetic factor, a SNP microhaplotype named A-A-T, was recently found to be associated with a more severe phenotype and also with low CD8(+T-lymphocyte numbers. The present study aimed to test whether the predictive value of the A-A-T microhaplotype remained in other population settings. In this study of 304 HH patients from 3 geographically distant populations (Porto, Portugal 65; Alabama, USA 57; Nord-Trøndelag, Norway 182, the extended haplotypes involving A-A-T were studied in 608 chromosomes and the CD8(+ T-lymphocyte numbers were determined in all subjects. Patients from Porto had a more severe phenotype than those from other settings. Patients with A-A-T seemed on average to have greater iron stores (p = 0.021, but significant differences were not confirmed in the 3 separate populations. Low CD8(+ T-lymphocytes were associated with HLA-A*03-A-A-T in Porto and Alabama patients but not in the greater series from Nord-Trøndelag. Although A-A-T may signal a more severe iron phenotype, this study was unable to prove such an association in all population settings, precluding its use as a universal predictive marker of iron overload in HH. Interestingly, the association between A-A-T and CD8(+ T-lymphocytes, which was confirmed in Porto and Alabama patients, was not observed in Nord-Trøndelag patients, showing that common HLA haplotypes like A*01-B*08 or A*03-B*07 segregating with HFE/C282Y in the three populations may carry different messages. These findings further strengthen the relevance of HH as a good disease model to search for novel candidate loci

The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead

International Nuclear Information System (INIS)

Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

2015-01-01

The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25–63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead–exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. Conclusion. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers

Hereditary Hemochromatosis (HFE genotypes in heart failure: Relation to etiology and prognosis

Directory of Open Access Journals (Sweden)

Torp-Pedersen Christian

2010-07-01

Full Text Available Abstract Background It is believed that hereditary hemochromatosis (HH might play a role in cardiac disease (heart failure (HF and ischemia. Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role and the prognostic significance of HFE genotypes. Methods We studied 667 HF patients (72.7% men with depressed systolic function, enrolled in a multicentre trial with a follow-up period of up to 5 years. All were genotyped for the known HFE variants C282Y, H63D and S65C. Results The genotype and allele frequencies in the HF group were similar to the frequencies determined in the general Danish population. In multivariable analysis mortality was not predicted by C282Y-carrier status (HR 1.2, 95% CI: 0.8-1.7; H63D-carrier status (HR 1.0, 95% CI: 0.7-1.3; nor S65C-carrier status (HR 1.2, 95% CI: 0.7-2.0. We identified 27 (4.1% homozygous or compound heterozygous carriers of HFE variants. None of these carriers had a clinical presentation suggesting hemochromatosis, but hemoglobin and ferritin levels were higher than in the rest of the cohort. Furthermore, a trend towards reduced mortality was seen in this group in univariate analyses (HR 0.4, 95% CI: 0.2-0.9, p = 0.03, but not in multivariate (HR 0.5, 95% CI: 0.2-1.2. Conclusion HFE genotypes do not seem to be a significant contributor to the etiology of heart failure in Denmark. HFE variants do not affect mortality in HF.

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

OpenAIRE

Selma Ünal; Günay Balta; Fatma Gümrük

2014-01-01

Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

Precipitating factors of porphyria cutanea tarda in Brazil with emphasis on hemochromatosis gene (HFE) mutations. Study of 60 patients.

Science.gov (United States)

Vieira, Fatima Mendonça Jorge; Nakhle, Maria Cristina; Abrantes-Lemos, Clarice Pires; Cançado, Eduardo Luiz Rachid; Reis, Vitor Manoel Silva dos

2013-01-01

Porphyria cutanea tarda is the most common form of porphyria, characterized by the decreased activity of the uroporphyrinogen decarboxylase enzyme. Several reports associated HFE gene mutations of hereditary hemochromatosis with porphyria cutanea tarda worldwide, although up to date only one study has been conducted in Brazil. Investigation of porphyria cutanea tarda association with C282Y and H63D mutations in the HFE gene. Identification of precipitating factors (hepatitis C, HIV, alcoholism and estrogen) and their link with HFE mutations. An ambispective study of 60 patients with PCT was conducted during the period from 2003 to 2012. Serological tests for hepatitis C and HIV were performed and histories of alcohol abuse and estrogen intake were investigated. HFE mutations were identified with real-time PCR. Porphyria cutanea tarda predominated in males and alcohol abuse was the main precipitating factor. Estrogen intake was the sole precipitating factor present in 25% of female patients. Hepatitis C was present in 41.7%. All HIV-positive patients (15.3%) had a history of alcohol abuse. Allele frequency for HFE mutations, i.e., C282Y (p = 0.0001) and H63D (p = 0.0004), were significantly higher in porphyria cutanea tarda patients, compared to control group. HFE mutations had no association with the other precipitating factors. Alcohol abuse, hepatitis C and estrogen intake are prevalent precipitating factors in our porphyria cutanea tarda population; however, hemochromatosis in itself can also contribute to the outbreak of porphyria cutanea tarda, which makes the research for HFE mutations necessary in these patients.

HFE gene polymorphism defined by sequence-based typing of the Brazilian population and a standardized nomenclature for HFE allele sequences.

Science.gov (United States)

Campos, W N; Massaro, J D; Martinelli, A L C; Halliwell, J A; Marsh, S G E; Mendes-Junior, C T; Donadi, E A

2017-10-01

The HFE molecule controls iron uptake from gut, and defects in the molecule have been associated with iron overload, particularly in hereditary hemochromatosis. The HFE gene including both coding and boundary intronic regions were sequenced in 304 Brazilian individuals, encompassing healthy individuals and patients exhibiting hereditary or acquired iron overload. Six sites of variation were detected: (1) H63D C>G in exon 2, (2) IVS2 (+4) T>C in intron 2, (3) a C>G transversion in intron 3, (4) C282Y G>A in exon 4, (5) IVS4 (-44) T>C in intron 4, and (6) a new guanine deletion (G>del) in intron 5, which were used for haplotype inference. Nine HFE alleles were detected and six of these were officially named on the basis of the HLA Nomenclature, defined by the World Health Organization (WHO) Nomenclature Committee for Factors of the HLA System, and published via the IPD-IMGT/HLA website. Four alleles, HFE*001, *002, *003, and *004 exhibited variation within their exon sequences. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The relationship between selected VDR, HFE and ALAD gene polymorphisms and several basic toxicological parameters among persons occupationally exposed to lead.

Science.gov (United States)

Szymańska-Chabowska, Anna; Łaczmański, Łukasz; Jędrychowska, Iwona; Chabowski, Mariusz; Gać, Paweł; Janus, Agnieszka; Gosławska, Katarzyna; Smyk, Beata; Solska, Urszula; Mazur, Grzegorz; Poręba, Rafał

2015-08-06

The aim of this study was to find a relationship between polymorphisms of ALAD rs1805313, rs222808, rs1139488, VDR FokI and HFE C282Y and H63D and basic toxicological parameters (lead and ZnPP blood concentration) in people occupationally exposed to lead. We collected data of 101 workers (age 25-63 years) directly exposed to lead. The toxicological lab tests included blood lead, cadmium and ZnPP concentration measurement and arsenic urine concentration measurement. Workers were genotyped for ALAD (rs1805313, rs222808, rs1139488), HFE (C282Y, H63D) and VDR (FokI). Individuals with the lead exposure and coexisting F allel in the locus Fok-I of VDR gene are suspected of higher zinc protoporphyrins concentrations. Workers exposed to the lead with the Y allel in the locus C282Y of the HFE gene are predisposed to lower ZnPP levels and individuals with coexisting H allel in the locus H63D HFE gene are predisposed to lower Pb-B levels. The T allel in the locus rs1805313 of the ALAD gene determines lower Pb-B and ZnPP levels in lead-exposed individuals. The heterozigosity of the locus rs2228083 of the ALAD gene has a strong predilection to higher Pb-B levels. The carriage of the C allel in the locus rs1139488 of the ALAD gene might determine higher Pb-B levels and the heterozigosity of the locus rs1139488 of the ALAD gene might result in higher ZnPP levels. The study revealed relationship between VDR, HFE and ALAD genes polymorphism and basic toxicological parameters in occupationally exposed workers. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

EMQN best practice guidelines for the molecular genetic diagnosis of hereditary hemochromatosis (HH)

Science.gov (United States)

Porto, Graça; Brissot, Pierre; Swinkels, Dorine W; Zoller, Heinz; Kamarainen, Outi; Patton, Simon; Alonso, Isabel; Morris, Michael; Keeney, Steve

2016-01-01

Molecular genetic testing for hereditary hemochromatosis (HH) is recognized as a reference test to confirm the diagnosis of suspected HH or to predict its risk. The vast majority (typically >90%) of patients with clinically characterized HH are homozygous for the p.C282Y variant in the HFE gene, referred to as HFE-related HH. Since 1996, HFE genotyping was implemented in diagnostic algorithms for suspected HH, allowing its early diagnosis and prevention. However, the penetrance of disease in p.C282Y homozygotes is incomplete. Hence, homozygosity for p.C282Y is not sufficient to diagnose HH. Neither is p.C282Y homozygosity required for diagnosis as other rare forms of HH exist, generally referred to as non-HFE-related HH. These pose significant challenges when defining criteria for referral, testing protocols, interpretation of test results and reporting practices. We present best practice guidelines for the molecular genetic diagnosis of HH where recommendations are classified, as far as possible, according to the level and strength of evidence. For clarification, the guidelines' recommendations are preceded by a detailed description of the methodology and results obtained with a series of actions taken in order to achieve a wide expert consensus, namely: (i) a survey on the current practices followed by laboratories offering molecular diagnosis of HH; (ii) a systematic literature search focused on some identified controversial topics; (iii) an expert Best Practice Workshop convened to achieve consensus on the practical recommendations included in the guidelines. PMID:26153218

The effect of the hemochromatosis (HFE) genotype on lead load and iron metabolism among lead smelter workers.

Science.gov (United States)

Fan, Guangqin; Du, Guihua; Li, Huijun; Lin, Fen; Sun, Ziyong; Yang, Wei; Feng, Chang; Zhu, Gaochun; Li, Yanshu; Chen, Ying; Jiao, Huan; Zhou, Fankun

2014-01-01

Both an excess of toxic lead (Pb) and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE) gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking. To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant) on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure. Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted. Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin. No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

Correlation between HFE gene polymorphisms and increased risk of coronary artery disease among patients with type 2 diabetes in Iran.

Science.gov (United States)

Saremi, Leila; Saremi, Marzieh; Lotfipanah, Shirin; İmani, Saber; Fu, Junjiang; Zhang, Tianyu

2016-04-19

Diabetes mellitus is a risk factor for cardiovascular diseases (CVDs), which are among the major causes of deaths in type 2 diabetes (T2D). The purpose of the present study was to determine the association of C282Y and H63D mutations in the HFE gene with increased risk of coronary artery disease (CAD) in T2D patients. Two hundred and ninety individuals were divided into two groups: a case group and a control group. Genomic DNA of peripheral venous blood cells was extracted and the HFE gene mutations were analyzed using the PCR-RFLP technique. Data analysis revealed a significant difference between the allele frequencies of H63D and C282Y mutations between the case group and the controls (P 0.05). Using a logistic regression model, BMI, FBS, HDL, and total cholesterol levels were significantly different with independent predictors of CVD (P < 0.05). Our results revealed a significant correlation between C282Y and H63D mutations and the development of CAD in T2D patients.

Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

Science.gov (United States)

Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

2011-06-01

Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for

Dietary Iron Intake and Serum Ferritin Concentration in 213 Patients Homozygous for the HFEC282Y Hemochromatosis Mutation

Directory of Open Access Journals (Sweden)

Victor R Gordeuk

2012-01-01

Full Text Available BACKGROUND: HFEC282Y homozygotes have an increased risk for developing increased iron stores and related disorders. It is controversial whether dietary iron restrictions should be recommended to such individuals.

Frequency of the Hemochromatosis Gene (HFE Variants in a Jordanian Arab Population and in Diabetics from the Same Region

Directory of Open Access Journals (Sweden)

Asem Alkhateeb

2009-01-01

Full Text Available Hereditary HFE-linked hemochromatosis is a frequent recessive disorder among individuals of northern European ancestry. The clinical characteristic of this disease is the gradual accumulation of iron in internal organs, which ultimately may lead to organ damage and death. Three allelic variants of HFE gene have been correlated with hereditary hemochromatosis: C282Y is significantly associated with hereditary hemochromatosis in populations of Celtic origin, H63D and S65C are associated with milder form of iron overload. In this study we performed mutation analysis to identify allele frequency of the three variants of HFE gene in Jordanian Arab population, to assess deviations of these frequencies from those detected elsewhere, and to determine if there is an increased frequency of these variants in a diabetic population (Type 2 diabetes from the same area. DNA was extracted from blood samples of 440 individuals attending King Abdullah University Hospital for ambulatory services. We used polymerase chain reaction (PCR to amplify exons 2 and 4 of the HFE gene then restriction fragment length polymorphism (RFLP method to detect the variants. There were neither homozygous nor heterozygous for C282Y variant. For the H63D variant, 0.68% were homozygous and 21.1% were heterozygous. For the S65C variant, there were no homozygous and 0.23% were heterozygous. Allelic frequencies were, 0%, 11.25%, and 0.11% for C282Y, H63D, and S65C, respectively. Our samples were subdivided into two categories of type 2 diabetic (89 cases and controls (blood donors, 204 cases and compared with regard to the H63D variant. Both groups did not have homozygous H63D variant. H63D heterozygous in diabetics were 23.60% and in blood donor controls 22.55%. Allelic frequency of the mutant H63D allele was 11.80% in diabetics and 11.27% for the blood donor controls. This is the first study to show the frequency of the three hemochromatosis gene variants in Jordan with the interesting

The effect of the hemochromatosis (HFE genotype on lead load and iron metabolism among lead smelter workers.

Directory of Open Access Journals (Sweden)

Guangqin Fan

Full Text Available Both an excess of toxic lead (Pb and an essential iron disorder have been implicated in many diseases and public health problems. Iron metabolism genes, such as the hemochromatosis (HFE gene, have been reported to be modifiers for lead absorption and storage. However, the HFE gene studies among the Asian population with occupationally high lead exposure are lacking.To explore the modifying effects of the HFE genotype (wild-type, H63D variant and C282Y variant on the Pb load and iron metabolism among Asian Pb-workers with high occupational exposure.Seven hundred and seventy-one employees from a lead smelter manufacturing company were tested to determine their Pb intoxication parameters, iron metabolic indexes and identify the HFE genotype. Descriptive and multivariate analyses were conducted.Forty-five H63D variant carriers and no C282Y variant carrier were found among the 771 subjects. Compared with subjects with the wild-type genotype, H63D variant carriers had higher blood lead levels, even after controlling for factors such as age, sex, marriage, education, smoking and lead exposure levels. Multivariate analyses also showed that the H63D genotype modifies the associations between the blood lead levels and the body iron burden/transferrin.No C282Y variant was found in this Asian population. The H63D genotype modified the association between the lead and iron metabolism such that increased blood lead is associated with a higher body iron content or a lower transferrin in the H63D variant. It is indicated that H63D variant carriers may be a potentially highly vulnerable sub-population if they are exposed to high lead levels occupationally.

Iron storage disease in Asia-Pacific populations: the importance of non-HFE mutations.

Science.gov (United States)

McDonald, Cameron J; Wallace, Daniel F; Crawford, Darrell H G; Subramaniam, V Nathan

2013-07-01

Hereditary hemochromatosis (HH) is a widely recognized and well-studied condition in European populations. This is largely due to the high prevalence of the C282Y mutation of HFE. Although less common than in Europe, HH cases have been reported in the Asia-Pacific region because of mutations in both HFE and non-HFE genes. Mutations in all of the currently known genes implicated in non-HFE HH (hemojuvelin, hepcidin, transferrin receptor 2, and ferroportin) have been reported in patients from the Asia-Pacific region. This review discusses the molecular basis of HH and the genes and mutations known to cause non-HFE HH with particular reference to the Asia-Pacific region. Challenges in the genetic diagnosis of non-HFE HH are also discussed and how new technologies such as next generation sequencing may be informative in the future. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

HFE gene variants modify the association between maternal lead burden and infant birthweight: a prospective birth cohort study in Mexico City, Mexico.

Science.gov (United States)

Cantonwine, David; Hu, Howard; Téllez-Rojo, Martha Maria; Sánchez, Brisa N; Lamadrid-Figueroa, Héctor; Ettinger, Adrienne S; Mercado-García, Adriana; Hernández-Avila, Mauricio; Wright, Robert O

2010-07-26

Neonatal growth is a complex process involving genetic and environmental factors. Polymorphisms in the hemochromatosis (HFE) iron regulatory genes have been shown to modify transport and toxicity of lead which is known to affect birth weight. We investigated the role of HFE C282Y, HFE H63 D, and transferrin (TF) P570 S gene variants in modifying the association of lead and infant birthweight in a cohort of Mexican mother-infant pairs. Subjects were initially recruited between 1994-1995 from three maternity hospitals in Mexico City and 411 infants/565 mothers had archived blood available for genotyping. Multiple linear regression models, stratified by either maternal/infant HFE or TF genotype and then combined with interaction terms, were constructed examining the association of lead and birthweight after controlling for covariates. 3.1%, 16.8% and 17.5% of infants (N=390) and 1.9%, 14.5% and 18.9% of mothers (N=533) carried the HFE C282Y, HFE H63D, and TF P570 S variants, respectively. The presence of infant HFE H63 D variants predicted 110.3 g (95% CI -216.1, -4.6) decreases in birthweight while maternal HFE H63 D variants predicted reductions of 52.0 g (95% CI -147.3 to 43.2). Interaction models suggest that both maternal and infant HFE H63 D genotype may modify tibia lead's effect on infant birthweight in opposing ways. In our interaction models, maternal HFE H63 D variant carriers had a negative association between tibia lead and birthweight. These results suggest that the HFE H63 D genotype modifies lead's effects on infant birthweight in a complex fashion that may reflect maternal-fetal interactions with respect to the metabolism and transport of metals.

Hemocromatosis gene (HFE) mutations in patients with type 2 diabetes and their control group in an Iranian population

International Nuclear Information System (INIS)

Sharifi, F.; Esmaeilzadeh, A.; Zali, M.

2008-01-01

Objective was to assess the frequency of 2 different forms of hemochromatosis HFE gene mutations c282y and H63D mutations in a normal population in comparison with type 2 diabetic patients. This case control study was undertaken in Zanjan Diabetic Care Center, Zanjan, western Tehran, in 2005. Two hundred and two individuals were included in this study: 101 type 2 diabetes mellitus T2DM patients and 101 age and gender-matched controls. The patients were examined for mutations in the HFE gene. Nucleotide 845 C282Y and 187 H63D alleles were amplified by polymerase chain reaction PCR with lymphocyte deoxyribonucleic acid. The PCR products were analyzed by restriction enzyme digestion. Chi-square students test and Fisher's exact tests were used for comparison and odds ratio was calculated. Two hundred and two individuals were studied. The frequency of wild /C28Y alleles was 68.3/31.7% in diabetics p=0.08 and 73.4/26.3% in control subjects p=0.08. The distribution of genotypes was not statistically different. Based on our data, HFE mutations were not found in excess in patients with T2DM and there was no evidence that a population-based search for an excess of these alleles in type 2 diabetes was indicated. (author)

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

Science.gov (United States)

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Impact of HFE genetic testing on clinical presentation of hereditary hemochromatosis: new epidemiological data

Directory of Open Access Journals (Sweden)

Ka Chandran

2005-06-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common inherited disorder of iron metabolism in Northern European populations. The discovery of a candidate gene in 1996 (HFE, and of its main mutation (C282Y, has radically altered the way to diagnose this disease. The aim of this study was to assess the impact of the HFE gene discovery on the clinical presentation and epidemiology of HH. Methods We studied our cohort of 415 patients homozygous for the C282Y allele and included in a phlebotomy program in a blood centre in western Brittany, France. Results In this cohort, 56.9% of the patients were male and 21.9% began their phlebotomy program before the implementation of the genetic test. A significant decrease in the sex ratio was noticed following implementation of this DNA test, from 3.79 to 1.03 (p -5, meaning that the proportion of diagnosed females relatives to males greatly increased. The profile of HH patients at diagnosis changed after the DNA test became available. Serum ferritin and iron values were lower and there was a reduced frequency of clinical signs displayed at diagnosis, particularly skin pigmentation (20.1 vs. 40.4%, OR = 0.37, p Conclusion This study highlights the importance of the HFE gene discovery, which has simplified the diagnosis of HH and modified its clinical presentation and epidemiology. This study precisely measures these changes. Enhanced diagnosis of HFE-related HH at an early stage and implementation of phlebotomy treatment are anticipated to maintain normal life expectancy for these patients.

Computational Profiling of Deleterious Non-Synonymous SNP’s in HFE

Directory of Open Access Journals (Sweden)

S. Sarath Raj

2017-12-01

Full Text Available Liver cirrhosis describes a condition where scar tissue gradually replaces healthy cells in liver. The main causes are sustained, excessive alcohol consumption, viral hepatitis B and C, and fatty liver disease - however, there are other possible causes. Hemochromatosis is most common form of iron overload disease. Three types of hemochromatosis are primary hemochromatosis, also called hereditary hemochromatosis; secondary hemochromatosis; and neonatal hemochromatosis. The HFE gene helps regulate the amount of iron absorbed from food and inherited genetic defects or mutation in HFE [C282Y] cause primary hemochromatosis. Computational approach is sought to determine other similar mutations in this gene. In-silico tools such as SIFT, Polyphen 2.0, and PROVEAN were employed to determine the various deleterious ns-SNPs of HFE that may influence cystic fibrosis.

Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

Directory of Open Access Journals (Sweden)

Yunus Kasım Terzi

2016-12-01

Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic.

Science.gov (United States)

Heath, Kathleen M; Axton, Jacob H; McCullough, John M; Harris, Nathan

2016-05-01

The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronutrient for effective thermoregulation. We argue that the C282Y allele was an adaptation to this novel environment. To address our hypothesis, we compiled C282Y allele frequencies, known Neolithic sites in Europe and climatic data on temperature and rainfall for statistical analysis. Our findings indicate that the geographic cline for C282Y frequency in Europe increases as average temperatures decrease below 16°C, a critical threshold for thermoregulation, with rainy days intensifying the trend. The results indicate that the deleterious C282Y allele, responsible for most cases of hemochromatosis, may have evolved as a selective advantage to culture and climate during the European Neolithic. © 2016 The Authors American Journal of Physical Anthropology Published by Wiley Periodicals, Inc.

Preliminary investigation of bottlenose dolphins (Tursiops truncatus) for hfe gene-related hemochromatosis.

Science.gov (United States)

Phillips, Brianne E; Venn-Watson, Stephanie; Archer, Linda L; Nollens, Hendrik H; Wellehan, James F X

2014-10-01

Hemochromatosis (iron storage disease) has been reported in diverse mammals including bottlenose dolphins (Tursiops truncatus). The primary cause of excessive iron storage in humans is hereditary hemochromatosis. Most human hereditary hemochromatosis cases (up to 90%) are caused by a point mutation in the hfe gene, resulting in a C282Y substitution leading to iron accumulation. To evaluate the possibility of a hereditary hemochromatosis-like genetic predisposition in dolphins, we sequenced the bottlenose dolphin hfe gene, using reverse transcriptase-PCR and hfe primers designed from the dolphin genome, from liver of affected and healthy control dolphins. Sample size included two case animals and five control animals. Although isotype diversity was evident, no coding differences were identified in the hfe gene between any of the animals examined. Because our sample size was small, we cannot exclude the possibility that hemochromatosis in dolphins is due to a coding mutation in the hfe gene. Other potential causes of hemochromatosis, including mutations in different genes, diet, primary liver disease, and insulin resistance, should be evaluated.

АЛЛЕЛИ 282Y И H63D ГЕНА HFE И ПРЕДРАСПОЛОЖЕННОСТЬ К СИНДРОМУ ХРОНИЧЕСКОЙ ПЕРЕГРУЗКИ ЖЕЛЕЗОМ И НАРУШЕНИЮ ПОРФИРИНОВОГО ОБМЕНА ПРИ НЕАЛКОГОЛЬНОЙ ЖИРОВОЙ БОЛЕЗНИ ПЕЧЕНИ

Directory of Open Access Journals (Sweden)

А. Б. Кривошеев

2012-01-01

Full Text Available Testing for carriers of mutations C282Y and H63D HFE gene in 57 patients with nonalcoholic fatty liver disease was completed. Abnormalities in the metabolism of porphyrins were detected in 39 (68.4% patients, mutations C282Y and H63D were detected in 16 (28.1% patients, of whom 12 patients with metabolic disorders of porphyrins and symptoms of the syndrome of chronic iron overload. In 41 (71.9% patients without the mutations found disorders metabolism of porphyrins were in 27 (65.8% patients. They had no symptoms of the syndrome of chronic iron overload. Detection of C282Y and H63D mutations in the gene HFE in conjunction with disorders of porphyrin metabolism in association with the syndrome of chronic iron overload, but the probability will consider these patients as candidates for inclusion in the higher risk of formation of liver fibrosis.

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

Science.gov (United States)

Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

2015-01-01

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, poverload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C] has a role, as genetic predisposition factor, on iron overload in the S�

Highly sensitivity adhesion molecules detection in hereditary haemochromatosis patients reveals altered expression.

LENUS (Irish Health Repository)

Norris, S

2012-02-01

Several abnormalities in the immune status of patients with hereditary haemochromatosis (HH) have been reported, suggesting an imbalance in their immune function. This may include persistent production of, or exposure to, altered immune signalling contributing to the pathogenesis of this disorder. Adhesion molecules L-, E- and P-Selectin, intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) are some of the major regulators of the immune processes and altered levels of these proteins have been found in pathological states including cardiovascular diseases, arthritis and liver cancer. The aim of this study was to assess L-, E- and P-Selectin, ICAM-1 and VCAM-1 expression in patients with HH and correlate these results with HFE mutation status and iron indexes. A total of 139 subjects were diagnosed with HH (C282Y homozygotes = 87, C282Y\\/H63D = 26 heterozygotes, H63D homozygotes = 26), 27 healthy control subjects with no HFE mutation (N\\/N), 18 normal subjects heterozygous for the H63D mutation served as age-sex-matched controls. We observed a significant decrease in L-selectin (P = 0.0002) and increased E-selectin and ICAM-1 (P = 0.0006 and P = 0.0059) expression in HH patients compared with healthy controls. This study observes for the first time that an altered adhesion molecules profile occurs in patients with HH that is associated with specific HFE genetic component for iron overload, suggesting that differential expression of adhesion molecules may play a role in the pathogenesis of HH.

The role of genetic factors in patients with hepatocellular carcinoma and iron overload - a prospective series of 234 patients.

Science.gov (United States)

Funakoshi, Natalie; Chaze, Iphigénie; Alary, Anne-Sophie; Tachon, Gaëlle; Cunat, Séverine; Giansily-Blaizot, Muriel; Bismuth, Michael; Larrey, Dominique; Pageaux, Georges-Philippe; Schved, Jean-François; Donnadieu-Rigole, Hélène; Blanc, Pierre; Aguilar-Martinez, Patricia

2016-05-01

Iron overload (IO) in HFE-related hereditary haemochromatosis is associated with increased risk of liver cancer. This study aimed to investigate the role of other genes involved in hereditary IO among patients with hepatocellular carcinoma (HCC). Patients with HCC diagnosed in our institution were included in this prospective study. Those with ferritin levels ≥300 μg/L (males) or ≥200 μg/L (females) and/or transferrin saturation ≥50% (males) or ≥45% (females) had liver iron concentration (LIC) evaluated by MRI. HFE C282Y and H63D mutations were screened. Genetic analyses of genes involved in hereditary IO (HFE, HJV/HFE2, HAMP, TFR2, SLC40A1, GNPAT) were performed in patients with increased LIC. A total of 234 patients were included; 215 (92%) had common acquired risk factors of HCC (mainly alcoholism or chronic viral hepatitis). 119 patients had abnormal iron parameters. Twelve (5.1%) were C282Y homozygotes, three were compound C282Y/H63D heterozygotes. LIC was measured by MRI in 100 patients. Thirteen patients with a LIC>70 μmol/g were enrolled in further genetic analyses: two unrelated patients bore the HAMP:c.-153C>T mutation at the heterozygous state, which is associated with increased risk of IO and severe haemochromatosis. Specific haplotypes of SLC40A1 were also studied. Additional genetic risk factors of IO were found in 18 patients (7.7%) among a large series of 234 HCC patients. Screening for IO and the associated at-risk genotypes in patients who have developed HCC, is useful for both determining etiologic diagnosis and enabling family screening and possibly primary prevention in relatives. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

Directory of Open Access Journals (Sweden)

Luis COSTA-MATOS

2013-03-01

Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05, but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI: 2.09-142.34, P = 0.008. However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003. Conclusions ALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no

Porfiria cutánea tarda: asociación con mutaciones HFE, hepatitis virales, alcohol y otros factores de riesgo en Guipúzcoa, País Vasco Porphyria cutanea tarda: An analysis of HFE gene mutations, hepatitis viruses, alcohol intake, and other risk factors in 54 patients from Guipúzcoa, Basque Country, Spain

Directory of Open Access Journals (Sweden)

A. Castiella

2008-12-01

Full Text Available Objetivo: estudiar la frecuencia de las mutaciones en el gen HFE (C282Y, H63D, S65C en un grupo de 54 pacientes con porfiria cutánea tarda (PCT y en un grupo de controles sanos (donantes de sangre en Guipúzcoa. También analizar su relación con los virus de la hepatitis B y C (VHB, VHC, alcohol y otros factores de riesgo reconocidos. Métodos: el análisis de las mutaciones se hizo mediante PCR. Se compararon las frecuencias alélicas y genotípicas. Se determinaron la probabilidad y el test de Chi cuadrado. Resultados: no encontramos asociación entre C282Y y PCT (5,76 vs. 5% controles. Se observó una alta frecuencia alélica en la mutación H63D en PCT (34,25%, pero sin ser estadísticamente significativa (controles 29,31%, debido a la alta prevalencia de esta mutación en la población vasca. La mutación S65C fue menor en PCT que en controles. Encontramos una idéntica presencia de H63D en heterocigosis en ambos grupos (38,8 vs. 38,8%. La asociación con el VHC se objetivó en el 35,18% de los pacientes y la infección por VHB en el 7,4%. Un 55,55% de los pacientes tenía un hábito alcohólico de más de 60 g etanol día. Todos eran negativos para el virus de la inmunodeficiencia humana (VIH y 1 de las 5 mujeres con PCT tomaba estrógenos. Conclusión: las mutaciones C282Y y H63D no tienen un papel relevante en los pacientes con PCT en Guipúzcoa. Los factores externos (consumo importante de alcohol y VHC parecen jugar un papel fundamental en el desarrollo de la PCT en nuestra población.Aim: to study the frequency of HFE gene mutations (C282Y, H63D, S65C in a group of 54 sporadic PCT patients and in a group of healthy controls (blood donors from Guipúzcoa, Spain. We studied the association of PCT with HCV, HBV, alcohol abuse, and other established risk factors. Methods: the analysis of mutations was made by PCR. Allelic and genotypic frequencies were compared. Probability was determined and a Chi-squared test was performed. Results

Serum hepcidin levels, iron status, and HFE gene alterations during the first year of life in healthy Spanish infants.

Science.gov (United States)

Aranda, Nuria; Bedmar, Cristina; Arija, Victoria; Jardí, Cristina; Jimenez-Feijoo, Rosa; Ferré, Natalia; Tous, Monica

2018-06-01

The aims of this study were to describe hepcidin levels and to assess their associations with iron status and the main variants in the HFE gene in healthy and full-term newborns during the first year of life, as a longitudinal study conducted on 140 infants. Anthropometric and biochemical parameters, hepcidin, hemoglobin (Hb), serum ferritin (SF), transferrin saturation (TS), mean corpuscular volume (MCV), and C-reactive protein (CRP), were assessed in 6- and 12-month-olds. Infants were genotyped for the three main HFE variants: C282Y, H63D, and S65C. Hepcidin levels increased from 6 to 12 months of age (43.7 ± 1.5 to 52.0 ± 1.5 ng/mL; p HFE gene (p = 0.046 and p = 0.048 in 6- and 12-month-olds, respectively). However, this association was not found in HFE-alteration-carrying infants. Hepcidin levels increased in healthy infants during the first year of life and were positively associated with iron levels only in infants with wild-type HFE gene, a situation that requires further investigation.

Was the C282Y mutation an Irish Gaelic mutation that the Vikings helped disseminate?

DEFF Research Database (Denmark)

Olsson, Karl Sigvard; Konar, Jan; Dufva, Inge Hoegh

2011-01-01

The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses.......The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses....

Association study between four polymorphisms in the HFE, TF and TFR genes and Parkinson's disease in southern Italy.

Science.gov (United States)

Greco, Valentina; De Marco, Elvira Valeria; Rocca, Francesca Emanuela; Annesi, Ferdinanda; Civitelli, Donatella; Provenzano, Giovanni; Tarantino, Patrizia; Scornaienchi, Vittorio; Pucci, Franco; Salsone, Maria; Novellino, Fabiana; Morelli, Maurizio; Paglionico, Sandra; Gambardella, Antonio; Quattrone, Aldo; Annesi, Grazia

2011-06-01

Iron overload may lead to neurodegenerative disorders such as Parkinson's disease (PD) and alterations of iron-related genes might be involved in the pathogenesis of this disease. The gene of haemochromatosis (HFE) encodes the HFE protein which interacts with the transferrin receptor (TFR), lowering its affinity for iron-bound transferrin (TF). We examined four known polymorphisms, C282Y and H63D in the HFE gene, G258S in the TF gene and S82G in the TFR gene, in 181 sporadic PD patients and 180 controls from Southern Italy to investigate their possible role in susceptibility to PD. No significant differences were found in genotype and allele frequencies between PD and controls for all the polymorphisms studied, suggesting that these variants do not contribute significantly to the risk of PD.

Hemochromatosis mutations in the general population

DEFF Research Database (Denmark)

Andersen, Rolf Vaern; Tybjaerg-Hansen, Anne; Appleyard, Merete

2004-01-01

The progression rate of iron overload in hereditary hemochromatosis in individuals in the general population is unknown. We therefore examined in the general population iron overload progression rate in C282Y homozygotes. Using a cohort study of the Danish general population, The Copenhagen City...... saturation and ferritin levels increased slightly in male and female C282Y homozygotes. None of the C282Y homozygotes developed clinically overt hemochromatosis. In conclusion, individuals in the general population with C282Y homozygosity at most demonstrate modest increases in transferrin saturation...

HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

Directory of Open Access Journals (Sweden)

Luís COSTA-MATOS

2013-03-01

Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P Contexto A doença hepática alcoólica (DHA está geralmente associada à sobrecarga de ferro, que pode contribuir para a sua patogênese, através do aumento do estresse oxidativo e dano celular. As descrições existentes na literatura sobre a associação entre mutações HFE e a gravidade da DHA nem sempre são concordantes. Objetivos Comparar a prevalência de mutações HFE entre um grupo de pacientes com DHA e uma população de controle. Avaliar a relação entre mutações HFE e os depósitos de ferro hepático. Avaliar se a presença dessas mutações está associada com a gravidade da DHA. Métodos Compararam-se 63 pacientes com DHA que efetuaram biopsia hepática com 52 controles saudáveis. A genotipagem HFE (wild type, C282Y, H63D, S65C, E

The prevalence of primary hereditary hemochromatosis in central Anatolia.

Science.gov (United States)

Karaca, Halit; Güven, Kadri; Önal, Müge; Gürsoy, Şebnem; Başkol, Mevlüt; Özkul, Yusuf

2013-01-01

Hereditary hemochromatosis is an autosomal recessive disorder associated with the HFE genes. Early identification and diagnosis is important as end stage organ damage may occur if treatment is delayed.. This study aimed to identify the prevalence of hereditary hemochromatosis in Kayseri and surroundings known as Central Anatolia. 2304 participants (1220 males, 1084 females) who were older then the age of 17 were included in the study conducted between December 2005 and December 2006 in Kayseri, Turkey. Transferin saturation was measured from overnight fasting blood samples. Serum iron, total iron binding capacity, and transferin saturation were measured. Serum ferritin levels and hereditary hemochromatosis genetic analysis were also performed after an overnight fasting blood samples from participants whose transferin saturation results were more than 50% in man and more than 45% in women. The homozygote C282Y mutation and heterozygote C282Y mutation prevalences were found as 0.08% (1/1220) and 0.08% (1/1220) in male participants, respectively. The heterozygote H63D mutation prevalence was found in 0.09% (1/1084) of female participants. Calculated prevalences in general population are as follows; The homozygote C282Y mutation prevalence is 0.043% (1/2304), the heterozygote C282Y mutation prevalence is 0.043% (1/2304) and the heterozygote H63D mutation prevalence is 0.043% (1/2304). The prevalence of hereditary hemochromatosis in Central Anatolia is 0.043% (1/2304). Because of the relatively low frequency, population screening studies are not cost-effective.

