On the discrete spectrum of the N-body quantum mechanical Hamiltonian. Pt. 2

International Nuclear Information System (INIS)

Iorio, R.J. Jr.

1981-01-01

Using the Weinberg-van Winter equations we prove finiteness of the discrete spectrum of the N-body quantum mechanical Hamiltonian with pair potentials satisfying vertical stroke V(x) vertical stroke 2 ) - sup(rho), rho > 1 increase the threshold of the continuous spectrum is negative and determined exclusively by eigenvalues of two-cluster Hamiltonians. (orig.)

PSYCHE CPMG-HSQMBC: An NMR Spectroscopic Method for Precise and Simple Measurement of Long-Range Heteronuclear Coupling Constants.

Science.gov (United States)

Timári, István; Szilágyi, László; Kövér, Katalin E

2015-09-28

Among the NMR spectroscopic parameters, long-range heteronuclear coupling constants convey invaluable information on torsion angles relevant to glycosidic linkages of carbohydrates. A broadband homonuclear decoupled PSYCHE CPMG-HSQMBC method for the precise and direct measurement of multiple-bond heteronuclear couplings is presented. The PSYCHE scheme built into the pulse sequence efficiently eliminates unwanted proton-proton splittings from the heteronuclear multiplets so that the desired heteronuclear couplings can be determined simply by measuring frequency differences between peak maxima of pure antiphase doublets. Moreover, PSYCHE CPMG-HSQMBC can provide significant improvement in sensitivity as compared to an earlier Zangger-Sterk-based method. Applications of the proposed pulse sequence are demonstrated for the extraction of (n)J((1)H,(77)Se) and (n)J((1)H,(13)C) values, respectively, in carbohydrates; further extensions can be envisioned in any J-based structural and conformational studies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Adatom pair distribution up to half coverage: O-Pd(100)

OpenAIRE

Kappus, Wolfgang

2017-01-01

Using substrate mediated elastic interactions fitted previously to first principles (FP) calculations, adatom pair distributions are derived for O-Pd(100) evaluating a statistical BGY based integral equation. The evaluation method utilizes the superposition approximation, a temperature scaling scheme, and for one variant the particle-hole symmetry of a pair interaction lattice gas Hamiltonian. The elastic Hamiltonian is taken from a previous 3 parameter analytical model. The resulting adatom ...

Extension of the CPT theorem to non-Hermitian Hamiltonians and unstable states

Energy Technology Data Exchange (ETDEWEB)

Mannheim, Philip D., E-mail: philip.mannheim@uconn.edu

2016-02-10

We extend the CPT theorem to quantum field theories with non-Hermitian Hamiltonians and unstable states. Our derivation is a quite minimal one as it requires only the time-independent evolution of scalar products, invariance under complex Lorentz transformations, and a non-standard but nonetheless perfectly legitimate interpretation of charge conjugation as an antilinear operator. The first of these requirements does not force the Hamiltonian to be Hermitian. Rather, it forces its eigenvalues to either be real or to appear in complex conjugate pairs, forces the eigenvectors of such conjugate pairs to be conjugates of each other, and forces the Hamiltonian to admit of an antilinear symmetry. The latter two requirements then force this antilinear symmetry to be CPT, while forcing the Hamiltonian to be real rather than Hermitian. Our work justifies the use of the CPT theorem in establishing the equality of the lifetimes of unstable particles that are charge conjugates of each other. We show that the Euclidean time path integrals of a CPT-symmetric theory must always be real. In the quantum-mechanical limit the key results of the PT symmetry program of Bender and collaborators are recovered, with the C-operator of the PT symmetry program being identified with the linear component of the charge conjugation operator.

Hamiltonian Dynamics of Doubly-Foliable Space-Times

Directory of Open Access Journals (Sweden)

Cecília Gergely

2018-01-01

Full Text Available The 2 + 1 + 1 decomposition of space-time is useful in monitoring the temporal evolution of gravitational perturbations/waves in space-times with a spatial direction singled-out by symmetries. Such an approach based on a perpendicular double foliation has been employed in the framework of dark matter and dark energy-motivated scalar-tensor gravitational theories for the discussion of the odd sector perturbations of spherically-symmetric gravity. For the even sector, however, the perpendicularity has to be suppressed in order to allow for suitable gauge freedom, recovering the 10th metric variable. The 2 + 1 + 1 decomposition of the Einstein–Hilbert action leads to the identification of the canonical pairs, the Hamiltonian and momentum constraints. Hamiltonian dynamics is then derived via Poisson brackets.

Pair Interaction of Dislocations in Two-Dimensional Crystals

Science.gov (United States)

Eisenmann, C.; Gasser, U.; Keim, P.; Maret, G.; von Grünberg, H. H.

2005-10-01

The pair interaction between crystal dislocations is systematically explored by analyzing particle trajectories of two-dimensional colloidal crystals measured by video microscopy. The resulting pair energies are compared to Monte Carlo data and to predictions derived from the standard Hamiltonian of the elastic theory of dislocations. Good agreement is found with respect to the distance and temperature dependence of the interaction potential, but not regarding the angle dependence where discrete lattice effects become important. Our results on the whole confirm that the dislocation Hamiltonian allows a quantitative understanding of the formation and interaction energies of dislocations in two-dimensional crystals.

Supersymmetric Hamiltonian approach to edge excitations in ν=5/2 fractional quantum Hall effect

International Nuclear Information System (INIS)

Yu Ming; Zhang Xin

2008-01-01

A supersymmetric Hamiltonian is constructed for the edge excitations of the Moore-Read (Pfaffian) like state, which is a realization of the N=2 supersymmetric CS model. Fermionic generators and their conjugates are introduced to deal with the fermion pairing, whose condensation form a BCS like state. After Bogoliubov transformation, an N=2 supersymmetric and nonrelativistic Hamiltonian is found to take a known form, which is integrable. The main difference between the Moore-Read state and our BCS like state is that the number of fermion pairs in our formalism is not fixed. However, we have also found that the excited states in our model looks similar but not exactly the same as Moore and Read's

Heteronuclear three-dimensional NMR spectroscopy. Natural abundance 13C chemical shift editing of 1H-1H COSY spectra

International Nuclear Information System (INIS)

Fesik, S.W.; Gampe, R.T. Jr.; Zuiderweg, E.R.P.

1989-01-01

It has been demonstrated that heteronuclear 3D NMR spectroscopy can be effectively applied to small molecules with 13 C at natural abundance. A 78mM solution of the aminoglycoside, kanamycin A was used for this experiment. The heteronuclear 3D NMR spectroscopy is shown to be a useful method for resolving spectral overlap in all frequency domains. 10 refs., 2 figs

Scaling properties of the pairing problem in the strong coupling limit

International Nuclear Information System (INIS)

Barbaro, M.B.; Cenni, R.; Molinari, A.; Quaglia, M.R.

2013-01-01

We study the excited states of the pairing Hamiltonian providing an expansion for their energy in the strong coupling limit. To assess the role of the pairing interaction we apply the formalism to the case of a heavy atomic nucleus. We show that only a few statistical moments of the level distribution are sufficient to yield an accurate estimate of the energy for not too small values of the coupling G and we give the analytic expressions of the first four terms of the series. Further, we discuss the convergence radius G sing of the expansion showing that it strongly depends upon the details of the level distribution. Furthermore G sing is not related to the critical values of the coupling G crit , which characterize the physics of the pairing Hamiltonian, since it can exist even in the absence of these critical points. -- Highlights: •We study the excitation spectrum of the pairing Hamiltonian. •We provide an analytic expansion around the strong coupling limit. •We discuss the convergence radius of the expansion. •We connect the radius with the critical points of H

Long-range dispersion interactions. I. Formalism for two heteronuclear atoms

International Nuclear Information System (INIS)

Zhang, J.-Y.; Mitroy, J.

2007-01-01

A general procedure for systematically evaluating the long-range dispersion interaction between two heteronuclear atoms in arbitrary states is outlined. The C 6 dispersion parameter can always be written in terms of sum rules involving oscillator strengths only and formulas for a number of symmetry cases are given. The dispersion coefficients for excited alkali-metal atoms interacting with the ground-state H and He are tabulated

Lagrangian and Hamiltonian structures in an integrable hierarchy and space–time duality

International Nuclear Information System (INIS)

Avan, Jean; Caudrelier, Vincent; Doikou, Anastasia; Kundu, Anjan

2016-01-01

We define and illustrate the novel notion of dual integrable hierarchies, on the example of the nonlinear Schrödinger (NLS) hierarchy. For each integrable nonlinear evolution equation (NLEE) in the hierarchy, dual integrable structures are characterized by the fact that the zero-curvature representation of the NLEE can be realized by two Hamiltonian formulations stemming from two distinct choices of the configuration space, yielding two inequivalent Poisson structures on the corresponding phase space and two distinct Hamiltonians. This is fundamentally different from the standard bi-Hamiltonian or generally multitime structure. The first formulation chooses purely space-dependent fields as configuration space; it yields the standard Poisson structure for NLS. The other one is new: it chooses purely time-dependent fields as configuration space and yields a different Poisson structure at each level of the hierarchy. The corresponding NLEE becomes a space evolution equation. We emphasize the role of the Lagrangian formulation as a unifying framework for deriving both Poisson structures, using ideas from covariant field theory. One of our main results is to show that the two matrices of the Lax pair satisfy the same form of ultralocal Poisson algebra (up to a sign) characterized by an r-matrix structure, whereas traditionally only one of them is involved in the classical r-matrix method. We construct explicit dual hierarchies of Hamiltonians, and Lax representations of the triggered dynamics, from the monodromy matrices of either Lax matrix. An appealing procedure to build a multi-dimensional lattice of Lax pair, through successive uses of the dual Poisson structures, is briefly introduced.

Lagrangian and Hamiltonian structures in an integrable hierarchy and space–time duality

Energy Technology Data Exchange (ETDEWEB)

Avan, Jean, E-mail: Jean.Avan@u-cergy.fr [Laboratoire de Physique Théorique et Modélisation (CNRS UMR 8089), Université de Cergy-Pontoise, F-95302 Cergy-Pontoise (France); Caudrelier, Vincent, E-mail: v.caudrelier@city.ac.uk [Department of Mathematics, City University London, Northampton Square, EC1V 0HB London (United Kingdom); Doikou, Anastasia, E-mail: A.Doikou@hw.ac.uk [Department of Mathematics, Heriot-Watt University, EH14 4AS, Edinburgh (United Kingdom); Kundu, Anjan, E-mail: Anjan.Kundu@saha.ac.in [Saha Institute of Nuclear Physics, Theory Division, Kolkata (India)

2016-01-15

We define and illustrate the novel notion of dual integrable hierarchies, on the example of the nonlinear Schrödinger (NLS) hierarchy. For each integrable nonlinear evolution equation (NLEE) in the hierarchy, dual integrable structures are characterized by the fact that the zero-curvature representation of the NLEE can be realized by two Hamiltonian formulations stemming from two distinct choices of the configuration space, yielding two inequivalent Poisson structures on the corresponding phase space and two distinct Hamiltonians. This is fundamentally different from the standard bi-Hamiltonian or generally multitime structure. The first formulation chooses purely space-dependent fields as configuration space; it yields the standard Poisson structure for NLS. The other one is new: it chooses purely time-dependent fields as configuration space and yields a different Poisson structure at each level of the hierarchy. The corresponding NLEE becomes a space evolution equation. We emphasize the role of the Lagrangian formulation as a unifying framework for deriving both Poisson structures, using ideas from covariant field theory. One of our main results is to show that the two matrices of the Lax pair satisfy the same form of ultralocal Poisson algebra (up to a sign) characterized by an r-matrix structure, whereas traditionally only one of them is involved in the classical r-matrix method. We construct explicit dual hierarchies of Hamiltonians, and Lax representations of the triggered dynamics, from the monodromy matrices of either Lax matrix. An appealing procedure to build a multi-dimensional lattice of Lax pair, through successive uses of the dual Poisson structures, is briefly introduced.

Heteronuclear three-dimensional NMR spectroscopy of the inflammatory protein C5a

International Nuclear Information System (INIS)

Zuiderweg, E.R.P.; Fesik, S.W.

1989-01-01

The utility of three-dimensional heteronuclear NMR spectroscopy for the assignment of 1 H and 15 N resonances of the inflammatory protein C5a (MW 8500), uniformly labeled with 15 N, is demonstrated at a protein concentration of 0.7 mM. It is shown that dramatic simplification of the 2D nuclear Overhauser effect spectrum (NOESY) is obtained by editing with respect to the frequency of the 15 N heteronucleus in a third dimension. The improved resolution in the 3D experiment largely facilitates the assignment of protein NMR spectra and allows for the determination of distance constraints from otherwise overlapping NOE cross peaks for purposes of 3D structure determination. The results show that 15 N heteronuclear 3D NMR can facilitate the structure determination of small proteins and promises to be a useful tool for the study of larger systems that cannot be studied by conventional 2D NMR techniques

Heteronuclear three-dimensional NMR spectroscopy of the inflammatory protein C5a

Energy Technology Data Exchange (ETDEWEB)

Zuiderweg, E.R.P.; Fesik, S.W. (Abbott Laboratories, Abbott Park, IL (USA))

1989-03-21

The utility of three-dimensional heteronuclear NMR spectroscopy for the assignment of {sup 1}H and {sup 15}N resonances of the inflammatory protein C5a (MW 8500), uniformly labeled with {sup 15}N, is demonstrated at a protein concentration of 0.7 mM. It is shown that dramatic simplification of the 2D nuclear Overhauser effect spectrum (NOESY) is obtained by editing with respect to the frequency of the {sup 15}N heteronucleus in a third dimension. The improved resolution in the 3D experiment largely facilitates the assignment of protein NMR spectra and allows for the determination of distance constraints from otherwise overlapping NOE cross peaks for purposes of 3D structure determination. The results show that {sup 15}N heteronuclear 3D NMR can facilitate the structure determination of small proteins and promises to be a useful tool for the study of larger systems that cannot be studied by conventional 2D NMR techniques.

Contact Hamiltonian mechanics

Energy Technology Data Exchange (ETDEWEB)

Bravetti, Alessandro, E-mail: alessandro.bravetti@iimas.unam.mx [Instituto de Investigaciones en Matemáticas Aplicadas y en Sistemas, Universidad Nacional Autónoma de México, A. P. 70543, México, DF 04510 (Mexico); Cruz, Hans, E-mail: hans@ciencias.unam.mx [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, A. P. 70543, México, DF 04510 (Mexico); Tapias, Diego, E-mail: diego.tapias@nucleares.unam.mx [Facultad de Ciencias, Universidad Nacional Autónoma de México, A.P. 70543, México, DF 04510 (Mexico)

2017-01-15

In this work we introduce contact Hamiltonian mechanics, an extension of symplectic Hamiltonian mechanics, and show that it is a natural candidate for a geometric description of non-dissipative and dissipative systems. For this purpose we review in detail the major features of standard symplectic Hamiltonian dynamics and show that all of them can be generalized to the contact case.

A partial Hamiltonian approach for current value Hamiltonian systems

Science.gov (United States)

Naz, R.; Mahomed, F. M.; Chaudhry, Azam

2014-10-01

We develop a partial Hamiltonian framework to obtain reductions and closed-form solutions via first integrals of current value Hamiltonian systems of ordinary differential equations (ODEs). The approach is algorithmic and applies to many state and costate variables of the current value Hamiltonian. However, we apply the method to models with one control, one state and one costate variable to illustrate its effectiveness. The current value Hamiltonian systems arise in economic growth theory and other economic models. We explain our approach with the help of a simple illustrative example and then apply it to two widely used economic growth models: the Ramsey model with a constant relative risk aversion (CRRA) utility function and Cobb Douglas technology and a one-sector AK model of endogenous growth are considered. We show that our newly developed systematic approach can be used to deduce results given in the literature and also to find new solutions.

Renormalization of Hamiltonians

International Nuclear Information System (INIS)

Glazek, S.D.; Wilson, K.G.

1993-01-01

This paper presents a new renormalization procedure for Hamiltonians such as those of light-front field theory. The bare Hamiltonian with an arbitrarily large, but finite cutoff, is transformed by a specially chosen similarity transformation. The similarity transformation has two desirable features. First, the transformed Hamiltonian is band diagonal: in particular, all matrix elements vanish which would otherwise have caused transitions with big energy jumps, such as from a state of bounded energy to a state with an energy of the order of the cutoff. At the same time, neither the similarity transformation nor the transformed Hamiltonian, computed in perturbation theory, contain vanishing or near-vanishing energy denominators. Instead, energy differences in denominators can be replaced by energy sums for purposes of order of magnitude estimates needed to determine cutoff dependences. These two properties make it possible to determine relatively easily the list of counterterms needed to obtain finite low energy results (such as for eigenvalues). A simple model Hamiltonian is discussed to illustrate the method

R-matrix-valued Lax pairs and long-range spin chains

Science.gov (United States)

Sechin, I.; Zotov, A.

2018-06-01

In this paper we discuss R-matrix-valued Lax pairs for slN Calogero-Moser model and their relation to integrable quantum long-range spin chains of the Haldane-Shastry-Inozemtsev type. First, we construct the R-matrix-valued Lax pairs for the third flow of the classical Calogero-Moser model. Then we notice that the scalar parts (in the auxiliary space) of the M-matrices corresponding to the second and third flows have form of special spin exchange operators. The freezing trick restricts them to quantum Hamiltonians of long-range spin chains. We show that for a special choice of the R-matrix these Hamiltonians reproduce those for the Inozemtsev chain. In the general case related to the Baxter's elliptic R-matrix we obtain a natural anisotropic extension of the Inozemtsev chain. Commutativity of the Hamiltonians is verified numerically. Trigonometric limits lead to the Haldane-Shastry chains and their anisotropic generalizations.

A Discrete Spectral Problem and Related Hierarchy of Discrete Hamiltonian Lattice Equations

International Nuclear Information System (INIS)

Xu Xixiang; Cao Weili

2007-01-01

Staring from a discrete matrix spectral problem, a hierarchy of lattice soliton equations is presented though discrete zero curvature representation. The resulting lattice soliton equations possess non-local Lax pairs. The Hamiltonian structures are established for the resulting hierarchy by the discrete trace identity. Liouville integrability of resulting hierarchy is demonstrated.

Hamiltonian Algorithm Sound Synthesis

OpenAIRE

大矢, 健一

2013-01-01

Hamiltonian Algorithm (HA) is an algorithm for searching solutions is optimization problems. This paper introduces a sound synthesis technique using Hamiltonian Algorithm and shows a simple example. "Hamiltonian Algorithm Sound Synthesis" uses phase transition effect in HA. Because of this transition effect, totally new waveforms are produced.

First-principles lattice-gas Hamiltonian revisited: O-Pd(100)

OpenAIRE

Kappus, Wolfgang

2016-01-01

The methodology of deriving an adatom lattice-gas Hamiltonian (LGH) from first principles (FP) calculations is revisited. Such LGH cluster expansions compute a large set of lateral pair-, trio-, quarto interactions by solving a set of linear equations modelling regular adatom configurations and their FP energies. The basic assumption of truncating interaction terms beyond fifth nearest neighbors does not hold when adatoms show longer range interactions, e.g. substrate mediated elastic interac...

Non-perturbative RPA-method implemented in the Coulomb gauge QCD Hamiltonian: From quarks and gluons to baryons and mesons

Science.gov (United States)

Yepez-Martinez, Tochtli; Civitarese, Osvaldo; Hess, Peter O.

2018-02-01

Starting from an algebraic model based on the QCD-Hamiltonian and previously applied to study meson states, we have developed an extension of it in order to explore the structure of baryon states. In developing our approach we have adapted concepts taken from group theory and non-perturbative many-body methods to describe states built from effective quarks and anti-quarks degrees of freedom. As a Hamiltonian we have used the QCD Hamiltonian written in the Coulomb Gauge, and expressed it in terms of effective quark-antiquark, di-quarks and di-antiquark excitations. To gain some insights about the relevant interactions of quarks in hadronic states, the Hamiltonian was approximately diagonalized by mapping quark-antiquark pairs and di-quarks (di-antiquarks) onto phonon states. In dealing with the structure of the vacuum of the theory, color-scalar and color-vector states are introduced to account for ground-state correlations. While the use of a purely color-scalar ground state is an obvious choice, so that colorless hadrons contain at least three quarks, the presence of coupled color-vector pairs in the ground state allows for colorless excitations resulting from the action of color objects upon it.

Identity of the SU(3) model phenomenological hamiltonian and the hamiltonian of nonaxial rotator

International Nuclear Information System (INIS)

Filippov, G.F.; Avramenko, V.I.; Sokolov, A.M.

1984-01-01

Interpretation of nonspheric atomic nuclei spectra on the basis of phenomenological hamiltonians of SU(3) model showed satisfactory agreement of simulation calculations with experimental data. Meanwhile physical sense of phenomenological hamiltonians was not yet discussed. It is shown that phenomenological hamiltonians of SU(3) model are reduced to hamiltonian of nonaxial rotator but with additional items of the third and fourth powers angular momentum operator of rotator

Hamiltonian thermodynamics of charged three-dimensional dilatonic black holes

International Nuclear Information System (INIS)

Dias, Goncalo A. S.; Lemos, Jose P. S.

2008-01-01

The action for a class of three-dimensional dilaton-gravity theories, with an electromagnetic Maxwell field and a cosmological constant, can be recast in a Brans-Dicke-Maxwell type action, with its free ω parameter. For a negative cosmological constant, these theories have static, electrically charged, and spherically symmetric black hole solutions. Those theories with well formulated asymptotics are studied through a Hamiltonian formalism, and their thermodynamical properties are found out. The theories studied are general relativity (ω→±∞), a dimensionally reduced cylindrical four-dimensional general relativity theory (ω=0), and a theory representing a class of theories (ω=-3), all with a Maxwell term. The Hamiltonian formalism is set up in three dimensions through foliations on the right region of the Carter-Penrose diagram, with the bifurcation 1-sphere as the left boundary, and anti-de Sitter infinity as the right boundary. The metric functions on the foliated hypersurfaces and the radial component of the vector potential one-form are the canonical coordinates. The Hamiltonian action is written, the Hamiltonian being a sum of constraints. One finds a new action which yields an unconstrained theory with two pairs of canonical coordinates (M,P M ;Q,P Q ), where M is the mass parameter, which for ω M is the conjugate momenta of M, Q is the charge parameter, and P Q is its conjugate momentum. The resulting Hamiltonian is a sum of boundary terms only. A quantization of the theory is performed. The Schroedinger evolution operator is constructed, the trace is taken, and the partition function of the grand canonical ensemble is obtained, where the chemical potential is the scalar electric field φ. Like the uncharged cases studied previously, the charged black hole entropies differ, in general, from the usual quarter of the horizon area due to the dilaton.

Quasi-stationary states and fermion pair creation from a vacuum in supercritical Coulomb field

Science.gov (United States)

Khalilov, V. R.

2017-12-01

Creation of charged fermion pair from a vacuum in so-called supercritical Coulomb potential is examined for the case when fermions can move only in the same (one) plane. In which case, quantum dynamics of charged massive or massless fermions can be described by the two-dimensional Dirac Hamiltonians with an usual (-a/r) Coulomb potential. These Hamiltonians are singular and require the additional definition in order for them to be treated as self-adjoint quantum-mechanical operators. We construct the self-adjoint two-dimensional Dirac Hamiltonians with a Coulomb potential and determine the quantum-mechanical states for such Hamiltonians in the corresponding Hilbert spaces of square-integrable functions. We determine the scattering amplitude in which the self-adjoint extension parameter is incorporated and then obtain equations implicitly defining possible discrete energy spectra of the self-adjoint Dirac Hamiltonians with a Coulomb potential. It is shown that this quantum system becomes unstable in the presence of a supercritical Coulomb potential which manifests in the appearance of quasi-stationary states in the lower (negative) energy continuum. The energy spectrum of those states is quasi-discrete, consists of broadened levels with widths related to the inverse lifetimes of the quasi-stationary states as well as the probability of creation of charged fermion pair by a supercritical Coulomb field. Explicit analytical expressions for the creation probabilities of charged (massive or massless) fermion pair are obtained in a supercritical Coulomb field.

A real nonlinear integrable couplings of continuous soliton hierarchy and its Hamiltonian structure

International Nuclear Information System (INIS)

Yu Fajun

2011-01-01

Some integrable coupling systems of existing papers are linear integrable couplings. In the Letter, beginning with Lax pairs from special non-semisimple matrix Lie algebras, we establish a scheme for constructing real nonlinear integrable couplings of continuous soliton hierarchy. A direct application to the AKNS spectral problem leads to a novel nonlinear integrable couplings, then we consider the Hamiltonian structures of nonlinear integrable couplings of AKNS hierarchy with the component-trace identity. - Highlights: → We establish a scheme to construct real nonlinear integrable couplings. → We obtain a novel nonlinear integrable couplings of AKNS hierarchy. → Hamiltonian structure of nonlinear integrable couplings AKNS hierarchy is presented.

Heteronuclear relaxation in time-dependent spin systems: 15N-T1ρ dispersion during adiabatic fast passage

International Nuclear Information System (INIS)

Konrat, Robert; Tollinger, Martin

1999-01-01

A novel NMR experiment comprising adiabatic fast passage techniques for the measurement of heteronuclear self-relaxation rates in fully 15N-enriched proteins is described. Heteronuclear self-relaxation is monitored by performing adiabatic fast passage (AFP) experiments at variable adiabaticity (e.g., variation of RF spin-lock field intensity). The experiment encompasses gradient- selection and sensitivity-enhancement. It is shown that transverse relaxation rates derived with this method are in good agreement with the ones measured by the classical Carr-Purcell-Meiboom-Gill (CPMG) sequences. An application of this method to the study of the carboxyl-terminal LIM domain of quail cysteine and glycine-rich protein qCRP2(LIM2) is presented

Hamiltonian description of the ideal fluid

International Nuclear Information System (INIS)

Morrison, P.J.

1994-01-01

Fluid mechanics is examined from a Hamiltonian perspective. The Hamiltonian point of view provides a unifying framework; by understanding the Hamiltonian perspective, one knows in advance (within bounds) what answers to expect and what kinds of procedures can be performed. The material is organized into five lectures, on the following topics: rudiments of few-degree-of-freedom Hamiltonian systems illustrated by passive advection in two-dimensional fluids; functional differentiation, two action principles of mechanics, and the action principle and canonical Hamiltonian description of the ideal fluid; noncanonical Hamiltonian dynamics with examples; tutorial on Lie groups and algebras, reduction-realization, and Clebsch variables; and stability and Hamiltonian systems

Entanglement spectrum and boundary theories with projected entangled-pair states

Energy Technology Data Exchange (ETDEWEB)

Cirac, Ignacio [Max-Planck-Institut fuer Quantenoptik, Garching (Germany); Poilblanc, Didier [Laboratoire de Physique Theorique, C.N.R.S. and Universite de Toulouse, Toulouse (France); Schuch, Norbert [California Institute of Technology, Pasadena, CA (United States); Verstraete, Frank [Vienna Univ. (Austria)

2012-07-01

In many physical scenarios, close relations between the bulk properties of quantum systems and theories associated to their boundaries have been observed. In this work, we provide an exact duality mapping between the bulk of a quantum spin system and its boundary using Projected Entangled Pair States (PEPS). This duality associates to every region a Hamiltonian on its boundary, in such a way that the entanglement spectrum of the bulk corresponds to the excitation spectrum of the boundary Hamiltonian. We study various models and find that a gapped bulk phase with local order corresponds to a boundary Hamiltonian with local interactions, whereas critical behavior in the bulk is reflected on a diverging interaction length of the boundary Hamiltonian. Furthermore, topologically ordered states yield non-local Hamiltonians. As our duality also associates a boundary operator to any operator in the bulk, it in fact provides a full holographic framework for the study of quantum many-body systems via their boundary.

Assessment of protein solution versus crystal structure determination using spin- diffusion-suppressed NOE and heteronuclear relaxation data

International Nuclear Information System (INIS)

LeMaster, David M.

1997-01-01

A spin-diffusion-suppressed NOE buildup series has been measured for E. coli thioredoxin.The extensive 13C and 15N relaxation data previously reported for this protein allow for direct interpretation of dynamical contributions to the 1H-1H cross-relaxation rates for a large proportion of the NOE cross peaks. Estimates of the average accuracy for these derived NOE distances are bounded by 4% and 10%, based on a comparison to the corresponding X-ray distances. An independent fluctuation model is proposed for prediction of the dynamical corrections to 1H-1H cross-relaxation rates, based solely on experimental structural and heteronuclear relaxation data. This analysis is aided by the demonstration that heteronuclear order parameters greater than 0.6 depend only on the variance of the H-X bond orientation,independent of the motional model in either one- or two-dimensional diffusion (i.e., 1- S2 = 3/4 sin2 2 θσ). The combination of spin-diffusion-suppressed NOE data and analysis of dynamical corrections to 1H-1H cross-relaxation rates based on heteronuclear relaxation data has allowed for a detailed interpretation of various discrepancies between the reported solution and crystal structures

Hamiltonian formulation of systems with balanced loss-gain and exactly solvable models

Science.gov (United States)

Ghosh, Pijush K.; Sinha, Debdeep

2018-01-01

A Hamiltonian formulation of generic many-body systems with balanced loss and gain is presented. It is shown that a Hamiltonian formulation is possible only if the balancing of loss and gain terms occurs in a pairwise fashion. It is also shown that with the choice of a suitable co-ordinate, the Hamiltonian can always be reformulated in the background of a pseudo-Euclidean metric. If the equations of motion of some of the well-known many-body systems like Calogero models are generalized to include balanced loss and gain, it appears that the same may not be amenable to a Hamiltonian formulation. A few exactly solvable systems with balanced loss and gain, along with a set of integrals of motion are constructed. The examples include a coupled chain of nonlinear oscillators and a many-particle Calogero-type model with four-body inverse square plus two-body pair-wise harmonic interactions. For the case of nonlinear oscillators, stable solution exists even if the loss and gain parameter has unbounded upper range. Further, the range of the parameter for which the stable solutions are obtained is independent of the total number of the oscillators. The set of coupled nonlinear equations are solved exactly for the case when the values of all the constants of motions except the Hamiltonian are equal to zero. Exact, analytical classical solutions are presented for all the examples considered.