Association of HFE common mutations with Parkinson's disease, Alzheimer's disease and mild cognitive impairment in a Portuguese cohort

Directory of Open Access Journals (Sweden)

Morgadinho Ana S

2006-07-01

Full Text Available Abstract Background Pathological brain iron deposition has been implicated as a source of neurotoxic reactive oxygen species in Alzheimer (AD and Parkinson diseases (PD. Iron metabolism is associated with the gene hemochromatosis (HFE Human genome nomenclature committee ID:4886, and mutations in HFE are a cause of the iron mismetabolism disease, hemochromatosis. Several reports have tested the association of HFE variants with neurodegenerative diseases, such as AD and PD with conflicting results. Methods Genotypes were analysed for the two most common variants of HFE in a series of 130 AD, 55 Mild Cognitive Impairment (MCI and 132 PD patients. Additionally, a series of 115 healthy age-matched controls was also screened. Results A statistically significant association was found in the PD group when compared to controls, showing that the presence of the C282Y variant allele may confer higher risk for developing the disease. Conclusion Taken together these results suggest that the common variants in HFE may be a risk factor for PD, but not for AD in the Portuguese population.

Natural selection on HFE in Asian populations contributes to enhanced non-heme iron absorption.

Science.gov (United States)

Ye, Kaixiong; Cao, Chang; Lin, Xu; O'Brien, Kimberly O; Gu, Zhenglong

2015-06-10

HFE, a major regulator of iron (Fe) homeostasis, has been suggested to be under positive selection in both European and Asian populations. While the genetic variant under selection in Europeans (a non-synonymous mutation, C282Y) has been relatively well-studied, the adaptive variant in Asians and its functional consequences are still unknown. Identifying the adaptive HFE variants in Asians will not only elucidate the evolutionary history and the genetic basis of population difference in Fe status, but also assist the future practice of genome-informed dietary recommendation. Using data from the International HapMap Project, we confirmed the signatures of positive selection on HFE in Asian populations and identified a candidate adaptive haplotype that is common in Asians (52.35-54.71%) but rare in Europeans (5.98%) and Africans (4.35%). The T allele at tag SNP rs9366637 (C/T) captured 95.8% of this Asian-common haplotype. A significantly reduced HFE expression was observed in individuals carrying T/T at rs9366637 compared to C/C and C/T, indicating a possible role of gene regulation in adaptation. We recruited 57 women of Asian descent and measured Fe absorption using stable isotopes in those homozygous at rs9366637. We observed a 22% higher absorption in women homozygous for the Asian-common haplotype (T/T) compared to the control genotype (C/C). Additionally, compared with a group of age-matched Caucasian women, Asian women exhibited significantly elevated Fe absorption. Our results indicate parallel adaptation of HFE gene in Europeans and Asians with different genetic variants. Moreover, natural selection on HFE may have contributed to elevated Fe absorption in Asians. This study regarding population differences in Fe homeostasis has significant medical impact as high Fe level has been linked to an increased disease risk of metabolic syndromes.

Lack of evidence for the pathogenic role of iron and HFE gene mutations in Brazilian patients with nonalcoholic steatohepatitis

Directory of Open Access Journals (Sweden)

M.M. Deguti

2003-06-01

Full Text Available The hypothesis of the role of iron overload associated with HFE gene mutations in the pathogenesis of nonalcoholic steatohepatitis (NASH has been raised in recent years. In the present study, biochemical and histopathological evidence of iron overload and HFE mutations was investigated in NASH patients. Thirty-two NASH patients, 19 females (59%, average 49.2 years, 72% Caucasians, 12% Mulattoes and 12% Asians, were submitted to serum aminotransferase and iron profile determinations. Liver biopsies were analyzed for necroinflammatory activity, architectural damage and iron deposition. In 31 of the patients, C282Y and H63D mutations were tested by PCR-RFLP. Alanine aminotransferase levels were increased in 30 patients, 2.42 ± 1.12 times the upper normal limit on average. Serum iron concentration, transferrin saturation and ferritin averages were 99.4 ± 31.3 g/dl, 33.1 ± 12.7% and 219.8 ± 163.8 µg/dl, respectively, corresponding to normal values in 93.5, 68.7 and 78.1% of the patients. Hepatic siderosis was observed in three patients and was not associated with architectural damage (P = 0.53 or with necroinflammatory activity (P = 0.27. The allelic frequencies (N = 31 found were 1.6 and 14.1% for C282Y and H63D, respectively, which were compatible with those described for the local population. In conclusion, no evidence of an association of hepatic iron overload and HFE mutations with NASH was found. Brazilian NASH patients comprise a heterogeneous group with many associated conditions such as hyperinsulinism, environmental hepatotoxin exposure and drugs, but not hepatic iron overload, and their disease susceptibility could be related to genetic and environmental features other than HFE mutations.

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

Population Screening for Hereditary Haemochromatosis in Australia: Construction and Validation of a State-Transition Cost-Effectiveness Model.

Science.gov (United States)

de Graaff, Barbara; Si, Lei; Neil, Amanda L; Yee, Kwang Chien; Sanderson, Kristy; Gurrin, Lyle C; Palmer, Andrew J

2017-03-01

HFE-associated haemochromatosis, the most common monogenic disorder amongst populations of northern European ancestry, is characterised by iron overload. Excess iron is stored in parenchymal tissues, leading to morbidity and mortality. Population screening programmes are likely to improve early diagnosis, thereby decreasing associated disease. Our aim was to develop and validate a health economics model of screening using utilities and costs from a haemochromatosis cohort. A state-transition model was developed with Markov states based on disease severity. Australian males (aged 30 years) and females (aged 45 years) of northern European ancestry were the target populations. The screening strategy was the status quo approach in Australia; the model was run over a lifetime horizon. Costs were estimated from the government perspective and reported in 2015 Australian dollars ($A); costs and quality-adjusted life-years (QALYs) were discounted at 5% annually. Model validity was assessed using goodness-of-fit analyses. Second-order Monte-Carlo simulation was used to account for uncertainty in multiple parameters. For validity, the model reproduced mortality, life expectancy (LE) and prevalence rates in line with published data. LE for C282Y homozygote males and females were 49.9 and 40.2 years, respectively, slightly lower than population rates. Mean (95% confidence interval) QALYS were 15.7 (7.7-23.7) for males and 14.4 (6.7-22.1) for females. Mean discounted lifetime costs for C282Y homozygotes were $A22,737 (3670-85,793) for males and $A13,840 (1335-67,377) for females. Sensitivity analyses revealed discount rates and prevalence had the greatest impacts on outcomes. We have developed a transparent, validated health economics model of C282Y homozygote haemochromatosis. The model will be useful to decision makers to identify cost-effective screening strategies.

[The polymorphism of catechol-O-methyltransferase (COMT) and hemochromatosis (HFE) genes in the radiocontaminated regions residents with different chromosome aberration frequency].

Science.gov (United States)

Ivanova, T I; Kondrashova, T V; Krikunova, L I; Smirnova, I A; Shentereva, N I; Sychenkova, N I; Rykova, E V; Zharikova, I A; Khorokhorina, V A; Riabchenko, N I; Zamulaeva, I A

2010-01-01

The association between polymorphisms in genes COMT, HFE that takes part in oxidative stress regulation, and chromosome aberration frequency in lymphocytes was assessed in 278 female residents of radiation polluted regions of Central Russia: Bryansk (322 kBk/m2) and Tula Districts (137Cs - 171 kBk/m2). The C187G, G845A genotyping of HFE and G1947A (H/L) of COMT was done by means of polymerase chain reaction-restriction fragment length polymorphism. Studied population was divided into 3 subgroups by level of chromosome aberrations per cell (0-2, 3-4, >5). There was shown statistically significant difference in distribution of COMTand HFE genotypes between the groups. The high frequency of chromosome aberrations (> or = 5%) was associated with homozygotes of the high activity COMT G/G and HFE CC. Heterozygotes for G1947A COMT and C187G HFE reveal negative association with the high frequency of chromosome aberrations and correspond to "resistance factors".

HFE gene mutations in coronary atherothrombotic disease

Directory of Open Access Journals (Sweden)

Calado R.T.

2000-01-01

Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

Science.gov (United States)

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2012-10-15

Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

Four variants in transferrin and HFE genes as potential markers of iron deficiency anaemia risk: an association study in menstruating women

Directory of Open Access Journals (Sweden)

Arroyo-Pardo Eduardo

2011-10-01

Full Text Available Abstract Background Iron deficiency anaemia is a worldwide health problem in which environmental, physiologic and genetic factors play important roles. The associations between iron status biomarkers and single nucleotide polymorphisms (SNPs known to be related to iron metabolism were studied in menstruating women. Methods A group of 270 Caucasian menstruating women, a population group at risk of iron deficiency anaemia, participated in the study. Haematological and biochemical parameters were analysed and 10 selected SNPs were genotyped by minisequencing assay. The associations between genetic and biochemical data were analysed by Bayesian Model Averaging (BMA test and decision trees. Dietary intake of a representative subgroup of these volunteers (n = 141 was assessed, and the relationship between nutrients and iron biomarkers was also determined by linear regression. Results Four variants, two in the transferrin gene (rs3811647, rs1799852 and two in the HFE gene (C282Y, H63D, explain 35% of the genetic variation or heritability of serum transferrin in menstruating women. The minor allele of rs3811647 was associated with higher serum transferrin levels and lower transferrin saturation, while the minor alleles of rs1799852 and the C282Y and H63D mutations of HFE were associated with lower serum transferrin levels. No association between nutrient intake and iron biomarkers was found. Conclusions In contrast to dietary intake, these four SNPs are strongly associated with serum transferrin. Carriers of the minor allele of rs3811647 present a reduction in iron transport to tissues, which might indicate higher iron deficiency anaemia risk, although the simultaneous presence of the minor allele of rs1799852 and HFE mutations appear to have compensatory effects. Therefore, it is suggested that these genetic variants might potentially be used as markers of iron deficiency anaemia risk.

Coinheritance of hereditary spherocytosis and reversibility of cirrhosis in a young female patient with hereditary hemochromatosis.

Science.gov (United States)

Höblinger, A; Erdmann, C; Strassburg, C P; Sauerbruch, T; Lammert, F

2009-04-16

Here we report a 33-years-old woman with hereditary spherocytosis and hemochromatosis due to homozygosity for the C282Y mutation of the HFE gene. The coinheritance of both conditions led to severe iron overload and liver cirrhosis at young age. The patient was treated by repeated phlebotomy, and reversibility of cirrhosis was documented by transient elastography. This report discusses the pathophysiology of iron accumulation in patients with hemolytic anemia combined with HFE C282Y homozygosity. The case indicates that patients with hematological disorders characterized by increased erythropoetic activity should be screened for HFE mutations.

Arvelig hemokromatose - nytten av screening

Directory of Open Access Journals (Sweden)

Arne Åsberg

2009-10-01

Full Text Available Arvelig hemokromatose fører til jernopphopning i kroppen, men gir sjelden alvorlig helseskade. Nesten alle hemokromatosepasienter i vårt land er homozygote for C282Y-mutasjonen i HFE-genet. Omtrent 7 per 1000 innbyggere har denne genotypen. Alvorlig syke blir bare omkring 5-15% av homozygote menn og nesten ingen kvinner. Likevel er det holdepunkter for at screening for hemokromatose blant friske, yngre menn kan være kostnadseffektivt. Det er relativt lett å påvise om en person er disponert for sykdommen, i god tid før den bryter ut, og forebyggende behandling er billig og effektiv. Imidlertid kan vi ikke forutsi hvilke screeningpositive personer som ubehandlet får alvorlig sykdom. Et kontrollert forsøk med screening bør gjennomføresHereditary hemochromatosis – benefits of screening. Hereditary hemochromatosis leads to iron accumulation in the body; however, serious illness due to hemochromatosis is rare. In Norway, almost all patients with hemochromatosis are homozygous for the C282Ymutation in the HFE-gene, a genotype carried by about 7 per 1000 inhabitants. Serious complications are seen in only about 5-15% of homozygous men and in very few women. Nevertheless, screening young men for hemochromatosis may be cost-effective. Detecting predisposed men is relatively straightforward, and prophylactic treatment is cheap and effective. However, we can not predict, among screen-positive men, the few who untreated will become seriously ill. A controlled screening trial should be conducted.

HFE gene mutation and oxidative damage biomarkers in patients with myelodysplastic syndromes and its relation to transfusional iron overload: an observational cross-sectional study.

Science.gov (United States)

De Souza, Geane Felix; Ribeiro, Howard Lopes; De Sousa, Juliana Cordeiro; Heredia, Fabíola Fernandes; De Freitas, Rivelilson Mendes; Martins, Manoel Ricardo Alves; Gonçalves, Romélia Pinheiro; Pinheiro, Ronald Feitosa; Magalhães, Silvia Maria Meira

2015-04-03

A relation between transfusional IOL (iron overload), HFE status and oxidative damage was evaluated. An observational cross-sectional study involving 87 healthy individuals and 78 patients with myelodysplastic syndromes (MDS) with and without IOL, seen at University Hospital of the Federal University of Ceará, Brazil, between May 2010 and September 2011. IOL was defined using repeated measures of serum ferritin ≥1000 ng/mL. Variations in the HFE gene were investigated using PCR/restriction fragment length polymorphism (RFLP). The biomarkers of oxidative stress (plasmatic malonaldehyde (MDA), glutathione peroxidase (GPx) and superoxide dismutase (SOD)) were determined by spectrophotometry. The HFE gene variations were identified in 24 patients (30.77%) and 5 volunteers (5.74%). The H63D variant was observed in 35% and the C282Y variant as heterozygous in 5% of patients with MDS with IOL. One patient showed double heterozygous variant (C282Y/H63D) and serum ferritin of 11,649 ng/mL. In patients without IOL, the H63D variant was detected in 29.34%. Serum MDA levels were highest in patients with MDS with IOL, with a significant difference when compared with patients without IOL and healthy volunteers, pointing to the relationship between IOL and oxidative stress. The GPx and SOD were also significantly higher in these patients, indicating that lipid peroxidation increase was followed by an increase in antioxidant capacity. Higher ferritin levels were observed in patients with HFE gene variation. 95.7% of patients with MDS with the presence of HFE gene variations had received more of 20 transfusions. We observed a significant increase in MDA levels in patients with MDS and IOL, suggesting an increased lipid peroxidation in these patients. The accumulation of MDA alters the organisation of membrane phospholipids, contributing to the process of cellular degeneration. Results show that excess iron intensifies the process of cell damage through oxidative stress

Introduction of Molecular Diagnosis of Hemochromatosis Type 1 in Cuba

Directory of Open Access Journals (Sweden)

Ismael Aramís Cervera García

2013-06-01

Full Text Available Background: hemochromatosis type 1 is an autosomal recessive genetic disorder, which should be diagnosed during its preclinical phase in order to prevent severe organ damage. Objective: to establish the diagnosis of hemochromatosis type 1 in Cuba, and calculate its frequencies in patients with hepatopathies. Methods: an analytic cross-sectional study was conducted including 65 patients with liver disease, who were referred to the laboratory of Molecular Biology of the National Medical Genetics Center by clinical geneticists. A PCR-RFLP analysis was used for detecting the C282Y and H63D mutations in the HFE gene. Results: PCR-RFLP analysis was standardized for the detection of C282Y and H63D mutations. Frequencies of C282Y and H63D mutations in the HFE gene in patients with hepatopathies were 6.3% and 18.2% respectively. Conclusions: molecular diagnosis of C282Y and H63D mutations in the HFE gene causing hemochromatosis type 1 contributed to the identification of 28 carriers in the 65 patients who were studied, as well as a homozygous individual for the H63D mutation, which shows the high prevalence of these mutations in Cuban patients with liver disease.

Pathophysiological consequences and benefits of HFE mutations: 20 years of research

Science.gov (United States)

Hollerer, Ina; Bachmann, André; Muckenthaler, Martina U.

2017-01-01

Mutations in the HFE (hemochromatosis) gene cause hereditary hemochromatosis, an iron overload disorder that is hallmarked by excessive accumulation of iron in parenchymal organs. The HFE mutation p.Cys282Tyr is pathologically most relevant and occurs in the Caucasian population with a carrier frequency of up to 1 in 8 in specific European regions. Despite this high prevalence, the mutation causes a clinically relevant phenotype only in a minority of cases. In this review, we summarize historical facts and recent research findings about hereditary hemochromatosis, and outline the pathological consequences of the associated gene defects. In addition, we discuss potential advantages of HFE mutations in asymptomatic carriers. PMID:28280078

Best practice guidelines for the molecular genetic diagnosis of Type 1 (HFE-related hereditary haemochromatosis

Directory of Open Access Journals (Sweden)

Barton David E

2006-11-01

Full Text Available Abstract Background Hereditary haemochromatosis (HH is a recessively-inherited disorder of iron over-absorption prevalent in Caucasian populations. Affected individuals for Type 1 HH are usually either homozygous for a cysteine to tyrosine amino acid substitution at position 282 (C282Y of the HFE gene, or compound heterozygotes for C282Y and for a histidine to aspartic acid change at position 63 (H63D. Molecular genetic testing for these two mutations has become widespread in recent years. With diverse testing methods and reporting practices in use, there was a clear need for agreed guidelines for haemochromatosis genetic testing. The UK Clinical Molecular Genetics Society has elaborated a consensus process for the development of disease-specific best practice guidelines for genetic testing. Methods A survey of current practice in the molecular diagnosis of haemochromatosis was conducted. Based on the results of this survey, draft guidelines were prepared using the template developed by UK Clinical Molecular Genetics Society. A workshop was held to develop the draft into a consensus document. The consensus document was then posted on the Clinical Molecular Genetics Society website for broader consultation and amendment. Results Consensus or near-consensus was achieved on all points in the draft guidelines. The consensus and consultation processes worked well, and outstanding issues were documented in an appendix to the guidelines. Conclusion An agreed set of best practice guidelines were developed for diagnostic, predictive and carrier testing for hereditary haemochromatosis and for reporting the results of such testing.

HFE gene variants, iron, and lipids: a novel connection in Alzheimer's disease.

Science.gov (United States)

Ali-Rahmani, Fatima; Schengrund, Cara-Lynne; Connor, James R

2014-01-01

Iron accumulation and associated oxidative stress in the brain have been consistently found in several neurodegenerative diseases. Multiple genetic studies have been undertaken to try to identify a cause of neurodegenerative diseases but direct connections have been rare. In the iron field, variants in the HFE gene that give rise to a protein involved in cellular iron regulation, are associated with iron accumulation in multiple organs including the brain. There is also substantial epidemiological, genetic, and molecular evidence of disruption of cholesterol homeostasis in several neurodegenerative diseases, in particular Alzheimer's disease (AD). Despite the efforts that have been made to identify factors that can trigger the pathological events associated with neurodegenerative diseases they remain mostly unknown. Because molecular phenotypes such as oxidative stress, synaptic failure, neuronal loss, and cognitive decline, characteristics associated with AD, have been shown to result from disruption of a number of pathways, one can easily argue that the phenotype seen may not arise from a linear sequence of events. Therefore, a multi-targeted approach is needed to understand a complex disorder like AD. This can be achieved only when knowledge about interactions between the different pathways and the potential influence of environmental factors on them becomes available. Toward this end, this review discusses what is known about the roles and interactions of iron and cholesterol in neurodegenerative diseases. It highlights the effects of gene variants of HFE (H63D- and C282Y-HFE) on iron and cholesterol metabolism and how they may contribute to understanding the etiology of complex neurodegenerative diseases.

The influence of iron status and genetic polymorphisms in the HFE gene on the risk for postoperative complications after bariatric surgery: a prospective cohort study in 1,064 patients

Directory of Open Access Journals (Sweden)

Freedman-Weiss Mollie

2011-01-01

Full Text Available Abstract Background Gastric bypass surgery is a highly effective therapy for long-term weight loss in severely obese patients, but carries significant perioperative risks including infection, wound dehiscence, and leaks from staple breakdown. Iron status can affect immune function and wound healing, thus may influence peri-operative complications. Common mutations in the HFE gene, the gene responsible for the iron overload disorder hereditary hemochromatosis, may impact iron status. Methods We analyzed 1064 extremely obese Caucasian individuals who underwent open and laparoscopic Roux-n-Y gastric bypass surgery at the Geisinger Clinic. Serum iron, ferritin, transferrin, and iron binding capacity were measured pre-operatively. All patients had intra-operative liver biopsies and were genotyped for the C282Y and H63D mutations in the HFE gene. Associations between surgical complications and serum iron measures, HFE gene status, and liver iron histology were determined. Results We found that increased serum iron and transferrin saturation were present in patients with any post-operative complication, and that increased serum ferritin was also increased in patients with major complications. Increased serum transferrin saturation was also associated with wound complications in open RYGB, and transferrin saturation and ferritin with prolonged lengths of stay. The presence of 2 or more HFE mutations was associated with overall complications as well as wound complications in open RYGB. No differences were found in complication rates between those with stainable liver iron and those without. Conclusion Serum iron status and HFE genotype may be associated with complications following RYGB surgery in the extremely obese.

HFE gene variants, iron, and lipids: a novel connection in Alzheimer’s disease

Science.gov (United States)

Ali-Rahmani, Fatima; Schengrund, Cara-Lynne; Connor, James R.

2014-01-01

Iron accumulation and associated oxidative stress in the brain have been consistently found in several neurodegenerative diseases. Multiple genetic studies have been undertaken to try to identify a cause of neurodegenerative diseases but direct connections have been rare. In the iron field, variants in the HFE gene that give rise to a protein involved in cellular iron regulation, are associated with iron accumulation in multiple organs including the brain. There is also substantial epidemiological, genetic, and molecular evidence of disruption of cholesterol homeostasis in several neurodegenerative diseases, in particular Alzheimer’s disease (AD). Despite the efforts that have been made to identify factors that can trigger the pathological events associated with neurodegenerative diseases they remain mostly unknown. Because molecular phenotypes such as oxidative stress, synaptic failure, neuronal loss, and cognitive decline, characteristics associated with AD, have been shown to result from disruption of a number of pathways, one can easily argue that the phenotype seen may not arise from a linear sequence of events. Therefore, a multi-targeted approach is needed to understand a complex disorder like AD. This can be achieved only when knowledge about interactions between the different pathways and the potential influence of environmental factors on them becomes available. Toward this end, this review discusses what is known about the roles and interactions of iron and cholesterol in neurodegenerative diseases. It highlights the effects of gene variants of HFE (H63D- and C282Y-HFE) on iron and cholesterol metabolism and how they may contribute to understanding the etiology of complex neurodegenerative diseases. PMID:25071582

A novel homozygous stop-codon mutation in human HFE responsible for nonsense-mediated mRNA decay.

Science.gov (United States)

Padula, Maria Carmela; Martelli, Giuseppe; Larocca, Marilena; Rossano, Rocco; Olivieri, Attilio

2014-09-01

HFE-hemochromatosis (HH) is an autosomal disease characterized by excessive iron absorption. Homozygotes for H63D variant, and still less H63D heterozygotes, generally do not express HH phenotype. The data collected in our previous study in the province of Matera (Basilicata, Italy) underlined that some H63D carriers showed altered iron metabolism, without additional factors. In this study, we selected a cohort of 10/22 H63D carriers with severe biochemical iron overload (BIO). Additional analysis was performed for studying HFE exons, exon-intron boundaries, and untranslated regions (UTRs) by performing DNA extraction, PCR amplification and sequencing. The results showed a novel substitution (NM_000410.3:c.847C>T) in a patient exon 4 (GenBankJQ478433); it introduces a premature stop-codon (PTC). RNA extraction and reverse-transcription were also performed. Quantitative real-time PCR was carried out for verifying if our aberrant mRNA is targeted for nonsense-mediated mRNA decay (NMD); we observed that patient HFE mRNA was expressed much less than calibrator, suggesting that the mutated HFE protein cannot play its role in iron metabolism regulation, resulting in proband BIO. Our finding is the first evidence of a variation responsible for a PTC in iron cycle genes. The genotype-phenotype correlation observed in our cases could be related to the additional mutation. Copyright © 2014 Elsevier Inc. All rights reserved.

[Molecular genetic analysis and clinical aspects of patients with hereditary hemochromatosis].

Science.gov (United States)

Lange, U; Teichmann, J; Dischereit, G

2014-08-01

The purpose of the study was to perform a molecular genetic analysis and to document clinical aspects in patients with hereditary hemochromatosis. The study included 33 outpatients (23 males average age 50.6 years and 10 females average age 60.6 years) with a disorder of iron metabolism (transferrin saturation > 75 %) as confirmation of hemochromatosis who were subjected to molecular genetic and clinical analyses. A homozygous mutation of the hemochromatosis (HFE) gene (C282YY) was detected in 63.6 %, a compound heterozygous mutation (C282Y/H63D) in 30.3% and no mutation of the HFE gene was detected in 6.1 %. The following organ manifestations could be objectified: arthralgia (78.8 %), liver disease (39.9 %), skin hyperpigmentation (30.3 %), osteoporosis (24.2 %), diabetes mellitus (24.2 %) and cardiomyopathy (12.1 %). Comparison between patients with heterozygous and homozygous hemochromatosis revealed the following differences: compound heterozygote patients presented less frequently with osteoarthritis of the metacarpophalangeal (MCP) joints and hands (85.7 %/71.4 % homozygotes vs. 60 %/60 % heterozygotes). Osteoarthritis of the shoulder joints and osteoporosis as well as hypothyroidism were more frequent in compound heterozygote patients, whereas osteoarthritis of the knee and hip joints as well as liver disease were more common in homozygote patients. No differences between both groups were seen with respect to the clinical manifestations of cardiomyopathy and diabetes mellitus. Prevalent causes of death in hereditary hemochromatosis are heart failure, liver disease (cirrhosis and hepatocellular carcinoma) and portal hypertension. Therefore, an early diagnosis, adequate therapy and genetic screening of family members are of great importance. Medicinal treatment will only effectively prevent deleterious organ involvement and subsequent complications if initiated at an early stage. Furthermore, an overview of the current data is given.

The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic

OpenAIRE

Heath, Kathleen M.; Axton, Jacob H.; McCullough, John M.; Harris, Nathan

2016-01-01

ABSTRACT Objectives The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronut...

Mutaciones del gen de la Hemocromatosis en donantes de sangre voluntarios y en pacientes con Porfiria cutánea tarda en Chile Mutations of hemochromatosis gene in volunteer blood donors and Chilean porphyria cutanea tarda patients

Directory of Open Access Journals (Sweden)

Carlos Wolff F

2006-10-01

Full Text Available La acumulación de hierro hepático asociada a mutaciones en el gen HFE de la hemocromatosis hereditaria (HH en los pacientes con porfiria cutánea tarda (PCT podría tener un papel en la etiología y en la expresión clínica de esta enfermedad. Se estudió la frecuencia de las mutaciones H63D y C282Y en un grupo de pacientes con PCT y se la comparó con la observada en un grupo de donantes voluntarios de sangre. Los pacientes con PCT fueron catalogados como portadores de la forma hereditaria o adquirida de la enfermedad, según presentaran o no mutaciones en el gen uroporfirinógeno decarboxilasa (UROD. El 50% de los pacientes con PCT eran portadores de la forma genética de la enfermedad, porcentaje significativamente mayor que lo informado en otras series. El 23% de los donantes voluntarios de sangre eran portadores de la mutación H63D y 2.4% lo era de la mutación C282Y. Frecuencias similares a lo encontrado por otros autores en población chilena de etnia blanca, en población argentina y española, pero significativamente más alta que lo encontrado en estudios en población aborigen araucana. Esto tiene, probablemente, relación con el predominio de ascendencia española en la población blanca chilena. La frecuencia de mutación en el gen HFE en pacientes con PCT no fue significativamente diferente que la observada en donantes voluntarios de sangre. Tampoco hubo diferencias significativas en la frecuencia de estas mutaciones entre los casos con PCT adquirida respecto de aquellos en que ésta era de origen genético. Los resultados obtenidos no permiten afirmar que exista asociación entre la PCT y la condición de portador de mutaciones del gen HFE de la hemocromatosis hereditaria.In patients with porphyria cutanea tarda (PCT, hepatic iron accumulation associated to hereditary hemochromatosis (HH could play a role in the etiology and in the clinical expression of the disease. The H63D and C282Y mutations of the HFE gene frequency were

Visão atual da hemocromatose hereditária Current approach to hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

Rodolfo Delfini Cançado

2010-01-01

Full Text Available A hemocromatose hereditária (HH está relacionada a diversos distúrbios do metabolismo do ferro que ocasionam sua sobrecarga tecidual. A HH clássica está associada às mutações do gene HFE (homozigose para C282Y ou duplo heterozigose para C282Y/H63D, sendo encontrada quase exclusivamente em descendentes do norte Europeu. A hemocromatose hereditária, quando não relacionada ao gene HFE, é causada por mutações de outros genes, recentemente identificados, envolvidos no metabolismo do ferro. Hepcedina é o hormônio regulador do ferro que inibe a ferroportina, proteína exportadora de ferro dos enterócitos e dos macrófagos; um defeito na expressão do gene da hepcedina ou na sua função costuma ser a causa da maioria dos tipos de hemocromatose hereditária. Os alvos acometidos pela HH são órgãos e tecidos - fígado, coração, pâncreas, articulações e pele -, sendo a cirrose e o diabetes melito os sinais tardios da doença em pacientes com expressivo aumento da concentração hepática de ferro. Pacientes com diagnóstico estabelecido de hemocromatose hereditária e sobrecarga de ferro devem ser tratados com flebotomia para a obtenção de depleção do ferro do organismo; em seguida, com flebotomia de manutenção. As causas mais frequentes de morte por hemocromatose hereditária são câncer hepático, cirrose, miocardiopatia e diabete; entretanto, pacientes submetidos à depleção do ferro de maneira satisfatória e antes do desenvolvimento da cirrose ou da diabete podem ter sobrevida normal.Hereditary hemochromatosis refers to several inherited disorders of the iron metabolism that lead to tissue iron overload. Classical hereditary hemochromatosis is associated with mutations of the HFE gene (C282Y homozygotes or C282Y/H63D compound heterozygotes and is almost exclusively found in populations of northern European descent. Non-HFE-associated hereditary hemochromatosis is caused by mutations in other recently identified genes

Dicty_cDB: SLH282 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH282 (Link to dictyBase) - - - Contig-U10985-1 | Contig-U15908-1 SLH2...82P (Link to Original site) SLH282F 506 SLH282Z 455 SLH282P 961 - - Show SLH282 Library SL (Link to library) Clone ID SLH2...85-1 | Contig-U15908-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH2...82Q.Seq.d/ Representative seq. ID SLH282P (Link to Original site) Representative DNA sequence >SLH282 (SLH2...82Q) /CSM/SL/SLH2-D/SLH282Q.Seq.d/ GGTTTTTAAAACTATTGATACTGAAGAGAATGGAATTATATCAATAACACAATTAAGACA

Total and cause-specific mortality by elevated transferrin saturation and hemochromatosis genotype in individuals with diabetes - two general population studies

DEFF Research Database (Denmark)

Ellervik, Christina; Mandrup-Poulsen, Thomas; Tybjærg-Hansen, Anne

2013-01-01

ObjectiveMortality is increased in patients with hereditary hemochromatosis, in individuals from the general population with increased transferrin saturation(TS), and also in patients with diabetes type 1 and increased TS from a highly specialised diabetes clinic. Thus, we have recommended targeted...... and hemochromatosis genotype(HFE) C282Y/C282Y in individuals with diabetes(type 1,N=118;type 2,N=3228;total,N=3346).ResultsThe cumulative survival was reduced in individuals with diabetes with TS≥50% vs....

Transgenic HFE-dependent induction of hepcidin in mice does not require transferrin receptor-2.

Science.gov (United States)

Schmidt, Paul J; Fleming, Mark D

2012-06-01

Hereditary hemochomatosis (HH) is caused by mutations in several genes, including HFE and transferrin receptor-2 (TFR2). Loss of either protein decreases expression of the iron regulatory hormone hepcidin by the liver, leading to inappropriately high iron uptake from the diet, and resulting in systemic iron overload. In tissue culture, overexpressed HFE and TFR2 physically interact. Hepatocellular overexpression of Hfe in vivo increases hepcidin expression, despite an associated decrease in Tfr2. On this basis, we hypothesized that Tfr2 would not be required for Hfe-dependent up-regulation of hepcidin. We show that hepatocellular overexpression of Hfe in Tfr2(Y245X/Y245X) mice leads to hepcidin induction eventuating in iron deficiency and a hypochromic, microcytic anemia. Furthermore, coimmunoprecipitation studies using liver lysates did not provide evidence for physical interaction between Hfe and Tfr2 in vivo. In conclusion, we demonstrate that Tfr2 is not essential for Hfe-mediated induction of hepcidin expression, supporting the possibility that TFR2 may regulate iron metabolism in an HFE-independent manner. Copyright © 2012 Wiley Periodicals, Inc.

HLA haplotype map of river valley populations with hemochromatosis traced through five centuries in Central Sweden.

Science.gov (United States)

Olsson, K Sigvard; Ritter, Bernd; Hansson, Norbeth; Chowdhury, Ruma R

2008-07-01

The hemochromatosis mutation, C282Y of the HFE gene, seems to have originated from a single event which once occurred in a person living in the north west of Europe carrying human leukocyte antigen (HLA)-A3-B7. In descendants of this ancestor also other haplotypes appear probably caused by local recombinations and founder effects. The background of these associations is unknown. Isolated river valley populations may be fruitful for the mapping of genetic disorders such as hemochromatosis. In this study, we try to test this hypothesis in a study from central Sweden where the haplotyope A1-B8 was common. HLA haplotypes and HFE mutations were studied in hemochromatosis patients with present or past parental origin in a sparsely populated (1/km(2)) rural district (n = 8366 in the year of 2005), in central Sweden. Pedigrees were constructed from the Swedish church book registry. Extended haplotypes were studied to evaluate origin of recombinations. There were 87 original probands, 36 females and 51 males identified during 30 yr, of whom 86% carried C282Y/C282Y and 14% C282Y/H63D. Of 32 different HLA haplotypes A1-B8 was the most common (34%), followed by A3-B7 (16%), both in strong linkage disequilibrium with controls, (P females. River valley populations may contain HLA haplotypes reflecting their demographic history. This study has demonstrated that the resistance against recombinations between HLA-A and HFE make HLA haplotypes excellent markers for population movements. Founder effects and genetic drift from bottleneck populations (surviving the plague?) may explain the commonness of the mutation in central Scandinavia. The intergenerational time difference >30 yr was greater than expected and means that the age of the original mutation may be underestimated.

Ethnic and genetic factors of iron status in women of reproductive age.

Science.gov (United States)

Gordeuk, Victor R; Brannon, Patsy M

2017-12-01

Background: African Americans are at increased risk of iron deficiency (ID) but also have higher serum ferritin (SF) concentrations than those of the general population. The Hemochromatosis and Iron Overload Screening (HEIRS) Study was a multicenter study of ethnically diverse participants that tested for the hemochromatosis ( HFE ) C282Y genotype and iron status. Objective: We sought to determine the prevalence and predictors of ID (SF concentration ≤15 μg/L) and elevated iron stores (SF concentration >300 μg/L) in HEIRS women of reproductive age (25-44 y). Design: The HEIRS Study was a cross-sectional study of iron status and HFE mutations in primary care patients at 5 centers in the United States and Canada. We analyzed data for women of reproductive age according to whether or not they were pregnant or breastfeeding at the time of the study. Results: ID was present in 12.5% of 20,080 nonpregnant and nonbreastfeeding women compared with 19.2% of 1962 pregnant or breastfeeding women ( P iron stores were shown in 1.7% of nonpregnant and nonbreastfeeding women compared with 0.7% of pregnant or breastfeeding women ( P = 0.001). HFE C282Y homozygosity had the most marked independent association with elevated iron stores in nonpregnant and nonbreastfeeding women and in pregnant or breastfeeding women (OR >49.0; P iron stores in both groups of women (OR >2.0; P iron stores in nonpregnant and nonbreastfeeding women. Conclusions: Both ID and elevated iron stores are present in women of reproductive age and are influenced by ethnicity and HFE C282Y. Efforts to optimize iron status should keep these findings in view. This study was registered at clinicaltrials.gov as NCT03276247. © 2017 American Society for Nutrition.

Frekvensen af haemokromatoseassocierede mutationer i haemokromatosegenet i den danske befolkning. ØsterbroundersØgelsen

DEFF Research Database (Denmark)

Larsen, Lisbeth Enggaard; Ellervik, Christina; Appleyard, Merete

2002-01-01

INTRODUCTION: Hereditary haemochromatosis is an autosomal recessive condition characterised by systemic iron overload. In Northern Europe, 85-90% of patients with haemochromatosis are homozygous for the C282Y mutation in the HFE gene. In the present study, we determined the prevalence...

Risk factors for development of dementia in a unique six-year cohort study. I. An exploratory, pilot study of involvement of the E4 allele of apolipoprotein E, mutations of the hemochromatosis-HFE gene, type 2 diabetes, and stroke.

Science.gov (United States)

Percy, Maire; Somerville, Martin J; Hicks, Mark; Garcia, Angeles; Colelli, Teresa; Wright, Emily; Kitaygorodsky, Julia; Jiang, Amy; Ho, Valerie; Parpia, Alyssa; Wong, Michael K

2014-01-01

Risk factors for dementia development are not well-defined. We evaluated several factors alone and in combination in a unique cohort of Caucasian volunteers over an approximately 6-year observation window using a nested case/control design. Factors included: apolipoprotein E (ApoE) gene variants (the E4 allele is the strongest confirmed genetic predisposing factor for Alzheimer's disease), the hemochromatosis-HFE gene mutations (H63D and C282Y), diabetes, and stroke. At study entry, subjects were ≥65 years of age (M ± SD = 73.0 ± 4.9), had an MMSE score ≥24, and no evidence of cerebrovascular disease or current depression. Genotyping was completed on 163 available DNA samples from three different groups at the study end: those who still had normal cognitive function; those who had developed dementia; and those with Mild Cognitive Impairment (MCI). Analyses were interpreted at the 95% confidence level without Bonferroni corrections. In the subgroup with dementia, all cases of diabetes were type 2 and present at study entry, whereas all strokes occurred during the study. The results highlight apparently synergistic interactions between genetic and medical risk factors for dementia development, gender differences in risk factors, and involvement of HFE mutations. Having E4 (i.e., either of E3/4 or E4/4), C282Y, H63D, diabetes, or stroke alone did not attain significance. Significant predisposing factors with post-hoc power ≥80% were: E4 homozygosity (E4/4)males+females, odds ratio (OR) = 56.0); E4+diabetes (males+females, OR = 13.7; E4+H63D+diabetes (females, OR = 52.0); E4+stroke (males, OR = 46.5). The importance of preventing diabetes and stroke to ward off dementia and the possible role of iron dysmetabolism in dementia are discussed.

Mild iron overload in patients carrying the HFE S65C gene mutation: a retrospective study in patients with suspected iron overload and healthy controls

OpenAIRE

Holmström, P; Marmur, J; Eggertsen, G; Gåfvels, M; Stål, P

2002-01-01

Background and aims: The role of the HFE S65C mutation in the development of hepatic iron overload is unknown. The aim of the present study was: (A) to determine the HFE S65C frequency in a Northern European population; and (B) to evaluate whether the presence of the HFE S65C mutation would result in a significant hepatic iron overload.

Associations of iron metabolism genes with blood manganese levels: a population-based study with validation data from animal models

Directory of Open Access Journals (Sweden)

Claus Henn Birgit

2011-11-01

Full Text Available Abstract Background Given mounting evidence for adverse effects from excess manganese exposure, it is critical to understand host factors, such as genetics, that affect manganese metabolism. Methods Archived blood samples, collected from 332 Mexican women at delivery, were analyzed for manganese. We evaluated associations of manganese with functional variants in three candidate iron metabolism genes: HFE [hemochromatosis], TF [transferrin], and ALAD [δ-aminolevulinic acid dehydratase]. We used a knockout mouse model to parallel our significant results as a novel method of validating the observed associations between genotype and blood manganese in our epidemiologic data. Results Percentage of participants carrying at least one copy of HFE C282Y, HFE H63D, TF P570S, and ALAD K59N variant alleles was 2.4%, 17.7%, 20.1%, and 6.4%, respectively. Percentage carrying at least one copy of either C282Y or H63D allele in HFE gene was 19.6%. Geometric mean (geometric standard deviation manganese concentrations were 17.0 (1.5 μg/l. Women with any HFE variant allele had 12% lower blood manganese concentrations than women with no variant alleles (β = -0.12 [95% CI = -0.23 to -0.01]. TF and ALAD variants were not significant predictors of blood manganese. In animal models, Hfe-/- mice displayed a significant reduction in blood manganese compared with Hfe+/+ mice, replicating the altered manganese metabolism found in our human research. Conclusions Our study suggests that genetic variants in iron metabolism genes may contribute to variability in manganese exposure by affecting manganese absorption, distribution, or excretion. Genetic background may be critical to consider in studies that rely on environmental manganese measurements.

Molecular basis of HFE-hemochromatosis

Directory of Open Access Journals (Sweden)

Maja eVujic Spasic

2014-03-01

Full Text Available Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH. The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-hemochromatosis as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorption from the diet and iron deposition in tissues causing multiple organ damage and failure. This review focuses on the molecular actions of the HFE/Hfe and hepcidin in maintaining systemic iron homeostasis and approaches undertaken so far to combat iron overload in HFE/Hfe-HH. In the light of the recent investigations, novel roles of extra-hepatocytic Hfe are discussed raising a question to the relevance of the multipurpose functions of Hfe for the understanding of HH associated pathologies.

Molecular basis of HFE-hemochromatosis.

Science.gov (United States)

Vujić, Maja

2014-01-01

Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH). The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-HH as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorption from the diet and iron deposition in tissues causing multiple organ damage and failure. This review focuses on the molecular actions of the HFE/Hfe and hepcidin in maintaining systemic iron homeostasis and approaches undertaken so far to combat iron overload in HFE/Hfe-HH. In the light of the recent investigations, novel roles of extra-hepatocytic Hfe are discussed raising a question to the relevance of the multipurpose functions of Hfe for the understanding of HH-associated pathologies.

PREDICTION OF THE SPECTROSCOPIC PARAMETERS OF NEW IRON COMPOUNDS: HYDRIDE OF IRON CYANIDE/ISOCYANIDE, HFeCN/HFeNC

Energy Technology Data Exchange (ETDEWEB)

Redondo, Pilar; Barrientos, Carmen; Largo, Antonio, E-mail: predondo@qf.uva.es [Departamento de Química Física y Química Inorgánica Facultad de Ciencias, Universidad de Valladolid Campus Miguel Delibes Paseo de Belén 7, E-47011, Valladolid (Spain)

2016-09-01

Iron is the most abundant transition metal in space. Its abundance is similar to that of magnesium, and until today only, FeO and FeCN have been detected. However, magnesium-bearing compounds such as MgCN, MgNC, and HMgNC are found in IRC+10216. It seems that the hydrides of iron cyanide/isocyanide could be good candidates to be present in space. In the present work we carried out a characterization of the different minima on the quintet and triplet [C, Fe, H, N] potential energy surfaces, employing several theoretical approaches. The most stable isomers are predicted to be hydride of iron cyanide HFeCN, and isocyanide HFeNC, in their {sup 5}Δ states. Both isomers are found to be quasi-isoenergetics. The HFeNC isomer is predicted to lie about 0.5 kcal/mol below HFeCN. The barrier for the interconversion process is estimated to be around 6.0 kcal/mol, making this process unfeasible under low temperature conditions, such as those in the interstellar medium. Therefore, both HFeCN and HFeNC could be candidates for their detection. We report geometrical parameters, vibrational frequencies, and rotational constants that could help with their experimental characterization.

PREDICTION OF THE SPECTROSCOPIC PARAMETERS OF NEW IRON COMPOUNDS: HYDRIDE OF IRON CYANIDE/ISOCYANIDE, HFeCN/HFeNC

International Nuclear Information System (INIS)

Redondo, Pilar; Barrientos, Carmen; Largo, Antonio

2016-01-01

Iron is the most abundant transition metal in space. Its abundance is similar to that of magnesium, and until today only, FeO and FeCN have been detected. However, magnesium-bearing compounds such as MgCN, MgNC, and HMgNC are found in IRC+10216. It seems that the hydrides of iron cyanide/isocyanide could be good candidates to be present in space. In the present work we carried out a characterization of the different minima on the quintet and triplet [C, Fe, H, N] potential energy surfaces, employing several theoretical approaches. The most stable isomers are predicted to be hydride of iron cyanide HFeCN, and isocyanide HFeNC, in their 5 Δ states. Both isomers are found to be quasi-isoenergetics. The HFeNC isomer is predicted to lie about 0.5 kcal/mol below HFeCN. The barrier for the interconversion process is estimated to be around 6.0 kcal/mol, making this process unfeasible under low temperature conditions, such as those in the interstellar medium. Therefore, both HFeCN and HFeNC could be candidates for their detection. We report geometrical parameters, vibrational frequencies, and rotational constants that could help with their experimental characterization.

Hereditäre Hämochromatose : molekulargenetische Analyse und klinische Aspekte

OpenAIRE

Bayindir, Özlem

2009-01-01

In der vorliegenden Arbeit galt das Interesse Patienten aus der rheumatologischen Ambulanz der Kerckhoff-Klinik, die durch eine Störung des Eisenstoffwechsels auffielen und u. a. eine erhöhte Transferrin-Sättigung (Männer > 60 %, Frauen > 50 %) boten. Insgesamt wurden 33 Patienten (23 Männer, Durchschnittsalter 50,6 Jahre; 10 Frauen, Durchschnittsalter 60,6 Jahre) untersucht. Bei der molekulargenetischen Analyse waren 63,6 % homozygote Anlagenträger (282YY) für das HFE-Gen, eine sog. Compou...

Gender and plasma iron biomarkers, but not HFE gene mutations, increase the risk of colorectal cancer and polyps.

Science.gov (United States)

Castiella, Agustin; Múgica, Fernando; Zapata, Eva; Zubiaurre, Leire; Iribarren, Arantxa; de Juan, M Dolores; Alzate, Luis; Gil, Ines; Urdapilleta, Gregorio; Otazua, Pedro; Emparanza, José Ignacio

2015-09-01

A cohort study of patients included in the Basque Country colorectal cancer (CRC) screening programme was carried out to assess the risk of adenomatous polyps and CRC (P-CRC) associated with HFE gene mutations, with gender and with iron biomarkers (serum ferritin (SF), iron (Fe) and transferrin saturation index (TSI)). Among 432 included patients (mean age 59.8 years), 263 were men (60.9 %) and 169 women (39.1 %). P-CRC were identified in 221 patients (51.2 %) and no polyps (NP) in 211 patients (48.8 %). HFE mutations were identified in 43.8 % of the patients. C282Y/wt genotypic frequency was 6.8 % in the P-CRC group and 1.4 % in the NP group (p < 0.05). The allelic frequency was 3.8 versus 1.2 % (p < 0.05). For laboratory, all three iron biomarkers showed a statistically significant difference: mean Fe, 91.29 ± 34 for P-CRC and 80.81 ± 30.59 for NP group. Mean TSI for P-CRC was 24.95 ± 8.90 and 22.74 ± 8.79 for NP group. Mean SF 308.09 ± 536.32 for P-CRC and 177.55 ± 159.95 for NP group. In a multivariate logistic regression analysis, only male gender (odds ratio (OR) = 2.04, 1.29-3.22), SF (OR = 1.001, 1.0004-1.003) and Fe (OR = 1.01, 1.004-1.02) were related with the presence of CRC and adenoma. Men gender and raised serum iron biomarkers increase the risk of P-CRC.

Haemochromatosis gene mutation H63D is a risk factor for iron ...

African Journals Online (AJOL)

Introduction: Iron overload is the main cause of morbidity and mortality in patients with β-thalassemia. The Aim: The aim of this study was to evaluate the prevalence of genetic markers (HFE mutations C282Y and H63D) among Egyptian β-thalassemic. Children and its effect on their iron status. Patients and Methods: 59 ...

Influence of Diet, Menstruation and Genetic Factors on Iron Status: A Cross-Sectional Study in Spanish Women of Childbearing Age

Directory of Open Access Journals (Sweden)

Ruth Blanco-Rojo

2014-03-01

Full Text Available The aim of this study was to investigate the combined influence of diet, menstruation and genetic factors on iron status in Spanish menstruating women (n = 142. Dietary intake was assessed by a 72-h detailed dietary report and menstrual blood loss by a questionnaire, to determine a Menstrual Blood Loss Coefficient (MBLC. Five selected SNPs were genotyped: rs3811647, rs1799852 (Tf gene; rs1375515 (CACNA2D3 gene; and rs1800562 and rs1799945 (HFE gene, mutations C282Y and H63D, respectively. Iron biomarkers were determined and cluster analysis was performed. Differences among clusters in dietary intake, menstrual blood loss parameters and genotype frequencies distribution were studied. A categorical regression was performed to identify factors associated with cluster belonging. Three clusters were identified: women with poor iron status close to developing iron deficiency anemia (Cluster 1, n = 26; women with mild iron deficiency (Cluster 2, n = 59 and women with normal iron status (Cluster 3, n = 57. Three independent factors, red meat consumption, MBLC and mutation C282Y, were included in the model that better explained cluster belonging (R2 = 0.142, p < 0.001. In conclusion, the combination of high red meat consumption, low menstrual blood loss and the HFE C282Y mutation may protect from iron deficiency in women of childbearing age. These findings could be useful to implement adequate strategies to prevent iron deficiency anemia.

Influence of diet, menstruation and genetic factors on iron status: a cross-sectional study in Spanish women of childbearing age.

Science.gov (United States)

Blanco-Rojo, Ruth; Toxqui, Laura; López-Parra, Ana M; Baeza-Richer, Carlos; Pérez-Granados, Ana M; Arroyo-Pardo, Eduardo; Vaquero, M Pilar

2014-03-06

The aim of this study was to investigate the combined influence of diet, menstruation and genetic factors on iron status in Spanish menstruating women (n = 142). Dietary intake was assessed by a 72-h detailed dietary report and menstrual blood loss by a questionnaire, to determine a Menstrual Blood Loss Coefficient (MBLC). Five selected SNPs were genotyped: rs3811647, rs1799852 (Tf gene); rs1375515 (CACNA2D3 gene); and rs1800562 and rs1799945 (HFE gene, mutations C282Y and H63D, respectively). Iron biomarkers were determined and cluster analysis was performed. Differences among clusters in dietary intake, menstrual blood loss parameters and genotype frequencies distribution were studied. A categorical regression was performed to identify factors associated with cluster belonging. Three clusters were identified: women with poor iron status close to developing iron deficiency anemia (Cluster 1, n = 26); women with mild iron deficiency (Cluster 2, n = 59) and women with normal iron status (Cluster 3, n = 57). Three independent factors, red meat consumption, MBLC and mutation C282Y, were included in the model that better explained cluster belonging (R2 = 0.142, p < 0.001). In conclusion, the combination of high red meat consumption, low menstrual blood loss and the HFE C282Y mutation may protect from iron deficiency in women of childbearing age. These findings could be useful to implement adequate strategies to prevent iron deficiency anemia.

Prevalence of the N-Acetyltransferase (NAT2 gene polymorphism 282C>T in Peruvian population and health implications

Directory of Open Access Journals (Sweden)

Salazar-Granara Alberto

2016-03-01

Full Text Available Objective: To determine the frequency of the C282T polymorphism of the NAT2 gene (N acetyltransferase in Peruvian populations. Field work, focused on exploring genetic risk factor in Peruvian populations, which has influence in the response to drugs and malignancies aetiology. Material and Methods: Cross-sectional study. 166 voluntaries from Lima, Lambayeque, Apurimac, Puno, San Martin, Amazonas and Loreto were enrolled. The sampling was done by convenience and it was use the RFLP-PCR conventional technique was used. Results: The allele frequency were 54% (n=126 for C282 and 46% (n=106 for T282. For the T allele, by its orign , stand out 2 those which origins were Lima 42% (n=25, Amazonas 47% (n=16, San Martin 74% (n=28 and Apurimac 50% (n=13 (X , p>0.05. A global genotype frequency were 26.7% (n=31 for C282/C282, 56.0% (n=65 for C282/T282 and 17.2% (n=20 for T282/T282 (Hardy Weinberg Test p>0.05. By origin, Puno presented allelic imbalance (Hardy Weinberg test p0.05. Conclusion: The overall frequency of NAT2 allele T282 was 46%; San Martin had the highest prevalence (74%. The T282 allele is linked to neoplastic diseases and adverse reactions to anti-TB drugs, these results will be used for the application of pharmacogenetics in Peru

HFE and Spherical Cryostats MC Study

International Nuclear Information System (INIS)

Brodsky, Jason P.

2016-01-01

The copper vessel containing the nEXO TPC is surrounded by a buffer of HFE, a liquid refrigerant with very low levels of radioactive element contamination. The HFE is contained within the cryostat's inner vessel, which is in turn inside the outer vessel. While some HFE may be necessary for stable cooling of nEXO, it is possible that using substantially more than necessary for thermal reasons will help reduce backgrounds originating in the cryostats. Using a larger amount of HFE is accomplished by making the cryostat vessels larger. By itself, increasing the cryostat size somewhat increases the background rate, as the thickness of the cryostat wall must increase at larger sizes. However, the additional space inside the cryostat will be filled with HFE which can absorb gamma rays headed for the TPC. As a result, increasing the HFE reduces the number of backgrounds reaching the TPC. The aim of this study was to determine the relationship between HFE thickness and background rate. Ultimately, this work should support choosing a cryostat and HFE size that satisfies nEXO's background budget. I have attempted to account for every consequence of changing the cryostat size, although naturally this remains a work in progress until a final design is achieved. At the moment, the scope of the study includes only the spherical cryostat design. This study concludes that increasing cryostat size reduces backgrounds, reaching neglible backgrounds originating from the cryostat at the largest sizes. It also shows that backgrounds originating from the inherent radioactivity of the HFE plateau quickly, so may be considered essentially fixed at any quantity of HFE.

Autoimmune Conditions in 235 Hemochromatosis Probands with HFE C282Y Homozygosity and Their First-Degree Relatives

Directory of Open Access Journals (Sweden)

James C. Barton

2015-01-01

Full Text Available We performed a retrospective study of autoimmune conditions (ACs in 235 hemochromatosis probands at diagnosis by analyzing age, sex, ACs, history of first-degree family members with ACs (FH, diabetes, heavy ethanol consumption, elevated serum ALT/AST, nonalcoholic fatty liver disease, viral hepatitis, cirrhosis, iron removed to achieve iron depletion (QFe, and positivity for human leukocyte antigen (HLA haplotypes A∗01, B∗08; A∗02, B∗44; A∗03, B∗07; A∗03, B∗14; and A∗29, B∗44. There were 138 men (58.7%. Median followup was 19.6 y. One or more of 19 ACs were diagnosed in each of 35 probands (14.9%. Prevalences of Hashimoto’s thyroiditis, rheumatoid arthritis, and ankylosing spondylitis were 8.1% (95% CI: [5.1, 12.5], 1.7% [0.6, 4.6], and 0.0085 [0.0015, 0.0337], respectively. Eighteen probands (7.7% had a FH. Eight probands with ACs had 9 family members with ACs. In a logistic regression, ACs were less likely in men (odds ratio (OR 0.3 [0.1, 0.6] and more likely in probands with a FH (OR 4.1 [1.4, 11.8]. Overall ACs risk was not significantly associated with QFe or HLA haplotypes. Estimated survival of probands with and without ACs did not differ significantly. We conclude that ACs are common in hemochromatosis probands, especially women and probands with a FH.

HFE gene: Structure, function, mutations, and associated iron abnormalities.

Science.gov (United States)

Barton, James C; Edwards, Corwin Q; Acton, Ronald T

2015-12-15

The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.

Association of mutations in the hemochromatosis gene with shorter life expectancy

DEFF Research Database (Denmark)

Bathum, L; Christiansen, L; Nybo, H

2001-01-01

BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

MTHFR and HFE, but not preproghrelin and LBP, polymorphisms as risk factors for all-cause end-stage renal disease development.

Science.gov (United States)

Bloudíčková, S; Kuthanová, L; Hubáček, J A

2014-01-01

End-stage renal disease (ESRD) is a serious health problem worldwide. The high prevalence of cardiovascular diseases and chronic inflammation remains a major cause of morbidity and mortality in haemodialysed patients. Beside some external factors, genetic predisposition both to renal failure and poor prognosis has been assumed. We have collected a total of 1,014 haemodialysed patients and 2,559 unrelated healthy Caucasians. Single-nucleotide polymorphisms (SNPs) in genes for preproghrelin (GHRL), lipopolysaccharide-binding protein (LBP), HFE and MTHFR were genotyped. In the group of patients, significantly more carriers presented the MTHFR T667T (P = 0.002) and HFE Asp63Asp (P = 0.001) and Cys282Cys (P = 0.01) genotypes. The frequencies of individual SNPs within GHRL and LBP genes did not differ between the patients and controls. The trends in genotype frequencies did not differ between the subgroups of patients with different time on haemodialysis. Common variants in MTHFR and HFE could be a risk factor for all-cause ESRD development, but are not predictors for the survival on haemodialysis.

Effects of strain and age on hepatic gene expression profiles in murine models of HFE-associated hereditary hemochromatosis.

Science.gov (United States)

Lee, Seung-Min; Loguinov, Alexandre; Fleming, Robert E; Vulpe, Christopher D

2015-01-01

Hereditary hemochromatosis is an iron overload disorder most commonly caused by a defect in the HFE gene. While the genetic defect is highly prevalent, the majority of individuals do not develop clinically significant iron overload, suggesting the importance of genetic modifiers. Murine hfe knockout models have demonstrated that strain background has a strong effect on the severity of iron loading. We noted that hepatic iron loading in hfe-/- mice occurs primarily over the first postnatal weeks (loading phase) followed by a timeframe of relatively static iron concentrations (plateau phase). We thus evaluated the effects of background strain and of age on hepatic gene expression in Hfe knockout mice (hfe-/-). Hepatic gene expression profiles were examined using cDNA microarrays in 4- and 8-week-old hfe-/- and wild-type mice on two different genetic backgrounds, C57BL/6J (C57) and AKR/J (AKR). Genes differentially regulated in all hfe-/- mice groups, compared with wild-type mice, including those involved in cell survival, stress and damage responses and lipid metabolism. AKR strain-specific changes in lipid metabolism genes and C57 strain-specific changes in cell adhesion and extracellular matrix protein genes were detected in hfe-/- mice. Mouse strain and age are each significantly associated with hepatic gene expression profiles in hfe-/- mice. These affects may underlie or reflect differences in iron loading in these mice.

The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Mohammad Soleiman Soltanpour

2018-01-01

Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

Molecular basis of HFE-hemochromatosis

OpenAIRE

Vujić, Maja

2014-01-01

Iron-overload disorders owing to genetic misregulation of iron acquisition are referred to as hereditary hemochromatosis (HH). The most prevalent genetic iron overload disorder in Caucasians is caused by mutations in the HFE gene, an atypical MHC class I molecule. Recent studies classified HFE/Hfe-hemochromatosis as a liver disease with the primarily failure in the production of the liver iron hormone hepcidin in hepatocytes. Inadequate hepcidin expression signals for excessive iron absorptio...

Liquid density of HFE-7200 and HFE-7500 from T = (283 to 363) K at pressures up to 100 MPa

International Nuclear Information System (INIS)

Fang, Dan; Li, Ying; Meng, Xianyang; Wu, Jiangtao

2014-01-01

Highlights: • Liquid densities are reported for HFE-7200 and HFE-7500 at temperatures from (283 to 363) K, pressures up to 100 MPa. • The expanded uncertainty (k = 2) of density measurement for HFE-7200 and HFE-7500 were 0.04% and 0.03%, respectively. • Modified Tait equations were correlated with the experimental data. • The isobaric thermal expansivity and isothermal compressibility of HFE-7200 and HFE-7500 were calculated. -- Abstract: The liquid densities of HFE-7200 (1-ethoxy-1,1,2,2,3,3,4,4,4-nonafluorobutane, CAS Registry Number: 163702-05-4) and HFE-7500 (3-ethoxyperfluoro(2-methylhexane), CAS Registry Number: 297730-93-9) have been measured over the temperature range from (283 to 363) K and pressures up to 100 MPa by using a high pressure vibrating-tube densimeter. R134a has been used as a reference fluid to validate the densimeter. The uncertainty of each obtained datum was estimated, and the maximum expanded uncertainty with a level of confidence of 0.95 (k = 2) of density measurement for HFE-7200 and HFE-7500 were 0.04% and 0.03%, respectively. The measured liquid densities were correlated with the modified Tait equation and the maximum deviation is less than 0.03%. The isothermal compressibility and isobaric thermal expansivity were also calculated

Haplotype analysis of the HFE gene among populations of Northern Eurasia, in patients with metabolic disorders or stomach cancer, and in long-lived people.

Science.gov (United States)

Mikhailova, S V; Babenko, V N; Ivanoshchuk, D E; Gubina, M A; Maksimov, V N; Solovjova, I G; Voevoda, M I

2016-06-17

Previously, it was shown that the HFE gene (associated with human hereditary hemochromatosis) has several haplotypes of intronic polymorphisms. Some haplotype frequencies are race specific and hence can be used in phylogenetic analysis. We assumed that analysis of Caucasoid patients-living now in Western Siberia and having diseases associated with dietary habits and metabolic rate-will allow us to understand the processes of possible selection during settling of the northern part of Asia. Haplotype analysis of Northern Eurasian native and recently settled ethnic groups was performed on polymorphisms rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, rs1572982, rs2794719, rs807209, and rs2032451 of this gene. The CCA haplotype of the rs2071303, rs1800708, and rs1572982 was found to be associated with HLA-A2 (39 %) in Asian populations. Haplotype analysis for the rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, and rs1572982 was performed on Russian patients with some metabolic disorders or stomach cancer and among long-lived people. Decreased frequencies of the TTA haplotype (T in rs2071303, T in rs1800708, and A in rs1572982) were observed in the groups of patients with diseases associated with overweight (fatty liver disease, type 2 diabetes mellitus, or metabolic syndrome + arterial hypertension) as compared with the control sample. We detected significant differences in this haplotype's frequency between the patients with type 2 diabetes mellitus and Russian adolescents, elderly citizens, and long-lived people (χ(2) P value = 0.003, 0.010, and 0.015, respectively). No significant differences in frequencies of the alleles with mutations in coding regions of the HFE gene (C282Y, H63D, and S65C) were detected between the analyzed patients (with stomach cancer, metabolic syndrome, fatty liver disease, or type 2 diabetes mellitus) and the control Caucasoid sample. Monophyletic origin of H63D (rs1799945) was confirmed in Caucasoids and Northern

HJV and HFE Play Distinct Roles in Regulating Hepcidin.

Science.gov (United States)

Wu, Qian; Wang, Hao; An, Peng; Tao, Yunlong; Deng, Jiali; Zhang, Zhuzhen; Shen, Yuanyuan; Chen, Caiyong; Min, Junxia; Wang, Fudi

2015-05-20

Hereditary hemochromatosis (HH) is an iron overload disease that is caused by mutations in HFE, HJV, and several other genes. However, whether HFE-HH and HJV-HH share a common pathway via hepcidin regulation is currently unclear. Recently, some HH patients have been reported to carry concurrent mutations in both the HFE and HJV genes. To dissect the roles and molecular mechanisms of HFE and/or HJV in the pathogenesis of HH, we studied Hfe(-/-), Hjv(-/-), and Hfe(-/-)Hjv(-/-) double-knockout mouse models. Hfe(-/-)Hjv(-/-) mice developed iron overload in multiple organs at levels comparable to Hjv(-/-) mice. After an acute delivery of iron, the expression of hepcidin (i.e., Hamp1 mRNA) was increased in the livers of wild-type and Hfe(-/-) mice, but not in either Hjv(-/-) or Hfe(-/-)Hjv(-/-) mice. Furthermore, iron-induced phosphorylation of Smad1/5/8 was not detected in the livers of Hjv(-/-) or Hfe(-/-)Hjv(-/-) mice. We generated and phenotypically characterized Hfe(-/-)Hjv(-/-) double-knockout mice. In addition, because they faithfully phenocopy clinical HH patients, these mouse models are an invaluable tool for mechanistically dissecting how HFE and HJV regulate hepcidin expression. Based on our results, we conclude that HFE may depend on HJV for transferrin-dependent hepcidin regulation. The presence of residual hepcidin in the absence of HFE suggests either the presence of an unknown regulator (e.g., TFR2) that is synergistic with HJV or that HJV is sufficient to maintain basal levels of hepcidin.

Liver steatosis correlates with iron overload but not with HFE gene mutations in chronic hepatitis C.

Science.gov (United States)

Sikorska, Katarzyna; Stalke, Piotr; Romanowski, Tomasz; Rzepko, Robert; Bielawski, Krzysztof Piotr

2013-08-01

Liver steatosis and iron overload, which are frequently observed in chronic hepatitis C (CHC), may contribute to the progression of liver injury. This study aimed to evaluate the correlation between liver steatosis and iron overload in Polish patients with CHC compared to non-alcoholic fatty liver disease (NAFLD) and HFE-hereditary hemochromatosis (HH) patients. A total of 191 CHC patients were compared with 67 NAFLD and 21 HH patients. Liver function tests, serum markers of iron metabolism, cholesterol and triglycerides were assayed. The inflammatory activity, fibrosis, iron deposits and steatosis stages were assessed in liver specimens. HFE gene polymorphisms were investigated by PCR-RFLP. Liver steatosis was associated with obesity and diabetes mellitus. This disease was confirmed in 76/174 (44%) CHC patients, most of whom were infected with genotype 1. The average grade of steatosis was higher in NAFLD patients. CHC patients had significantly higher iron concentrations and transferrin saturations than NAFLD patients. Compared with CHC patients, HH patients had higher values of serum iron parameters and more intensive hepatocyte iron deposits without differences in the prevalence and intensity of liver steatosis. In the CHC group, lipids accumulation in hepatocytes was significantly associated with the presence of serum markers of iron overload. No correlation between the HFE gene polymorphism and liver steatosis in CHC patients was found. Liver steatosis was diagnosed in nearly half of CHC patients, most of whom were infected with genotype 1. The intensity of steatosis was lower in CHC patients than that in NAFLD patients because of a less frequent diagnosis of metabolic syndrome. Only in CHC patients were biochemical markers of iron accumulation positively correlated with liver steatosis; these findings were independent of HFE gene mutations.

Risk of iron overload in carriers of genetic mutations associated with hereditary haemochromatosis: UK Food Standards Agency workshop.

Science.gov (United States)

Singh, Mamta; Ashwell, Margaret; Sanderson, Peter; Cade, Janet; Moreton, Jennifer; Fairweather-Tait, Susan; Roe, Mark; Marx, Joannes J M; Worwood, Mark; Cook, James D

2006-10-01

The UK Food Standards Agency convened a group of expert scientists to review current research investigating diet and carriers of genetic mutations associated with hereditary haemochromatosis. The workshop concluded that individuals who are heterozygous for the C282Y mutation of the HFE gene do not appear to respond abnormally to dietary Fe and therefore do not need to change their diet to prevent accumulation of body Fe.

HFE gene mutations and Wilson's disease in Sardinia.

Science.gov (United States)

Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

2010-03-01

Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

Directory of Open Access Journals (Sweden)

NING Huibin

2017-01-01

Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

Mutant HFE H63D Protein Is Associated with Prolonged Endoplasmic Reticulum Stress and Increased Neuronal Vulnerability*

Science.gov (United States)

Liu, Yiting; Lee, Sang Y.; Neely, Elizabeth; Nandar, Wint; Moyo, Mthabisi; Simmons, Zachary; Connor, James R.

2011-01-01

A specific polymorphism in the hemochromatosis (HFE) gene, H63D, is over-represented in neurodegenerative disorders such as amyotrophic lateral sclerosis and Alzheimer disease. Mutations of HFE are best known as being associated with cellular iron overload, but the mechanism by which HFE H63D might increase the risk of neuron degeneration is unclear. Here, using an inducible expression cell model developed from a human neuronal cell line SH-SY5Y, we reported that the presence of the HFE H63D protein activated the unfolded protein response (UPR). This response was followed by a persistent endoplasmic reticulum (ER) stress, as the signals of UPR sensors attenuated and followed by up-regulation of caspase-3 cleavage and activity. Our in vitro findings were recapitulated in a transgenic mouse model carrying Hfe H67D, the mouse equivalent of the human H63D mutation. In this model, UPR activation was detected in the lumbar spinal cord at 6 months then declined at 12 months in association with increased caspase-3 cleavage. Moreover, upon the prolonged ER stress, the number of cells expressing HFE H63D in early apoptosis was increased moderately. Cell proliferation was decreased without increased cell death. Additionally, despite increased iron level in cells carrying HFE H63D, it appeared that ER stress was not responsive to the change of cellular iron status. Overall, our studies indicate that the HFE H63D mutant protein is associated with prolonged ER stress and chronically increased neuronal vulnerability. PMID:21349849

THE EFFECT OF HAEMOCHROMATOSIS MUTATION ON IRON OVERLOAD IN THALASSAEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Tapas Ranjan Behera

2016-11-01

Full Text Available BACKGROUND Haemochromatosis is a genetic form of iron overload due to a defective HFE gene. Secondary iron overload is the main complication in transfusion-dependent thalassaemia major patients. This study aims at evaluating the degree of iron overload in β-thalassaemia major patients with and without HFE mutations (C282Y, H63D and S65C. MATERIALS AND METHODS A descriptive observational study was conducted including fifty diagnosed -thalassaemia major cases. Detailed clinical history and iron profile was estimated. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS After DNA analysis of all the thalassaemia major cases, two groups were identified, one with HFE gene mutation and other without HFE gene mutation. Iron profile of both the groups (with and without HFE gene mutation was estimated and compared. Only H63D mutation (out of three HFE gene mutations was detected in 16% cases (8 out of 50 cases, which comprised the group with mutation. Comparison of iron parameters between two groups (with and without HFE gene mutation showed significant difference in percent transferrin saturation (p=0.02, while other iron parameters (serum iron and serum ferritin did not show significant difference. CONCLUSION No significant difference between serum ferritin values (a marker of iron overload of groups with and without mutation (mean ferritin level 4641±2166 ng/mL and 4170±2461 ng/mL, respectively was found (p=0.61, in a patient population in whom transfusion protocol and proper chelation regimen was followed.

H63D mutation in HFE gene is common in Indians and is associated ...

Indian Academy of Sciences (India)

HH affects predominantly people of northern European origin and is often ... mutation with the C282Y mutation is a known risk factor for iron overload ... or has low allele frequencies in non-Caucasian populations,. i.e. African ... who were ascertained through self-reported questionnaire. ... confidence limits of the D statistic.

Differential HFE gene expression is regulated by alternative splicing in human tissues.

Science.gov (United States)

Martins, Rute; Silva, Bruno; Proença, Daniela; Faustino, Paula

2011-03-03

The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

Development of a HFE program for an operating NPP: Balancing between existing design practices and human factors standards

International Nuclear Information System (INIS)

Salo, Leena; Savioja, Paula

2014-01-01

This paper describes HFE program development project conducted at a Finnish power company Fortum. The aim of developing a formal HFE program was to improve integration of human factors issues in design of technical systems and to systematically document the HFE process of the company. As Fortum has a long tradition of designing control room solutions, the starting point of the HFE program development was the existing own design practices. On the other hand, the aim was to create a program which would comply with international guidelines such as NUREG-0711. The program development was conducted by tracing the HFE design practices in an on-going I and C modernization project. This empirical work was carried out by interviews of designers and other HFE key stake holders. After the explication of the current practices, the gaps, overlaps and differences in relation to the international standards and guidelines were identified. Based on an analysis of current practices and guidelines and standards a new HFE process model was created. The design process model can be followed in modifications which concern systems with human user interfaces of any kind. The model consists of five separate phases which comply with the general engineering design process model utilized at the company. The HFE program is intended to be both a practical guide on how to take human factors issues into consideration in the design of NPP systems and also a tool for the management of HFE activities

ENVIRONMENTAL RESEARCH BRIEF: THERMOPHYSICAL PROPERTIES OF HFE-125

Science.gov (United States)

Thermophysical properties of HFE-125 (pentafluorodimethylether) suggest that it could serve as an alternative non-ozone depleting refrigerant for certain low temperature applications. This Brief presents the thermophysical properties of HFE-125 (Tables 1-4) which have been obtai...

Differential HFE gene expression is regulated by alternative splicing in human tissues.

Directory of Open Access Journals (Sweden)

Rute Martins

Full Text Available BACKGROUND: The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. METHODOLOGY/PRINCIPAL FINDINGS: Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE that is mostly secreted by cells to the medium in association with β2M. CONCLUSIONS/SIGNIFICANCE: HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

HFE p.H63D polymorphism does not influence ALS phenotype and survival.

Science.gov (United States)

Chiò, Adriano; Mora, Gabriele; Sabatelli, Mario; Caponnetto, Claudia; Lunetta, Christian; Traynor, Bryan J; Johnson, Janel O; Nalls, Mike A; Calvo, Andrea; Moglia, Cristina; Borghero, Giuseppe; Monsurrò, Maria Rosaria; La Bella, Vincenzo; Volanti, Paolo; Simone, Isabella; Salvi, Fabrizio; Logullo, Francesco O; Nilo, Riva; Giannini, Fabio; Mandrioli, Jessica; Tanel, Raffaella; Murru, Maria Rita; Mandich, Paola; Zollino, Marcella; Conforti, Francesca L; Penco, Silvana; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella

2015-10-01

It has been recently reported that the p.His63Asp polymorphism of the HFE gene accelerates disease progression both in the SOD1 transgenic mouse and in amyotrophic lateral sclerosis (ALS) patients. We have evaluated the effect of HFE p.His63Asp polymorphism on the phenotype in 1351 Italian ALS patients (232 of Sardinian ancestry). Patients were genotyped for the HFE p.His63Asp polymorphism (CC, GC, and GG). All patients were also assessed for C9ORF72, TARDBP, SOD1, and FUS mutations. Of the 1351 ALS patients, 363 (29.2%) were heterozygous (GC) for the p.His63Asp polymorphism and 30 (2.2%) were homozygous for the minor allele (GG). Patients with CC, GC, and GG polymorphisms did not significantly differ by age at onset, site of onset of symptoms, and survival; however, in SOD1 patients with CG or GG polymorphism had a significantly longer survival than those with a CC polymorphism. Differently from what observed in the mouse model of ALS, the HFE p.His63Asp polymorphism has no effect on ALS phenotype in this large series of Italian ALS patients. Copyright © 2015 Elsevier Inc. All rights reserved.