Optimal auxiliary Hamiltonians for truncated boson-space calculations by means of a maximal-decoupling variational principle

International Nuclear Information System (INIS)

Li, C.

1991-01-01

A new method based on a maximal-decoupling variational principle is proposed to treat the Pauli-principle constraints for calculations of nuclear collective motion in a truncated boson space. The viability of the method is demonstrated through an application to the multipole form of boson Hamiltonians for the single-j and nondegenerate multi-j pairing interactions. While these boson Hamiltonians are Hermitian and contain only one- and two-boson terms, they are also the worst case for truncated boson-space calculations because they are not amenable to any boson truncations at all. By using auxiliary Hamiltonians optimally determined by the maximal-decoupling variational principle, however, truncations in the boson space become feasible and even yield reasonably accurate results. The method proposed here may thus be useful for doing realistic calculations of nuclear collective motion as well as for obtaining a viable interacting-boson-model type of boson Hamiltonian from the shell model

Powerful effective one-electron Hamiltonian for describing many-atom interacting systems

International Nuclear Information System (INIS)

Lugo, J.O.; Vergara, L.I.; Bolcatto, P.G.; Goldberg, E.C.

2002-01-01

In this paper, we present an alternative way to build the effective one-electron picture of a many-atom interacting system. By simplifying the many-body general problem we present two different options for the bond-pair model Hamiltonian. We have found that the successive approximations in order to achieve the effective description have a dramatic influence on the result. Thus, only the model that introduces the correct renormalization in the diagonal term due to the overlap is able to reproduce, even in a quantitative fashion, the main properties of simple homonuclear diatomic molecules. The success of the model resides in the accurate definitions (free of parametrization) of the Hamiltonian terms, which, therefore, could be used to describe more complex interacting systems such as polyatomic molecules, adsorbed species, or atoms scattered by a surface

Three particle scattering at high energies in a model with eikonal Hamiltonian

International Nuclear Information System (INIS)

Kharchenko, V.F.; Kuzmichev, V.E.

1980-04-01

The three particle collision process 3 → 3 with relative motion of each pair of particles described by a model with eikonal Hamiltonian is investigated. No additional restrictions on the motion of the particles (such as the fixed scattering centre approximation) are imposed. A unique, exact analytical solution of the three-particle problem is then shown to exist. An explicit expression for the 3 → 3 amplitude in the general case off the energy shell is obtained as the result of the exact summation of the multiple scattering series. It is shown that this series terminates on the energy shell. A new formula for the mutual cancellation of terms in the multiple scattering series in a model with eikonal Hamiltonian is found. (orig.)

Quantum atom-heteronuclear molecule dark state: Role of population imbalance

International Nuclear Information System (INIS)

Jing Hui; Cui Shuai

2010-01-01

Recently, the finite-number effect of initial atoms in coherent atom-molecule conversion was investigated by Zhao et al. [Phys. Rev. Lett. 101, 010401 (2008)]. Here, by extending to the atom-heteronuclear molecule dark state, we find that the initial populations imbalance of the atoms plays a significant role in quantum conversion rate and adiabatic fidelity. In particular, even for the finite total number of imbalanced two-species atoms, the mean-field conversion rate, contrary to the general belief, still can be remarkably close to the exact quantum results.

Approximating local observables on projected entangled pair states

Science.gov (United States)

Schwarz, M.; Buerschaper, O.; Eisert, J.

2017-06-01

Tensor network states are for good reasons believed to capture ground states of gapped local Hamiltonians arising in the condensed matter context, states which are in turn expected to satisfy an entanglement area law. However, the computational hardness of contracting projected entangled pair states in two- and higher-dimensional systems is often seen as a significant obstacle when devising higher-dimensional variants of the density-matrix renormalization group method. In this work, we show that for those projected entangled pair states that are expected to provide good approximations of such ground states of local Hamiltonians, one can compute local expectation values in quasipolynomial time. We therefore provide a complexity-theoretic justification of why state-of-the-art numerical tools work so well in practice. We finally turn to the computation of local expectation values on quantum computers, providing a meaningful application for a small-scale quantum computer.

Competing bosonic condensates in optical lattice with a mixture of single and pair hoppings

Energy Technology Data Exchange (ETDEWEB)

Travin, V.M., E-mail: v.travin@int.pan.wroc.pl; Kopeć, T.K., E-mail: t.kopec@int.pan.wroc.pl

2017-01-15

A system of ultra-cold atoms with single boson and pair tunneling of bosonic atoms is considered in an optical lattice at arbitrary temperature. A mean-field theory was applied to the extended Bose-Hubbard Hamiltonian describing the system in order to investigate the competition between superfluid and pair superfluid as a function of the chemical potential and the temperature. To this end we have applied a method based on the Laplace transform method for the efficient calculation of the statistical sum for the quantum Hamiltonian. These results may be of interest for experiments on cold atom systems in optical lattices.

General technique to produce isochronous Hamiltonians

International Nuclear Information System (INIS)

Calogero, F; Leyvraz, F

2007-01-01

We introduce a new technique-characterized by an arbitrary positive constant Ω, with which we associate the period T = 2π/Ω-to 'Ω-modify' a Hamiltonian so that the new Hamiltonian thereby obtained is entirely isochronous, namely it yields motions all of which (except possibly for a lower dimensional set of singular motions) are periodic with the same fixed period T in all their degrees of freedom. This technique transforms real autonomous Hamiltonians into Ω-modified Hamiltonians which are also real and autonomous, and it is widely applicable, for instance, to the most general many-body problem characterized by Newtonian equations of motion ('acceleration equal force') provided it is translation invariant. The Ω-modified Hamiltonians are of course not translation invariant, but for Ω = 0 they reduce (up to marginal changes) to the unmodified Hamiltonians they were obtained from. Hence, when this technique is applied to translation-invariant Hamiltonians yielding, in their center-of-mass systems, chaotic motions with a natural time scale much smaller than T, the corresponding Ω-modified Hamiltonians shall display a chaotic behavior for quite some time before the isochronous character of the motions takes over. We moreover show that the quantized versions of these Ω-modified Hamiltonians feature equispaced spectra

Conditions for formation of electron pairs in a metal

Energy Technology Data Exchange (ETDEWEB)

Shekhtman, A.Z., E-mail: shekhtmanalexander@gmail.com

2015-04-15

Highlights: • A new approach has been developed for consideration of electron pairing in metals. • Binding energy of a single pair induced by electron-phonon interaction is very small. • A new mechanism for electron pairing in metals has been considered. • Conditions for feasibility of the mechanism give conditions for electron pairing. • The mechanism gives wide opportunities to study new conditions for electron pairing. - Abstract: In an isotropic model of the electron system of metal that is presented by the Fröhlich’s initial Hamiltonian, in the approximation of a weak electron–phonon interaction at T = 0, first time, we show that the ground state of the system is the state with pairing correlations of electrons (the pair correlations of occupied electron states). In contrast to the BCS approach, the initial point in our approach is not electron pairing but is the maximum reduction of the energy of the considered system due to virtual processes of the electron–phonon interaction and to the exchange effect for the indirect electron–electron interaction (which is induced by certain phonon modes separately from others). In contrast to the BCS approach, we take into account the portion of the energy of the electron system that is connected with the above exchange effect. In the BCS approach, the corresponding portion is missed, and its role is prescribed to the portion that does not relate to the electron pairing. We show that expectation values of the above Hamiltonian for different wave functions for two interacting electrons above the Fermi sea of the non-interacting system (with interaction between the electrons that is induced by different phonon modes separately from others) are minimum for a certain structure of these functions and simultaneously for phonon modes that can induce the transitions of the interacting electrons between electron states in which they are (without violation of the Pauli exclusion principle and at everything else

Hydrothermal liquefaction oil and hydrotreated product from pine feedstock characterized by heteronuclear two-dimensional NMR spectroscopy and FT-ICR mass spectrometry

Energy Technology Data Exchange (ETDEWEB)

Sudasinghe, Nilusha; Cort, John R.; Hallen, Richard T.; Olarte, Mariefel V.; Schmidt, Andrew J.; Schaub, Tanner

2014-12-01

Hydrothermal liquefaction (HTL) crude oil and hydrotreated product from pine tree farm waste (forest product residual, FPR) have been analyzed by direct infusion electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI FT-ICR MS) in both positive- and negative-ionization modes and high-resolution twodimensional heteronuclear 1H-13C NMR spectroscopy. FT-ICR MS resolves thousands of compounds in complex oils and provides unparalleled compositional details for individual molecules for identification of compound class (heteroatom content), type (number of rings plus double bonds to carbon or double bond equivalents (DBE) and carbon number (degree of alkylation). Heteronuclear 1H-13C NMR spectroscopy provides one-bond and multiple-bond correlations between pairs of 1H and 13C chemical shifts that are characteristic of different organic functional groups. Taken together this information provides a picture of the chemical composition of these oils. Pyrolysis crude oil product from pine wood was characterized for comparison. Generally, pyrolysis oil is comprised of a more diverse distribution of heteroatom classes with higher oxygen number relative to HTL oil as shown by both positive- and negative-ion ESI FT-ICR MS. A total of 300 N1, 594 O1 and 267 O2 compounds were observed as products of hydrotreatment. The relative abundance of N1O1, N1O2, N1O3, N2, N2O1, N2O2 and O3 compounds are reduced to different degrees after hydrotreatment and other higher heteroatom containing species (O4-O10, N1O4, N1O5 and N2O3) are completely removed by hydrotreatment.

Highly efficient F-19 heteronuclear decoupling in solid-state NMR spectroscopy using supercycled refocused-CW irradiation

DEFF Research Database (Denmark)

Equbal, Asif; Basse, Kristoffer; Nielsen, Niels Christian

2016-01-01

We present heteronuclear F-19 refocused CW (rCW) decoupling pulse sequences for solid-state magic-angle- spinning NMR applications. The decoupling sequences have been designed specifically to ensure suppression of the pertinent C-13-F-19 dipolar coupling interactions while simultaneously suppress...

The direct measurement of the heteronuclear chemical shifts relative to tetramethylsilane

International Nuclear Information System (INIS)

Moritz, A.G.

1988-12-01

The measurement of heteronuclear chemical shifts using absolute frequencies of the heteronucleus and the 1 H resonance of tetramethylsilane has been examined. This method avoids the problems associated with external standards and gives results which can be obtained quickly and with high precision. The method has a number of advantages in the accurate measurement of chemical shifts, as for example 31 P in chemical warfare agents and related chemicals and allows multinuclear data to be obtained without dynamic range or potential interference problems. 15 refs., 4 tabs

Application of heteronuclear couplings to conformational analysis of oligonucleotides

International Nuclear Information System (INIS)

Zhu, G.; Live, D.; Bax, A.

1994-01-01

The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1' and C1' atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3'-endo and C2'-endo conformations of the sugars and syn and anti bases arrangements

Application of heteronuclear couplings to conformational analysis of oligonucleotides

Energy Technology Data Exchange (ETDEWEB)

Zhu, G. [Univ. of Maryland, College Park, MD (United States); Live, D. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Bax, A. [NIDDK National Institutes of Health, Bethesda, MD (United States)

1994-12-01

The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

Renormalization of Hamiltonian QCD

International Nuclear Information System (INIS)

Andrasi, A.; Taylor, John C.

2009-01-01

We study to one-loop order the renormalization of QCD in the Coulomb gauge using the Hamiltonian formalism. Divergences occur which might require counter-terms outside the Hamiltonian formalism, but they can be cancelled by a redefinition of the Yang-Mills electric field.

Calculation of nuclear moment of inertia with proper treatment of pairing interaction

International Nuclear Information System (INIS)

Tazaki, S.; Ando, Y.; Hasegawa, M.

1997-01-01

An attempt to calculate nuclear moments of inertia treating the pairing interaction exactly is reported. As usual, hamiltonian is composed of the Nilsson's singleparticle energies and the pairing interaction, but the eigenstates and the eigenvalues are calculated exactly in a realistic, sufficiently large model space. The method of calculating the moment of inertia is presented. (author)

Geometry of Hamiltonian chaos

DEFF Research Database (Denmark)

Horwitz, Lawrence; Zion, Yossi Ben; Lewkowicz, Meir

2007-01-01

The characterization of chaotic Hamiltonian systems in terms of the curvature associated with a Riemannian metric tensor in the structure of the Hamiltonian is extended to a wide class of potential models of standard form through definition of a conformal metric. The geodesic equations reproduce ...

Magnetic field line Hamiltonian

International Nuclear Information System (INIS)

Boozer, A.H.

1984-03-01

The magnetic field line Hamiltonian and the associated canonical form for the magnetic field are important concepts both for understanding toroidal plasma physics and for practical calculations. A number of important properties of the canonical or Hamiltonian representation are derived and their importance is explained

Deformed model Sp(4) model for studying pairing correlations in atomic nuclei

CERN Document Server

Georgieva, A I; Sviratcheva, K

2002-01-01

A fermion representation of the compact symplectic sp(4) algebra introduces a theoretical framework for describing pairing correlations in atomic nuclei. The important non-deformed and deformed subalgebras of sp sub ( sub q sub ) (4) and the corresponding reduction chains are explored for the multiple orbit problem. One realization of the u sub ( sub q sub ) (2) subalgebra is associated with the valence isospin, other reductions describe coupling between identical nucleons or proton-neutron pairs. Microscopic non-deformed and deformed Hamiltonians are expressed in terms of the generators of the sp(4) and sp sub q (4) algebras. In both cases eigenvalues of the isospin breaking Hamiltonian are fit to experimental ground state energies. The theory can be used to investigate the origin of the deformation and predict binding energies of nuclei in proton-rich regions. The q-deformation parameter changes the pairing strength and in so doing introduces a non-linear coupling into the collective degree of freedom

Pairing mechanism in oxide superconductors

International Nuclear Information System (INIS)

Hirsch, J.E.

1988-01-01

A useful way to learn about the pairing mechanism that is responsible for high T c superconductivity is to study properties of model Hamiltonians on small systems. The goal is to find the simplest model that can describe the essential physics of high T c superconductivity. The authors have used Monte Carlo simulation and exact diagonalization techniques to study properties of systems of up to 64 sites. Their results show that spin fluctuations and other spin related mechanisms induced by a Hubbard on-site repulsion U are not likely to give rise to pairing, neither in one nor in multiple band models. In contrast, charge fluctuations in a model with both strong U and V (repulsion between Cu and O) are shown to give rise to pairing and it is suggested that this model provides a plausible mechanism for high T c superconductivity

Canonical transformations and hamiltonian path integrals

International Nuclear Information System (INIS)

Prokhorov, L.V.

1982-01-01

Behaviour of the Hamiltonian path integrals under canonical transformations produced by a generator, is investigated. An exact form is determined for the kernel of the unitary operator realizing the corresponding quantum transformation. Equivalence rules are found (the Hamiltonian formalism, one-dimensional case) enabling one to exclude non-standard terms from the action. It is shown that the Hamiltonian path integral changes its form under cononical transformations: in the transformed expression besides the classical Hamiltonian function there appear some non-classical terms

Perspective: Quantum Hamiltonians for optical interactions

Science.gov (United States)

Andrews, David L.; Jones, Garth A.; Salam, A.; Woolley, R. Guy

2018-01-01

The multipolar Hamiltonian of quantum electrodynamics is extensively employed in chemical and optical physics to treat rigorously the interaction of electromagnetic fields with matter. It is also widely used to evaluate intermolecular interactions. The multipolar version of the Hamiltonian is commonly obtained by carrying out a unitary transformation of the Coulomb gauge Hamiltonian that goes by the name of Power-Zienau-Woolley (PZW). Not only does the formulation provide excellent agreement with experiment, and versatility in its predictive ability, but also superior physical insight. Recently, the foundations and validity of the PZW Hamiltonian have been questioned, raising a concern over issues of gauge transformation and invariance, and whether observable quantities obtained from unitarily equivalent Hamiltonians are identical. Here, an in-depth analysis of theoretical foundations clarifies the issues and enables misconceptions to be identified. Claims of non-physicality are refuted: the PZW transformation and ensuing Hamiltonian are shown to rest on solid physical principles and secure theoretical ground.

Notch filters for port-Hamiltonian systems

NARCIS (Netherlands)

Dirksz, D.A.; Scherpen, J.M.A.; van der Schaft, A.J.; Steinbuch, M.

2012-01-01

In this paper a standard notch filter is modeled in the port-Hamiltonian framework. By having such a port-Hamiltonian description it is proven that the notch filter is a passive system. The notch filter can then be interconnected with another (nonlinear) port-Hamiltonian system, while preserving the

Noncanonical Hamiltonian methods in plasma dynamics

International Nuclear Information System (INIS)

Kaufman, A.N.

1981-11-01

A Hamiltonian approach to plasma dynamics has numerous advantages over equivalent formulations which ignore the underlying Hamiltonian structure. In addition to achieving a deeper understanding of processes, Hamiltonian methods yield concise expressions (such as the Kubo form for linear susceptibility), greatly shorten the length of calculations, expose relationships (such as between the ponderomotive Hamiltonian and the linear susceptibility), determine invariants in terms of symmetry operations, and cover situations of great generality. In addition, they yield the Poincare invariants, in particular Liouville volume and adiabatic actions

Theory of collective Hamiltonian

Energy Technology Data Exchange (ETDEWEB)

Zhang Qingying

1982-02-01

Starting from the cranking model, we derive the nuclear collective Hamiltonian. We expand the total energy of the collective motion of the ground state of even--even nuclei in powers of the deformation parameter ..beta... In the first approximation, we only take the lowest-order non-vanished terms in the expansion. The collective Hamiltonian thus obtained rather differs from the A. Bohr's Hamiltonian obtained by the irrotational incompressible liquid drop model. If we neglect the coupling term between ..beta..-and ..gamma..-vibration, our Hamiltonian then has the same form as that of A. Bohr. But there is a difference between these collective parameters. Our collective parameters are determined by the state of motion of the nucleous in the nuclei. They are the microscopic expressions. On the contrary, A. Bohr's collective parameters are only the simple functions of the microscopic physical quantities (such as nuclear radius and surface tension, etc.), and independent of the state of motion of the nucleons in the nuclei. Furthermore, there exist the coupling term between ..beta..-and ..gamma..-vibration and the higher-order terms in our expansion. They can be treated as the perturbations. There are no such terms in A. Bohr's Hamiltonian. These perturbation terms will influence the rotational, vibrational spectra and the ..gamma..-transition process, etc.

Collective Hamiltonians for dipole giant resonances

International Nuclear Information System (INIS)

Weiss, L.I.

1991-07-01

The collective hamiltonian for the Giant Dipole resonance (GDR), in the Goldhaber-Teller-Model, is analytically constructed using the semiclassical and generator coordinates method. Initially a conveniently parametrized set of many body wave functions and a microscopic hamiltonian, the Skyrme hamiltonian - are used. These collective Hamiltonians are applied to the investigation of the GDR, in He 4 , O 16 and Ca 40 nuclei. Also the energies and spectra of the GDR are obtained in these nuclei. The two sets of results are compared, and the zero point energy effects analysed. (author)

On the domain of the Nelson Hamiltonian

Science.gov (United States)

Griesemer, M.; Wünsch, A.

2018-04-01

The Nelson Hamiltonian is unitarily equivalent to a Hamiltonian defined through a closed, semibounded quadratic form, the unitary transformation being explicitly known and due to Gross. In this paper, we study the mapping properties of the Gross-transform in order to characterize the regularity properties of vectors in the form domain of the Nelson Hamiltonian. Since the operator domain is a subset of the form domain, our results apply to vectors in the domain of the Hamiltonian as well. This work is a continuation of our previous work on the Fröhlich Hamiltonian.

Geometric Hamiltonian structures and perturbation theory

International Nuclear Information System (INIS)

Omohundro, S.

1984-08-01

We have been engaged in a program of investigating the Hamiltonian structure of the various perturbation theories used in practice. We describe the geometry of a Hamiltonian structure for non-singular perturbation theory applied to Hamiltonian systems on symplectic manifolds and the connection with singular perturbation techniques based on the method of averaging

Hamiltonian analysis of a magnetoelectroelastic notch in a mode III singularity

International Nuclear Information System (INIS)

Zhou, Z H; Xu, X S; Leung, A Y T

2013-01-01

The stress intensity factor (SIF) of a multi-material magnetoelectroelastic wedge in anti-plane deformation is analytically determined by the symplectic method. The Lagrangian equations in configuration variables alone are transformed to Hamiltonian equations in dual variables (configuration and momentum) which allow the use of the method of separation of variables. The solutions of the Hamiltonian equations can be expanded analytically in terms of the symplectic eigenfunctions with coefficients to be determined by the boundary conditions. For the wedge problem, the pairs of anti-plane displacements and shear stresses, electric fields and electric displacements, and magnetic fields and magnetic inductions are proved to be the dual (momentum) variables of the configuration variables. The singularity orders depend directly on the first few eigenvalues whose real parts are less than one but greater than zero. Numerical results for various conditions show the variations of the singularity orders. In particular, special behaviors of the order of the singularity for some special wedge angles are noted. (paper)

Topological Nodal Cooper Pairing in Doped Weyl Metals

Science.gov (United States)

Li, Yi; Haldane, F. D. M.

2018-02-01

We generalize the concept of Berry connection of the single-electron band structure to that of a two-particle Cooper pairing state between two Fermi surfaces with opposite Chern numbers. Because of underlying Fermi surface topology, the pairing Berry phase acquires nontrivial monopole structure. Consequently, pairing gap functions have topologically protected nodal structure as vortices in the momentum space with the total vorticity solely determined by the pair monopole charge qp. The nodes of gap function behave as the Weyl-Majorana points of the Bogoliubov-de Gennes pairing Hamiltonian. Their relation with the connection patterns of the surface modes from the Weyl band structure and the Majorana surface modes inside the pairing gap is also discussed. Under the approximation of spherical Fermi surfaces, the pairing symmetry are represented by monopole harmonic functions. The lowest possible pairing channel carries angular momentum number j =|qp|, and the corresponding gap functions are holomorphic or antiholomorphic functions on Fermi surfaces. After projected on the Fermi surfaces with nontrivial topology, all the partial-wave channels of pairing interactions acquire the monopole charge qp independent of concrete pairing mechanism.

Time dependent drift Hamiltonian

International Nuclear Information System (INIS)

Boozer, A.H.

1982-04-01

The motion of individual charged particles in a given magnetic and an electric fields is discussed. An idea of a guiding center distribution function f is introduced. The guiding center distribution function is connected to the asymptotic Hamiltonian through the drift kinetic equation. The general non-stochastic magnetic field can be written in a contravariant and a covariant forms. The drift Hamiltonian is proposed, and the canonical gyroradius is presented. The proposed drift Hamiltonian agrees with Alfven's drift velocity to lowest non-vanishing order in the gyroradius. The relation between the exact, time dependent equations of motion and the guiding center equation is clarified by a Lagrangian analysis. The deduced Lagrangian represents the drift motion. (Kato, T.)

Magnetic field line Hamiltonian

International Nuclear Information System (INIS)

Boozer, A.H.

1985-02-01

The basic properties of the Hamiltonian representation of magnetic fields in canonical form are reviewed. The theory of canonical magnetic perturbation theory is then developed and applied to the time evolution of a magnetic field embedded in a toroidal plasma. Finally, the extension of the energy principle to tearing modes, utilizing the magnetic field line Hamiltonian, is outlined

Hamiltonian closures in fluid models for plasmas

Science.gov (United States)

Tassi, Emanuele

2017-11-01

This article reviews recent activity on the Hamiltonian formulation of fluid models for plasmas in the non-dissipative limit, with emphasis on the relations between the fluid closures adopted for the different models and the Hamiltonian structures. The review focuses on results obtained during the last decade, but a few classical results are also described, in order to illustrate connections with the most recent developments. With the hope of making the review accessible not only to specialists in the field, an introduction to the mathematical tools applied in the Hamiltonian formalism for continuum models is provided. Subsequently, we review the Hamiltonian formulation of models based on the magnetohydrodynamics description, including those based on the adiabatic and double adiabatic closure. It is shown how Dirac's theory of constrained Hamiltonian systems can be applied to impose the incompressibility closure on a magnetohydrodynamic model and how an extended version of barotropic magnetohydrodynamics, accounting for two-fluid effects, is amenable to a Hamiltonian formulation. Hamiltonian reduced fluid models, valid in the presence of a strong magnetic field, are also reviewed. In particular, reduced magnetohydrodynamics and models assuming cold ions and different closures for the electron fluid are discussed. Hamiltonian models relaxing the cold-ion assumption are then introduced. These include models where finite Larmor radius effects are added by means of the gyromap technique, and gyrofluid models. Numerical simulations of Hamiltonian reduced fluid models investigating the phenomenon of magnetic reconnection are illustrated. The last part of the review concerns recent results based on the derivation of closures preserving a Hamiltonian structure, based on the Hamiltonian structure of parent kinetic models. Identification of such closures for fluid models derived from kinetic systems based on the Vlasov and drift-kinetic equations are presented, and

Single-particle dynamics - Hamiltonian formulation

International Nuclear Information System (INIS)

Montague, B.W.

1977-01-01

In this paper the Hamiltonian formalism is applied to the linear theory of accelerator dynamics. The reasons for the introduction of this method rather than the more straightforward use of second order differential equations of motion are briefly discussed. An outline of Lagrangian and Hamiltonian formalism is given, some properties of the Hamiltonian are discussed and canonical transformations are illustrated. The methods are demonstrated using elementary examples such as the simple pendulum and the procedures adopted to handle specific problems in accelerator theory are indicated. (B.D.)

The Hamiltonian of QED. Zero mode

International Nuclear Information System (INIS)

Zastavenko, L.G.

1990-01-01

We start with the standard QED Lagrangian. New derivation of the spinor QED Hamiltonian is given. We have taken into account the zero mode. Our derivation is faultless from the point of view of gauge invariance. It gives important corrections to the standard QED Hamiltonian. Our derivation of the Hamiltonian can be generalized to the case of QCD. 5 refs

A two-level solvable model involving competing pairing interactions

International Nuclear Information System (INIS)

Dussel, G.G.; Maqueda, E.E.; Perazzo, R.P.J.; Evans, J.A.

1986-01-01

A model is considered consisting of nucleons moving in two non-degenerate l-shells and interacting through two pairing residual interactions with (S, T) = (1, 0) and (0, 1). These, together with the single particle hamiltonian induce mutually destructive correlations, giving rise to various collective pictures that can be discussed as representing a two-dimensional space of phases. The model is solved exactly using an O(8)xO(8) group theoretical classification scheme. The transfer of correlated pairs and quartets is also discussed. (orig.)

Dissipative systems and Bateman's Hamiltonian

International Nuclear Information System (INIS)

Pedrosa, I.A.; Baseia, B.

1983-01-01

It is shown, by using canonical transformations, that one can construct Bateman's Hamiltonian from a Hamiltonian for a conservative system and obtain a clear physical interpretation which explains the ambiguities emerging from its application to describe dissipative systems. (Author) [pt

Diagonalization of Hamiltonian; Diagonalization of Hamiltonian

Energy Technology Data Exchange (ETDEWEB)

Garrido, L M; Pascual, P

1960-07-01

We present a general method to diagonalized the Hamiltonian of particles of arbitrary spin. In particular we study the cases of spin 0,1/2, 1 and see that for spin 1/2 our transformation agrees with Foldy's and obtain the expression for different observables for particles of spin C and 1 in the new representation. (Author) 7 refs.

Squeezed states from a quantum deformed oscillator Hamiltonian

Energy Technology Data Exchange (ETDEWEB)

Ramírez, R. [IFLP, CONICET–Department of Mathematics, University of La Plata c.c. 67 1900, La Plata (Argentina); Reboiro, M., E-mail: marta.reboiro@gmail.com [IFLP, CONICET–Department of Physics, University of La Plata c.c. 67 1900, La Plata (Argentina)

2016-03-11

The spectrum and the time evolution of a system, which is modeled by a non-hermitian quantum deformed oscillator Hamiltonian, is analyzed. The proposed Hamiltonian is constructed from a non-standard realization of the algebra of Heisenberg. We show that, for certain values of the coupling constants and for a range of values of the deformation parameter, the deformed Hamiltonian is a pseudo-hermitic Hamiltonian. We explore the conditions under which the Hamiltonian is similar to a Swanson Hamiltonian. Also, we show that the lowest eigenstate of the system is a squeezed state. We study the time evolution of the system, for different initial states, by computing the corresponding Wigner functions. - Highlights: • A generalization of the squeezed harmonic oscillator is constructed from a non-standard realization of the Heisenberg algebra. • It is proved that, for certain values of the parameters of the model, the Hamiltonian is a pseudo-hermitian Hamiltonian. • It is shown that the lowest eigenstate of the Hamiltonian is a squeezed state. • The squeezing behavior of the associated Gazeau–Klauder state, as a function of time, is discussed.

Quantum Hamiltonian reduction in superspace formalism

International Nuclear Information System (INIS)

Madsen, J.O.; Ragoucy, E.