Allele frequencies of hemojuvelin gene (HJV I222N and G320V missense mutations in white and African American subjects from the general Alabama population

Directory of Open Access Journals (Sweden)

Bohannon Sean B

2004-12-01

Full Text Available Abstract Background Homozygosity or compound heterozygosity for coding region mutations of the hemojuvelin gene (HJV in whites is a cause of early age-of-onset iron overload (juvenile hemochromatosis, and of hemochromatosis phenotypes in some young or middle-aged adults. HJV coding region mutations have also been identified recently in African American primary iron overload and control subjects. Primary iron overload unexplained by typical hemochromatosis-associated HFE genotypes is common in white and black adults in Alabama, and HJV I222N and G320V were detected in a white Alabama juvenile hemochromatosis index patient. Thus, we estimated the frequency of the HJV missense mutations I222N and G320V in adult whites and African Americans from Alabama general population convenience samples. Methods We evaluated the genomic DNA of 241 Alabama white and 124 African American adults who reported no history of hemochromatosis or iron overload to detect HJV missense mutations I222N and G320V using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP technique. Analysis for HJV I222N was performed in 240 whites and 124 African Americans. Analysis for HJV G320V was performed in 241 whites and 118 African Americans. Results One of 240 white control subjects was heterozygous for HJV I222N; she was also heterozygous for HFE C282Y, but had normal serum iron measures and bone marrow iron stores. HJV I222N was not detected in 124 African American subjects. HJV G320V was not detected in 241 white or 118 African American subjects. Conclusions HJV I222N and G320V are probably uncommon causes or modifiers of primary iron overload in adult whites and African Americans in Alabama. Double heterozygosity for HJV I222N and HFE C282Y may not promote increased iron absorption.

HFE genotype affects exosome phenotype in cancer.

Science.gov (United States)

Mrowczynski, Oliver D; Madhankumar, A B; Slagle-Webb, Becky; Lee, Sang Y; Zacharia, Brad E; Connor, James R

2017-08-01

Neuroblastoma is the third most common childhood cancer, and timely diagnosis and sensitive therapeutic monitoring remain major challenges. Tumor progression and recurrence is common with little understanding of mechanisms. A major recent focus in cancer biology is the impact of exosomes on metastatic behavior and the tumor microenvironment. Exosomes have been demonstrated to contribute to the oncogenic effect on the surrounding tumor environment and also mediate resistance to therapy. The effect of genotype on exosomal phenotype has not yet been explored. We interrogated exosomes from human neuroblastoma cells that express wild-type or mutant forms of the HFE gene. HFE, one of the most common autosomal recessive polymorphisms in the Caucasian population, originally associated with hemochromatosis, has also been associated with increased tumor burden, therapeutic resistance boost, and negative impact on patient survival. Herein, we demonstrate that changes in genotype cause major differences in the molecular and functional properties of exosomes; specifically, HFE mutant derived exosomes have increased expression of proteins relating to invasion, angiogenesis, and cancer therapeutic resistance. HFE mutant derived exosomes were also shown to transfer this cargo to recipient cells and cause an increased oncogenic functionality in those recipient cells. Copyright © 2017. Published by Elsevier B.V.

Meta-analyses of HFE variants in coronary heart disease.

Science.gov (United States)

Lian, Jiangfang; Xu, Limin; Huang, Yi; Le, Yanping; Jiang, Danjie; Yang, Xi; Xu, Weifeng; Huang, Xiaoyan; Dong, Changzheng; Ye, Meng; Zhou, Jianqing; Duan, Shiwei

2013-09-15

HFE gene variants can cause hereditary hemochromatosis (HH) that often comes along with an increased risk of coronary heart disease (CHD). The goal of our study is to assess the contribution of four HFE gene variants to the risk of CHD. We conducted four meta-analyses of the studies examining the association between four HFE gene variants and the risk of CHD. A systematic search was conducted using MEDLINE, EMBASE, Web of Science and China National Knowledge Infrastructure (CNKI), Wanfang Chinese Periodical. Meta-analyses showed that HFE rs1799945-G allele was associated with a 6% increased risk of CHD (P=0.02, odds ratio (OR)=1.06, 95% confidence interval (CI)=1.01-1.11). However, no association between the other three HFE gene variants (rs1800562, rs1800730, and rs9366637) and CHD risk was observed by the meta-analyses (all P values>0.05). In addition, the results of our case-control study indicated that rs1800562 and rs1800730 were monomorphic, and that rs1799945 and rs9366637 were not associated with CHD in Han Chinese. Our meta-analysis suggested that a significant association existed between rs1799945 mutation and CHD, although this mutation was rare in Han Chinese. Copyright © 2013 Elsevier B.V. All rights reserved.

Loss of hfe function reverses impaired recognition memory caused by olfactory manganese exposure in mice.

Science.gov (United States)

Ye, Qi; Kim, Jonghan

2015-03-01

Excessive manganese (Mn) in the brain promotes a variety of abnormal behaviors, including memory deficits, decreased motor skills and psychotic behavior resembling Parkinson's disease. Hereditary hemochromatosis (HH) is a prevalent genetic iron overload disorder worldwide. Dysfunction in HFE gene is the major cause of HH. Our previous study has demonstrated that olfactory Mn uptake is altered by HFE deficiency, suggesting that loss of HFE function could alter manganese-associated neurotoxicity. To test this hypothesis, Hfe-knockout (Hfe (-/-)) and wild-type (Hfe (+/+)) mice mice were intranasally-instilled with manganese chloride (MnCl2 5 mg/kg) or water daily for 3 weeks and examined for memory function. Olfactory Mn diminished both short-term recognition and spatial memory in Hfe (+/+) mice, as examined by novel object recognition task and Barnes maze test, respectively. Interestingly, Hfe (-/-) mice did not show impaired recognition memory caused by Mn exposure, suggesting a potential protective effect of Hfe deficiency against Mn-induced memory deficits. Since many of the neurotoxic effects of manganese are thought to result from increased oxidative stress, we quantified activities of anti-oxidant enzymes in the prefrontal cortex (PFC). Mn instillation decreased superoxide dismutase 1 (SOD1) activity in Hfe (+/+) mice, but not in Hfe (-/-) mice. In addition, Hfe deficiency up-regulated SOD1 and glutathione peroxidase activities. These results suggest a beneficial role of Hfe deficiency in attenuating Mn-induced oxidative stress in the PFC. Furthermore, Mn exposure reduced nicotinic acetylcholine receptor levels in the PFC, indicating that blunted acetylcholine signaling could contribute to impaired memory associated with intranasal manganese. Together, our model suggests that disrupted cholinergic system in the brain is involved in airborne Mn-induced memory deficits and loss of HFE function could in part prevent memory loss via a potential up-regulation of

Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

Science.gov (United States)

Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

2017-04-01

Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

[Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

Science.gov (United States)

Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

2013-02-01

An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

HFE gene variants and iron-induced oxygen radical generation in idiopathic pulmonary fibrosis.

Science.gov (United States)

Sangiuolo, Federica; Puxeddu, Ermanno; Pezzuto, Gabriella; Cavalli, Francesco; Longo, Giuliana; Comandini, Alessia; Di Pierro, Donato; Pallante, Marco; Sergiacomi, Gianluigi; Simonetti, Giovanni; Zompatori, Maurizio; Orlandi, Augusto; Magrini, Andrea; Amicosante, Massimo; Mariani, Francesca; Losi, Monica; Fraboni, Daniela; Bisetti, Alberto; Saltini, Cesare

2015-02-01

In idiopathic pulmonary fibrosis (IPF), lung accumulation of excessive extracellular iron and macrophage haemosiderin may suggest disordered iron homeostasis leading to recurring microscopic injury and fibrosing damage. The current study population comprised 89 consistent IPF patients and 107 controls. 54 patients and 11 controls underwent bronchoalveolar lavage (BAL). Haemosiderin was assessed by Perls' stain, BAL fluid malondialdehyde (MDA) by high-performance liquid chromatography, BAL cell iron-dependent oxygen radical generation by fluorimetry and the frequency of hereditary haemochromatosis HFE gene variants by reverse dot blot hybridisation. Macrophage haemosiderin, BAL fluid MDA and BAL cell unstimulated iron-dependent oxygen radical generation were all significantly increased above controls (pHFE allelic variants was markedly higher in IPF compared with controls (40.4% versus 22.4%, OR 2.35, p=0.008) and was associated with higher iron-dependent oxygen radical generation (HFE variant 107.4±56.0, HFE wild type (wt) 59.4±36.4 and controls 16.7±11.8 fluorescence units per 10(5) BAL cells; p=0.028 HFE variant versus HFE wt, p=0.006 HFE wt versus controls). The data suggest iron dysregulation associated with HFE allelic variants may play an important role in increasing susceptibility to environmental exposures, leading to recurring injury and fibrosis in IPF. Copyright ©ERS 2015.

Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

Science.gov (United States)

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2011-03-01

The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

Human Factors Engineering (HFE) insights for advanced reactors based upon operating experience

International Nuclear Information System (INIS)

Higgins, J.; Nasta, K.

1997-01-01

The NRC Human Factors Engineering Program Review Model (HFE PRM, NUREG-0711) was developed to support a design process review for advanced reactor design certification under 10CFR52. The HFE PRM defines ten fundamental elements of a human factors engineering program. An Operating Experience Review (OER) is one of these elements. The main purpose of an OER is to identify potential safety issues from operating plant experience and ensure that they are addressed in a new design. Broad-based experience reviews have typically been performed in the past by reactor designers. For the HFE PRM the intent is to have a more focussed OER that concentrates on HFE issues or experience that would be relevant to the human-system interface (HSI) design process for new advanced reactors. This document provides a detailed list of HFE-relevant operating experience pertinent to the HSI design process for advanced nuclear power plants. This document is intended to be used by NRC reviewers as part of the HFE PRM review process in determining the completeness of an OER performed by an applicant for advanced reactor design certification. 49 refs

Hepcidin regulation in wild-type and Hfe knockout mice in response to alcohol consumption: evidence for an alcohol-induced hypoxic response.

Science.gov (United States)

Heritage, Mandy L; Murphy, Therese L; Bridle, Kim R; Anderson, Gregory J; Crawford, Darrell H G; Fletcher, Linda M

2009-08-01

Expression of Hamp1, the gene encoding the iron regulatory peptide hepcidin, is inappropriately low in HFE-associated hereditary hemochromatosis and Hfe knockout mice (Hfe(-/-)). Since chronic alcohol consumption is also associated with disturbances in iron metabolism, we investigated the effects of alcohol consumption on hepcidin mRNA expression in Hfe(-/-) mice. Hfe(-/-) and C57BL/6 (wild-type) mice were pair-fed either an alcohol liquid diet or control diet for up to 8 weeks. The mRNA levels of hepcidin and ferroportin were measured at the mRNA level by RT-PCR and protein expression of hypoxia inducible factor-1 alpha (HIF-1alpha) was measured by western blot. Hamp1 mRNA expression was significantly decreased and duodenal ferroportin expression was increased in alcohol-fed wild-type mice at 8 weeks. Time course experiments showed that the decrease in hepcidin mRNA was not immediate, but was significant by 4 weeks. Consistent with the genetic defect, Hamp1 mRNA was decreased and duodenal ferroportin mRNA expression was increased in Hfe(-/-) mice fed on the control diet compared with wild-type animals and alcohol further exacerbated these effects. HIF-1alpha protein levels were elevated in alcohol-fed wild-type animals compared with controls. Alcohol may decrease Hamp1 gene expression independently of the HFE pathway possibly via alcohol-induced hypoxia.

Morbidity and mortality in first-degree relatives of C282Y homozygous probands with clinically detected haemochromatosis compared with the general population: the HEmochromatosis FAmily Study (HEFAS).

NARCIS (Netherlands)

Jacobs, E.M.G.; Hendriks, J.C.M.; Marx, J.J.M.; Deursen, C.T. van; Kreeftenberg, H.G.; Vries, R.A. de; Stalenhoef, A.F.H.; Verbeek, A.L.M.; Swinkels, D.W.

2007-01-01

BACKGROUND: Family screening has been suggested as a sophisticated model for the early detection of HFE-related hereditary haemochromatosis (HH). However, until now, controlled studies on the morbidity and mortality in families with HH are lacking. METHODS: Data on iron parameters, morbidity and

The role of HFE genotype in macrophage phenotype.

Science.gov (United States)

Nixon, Anne M; Neely, Elizabeth; Simpson, Ian A; Connor, James R

2018-02-01

Iron regulation is essential for cellular energy production. Loss of cellular iron homeostasis has critical implications for both normal function and disease progression. The H63D variant of the HFE gene is the most common gene variant in Caucasians. The resulting mutant protein alters cellular iron homeostasis and is associated with a number of neurological diseases and cancer. In the brain, microglial and infiltrating macrophages are critical to maintaining iron homeostasis and modulating inflammation associated with the pathogenic process in multiple diseases. This study addresses whether HFE genotype affects macrophage function and the implications of these findings for disease processes. Bone marrow macrophages were isolated from wildtype and H67D HFE knock-in mice. The H67D gene variant in mice is the human equivalent of the H63D variant. Upon differentiation, the macrophages were used to analyze iron regulatory proteins, cellular iron release, migration, phagocytosis, and cytokine expression. The results of this study demonstrate that the H67D HFE genotype significantly impacts a number of critical macrophage functions. Specifically, fundamental activities such as proliferation in response to iron exposure, L-ferritin expression in response to iron loading, secretion of BMP6 and cytokines, and migration and phagocytic activity were all found to be impacted by genotype. Furthermore, we demonstrated that exposure to apo-Tf (iron-poor transferrin) can increase the release of iron from macrophages. In normal conditions, 70% of circulating transferrin is unsaturated. Therefore, the ability of apo-Tf to induce iron release could be a major regulatory mechanism for iron release from macrophages. These studies demonstrate that the HFE genotype impacts fundamental components of macrophage phenotype that could alter their role in degenerative and reparative processes in neurodegenerative disorders.

Homozygosity For The C282Y Substitution In The HFE Gene: The Incomplete Penetrance And Variable Expressivity

Directory of Open Access Journals (Sweden)

Dilum Ekanayake

2015-01-01

Full Text Available The syndrome of hepatic cirrhosis diabetes and skin pigmentation (‘Bronze diabetes’ has been well documented, including its propensity to lead to hepatocellular cancer. However, this picture of advanced disease is much less common nowadays with increased awareness and early diagnosis. However, in addition to this, it has been increasingly recognised that in contrast to other diseases inherited as autosomal recessive traits, subjects carrying the genetic predisposition infrequently develop overt disease. This is due only in part to physiological and pathological blood loss, and further relevant genetic mutations have been anticipated. Indeed, an international consortium has recently identified that the genetic variant ( GNPAT has been identified as predisposing to iron overload related disease. Further mutations can be anticipated and will assist in early diagnosis and treatment as well as identifying subjects predisposed to significant iron overload.

Tmprss6 is a genetic modifier of the Hfe-hemochromatosis phenotype in mice

Science.gov (United States)

Whittlesey, Rebecca L.; Andrews, Nancy C.

2011-01-01

The hereditary hemochromatosis protein HFE promotes the expression of hepcidin, a circulating hormone produced by the liver that inhibits dietary iron absorption and macrophage iron release. HFE mutations are associated with impaired hepatic bone morphogenetic protein (BMP)/SMAD signaling for hepcidin production. TMPRSS6, a transmembrane serine protease mutated in iron-refractory iron deficiency anemia, inhibits hepcidin expression by dampening BMP/SMAD signaling. In the present study, we used genetic approaches in mice to examine the relationship between Hfe and Tmprss6 in the regulation of systemic iron homeostasis. Heterozygous loss of Tmprss6 in Hfe−/− mice reduced systemic iron overload, whereas homozygous loss caused systemic iron deficiency and elevated hepatic expression of hepcidin and other Bmp/Smad target genes. In contrast, neither genetic loss of Hfe nor hepatic Hfe overexpression modulated the hepcidin elevation and systemic iron deficiency of Tmprss6−/− mice. These results indicate that genetic loss of Tmprss6 increases Bmp/Smad signaling in an Hfe-independent manner that can restore Bmp/Smad signaling in Hfe−/− mice. Furthermore, these results suggest that natural genetic variation in the human ortholog TMPRSS6 might modify the clinical penetrance of HFE-associated hereditary hemochromatosis, raising the possibility that pharmacologic inhibition of TMPRSS6 could attenuate iron loading in this disorder. PMID:21355094

Effect of Hfe Deficiency on Memory Capacity and Motor Coordination after Manganese Exposure by Drinking Water in Mice.

Science.gov (United States)

Alsulimani, Helal Hussain; Ye, Qi; Kim, Jonghan

2015-12-01

Excess manganese (Mn) is neurotoxic. Increased manganese stores in the brain are associated with a number of behavioral problems, including motor dysfunction, memory loss and psychiatric disorders. We previously showed that the transport and neurotoxicity of manganese after intranasal instillation of the metal are altered in Hfe-deficient mice, a mouse model of the iron overload disorder hereditary hemochromatosis (HH). However, it is not fully understood whether loss of Hfe function modifies Mn neurotoxicity after ingestion. To investigate the role of Hfe in oral Mn toxicity, we exposed Hfe-knockout (Hfe (-/-)) and their control wild-type (Hfe (+/+)) mice to MnCl2 in drinking water (5 mg/mL) for 5 weeks. Motor coordination and spatial memory capacity were determined by the rotarod test and the Barnes maze test, respectively. Brain and liver metal levels were analyzed by inductively coupled plasma mass spectrometry. Compared with the water-drinking group, mice drinking Mn significantly increased Mn concentrations in the liver and brain of both genotypes. Mn exposure decreased iron levels in the liver, but not in the brain. Neither Mn nor Hfe deficiency altered tissue concentrations of copper or zinc. The rotarod test showed that Mn exposure decreased motor skills in Hfe (+/+) mice, but not in Hfe (-/-) mice (p = 0.023). In the Barns maze test, latency to find the target hole was not altered in Mn-exposed Hfe (+/+) compared with water-drinking Hfe (+/+) mice. However, Mn-exposed Hfe (-/-) mice spent more time to find the target hole than Mn-drinking Hfe (+/+) mice (p = 0.028). These data indicate that loss of Hfe function impairs spatial memory upon Mn exposure in drinking water. Our results suggest that individuals with hemochromatosis could be more vulnerable to memory deficits induced by Mn ingestion from our environment. The pathophysiological role of HFE in manganese neurotoxicity should be carefully examined in patients with HFE-associated hemochromatosis and

Alternative Polyadenylation and Nonsense-Mediated Decay Coordinately Regulate the Human HFE mRNA Levels

Science.gov (United States)

Martins, Rute; Proença, Daniela; Silva, Bruno; Barbosa, Cristina; Silva, Ana Luísa; Faustino, Paula; Romão, Luísa

2012-01-01

Nonsense-mediated decay (NMD) is an mRNA surveillance pathway that selectively recognizes and degrades defective mRNAs carrying premature translation-termination codons. However, several studies have shown that NMD also targets physiological transcripts that encode full-length proteins, modulating their expression. Indeed, some features of physiological mRNAs can render them NMD-sensitive. Human HFE is a MHC class I protein mainly expressed in the liver that, when mutated, can cause hereditary hemochromatosis, a common genetic disorder of iron metabolism. The HFE gene structure comprises seven exons; although the sixth exon is 1056 base pairs (bp) long, only the first 41 bp encode for amino acids. Thus, the remaining downstream 1015 bp sequence corresponds to the HFE 3′ untranslated region (UTR), along with exon seven. Therefore, this 3′ UTR encompasses an exon/exon junction, a feature that can make the corresponding physiological transcript NMD-sensitive. Here, we demonstrate that in UPF1-depleted or in cycloheximide-treated HeLa and HepG2 cells the HFE transcripts are clearly upregulated, meaning that the physiological HFE mRNA is in fact an NMD-target. This role of NMD in controlling the HFE expression levels was further confirmed in HeLa cells transiently expressing the HFE human gene. Besides, we show, by 3′-RACE analysis in several human tissues that HFE mRNA expression results from alternative cleavage and polyadenylation at four different sites – two were previously described and two are novel polyadenylation sites: one located at exon six, which confers NMD-resistance to the corresponding transcripts, and another located at exon seven. In addition, we show that the amount of HFE mRNA isoforms resulting from cleavage and polyadenylation at exon seven, although present in both cell lines, is higher in HepG2 cells. These results reveal that NMD and alternative polyadenylation may act coordinately to control HFE mRNA levels, possibly varying its

The Southern French registry of genetic hemochromatosis: a tool for determining clinical prevalence of the disorder and genotype penetrance.

Science.gov (United States)

Aguilar-Martinez, Patricia; Bismuth, Michael; Blanc, François; Blanc, Pierre; Cunat, Severine; Dereure, Olivier; Dujols, Pierre; Giansily-Blaizot, Muriel; Jorgensen, Christian; Konate, Amadou; Larrey, Dominique; Le Quellec, Alain; Mura, Thibault; Raingeard, Isabelle; Ramos, Jeanne; Renard, Eric; Rousseau, Florence; Schved, Jean-François; Picot, Marie-Christine

2010-04-01

Despite great progress in understanding the mechanisms underlying genetic hemochromatosis, data on the prevalence and the penetrance of the disorder are conflicting. A registry of patients with genetic hemochromatosis was established in the South of France and a regional health network was developed to allow the inclusion of all the diagnosed patients. C282Y homozygous patients classified in stages 2 (biological iron overload), 3 and 4 (clinical manifestations of iron overload, stage 4 being the more severe) according to the classification of the French National Authority for Health were included in the registry over a 6-year period. A total of 352 symptomatic C282Y homozygotes were identified, resulting in a total prevalence of 1.83 per 10,000 (95% CI: 1.63 to 2.02) in subjects over 20 years and 2.40 per 10,000 (95% CI, 2.15 to 2.65) among subjects of European descent. Among Europeans, the total calculated penetrance was 15.8% in stage 2 or higher, 12.1% in stage 3 or 4 and 2.9% in stage 4. The penetrance was slightly higher in males (18.7%) than in females (13.2%). It was 19.9% for individuals over 40 years of age (24.1% and 16.3% in males and females, respectively) with a maximum of 31% in subjects between 50 and 54 years old. Among 249 patients with complete records, 24% were in stage 2, the majority (58%) were in stage 3, and 18% in stage 4. There was a higher proportion of males, and excessive alcohol intake was more prevalent in stage 4 than in stages 2 and 3 combined. A French Mediterranean regional hemochromatosis registry with strict inclusion criteria is a useful tool for characterizing the history of this disease, particularly for the most severely affected patients, as defined by the disease severity classification. The total prevalence of symptomatic C282Y homozygotes in the region was found to be low. However, clinical penetrance (stages 3 and 4) was not negligible.

Factors affecting the appreciation generated through applying human factors/ergonomics (HFE) principles to systems of work.

Science.gov (United States)

So, R H Y; Lam, S T

2014-01-01

This retrospective study examined the levels of appreciation (applause) given by clients to Human Factors/Ergonomic (HFE) specialists after they have modified the systems of work. Thirteen non-academic projects were chosen because the HFE interventions involved changed the way workers work at their workplaces. Companies involved range from multi-national corporations and military organizations with thousands of employees to small trading companies with less than 10 employees. In 5 cases the HFE recommendations were fully adopted and well appreciated. In 4 they were largely ignored and not appreciated, with partial adoption and some appreciation in the other 4 cases. Three factors that predict appreciation were identified: (i) alignment between the benefits HFE can provide and the project's key performance indices; (ii) awareness of HFE among the client's senior management; and (iii) a team organization appropriate for applying HFE recommendations. Having an HFE specialist on the client's side can greatly increase levels of appreciation, but lack of such a specialist will not affect levels of appreciation. A clear contractual requirement for HFE intervention does not promote appreciation significantly, but its absence can greatly reduce levels of appreciation. These relationships are discussed using the Kano's model of quality. Means to generate greater appreciation of the benefits of HFE are discussed. Copyright © 2013 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Trends in HFE Methods and Tools and Their Applicability to Safety Reviews

Energy Technology Data Exchange (ETDEWEB)

O' Hara, J.M.; Plott, C.; Milanski, J.; Ronan, A.; Scheff, S.; Laux, L.; and Bzostek, J.

2009-09-30

The U.S. Nuclear Regulatory Commission's (NRC) conducts human factors engineering (HFE) safety reviews of applicant submittals for new plants and for changes to existing plants. The reviews include the evaluation of the methods and tools (M&T) used by applicants as part of their HFE program. The technology used to perform HFE activities has been rapidly evolving, resulting in a whole new generation of HFE M&Ts. The objectives of this research were to identify the current trends in HFE methods and tools, determine their applicability to NRC safety reviews, and identify topics for which the NRC may need additional guidance to support the NRC's safety reviews. We conducted a survey that identified over 100 new HFE M&Ts. The M&Ts were assessed to identify general trends. Seven trends were identified: Computer Applications for Performing Traditional Analyses, Computer-Aided Design, Integration of HFE Methods and Tools, Rapid Development Engineering, Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. We assessed each trend to determine its applicability to the NRC's review by considering (1) whether the nuclear industry is making use of M&Ts for each trend, and (2) whether M&Ts reflecting the trend can be reviewed using the current design review guidance. We concluded that M&T trends that are applicable to the commercial nuclear industry and are expected to impact safety reviews may be considered for review guidance development. Three trends fell into this category: Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. The other trends do not need to be addressed at this time.

Trends in HFE Methods and Tools and Their Applicability to Safety Reviews

International Nuclear Information System (INIS)

O'Hara, J.M.; Plott, C.; Milanski, J.; Ronan, A.; Scheff, S.; Laux, L.; Bzostek, J.

2009-01-01

The U.S. Nuclear Regulatory Commission's (NRC) conducts human factors engineering (HFE) safety reviews of applicant submittals for new plants and for changes to existing plants. The reviews include the evaluation of the methods and tools (M and T) used by applicants as part of their HFE program. The technology used to perform HFE activities has been rapidly evolving, resulting in a whole new generation of HFE M and Ts. The objectives of this research were to identify the current trends in HFE methods and tools, determine their applicability to NRC safety reviews, and identify topics for which the NRC may need additional guidance to support the NRC's safety reviews. We conducted a survey that identified over 100 new HFE M and Ts. The M and Ts were assessed to identify general trends. Seven trends were identified: Computer Applications for Performing Traditional Analyses, Computer-Aided Design, Integration of HFE Methods and Tools, Rapid Development Engineering, Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. We assessed each trend to determine its applicability to the NRC's review by considering (1) whether the nuclear industry is making use of M and Ts for each trend, and (2) whether M and Ts reflecting the trend can be reviewed using the current design review guidance. We concluded that M and T trends that are applicable to the commercial nuclear industry and are expected to impact safety reviews may be considered for review guidance development. Three trends fell into this category: Analysis of Cognitive Tasks, Use of Virtual Environments and Visualizations, and Application of Human Performance Models. The other trends do not need to be addressed at this time.

HFE mRNA expression is responsive to intracellular and extracellular iron loading: short communication.

Science.gov (United States)

Mehta, Kosha J; Farnaud, Sebastien; Patel, Vinood B

2017-10-01

In liver hepatocytes, the HFE gene regulates cellular and systemic iron homeostasis by modulating cellular iron-uptake and producing the iron-hormone hepcidin in response to systemic iron elevation. However, the mechanism of iron-sensing in hepatocytes remain enigmatic. Therefore, to study the effect of iron on HFE and hepcidin (HAMP) expressions under distinct extracellular and intracellular iron-loading, we examined the effect of holotransferrin treatment (1, 2, 5 and 8 g/L for 6 h) on intracellular iron levels, and mRNA expressions of HFE and HAMP in wild-type HepG2 and previously characterized iron-loaded recombinant-TfR1 HepG2 cells. Gene expression was analyzed by real-time PCR and intracellular iron was measured by ferrozine assay. Data showed that in the wild-type cells, where intracellular iron content remained unchanged, HFE expression remained unaltered at low holotransferrin treatments but was upregulated upon 5 g/L (p HFE and HAMP expressions were elevated only at low 1 g/L treatment (p HFE (p HFE mRNA was independently elevated by extracellular and intracellular iron-excess. Thus, it may be involved in sensing both, extracellular and intracellular iron. Repression of HAMP expression under simultaneous intracellular and extracellular iron-loading resembles non-hereditary iron-excess pathologies.

Alterações moleculares associadas à hemocromatose hereditária Molecular changes associated with hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo C. J. L. Santos

2009-01-01

Full Text Available A hemocromatose hereditária (HH é a mais comum doença autossômica em caucasianos e caracteriza-se pelo aumento da absorção intestinal de ferro, o qual resulta em acúmulo progressivo de ferro no organismo. A classificação da HH é realizada de acordo com a alteração genética encontrada, sendo os casos divididos em tipos 1, 2A, 2B, 3 e 4, quando a sobrecarga de ferro for associada aos genes HFE, HJV, HAMP, TFR2 e SLC40A1, respectivamente. Não existem estudos brasileiros que avaliaram a presença de mutações em genes relacionados à fisiopatologia da HH (genes HJV, HAMP, TFR2 e SLC40A1, além da pesquisa das três mutações no gene HFE (C282Y, H63D e S65C. Porém, está descrito, nos estudos realizados no Brasil, que alguns pacientes com sobrecarga de ferro primária não são portadores da HH tipo 1 (associada ao gene HFE. Portanto, é de suma importância a identificação das características genéticas dessa população, uma vez que outras mutações nos genes HJV, HAMP, TFR2 e SLC40A1 podem estar associadas à fisiopatologia da doença, podendo haver interações entre os genes alterados, de forma que possa auxiliar no entendimento da fisiopatologia da HH em pacientes brasileiros.Hereditary Hemochromatosis (HH is the most common autosomal disease in Caucasians. It is characterized by an increase in intestinal absorption of iron, which results in a progressive accumulation of iron in the body. The classification of HH is carried out according to the genetic alteration found; thus cases of HH are divided into Types 1, 2A, 2B, 3 and 4, when the iron overload is associated to the HFE, HJV, HAMP, TFR2 and SLC40A1 genes, respectively. There is research on the three HFE gene mutations (C282Y, H63D and S65C in the Brazilian population however there are no Brazilian studies that evaluate the presence of mutations in other genes related to the pathophysiology of HH (HJV, HAMP, TFR2 and SLC40A1 genes. Nevertheless, studies conducted in

Genetic disruption of NRF2 promotes the development of necroinflammation and liver fibrosis in a mouse model of HFE-hereditary hemochromatosis.

Science.gov (United States)

Duarte, Tiago L; Caldas, Carolina; Santos, Ana G; Silva-Gomes, Sandro; Santos-Gonçalves, Andreia; Martins, Maria João; Porto, Graça; Lopes, José Manuel

2017-04-01

In hereditary hemochromatosis, iron deposition in the liver parenchyma may lead to fibrosis, cirrhosis and hepatocellular carcinoma. Most cases are ascribed to a common mutation in the HFE gene, but the extent of clinical expression is greatly influenced by the combined action of yet unidentified genetic and/or environmental modifying factors. In mice, transcription factor NRF2 is a critical determinant of hepatocyte viability during exposure to acute dietary iron overload. We evaluated if the genetic disruption of Nrf2 would prompt the development of liver damage in Hfe -/- mice (an established model of human HFE-hemochromatosis). Wild-type, Nrf2 -/- , Hfe -/- and double knockout (Hfe/Nrf2 -/- ) female mice on C57BL/6 genetic background were sacrificed at the age of 6 (young), 12-18 (middle-aged) or 24 months (old) for evaluation of liver pathology. Despite the parenchymal iron accumulation, Hfe -/- mice presented no liver injury. The combination of iron overload (Hfe -/- ) and defective antioxidant defences (Nrf2 -/- ) increased the number of iron-related necroinflammatory lesions (sideronecrosis), possibly due to the accumulation of toxic oxidation products such as 4-hydroxy-2-nonenal-protein adducts. The engulfment of dead hepatocytes led to a gradual accumulation of iron within macrophages, featuring large aggregates. Myofibroblasts recruited towards the injury areas produced substantial amounts of collagen fibers involving the liver parenchyma of double-knockout animals with increased hepatic fibrosis in an age-dependent manner. The genetic disruption of Nrf2 promotes the transition from iron accumulation (siderosis) to liver injury in Hfe -/- mice, representing the first demonstration of spontaneous hepatic fibrosis in the long term in a mouse model of hereditary hemochromatosis displaying mildly elevated liver iron. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

HFE Genotype Restricts the Response to Paraquat in a Mouse Model of Neurotoxicity.

Science.gov (United States)

Nixon, Anne M; Meadowcroft, Mark D; Neely, Elizabeth B; Snyder, Amanda M; Purnell, Carson J; Wright, Justin; Lamendella, Regina; Nandar, Wint; Huang, Xuemei; Connor, James R

2018-05-01

Parkinson's disease is marked clinically by motor dysfunction and pathologically by dopaminergic cell loss in the substantia nigra and iron accumulation in the substantia nigra. The driver underlying iron accumulation remains unknown and could be genetic or environmental. The HFE protein is critical for the regulation of cellular iron uptake. Mutations within this protein are associated with increased iron accumulation including in the brain. We have focused on the commonly occurring H63D variant of the HFE gene as a disease modifier in a number of neurodegenerative diseases. To investigate the role of H63D HFE genotype, we generated a mouse model in which the wild-type (WT) HFE gene is replaced by the H67D gene variant (mouse homolog of the human H63D gene variant). Using paraquat toxicity as the model for Parkinson's disease, we found that WT mice responded as expected with significantly greater motor function, loss of tyrosine hydroxylase staining and increase microglial staining in the substantia nigra, and an increase in R 2 relaxation rate within the substantia nigra of the paraquat-treated mice compared to their saline-treated counterparts. In contrast, the H67D mice showed a remarkable resistance to paraquat treatment; specifically differing from the WT mice with no changes in motor function or changes in R 2 relaxation rates following paraquat exposure. At baseline, there were differences between the H67D HFE mice and WT mice in gut microbiome profile and increased L-ferritin staining in the substantia nigra that could account for the resistance to paraquat. Of particular note, the H67D HFE mice regardless of whether or not they were treated with paraquat had significantly less tyrosine hydroxylase immunostaining than WT. Our results clearly demonstrate that the HFE genotype impacts the expression of tyrosine hydroxylase in the substantia nigra, the gut microbiome and the response to paraquat providing additional support that the HFE genotype is a disease

HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

Science.gov (United States)

Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

2017-07-01

HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

Reduction of body iron in HFE-related haemochromatosis and moderate iron overload (Mi-Iron): a multicentre, participant-blinded, randomised controlled trial.

Science.gov (United States)

Ong, Sim Y; Gurrin, Lyle C; Dolling, Lara; Dixon, Jeanette; Nicoll, Amanda J; Wolthuizen, Michelle; Wood, Erica M; Anderson, Gregory J; Ramm, Grant A; Allen, Katrina J; Olynyk, John K; Crawford, Darrell; Ramm, Louise E; Gow, Paul; Durrant, Simon; Powell, Lawrie W; Delatycki, Martin B

2017-12-01

The iron overload disorder hereditary haemochromatosis is most commonly caused by HFE p.Cys282Tyr homozygosity. In the absence of results from any randomised trials, current evidence is insufficient to determine whether individuals with hereditary haemochromatosis and moderately elevated serum ferritin, should undergo iron reduction treatment. This trial aimed to establish whether serum ferritin normalisation in this population improved symptoms and surrogate biomarkers. This study was a multicentre, participant-blinded, randomised controlled trial done at three centres in Australia. We enrolled people who were homozygous for HFE p.Cys282Tyr, aged between 18 and 70 years, with moderately elevated serum ferritin, defined as 300-1000 μg/L, and raised transferrin saturation. Participants were randomly assigned, via a computer-generated random number, to undergo either iron reduction by erythrocytapheresis (treatment group) or sham treatment by plasmapheresis (control group). Randomisation was stratified by baseline serum ferritin (cognitive subcomponent (-3·6, -5·9 to -1·3, p=0·0030), but not in the physical (-1·90 -4·5 to 0·63, p=0·14) and psychosocial (-0·54, -1·2 to 0·11, p=0·10) subcomponents. No serious adverse events occurred in either group. One participant in the control group had a vasovagal event and 17 participants (14 in the treatment group and three in the control group) had transient symptoms assessed as related to hypovolaemia. Mild citrate reactions were more common in the treatment group (32 events [25%] in 129 procedures) compared with the control group (one event [1%] in 93 procedures). To our knowledge, this study is the first to objectively assess the consequences of iron removal in individuals with hereditary haemochromatosis and moderately elevated serum ferritin. Our results suggest that serum ferritin normalisation by iron depletion could be of benefit for all individuals with hereditary haemochromatosis and elevated serum

Hemochromatosis

Directory of Open Access Journals (Sweden)

Onur Albayrak

2009-08-01

Full Text Available Hemochromatosis is the most common form of iron overload disease. Iron builds up in the body’s organs and damages them. Hemochromatosis is presented with arthropathy, cirrhosis of the liver, melanoderma, heart failure, diabetes mellitus and other endocrine deficiencies. There are two type of this disease. Primary hemochromatosis is known as an inherited disease. Herediter hemochromatosis is caused by the mutations of HFE gene. The most common mutations are H63D (Histidine- Aspartat and C282Y (Cysteine-Tyrosine on the gene. Secondary hemochromatosis is caused by anemia, alcoholism, and some of the other disorders. [Archives Medical Review Journal 2009; 18(4.000: 268-275

18 CFR 284.282 - Definitions.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 284.282 Section 284.282 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Blanket Certificates Authorizing Certain Natural Gas Sales by Interstate Pipelines § 284.282 Definitions...