1994-02-01

Recently the quantum Hamiltonian reduction was done in the case of general sl(2) embeddings into Lie algebras and superalgebras. The results are extended to the quantum Hamiltonian reduction of N=1 affine Lie superalgebras in the superspace formalism. It is shown that if we choose a gauge for the supersymmetry, and consider only certain equivalence classes of fields, then our quantum Hamiltonian reduction reduces to quantum Hamiltonian reduction of non-supersymmetric Lie superalgebras. The super energy-momentum tensor is constructed explicitly as well as all generators of spin 1 (and 1/2); thus all generators in the superconformal, quasi-superconformal and Z 2 *Z 2 superconformal algebras are constructed. (authors). 21 refs

Discrete Hamiltonian evolution and quantum gravity

International Nuclear Information System (INIS)

Husain, Viqar; Winkler, Oliver

2004-01-01

We study constrained Hamiltonian systems by utilizing general forms of time discretization. We show that for explicit discretizations, the requirement of preserving the canonical Poisson bracket under discrete evolution imposes strong conditions on both allowable discretizations and Hamiltonians. These conditions permit time discretizations for a limited class of Hamiltonians, which does not include homogeneous cosmological models. We also present two general classes of implicit discretizations which preserve Poisson brackets for any Hamiltonian. Both types of discretizations generically do not preserve first class constraint algebras. Using this observation, we show that time discretization provides a complicated time gauge fixing for quantum gravity models, which may be compared with the alternative procedure of gauge fixing before discretization

Twisted injectivity in projected entangled pair states and the classification of quantum phases

Energy Technology Data Exchange (ETDEWEB)

Buerschaper, Oliver, E-mail: obuerschaper@perimeterinstitute.ca

2014-12-15

We introduce a class of projected entangled pair states (PEPS) which is based on a group symmetry twisted by a 3-cocycle of the group. This twisted symmetry is expressed as a matrix product operator (MPO) with bond dimension greater than 1 and acts on the virtual boundary of a PEPS tensor. We show that it gives rise to a new standard form for PEPS from which we construct a family of local Hamiltonians which are gapped, frustration-free and include fixed points of the renormalization group flow. Based on this insight, we advance the classification of 2D gapped quantum spin systems by showing how this new standard form for PEPS determines the emergent topological order of these local Hamiltonians. Specifically, we identify their universality class as DIJKGRAAF–WITTEN topological quantum field theory (TQFT). - Highlights: • We introduce a new standard form for projected entangled pair states via a twisted group symmetry which is given by nontrivial matrix product operators. • We construct a large family of gapped, frustration-free Hamiltonians in two dimensions from this new standard form. • We rigorously show how this new standard form for low energy states determines the emergent topological order.

Generalized oscillator representations for Calogero Hamiltonians

International Nuclear Information System (INIS)

Tyutin, I V; Voronov, B L

2013-01-01

This paper is a natural continuation of the previous paper (Gitman et al 2011 J. Phys. A: Math. Theor. 44 425204), where oscillator representations for nonnegative Calogero Hamiltonians with coupling constant α ⩾ − 1/4 were constructed. In this paper, we present generalized oscillator representations for all Calogero Hamiltonians with α ⩾ − 1/4. These representations are generally highly nonunique, but there exists an optimum representation for each Hamiltonian. (comment)

Constructing Dense Graphs with Unique Hamiltonian Cycles

Science.gov (United States)

Lynch, Mark A. M.

2012-01-01

It is not difficult to construct dense graphs containing Hamiltonian cycles, but it is difficult to generate dense graphs that are guaranteed to contain a unique Hamiltonian cycle. This article presents an algorithm for generating arbitrarily large simple graphs containing "unique" Hamiltonian cycles. These graphs can be turned into dense graphs…

On the physical applications of hyper-Hamiltonian dynamics

International Nuclear Information System (INIS)

Gaeta, Giuseppe; Rodriguez, Miguel A

2008-01-01

An extension of Hamiltonian dynamics, defined on hyper-Kahler manifolds ('hyper-Hamiltonian dynamics') and sharing many of the attractive features of standard Hamiltonian dynamics, was introduced in previous work. In this paper, we discuss applications of the theory to physically interesting cases, dealing with the dynamics of particles with spin 1/2 in a magnetic field, i.e. the Pauli and the Dirac equations. While the free Pauli equation corresponds to a hyper-Hamiltonian flow, it turns out that the hyper-Hamiltonian description of the Dirac equation, and of the full Pauli one, is in terms of two commuting hyper-Hamiltonian flows. In this framework one can use a factorization principle discussed here (which is a special case of a general phenomenon studied by Walcher) and provide an explicit description of the resulting flow. On the other hand, by applying the familiar Foldy-Wouthuysen and Cini-Tousheck transformations (and the one recently introduced by Mulligan) which separate-in suitable limits-the Dirac equation into two equations, each of these turn out to be described by a single hyper-Hamiltonian flow. Thus the hyper-Hamiltonian construction is able to describe the fundamental dynamics for particles with spin

On the Josephson effect between superconductors in singlet and triplet spin-pairing states

International Nuclear Information System (INIS)

Pals, J.A.; Haeringen, W. van

1977-01-01

An expression is derived for the Josephson current between two weakly coupled superconductors of which one or both have pairs in a spin-triplet state. It is shown that there can be no Josephson effect up to second order in the transition matrix elements between a superconductor with spin-triplet pairs and one with spin-singlet pairs if the coupling between the two superconductors can be described with a spin-conserving tunnel hamiltonian. This is shown to offer a possibility to investigate experimentally whether a particular superconductor has spin-triplet pairs by coupling it weakly to a well-known spin-singlet pairing superconductor. (Auth.)

Oscillator representations for self-adjoint Calogero Hamiltonians

Energy Technology Data Exchange (ETDEWEB)

Gitman, D M [Institute of Physics, University of Sao Paulo (Brazil); Tyutin, I V; Voronov, B L, E-mail: gitman@dfn.if.usp.br, E-mail: tyutin@lpi.ru, E-mail: voronov@lpi.ru [Lebedev Physical Institute, Moscow (Russian Federation)

2011-10-21

In Gitman et al (2010 J. Phys. A: Math. Theor. 43 145205), we presented a mathematically rigorous quantum-mechanical treatment of a one-dimensional motion of a particle in the Calogero potential V(x) = {alpha}x{sup -2}. We described all possible self-adjoint (s.a.) operators (s.a. Hamiltonians) associated with the differential operation H=-d{sub x}{sup 2}+{alpha}x{sup -2} for the Calogero Hamiltonian. Here, we discuss a new aspect of the problem, the so-called oscillator representations for the Calogero Hamiltonians. As is known, operators of the form N-hat = a-hat{sup +} a-hat and A-hat = a-hat a-hat{sup +} are called operators of oscillator type. Oscillator-type operators possess a number of useful properties in the case when the elementary operators a-hat are closed. It turns out that some s.a. Calogero Hamiltonians allow oscillator-type representations. We describe such Hamiltonians and find the corresponding mutually adjoint elementary operators a-hat and a-hat{sup +}. An oscillator-type representation for a given Hamiltonian is generally not unique. (paper)

Oscillator representations for self-adjoint Calogero Hamiltonians

International Nuclear Information System (INIS)

Gitman, D M; Tyutin, I V; Voronov, B L

2011-01-01

In Gitman et al (2010 J. Phys. A: Math. Theor. 43 145205), we presented a mathematically rigorous quantum-mechanical treatment of a one-dimensional motion of a particle in the Calogero potential V(x) = αx -2 . We described all possible self-adjoint (s.a.) operators (s.a. Hamiltonians) associated with the differential operation H=-d x 2 +αx -2 for the Calogero Hamiltonian. Here, we discuss a new aspect of the problem, the so-called oscillator representations for the Calogero Hamiltonians. As is known, operators of the form N-hat = a-hat + a-hat and A-hat = a-hat a-hat + are called operators of oscillator type. Oscillator-type operators possess a number of useful properties in the case when the elementary operators a-hat are closed. It turns out that some s.a. Calogero Hamiltonians allow oscillator-type representations. We describe such Hamiltonians and find the corresponding mutually adjoint elementary operators a-hat and a-hat + . An oscillator-type representation for a given Hamiltonian is generally not unique. (paper)

S³ HMBC hetero: Spin-State-Selective HMBC for accurate measurement of long-range heteronuclear coupling constants

DEFF Research Database (Denmark)

Hoeck, Casper; Gotfredsen, Charlotte Held; Sørensen, Ole W.

2017-01-01

A novel method, Spin-State-Selective (S3) HMBC hetero, for accurate measurement of heteronuclear coupling constants is introduced. The method extends the S3 HMBC technique for measurement of homonuclear coupling constants by appending a pulse sequence element that interchanges the polarization...

EMR-related problems at the interface between the crystal field Hamiltonians and the zero-field splitting Hamiltonians

Directory of Open Access Journals (Sweden)

Rudowicz Czesław

2015-07-01

Full Text Available The interface between optical spectroscopy, electron magnetic resonance (EMR, and magnetism of transition ions forms the intricate web of interrelated notions. Major notions are the physical Hamiltonians, which include the crystal field (CF (or equivalently ligand field (LF Hamiltonians, and the effective spin Hamiltonians (SH, which include the zero-field splitting (ZFS Hamiltonians as well as to a certain extent also the notion of magnetic anisotropy (MA. Survey of recent literature has revealed that this interface, denoted CF (LF ↔ SH (ZFS, has become dangerously entangled over the years. The same notion is referred to by three names that are not synonymous: CF (LF, SH (ZFS, and MA. In view of the strong need for systematization of nomenclature aimed at bringing order to the multitude of different Hamiltonians and the associated quantities, we have embarked on this systematization. In this article, we do an overview of our efforts aimed at providing a deeper understanding of the major intricacies occurring at the CF (LF ↔ SH (ZFS interface with the focus on the EMR-related problems for transition ions.

Derivation of Hamiltonians for accelerators

Energy Technology Data Exchange (ETDEWEB)

Symon, K.R.

1997-09-12

In this report various forms of the Hamiltonian for particle motion in an accelerator will be derived. Except where noted, the treatment will apply generally to linear and circular accelerators, storage rings, and beamlines. The generic term accelerator will be used to refer to any of these devices. The author will use the usual accelerator coordinate system, which will be introduced first, along with a list of handy formulas. He then starts from the general Hamiltonian for a particle in an electromagnetic field, using the accelerator coordinate system, with time t as independent variable. He switches to a form more convenient for most purposes using the distance s along the reference orbit as independent variable. In section 2, formulas will be derived for the vector potentials that describe the various lattice components. In sections 3, 4, and 5, special forms of the Hamiltonian will be derived for transverse horizontal and vertical motion, for longitudinal motion, and for synchrobetatron coupling of horizontal and longitudinal motions. Hamiltonians will be expanded to fourth order in the variables.

Phase behaviour of heteronuclear dimers in three-dimensional systems-a Monte Carlo study

International Nuclear Information System (INIS)

Rzysko, W; Binder, K

2008-01-01

Monte Carlo simulation in the grand canonical ensemble, the histogram reweighting technique and finite size scaling are used to study the phase behaviour of dimers in three-dimensional systems. A single molecule is composed of two segments A and B, and the bond between them cannot be broken. The phase diagrams have been estimated for a set of model systems. Different structures formed by heteronuclear dimers have been found. The results show a great variety of vapour-liquid coexistence behaviour depending on the strength of the interactions between segments

A Bethe ansatz solvable model for superpositions of Cooper pairs and condensed molecular bosons

International Nuclear Information System (INIS)

Hibberd, K.E.; Dunning, C.; Links, J.

2006-01-01

We introduce a general Hamiltonian describing coherent superpositions of Cooper pairs and condensed molecular bosons. For particular choices of the coupling parameters, the model is integrable. One integrable manifold, as well as the Bethe ansatz solution, was found by Dukelsky et al. [J. Dukelsky, G.G. Dussel, C. Esebbag, S. Pittel, Phys. Rev. Lett. 93 (2004) 050403]. Here we show that there is a second integrable manifold, established using the boundary quantum inverse scattering method. In this manner we obtain the exact solution by means of the algebraic Bethe ansatz. In the case where the Cooper pair energies are degenerate we examine the relationship between the spectrum of these integrable Hamiltonians and the quasi-exactly solvable spectrum of particular Schrodinger operators. For the solution we derive here the potential of the Schrodinger operator is given in terms of hyperbolic functions. For the solution derived by Dukelsky et al., loc. cit. the potential is sextic and the wavefunctions obey PT-symmetric boundary conditions. This latter case provides a novel example of an integrable Hermitian Hamiltonian acting on a Fock space whose states map into a Hilbert space of PT-symmetric wavefunctions defined on a contour in the complex plane

Pair truncation for rotational nuclei: j=17/2 model

International Nuclear Information System (INIS)

Halse, P.; Jaqua, L.; Barrett, B.R.

1989-01-01

The suitability of the pair condensate approach for rotational states is studied in a single j=17/2 shell of identical nucleons interacting through a quadrupole-quadrupole Hamiltonian. The ground band and a K=2 excited band are both studied in detail. A direct comparison of the exact states with those constituting the SD and SDG subspaces is used to identify the important degrees of freedom for these levels. The range of pairs necessary for a good description is found to be highly state dependent; S and D pairs are the major constituents of the low-spin ground-band levels, while G pairs are needed for those in the γ band. Energy spectra are obtained for each truncated subspace. SDG pairs allow accurate reproduction of the binding energy and K=2 excitation energy, but still give a moment of inertia which is about 30% too small even for the lowest levels

Relativistic non-Hamiltonian mechanics

International Nuclear Information System (INIS)

Tarasov, Vasily E.

2010-01-01

Relativistic particle subjected to a general four-force is considered as a nonholonomic system. The nonholonomic constraint in four-dimensional space-time represents the relativistic invariance by the equation for four-velocity u μ u μ + c 2 = 0, where c is the speed of light in vacuum. In the general case, four-forces are non-potential, and the relativistic particle is a non-Hamiltonian system in four-dimensional pseudo-Euclidean space-time. We consider non-Hamiltonian and dissipative systems in relativistic mechanics. Covariant forms of the principle of stationary action and the Hamilton's principle for relativistic mechanics of non-Hamiltonian systems are discussed. The equivalence of these principles is considered for relativistic particles subjected to potential and non-potential forces. We note that the equations of motion which follow from the Hamilton's principle are not equivalent to the equations which follow from the variational principle of stationary action. The Hamilton's principle and the principle of stationary action are not compatible in the case of systems with nonholonomic constraint and the potential forces. The principle of stationary action for relativistic particle subjected to non-potential forces can be used if the Helmholtz conditions are satisfied. The Hamilton's principle and the principle of stationary action are equivalent only for a special class of relativistic non-Hamiltonian systems.

Chromatic roots and hamiltonian paths

DEFF Research Database (Denmark)

Thomassen, Carsten

2000-01-01

We present a new connection between colorings and hamiltonian paths: If the chromatic polynomial of a graph has a noninteger root less than or equal to t(n) = 2/3 + 1/3 (3)root (26 + 6 root (33)) + 1/3 (3)root (26 - 6 root (33)) = 1.29559.... then the graph has no hamiltonian path. This result...

Hamiltonian structure of the Lotka-Volterra equations

Science.gov (United States)

Nutku, Y.

1990-03-01

The Lotka-Volterra equations governing predator-prey relations are shown to admit Hamiltonian structure with respect to a generalized Poisson bracket. These equations provide an example of a system for which the naive criterion for the existence of Hamiltonian structure fails. We show further that there is a three-component generalization of the Lotka-Volterra equations which is a bi-Hamiltonian system.