The impact of H63D HFE gene carriage on hemoglobin and iron status in children.

Science.gov (United States)

Barbara, Kaczorowska-Hac; Marcin, Luszczyk; Jedrzej, Antosiewicz; Wieslaw, Ziolkowski; Elzbieta, Adamkiewicz-Drozynska; Malgorzata, Mysliwiec; Ewa, Milosz; Jacek, Kaczor Jan

2016-12-01

The molecular mechanism that regulates iron homeostasis is based on a network of signals, which reflect on the iron requirements of the body. Hereditary hemochromatosis is a heterogenic metabolic syndrome which is due to unchecked transfer of iron into the bloodstream and its toxic effects on parenchymatous organs. It is caused by the mutation of genes that encode proteins that help hepcidin to monitor serum iron. These proteins include the human hemochromatosis protein -HFE, transferrin-receptor 2, hemojuvelin in rare instances, and ferroportin. HFE-related hemochromatosis is the most frequent form of the disease. Interestingly, the low penetrance of polymorphic HFE genes results in rare clinical presentation of the disease, predominantly in middle-aged males. Taking into account the wide dispersion of HFE mutation in our population and also its unknown role in heterozygotes, we analyzed the impact of H63D HFE carriage in the developmental age, with respect to gender, on the iron status and hemoglobin concentration of carriers in comparison to those of wild-type HFE gene (12.7 ± 3.07 years, 42 boys and 41 girls). H63D carriers presented higher blood iron, transferrin saturation, and ferritin concentration than wild-type probands (p HFE heterozygotes.

Reduced white matter MRI transverse relaxation rate in cognitively normal H63D-HFE human carriers and H67D-HFE mice.

Science.gov (United States)

Meadowcroft, Mark D; Wang, Jianli; Purnell, Carson J; Peters, Douglas G; Eslinger, Paul J; Neely, Elizabeth B; Gill, David J; Vasavada, Megha; Ali-Rahmani, Fatima; Yang, Qing X; Connor, James R

2016-12-01

Mutations within the HFE protein gene sequence have been associated with increased risk of developing a number of neurodegenerative disorders. To this effect, an animal model has been created which incorporates the mouse homologue to the human H63D-HFE mutation: the H67D-HFE knock-in mouse. These mice exhibit alterations in iron management proteins, have increased neuronal oxidative stress, and a disruption in cholesterol regulation. However, it remains undetermined how these differences translate to human H63D carriers in regards to white matter (WM) integrity. To this endeavor, MRI transverse relaxation rate (R 2 ) parametrics were employed to test the hypothesis that WM alterations are present in H63D human carriers and are recapitulated in the H67D mice. H63D carriers exhibit widespread reductions in brain R 2 compared to non-carriers within white matter association fibers in the brain. Similar R 2 decreases within white matter tracts were observed in the H67D mouse brain. Additionally, an exacerbation of age-related R 2 decrease is found in the H67D animal model in white matter regions of interest. The decrease in R 2 within white matter tracts of both species is speculated to be multifaceted. The R 2 changes are hypothesized to be due to alterations in axonal biochemical tissue composition. The R 2 changes observed in both the human-H63D and mouse-H67D data suggest that modified white matter myelination is occurring in subjects with HFE mutations, potentially increasing vulnerability to neurodegenerative disorders.

30 CFR 282.3 - Definitions.

Science.gov (United States)

2010-07-01

... from such activity. Contingency Plan means a plan for action to be taken in emergency situations. Data... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Definitions. 282.3 Section 282.3 Mineral... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.3 Definitions. When used in this...

Hereditary hemochromatosis (HFE) genotypes in heart failure: relation to etiology and prognosis

DEFF Research Database (Denmark)

Møller, Daniel Vega; Pecini, Redi; Gustafsson, Finn

2010-01-01

It is believed that hereditary hemochromatosis (HH) might play a role in cardiac disease (heart failure (HF) and ischemia). Mutations within several genes are HH-associated, the most common being the HFE gene. In a large cohort of HF patients, we sought to determine the etiological role...... and the prognostic significance of HFE genotypes....

Genome-wide association study identifies genetic loci associated with iron deficiency.

Directory of Open Access Journals (Sweden)

Christine E McLaren

2011-03-01

Full Text Available The existence of multiple inherited disorders of iron metabolism in man, rodents and other vertebrates suggests genetic contributions to iron deficiency. To identify new genomic locations associated with iron deficiency, a genome-wide association study (GWAS was performed using DNA collected from white men aged≥25 y and women≥50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF≤12 µg/L (cases and iron replete controls (SF>100 µg/L in men, SF>50 µg/L in women. Regression analysis was used to examine the association between case-control status (336 cases, 343 controls and quantitative serum iron measures and 331,060 single nucleotide polymorphism (SNP genotypes, with replication analyses performed in a sample of 71 cases and 161 controls from a population of white male and female veterans screened at a US Veterans Affairs (VA medical center. Five SNPs identified in the GWAS met genome-wide statistical significance for association with at least one iron measure, rs2698530 on chr. 2p14; rs3811647 on chr. 3q22, a known SNP in the transferrin (TF gene region; rs1800562 on chr. 6p22, the C282Y mutation in the HFE gene; rs7787204 on chr. 7p21; and rs987710 on chr. 22q11 (GWAS observed P<1.51×10(-7 for all. An association between total iron binding capacity and SNP rs3811647 in the TF gene (GWAS observed P=7.0×10(-9, corrected P=0.012 was replicated within the VA samples (observed P=0.012. Associations with the C282Y mutation in the HFE gene also were replicated. The joint analysis of the HEIRS and VA samples revealed strong associations between rs2698530 on chr. 2p14 and iron status outcomes. These results confirm a previously-described TF polymorphism and implicate one potential new locus as a target for gene identification.

Brain transcriptome perturbations in the Hfe(-/-) mouse model of genetic iron loading.

Science.gov (United States)

Johnstone, Daniel; Graham, Ross M; Trinder, Debbie; Delima, Roheeth D; Riveros, Carlos; Olynyk, John K; Scott, Rodney J; Moscato, Pablo; Milward, Elizabeth A

2012-04-11

Severe disruption of brain iron homeostasis can cause fatal neurodegenerative disease, however debate surrounds the neurologic effects of milder, more common iron loading disorders such as hereditary hemochromatosis, which is usually caused by loss-of-function polymorphisms in the HFE gene. There is evidence from both human and animal studies that HFE gene variants may affect brain function and modify risks of brain disease. To investigate how disruption of HFE influences brain transcript levels, we used microarray and real-time reverse transcription polymerase chain reaction to assess the brain transcriptome in Hfe(-/-) mice relative to wildtype AKR controls (age 10 weeks, n≥4/group). The Hfe(-/-) mouse brain showed numerous significant changes in transcript levels (pgenes relating to transcriptional regulation (FBJ osteosarcoma oncogene Fos, early growth response genes), neurotransmission (glutamate NMDA receptor Grin1, GABA receptor Gabbr1) and synaptic plasticity and memory (calcium/calmodulin-dependent protein kinase IIα Camk2a). As previously reported for dietary iron-supplemented mice, there were altered levels of transcripts for genes linked to neuronal ceroid lipofuscinosis, a disease characterized by excessive lipofuscin deposition. Labile iron is known to enhance lipofuscin generation which may accelerate brain aging. The findings provide evidence that iron loading disorders can considerably perturb levels of transcripts for genes essential for normal brain function and may help explain some of the neurologic signs and symptoms reported in hemochromatosis patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Contribution of Hfe expression in macrophages to the regulation of hepatic hepcidin levels and iron loading

OpenAIRE

Makui, Hortence; Soares, Ricardo J.; Jiang, Wenlei; Constante, Marco; Santos, Manuela M.

2005-01-01

Hereditary hemochromatosis (HH), an iron overload disease associated with mutations in the HFE gene, is characterized by increased intestinal iron absorption and consequent deposition of excess iron, primarily in the liver. Patients with HH and Hfe-deficient (Hfe−/−) mice manifest inappropriate expression of the iron absorption regulator hepcidin, a peptide hormone produced by the liver in response to iron loading. In this study, we investigated the contribution of Hfe expression in macrophag...

The hemochromatosis protein HFE 20 years later: An emerging role in antigen presentation and in the immune system.

Science.gov (United States)

Reuben, Alexandre; Chung, Jacqueline W; Lapointe, Réjean; Santos, Manuela M

2017-09-01

Since its discovery, the hemochromatosis protein HFE has been primarily defined by its role in iron metabolism and homeostasis, and its involvement in the genetic disease termed hereditary hemochromatosis (HH). While HH patients are typically afflicted by dysregulated iron levels, many are also affected by several immune defects and increased incidence of autoimmune diseases that have thereby implicated HFE in the immune response. Growing evidence has supported an immunological role for HFE with recent studies describing HFE specifically as it relates to MHC I antigen presentation. Here, we present a comprehensive overview of the relationship between iron metabolism, HFE, and the immune system to better understand the origin and cause of immune defects in HH patients. We further describe the role of HFE in MHC I antigen presentation and its potential to impair autoimmune responses in homeostatic conditions, a mechanism which may be exploited by tumors to evade immune surveillance. Overall, this increased understanding of the role of HFE in the immune response sets the stage for better treatment and management of HH and other iron-related diseases, as well as of the immune defects related to this condition. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

30 CFR 282.23 - Testing Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Testing Plan. 282.23 Section 282.23 Mineral... § 282.23 Testing Plan. All testing activities shall be conducted in accordance with a Testing Plan... detailed Mining Plan than is obtainable under an approved Delineation Plan, to prepare feasibility studies...

30 CFR 282.22 - Delineation Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Delineation Plan. 282.22 Section 282.22 Mineral... § 282.22 Delineation Plan. All exploration activities shall be conducted in accordance with a Delineation Plan submitted by the lessee and approved by the Director. The Delineation Plan shall describe the...

Global transcriptional response to Hfe deficiency and dietary iron overload in mouse liver and duodenum.

Directory of Open Access Journals (Sweden)

Alejandra Rodriguez

2009-09-01

Full Text Available Iron is an essential trace element whose absorption is usually tightly regulated in the duodenum. HFE-related hereditary hemochromatosis (HH is characterized by abnormally low expression of the iron-regulatory hormone, hepcidin, which results in increased iron absorption. The liver is crucial for iron homeostasis as it is the main production site of hepcidin. The aim of this study was to explore and compare the genome-wide transcriptome response to Hfe deficiency and dietary iron overload in murine liver and duodenum. Illumina arrays containing over 47,000 probes were used to study global transcriptional changes. Quantitative RT-PCR (Q-RT-PCR was used to validate the microarray results. In the liver, the expression of 151 genes was altered in Hfe(-/- mice while dietary iron overload changed the expression of 218 genes. There were 173 and 108 differentially expressed genes in the duodenum of Hfe(-/- mice and mice with dietary iron overload, respectively. There was 93.5% concordance between the results obtained by microarray analysis and Q-RT-PCR. Overexpression of genes for acute phase reactants in the liver and a strong induction of digestive enzyme genes in the duodenum were characteristic of the Hfe-deficient genotype. In contrast, dietary iron overload caused a more pronounced change of gene expression responsive to oxidative stress. In conclusion, Hfe deficiency caused a previously unrecognized increase in gene expression of hepatic acute phase proteins and duodenal digestive enzymes.

30 CFR 282.24 - Mining Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Mining Plan. 282.24 Section 282.24 Mineral... § 282.24 Mining Plan. All OCS mineral development and production activities shall be conducted in accordance with a Mining Plan submitted by the lessee and approved by the Director. A Mining Plan shall...

30 CFR 282.26 - Contingency Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Contingency Plan. 282.26 Section 282.26 Mineral... § 282.26 Contingency Plan. (a) When required by the Director, a lessee shall include a Contingency Plan as part of its request for approval of a Delineation, Testing, or Mining Plan. The Contingency Plan...

Anti-obesity and pro-diabetic effects of hemochromatosis.

Science.gov (United States)

Abbas, Mousa Al; Abraham, Deveraprabu; Kushner, James P; McClain, Donald A

2014-10-01

Levels of tissue iron contribute to determining diabetes risk, but little is known about the effects of higher iron levels on weight, and on the interaction of weight and iron overload on diabetes risk. Therefore, the effect of iron on body mass index and diabetes in individuals with iron overload from hereditary hemochromatosis (HH), compared to non-HH siblings and historical controls was examined. Chart reviews were performed on a cohort of adults (age ≥40, N = 101) with the common C282Y/C282Y HFE genotype, compared to wild type siblings (N = 32) and comparable NHANES cohorts, with respect to body mass index and diabetes status. Males with HH have lower body mass index (BMI) than control siblings. Females had a trend toward decreased BMI that was not significant, possibly related to decreased degrees of iron overload. In both males and females, increased rates of diabetes were seen, especially in the overweight or obese. High tissue iron levels may be both pro- and anti-diabetic. The prevalence of obesity and diabetes in HH is likely dependent upon the degree of iron overload, caloric intake, and other genetic and environmental factors, contributing to the observed heterogeneity in the frequency of disease-related morbidities in HH. Copyright © 2014 The Obesity Society.

Heat transfer and entropy generation analysis of HFE 7000 based nanorefrigerants

OpenAIRE

Helvaci, H.; Khan, Zulfiqar Ahmad

2017-01-01

In this study, two dimensional numerical simulations of forced convection flow of HFE 7000 based nanofluids in a horizontal circular tube subjected to a constant and uniform heat flux in laminar flow was performed by using single phase homogeneous model. Four different nanofluids considered in the present study are Al2O3, CuO, SiO2 and MgO nanoparticles dispersed in pure HFE 7000. The simulations were performed with particle volumetric concentrations of 0, 1, 4 and 6% and Reynolds number of 4...

Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

Science.gov (United States)

Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

2016-06-01

Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Spent nuclear fuel project, Cold Vacuum Drying Facility human factors engineering (HFE) analysis: Results and findings

International Nuclear Information System (INIS)

Garvin, L.J.

1998-01-01

This report presents the background, methodology, and findings of a human factors engineering (HFE) analysis performed in May, 1998, of the Spent Nuclear Fuels (SNF) Project Cold Vacuum Drying Facility (CVDF), to support its Preliminary Safety Analysis Report (PSAR), in responding to the requirements of Department of Energy (DOE) Order 5480.23 (DOE 1992a) and drafted to DOE-STD-3009-94 format. This HFE analysis focused on general environment, physical and computer workstations, and handling devices involved in or directly supporting the technical operations of the facility. This report makes no attempt to interpret or evaluate the safety significance of the HFE analysis findings. The HFE findings presented in this report, along with the results of the CVDF PSAR Chapter 3, Hazards and Accident Analyses, provide the technical basis for preparing the CVDF PSAR Chapter 13, Human Factors Engineering, including interpretation and disposition of findings. The findings presented in this report allow the PSAR Chapter 13 to fully respond to HFE requirements established in DOE Order 5480.23. DOE 5480.23, Nuclear Safety Analysis Reports, Section 8b(3)(n) and Attachment 1, Section-M, require that HFE be analyzed in the PSAR for the adequacy of the current design and planned construction for internal and external communications, operational aids, instrumentation and controls, environmental factors such as heat, light, and noise and that an assessment of human performance under abnormal and emergency conditions be performed (DOE 1992a)

A systematic review of human factors and ergonomics (HFE)-based healthcare system redesign for quality of care and patient safety.

Science.gov (United States)

Xie, Anping; Carayon, Pascale

2015-01-01

Healthcare systems need to be redesigned to provide care that is safe, effective and efficient, and meets the multiple needs of patients. This systematic review examines how human factors and ergonomics (HFE) is applied to redesign healthcare work systems and processes and improve quality and safety of care. We identified 12 projects representing 23 studies and addressing different physical, cognitive and organisational HFE issues in a variety of healthcare systems and care settings. Some evidence exists for the effectiveness of HFE-based healthcare system redesign in improving process and outcome measures of quality and safety of care. We assessed risk of bias in 16 studies reporting the impact of HFE-based healthcare system redesign and found varying quality across studies. Future research should further assess the impact of HFE on quality and safety of care, and clearly define the mechanisms by which HFE-based system redesign can improve quality and safety of care.

A measurement of π+p backward elastic differential cross-sections from 1.282 to 2.472 GeV/c

International Nuclear Information System (INIS)

Candlin, D.J.; Lowe, D.C.; Peach, K.J.

1984-02-01

New high statistics measurements of π + p elastic scattering differential cross-sections are presented at 30 momentum points between 1.282 and 2.472 GeV/c, covering most of the angular distribution outside the forward diffractive peak. These data show significant disagreements at some momenta with previous high statistics experiments and with current partial wave analyses. (author)

Possible Alzheimer’s Disease in an Apolipoprotein E2 Homozygote

Science.gov (United States)

Ignatov, Ignat; Belden, Christine; Jacobson, Sandra; Connor, Donald; Sabbagh, Marwan N.

2010-01-01

The objective of this study was to describe a case of Alzheimer’s disease in an ApoE ε2/ε2 homozygote. ApoE ε2/ε2 is the rarest of the apolipoprotein E genotypes, representing only 1.4% of the population. There is only one case reported in the literature of a nonagenarian with minimal cognitive changes whose brain showed AD pathology on postmortem study. Here we report an 87-year-old ApoE ε2/ε2 female who meets clinical criteria for Alzheimer’s disease, with confirmation from neuropsychological testing and PET scan. Clinical course is typical for Alzheimer’s disease with decline on the Mini-Mental Status Examination from a score of 25 to 19 over 3.5 years. The patient is currently treated with donepezil and memantine. In conclusion, a clinically confirmed case of Alzheimer’s disease is rare in Apo E2 homozygotes but can occur. PMID:19158419

The expression of the soluble HFE corresponding transcript is up-regulated by intracellular iron and inhibits iron absorption in a duodenal cell model

OpenAIRE

Silva, Bruno; Ferreira, Joana; Santos, Vera; Baldaia, Cilénia; Serejo, Fátima; Faustino, Paula

2014-01-01

Background and aims: Dietary iron absorption regulation is a key-step for the maintenance of body iron homeostasis. Besides the HFE full-length protein, the HFE gene codes for alternative splicing variants responsible for the synthesis of a soluble form of HFE protein (sHFE). Here we aimed to determine whether sHFE transcript levels respond to different iron conditions in duodenal, macrophage and hepatic cell models, as well, in vivo, in the liver. Furthermore, we determined the functional ef...

Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter.

Science.gov (United States)

Pelham, Christopher; Jimenez, Tamara; Rodova, Marianna; Rudolph, Angela; Chipps, Elizabeth; Islam, M Rafiq

2013-12-01

Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression. © 2013.

A role for sex and a common HFE gene variant in brain iron uptake.

Science.gov (United States)

Duck, Kari A; Neely, Elizabeth B; Simpson, Ian A; Connor, James R

2018-03-01

HFE (high iron) is an essential protein for regulating iron transport into cells. Mutations of the HFE gene result in loss of this regulation causing accumulation of iron within the cell. The mutated protein has been found increasingly in numerous neurodegenerative disorders in which increased levels of iron in the brain are reported. Additionally, evidence that these mutations are associated with elevated brain iron challenges the paradigm that the brain is protected by the blood-brain barrier. While much has been studied regarding the role of HFE in cellular iron uptake, it has remained unclear what role the protein plays in the transport of iron into the brain. We investigated regulation of iron transport into the brain using a mouse model with a mutation in the HFE gene. We demonstrated that the rate of radiolabeled iron ( 59 Fe) uptake was similar between the two genotypes despite higher brain iron concentrations in the mutant. However, there were significant differences in iron uptake between males and females regardless of genotype. These data indicate that brain iron status is consistently maintained and tightly regulated at the level of the blood-brain barrier.

27 CFR 28.282 - Beer.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Beer. 28.282 Section 28.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Beer. When beer has been laden on board the aircraft for use as supplies, the customs officer shall...

46 CFR 282.30 - Payment of subsidy.

Science.gov (United States)

2010-10-01

... include for payment in such voucher the amount of ODS accrued for the voyages terminated during the period. ... 46 Shipping 8 2010-10-01 2010-10-01 false Payment of subsidy. 282.30 Section 282.30 Shipping... COMMERCE OF THE UNITED STATES Subsidy Payment and Billing Procedures § 282.30 Payment of subsidy...

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene.

Science.gov (United States)

Luszczyk, Marcin; Kaczorowska-Hac, Barbara; Milosz, Ewa; Adamkiewicz-Drozynska, Elzbieta; Ziemann, Ewa; Laskowski, Radoslaw; Flis, Damian; Rokicka-Hebel, Magdalena; Antosiewicz, Jedrzej

2017-01-01

Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE) mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

46 CFR 282.11 - Ranking of flags.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Ranking of flags. 282.11 Section 282.11 Shipping... COMMERCE OF THE UNITED STATES Foreign-Flag Competition § 282.11 Ranking of flags. The operators under each... priority of costs which are representative of the flag. For liner cargo vessels, the ranking of operators...

Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

LYU Tingxia

2016-08-01

Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice.

Science.gov (United States)

Nandar, Wint; Neely, Elizabeth B; Unger, Erica; Connor, James R

2013-06-01

Because of the increasing evidence that H63D HFE polymorphism appears in higher frequency in neurodegenerative diseases, we evaluated the neurological consequences of H63D HFE in vivo using mice that carry H67D HFE (homologous to human H63D). Although total brain iron concentration did not change significantly in the H67D mice, brain iron management proteins expressions were altered significantly. The 6-month-old H67D mice had increased HFE and H-ferritin expression. At 12 months, H67D mice had increased H- and L-ferritin but decreased transferrin expression suggesting increased iron storage and decreased iron mobilization. Increased L-ferritin positive microglia in H67D mice suggests that microglia increase iron storage to maintain brain iron homeostasis. The 6-month-old H67D mice had increased levels of GFAP, increased oxidatively modified protein levels, and increased cystine/glutamate antiporter (xCT) and hemeoxygenase-1 (HO-1) expression indicating increased metabolic and oxidative stress. By 12 months, there was no longer increased astrogliosis or oxidative stress. The decrease in oxidative stress at 12 months could be related to an adaptive response by nuclear factor E2-related factor 2 (Nrf2) that regulates antioxidant enzymes expression and is increased in the H67D mice. These findings demonstrate that the H63D HFE impacts brain iron homeostasis, and promotes an environment of oxidative stress and induction of adaptive mechanisms. These data, along with literature reports on humans with HFE mutations provide the evidence to overturn the traditional paradigm that the brain is protected from HFE mutations. The H67D knock-in mouse can be used as a model to evaluate how the H63D HFE mutation contributes to neurodegenerative diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

Fatigue Crack Growth Behavior of Nickel-base Superalloy Haynes 282 at 550-750 °C

Science.gov (United States)

Rozman, K. A.; Kruzic, J. J.; Hawk, J. A.

2015-08-01

The fatigue crack growth rates for nickel-based superalloy Haynes 282 were measured at temperatures of 550, 650, and 750 °C using compact tension specimens with a load ratio of 0.1 and cyclic loading frequencies of 25 Hz and 0.25 Hz. Increasing the temperature from 550 to 750 °C caused the fatigue crack growth rates to increase from ~20 to 60% depending upon the applied stress intensity level. The effect of reducing the applied loading frequency increased the fatigue crack growth rates from ~20 to 70%, also depending upon the applied stress intensity range. The crack path was observed to be transgranular for the temperatures and frequencies used during fatigue crack growth rate testing. At 750 °C, there were some indications of limited intergranular cracking excursions at both loading frequencies; however, the extent of intergranular crack growth was limited and the cause is not understood at this time.

A Mouse Model of Cardiomyopathy Induced by Mutations in the Hemochromatosis HFE Gene.

Science.gov (United States)

Djemai, Haidar; Thomasson, Rémi; Trzaskus, Yvan; Mougenot, Nathalie; Meziani, Amira; Toussaint, Jean-François; Noirez, Philippe; Vitiello, Damien

2017-07-01

The heart is 1 of the organs most affected by hereditary hemochromatosis (HH). The clinical impact of cardiomyopathy in patients with HH requires a particular diagnosis and less invasive treatments. We developed a model of cardiomyopathy in knockout (KO) mice for the high-Fe (HFE) gene and assessed left ventricular (LV) function and structure from 7-20 months. Male wild-type (WT) heterozygous and KO SV129 mice for the HFE gene were used in this study. Twenty-four mice were used to assess LV function and structure by echocardiography at 7, 14, 18, and 20 months. Evaluations of LV function and structure and myocardial fibrosis were performed at 7 and 20 months. The percent decrease of LV thickness-to-radius ratio between 7 and 20 months was higher in KO mice compared with WT mice (-30.2% ± 5.3% vs -10.5% ± 4.9%; P HFE-related hemochromatosis. Copyright © 2017 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

Directory of Open Access Journals (Sweden)

Marcin Luszczyk

2017-01-01

Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

Intragenic haplotype analysis of common HFE mutations in the ...

Indian Academy of Sciences (India)

mutation <100 generations ago in the Celtic populations of mainland Europe, with a ... 0.9–5.8%, evidencing regional differences in distribution across the ..... and H63D alleles in the HFE gene among various Jewish ethnic groups in Israel: a ...

27 CFR 24.282 - Multiple transfers.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Multiple transfers. 24.282 Section 24.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... transfer record for all wine (including distilling material and vinegar stock) transferred by pipeline to...

46 CFR 282.23 - Hull and machinery insurance.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 282.23 Section 282.23... COMMERCE OF THE UNITED STATES Calculation of Subsidy Rates § 282.23 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery...

Maternal hemochromatosis gene H63D single-nucleotide polymorphism and lead levels of placental tissue, maternal and umbilical cord blood

Energy Technology Data Exchange (ETDEWEB)

Kayaalti, Zeliha, E-mail: kayaalti@ankara.edu.tr [Ankara University, Institute of Forensic Sciences, Ankara (Turkey); Kaya-Akyüzlü, Dilek [Ankara University, Institute of Forensic Sciences, Ankara (Turkey); Söylemez, Esma [Ankara University, Institute of Forensic Sciences, Ankara (Turkey); Middle Black Sea Passage Generation of Agricultural Research Station Director, Tokat (Turkey); Söylemezoğlu, Tülin [Ankara University, Institute of Forensic Sciences, Ankara (Turkey)

2015-07-15

Human hemochromatosis protein (HFE), a major histocompatibility complex class I-like integral membrane protein, participates in the down regulation of intestinal iron absorption by binding to transferrin receptor (TR). HFE competes with transferrin-bound iron for the TR and thus reduces uptake of iron into cells. On the other hand, a lack of HFE increases the intestinal absorption of iron similarly to iron deficiency associated with increasing in absorption and deposition of lead. During pregnancy, placenta cannot prevent transfer lead to the fetus; even low-level lead poisoning causes neurodevelopmental toxicity in children. The aim of this study was to determine the association between the maternal HFE H63D single-nucleotide polymorphism and lead levels in placental tissue, maternal blood and umbilical cord bloods. The study population comprised 93 mother–placenta pairs. Venous blood from mother was collected to investigate lead levels and HFE polymorphism that was detected by standard PCR–RFLP technique. Cord bloods and placentas were collected for lead levels which were analyzed by dual atomic absorption spectrometer system. The HFE H63D genotype frequencies of mothers were found as 75.3% homozygote typical (HH), 23.6% heterozygote (HD) and 1.1% homozygote atypical (DD). Our study results showed that the placental tissue, umbilical cord and maternal blood lead levels of mothers with HD+DD genotypes were significantly higher than those with HH genotype (p<0.05). The present study indicated for the first time that mothers with H63D gene variants have higher lead levels of their newborn's placentas and umbilical cord bloods. - Highlights: • Mothers with H63D gene variants have higher lead levels of their newborn's umbilical cord blood. • Unborn child of women with HD+DD genotypes may be at increased risk of internal exposure to lead. • Maternal HFE status may have an effect on increased placenta, maternal and cord blood lead levels. �

Maternal hemochromatosis gene H63D single-nucleotide polymorphism and lead levels of placental tissue, maternal and umbilical cord blood

International Nuclear Information System (INIS)

Kayaalti, Zeliha; Kaya-Akyüzlü, Dilek; Söylemez, Esma; Söylemezoğlu, Tülin

2015-01-01

Human hemochromatosis protein (HFE), a major histocompatibility complex class I-like integral membrane protein, participates in the down regulation of intestinal iron absorption by binding to transferrin receptor (TR). HFE competes with transferrin-bound iron for the TR and thus reduces uptake of iron into cells. On the other hand, a lack of HFE increases the intestinal absorption of iron similarly to iron deficiency associated with increasing in absorption and deposition of lead. During pregnancy, placenta cannot prevent transfer lead to the fetus; even low-level lead poisoning causes neurodevelopmental toxicity in children. The aim of this study was to determine the association between the maternal HFE H63D single-nucleotide polymorphism and lead levels in placental tissue, maternal blood and umbilical cord bloods. The study population comprised 93 mother–placenta pairs. Venous blood from mother was collected to investigate lead levels and HFE polymorphism that was detected by standard PCR–RFLP technique. Cord bloods and placentas were collected for lead levels which were analyzed by dual atomic absorption spectrometer system. The HFE H63D genotype frequencies of mothers were found as 75.3% homozygote typical (HH), 23.6% heterozygote (HD) and 1.1% homozygote atypical (DD). Our study results showed that the placental tissue, umbilical cord and maternal blood lead levels of mothers with HD+DD genotypes were significantly higher than those with HH genotype (p<0.05). The present study indicated for the first time that mothers with H63D gene variants have higher lead levels of their newborn's placentas and umbilical cord bloods. - Highlights: • Mothers with H63D gene variants have higher lead levels of their newborn's umbilical cord blood. • Unborn child of women with HD+DD genotypes may be at increased risk of internal exposure to lead. • Maternal HFE status may have an effect on increased placenta, maternal and cord blood lead levels. �

30 CFR 282.11 - Director's authority.

Science.gov (United States)

2010-07-01

... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR Jurisdiction and Responsibilities of Director § 282.11 Director's authority. (a) In the exercise of jurisdiction under § 282.10, the Director is... of two or more OCS mineral leases or portions of two or more OCS mineral leases into a single mining...

Hereditary hemochromatosis and risk of ischemic heart disease

DEFF Research Database (Denmark)

Ellervik, Christina; Tybjaerg-Hansen, Anne; Grande, Peer

2005-01-01

BACKGROUND: We tested the hypothesis that the hereditary hemochromatosis genotypes C282Y/C282Y, C282Y/H63D, or C282Y/wild-type are risk factors for ischemic heart disease (IHD) and myocardial infarction (MI). METHODS AND RESULTS: We performed a prospective study of 9178 individuals from the Danish...

Iron regulation of hepcidin despite attenuated Smad1,5,8 signaling in mice without transferrin receptor 2 or Hfe

Science.gov (United States)

Corradini, Elena; Rozier, Molly; Meynard, Delphine; Odhiambo, Adam; Lin, Herbert Y.; Feng, Qi; Migas, Mary C.; Britton, Robert S.; Babitt, Jodie L.; Fleming, Robert E.

2011-01-01

Background & Aims HFE and transferrin receptor 2 (TFR2) are each necessary for the normal relationship between body iron status and liver hepcidin expression. In murine Hfe and Tfr2 knockout models of hereditary hemochromatosis (HH), signal transduction to hepcidin via the bone morphogenetic protein 6 (Bmp6)/Smad1,5,8 pathway is attenuated. We examined the effect of dietary iron on regulation of hepcidin expression via the Bmp6/Smad1,5,8 pathway using mice with targeted disruption of Tfr2, Hfe, or both genes. Methods Hepatic iron concentrations and mRNA expression of Bmp6 and hepcidin were compared with wild-type mice in each of the HH models on standard or iron-loading diets. Liver phospho-Smad (P-Smad)1,5,8 and Id1 mRNA levels were measured as markers of Bmp/Smad signaling. Results While Bmp6 expression was increased, liver hepcidin and Id1 expression were decreased in each of the HH models compared with wild-type mice. Each of the HH models also demonstrated attenuated P-Smad1,5,8 levels relative to liver iron status. Mice with combined Hfe/Tfr2 disruption were most affected. Dietary iron loading increased hepcidin and Id1 expression in each of the HH models. Compared with wild-type mice, HH mice demonstrated attenuated (Hfe knockout) or no increases in P-Smad1,5,8 levels in response to dietary iron loading. Conclusions These observations demonstrate that Tfr2 and Hfe are each required for normal signaling of iron status to hepcidin via Bmp6/Smad1,5,8 pathway. Mice with combined loss of Hfe and Tfr2 up-regulate hepcidin in response to dietary iron loading without increases in liver BMP6 mRNA or steady-state P-Smad1,5,8 levels. PMID:21745449

Involvement of the major histocompatibility complex region in the genetic regulation of circulating CD8 T-cell numbers in humans.

Science.gov (United States)

Cruz, E; Vieira, J; Gonçalves, R; Alves, H; Almeida, S; Rodrigues, P; Lacerda, R; Porto, G

2004-07-01

Variability in T-lymphocyte numbers is partially explained by a genetic regulation. From studies in animal models, it is known that the Major Histocompatibility Complex (MHC) is involved in this regulation. In humans, this has not been shown yet. The objective of the present study was to test the hypothesis that genes in the MHC region influence the regulation of T-lymphocyte numbers. Two approaches were used. Association studies between T-cell counts (CD4(+) and CD8(+)) or total lymphocyte counts and HLA class I alleles (A and B) or mutations in the HFE (C282Y and H63D), the hemochromatosis gene, in an unrelated population (n = 264). A second approach was a sibpair correlation analysis of the same T-cell counts in relation to HLA-HFE haplotypes in subjects belonging to 48 hemochromatosis families (n = 456 sibpairs). In the normal population, results showed a strong statistically significant association of the HLA-A*01 with high numbers of CD8(+) T cells and a less powerful association with the HLA-A*24 with low numbers of CD8(+) T cells. Sibpair correlations revealed the most significant correlation for CD8(+) T-cell numbers for sibpairs with HLA-HFE-identical haplotypes. This was not observed for CD4(+) T cells. These results show that the MHC region is involved in the genetic regulation of CD8(+) T-cell numbers in humans. Identification of genes responsible for this control may have important biological and clinical implications.

Diagnosis of hepatic iron overload: a family study illustrating pitfalls in diagnosing hemochromatosis.

Science.gov (United States)

Schranz, Melanie; Talasz, Heribert; Graziadei, Ivo; Winder, Thomas; Sergi, Consolato; Bogner, Klaus; Vogel, Wolfgang; Zoller, Heinz

2009-03-01

Recent identification of genetic variants in iron storage disease has changed the classification system and diagnostic algorithms for hemochromatosis. Clinical diagnosis of the disease requires phenotypic evidence of iron overload because the commonly disease-associated HFE genotypes have an incomplete penetrance. Furthermore, approximately 20% of patients with a clinical diagnosis of hemochromatosis have no disease-associated genotype, which underlines the importance of clear phenotypic criteria of hemochromatosis. A diagnosis of hemochromatosis cannot be made even in patients with liver cirrhosis simply on the basis of genetic testing that indicates that iron overload is the cause of the disease and not its consequence. Proper diagnosis requires integration of clinical presentation, family history, and the results of biochemical and histopathologic tests. Here we propose a rational diagnostic algorithm for hepatic iron overload syndromes and illustrate potential pitfalls by presenting a family study in a pedigree with rare HFE variants (H63D and E168Q), in cis on the same chromosome. Although the clinical suspicion of hemochromatosis was confirmed by histology, chemical analysis of liver tissue revealed a normal hepatic iron concentration, which is compatible with the genetic finding of 1 normal and 1 doubly mutated allele. In conclusion, clinical suspicion of hemochromatosis and elevated serum iron parameters should prompt HFE genotyping for C282Y and H63D. Should they be uninformative, further genetic tests should be recommended only if iron overload in liver tissue has been confirmed chemically.

An Excel Macro to Plot the HFE-Diagram to Identify Sea Water Intrusion Phases.