Electron correlation within the relativistic no-pair approximation

Energy Technology Data Exchange (ETDEWEB)

Almoukhalalati, Adel; Saue, Trond, E-mail: trond.saue@irsamc.ups-tlse.fr [Laboratoire de Chimie et Physique Quantique, UMR 5626 CNRS — Université Toulouse III-Paul Sabatier, 118 route de Narbonne, F-31062 Toulouse (France); Knecht, Stefan [ETH Zürich, Laboratorium für Physikalische Chemie, Vladimir-Prelog-Weg 2, 8093 Zürich (Switzerland); Jensen, Hans Jørgen Aa. [Department of Physics, Chemistry and Pharmacy, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark); Dyall, Kenneth G. [Dirac Solutions, 10527 NW Lost Park Drive, Portland, Oregon 97229 (United States)

2016-08-21

This paper addresses the definition of correlation energy within 4-component relativistic atomic and molecular calculations. In the nonrelativistic domain the correlation energy is defined as the difference between the exact eigenvalue of the electronic Hamiltonian and the Hartree-Fock energy. In practice, what is reported is the basis set correlation energy, where the “exact” value is provided by a full Configuration Interaction (CI) calculation with some specified one-particle basis. The extension of this definition to the relativistic domain is not straightforward since the corresponding electronic Hamiltonian, the Dirac-Coulomb Hamiltonian, has no bound solutions. Present-day relativistic calculations are carried out within the no-pair approximation, where the Dirac-Coulomb Hamiltonian is embedded by projectors eliminating the troublesome negative-energy solutions. Hartree-Fock calculations are carried out with the implicit use of such projectors and only positive-energy orbitals are retained at the correlated level, meaning that the Hartree-Fock projectors are frozen at the correlated level. We argue that the projection operators should be optimized also at the correlated level and that this is possible by full Multiconfigurational Self-Consistent Field (MCSCF) calculations, that is, MCSCF calculations using a no-pair full CI expansion, but including orbital relaxation from the negative-energy orbitals. We show by variational perturbation theory that the MCSCF correlation energy is a pure MP2-like correlation expression, whereas the corresponding CI correlation energy contains an additional relaxation term. We explore numerically our theoretical analysis by carrying out variational and perturbative calculations on the two-electron rare gas atoms with specially tailored basis sets. In particular, we show that the correlation energy obtained by the suggested MCSCF procedure is smaller than the no-pair full CI correlation energy, in accordance with the

Boson mapping and the microscopic collective nuclear Hamiltonian

International Nuclear Information System (INIS)

Dobes, J.; Ivanova, S.P.; Dzholos, R.V.; Pedrosa, R.

1990-01-01

Starting with the mapping of the quadrupole collective states in the fermion space onto the boson space, the fermion nuclear problem is transformed into the boson one. The boson images of the bifermion operators and of the fermion Hamiltonian are found. Recurrence relations are used to obtain approximately the norm matrix which appears in the boson-fermion mapping. The resulting boson Hamiltonian contains terms which go beyond the ordinary SU(6) symmetry Hamiltonian of the interacting boson model. Calculations, however, suggest that on the phenomenological level the differences between the mapped Hamiltonian and the SU(6) Hamiltonian are not too important. 18 refs.; 2 figs

On integrable Hamiltonians for higher spin XXZ chain

International Nuclear Information System (INIS)

Bytsko, Andrei G.

2003-01-01

Integrable Hamiltonians for higher spin periodic XXZ chains are constructed in terms of the spin generators; explicit examples for spins up to (3/2) are given. Relations between Hamiltonians for some U q (sl 2 )-symmetric and U(1)-symmetric universal r-matrices are studied; their properties are investigated. A certain modification of the higher spin periodic chain Hamiltonian is shown to be an integrable U q (sl 2 )-symmetric Hamiltonian for an open chain

Hamiltonian ABC

NARCIS (Netherlands)

Meeds, E.; Leenders, R.; Welling, M.; Meila, M.; Heskes, T.

2015-01-01

Approximate Bayesian computation (ABC) is a powerful and elegant framework for performing inference in simulation-based models. However, due to the difficulty in scaling likelihood estimates, ABC remains useful for relatively lowdimensional problems. We introduce Hamiltonian ABC (HABC), a set of

Heteronuclear long-range correlation, what’s new and how far can it take us?

DEFF Research Database (Denmark)

Sørensen, Ole W.

: A novel experiment for small-molecule and biomolecular NMR at natural isotopic abundance. Sebastian Meier, Andrew J. Benie, Jens Ø. Duus and Ole W. Sørensen, Journal of Magnetic Resonance, in press, doi:10.1016/j.jmr.2009.06.017 Recent progress in heteronuclear long-range NMR of complex carbohydrates: 3D...... H2BC and clean HMBC. Sebastian Meier, Bent O. Petersen, Jens Ø. Duus, Ole W. Sørensen. Carbohydrate Research, in press, doi:10.1016/j.carres.2009.08.013...

Hamiltonian quantum simulation with bounded-strength controls

International Nuclear Information System (INIS)

Bookatz, Adam D; Wocjan, Pawel; Viola, Lorenza

2014-01-01

We propose dynamical control schemes for Hamiltonian simulation in many-body quantum systems that avoid instantaneous control operations and rely solely on realistic bounded-strength control Hamiltonians. Each simulation protocol consists of periodic repetitions of a basic control block, constructed as a modification of an ‘Eulerian decoupling cycle,’ that would otherwise implement a trivial (zero) target Hamiltonian. For an open quantum system coupled to an uncontrollable environment, our approach may be employed to engineer an effective evolution that simulates a target Hamiltonian on the system while suppressing unwanted decoherence to the leading order, thereby allowing for dynamically corrected simulation. We present illustrative applications to both closed- and open-system simulation settings, with emphasis on simulation of non-local (two-body) Hamiltonians using only local (one-body) controls. In particular, we provide simulation schemes applicable to Heisenberg-coupled spin chains exposed to general linear decoherence, and show how to simulate Kitaev's honeycomb lattice Hamiltonian starting from Ising-coupled qubits, as potentially relevant to the dynamical generation of a topologically protected quantum memory. Additional implications for quantum information processing are discussed. (papers)

Mathematical Modeling of Constrained Hamiltonian Systems

NARCIS (Netherlands)

Schaft, A.J. van der; Maschke, B.M.

1995-01-01

Network modelling of unconstrained energy conserving physical systems leads to an intrinsic generalized Hamiltonian formulation of the dynamics. Constrained energy conserving physical systems are directly modelled as implicit Hamiltonian systems with regard to a generalized Dirac structure on the

Lagrangian and Hamiltonian dynamics

CERN Document Server

Mann, Peter

2018-01-01

An introductory textbook exploring the subject of Lagrangian and Hamiltonian dynamics, with a relaxed and self-contained setting. Lagrangian and Hamiltonian dynamics is the continuation of Newton's classical physics into new formalisms, each highlighting novel aspects of mechanics that gradually build in complexity to form the basis for almost all of theoretical physics. Lagrangian and Hamiltonian dynamics also acts as a gateway to more abstract concepts routed in differential geometry and field theories and can be used to introduce these subject areas to newcomers. Journeying in a self-contained manner from the very basics, through the fundamentals and onwards to the cutting edge of the subject, along the way the reader is supported by all the necessary background mathematics, fully worked examples, thoughtful and vibrant illustrations as well as an informal narrative and numerous fresh, modern and inter-disciplinary applications. The book contains some unusual topics for a classical mechanics textbook. Mo...

Interaction-induced decay of a heteronuclear two-atom system

Science.gov (United States)

Xu, Peng; Yang, Jiaheng; Liu, Min; He, Xiaodong; Zeng, Yong; Wang, Kunpeng; Wang, Jin; Papoular, D. J.; Shlyapnikov, G. V.; Zhan, Mingsheng

2015-01-01

Two-atom systems in small traps are of fundamental interest for understanding the role of interactions in degenerate cold gases and for the creation of quantum gates in quantum information processing with single-atom traps. One of the key quantities is the inelastic relaxation (decay) time when one of the atoms or both are in a higher hyperfine state. Here we measure this quantity in a heteronuclear system of 87Rb and 85Rb in a micro optical trap and demonstrate experimentally and theoretically the presence of both fast and slow relaxation processes, depending on the choice of the initial hyperfine states. This experimental method allows us to single out a particular relaxation process thus provides an extremely clean platform for collisional physics studies. Our results have also implications for engineering of quantum states via controlled collisions and creation of two-qubit quantum gates. PMID:26199051

Relativistic magnetohydrodynamics as a Hamiltonian system

International Nuclear Information System (INIS)

Holm, D.D.; Kupershmidt, A.

1985-01-01

The equations of ideal relativistic magnetohydrodynamics in the laboratory frame form a noncanonical Hamiltonian system with the same Poisson bracket as for the nonrelativistic system, but with dynamical variables and Hamiltonian obtained via a regular deformation of their nonrelativistic counterparts [fr

Alternative structures and bi-Hamiltonian systems on a Hilbert space

International Nuclear Information System (INIS)

Marmo, G; Scolarici, G; Simoni, A; Ventriglia, F

2005-01-01

We discuss transformations generated by dynamical quantum systems which are bi-unitary, i.e. unitary with respect to a pair of Hermitian structures on an infinite-dimensional complex Hilbert space. We introduce the notion of Hermitian structures in generic relative position. We provide a few necessary and sufficient conditions for two Hermitian structures to be in generic relative position to better illustrate the relevance of this notion. The group of bi-unitary transformations is considered in both the generic and the non-generic case. Finally, we generalize the analysis to real Hilbert spaces and extend to infinite dimensions results already available in the framework of finite-dimensional linear bi-Hamiltonian systems

A Lax integrable hierarchy, bi-Hamiltonian structure and finite-dimensional Liouville integrable involutive systems

International Nuclear Information System (INIS)

Xia Tiecheng; Chen Xiaohong; Chen Dengyuan

2004-01-01

An eigenvalue problem and the associated new Lax integrable hierarchy of nonlinear evolution equations are presented in this paper. As two reductions, the generalized nonlinear Schroedinger equations and the generalized mKdV equations are obtained. Zero curvature representation and bi-Hamiltonian structure are established for the whole hierarchy based on a pair of Hamiltonian operators (Lenard's operators), and it is shown that the hierarchy of nonlinear evolution equations is integrable in Liouville's sense. Thus the hierarchy of nonlinear evolution equations has infinitely many commuting symmetries and conservation laws. Moreover the eigenvalue problem is nonlinearized as a finite-dimensional completely integrable system under the Bargmann constraint between the potentials and the eigenvalue functions. Finally finite-dimensional Liouville integrable system are found, and the involutive solutions of the hierarchy of equations are given. In particular, the involutive solutions are developed for the system of generalized nonlinear Schroedinger equations

Noncanonical Hamiltonian mechanics

International Nuclear Information System (INIS)

Litteljohn, R.G.

1986-01-01

Noncanonical variables in Hamiltonian mechanics were first used by Lagrange in 1808. In spite of this, most work in Hamiltonian mechanics has been carried out in canonical variables, up to this day. One reason for this is that noncanonical coordinates are seldom needed for mechanical problems based on Lagrangians of the form L = T - V, where T is the kinetic energy and V is the potential energy. Of course, such Lagrangians arise naturally in celestial mechanics, and as a result they form the paradigms of nineteenth-century mechanics and have become enshrined in all the mechanics textbooks. Certain features of modern problems, however, lead to the use of noncanonical coordinates. Among these are issues of gauge invariance and singular Lagrange a Poisson structures. In addition, certain problems, like the flow of magnetic-field lines in physical space, are naturally formulated in terms of noncanonical coordinates. None of these features is present in the nineteenth-century paradigms of mechanics, but they do arise in problems involving particle motion in the presence of magnetic fields. For example, the motion of a particle in an electromagnetic wave is an important one in plasma physics, but the usual Hamiltonian formulation is gauge dependent. For this problem, noncanonical approaches based on Lagrangians in phase space lead to powerful computational techniques which are gauge invariant. In the limit of strong magnetic fields, particle motion becomes 'guiding-center motion'. Guiding-center motion is also best understood in terms of noncanonical coordinates. Finally the flow of magnetic-field lines through physical space is a Hamiltonian system which is best understood with noncanonical coordinates. No doubt many more systems will arise in the future for which these noncanonical techniques can be applied. (author)

Variational identities and Hamiltonian structures

International Nuclear Information System (INIS)

Ma Wenxiu

2010-01-01

This report is concerned with Hamiltonian structures of classical and super soliton hierarchies. In the classical case, basic tools are variational identities associated with continuous and discrete matrix spectral problems, targeted to soliton equations derived from zero curvature equations over general Lie algebras, both semisimple and non-semisimple. In the super case, a supertrace identity is presented for constructing Hamiltonian structures of super soliton equations associated with Lie superalgebras. We illustrate the general theories by the KdV hierarchy, the Volterra lattice hierarchy, the super AKNS hierarchy, and two hierarchies of dark KdV equations and dark Volterra lattices. The resulting Hamiltonian structures show the commutativity of each hierarchy discussed and thus the existence of infinitely many commuting symmetries and conservation laws.

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

International Nuclear Information System (INIS)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.

2012-01-01

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

Energy Technology Data Exchange (ETDEWEB)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)

2012-04-15

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

Almost periodic Hamiltonians: an algebraic approach

International Nuclear Information System (INIS)

Bellissard, J.

1981-07-01

We develop, by analogy with the study of periodic potential, an algebraic theory for almost periodic hamiltonians, leading to a generalized Bloch theorem. This gives rise to results concerning the spectral measures of these operators in terms of those of the corresponding Bloch hamiltonians

Scattering theory for Stark Hamiltonians

International Nuclear Information System (INIS)

Jensen, Arne

1994-01-01

An introduction to the spectral and scattering theory for Schroedinger operators is given. An abstract short range scattering theory is developed. It is applied to perturbations of the Laplacian. Particular attention is paid to the study of Stark Hamiltonians. The main result is an explanation of the discrepancy between the classical and the quantum scattering theory for one-dimensional Stark Hamiltonians. (author). 47 refs

Indirect quantum tomography of quadratic Hamiltonians

Energy Technology Data Exchange (ETDEWEB)

Burgarth, Daniel [Institute for Mathematical Sciences, Imperial College London, London SW7 2PG (United Kingdom); Maruyama, Koji; Nori, Franco, E-mail: daniel@burgarth.de, E-mail: kmaruyama@riken.jp [Advanced Science Institute, RIKEN, Wako-shi, Saitama 351-0198 (Japan)

2011-01-15

A number of many-body problems can be formulated using Hamiltonians that are quadratic in the creation and annihilation operators. Here, we show how such quadratic Hamiltonians can be efficiently estimated indirectly, employing very few resources. We found that almost all the properties of the Hamiltonian are determined by its surface and that these properties can be measured even if the system can only be initialized to a mixed state. Therefore, our method can be applied to various physical models, with important examples including coupled nano-mechanical oscillators, hopping fermions in optical lattices and transverse Ising chains.

Sdg interacting boson hamiltonian in the seniority scheme

Energy Technology Data Exchange (ETDEWEB)

Yoshinaga, N.

1989-03-06

The sdg interacting boson hamiltonian is derived in the seniority scheme. We use the method of Otsuka, Arima and Iachello in order to derive the boson hamiltonian from the fermion hamiltonian. To examine how good is the boson approximation in the zeroth-order, we carry out the exact shell model calculations in a single j-shell. It is found that almost all low-lying levels are reproduced quite well by diagonalizing the sdg interacting boson hamiltonian in the vibrational case. In the deformed case the introduction of g-bosons improves the reproduction of the spectra and of the binding energies which are obtained by diagnoalizing the exact shell model hamiltonian. In particular the sdg interacting boson model reproduces well-developed rotational bands.

sdg Interacting boson hamiltonian in the seniority scheme

Science.gov (United States)

Yoshinaga, N.

1989-03-01

The sdg interacting boson hamiltonian is derived in the seniority scheme. We use the method of Otsuka, Arima and Iachello in order to derive the boson hamiltonian from the fermion hamiltonian. To examine how good is the boson approximation in the zeroth-order, we carry out the exact shell model calculations in a single j-shell. It is found that almost all low-lying levels are reproduced quite well by diagonalizing the sdg interacting boson hamiltonian in the vibrational case. In the deformed case the introduction of g-bosons improves the reproduction of the spectra and of the binding energies which are obtained by diagonalizing the exact shell model hamiltonian. In particular the sdg interacting boson model reproduces well-developed rotational bands.

Dynamical decoupling of unbounded Hamiltonians

Science.gov (United States)

Arenz, Christian; Burgarth, Daniel; Facchi, Paolo; Hillier, Robin

2018-03-01

We investigate the possibility to suppress interactions between a finite dimensional system and an infinite dimensional environment through a fast sequence of unitary kicks on the finite dimensional system. This method, called dynamical decoupling, is known to work for bounded interactions, but physical environments such as bosonic heat baths are usually modeled with unbounded interactions; hence, here, we initiate a systematic study of dynamical decoupling for unbounded operators. We develop a sufficient decoupling criterion for arbitrary Hamiltonians and a necessary decoupling criterion for semibounded Hamiltonians. We give examples for unbounded Hamiltonians where decoupling works and the limiting evolution as well as the convergence speed can be explicitly computed. We show that decoupling does not always work for unbounded interactions and we provide both physically and mathematically motivated examples.

Matchings Extend to Hamiltonian Cycles in 5-Cube

Directory of Open Access Journals (Sweden)

Wang Fan

2018-02-01

Full Text Available Ruskey and Savage asked the following question: Does every matching in a hypercube Qn for n ≥ 2 extend to a Hamiltonian cycle of Qn? Fink confirmed that every perfect matching can be extended to a Hamiltonian cycle of Qn, thus solved Kreweras’ conjecture. Also, Fink pointed out that every matching can be extended to a Hamiltonian cycle of Qn for n ∈ {2, 3, 4}. In this paper, we prove that every matching in Q5 can be extended to a Hamiltonian cycle of Q5.

Algebraic approach to q-deformed supersymmetric variants of the Hubbard model with pair hoppings

International Nuclear Information System (INIS)

Arnaudon, D.

1997-01-01

Two quantum spin chains Hamiltonians with quantum sl(2/1) invariance are constructed. These spin chains define variants of the Hubbard model and describe electron models with pair hoppings. A cubic algebra that admits the Birman-Wenzl-Murakami algebra as a quotient allows exact solvability of the periodic chain. The two Hamiltonians, respectively built using the distinguished and the fermionic bases of U q (sl(2/1)) differ only in the boundary terms. They are actually equivalent, but the equivalence is non local. Reflection equations are solved to get exact solvability on open chains with non trivial boundary conditions. Two families of diagonal solutions are found. The centre and the s-Casimir of the quantum enveloping algebra of sl(2/1) appear as tools for the construction of exactly solvable Hamiltonians. (author)

Synthesis and magnetic properties of heteronuclear 3d-4f compound

International Nuclear Information System (INIS)

Cristovao, B.; Ferenc, W.

2007-01-01

A novel heteronuclear 3d-4f compound having formula NdCu 3 L 3 ·13H 2 O (where H 3 L = Schiff base derived from 5-bromosalicylaldehyde and glycylglycine and L 3 = C 11 H 8 N 2 O 4 Br) was obtained. It was characterized by elemental and thermal analyses and magnetic measurements. The Cu(II)-Nd(III) compound is stable up to 323 K. During dehydration process the water molecules are lost in two stages. The magnetic susceptibility data for this complex change with temperature according to the Curie-Weiss law with Θ = -35 K. The magnetic moment values decrease from 5.00μ B at 303 K to 4.38μB at 76 K. (author)

Hamiltonian Approach to 2+1 Dimensional Gravity

Science.gov (United States)

Cantini, L.; Menotti, P.; Seminara, D.

2002-12-01

It is shown that the reduced particle dynamics of 2+1 dimensional gravity in the maximally slicing gauge has hamiltonian form. We give the exact diffeomorphism which transforms the spinning cone metric in the Deser, Jackiw, 't Hooft gauge to the maximally slicing gauge. It is explicitly shown that the boundary term in the action, written in hamiltonian form gives the hamiltonian for the reduced particle dynamics. The quantum mechanical translation of the two particle hamiltonian gives rise to the logarithm of the Laplace-Beltrami operator on a cone whose angular deficit is given by the total energy of the system irrespective of the masses of the particles thus proving at the quantum level a conjecture by 't Hooft on the two particle dynamics.

A Direct Method of Hamiltonian Structure

International Nuclear Information System (INIS)

Li Qi; Chen Dengyuan; Su Shuhua

2011-01-01

A direct method of constructing the Hamiltonian structure of the soliton hierarchy with self-consistent sources is proposed through computing the functional derivative under some constraints. The Hamiltonian functional is related with the conservation densities of the corresponding hierarchy. Three examples and their two reductions are given. (general)

On Distributed Port-Hamiltonian Process Systems

NARCIS (Netherlands)

Lopezlena, Ricardo; Scherpen, Jacquelien M.A.

2004-01-01

In this paper we use the term distributed port-Hamiltonian Process Systems (DPHPS) to refer to the result of merging the theory of distributed Port-Hamiltonian systems (DPHS) with the theory of process systems (PS). Such concept is useful for combining the systematic interconnection of PHS with the

A diagrammatic construction of formal E-independent model hamiltonian

International Nuclear Information System (INIS)

Kvasnicka, V.

1977-01-01

A diagrammatic construction of formal E-independent model interaction (i.e., without second-quantization formalism) is suggested. The construction starts from the quasi-degenerate Brillouin-Wigner perturbation theory, in the framework of which an E-dependent model Hamiltonian is simply constructed. Applying the ''E-removing'' procedure to this E-dependent model Hamiltonian, the E-independent formal model Hamiltonian either Hermitian or non-Hermitian can diagrammatically be easily derived. For the formal E-independent model Hamiltonian the separability theorem is proved, which can be profitably used for a rather ''formalistic ''construction of a many-body E-independent model Hamiltonian

Port Hamiltonian modeling of Power Networks

NARCIS (Netherlands)

van Schaik, F.; van der Schaft, Abraham; Scherpen, Jacquelien M.A.; Zonetti, Daniele; Ortega, R

2012-01-01

In this talk a full nonlinear model for the power network in port–Hamiltonian framework is derived to study its stability properties. For this we use the modularity approach i.e., we first derive the models of individual components in power network as port-Hamiltonian systems and then we combine all

Hamiltonian Cycles on Random Eulerian Triangulations

DEFF Research Database (Denmark)

Guitter, E.; Kristjansen, C.; Nielsen, Jakob Langgaard

1998-01-01

. Considering the case n -> 0, this implies that the system of random Eulerian triangulations equipped with Hamiltonian cycles describes a c=-1 matter field coupled to 2D quantum gravity as opposed to the system of usual random triangulations equipped with Hamiltonian cycles which has c=-2. Hence, in this case...

Incomplete Dirac reduction of constrained Hamiltonian systems

Energy Technology Data Exchange (ETDEWEB)

Chandre, C., E-mail: chandre@cpt.univ-mrs.fr

2015-10-15

First-class constraints constitute a potential obstacle to the computation of a Poisson bracket in Dirac’s theory of constrained Hamiltonian systems. Using the pseudoinverse instead of the inverse of the matrix defined by the Poisson brackets between the constraints, we show that a Dirac–Poisson bracket can be constructed, even if it corresponds to an incomplete reduction of the original Hamiltonian system. The uniqueness of Dirac brackets is discussed. The relevance of this procedure for infinite dimensional Hamiltonian systems is exemplified.

Spectral and resonance properties of the Smilansky Hamiltonian

Energy Technology Data Exchange (ETDEWEB)

Exner, Pavel [Department of Theoretical Physics, Nuclear Physics Institute, Czech Academy of Sciences, 25068 Řež near Prague (Czech Republic); Doppler Institute for Mathematical Physics and Applied Mathematics, Czech Technical University, Břehová 7, 11519 Prague (Czech Republic); Lotoreichik, Vladimir [Department of Theoretical Physics, Nuclear Physics Institute, Czech Academy of Sciences, 25068 Řež near Prague (Czech Republic); Tater, Miloš, E-mail: tater@ujf.cas.cz [Department of Theoretical Physics, Nuclear Physics Institute, Czech Academy of Sciences, 25068 Řež near Prague (Czech Republic)

2017-02-26

We analyze the Hamiltonian proposed by Smilansky to describe irreversible dynamics in quantum graphs and studied further by Solomyak and others. We derive a weak-coupling asymptotics of the ground state and add new insights by finding the discrete spectrum numerically in the subcritical case. Furthermore, we show that the model then has a rich resonance structure. - Highlights: • We derive conditions on bound states and on resonances of the Smilansky Hamiltonian. • Using these conditions we find numerically discrete spectrum and resonances of this Hamiltonian. • Our numerical tests confirm known properties of the Hamiltonian and allow us to conjecture new ones.

Theoretical issues in quantum computing: Graph isomorphism, PageRank, and Hamiltonian determination

Science.gov (United States)

Rudinger, Kenneth Michael

This thesis explores several theoretical questions pertaining to quantum computing. First we examine several questions regarding multi-particle quantum random walk-based algorithms for the graph isomorphism problem. We find that there exists a non-trivial difference between continuous-time walks of one and two non-interacting particles as compared to non-interacting walks of three or more particles, in that the latter are able to distinguish many strongly regular graphs (SRGs), a class of graphs with many graph pairs that are difficult to distinguish. We demonstrate analytically where this distinguishing power comes from, and we show numerically that three-particle and four-particle non-interacting continuous-time walks can distinguish many pairs of strongly regular graphs. We additionally show that this distinguishing power, while it grows with particle number, is bounded, so that no continuous-time non-interacting walk of fixed particle number can distinguish all strongly regular graphs. We then investigate the relationship between continuous-time and discrete-time walks, in the context of the graph isomorphism problem. While it has been previously demonstrated numerically that discrete-time walks of non-interacting particles can distinguish some SRGs, we demonstrate where this distinguishing power comes from. We also show that while no continuous-time non-interacting walk of fixed particle number can distinguish SRGs, it remains a possibility that such a discrete-time walk could, leaving open the possibility of a non-trivial difference between discrete-time and continuous-time walks. The last piece of our work on graph isomorphism examines limitations on certain kinds of continuous-time walk-based algorithms for distinguishing graphs. We show that a very general class of continuous-time walk algorithms, with a broad class of allowable interactions, cannot distinguish all graphs. We next consider a previously-proposed quantum adiabatic algorithm for computing the

Optimal adaptive control for quantum metrology with time-dependent Hamiltonians

Science.gov (United States)

Pang, Shengshi; Jordan, Andrew N.

2017-01-01

Quantum metrology has been studied for a wide range of systems with time-independent Hamiltonians. For systems with time-dependent Hamiltonians, however, due to the complexity of dynamics, little has been known about quantum metrology. Here we investigate quantum metrology with time-dependent Hamiltonians to bridge this gap. We obtain the optimal quantum Fisher information for parameters in time-dependent Hamiltonians, and show proper Hamiltonian control is generally necessary to optimize the Fisher information. We derive the optimal Hamiltonian control, which is generally adaptive, and the measurement scheme to attain the optimal Fisher information. In a minimal example of a qubit in a rotating magnetic field, we find a surprising result that the fundamental limit of T2 time scaling of quantum Fisher information can be broken with time-dependent Hamiltonians, which reaches T4 in estimating the rotation frequency of the field. We conclude by considering level crossings in the derivatives of the Hamiltonians, and point out additional control is necessary for that case. PMID:28276428

Optimal adaptive control for quantum metrology with time-dependent Hamiltonians.

Science.gov (United States)

Pang, Shengshi; Jordan, Andrew N

2017-03-09

Quantum metrology has been studied for a wide range of systems with time-independent Hamiltonians. For systems with time-dependent Hamiltonians, however, due to the complexity of dynamics, little has been known about quantum metrology. Here we investigate quantum metrology with time-dependent Hamiltonians to bridge this gap. We obtain the optimal quantum Fisher information for parameters in time-dependent Hamiltonians, and show proper Hamiltonian control is generally necessary to optimize the Fisher information. We derive the optimal Hamiltonian control, which is generally adaptive, and the measurement scheme to attain the optimal Fisher information. In a minimal example of a qubit in a rotating magnetic field, we find a surprising result that the fundamental limit of T 2 time scaling of quantum Fisher information can be broken with time-dependent Hamiltonians, which reaches T 4 in estimating the rotation frequency of the field. We conclude by considering level crossings in the derivatives of the Hamiltonians, and point out additional control is necessary for that case.

Hamiltonian representation of divergence-free fields

International Nuclear Information System (INIS)

Boozer, A.H.

1984-11-01

Globally divergence-free fields, such as the magnetic field and the vorticity, can be described by a two degree of freedom Hamiltonian. The Hamiltonian function provides a complete topological description of the field lines. The formulation also separates the dissipative and inertial time scale evolution of the magnetic and the vorticity fields

Hamiltonian structures of some non-linear evolution equations

International Nuclear Information System (INIS)

Tu, G.Z.

1983-06-01

The Hamiltonian structure of the O(2,1) non-linear sigma model, generalized AKNS equations, are discussed. By reducing the O(2,1) non-linear sigma model to its Hamiltonian form some new conservation laws are derived. A new hierarchy of non-linear evolution equations is proposed and shown to be generalized Hamiltonian equations with an infinite number of conservation laws. (author)

Numerical determination of the magnetic field line Hamiltonian

International Nuclear Information System (INIS)

Kuo-Petravic, G.; Boozer, A.H.

1986-03-01

The structure of a magnetic field is determined by a one-degree of freedom, time-dependent Hamiltonian. This Hamiltonian is evaluated for a given field in a perturbed action-angle form. The location and the size of magnetic islands in the given field are determined from Hamiltonian perturbation theory and from an ordinary Poincare plot of the field line trajectories

High spin exotic states and new method for pairing energy

International Nuclear Information System (INIS)

Molique, H.