Science.gov (United States)

Giménez-Forcada, Elena; Sánchez San Román, F Javier

2015-01-01

A hydrochemical facies evolution diagram (HFE-D) is a multirectangular diagram, which is a useful tool in the interpretation of sea water intrusion processes. This method note describes a simple method for generating an HFE-D plot using the spreadsheet software package, Microsoft Excel. The code was applied to groundwater from the alluvial coastal plain of Grosseto (Tuscany, Italy), which is characterized by a complex salinization process in which sea water mixes with sulfate or bicarbonate recharge water. © 2014, National GroundWater Association.

Iron-related gene variants and brain iron in multiple sclerosis and healthy individuals

Directory of Open Access Journals (Sweden)

Jesper Hagemeier

2018-01-01

Full Text Available Brain iron homeostasis is known to be disturbed in multiple sclerosis (MS, yet little is known about the association of common gene variants linked to iron regulation and pathological tissue changes in the brain. In this study, we investigated the association of genetic determinants linked to iron regulation with deep gray matter (GM magnetic susceptibility in both healthy controls (HC and MS patients. Four hundred (400 patients with MS and 150 age- and sex-matched HCs were enrolled and obtained 3 T MRI examination. Three (3 single nucleotide polymorphisms (SNPs associated with iron regulation were genotyped: two SNPs in the human hereditary hemochromatosis protein gene HFE: rs1800562 (C282Y mutation and rs1799945 (H63D mutation, as well as the rs1049296 SNP in the transferrin gene (C2 mutation. The effects of disease and genetic status were studied using quantitative susceptibility mapping (QSM voxel-based analysis (VBA and region-of-interest (ROI analysis of the deep GM. The general linear model framework was used to compare groups. Analyses were corrected for age and sex, and adjusted for false discovery rate. We found moderate increases in susceptibility in the right putamen of participants with the C282Y (+6.1 ppb and H63D (+6.9 ppb gene variants vs. non-carriers, as well as a decrease in thalamic susceptibility of progressive MS patients with the C282Y mutation (left: −5.3 ppb, right: −6.7 ppb, p < 0.05. Female MS patients had lower susceptibility in the caudate (−6.0 ppb and putamen (left: −3.9 ppb, right: −4.6 ppb than men, but only when they had a wild-type allele (p < 0.05. Iron-gene linked increases in putamen susceptibility (in HC and relapsing remitting MS and decreases in thalamus susceptibility (in progressive MS, coupled with apparent sex interactions, indicate that brain iron in healthy and disease states may be influenced by genetic factors.

40 CFR 265.282 - Special requirements for incompatible wastes.

Science.gov (United States)

2010-07-01

..., STORAGE, AND DISPOSAL FACILITIES Land Treatment § 265.282 Special requirements for incompatible wastes... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for incompatible wastes. 265.282 Section 265.282 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...

40 CFR 264.282 - Special requirements for incompatible wastes.

Science.gov (United States)

2010-07-01

... DISPOSAL FACILITIES Land Treatment § 264.282 Special requirements for incompatible wastes. The owner or... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for incompatible wastes. 264.282 Section 264.282 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...

Evidence for the Influence of the Iron Regulatory MHC Class I Molecule HFE on Tumor Progression in Experimental Models and Clinical Populations

Science.gov (United States)

Weston, Cody; Connor, James

2014-01-01

Proteins involved in iron regulation are modifiers of cancer risk and progression. Of these, the HFE protein (high iron gene and its protein product) is of particular interest because of its interaction with both iron handling and immune function and the high rate of genetic polymorphisms resulting in a mutant protein. Clinical studies suggest that HFE polymorphisms increase the risk of certain cancers, but the inconsistent outcomes suggest a more nuanced effect, possibly interacting with other genetic or environmental factors. Some basic science research has been conducted to begin to understand the implications of variant HFE genotype on cancer, but the story is far from complete. In particular, putative mechanisms exist for HFE to affect tumor progression through its role in iron handling and its major histocompatibility complex class I structural features. In this review, the current understanding of the role of HFE in cancer is described and models for future directions are identified. PMID:25520556

47 CFR 25.282 - Orbit raising maneuvers.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 2 2010-10-01 2010-10-01 false Orbit raising maneuvers. 25.282 Section 25.282 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS... geostationary satellite orbit under this part is also authorized to transmit in connection with short-term...

Implicating the H63D polymorphism in the HFE gene in increased incidence of solid cancers: a meta-analysis.

Science.gov (United States)

Shen, L L; Gu, D Y; Zhao, T T; Tang, C J; Xu, Y; Chen, J F

2015-10-29

A number of previous studies have demonstrated that the HFE H63D polymorphism is associated with increased risk of incidence multiple types of cancer, including colorectal cancer, breast cancer, liver cancer, pancreatic cancer, and gynecological malignant tumors. However, the clinical outcomes were inconsistent. Therefore, this meta-analysis was conducted to summarize the effect of the H63D variant on the incidence of solid tumor. PubMed and EMBASE databases were searched for articles associating the HFE H63D polymorphism with cancer risk. The relationships were evaluated by calculating the pooled odds ratios (ORs) with 95% confidence intervals (CIs). A total of 28 studies, including 7728 cancer cases and 11,895 controls, were identified. Statistically significant associations were identified between the HFE H63D polymorphism and solid cancer risk (CG vs CC, OR = 1.14, 95%CI = 1.07-1.23, P HFE H63D polymorphism may play a critical role in the increased aggressiveness of hepatocellular carcinoma and pancreatic cancer.

Composición química del huevo de tortuga lora (Lepidochelys olivacea) y evaluación de su calidad física y microbiológica durante su almacenamiento

OpenAIRE

Mora Castro, Randall; Chaves Quirós, Ana Cecilia

1997-01-01

Se determinó la composición química de los huevos de tortuga lora (Lepidochelys olivacea) y se evaluó su calidad física y microbiológica durante el almacenamiento a 5 °C y 25 °C y a una humedad relativa de 92 %. Se encontró que los huevos de tortuga lora tienen una masa promedio de 27,9 g y están constituidos por un 58,0 % de yema, un 38,0 % de clara y un 4,0 % de cáscara. La cáscara contiene un 37,0 % de humedad, un 28,2 % de proteína y un 36,0 % de materia mineral. En la clara el compone...

FAMILY ANAMNESIS OF CHILDREN WITH MUTATION OF THE INHERITED HEMOCHROMATOSIS

Directory of Open Access Journals (Sweden)

S.I. Polyakova

2010-01-01

Full Text Available The inherited burdened is studied on diseases, associated with an overload iron in 41 children with frequent mutations of the inherited hemochromatosis (IG of a 1 type (C282y, H63d, S65c. Control group was made by 27 children with undiscovered frequent mutations of NG. Frequencies of iron-associated diseases are compared for 560 members of families which have children with mutations of IG and 390 members of families which have children without IG mutations. Some features of medical-genealogical anamnesis, which can be conditioned of siderosis, are exposed, and indirectly specify in the presence of mutations in the gene of HFE. So, the high frequency of oncologic diseases, diabetes mellitus, hepatocirrhosis and deaths of relatives under the age of 50 years are the foundation for research of exchange of iron and holding of molecular-genetic research of the inherited hemochromatosis. Key words: inherited hemochromatosis, heredity, children. (Pediatric Pharmacology. – 2010; 7(3:52-56

Mutation in HFE gene decreases manganese accumulation and oxidative stress in the brain after olfactory manganese exposure.

Science.gov (United States)

Ye, Qi; Kim, Jonghan

2016-06-01

Increased accumulation of manganese (Mn) in the brain is significantly associated with neurobehavioral deficits and impaired brain function. Airborne Mn has a high systemic bioavailability and can be directly taken up into the brain, making it highly neurotoxic. While Mn transport is in part mediated by several iron transporters, the expression of these transporters is altered by the iron regulatory gene, HFE. Mutations in the HFE gene are the major cause of the iron overload disorder, hereditary hemochromatosis, one of the prevalent genetic diseases in humans. However, whether or not HFE mutation modifies Mn-induced neurotoxicity has not been evaluated. Therefore, our goal was to define the role of HFE mutation in Mn deposition in the brain and the resultant neurotoxic effects after olfactory Mn exposure. Mice carrying the H67D HFE mutation, which is homologous to the H63D mutation in humans, and their control, wild-type mice, were intranasally instilled with MnCl2 with different doses (0, 0.2, 1.0 and 5.0 mg kg(-1)) daily for 3 days. Mn levels in the blood, liver and brain were determined using inductively-coupled plasma mass spectrometry (ICP-MS). H67D mutant mice showed significantly lower Mn levels in the blood, liver, and most brain regions, especially in the striatum, while mice fed an iron-overload diet did not. Moreover, mRNA expression of ferroportin, an essential exporter of iron and Mn, was up-regulated in the striatum. In addition, the levels of isoprostane, a marker of lipid peroxidation, were increased in the striatum after Mn exposure in wild-type mice, but were unchanged in H67D mice. Together, our results suggest that the H67D mutation provides decreased susceptibility to Mn accumulation in the brain and neurotoxicity induced by inhaled Mn.

Molecular Diagnostic and Pathogenesis of Hereditary Hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo C. J. L. Santos

2012-02-01

Full Text Available Hereditary hemochromatosis (HH is an autosomal recessive disorder characterized by enhanced intestinal absorption of dietary iron. Without therapeutic intervention, iron overload leads to multiple organ damage such as liver cirrhosis, cardiomyopathy, diabetes, arthritis, hypogonadism and skin pigmentation. Most HH patients carry HFE mutant genotypes: homozygosity for p.Cys282Tyr or p.Cys282Tyr/p.His63Asp compound heterozygosity. In addition to HFE gene, mutations in the genes that encode hemojuvelin (HJV, hepcidin (HAMP, transferrin receptor 2 (TFR2 and ferroportin (SLC40A1 have been associated with regulation of iron homeostasis and development of HH. The aim of this review was to identify the main gene mutations involved in the pathogenesis of type 1, 2, 3 and 4 HH and their genetic testing indication. HFE testing for the two main mutations (p.Cys282Tyr and p.His63Asp should be performed in all patients with primary iron overload and unexplained increased transferrin saturation and/or serum ferritin values. The evaluation of the HJV p.Gly320Val mutation must be the molecular test of choice in suspected patients with juvenile hemochromatosis with less than 30 years and cardiac or endocrine manifestations. In conclusion, HH is an example that genetic testing can, in addition to performing the differential diagnostic with secondary iron overload, lead to more adequate and faster treatment.

Examination of HFE associations with childhood leukemia risk and extension to other iron regulatory genes.

Science.gov (United States)

Kennedy, Amy E; Kamdar, Kala Y; Lupo, Philip J; Okcu, M Fatih; Scheurer, Michael E; Baum, Marianna K; Dorak, M Tevfik

2014-09-01

Hereditary hemochromatosis (HFE) variants correlating with body iron levels have shown associations with cancer risk, including childhood acute lymphoblastic leukemia (ALL). Using a multi-ethnic sample of cases and controls from Houston, TX, we examined two HFE variants (rs1800562 and rs1799945), one transferrin receptor gene (TFRC) variant (rs3817672) and three additional iron regulatory gene (IRG) variants (SLC11A2 rs422982; TMPRSS6 rs855791 and rs733655) for their associations with childhood ALL. Being positive for either of the HFE variants yielded a modestly elevated odds ratio (OR) for childhood ALL risk in males (1.40, 95% CI=0.83-2.35), which increased to 2.96 (95% CI=1.29-6.80) in the presence of a particular TFRC genotype for rs3817672 (P interaction=0.04). The TFRC genotype also showed an ethnicity-specific association, with increased risk observed in non-Hispanic Whites (OR=2.54, 95% CI=1.05-6.12; P interaction with ethnicity=0.02). The three additional IRG SNPs all showed individual risk associations with childhood ALL in males (OR=1.52-2.60). A polygenic model based on the number of variant alleles in five IRG SNPs revealed a linear increase in risk among males with the increasing number of variants possessed (OR=2.0 per incremental change, 95% CI=1.29-3.12; P=0.002). Our results replicated previous HFE risk associations with childhood ALL in a US population and demonstrated novel associations for IRG SNPs, thereby strengthening the hypothesis that iron excess mediated by genetic variants contributes to childhood ALL risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

Progress of Design Improvements for APR1400 Computerized Procedure System from HFE V and V results and Design Experience

International Nuclear Information System (INIS)

Lee, Sungjin; Seong, Nokyu

2015-01-01

This study shows major already improved design features from the above three processes and a design proposal for to-be-improving items. APR1400 CPS has been verified and validated by the HFE process, internal design review and site acceptance tests. APR1400 Computerized Procedure System (CPS) has been applied to Shin-Kori Nuclear Power Plant (SKN) 3 and 4 units, Shin-Hanul Nuclear Power Plant (SHN) 1 and 2 units and Baraka Nuclear Power Plant (BNPP) 1, 2, 3 and 4 units. Since APR1400 CPS is a first-of-a-kind (FOAK) human machine interface (HMI) for executing a computerized procedure in the nuclear power plant's main control room in South Korea, it has been continuously improved through a) the human factor engineering (HFE) verification and validation (V and V), b) the internal design review and c) prototype tests. Human engineering discrepancies (HEDs) can be identified by the HFE V and V activity. Some HEDs of APR1400 CPS for SKN 3 and 4 and SHN 1 and 2 have been adopted as a role of design improvement in the CPS system while others were regarded as an operator training requirement or part of task contents. Various requests for improving the CPS have been collected from those results. A HMI system should be improved continuously for removing potential defects. Some of introduced design features in this paper has been adopted for APR1400 nuclear power plants. Some of them are under the review in the CPS design team of KHNP

Fatigue Crack Growth Mechanisms for Nickel-based Superalloy Haynes 282 at 550-750 °C

Science.gov (United States)

Rozman, Kyle A.; Kruzic, Jamie J.; Sears, John S.; Hawk, Jeffrey A.

2015-10-01

The fatigue crack growth rates for nickel-based superalloy Haynes 282 were measured at 550, 650, and 750 °C using compact tension specimens with a load ratio of 0.1 and cyclic loading frequencies of 25 and 0.25 Hz. The crack path was observed to be primarily transgranular for all temperatures, and the observed effect of increasing temperature was to increase the fatigue crack growth rates. The activation energy associated with the increasing crack growth rates over these three temperatures was calculated less than 60 kJ/mol, which is significantly lower than typical creep or oxidation mechanisms; therefore, creep and oxidation cannot explain the increase in fatigue crack growth rates. Transmission electron microscopy was done on selected samples removed from the cyclic plastic zone, and a trend of decreasing dislocation density was observed with increasing temperature. Accordingly, the trend of increasing crack growth rates with increasing temperature was attributed to softening associated with thermally assisted cross slip and dislocation annihilation.

Cross Sections for Electron-Impact Dissociation of Alternative Etching Gas, C3HF7O

Science.gov (United States)

Tanaka, Hideyuki; Toyoda, Hirotaka; Sugai, Hideo

1998-09-01

The search for alternative for perfluorocarbon gases from the environmental point of view has resulted in a new etching gas, C3HF7O (1,2,2,2-tetrafluoroethyl-trifluoromethyl ether, abbreviated as HFE-227). In this paper, the first measurement of the absolute cross sections for the dissociation of HFE-227, is reported.The neutral dissociation is measured from the threshold to 250 eV by appearance mass spectrometry in a dual electron beam device.The threshold energies for the neutral dissociation into CF, CF2 and CF3 are 14.7, 12.5 and 11.2 eV, respectively.The cross sections for the dissociation from HFE-227 into CF3 and CF are larger than those from c-C4F8 (octafluorocyclobutane), but not for the dissociation into CF2.Besides the neutral dissociation, the cross sections for the dissociative ionization of HFE-227 are extensively measured for the formation of twelve ionic species, i.e., CO+, CHO+, CF+, CHF+, CFO+, CF2+, CHF2+, CF3+, CHF3+, C2HF2O+, C2HF4+ and C2HF4O+.

Eighty percent of French sport winners in Olympic, World and Europeans competitions have mutations in the hemochromatosis HFE gene.

Science.gov (United States)

Hermine, Olivier; Dine, Gérard; Genty, Vincent; Marquet, Laurie-Anne; Fumagalli, Gabriela; Tafflet, Muriel; Guillem, Flavia; Van Lierde, Françoise; Rousseaux-Blanchi, Marie-Philippe; Palierne, Christian; Lapostolle, Jean-Claude; Cervetti, Jean-Pierre; Frey, Alain; Jouven, Xavier; Noirez, Philippe; Toussaint, Jean-François

2015-12-01

The HFE gene encodes a protein involved in iron homeostasis; individuals with mutations in both alleles develop hemochromatosis. 27% of the French population is heterozygous for mutations in this gene. We found that 80% of the French athletes who won international competitions in rowing, Nordic skiing and judo display mutations in one allele of HFE, thus demonstrating the existence of a favourable phenotype linked to this heterozygosity. Copyright © 2015. Published by Elsevier B.V.

7 CFR 282.2 - Funding.

Science.gov (United States)

2010-01-01

... of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM DEMONSTRATION, RESEARCH, AND EVALUATION PROJECTS § 282.2 Funding. Federal financial participation may be made available to demonstration, research, and evaluation...

Moral, cultura y ley: estudios latinoamericanos sobre seguridad ciudadana

Directory of Open Access Journals (Sweden)

Josefina Echavarría Álvarez

2014-03-01

Full Text Available Antípodas de la violencia. Desafíos de cultura ciudadana para la crisis de (inseguridad en América Latina. Antanas Mockus,Henry Murraín y María Villa (coords. Corporación Visionarios por Colombia (Corpovisionarios, Banco Interamericano de Desarrollo, Washington D. C., 2012, 282 págs., il.

Novel gene PUS3 c.A212G mutation in Ukrainian family with intellectual disability

Directory of Open Access Journals (Sweden)

Gulkovskyi R. V.

2015-04-01

Full Text Available Aim. To evaluate a possible role of a novel c.A212G substitution in the PUS3 gene at intellectual disability (ID. Methods. The observed group consisted of the ID Ukrainian family members (parents and two affected children and the control group – of 300 healthy individuals from general population of Ukraine. Sanger sequencing of the PUS3 gene exon 1 was performed for the family members. Polymorphic variants of c.A212G were analyzed using ARMS PCR. The homology models of wild type and p.Y71C mutant catalytic domains of human Pus3 were generated using the crystal structure of the human Pus1 catalytic domain (PDB ID: 4NZ6 as a template. Results. It was shown that the father of the affected siblings was the c.A212G substitution heterozygous carrier whereas the mother was a wild type allele homozygote, and the exom sequencing result was confirmed – the affected children are 212G homozygotes. We supposed de novo mutation in the maternal germ line. A low frequency of 212G allele (0.0017 was shown in the population of Ukraine. Homology modelling of the wild type and p.Y71C mutant catalytic domain of human Pus3 revealed that substitution p.Y71C is located in close proximity to its active site. Conclusions. The absence of hypoproteinemia in our patients, homozygous for the 212C allele allows us to assume that the mutation c.A212G PUS3 is rather neutral and cannot be the major cause of ID. However, considering a low frequency of the 212G allele in the population and close localization of p.Y71C substitution to the active site of hPus3 we cannot exclude that the c.A212G mutation in PUS3 may be a modifier for some pathologies including syndromic ID.

The Effects of Degraded Digital Instrumentation and Control Systems on Human-system Interfaces and Operator Performance: HFE Review Guidance and Technical Basis

Energy Technology Data Exchange (ETDEWEB)

O' Hara, J.M.; W. Gunther, G. Martinez-Guridi

2010-02-26

New and advanced reactors will use integrated digital instrumentation and control (I&C) systems to support operators in their monitoring and control functions. Even though digital systems are typically highly reliable, their potential for degradation or failure could significantly affect operator performance and, consequently, impact plant safety. The U.S. Nuclear Regulatory Commission (NRC) supported this research project to investigate the effects of degraded I&C systems on human performance and plant operations. The objective was to develop human factors engineering (HFE) review guidance addressing the detection and management of degraded digital I&C conditions by plant operators. We reviewed pertinent standards and guidelines, empirical studies, and plant operating experience. In addition, we conducted an evaluation of the potential effects of selected failure modes of the digital feedwater system on human-system interfaces (HSIs) and operator performance. The results indicated that I&C degradations are prevalent in plants employing digital systems and the overall effects on plant behavior can be significant, such as causing a reactor trip or causing equipment to operate unexpectedly. I&C degradations can impact the HSIs used by operators to monitor and control the plant. For example, sensor degradations can make displays difficult to interpret and can sometimes mislead operators by making it appear that a process disturbance has occurred. We used the information obtained as the technical basis upon which to develop HFE review guidance. The guidance addresses the treatment of degraded I&C conditions as part of the design process and the HSI features and functions that support operators to monitor I&C performance and manage I&C degradations when they occur. In addition, we identified topics for future research.

32 CFR 282.4 - Policy.

Science.gov (United States)

2010-07-01

... certain claim settlement and advance decision functions that, by statute or delegation, are vested in the... SETTLING PERSONNEL AND GENERAL CLAIMS AND PROCESSING ADVANCE DECISION REQUESTS § 282.4 Policy. It is DoD policy that: (a) Claims shall be settled and advance decisions rendered in accordance with all pertinent...

Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

Science.gov (United States)

Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

2014-11-01

Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

Change in attachment predicts change in emotion regulation particularly among 5-HTTLPR short-allele homozygotes.

Science.gov (United States)

Viddal, Kristine Rensvik; Berg-Nielsen, Turid Suzanne; Belsky, Jay; Wichstrøm, Lars

2017-07-01

In view of the theory that the attachment relationship provides a foundation for the development of emotion regulation, here, we evaluated (a) whether change in attachment security from 4 to 6 years predicts change in emotion regulation from 6 to 8 years and (b) whether 5-HTTLPR moderates this relation in a Norwegian community sample (n = 678, 99.7% Caucasian). Attachment was measured with the Manchester Child Attachment Story Task, and teachers completed the Emotion Regulation Checklist. Attachment security was modestly stable, with children becoming more secure over time. Regression analyses revealed that increased attachment security from 4 to 6 forecasted increases in emotion regulation from 6 to 8 and decreased attachment security forecasted decreases in emotion regulation. This effect was strongest among the 5-HTTLPR short-allele homozygotes and, according to competitive model fitting, in a differential-susceptibility manner. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

The Effects of Degraded Digital Instrumentation and Control Systems on Human-system Interfaces and Operator Performance: HFE Review Guidance and Technical Basis

International Nuclear Information System (INIS)

O'Hara, J.M.; Gunther, W.; Martinez-Guridi, G.

2010-01-01

New and advanced reactors will use integrated digital instrumentation and control (I and C) systems to support operators in their monitoring and control functions. Even though digital systems are typically highly reliable, their potential for degradation or failure could significantly affect operator performance and, consequently, impact plant safety. The U.S. Nuclear Regulatory Commission (NRC) supported this research project to investigate the effects of degraded I and C systems on human performance and plant operations. The objective was to develop human factors engineering (HFE) review guidance addressing the detection and management of degraded digital I and C conditions by plant operators. We reviewed pertinent standards and guidelines, empirical studies, and plant operating experience. In addition, we conducted an evaluation of the potential effects of selected failure modes of the digital feedwater system on human-system interfaces (HSIs) and operator performance. The results indicated that I and C degradations are prevalent in plants employing digital systems and the overall effects on plant behavior can be significant, such as causing a reactor trip or causing equipment to operate unexpectedly. I and C degradations can impact the HSIs used by operators to monitor and control the plant. For example, sensor degradations can make displays difficult to interpret and can sometimes mislead operators by making it appear that a process disturbance has occurred. We used the information obtained as the technical basis upon which to develop HFE review guidance. The guidance addresses the treatment of degraded I and C conditions as part of the design process and the HSI features and functions that support operators to monitor I and C performance and manage I and C degradations when they occur. In addition, we identified topics for future research.

Coordination of I and C design with the obligatory consideration of human factors. A project management approach

International Nuclear Information System (INIS)

Sanz, Silvia; Ciriello, Antonio; Krause, Wolfgang; Eisinger, Asriel

2015-01-01

Human Factors Engineering (HFE), like other engineering disciplines involved in plant design, cannot be considered retroactively. The engineering principles and methods derived from deep knowledge of the cognitive and perceptual capabilities and limitations of the plant's 'human element' are applied instead throughout plant design. Focusing HFE efforts on the plant's I and C, the plant's HMI is designed to ensure effective and error-free performance of the monitoring, control, and administrative tasks allocated to the control room crew. Generally speaking, a project's HFE program prescribes three main steps: (1) the analyses of plant monitoring and control functions in order to identify those to be performed manually (all others are performed automatically while still manually monitored) and determine in turn the HMI inventory of information displays, controls, alarms, and operating procedures required to support their performance, (2) the guided design of the plant's HMI, ensuring its compliance with HFE principles and the completeness and correctness of the task support it provides, and (3) the subsequent evaluation of operators performance, trained to follow the operating procedures and use the HMI referred to. The I and C systems designed to monitor and control the plant processes and implement, among other functions, the plant's HMI, are likely validated, governed by I and C norms and the project's V and V guidelines. Past experience shows that the three following obligatory steps pose challenges to project execution: (1) the acquisition and analysis of the multidisciplinary functional requirements (related to plant monitoring and control); (2) the likely interdisciplinary analysis whether and how fulfillment of these requirements shall be allocated to I and C automation systems or operators (or both), and (3) the HFE-guided HMI design and validation. A timely and cost-effective application of HFE to I and C engineering can be achieved by adequate planning and

GICLAS 112-29 (=NLTT 18149), A VERY WIDE COMPANION TO GJ 282 AB WITH COMMON PROPER MOTION, COMMON PARALLAX, COMMON RADIAL VELOCITY AND COMMON AGE

OpenAIRE

A. Poveda; A. Hernández-Alcántara; R. Costero; J. Echevarría

2008-01-01

En una búsqueda de compa~neras con movimiento propio común para las binarias separadas de la vecindad solar encontramos que GJ 282AB tiene una compañera distante (NLTT 18149), a una separaci on de s = 1:09°. Las paralajes trigonométricas (Hipparcos), velocidades radiales y edades son similares, y sugieren que éste es un sistema físico.

7 CFR 28.2 - Terms defined.

Science.gov (United States)

2010-01-01

... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing..., TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Definitions § 28.2 Terms... to act for the Secretary. (e) Service. The Agricultural Marketing Service of the U.S. Department of...

Reference: 282 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 282 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16214903i Kasahara Ryushiro...abidopsis. 11 2981-92 16214903 2005 Nov The Plant cell Drews Gary N|Kasahara Ryushiro D|Portereiko Michael F|Rabiger David S|Sandaklie-Nikolova Linda

A pseudoatom in a cage: trimetallofullerene Y(3)@C(80) mimics y(3)n@c(80) with nitrogen substituted by a pseudoatom.

Science.gov (United States)

Popov, Alexey A; Zhang, Lin; Dunsch, Lothar

2010-02-23

Y(3)C(80) obtained in the synthesis of nitride clusterfullerenes Y(3)N@C(2n) (2n = 80-88) by the reactive atmosphere method is found to be a genuine trimetallofullerene, Y(3)@C(80), with low ionization potential and divalent state of yttrium atoms. DFT studies of the electronic structure of Y(3)@C(80) show that this molecule mimics Y(3)N@C(80) with the pseudoatom (PA) instead of the nitrogen atom. Topology analysis of the electron density and electron localization function show that yttrium atoms form Y-PA bonds rather than direct Y-Y bonds. Molecular dynamics simulations show that the Y(3)PA cluster is as rigid as Y(3)N and rotates inside the fullerene cage as a single entity.

A rare cause of osteonecrosis

Directory of Open Access Journals (Sweden)

Paolo Agostinis

2012-01-01

Full Text Available IntroductionHereditary hemochromatosis (HH is an autosomal recessive disorder caused by mutations in the HFE gene, which increase intestinal iron absorption. The prevalence of C282Y homozygosity, which causes the disorder, is 0.5% in Caucasian populations. The clinical manifestations are related to excess iron in the tissues, especially the liver, heart, pancreas, pituitary, and skin. They include fatigue, loss of libido or impotence in males, liver disease, skin pigmentation, diabetes mellitus, cardiac enlargement—with or without heart failure, and conduction defects. The classic triad of cirrhosis, diabetes mellitus, and skin pigmentation (“bronze diabetes” results from a combination of iron deposits and melanin. It occurs late in the disease, when the total body iron content is more than five times the normal value, about 20 grams. Left untreated, approximately half of all patients with HH eventually develop arthralgia or arthropathy. Chondrocalcinosis, chronic pseudo-osteoarthritis, and osteoporosis are the major rheumatic manifestations of HH. The cause of the arthropathy is still unknown. Iron deposits within joints may trigger a number of pathologic events, such as free radical generation and crystal deposition, which stimulate immune complex formation and inflammation.Materials and methodsWe describe the case of a 48-year-old male suffering from chronic bilateral ankle pain.ResultsThe work-up revealed osteonecrosis of ankle. The patient also presented high plasma ferritin levels and homozygosity for the C282Y mutation. Other than HH, which was confirmed by liver biopsy, the patient had no other risk factors for osteonecrosis.DiscussionHH represents a rare cause of osteonecrosis, and there are no prior reports of aseptic osteonecrosis of the ankle in a patient with this disease. The pathogenetic mechanism remains unknown.

Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

OpenAIRE

Bedmar Carretero, Cristina

2012-01-01

El objetivo de este estudio fue valorar el desarrollo del niño durante el primer año de vida en función del tipo de lactancia realizada durante el primer semestre y de la dosis de hierro administrada durante el segundo semestre. El 75,5% realizan lactancia materna exclusiva al nacer y el 16,5% la mantienen hasta los 6 meses. El 39,5%tienen alguna mutación en el gen HFE. La prevalencia de déficit de hierroy anemia ferropénicaes del 4,5% y 2,5% a los 6 meses y del 9,2% y 1,2% a los 12 meses.La ...

Transferrin Level Before Treatment and Genetic Polymorphism in HFE Gene as Predictive Markers for Response to Adalimumab in Crohn's Disease Patients.

Science.gov (United States)

Repnik, Katja; Koder, Silvo; Skok, Pavel; Ferkolj, Ivan; Potočnik, Uroš

2016-08-01

Tumor necrosis factor α inhibitors (anti-TNF) have improved treatment of several complex diseases, including Crohn's disease (CD). However, the effect varies and approximately one-third of the patients do not respond. Since blood parameters as well as genetic factors have shown a great potential to predict response during treatment, the aim of the study was to evaluate response to anti-TNF treatment with adalimumab (ADA) between genes HFE and TF and haematological parameters in Slovenian refractory CD patients. Single nucleotide polymorphisms (SNPs) rs1799852 in gene TF and rs2071303 in gene HFE were genotyped in 68 refractory CD patients for which response has been measured using inflammatory bowel disease questionnaire (IBDQ) index. Haematological parameters and IBDQ index were determined before therapy and after 4, 12, 20 and 30 weeks. We found novel strong association between SNP rs2071303 in gene HFE and response to ADA treatment, particularly patients with G allele comparing to A allele had better response after 20 weeks (p = 0.008). Further, we found strong association between transferrin level at baseline and treatment response after 12, 20 and 30 weeks, where average transferrin level before therapy was lower in responders (2.38 g/L) compared to non-responders (2.89 g/L, p = 0.005). Association was found between transferrin level in week 30 and SNP rs1799852 (p = 0.023), and between MCHC level before treatment and SNP rs2071303 (p = 0.007). Our results suggest that SNP in gene HFE as well as haematological markers serve as promising prognostic markers of response to anti-TNF treatment in CD patients.

Dynamic strain aging in Haynes 282 superalloy

Directory of Open Access Journals (Sweden)

Hörnqvist Magnus

2014-01-01

Full Text Available Haynes 282 is a newly introduced Ni-based superallony, developed to provide a combination of high-temperature mechanical properties, thermal stability and processability. The present contribution investigates the effect of dynamic strain aging (DSA on the deformation behaviour of Haynes 282 during monotonic and cyclic loading. It is shown that DSA (presumably related to carbon diffusion based on rough estimates of the activation energy completely dominates the development of the stress during cycling at intermediate temperatures, leading to extensive cyclic hardening and serrated yielding. However, no clear effects on the fatigue life or the resulting dislocation structure could be observed. The tensile properties were not severely affected, in spite of the presence of extensive serrated yielding, although a reduction in ductility was observed in the DSA temperature regime. During monotonic loading at lower strain rates indications of an additional DSA mechanism due to substitutional elements were observed.

Male meiosis and gametogenesis in wild house mice (Mus musculus domesticus) from a chromosomal hybrid zone; a comparison between "simple" Robertsonian heterozygotes and homozygotes.

Science.gov (United States)

Wallace, B M; Searle, J B; Everett, C A

1992-01-01

Wild male house mice Mus musculus domesticus were collected from the hybrid zone between the John o'Groats race (2n = 32) and the standard race (2n = 40) in northern Scotland. Meiosis in both homozygotes (2n = 32, 36, and 40) and single Robertsonian heterozygotes (2n = 33, 35, and 37) was found to be orderly. At prophase/metaphase I in heterozygotes, a trivalent was formed from the metacentric and two homologous acrocentrics. At pachytene, this trivalent usually had a single side arm at the position of the centromeres, as a result of nonhomologous pairing of the acrocentrics. This side arm persisted into diplotene. Generally only a single chiasma was formed between each acrocentric and the metacentric. Anaphase I nondisjunction frequencies were estimated as 1.5% for the homozygotes and 2.7% for the heterozygotes. The extent of germ cell death between the pachytene and round spermatid stages was 18% greater in heterozygotes than in homozygotes. Our results concur with previous studies which indicate that single Robertsonian heterozygotes in wild house mice have near-normal fertility.

Differing impact of the deletion of hemochromatosis-associated molecules HFE and transferrin receptor-2 on the iron phenotype of mice lacking bone morphogenetic protein 6 or hemojuvelin.

Science.gov (United States)

Latour, Chloé; Besson-Fournier, Céline; Meynard, Delphine; Silvestri, Laura; Gourbeyre, Ophélie; Aguilar-Martinez, Patricia; Schmidt, Paul J; Fleming, Mark D; Roth, Marie-Paule; Coppin, Hélène

2016-01-01

Hereditary hemochromatosis, which is characterized by inappropriately low levels of hepcidin, increased dietary iron uptake, and systemic iron accumulation, has been associated with mutations in the HFE, transferrin receptor-2 (TfR2), and hemojuvelin (HJV) genes. However, it is still not clear whether these molecules intersect in vivo with bone morphogenetic protein 6 (BMP6)/mothers against decapentaplegic (SMAD) homolog signaling, the main pathway up-regulating hepcidin expression in response to elevated hepatic iron. To answer this question, we produced double knockout mice for Bmp6 and β2-microglobulin (a surrogate for the loss of Hfe) and for Bmp6 and Tfr2, and we compared their phenotype (hepcidin expression, Bmp/Smad signaling, hepatic and extrahepatic tissue iron accumulation) with that of single Bmp6-deficient mice and that of mice deficient for Hjv, alone or in combination with Hfe or Tfr2. Whereas the phenotype of Hjv-deficient females was not affected by loss of Hfe or Tfr2, that of Bmp6-deficient females was considerably worsened, with decreased Smad5 phosphorylation, compared with single Bmp6-deficient mice, further repression of hepcidin gene expression, undetectable serum hepcidin, and massive iron accumulation not only in the liver but also in the pancreas, the heart, and the kidneys. These results show that (1) BMP6 does not require HJV to transduce signal to hepcidin in response to intracellular iron, even if the loss of HJV partly reduces this signal, (2) another BMP ligand can replace BMP6 and significantly induce hepcidin expression in response to extracellular iron, and (3) BMP6 alone is as efficient at inducing hepcidin as the other BMPs in association with the HJV/HFE/TfR2 complex; they provide an explanation for the compensatory effect of BMP6 treatment on the molecular defect underlying Hfe hemochromatosis in mice. © 2015 by the American Association for the Study of Liver Diseases.

Heterozygote to homozygote related living donor liver transplantation in maple syrup urine disease: a case report.

Science.gov (United States)

Patel, N; Loveland, J; Zuckerman, M; Moshesh, P; Britz, R; Botha, J

2015-05-01

Liver transplantation is an accepted treatment modality in the management of MSUD. To our knowledge, ours is only the second successful case to date of a patient with MSUD receiving an allograft from an RLD who is a heterozygous carrier for the disease. In view of the worldwide shortage of available organs for transplantation, heterozygote to homozygote transplantation in the setting of MSUD may provide a viable alternative for those awaiting transplantation. We report on the case of a two-yr-old infant with MSUD, who received a left lateral segment (segments II and III) liver transplant from his mother, a heterozygote carrier of one of the three abnormal genes implicated in MSUD. Post-operative BCAA levels normalized in our patient and remained so on an unrestricted protein diet and during times of physiological stress. To date, this is only the second case of a successful RLD liver transplant in a child with MSUD. Preliminary results indicate that RLD liver transplants are at least equivalent to deceased donor liver transplants in the treatment of MSUD, although longer term follow-up is required. Heterozygote to homozygote RLD transplant in patients with MSUD presents a new pool of potential liver donors. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Hemochromatosis and diabetes mellitus: case report and literature review

Directory of Open Access Journals (Sweden)

Karina Biavatti

2008-12-01

Full Text Available Hemochromatosis is a disorder characterized by iron storage amended. The acquired form of the disease can be caused by iron overload, alcoholism, infection by  C virus hepatitis, non-alcoholic hepatitis and chronic liver disease. The hereditary form can be caused by different mutations, being the C282Y and H63D the most frequent, 83% of cases are homozigotous for C282Y and 4% are compound heterozygous (C282Y/H63D. Hemochromatosis is a condition that can affect several organs, including: heart, joints, liver, hypothalamus, pituitary, pancreas and gonads. The aim of this study was to report a case of hemochromatosis and review the literature, with special attention to the association of hemochromatosis and diabetes mellitus. Patient 53 years, male presented to the doctor with arthralgia metacarpophalangeal, ankles, knees, coxofemoral right, and cervical and lumbar, complaints of fatigue and weight loss. Between 3 brothers, one of them had a diagnosis of hereditary hemochromatosis, with PCR demonstrating homozygous for C282Y. Labs: GOT 128 U/L, ALT 231 U/L, alkaline phosphatase 258 U/L, abdominal ultrasound with hepatomegaly and spleen at the upper limit of normal. Liver biopsy demonstrated portal fibrosis extension with hemosiderosis intense. It also made the diagnosis of diabetes mellitus. The research confirmed the same mutation of the changing family: homozygous for C282Y

Exploring Aquaculture. Curriculum Guide for Agriscience 282.

Science.gov (United States)

Texas A and M Univ., College Station. Dept. of Agricultural Education.

This curriculum guide provides materials for teachers to use in developing a course in "Exploring Aquaculture, Agriscience 282," one of 28 semester courses in agricultural science and technology for Texas high schools. This introductory course is designed to acquaint students with the growing industry of aquaculture; it includes…

Phosphorylation of connexin43 on S279/282 may contribute to laminopathy-associated conduction defects

Energy Technology Data Exchange (ETDEWEB)

Chen, Steven C., E-mail: bug@uw.edu [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States); University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Kennedy, Brian K., E-mail: bkennedy@buckinstitute.org [University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Buck Institute for Research on Aging, 8001 Redwood Boulevard, Novato, CA 94945 (United States); Lampe, Paul D., E-mail: plampe@fhcrc.org [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States)

2013-04-01

An understanding of the molecular mechanism behind the arrhythmic phenotype associated with laminopathies has yet to emerge. A-type lamins have been shown to interact and sequester activated phospho-ERK1/2(pERK1/2) at the nucleus. The gap junction protein connexin43 (Cx43) can be phosphorylated by pERK1/2 on S279/282 (pS279/282), inhibiting intercellular communication. We hypothesized that without A-type lamins, pS279/282 Cx43 will increase due to inappropriate phosphorylation by pERK1/2, resulting in decreased gap junction function. We observed a 1.6-fold increase in pS279/282 Cx43 levels in Lmna{sup −/−} mouse embryonic fibroblasts (MEFs) compared to Lmna{sup +/+}, and 1.8-fold more pERK1/2 co-precipitated from Lmna{sup −/−} MEFs with Cx43 antibodies. We found a 3-fold increase in the fraction of non-nuclear pERK1/2 and a concomitant 2-fold increase in the fraction of pS279/282 Cx43 in Lmna{sup −/−} MEFs by immunofluorescence. In an assay of gap junctional function, Lmna{sup −/−} MEFs transferred dye to 60% fewer partners compared to Lmna{sup +/+} controls. These results are mirrored in 5–6 week-old Lmna{sup −/−} mice compared to their Lmna{sup +/+} littermates as we detect increased pS279/282 Cx43 in gap junctions by immunofluorescence and 1.7-fold increased levels by immunoblot. We conclude that increased pS279/282 Cx43 in the Lmna{sup −/−} background results in decreased cell communication and may contribute to the arrhythmic pathology in vivo. - Highlights: ► Connexin43 phosphorylation plays a role in laminopathy-associated conduction defects. ► Loss of A-type lamin activity results in release of pERK1/2 from the nucleus. ► Increased cytoplasmic localization of pERK1/2 acts to phosphorylate S279/282 of Cx43. ► Phosphorylation of S279/282 on Cx43 decreases gap junction activity in cell culture. ► Mice lacking A-type lamins have increased phosphorylation on S279/282 of Cx43.

Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

OpenAIRE

Bedmar Carretero, Cristina

2012-01-01

L’objectiu d’aquest estudi va ser valorar el desenvolupament del nen durant el primer any de vida en funció del tipus de lactància realitzada durant el primer semestre y de la dosis de ferro administrada durant el segon semestre. Hem observat que el 75,5% dels nens realitzen lactància materna exclusiva al néixer y el 16,5% la mantenen fins als 6 mesos. El 39,5% tenen alguna mutació en el gen HFE. La prevalença de dèficit de ferro y anèmia ferropènica es del 4,5% y 2,5% als 6 mesos y del 9,2% ...

miR-146a C/G polymorphism increased the risk of head and neck cancer, but overall cancer risk: an analysis of 89 studies.

Science.gov (United States)

Sun, Dezhong; Zhang, Xiaoyan; Zhang, Xiaolei

2018-02-28

Several studies have evaluated the association of miR-146a C/G with head and neck cancer (HNC) susceptibility, and overall cancer risk, but with inconclusive outcomes. To drive a more precise estimation, we carried out this meta-analysis. The literature was searched from MEDLINE (mainly PubMed), Embase, the Cochrane Library, and Google Scholar databases to identify eligible studies. A total of 89 studies were included. The results showed that miR-146a C/G was significantly associated with increased HNC risk in dominant model ( I 2 =15.6%, P heterogeneity =0.282, odds ratio (OR) =1.088, 95% confidence interval (CI) =1.002-1.182, P =0.044). However, no cancer risk was detected under all genetic models. By further stratified analysis, we found that rs4919510 mutation contributed to the risk of HNC amongst Asians under homozygote model ( I 2 =0, P heterogeneity =0.541, OR =1.189, 95% CI =1.025-1.378, P =0.022), and dominant model ( I 2 =0, P heterogeneity =0.959, OR =1.155, 95% CI =1.016-1.312, P =0.028). Simultaneously, in the stratified analysis by source of controls, a significantly increased cancer risk amongst population-based studies was found under homozygote model, dominant model, recessive model, and allele comparison model. However, no significant association was found in the stratified analysis by ethnicity and source of control. The results indicated that miR-146a C/G polymorphism may contribute to the increased HNC susceptibility and could be a promising target to forecast cancer risk for clinical practice. However, no significant association was found in subgroup analysis by ethnicity and source of control. To further confirm these results, well-designed large-scale case-control studies are needed in the future. © 2018 The Author(s).

30 CFR 282.4 - Opportunities for review and comment.

Science.gov (United States)

2010-07-01

... OPERATIONS IN THE OUTER CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.4... potential impacts on the environment and to provide comments and recommendations for the disposition of the...

Light fragment preformation in cold fission of {sup 282}Cn

Energy Technology Data Exchange (ETDEWEB)

Poenaru, D.N.; Gherghescu, R.A. [Horia Hulubei National Institute of Physics and Nuclear Engineering (IFIN-HH), P.O. Box MG-6, Bucharest-Magurele (Romania); Johann Wolfgang Goethe University, Frankfurt Institute for Advanced Studies (FIAS), Frankfurt am Main (Germany)

2016-11-15

In a previous article, published in Phys. Rev. C 94, 014309 (2016), we have shown for the first time that the best dynamical trajectory during the deformation toward fission of the superheavy nucleus {sup 286}Fl is a linearly increasing radius of the light fragment, R{sub 2}. This macroscopic-microscopic result reminds us about the α or cluster preformation at the nuclear surface, assumed already in 1928, and proved microscopically many times. This time we give more detailed arguments for the nucleus {sup 282}Cn. Also similar figures are presented for heavy nuclei {sup 240}Pu and {sup 252} Cf. The deep minimum of the total deformation energy near the surface is shown for the first time as a strong argument for cluster preformation. (orig.)

Intermediate long X-ray bursts from the ultra-compact binary candidate SLX1737-282

DEFF Research Database (Denmark)

Falanga, M.; Chenevez, Jérôme; Cumming, A.

2008-01-01

. The observed intermediate long burst properties from SLX 1737-282 are consistent with helium ignition at the column depth of 5-8 × 109 g cm-2 and a burst energy release of 1041 erg. The apparent recurrence time of ≃86 days between the intermediate long bursts from SLX 1737-282 suggests a regime of unstable...... bursts. Methods: Up to now only four bursts, all with duration between ≃15{-}30 min, have been recorded for SLX 1737-282. The properties of three of these intermediate long X-ray bursts observed by INTEGRAL are investigated and compared to other burster sources. The broadband spectrum of the persistent...

El ojo y la cámara fotográfica. Semejanzas y diferencias

OpenAIRE

Geijo Vegas, Noelia

2016-01-01

Las cámaras fotográficas poseen un sistema de formación de imagen que guarda estrecha relación con la formación de imagen del ojo humano: en una cámara la luz pasa a través de un sistema de lentes y forma una imagen invertida en el sensor; en el ojo humano la luz pasa a través de la córnea y el cristalino y forma una imagen; también invertida, en la retina. En este trabajo se describen y comparan las distintas partes de ambos elementos que intervienen en la formación de la imagen como son el ...

10 CFR 205.282 - Evaluation of petition by the Office of Hearings and Appeals.

Science.gov (United States)

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Evaluation of petition by the Office of Hearings and Appeals. 205.282 Section 205.282 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS... and Appeals or his designee shall issue a final Decision and Order which shall govern the disposition...

Thermal Analysis in the Technological “Step” Test of H282 Nickel Alloy

Directory of Open Access Journals (Sweden)

Pirowski Z.

2015-03-01

Full Text Available Superalloys show a good combination of mechanical strength and resistance to surface degradation under the influence of chemically active environments at high temperature. They are characterized by very high heat and creep resistance. Their main application is in gas turbines, chemical industry, and in all those cases where resistance to creep and the aggressive corrosion environment is required. Modern jet engines could never come into use if not for progress in the development of superalloys. Superalloys are based on iron, nickel and cobalt. The most common and the most interesting group includes superalloys based on nickel. They carry loads at temperatures well in excess of the eighty percent of the melting point. This group includes the H282 alloy, whose nominal chemical composition is as follows (wt%: Ni - base, Fe - max. 1.5%, Al - 1.5% Ti - 2.1%, C - 0.06% Co - 10% Cr - 20% Mo - 8.5%. This study shows the results of thermal analysis of the H282 alloy performed on a cast step block with different wall thickness. Using the results of measurements, changes in the temperature of H282 alloy during its solidification were determined, and the relationship dT / dt = f (t was derived. The results of the measurements taken at different points in the cast step block allowed identifying a number of thermal characteristics of the investigated alloy and linking the size of the dendrites formed in a metal matrix (DAS with the thermal effect of solidification. It was found that the time of solidification prolonged from less than ome minute at 10 mm wall thickness to over seven minutes at the wall thickness of 44 mm doubled the value of DAS.

7 CFR 282.1 - Legislative authority and notice requirements.

Science.gov (United States)

2010-01-01

... Section 282.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM DEMONSTRATION, RESEARCH, AND... 17 of the Act authorizes the Secretary to conduct demonstration, research, and evaluation projects...

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... ease (36.6%), delayed puberty (56.6%), primary (35.71%) and secondary amenorrhea (21.42%), short stature. (27.3%) .... guineous marriage (61.5%) and a high rate of positive family his- .... Safer food, better business.

Thermo-Viscoplastic Behavior of Ni-Based Superalloy Haynes 282 and Its Application to Machining Simulation

Directory of Open Access Journals (Sweden)

Marcos Rodríguez-Millán

2017-12-01

Full Text Available Ni-based superalloys are extensively used in high-responsibility applications in components of aerospace engines and gas turbines with high temperature service lives. The wrought, γ’-strengthened superalloy Haynes 282 has been recently developed for applications similar to other common superalloys, such as Waspaloy or Inconel 718, with improved creep behavior, thermal stability, and fabrication ability. Despite the potential of Haynes 282, there are still important gaps in the knowledge of the mechanical behavior of this alloy. In fact, it was not possible to find information concerning the mechanical behavior of the alloy under impulsive loading. This paper focuses on the mechanical characterization of the Haynes 282 at strain rates ranging from 0.1 to 2800 s−1 and high temperatures ranging from 293 to 523 K using Hopkinson bar compression tests. The experimental results from the thermo-mechanical characterization allowed for calibration of the Johnson–Cook model widely used in modeling metallic alloy’s responses under dynamic loading. Moreover, the behavior of Haynes 282 was compared to that reported for Inconel 718, and the results were used to successfully model the orthogonal cutting of Haynes 282, being a typical case of dynamic loading requiring previous characterization of the alloy.

30 CFR 282.10 - Jurisdiction and responsibilities of Director.

Science.gov (United States)

2010-07-01

... part and are under the jurisdiction of the Director: Exploration, testing, and mining operations... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Jurisdiction and responsibilities of Director... Jurisdiction and Responsibilities of Director § 282.10 Jurisdiction and responsibilities of Director. Subject...

Lymphocyte gene expression signatures from patients and mouse models of hereditary hemochromatosis reveal a function of HFE as a negative regulator of CD8+ T-lymphocyte activation and differentiation in vivo.

Science.gov (United States)

Costa, Mónica; Cruz, Eugénia; Oliveira, Susana; Benes, Vladimir; Ivacevic, Tomi; Silva, Maria João; Vieira, Inês; Dias, Francisco; Fonseca, Sónia; Gonçalves, Marta; Lima, Margarida; Leitão, Catarina; Muckenthaler, Martina U; Pinto, Jorge; Porto, Graça

2015-01-01

Abnormally low CD8+ T-lymphocyte numbers is characteristic of some patients with hereditary hemochromatosis (HH), a MHC-linked disorder of iron overload. Both environmental and genetic components are known to influence CD8+ T-lymphocyte homeostasis but the role of the HH associated protein HFE is still insufficiently understood. Genome-wide expression profiling was performed in peripheral blood CD8+ T lymphocytes from HH patients selected according to CD8+ T-lymphocyte numbers and from Hfe-/- mice maintained either under normal or high iron diet conditions. In addition, T-lymphocyte apoptosis and cell cycle progression were analyzed by flow cytometry in HH patients. HH patients with low CD8+ T-lymphocyte numbers show a differential expression of genes related to lymphocyte differentiation and maturation namely CCR7, LEF1, ACTN1, NAA50, P2RY8 and FOSL2, whose expression correlates with the relative proportions of naïve, central and effector memory subsets. In addition, expression levels of LEF1 and P2RY8 in memory cells as well as the proportions of CD8+ T cells in G2/M cell cycle phase are significantly different in HH patients compared to controls. Hfe-/- mice do not show alterations in CD8+ T-lymphocyte numbers but differential gene response patterns. We found an increased expression of S100a8 and S100a9 that is most pronounced in high iron diet conditions. Similarly, CD8+ T lymphocytes from HH patients display higher S100a9 expression both at the mRNA and protein level. Altogether, our results support a role for HFE as a negative regulator of CD8+ T-lymphocyte activation. While the activation markers S100a8 and S100a9 are strongly increased in CD8+ T cells from both, Hfe-/- mice and HH patients, a differential profile of genes related to differentiation/maturation of CD8+ T memory cells is evident in HH patients only. This supports the notion that HFE contributes, at least in part, to the generation of low peripheral blood CD8+ T lymphocytes in HH.

Seasonal Changes in Brain Serotonin Transporter Binding in Short Serotonin Transporter Linked Polymorphic Region-Allele Carriers but Not in Long-Allele Homozygotes

DEFF Research Database (Denmark)

Kalbitzer, Jan; Erritzoe, David; Holst, Klaus K

2010-01-01

of the short 5-HTTLPR allele but not in homozygote carriers of the long allele. Conclusions: Our findings are in line with S-carriers having an increased response in neural circuits involved in emotional processing to stressful environmental stimuli but here demonstrated as a endophenotype with dynamic changes...

Association between C677T and A1298C polymorphisms of the MTHFR gene and risk of male infertility: a meta-analysis.

Science.gov (United States)

Yang, Y; Luo, Y Y; Wu, S; Tang, Y D; Rao, X D; Xiong, L; Tan, M; Deng, M Z; Liu, H

2016-04-26

Published studies on the association between the C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene and male infertility risk are controversial. To obtain a more precise evaluation, we performed a meta-analysis based on published case-control studies. We conducted an electronic search of PubMed, EMBASE, the Cochrane Library, the Web of Science, and the China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and male infertility risk. Pooled odds ratios (ORs) with 95% confidence intervals (95%CIs) were used to assess the strength of association in homozygote, heterozygote, dominant, recessive, and additive models. Statistical heterogeneity, test of publication bias, and sensitivity analysis were carried out using the STATA software (Version 13.0). Overall, 21 studies of C677T (4505 cases and 4024 controls) and 13 studies of A1298C (2785 cases and 3094 controls) were included in this meta-analysis. For C677T, the homozygote comparison results were OR = 1.629, 95%CI (1.215- 2.184), and the recessive model results were OR = 1.462 (1.155- 1.850). For A1298C, the homozygote comparison results were OR = 1.289 (1.029-1.616), and the recessive model results were OR = 1.288 (1.034-1.604). In conclusion, the current meta-analysis showed that the MTHFR C677T polymorphism was associated with a significantly increased male infertility risk in the Asian and overall populations, but not in the Caucasian population, and there was a significant association between the A1298C polymorphism and male infertility risk in the Asian, Caucasian, and overall groups.

Sudden Sensorineural Hearing Loss and Polymorphisms in Iron Homeostasis Genes: New Insights from a Case-Control Study

Directory of Open Access Journals (Sweden)

Alessandro Castiglione

2015-01-01

Full Text Available Background. Even if various pathophysiological events have been proposed as explanations, the putative cause of sudden hearing loss remains unclear. Objectives. To investigate and to reveal associations (if any between the main iron-related gene variants and idiopathic sudden sensorineural hearing loss. Study Design. Case-control study. Materials and Methods. A total of 200 sudden sensorineural hearing loss patients (median age 63.65 years; range 10–92 were compared with 400 healthy control subjects. The following genetic variants were investigated: the polymorphism c.−8CG in the promoter of the ferroportin gene (FPN1; SLC40A1, the two isoforms C1 and C2 (p.P570S of the transferrin protein (TF, the amino acidic substitutions p.H63D and p.C282Y in the hereditary hemochromatosis protein (HFE, and the polymorphism c.–582AG in the promoter of the HEPC gene, which encodes the protein hepcidin (HAMP. Results. The homozygous genotype c.−8GG of the SLC40A1 gene revealed an OR for ISSNHL risk of 4.27 (CI 95%, 2.65–6.89; P=0.001, being overrepresented among cases. Conclusions. Our study indicates that the homozygous genotype FPN1 −8GG was significantly associated with increased risk of developing sudden hearing loss. These findings suggest new research should be conducted in the field of iron homeostasis in the inner ear.

Microstructural analysis of laser weld fusion zone in Haynes 282 superalloy

Energy Technology Data Exchange (ETDEWEB)

Osoba, L.O. [Department of Mechanical and Manufacturing Engineering, University of Manitoba, Winnipeg, Manitoba, R3T 5V6 (Canada); Ding, R.G. [Department of Metallurgy and Materials Engineering, University of Birmingham, Birmingham B15 2TT (United Kingdom); Ojo, O.A., E-mail: ojo@cc.umanitoba.ca [Department of Mechanical and Manufacturing Engineering, University of Manitoba, Winnipeg, Manitoba, R3T 5V6 (Canada)

2012-03-15

Analytical electron microscopy and spectroscopy analyses of the fusion zone (FZ) microstructure in autogenous laser beam welded Haynes 282 (HY 282) superalloy were performed. The micro-segregation patterns observed in the FZ indicate that Co, Cr and Al exhibited a nearly uniform distribution between the dendrite core and interdendritic regions while Ti and Mo were rejected into the interdendritic liquid during the weld solidification. Transmission electron diffraction analysis and energy dispersive X-ray microanalysis revealed the second phase particles formed along the FZ interdendritic region to be Ti-Mo rich MC-type carbide particles. Weld FZ solidification cracking, which is sometimes associated with the formation of {gamma}-{gamma}' eutectic in {gamma}' precipitation strengthened nickel-base superalloys, was not observed in the HY 282 superalloy. Modified primary solidification path due to carbon addition in the newly developed superalloy is used to explain preclusion of weld FZ solidification cracking in the material. - Highlights: Black-Right-Pointing-Pointer A newly developed superalloy was welded by CO{sub 2} laser beam joining technique. Black-Right-Pointing-Pointer Electron microscopy characterization of the weld microstructure was performed. Black-Right-Pointing-Pointer Identified interdendritic microconstituents consist of MC-type carbides. Black-Right-Pointing-Pointer Modification of primary solidification path is used to explain cracking resistance.

Microstructural analysis of laser weld fusion zone in Haynes 282 superalloy

International Nuclear Information System (INIS)

Osoba, L.O.; Ding, R.G.; Ojo, O.A.

2012-01-01

Analytical electron microscopy and spectroscopy analyses of the fusion zone (FZ) microstructure in autogenous laser beam welded Haynes 282 (HY 282) superalloy were performed. The micro-segregation patterns observed in the FZ indicate that Co, Cr and Al exhibited a nearly uniform distribution between the dendrite core and interdendritic regions while Ti and Mo were rejected into the interdendritic liquid during the weld solidification. Transmission electron diffraction analysis and energy dispersive X-ray microanalysis revealed the second phase particles formed along the FZ interdendritic region to be Ti–Mo rich MC-type carbide particles. Weld FZ solidification cracking, which is sometimes associated with the formation of γ–γ' eutectic in γ' precipitation strengthened nickel-base superalloys, was not observed in the HY 282 superalloy. Modified primary solidification path due to carbon addition in the newly developed superalloy is used to explain preclusion of weld FZ solidification cracking in the material. - Highlights: ► A newly developed superalloy was welded by CO 2 laser beam joining technique. ► Electron microscopy characterization of the weld microstructure was performed. ► Identified interdendritic microconstituents consist of MC-type carbides. ► Modification of primary solidification path is used to explain cracking resistance.

Renewable Formate from C-H Bond Formation with CO2: Using Iron Carbonyl Clusters as Electrocatalysts.

Science.gov (United States)

Loewen, Natalia D; Neelakantan, Taruna V; Berben, Louise A

2017-09-19

As a society, we are heavily dependent on nonrenewable petroleum-derived fuels and chemical feedstocks. Rapid depletion of these resources and the increasingly evident negative effects of excess atmospheric CO 2 drive our efforts to discover ways of converting excess CO 2 into energy dense chemical fuels through selective C-H bond formation and using renewable energy sources to supply electrons. In this way, a carbon-neutral fuel economy might be realized. To develop a molecular or heterogeneous catalyst for C-H bond formation with CO 2 requires a fundamental understanding of how to generate metal hydrides that selectively donate H - to CO 2 , rather than recombining with H + to liberate H 2 . Our work with a unique series of water-soluble and -stable, low-valent iron electrocatalysts offers mechanistic and thermochemical insights into formate production from CO 2 . Of particular interest are the nitride- and carbide-containing clusters: [Fe 4 N(CO) 12 ] - and its derivatives and [Fe 4 C(CO) 12 ] 2- . In both aqueous and mixed solvent conditions, [Fe 4 N(CO) 12 ] - forms a reduced hydride intermediate, [H-Fe 4 N(CO) 12 ] - , through stepwise electron and proton transfers. This hydride selectively reacts with CO 2 and generates formate with >95% efficiency. The mechanism for this transformation is supported by crystallographic, cyclic voltammetry, and spectroelectrochemical (SEC) evidence. Furthermore, installation of a proton shuttle onto [Fe 4 N(CO) 12 ] - facilitates proton transfer to the active site, successfully intercepting the hydride intermediate before it reacts with CO 2 ; only H 2 is observed in this case. In contrast, isoelectronic [Fe 4 C(CO) 12 ] 2- features a concerted proton-electron transfer mechanism to form [H-Fe 4 C(CO) 12 ] 2- , which is selective for H 2 production even in the presence of CO 2 , in both aqueous and mixed solvent systems. Higher nuclearity clusters were also studied, and all are proton reduction electrocatalysts, but none

Ansiedad y depresión en mujeres con cáncer de mama en radioterapia: Prevalencia y factores asociados

OpenAIRE

Ornelas-Mejorada,Rosa Elena; Tufiño Tufiño,Mónica Anahí; Sánchez-Sosa,Juan José

2011-01-01

Someterse a radioterapia y padecer los efectos secundarios son situaciones que generan ansiedad y depresión en las mujeres con cáncer de mama. El objetivo fue evaluar la prevalencia de ansiedad y depresión que presentan las mujeres con cáncer de mama en radioterapia y analizar los efectos y las diferencias de variables clínicas y sociodemográficas sobre su malestar psicológico. Participaron 203 mujeres mexicanas con cáncer de mama en estadios 0-III. Para evaluar ansiedad y depresión se utiliz...

Efectos de los nutrientes y compuestos bioactivos de los alimentos en tejidos y células de cáncer humano: aproximación nutrigenómica

OpenAIRE

Jhonny E Vargas-Hernández; María P Camacho-Gómez; Doris Ramírez de Peña

2013-01-01

El cáncer es una condición de programación genética anormal en la cual cambios en la secuencia genómica alteran la estructura, función y expresión de proteínas que controlan procesos celulares esenciales como el crecimiento, la proliferación, la diferenciación y la apoptosis. Investigaciones en nutrición y cáncer han analizado los efectos de determinados nutrientes y compuestos bioactivos de los alimentos en el desarrollo y evolución de diversos tipos de cáncer. ...

Efectos de los nutrientes y compuestos bioactivos de los alimentos en tejidos y células de cáncer humano: aproximación nutrigenómica

OpenAIRE

Vargas-Hernández, Jhonny E; Camacho-Gómez, María P; Ramírez de Peña, Doris

2013-01-01

Resumen El cáncer es una condición de programación genética anormal en la cual cambios en la secuencia genómica alteran la estructura, función y expresión de proteínas que controlan procesos celulares esenciales como el crecimiento, la proliferación, la diferenciación y la apoptosis. Investigaciones en nutrición y cáncer han analizado los efectos de determinados nutrientes y compuestos bioactivos de los alimentos en el desarrollo y evolución de diversos tipos de cáncer. El objetivo de esta in...

Programacion funcional y lambda cálculo

Directory of Open Access Journals (Sweden)

Jonatan Gómez Perdomo

1998-05-01

Full Text Available En la primera parte de este artículo se explican algunos conceptos de los lenguajes de programación, haciendo énfasis en las caracteristicas y propiedades de los lenguajes de programación funcional. En la segunda, se realiza una introducción al lambda cálculo puro, su notación, axiomas y reglas elementales.

Detailed crystallization study of co-precipitated Y1.47 Gd1.53 Fe5 O12 and relevant magnetic properties

International Nuclear Information System (INIS)

Serra, Rogerio Arving; Ogasawara, Tsuneharu; Ogasawara, Angelica Soares

2007-01-01

The crystallization process of co-precipitated Y 1.5 Gd 1.5 Fe 5 O 12 powder heated up to 1000 deg C at rate of 5 deg C min -1 was investigated. Above 810 deg C crystalline Y 1.47 Gd 1.53 Fe 5 O 12 was obtained with a lattice parameter of 12.41 A and a theoretical density of 5.84 g cm -3 . Dry pressed rings were sintered at 1270 and 1320 deg C, increasing the grain-size from 3.1 to 6.5 μm, the theoretical density by 87.6 to 95.3% and decreasing H c from 2.9725 to 1.4005 Oe. Additionally, Hc increased when the frequency of the hysteresis graph varied from 60 Hz to 10 kHz, the curie temperature was 282.4 deg C and Ms equalled 9.25 emu g -1 (0.17 kG) agreeing well with the B s -value of the hysteresis graph and literature values. (author)

Bases del intercambio entre las sociedades norperuanas y surecuatorianas: una zona de transición entre 1500 A.C. y 600 D.C

Directory of Open Access Journals (Sweden)

1993-01-01

Full Text Available BASES DE L'ECHANGE ENTRE LES SOCIETES NORD-PERUVIENNES ET SUD-EQUATORIENNES : UNE ZONE DE TRANSITION ENTRE 1500 AV. J.C. ET 600 AP. J.C. Cet article est le fruit d’une tentative de coopération entre des chercheurs qui travaillent en Équateur et au Pérou, pour relier les deux aires culturelles nettement différenciées, nord-andine et centre-andine, à partir de la définition et de l’étude d’une zone de transition, localisée entre le Río Jubones dans le sud de l'Équateur et le Río Olmos dans le nord du Pérou, entre environ 1500 av. J.C. et 600 ap. J.C. El artículo es resultado de un intento de cooperación entre investigadores que trabajan el Ecuador y el Perú para vincular las dos áreas culturales marcadamente diferenciadas, norandina y centroandina, a partir de la definición y estudio de una zona de transición, localizada entre el río Jubones, al sur de Ecuador y el Río Olmos, al norte de Perú, entre aproximadamente 1500 AC y 600 DC. BASIS OF THE EXCHANGE BETWEEN NORTH PERUVIAN AND SOUTH ECUATORIAN SOCIETIES: A TRANSITIONAL ZONE BETWEEN 1500 B.C. AND 600 A.C. This paper is a collaborative effort by researchers working in Ecuador and Peru, to explore the relationship between two clearly differentiated cultural areas (North and Central Andes on the basis of a definition and study of the prehistory transitional zone located between Río Jubones in Southern Ecuador and Río Olmos in Northern Peru between 1500 B.C. and 600 A.C.

Ciudad y protesta: Las luchas cívicas en Santander 1970-1984

Directory of Open Access Journals (Sweden)

Jhoney Díaz Fajardo

2013-01-01

Full Text Available Este artículo describe y analiza las protestas cívicas en Santander y los intentos por conformar movimientos cívicos en el departamento entre los años de 1970 a 1984. Los movimientos cívicos así como sus expresiones de protesta respondieron a demandas en donde lo territorial fue un aspecto central de sus reivindicaciones y un elemento de su identidad, en ese sentido en el artículo se nombraran dos tipos de expresiones cívicas: las locales y las regionales, ya que en los paros cívicos nacionales, como se analiza con el caso de 1977, la participación de los sectores cívicos en Bucaramanga fue casi inexistente y en Barrancabermeja correspondió mas a la situación particular del puerto donde se desarrollaba una huelga en Ecopetrol. Para tal fin, se hizo un seguimiento diario en las fuentes de periódicos (vanguardia liberal, así como las fuentes orales (entrevistas, publicaciones obreras, actas de la asamblea, el diario oficial y el archivo de AUDESA.

Aceite de oliva y cáncer

OpenAIRE

López, Sergio; Pacheco, Yolanda M.; Bermúdez, Beatriz; Abia, Rocío; Muriana, Francisco J. G.

2004-01-01

Numerosos estudios en los últimos años han determinado la existencia de una asociación entre las grasas procedentes de la dieta y el cáncer. Los ácidos grasos poliinsaturados (PUFA) de la familia n -6 pueden tener efectos proliferativos y angiogénicos, lo cual se debe en parte a que son especialmente sensibles a la peroxidación lipídica, formándose aldehídos que reaccionan con las bases del ADN y por lo tanto aductos exocíclicos con propiedades genotóxicas. Por el contrario, el consumo de die...

Etude de l’hémogramme dans la drépanocytose homozygote: à propos de 87 patients

Science.gov (United States)

Dahmani, Fatima; Benkirane, Souad; Kouzih, Jaafar; Woumki, Aziz; Mamad, Hassan; Masrar, Azlarab

2016-01-01

La drépanocytose homozygote, fait partie des hémoglobinopathies les plus fréquentes au Maroc. La drépanocytose est caractérisée par une grande variabilité d’expressions clinique et biologique qui dépendent des facteurs génétiques modulateurs et environnementaux. Elle se manifeste par une anémie régénérative de gravité très variable selon les individus. L’évolution spontanée en l’absence de traitement est le décès précoce. La drépanocytose est caractérisée par une grande variabilité d’expression clinique et biologique qui dépend des facteurs génétiques et environnementaux. Un tableau clinique sévère marqué par une fréquence de transfusion élevée et précoce, des complications infectieuses graves et une mortalité précoce. Un état inflammatoire constant caractérisé par des protéines inflammatoires élevées et état nutritionnel compromis. L’objectif est de déterminer le profil des paramètres hématologiques du drépanocytaire homozygote (SS) marocain au cours des stades stationnaires. Nous avons fait une étude descriptive transversale de 87 patients drépanocytaires (SS). Nous avons réalisé une étude biologique comportant: l’hémogramme avec étude morphologique des globules rouges en coloration MGG et numération automatique des réticulocytes. Les électrophorèses de l’hémoglobine à pH alcalin (8.8) sur gel d’agarose avec intégration densitométrique. L’âge moyen est de 13.22 ans ± 16.36 avec un sex- ratio (H/F) de 1.175 et des extrêmes allant de 0.6 à 36 ans. La répercussion de l’anémie sur le plan biologique, est intense chez 88.5% des patients, 67.8% ont une anémie normocytaire contre 29.9% présentant une microcytose, et 2.3% qui présentaient une macrocytose. Le degré d’anisocytose est lié au degré d’anémie, très évocatrice chez les drépanocytaires homozygotes S/S (95,4%). Une réticulocytose était observée chez nos patients (81,6%) et 52.9% présentaient une

ERAD defects and the HFE-H63D variant are associated with increased risk of liver damages in Alpha 1-Antitrypsin Deficiency

Science.gov (United States)

Di Martino, Julie; Ruiz, Mathias; Garin, Roman; Restier, Lioara; Belmalih, Abdelouahed; Marchal, Christelle; Cullin, Christophe; Arveiler, Benoit; Fergelot, Patricia; Gitler, Aaron D.; Lachaux, Alain; Couthouis, Julien

2017-01-01

Background The most common and severe disease causing allele of Alpha 1-Antitrypsin Deficiency (1ATD) is Z-1AT. This protein aggregates in the endoplasmic reticulum, which is the main cause of liver disease in childhood. Based on recent evidences and on the frequency of liver disease occurrence in Z-1AT patients, it seems that liver disease progression is linked to still unknown genetic factors. Methods We used an innovative approach combining yeast genetic screens with next generation exome sequencing to identify and functionally characterize the genes involved in 1ATD associated liver disease. Results Using yeast genetic screens, we identified HRD1, an Endoplasmic Reticulum Associated Degradation (ERAD) associated protein, as an inducer of Z-mediated toxicity. Whole exome sequencing of 1ATD patients resulted in the identification of two variants associated with liver damages in Z-1AT homozygous cases: HFE H63D and HERPUD1 R50H. Functional characterization in Z-1AT model cell lines demonstrated that impairment of the ERAD machinery combined with the HFE H63D variant expression decreased both cell proliferation and cell viability, while Unfolded Protein Response (UPR)-mediated cell death was hyperstimulated. Conclusion This powerful experimental pipeline allowed us to identify and functionally validate two genes involved in Z-1AT-mediated severe liver toxicity. This pilot study moves forward our understanding on genetic modifiers involved in 1ATD and highlights the UPR pathway as a target for the treatment of liver diseases associated with 1ATD. Finally, these findings support a larger scale screening for HERPUD1 R50H and HFE H63D variants in the sub-group of 1ATD patients developing significant chronic hepatic injuries (hepatomegaly, chronic cholestasis, elevated liver enzymes) and at risk developing liver cirrhosis. PMID:28617828

The Frequency of Factor V Leiden, Prothrombin G20210A and Methylenetetrahydrofolate Reductase C677T Mutations in Migraine Patients

Directory of Open Access Journals (Sweden)

Ruhsen Öcal

2010-12-01

Full Text Available OBJECTIVE: Migraine is an independent risk factor for ischemic stroke, but its pathophysiology is still unclear. Genetic factors that predispose patients to thrombosis have been studied in patients with migraine to highlight the pathogenesis, but the results remain controversial. In this study, the frequencies of factor V Leiden (FVL, prothrombin (Pt G20210A and methylenetetrahydrofolate reductase (MTHFR C677T mutations were investigated. METHODS: One hundred and sixty patients aged of 15 to 55 years with no history of systemic disease and who had been diagnosed as migraine according to the International Headache Society (IHS diagnostic criteria at Baskent University Hospital Neurology Outpatient Clinics were investigated for FVL, Pt G20210A and MTHFR C677T mutations from their genomic DNA, and the results were compared with those of healthy controls. RESULTS: One hundred and fifty five (96.9% of 160 migraine patients were homozygote normal, 5 (3.1% were heterozygote and none of them were homozygote mutant for FVL. The control group had 9.8% heterozygote individuals but the difference between the percentages was not statistically significant (p> 0.05. There were no homozygote mutant individuals in the Turkish population study in normal subjects like our study. Thirty nine (24.4% of 160 migraine patients were heterozygote and 8 (5% were homozygote mutant for MTHFR C677T. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.15. Three (1.9% of 160 migraine patients were heterozygote and 5 (2.9% of the control group were heterozygote mutant for Pt G20210A mutation. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.420. CONCLUSION: Our study indicates that FVL, Pt G20210A and MTHFR C677T gene mutations, which are considered

The Frequency of Factor V Leiden, Prothrombin G20210A and Methylenetetrahydrofolate Reductase C677T Mutations in Migraine Patients

Directory of Open Access Journals (Sweden)

Ruhsen Öcal

2010-12-01

Full Text Available OBJECTIVE: Migraine is an independent risk factor for ischemic stroke, but its pathophysiology is still unclear. Genetic factors that predispose patients to thrombosis have been studied in patients with migraine to highlight the pathogenesis, but the results remain controversial. In this study, the frequencies of factor V Leiden (FVL, prothrombin (Pt G20210A and methylenetetrahydrofolate reductase (MTHFR C677T mutations were investigated. METHODS: One hundred and sixty patients aged of 15 to 55 years with no history of systemic disease and who had been diagnosed as migraine according to the International Headache Society (IHS diagnostic criteria at Baskent University Hospital Neurology Outpatient Clinics were investigated for FVL, Pt G20210A and MTHFR C677T mutations from their genomic DNA, and the results were compared with those of healthy controls. RESULTS: One hundred and fifty five (96.9% of 160 migraine patients were homozygote normal, 5 (3.1% were heterozygote and none of them were homozygote mutant for FVL. The control group had 9.8% heterozygote individuals but the difference between the percentages was not statistically significant (p> 0.05. There were no homozygote mutant individuals in the Turkish population study in normal subjects like our study. Thirty nine (24.4% of 160 migraine patients were heterozygote and 8 (5% were homozygote mutant for MTHFR C677T. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.15. Three (1.9% of 160 migraine patients were heterozygote and 5 (2.9% of the control group were heterozygote mutant for Pt G20210A mutation. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.420. CONCLUSION: Our study indicates that FVL, Pt G20210A and MTHFR C677T gene mutations, which are considered

A phase 1/2, dose-escalation trial of deferasirox for the treatment of iron overload in HFE-related hereditary hemochromatosis.

Science.gov (United States)

Phatak, Pradyumna; Brissot, Pierre; Wurster, Mark; Adams, Paul C; Bonkovsky, Herbert L; Gross, John; Malfertheiner, Peter; McLaren, Gordon D; Niederau, Claus; Piperno, Alberto; Powell, Lawrie W; Russo, Mark W; Stoelzel, Ulrich; Stremmel, Wolfgang; Griffel, Louis; Lynch, Nicola; Zhang, Yiyun; Pietrangelo, Antonello

2010-11-01

Hereditary hemochromatosis (HH) is characterized by increased intestinal iron absorption that may result in iron overload. Although phlebotomy is widely practiced, it is poorly tolerated or contraindicated in patients with anemias, severe heart disease, or poor venous access, and compliance can vary. The once-daily, oral iron chelator, deferasirox (Exjade) may provide an alternative treatment option. Patients with HH carrying the HFE gene who were homozygous for the Cys282Tyr mutation, serum ferritin levels of 300-2000 ng/mL, transferrin saturation ≥ 45%, and no known history of cirrhosis were enrolled in this dose-escalation study to characterize the safety and efficacy of deferasirox, comprising a core and an extension phase (each 24 weeks). Forty-nine patients were enrolled and received starting deferasirox doses of 5 (n = 11), 10 (n = 15), or 15 (n = 23) mg/kg/day. Adverse events were generally dose-dependent, the most common being diarrhea, headache, and nausea (n = 18, n = 10, and n = 8 in the core and n = 1, n = 1, and n = 0 in the extension, respectively). More patients in the 15 mg/kg/day than in the 5 or 10 mg/kg/day cohorts experienced increases in alanine aminotransferase and serum creatinine levels during the 48-week treatment period; six patients had alanine aminotransferase > 3 × baseline and greater than the upper limit of normal range, and eight patients had serum creatinine > 33% above baseline and greater than upper limit of normal on two consecutive occasions. After receiving deferasirox for 48 weeks, median serum ferritin levels decreased by 63.5%, 74.8%, and 74.1% in the 5, 10, and 15 mg/kg/day cohorts, respectively. In all cohorts, median serum ferritin decreased to < 250 ng/mL. Deferasirox doses of 5, 10, and 15 mg/kg/day can reduce iron burden in patients with HH. Based on the safety and efficacy results, starting deferasirox at 10 mg/kg/day appears to be most appropriate for further study in this patient population.

High-temperature vaporization of thorium-uranium mixed monocarbide (Th1-y, Uy)C

International Nuclear Information System (INIS)

Koyama, Tadafumi; Yamawaki, Michio

1989-01-01

Vaporization thermodynamics of thorium-uranium mixed monocarbide phase (Th 1-y , U y )C was studied by mass spectrometric Knudsen effusion method for the compositions of (Th 0.9 , U 0.1 )C 0.855 , (Th 0.8 , U 0.2 )C 0.973 and (Th 0.6 , U 0.4 )C 0.973 . The partial vapor pressures of Th(g) and U(g) and activities of Th and U of these mixed monocarbides were determined at temperatures ranging from about 2000 to 2200 K. Further, the partial pressures of Th(g) and U(g) and activities of Th and U of the stoichiometric mixed monocarbides (Th 1-y , U y )C 1.00 were evaluated by compensating for the effect of carbon content. The Gibbs energies of formation of stoichiometric (Th 1-y , U y )C 1.00 were also evaluated. (orig.)

Astures y cántabros bajo la administración romana

Directory of Open Access Journals (Sweden)

C. M. BLÁZQUEZ

2009-11-01

Full Text Available Los cántabros y los astures fueron los últimos pueblos hispanos sometidos por Roma. La guerra de conquista terminó en el año 19. a.C. y fue llevada con gran ferocidad por ambas partes. Concretamente los territorios que se incorporaron al Imperio Romano fueron los de los cántabros y de los astures, algo más extensos que las actuales provincias de Astuturias y Santander. El ángulo NO., Galicia, había sido ya conquistado por la acción de César en el 61. a.C. (Dio Cass. 37, 52-53. Plut. Caes. 12, Zon. 10, 6. Gran parte del territorio vascón lo había sido ya antes durante la guerra sertoriana y de él hizo Pompeyo la base de sus operaciones (Plut. Sert. 21, fundando la ciudad de Pamplona, a la que el general romano dio su nombre.

Hydrogen bonded C-H···Y (Y = O, S, Hal) molecular complexes: A natural bond orbital analysis

Science.gov (United States)

Isaev, A. N.

2016-03-01

Hydrogen bonded C-H···Y complexes formed by H2O, H2S molecules, hydrogen halides, and halogen-ions with methane, halogen substituted methane as well as with the C2H2 and NCH molecules were studied at the MP2/aug-cc-pVDZ level. The structure of NBOs corresponding to lone pair of acceptor Y, n Y, and vacant anti-σ-bond C-H of proton donor was analyzed and estimates of second order perturbation energy E(2) characterizing donor-acceptor n Y → σ C-H * charge-transfer interaction were obtained. Computational results for complexes of methane and its halogen substituted derivatives show that for each set of analogous structures, the EnY→σ*C-H (2) energy tends to grow with an increase in the s-component percentage in the lone pair NBO of acceptor Y. Calculations for different C···Y distances show that the equilibrium geometries of complexes lie in the region where the E(2) energy is highest and it changes symbatically with the length of the covalent E-H bond when the R(C···Y) distance is varied. The performed analysis allows us to divide the hydrogen bonded complexes into two groups, depending on the pattern of overlapping for NBOs of the hydrogen bridge.

Hyperhomocysteinemia, methylenetetrahydrofolate reductase c.677C>T polymorphism and risk of cancer: cross-sectional and prospective studies and meta-analyses of 75,000 cases and 93,000 controls

DEFF Research Database (Denmark)

Zacho, Jeppe; Yazdanyar, Shiva; Bojesen, Stig E

2011-01-01

including 74,671 cases and 93,344 controls. Cross-sectionally, plasma homocysteine levels were 12.9 and 11.6 µmol/L in those with and without cancer (p homocysteine levels increased with age and age-adjusted odds ratio for any cancer in those with homocysteine levels >12.4 versus ....4 µmol/L did not differ from 1.0. In cancer-free participants, plasma homocysteine levels were 14.7 and 11.7 µmol/L in MTHFR c.677C>T homozygtes and noncarriers (p T homozygotes versus noncarriers did not differ...... from 1.0. However, in meta-analyses odds ratio for MTHFR c.677C>T homozygotes versus noncarriers were 1.07 (95% CI: 1.01-1.12) for any cancer, 1.77 (1.17-2.68) for esophagus cancer, 1.40 (1.19-1.66) for gastric cancer and 0.85 (0.77-0.94) for colorectal cancer. Increased plasma homocysteine levels...

Y2 receptor gene variants reduce the risk of hypertension in obese children and adolescents.

Science.gov (United States)

Santoro, Nicola; Del Giudice, Emanuele Miraglia; Grandone, Anna; Marzuillo, Pierluigi; Cozzolino, Domenico; Di Salvo, Giovanni; Pacileo, Giuseppe; Calabrò, Raffaele; Perrone, Laura

2008-08-01

To verify whether peptide YY (PYY) and its Y2 receptor (Y2R) gene variants can be associated with obesity or hypertension or both in a cohort of obese children and adolescents. Two hundred and twenty-nine obese children (105 girls, mean z-score BMI 5.1 +/- 2.4; mean age 10.5 +/- 2.9 years) and 250 age and sex-matched lean controls (130 women, mean z-score BMI 0.5 +/- 1.1; mean age 10.3 +/- 2.8) were enrolled in the study. Height, weight, BMI, waist circumference and 24-h systolic and diastolic blood pressure were measured. Night-time, day-time and 24-h systolic and diastolic blood pressures were evaluated by 24 h ambulatory blood pressure measurement, and appropriate standard deviation scores according to sex, age and height were calculated. Molecular screening of the PYY and Y2R genes was performed. No new mutations were found. We observed three previously described polymorphisms: G767C on PYY and T585C and T936C on Y2R. An association study was carried out in obese patients. No associations were found between the PYY genotypes and the studied phenotypes. The Y2R gene variants, T585C and T936C, which are in almost complete linkage disequilibrium, were found to be associated with night-time, day-time and 24-h systolic and diastolic blood pressures. In particular, subject homozygotes for the T allele showed lower systolic and diastolic blood pressure values compared with the other genotypes. Moreover, obese children homozygous for the T585 allele showed a lower risk of developing hypertension than patients carrying the CC and CT genotypes (chi 6.9; df = 1, P = 0.03; odds ratio = 0.5, 95% confidence interval: 0.27-0.88). Our results suggest that Y2R gene variants are involved in blood pressure regulation in obese children and adolescents.

Experiment data report for semiscale Mod-1 test S-28-2 (steam generator tube rupture test)

International Nuclear Information System (INIS)

Patton, M.L.; Sackett, K.E.

1977-10-01

Recorded test data are presented for Test S-28-2 of the Semiscale Mod-1 steam generator tube rupture test series. These tests are among several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a pressurized water reactor (PWR) system. Test S-28-2 was conducted from initial conditions of 15 936 kPa and 558 K to investigate the response of the Semiscale Mod-1 system to a depressurization and reflood transient following a simulated double-ended offset shear of the broken loop cold leg piping. During the test, cooling water was injected into the cold leg of the intact and broken loops to simulate emergency core coolant injection in a PWR. For Test S-28-2, accumulator injection into the intact loop hot leg was provided to simulate simulate the rupture of six steam generator tubes

Radiación solar y prevención del cáncer de piel

OpenAIRE

Zapater López, María

2017-01-01

Introducción. El cáncer de piel se considera un problema de Salud Pública. Se clasifica en: cáncer de piel no melanoma (que, a su vez, se divide en cáncer basocelular y cáncer espinocelular) y cáncer melanoma. El primero es más frecuente y tiene un pronóstico relativamente bueno; el segundo es menos frecuente y su pronóstico puede ser infausto. Objetivos. El objetivo principal del trabajo es profundizar en la influencia de la radiación ultravioleta en el cáncer de piel y valorar posibles f...

Efectos de los nutrientes y compuestos biactivos de los alimentos en tejidos y células de cáncer humano: aproximación nutrigenómica

Directory of Open Access Journals (Sweden)

Jhonny E. Vargas Hernández

2013-07-01

El objetivo de esta investigación fue revisar, en la información científica reciente, los efectos o interacciones de los nutrientes y compuestos bioactivos de los alimentos en tejidos y/o células de cáncer humano bajo una aproximación nutrigenómica. Se realizó una búsqueda de los artículos, publicados entre enero de 2011 y octubre de 2012, en la base de datos Pubmed, utilizando términos MeSH y “Text Word” relevantes para el objetivo de investigación. De esta búsqueda se obtuvo un total de 250 publicaciones de los cuales se seleccionaron 33. En general, los efectos e interacciones de los nutrientes y compuestos bioactivos selectivamente inducen la muerte e inhiben el crecimiento y proliferación de las células cancerígenas; sin embargo, bajo ciertas condiciones, dichos efectos e interacciones pueden promover la carcinogénesis

The CYP1A2 -163C>A polymorphism does not alter the effects of caffeine on basketball performance

Science.gov (United States)

Puente, Carlos; Abián-Vicén, Javier; Lara, Beatriz; Salinero, Juan José

2018-01-01

Purpose The aim of this investigation was to analyze the influence of the genetic variations of the -163C>A polymorphism of the CYP1A2 gene on the ergogenic effects of caffeine in elite basketball players. Methods Nineteen elite basketball players (10 men and 9 women) ingested 3 mg⋅kg-1 of caffeine or a placebo 60 min before performing 10 repetitions of the following series: the Abalakov jump test followed by the Change-of-Direction and Acceleration Test (CODAT). The players then competed in a 20-min simulated basketball game. Self-perceived performance and side effects were recorded by questionnaires after the trials. The effects of caffeine on basketball performance were established according to players’ CYP1A2 genotype (rs762551): AA homozygotes (n = 10) and C-allele carriers (n = 9). Results In the 10 repetitions, caffeine increased Abalakov jump height by a mean of 2.9±3.6% in AA homozygotes (p = 0.03) while this effect did not reach statistical significance for C-allele carriers (2.3 ± 6.8%; p = 0.33). Caffeine did not affect sprint time in the CODAT test in either genotype group but it increased the number of impacts performed during the simulated game in both AA homozygotes (4.1 ± 5.3%; p = 0.02) and C-allele carriers (3.3 ± 3.2%; p = 0.01). During the 24 h following the test, AA homozygotes tended to experience increased insomnia with caffeine while C-allele carriers did not present this effect. The remaining variables were unaffected by the genotype. Conclusion The CYP1A2 -163C>A polymorphism minimally altered the ergogenicity derived from the consumption of a moderate dose of caffeine in elite basketball players. PMID:29668752

The CYP1A2 -163C>A polymorphism does not alter the effects of caffeine on basketball performance.

Science.gov (United States)

Puente, Carlos; Abián-Vicén, Javier; Del Coso, Juan; Lara, Beatriz; Salinero, Juan José

2018-01-01

The aim of this investigation was to analyze the influence of the genetic variations of the -163C>A polymorphism of the CYP1A2 gene on the ergogenic effects of caffeine in elite basketball players. Nineteen elite basketball players (10 men and 9 women) ingested 3 mg⋅kg-1 of caffeine or a placebo 60 min before performing 10 repetitions of the following series: the Abalakov jump test followed by the Change-of-Direction and Acceleration Test (CODAT). The players then competed in a 20-min simulated basketball game. Self-perceived performance and side effects were recorded by questionnaires after the trials. The effects of caffeine on basketball performance were established according to players' CYP1A2 genotype (rs762551): AA homozygotes (n = 10) and C-allele carriers (n = 9). In the 10 repetitions, caffeine increased Abalakov jump height by a mean of 2.9±3.6% in AA homozygotes (p = 0.03) while this effect did not reach statistical significance for C-allele carriers (2.3 ± 6.8%; p = 0.33). Caffeine did not affect sprint time in the CODAT test in either genotype group but it increased the number of impacts performed during the simulated game in both AA homozygotes (4.1 ± 5.3%; p = 0.02) and C-allele carriers (3.3 ± 3.2%; p = 0.01). During the 24 h following the test, AA homozygotes tended to experience increased insomnia with caffeine while C-allele carriers did not present this effect. The remaining variables were unaffected by the genotype. The CYP1A2 -163C>A polymorphism minimally altered the ergogenicity derived from the consumption of a moderate dose of caffeine in elite basketball players.

Comportamiento mecánico y estudio in situ de la evolución del daño en el grafito y en un compuesto C/C a 77 y a 300 K

Directory of Open Access Journals (Sweden)

Salazar, A.

2002-04-01

Full Text Available The mechanical properties at 77 K and at 300 K were determined in two polycristalline graphites with different microstructures and in a C/C composite. The flexure strength and the fracture toughness were evaluated and the micromechanic failure was studied in situ with a long distance microscope. The results obtained showed that the mechanical properties of these carbon materials are not affected by the cryogenic temperatures. The porosity is the main responsible of the mechanical failure in the graphites while in the composite, the matrix/yarn interface deflect the crack nucleated in the mattrix, presenting the best mechanical behavior.

En este trabajo se han evaluado las propiedades mecánicas a 77 y a 300 K de dos grafitos policristalinos con microestructuras muy diferentes y de un compuesto C/C. Se realizaron ensayos de flexión en tres puntos y de tenacidad, y en éstos últimos se midió in situ la iniciación y la evolución del daño en el fondo de la entalla con un microscopio de larga distancia focal. Los resultados obtenidos muestran que las temperaturas criogénicas no afectan el comportamiento mecánico de los compuestos de carbono estudiados. Además, la porosidad presente en los grafitos es el mecanismo de rotura dominante mientras que en el material compuesto, la intercara débil entre matriz y haz de fibras detiene y desvía las grietas nucleadas en la matriz, presentando el mejor comportamiento mecánico.

Incidencia y mortalidad por cáncer cervicouterino

OpenAIRE

Reyes Zuñiga, Yesika Isabel; Sanabria Negrín, José Guillermo; Marrero Fernández, Raydel

2014-01-01

Introducción: existe un desconocimiento del impacto del Programa de Detección Precoz del cáncer cervicouterino en el área de salud del policlínico Pedro Borrás Astorga. Objetivo: evaluar el impacto del Programa de Detección Precoz del Cáncer Cervicouterino en el área de salud del Policlínico Universitario "Pedro Borrás Astorga", Pinar del Río, 2004-2011. Material y método: se realizó una investigación observacional, descriptiva y retrospectiva, utilizando la base automatizada de datos de la C...

Nutrition and cancer Nutrición y cáncer

Directory of Open Access Journals (Sweden)

WALTER C WILLETT

1997-07-01

Full Text Available Evidence from both animal and epidemiologic studies indicate that throughout life excessive energy intake in relation to requirements increases risk of human cancer. Rapid growth rates in childhood lead to earlier age at menarche, which in turn increases risk of breast cancer, and accumulation of body fat in adulthood in related to cancers of the colon, kidney, and endometrium as well as postmenopausal breast cancer. Higher intake of vegetables and fruits has been associated with lower risks of many cancers. The constituents responsible for these apparent protective effects remain uncertain, although evidence supports a contribution of folic acid. Recent evidence suggests that the percentage of energy from fat in the diet is not a major cause of cancers of the breast or colon. Higher intake of meat and dairy products has been associated with greater risk of prostate cancer, which may be related to their saturated fat content. Also, red meat consumption has been associated with risk of colon cancer in numerous studies, but this appears to be unrelated to its fat content. Excessive consumption of alcohol increases risks of upper gastrointestinal tract and even moderate intake appears to increase cancers of the breast and large bowel. Although many details remain to be learned, evidence is strong that remaining physically active and lean throughout life, consuming an abundance of fruits and vegetables, and avoiding high intakes of red meat, foods high in animal fat, and excessive alcohol will substantially reduce risk of human cancer.La evidencia que proporcionan tanto los estudios en animales como los epidemiológicos, indica que el consumo excesivo de energía incrementa el riesgo de cáncer en los humanos. Las tasas de crecimiento rápidas durante la niñez pueden conducir a una menarquia temprana, lo que aumenta el riesgo de cáncer de mama, y la acumulación de grasa corporal en la madurez está relacionada con el cáncer de colon, riñón y

Interleukin 6 -174(G>C) gene polymorphism is related to celiac disease and autoimmune thyroiditis coincidence in diabetes type 1 children.

Science.gov (United States)

Myśliwiec, Małgorzata; Myśliwska, Jolanta; Zorena, Katarzyna; Balcerska, Anna; Malinowska, Ewa; Wiśniewski, Piotr

2008-10-01

The aim of the study was to assess the relationship between IL-6 gene polymorphism at -174(G>C) and the coincidence of celiac and autoimmune thyroid diseases with type 1 diabetes mellitus (DM1) in children. 200 children with DM1 aged 13.23+/-3.54 years and 172 healthy controls were analyzed. The IL-6 gene -174(G>C) polymorphism at the promoter region of the gene was analyzed by the PCR-RFLP method. The genotype distribution was significantly different in diabetic children as compared to the healthy controls (p=0.01). In DM1 patients GC heterozygotes were the most common (52.5%), while CC homozygotes accuted for 29% and GG homozygotes only for 18% of cases. In contrast, GG homozygotes were much more frequent among healthy children (31%). Besides, the GG homozygotes were significantly more frequent among diabetic children with celiac disease (p=0.04) in relation to those without autoimmune complications. In children with autoimmune thyroiditis, the distribution of the IL-6 genotypes was similar to that seen in diabetic patients without autoimmune complications (p=0.24). The results of our study suggest that the diabetic children, who have IL-6 gene -174GG genotype may have an increased risk for celiac disease development.

Prevalence of 1691G>A FV mutation in Poland compared with that in other Central, Eastern and South-Eastern European countries.

Science.gov (United States)

Adler, Grażyna; Clark, Jeremy S C; Loniewska, Beata; Czerska, Ewa; Salkic, Nermin N; Ciechanowicz, Andrzej

2012-05-01

The 1691G>A FV variant has been described as a common genetic risk factor in venous thromboembolism. The purpose of this study was to provide a further frequency value for 1691G>A FV in Poland and to collate summary data from Central (Poland, Czech, Slovakia), Eastern (Russia, Belarus, Ukraine) and South-Eastern (Slovenia, Croatia, Bosnia and Herzegovina, Serbia, Montenegro, Macedonia, Bulgaria) European countries. For this purpose in 2007 the 1691G>A FV variant was analyzed by polymerase chain reaction-restriction fragment length polymorphism from DNA collected in 2005-2006. We studied 650 subjects: 400 newborns and 250 older individuals (mean age 46.1 y) from Poland and compared results with reports from other countries, as well as with the frequency trend of 845G>A HFE across South-Eastern European countries using centroid cities. From our 1691G>A FV study we identified 626 GG homozygotes, 23 GA heterozygotes, and 1 AA homozygote (n = 650), giving an A allele frequency of 1.9%, and a summed frequency value for Poland of 2.0% (n = 1588); the frequency in Central European countries was 3.9% (n = 4559), mostly due to the high value in the Czech Republic: 5.1% (n = 2819); the South-Eastern European countries had 2.5% (n = 2410). Among the Eastern European countries the 1691G>A FV allele frequency was 1.9% (n=791), between the South-Eastern and Eastern European countries there was no significant difference (p=0.17). We confirm that the 1691G>A FV allele frequency in Poland, as well as other countries compared, is significantly lower than that in Czech.

Loss of Hfe Leads to Progression of Tumor Phenotype in Primary Retinal Pigment Epithelial Cells

Science.gov (United States)

Gnana-Prakasam, Jaya P.; Veeranan-Karmegam, Rajalakshmi; Coothankandaswamy, Veena; Reddy, Sushma K.; Martin, Pamela M.; Thangaraju, Muthusamy; Smith, Sylvia B.; Ganapathy, Vadivel

2013-01-01

Purpose. Hemochromatosis is a disorder of iron overload arising mostly from mutations in HFE. HFE is expressed in retinal pigment epithelium (RPE), and Hfe−/− mice develop age-related iron accumulation and retinal degeneration associated with RPE hyperproliferation. Here, the mechanism underlying the hyperproliferative phenotype in RPE was investigated. Methods. Cellular senescence was monitored by β-galactosidase activity. Gene expression was monitored by real-time PCR. Survivin was analyzed by Western blot and immunofluorescence. Migration and invasion were monitored using appropriate kits. Glucose transporters (GLUTs) were monitored by 3-O-methyl-D-glucose uptake. Histone deacetylases (HDACs) were studied by monitoring catalytic activity and acetylation status of histones H3/H4. Results. Hfe−/− RPE cells exhibited slower senescence rate and higher survivin expression than wild type cells. Hfe−/− cells migrated faster and showed greater glucose uptake and increased expression of GLUTs. The expression of HDACs and DNA methyltransferase (DNMTs) also was increased. Similarly, RPE cells from hemojuvelin (Hjv)-knockout mice, another model of hemochromatosis, also had increased expression of GLUTs, HDACs, and DNMTs. The expression of Slc5a8 was decreased in Hfe−/− RPE cells, but treatment with a DNA methylation inhibitor restored the transporter expression, indicating involvement of DNA methylation in the silencing of Slc5a8 in Hfe−/− cells. Conclusions. RPE cells from iron-overloaded mice exhibit several features of tumor cells: decreased senescence, enhanced migration, increased glucose uptake, and elevated levels of HDACs and DNMTs. These features are seen in Hfe−/− RPE cells as well as in Hjv−/− RPE cells, providing a molecular basis for the hyperproliferative phenotype of Hfe−/− and Hjv−/− RPE cells. PMID:23169885

Editorial-28(2-Eng

Directory of Open Access Journals (Sweden)

Yuri Morales

2014-01-01

Full Text Available Número actual (Vol.28 – N°1   Este número brinda al lector tres trabajos científicos en las áreas de topografía y geodesia, biología, y farmacia. Estos trabajos corresponden a manuscritos presentados en 2012 y 2013, y ofrecen aportes considerados de importancia para compartir con la comunidad nacional e internacional. El primer artículo, según los autores, describe el movimiento cinemático de una zona considerada sobre la placa Caribe, partiendo del hecho de que, precisamente, las diferencias en las series temporales, al igual que en el Sistema Geocéntrico para las Américas  (SIRGAS, se deben a los movimientos propios. El segundo trabajo, como indica el autor, tuvo como objetivo conocer, de manera sostenible, los recursos biológicos y ecológicos del Proyecto Hidroeléctrico de Toro 2. Para conocer si el sitio reúne las condiciones biológicas de atracción turística, se realizó una investigación en donde se hizo un inventario de aves, mamíferos y plantas. Por último, en el tercer artículo los autores aportan información sobre diferencias en el perfil de compuestos fenólicos y su actividad anti-radical entre diferentes comercializadores de tisanas de Hibiscus sabdariffa en Costa Rica.   Yuri Morales López Director Revista Uniciencia

Citotoxicidad y genotoxicidad en células humanas expuestas in vitro a glifosato.

Directory of Open Access Journals (Sweden)

Claudia Milena Monroy

2005-09-01

Full Text Available Introducción. El glifosato es un herbicida de amplio espectro, no selectivo, utilizado para eliminar malezas indeseables en ambientes agrícolas y forestales. La acción herbicida corresponde a la inhibición de la biosíntesis de aminoácidos aromáticos en las plantas. Al no ser este mecanismo compartido por los seres humanos es considerado como de bajo riesgo para la salud de los mismos. Sin embargo, investigaciones recientes indican que puede alterar otros procesos celulares en animales lo que puede presentar un factor de riesgo a nivel ambiental y de salud en las zonas donde se emplea este herbicida. Objetivo. El objetivo del presente estudio fue evaluar la citotoxicidad y la genotoxicidad del glifosato en células humanas normales (GM38 y en células humanas de fibrosarcoma (HT1080. Materiales y métodos. La citotoxicidad aguda y crónica se determinó al exponer las células en cultivo a diferentes concentraciones de glifosato, y se analizó la viabilidad celular con cristal violeta y colorante de exclusión azul de tripano, respectivamente. La genotoxicidad se determinó por medio del ensayo del cometa y los datos se analizaron usando la prueba de Dunnet. Resultados. En la citotoxicidad crónica las células GM38 y las HT1080 presentaron un efecto dependiente de la dosis después del tratamiento con glifosato en concentraciones de 5,2 a 8,5 mM y 0,9 a 3,0 mM, respectivamente. En la citotoxicidad aguda, las células GM38 y las HT1080 expuestas a un rango de concentraciones de 4,0 a 7,0 mM, 4,5 a 5,75 mM y 4,0 a 7,0 mM, respectivamente, presentaron una viabilidad mayor al 80%. Se evidenció daño en el ADN después del tratamiento con glifosato en concentraciones de 4,0 a 6,5 mM para las células GM38 y de 4,75 a 5,75 mM para las células HT1080. Conclusiones. Se sugiere que el mecanismo de acción del glifosato no se limita únicamente a las plantas sino que puede alterar la estructura del ADN en otros tipos de células como son las de

Plaguicidas y cáncer de mama en mujeres cordobesas

Directory of Open Access Journals (Sweden)

R. Angulo Lucena

2001-06-01

Full Text Available La exposición a contaminantes ambientales constituye en la actualidad un problema importante en salud pública, sobre todo con respecto al papel que dichos tóxicos juegan como carcinogenéticos. Este hecho junto con la incidencia creciente del cáncer de mama en España y de que no existe una relación clara entre esta patología y la exposición a plaguicidas, conduce a plantearnos evaluar el papel de los plaguicidas como factor de riesgo en el cáncer de mama en mujeres cordobesas.Se realiza un estudio de casos-controles en 134 mujeres que fueron sometidas a intervenciones quirúrgicas por lesiones mamarias en el Hospital Universitario Reina Sofía de Córdoba. A todas se les realiza un cuestionario, así como un estudio anatomopatológico y determinaciones en grasa mamaria de cuatro plaguicidas (HCB, HCH, p,p’DDE y Aldrín mediante cromatografía de gases.Tras el estudio anatomopatológico se estableció que 69 presentaban lesiones malignas (casos y 65 lesiones benignas (controles. Las determinaciones analíticas respecto a los 4 plaguicidas, detectan niveles elevados de p,p’DDE en todas las muestras, seguidas del HCB y Aldrín y en menores niveles y muestras se detecta el HCH.El análisis univariante detectó la edad, duración de la lactancia y niveles de Aldrín como factores de riesgo en las lesiones malignas, pero el análisis multivariante identificó los niveles del pesticida Aldrín como el factor más significativo en dichas lesiones (p < 0.001.Se establece la relación causal entre Aldrín y cáncer de mama, y se sugiere la necesidad de realizar nuevos estudios para eliminar los factores de confusión.

Deficiencia combinada de proteínas c y s

Directory of Open Access Journals (Sweden)

Yaneth Zamora-González

Full Text Available Las trombofilias son un grupo de enfermedades que favorecen la formación de trombosis, tanto arteriales como venosas, que han sido asociadas con diferentes complicaciones durante el embarazo, como: aborto recurrente, preclampsia, crecimiento intrauterino retardado y muerte fetal intraútero, entre otras. La deficiencia congénita o adquirida de proteínas de la coagulación, como las proteínas C y S, se asocia con eventos trombóticos antes de los 30 o 40 años. La trombosis venosa profunda es considerada la manifestación clínica más frecuente, aunque también puede verse asociada con enfermedad cerebro vascular, pérdidas recurrentes de embarazos y otros estados isquémicos. En la actualidad, las enfermedades trombóticas constituyen una de las primeras causas de fallecimiento en el mundo; la morbimortalidad anual por trombosis, ya sea arterial o venosa, es de aproximadamente dos millones de personas. Presentamos un caso con antecedentes de pérdidas recurrentes de embarazos y trombosis venosa profunda en miembros inferiores con deficiencia combinada de proteínas C y S.

Síntesis y propiedades analgésicas de imidas cíclicas: naftalimida y bisnaftalimida

OpenAIRE

Andricopulo, Adriano Defini; Yunes, Rosendo Augusto; Cechinel Filho, Valdir; Corrêa, Rogério; Willain Filho, Arnaldo; Santos, Adair Roberto S.; Nunes, Ricardo José

1998-01-01

En los últimos años se ha incrementado considerablemente el interés medicinal en las imidas cíclicas. Desde el aislamiento de la filantimida, un nuevo alcaloide presente en Phyllantus sellowianus, que posee moderadas propiedades antiespasmódicas y antibacterianas, se ha informado que varios análogos sintéticos poseen efectos antibacterianos, antifúngicos, antiespasmódicos y analgésicos. En el presente estudio fueron sintetizadas una serie de nuevas imidas cíclicas, derivadas de la naftalimida...

Review of advanced control rooms: Methodological considerations for the use of HFE guidelines

International Nuclear Information System (INIS)

O'Hara, J.M.

1994-01-01

Control rooms for advanced nuclear power plants use advanced human-system interface (HSI) technologies that may have significant implications for plant safety in that they will affect the operator's overall role in the system and the ways in which operators interact with the system. The US Nuclear Regulatory Commission (NRC) reviews HSIs to ensure that they are designed to accepted human factors engineering (HFE) principles. The principal review guidance, however, is more than ten-years old (US NRC, 1981). Accordingly, an Advanced HSI Design Review Guideline (DRG) was developed to provide criteria for these reviews. The DRG contains seven major sections: Information Display, User-System Interaction, Process Control and Input Devices, Alarms, Analysis and Decision Aids, Inter-Personnel Communication, and Workplace Design (see O'Hara ampersand Brown, 1993). The purpose of this paper is to describe the methodology for DRG use

Tratamiento de cáncer de seno y farmacogenética

Directory of Open Access Journals (Sweden)

Yeimy Viviana Ariza Márquez

2016-01-01

Full Text Available El cáncer de seno es una enfermedad con gran impacto a nivel mundial dado que es una de las patologías con mayor prevalencia en mujeres y el cáncer con mayor tasa de mortalidad en varios países (GLOBOCAN 2012. El uso de la farmacogenética y farmacogenómica, en pacientes con cáncer de seno tiene como fin, generar una salud personalizada que permita tratar a cada paciente como individuo y no como enfermedad, pues cada paciente tiene necesidades particulares a la hora de suministrarle un tratamiento. El propósito  de esta revisión es identificar las variantes genéticas reportadas en la literatura científica, donde se evalúan diferentes poblaciones y su posible uso como herramienta para medicina de precisión. En población colombiana es poca la caracterización poblacional que existe y por tanto estudios poblacionales son necesarios para definir los perfiles genéticos que deberán implementarse en nuestra población.

Infecciones cérvico vaginales y embarazo

Directory of Open Access Journals (Sweden)

A. Marcelo Pradenas, DR.

2014-11-01

Full Text Available La flora vaginal normal, conformada por múltiples microorganismos, juega un rol fundamental en la mantención de un ambiente adecuado de defensa contra ciertas infecciones durante el embarazo. Cuando se altera puede dar origen a Vaginosis Bacteriana, caracterizada por la presencia de múltiples bacterias en número mayor a lo habitual y que en el embarazo pueden potencialmente desencadenar efectos adversos, tanto en la madre como en el feto. Lo mismo ocurre con otro tipo de infecciones vaginales, como Clamydia y Gonorrea, que además de tener un impacto por ser las principales ETS, sus consecuencias en el feto pueden implicar secuelas de por vida. Si bien Estreptococo grupo B en la vagina no corresponde a una infección propiamente tal, su oportuna identificación y tratamiento durante el embarazo y parto, ha mostrado ser útil en la prevención de secuelas del recién nacido. El siguiente artículo aborda las principales infecciones cérvico vaginales, sus características y potenciales daños tanto para la madre como para su hijo.

Hydrogenation of Phenylacetylene to Styrene on Pre-C_xH_y- and C-Covered Cu(111) Single Crystal Catalysts

International Nuclear Information System (INIS)

Sohn, Young Ku; Wei, Wei; White, John M.

2011-01-01

Thermal hydrogenation of phenylacetylene (PA, C_8H_6) to styrene (C_8H_8) on pre-C_xH_y- and C-covered Cu(111) single crystal substrates has been studied using temperature-programmed desorption (TPD) mass spectrometry. Chemisorbed PA with an acetylene group has been proved to be associated with hydrogen of pre-adsorbed C_xH_y to form styrene (104 amu) on Cu surface. For the parent (PA) mass (102 amu) TPD profile, the TPD peaks at 360 K and 410 K are assigned to chemisorbed vertically aligned PA and flat-lying cross-bridged PA, respectively (J. Phys. Chem. C 2007, 111, 5101). The relative I_3_6_0_K/I_4_1_0_K TPD ratio dramatically increases with increasing pre-adsorbed C_xH_y before dosing PA, while the ratio does not increase for pre-C-covered surface. For PA on pre-C_xH_y-covered Cu(111) surface, styrene desorption is enhanced relative to the parent PA desorption, while styrene formation is dramatically quenched on pre-C-covered (lack of adsorbed hydrogen nearby) surface. It appears that only cross-bridged PA associates with adsorbed hydrogen to form styrene that promptly desorbs at 410 K, while vertically aligned PA is less likely to participate in forming styrene

Clima organizacional y satisfacción laboral de los trabajadores de la empresa E & C Contadores S.A.C., 2016