1996-01-01

We present a new method called 'PSY-MB', initially developed in the framework of abstract group theory for the solution of the problem of strongly interacting multi-fermionic systems with particular to systems in an external rotating field. The validity of the new method (PSY-MB) is tested on model Hamiltonians. A detailed comparison between the obtained solutions and the exact ones is performed. The new method is used in the study of realistic nuclear Hamiltonians based on the Woods-Saxon potential within the cranking approximation to study the influence of residual monopole pairing interactions in the rare-earth mass region. In parallel with this new technique we present original results obtained with the Woods-Saxon mean-field and the self-consistent Hartree-Fock approximation in order to investigate such exotic effects as octupole deformations and hexadecapole C 4 -polarizing deformations in the framework of high-spin physics. By developing these three approaches in one single work we prepare the ground for the nuclear structure calculations of the new generation - where the residual two-body interactions are taken into account also in the weak pairing limit. (author)

Hamiltonian analysis of transverse dynamics in axisymmetric rf photoinjectors

International Nuclear Information System (INIS)

Wang, C.-x.

2006-01-01

A general Hamiltonian that governs the beam dynamics in an rf photoinjector is derived from first principles. With proper choice of coordinates, the resulting Hamiltonian has a simple and familiar form, while taking into account the rapid acceleration, rf focusing, magnetic focusing, and space-charge forces. From the linear Hamiltonian, beam-envelope evolution is readily obtained, which better illuminates the theory of emittance compensation. Preliminary results on the third-order nonlinear Hamiltonian will be given as well.

Frustration-free Hamiltonians supporting Majorana zero edge modes

International Nuclear Information System (INIS)

Jevtic, Sania; Barnett, Ryan

2017-01-01

A one-dimensional fermionic system, such as a superconducting wire, may host Majorana zero-energy edge modes (MZMs) at its edges when it is in the topological phase. MZMs provide a path to realising fault-tolerant quantum computation, and so are the focus of intense experimental and theoretical studies. However, given a Hamiltonian, determining whether MZMs exist is a daunting task as it relies on knowing the spectral properties of the Hamiltonian in the thermodynamic limit. The Kitaev chain is a paradigmatic non-interacting model that supports MZMs and the Hamiltonian can be fully diagonalised. However, for interacting models, the situation is far more complex. Here we consider a different classification of models, namely, ones with frustration-free Hamiltonians. Within this class of models, interacting and non-interacting systems are treated on an equal footing, and we identify exactly which Hamiltonians can realise MZMs. (paper)

Frustration-free Hamiltonians supporting Majorana zero edge modes

Science.gov (United States)

Jevtic, Sania; Barnett, Ryan

2017-10-01

A one-dimensional fermionic system, such as a superconducting wire, may host Majorana zero-energy edge modes (MZMs) at its edges when it is in the topological phase. MZMs provide a path to realising fault-tolerant quantum computation, and so are the focus of intense experimental and theoretical studies. However, given a Hamiltonian, determining whether MZMs exist is a daunting task as it relies on knowing the spectral properties of the Hamiltonian in the thermodynamic limit. The Kitaev chain is a paradigmatic non-interacting model that supports MZMs and the Hamiltonian can be fully diagonalised. However, for interacting models, the situation is far more complex. Here we consider a different classification of models, namely, ones with frustration-free Hamiltonians. Within this class of models, interacting and non-interacting systems are treated on an equal footing, and we identify exactly which Hamiltonians can realise MZMs.

Two pairs of Lie algebras and the integrable couplings as well as the Hamiltonian structure of the Yang hierarchy

International Nuclear Information System (INIS)

Zhang Yufeng; Guo Fukui

2007-01-01

Two types of Lie algebras, which are the subalgebras of the Lie algebra A 2 , A 3 respectively, are presented. The resulting loop algebras are following. As their applications, two different integrable couplings of the Yang hierarchy are obtained, called them the double integrable couplings. The Hamiltonian structure of one of them is worked out by a proper linear isomorphic transformation and the quadratic-form identity

Quantum entangling power of adiabatically connected Hamiltonians

International Nuclear Information System (INIS)

Hamma, Alioscia; Zanardi, Paolo

2004-01-01

The space of quantum Hamiltonians has a natural partition in classes of operators that can be adiabatically deformed into each other. We consider parametric families of Hamiltonians acting on a bipartite quantum state space. When the different Hamiltonians in the family fall in the same adiabatic class, one can manipulate entanglement by moving through energy eigenstates corresponding to different values of the control parameters. We introduce an associated notion of adiabatic entangling power. This novel measure is analyzed for general dxd quantum systems, and specific two-qubit examples are studied

A parcel formulation for Hamiltonian layer models

NARCIS (Netherlands)

Bokhove, Onno; Oliver, M.

Starting from the three-dimensional hydrostatic primitive equations, we derive Hamiltonian N-layer models with isentropic tropospheric and isentropic or isothermal stratospheric layers. Our construction employs a new parcel Hamiltonian formulation which describes the fluid as a continuum of

Effective Hamiltonians in quantum physics: resonances and geometric phase

International Nuclear Information System (INIS)

Rau, A R P; Uskov, D

2006-01-01

Effective Hamiltonians are often used in quantum physics, both in time-dependent and time-independent contexts. Analogies are drawn between the two usages, the discussion framed particularly for the geometric phase of a time-dependent Hamiltonian and for resonances as stationary states of a time-independent Hamiltonian

Gravitational surface Hamiltonian and entropy quantization

Directory of Open Access Journals (Sweden)

Ashish Bakshi

2017-02-01

Full Text Available The surface Hamiltonian corresponding to the surface part of a gravitational action has xp structure where p is conjugate momentum of x. Moreover, it leads to TS on the horizon of a black hole. Here T and S are temperature and entropy of the horizon. Imposing the hermiticity condition we quantize this Hamiltonian. This leads to an equidistant spectrum of its eigenvalues. Using this we show that the entropy of the horizon is quantized. This analysis holds for any order of Lanczos–Lovelock gravity. For general relativity, the area spectrum is consistent with Bekenstein's observation. This provides a more robust confirmation of this earlier result as the calculation is based on the direct quantization of the Hamiltonian in the sense of usual quantum mechanics.

First principles of Hamiltonian medicine.

Science.gov (United States)

Crespi, Bernard; Foster, Kevin; Úbeda, Francisco

2014-05-19

We introduce the field of Hamiltonian medicine, which centres on the roles of genetic relatedness in human health and disease. Hamiltonian medicine represents the application of basic social-evolution theory, for interactions involving kinship, to core issues in medicine such as pathogens, cancer, optimal growth and mental illness. It encompasses three domains, which involve conflict and cooperation between: (i) microbes or cancer cells, within humans, (ii) genes expressed in humans, (iii) human individuals. A set of six core principles, based on these domains and their interfaces, serves to conceptually organize the field, and contextualize illustrative examples. The primary usefulness of Hamiltonian medicine is that, like Darwinian medicine more generally, it provides novel insights into what data will be productive to collect, to address important clinical and public health problems. Our synthesis of this nascent field is intended predominantly for evolutionary and behavioural biologists who aspire to address questions directly relevant to human health and disease.

Quantum Statistical Operator and Classically Chaotic Hamiltonian ...

African Journals Online (AJOL)

Quantum Statistical Operator and Classically Chaotic Hamiltonian System. ... Journal of the Nigerian Association of Mathematical Physics ... In a Hamiltonian system von Neumann Statistical Operator is used to tease out the quantum consequence of (classical) chaos engendered by the nonlinear coupling of system to its ...

Target-space duality between simple compact Lie groups and Lie algebras under the Hamiltonian formalism. Pt. 1. Remnants of duality at the classic level

International Nuclear Information System (INIS)

Alvarez, O.; Liu Chienhao

1996-01-01

It has been suggested that a possible classical remnant of the phenomenon of target-space duality (T-duality) would be the equivalence of the classical string Hamiltonian systems. Given a simple compact Lie group G with a bi-invariant metric and a generating function Γ suggested in the physics literature, we follow the above line of thought and work out the canonical transformation Φ generated by Γ together with an Ad-invariant metric and a B-field on the associated Lie algebra g of G so that G and g form a string target-space dual pair at the classical level under the Hamiltonian formalism. In this article, some general features of this Hamiltonian setting are discussed. We study properties of the canonical transformation Φ including a careful analysis of its domain and image. The geometry of the T-dual structure on g is lightly touched. We leave the task of tracing back the Hamiltonian formalism at the quantum level to the sequel of this paper. (orig.). With 4 figs

Model Hamiltonian Calculations of the Nonlinear Polarizabilities of Conjugated Molecules.

Science.gov (United States)

Risser, Steven Michael

This dissertation advances the theoretical knowledge of the nonlinear polarizabilities of conjugated molecules. The unifying feature of these molecules is an extended delocalized pi electron structure. The pi electrons dominate the electronic properties of the molecules, allowing prediction of molecular properties based on the treatment of just the pi electrons. Two separate pi electron Hamiltonians are used in the research. The principal Hamiltonian used is the non-interacting single-particle Huckel Hamiltonian, which replaces the Coulomb interaction among the pi electrons with a mean field interaction. The simplification allows for exact solution of the Hamiltonian for large molecules. The second Hamiltonian used for this research is the interacting multi-particle Pariser-Parr-Pople (PPP) Hamiltonian, which retains explicit Coulomb interactions. This limits exact solutions to molecules containing at most eight electrons. The molecular properties being investigated are the linear polarizability, and the second and third order hyperpolarizabilities. The hyperpolarizabilities determine the nonlinear optical response of materials. These molecular parameters are determined by two independent approaches. The results from the Huckel Hamiltonian are obtained through first, second and third order perturbation theory. The results from the PPP Hamiltonian are obtained by including the applied field directly in the Hamiltonian and determining the ground state energy at a series of field strengths. By fitting the energy to a polynomial in field strength, the polarizability and hyperpolarizabilities are determined. The Huckel Hamiltonian is used to calculate the third order hyperpolarizability of polyenes. These calculations were the first to show the average hyperpolarizability of the polyenes to be positive, and also to show the saturation of the hyperpolarizability. Comparison of these Huckel results to those from the PPP Hamiltonian shows the lack of explicit Coulomb

Generalized Hubbard Hamiltonian: renormalization group approach

International Nuclear Information System (INIS)

Cannas, S.A.; Tamarit, F.A.; Tsallis, C.

1991-01-01

We study a generalized Hubbard Hamiltonian which is closed within the framework of a Quantum Real Space Renormalization Group, which replaces the d-dimensional hypercubic lattice by a diamond-like lattice. The phase diagram of the generalized Hubbard Hamiltonian is analyzed for the half-filled band case in d = 2 and d = 3. Some evidence for superconductivity is presented. (author). 44 refs., 12 figs., 2 tabs

Local Hamiltonians for maximally multipartite-entangled states

Science.gov (United States)

Facchi, P.; Florio, G.; Pascazio, S.; Pepe, F.

2010-10-01

We study the conditions for obtaining maximally multipartite-entangled states (MMESs) as nondegenerate eigenstates of Hamiltonians that involve only short-range interactions. We investigate small-size systems (with a number of qubits ranging from 3 to 5) and show some example Hamiltonians with MMESs as eigenstates.

Local Hamiltonians for maximally multipartite-entangled states

International Nuclear Information System (INIS)

Facchi, P.; Florio, G.; Pascazio, S.; Pepe, F.

2010-01-01

We study the conditions for obtaining maximally multipartite-entangled states (MMESs) as nondegenerate eigenstates of Hamiltonians that involve only short-range interactions. We investigate small-size systems (with a number of qubits ranging from 3 to 5) and show some example Hamiltonians with MMESs as eigenstates.

Dependence of two-proton radioactivity on nuclear pairing models

Science.gov (United States)

Oishi, Tomohiro; Kortelainen, Markus; Pastore, Alessandro

2017-10-01

Sensitivity of two-proton emitting decay to nuclear pairing correlation is discussed within a time-dependent three-body model. We focus on the 6Be nucleus assuming α +p +p configuration, and its decay process is described as a time evolution of the three-body resonance state. For a proton-proton subsystem, a schematic density-dependent contact (SDDC) pairing model is employed. From the time-dependent calculation, we observed the exponential decay rule of a two-proton emission. It is shown that the density dependence does not play a major role in determining the decay width, which can be controlled only by the asymptotic strength of the pairing interaction. This asymptotic pairing sensitivity can be understood in terms of the dynamics of the wave function driven by the three-body Hamiltonian, by monitoring the time-dependent density distribution. With this simple SDDC pairing model, there remains an impossible trinity problem: it cannot simultaneously reproduce the empirical Q value, decay width, and the nucleon-nucleon scattering length. This problem suggests that a further sophistication of the theoretical pairing model is necessary, utilizing the two-proton radioactivity data as the reference quantities.

Greenberger-Horne-Zeilinger States and Few-Body Hamiltonians

Science.gov (United States)

Facchi, Paolo; Florio, Giuseppe; Pascazio, Saverio; Pepe, Francesco V.

2011-12-01

The generation of Greenberger-Horne-Zeilinger (GHZ) states is a crucial problem in quantum information. We derive general conditions for obtaining GHZ states as eigenstates of a Hamiltonian. We find that a necessary condition for an n-qubit GHZ state to be a nondegenerate eigenstate of a Hamiltonian is the presence of m-qubit couplings with m≥[(n+1)/2]. Moreover, we introduce a Hamiltonian with a GHZ eigenstate and derive sufficient conditions for the removal of the degeneracy.

Greenberger-Horne-Zeilinger states and few-body Hamiltonians.

Science.gov (United States)

Facchi, Paolo; Florio, Giuseppe; Pascazio, Saverio; Pepe, Francesco V

2011-12-23

The generation of Greenberger-Horne-Zeilinger (GHZ) states is a crucial problem in quantum information. We derive general conditions for obtaining GHZ states as eigenstates of a Hamiltonian. We find that a necessary condition for an n-qubit GHZ state to be a nondegenerate eigenstate of a Hamiltonian is the presence of m-qubit couplings with m≥[(n+1)/2]. Moreover, we introduce a Hamiltonian with a GHZ eigenstate and derive sufficient conditions for the removal of the degeneracy.

Effective Hamiltonian for travelling discrete breathers

Science.gov (United States)

MacKay, Robert S.; Sepulchre, Jacques-Alexandre

2002-05-01

Hamiltonian chains of oscillators in general probably do not sustain exact travelling discrete breathers. However solutions which look like moving discrete breathers for some time are not difficult to observe in numerics. In this paper we propose an abstract framework for the description of approximate travelling discrete breathers in Hamiltonian chains of oscillators. The method is based on the construction of an effective Hamiltonian enabling one to describe the dynamics of the translation degree of freedom of moving breathers. Error estimate on the approximate dynamics is also studied. The concept of the Peierls-Nabarro barrier can be made clear in this framework. We illustrate the method with two simple examples, namely the Salerno model which interpolates between the Ablowitz-Ladik lattice and the discrete nonlinear Schrödinger system, and the Fermi-Pasta-Ulam chain.

Complex Hamiltonian Dynamics

CERN Document Server

Bountis, Tassos

2012-01-01

This book introduces and explores modern developments in the well established field of Hamiltonian dynamical systems. It focuses on high degree-of-freedom systems and the transitional regimes between regular and chaotic motion. The role of nonlinear normal modes is highlighted and the importance of low-dimensional tori in the resolution of the famous FPU paradox is emphasized. Novel powerful numerical methods are used to study localization phenomena and distinguish order from strongly and weakly chaotic regimes. The emerging hierarchy of complex structures in such regimes gives rise to particularly long-lived patterns and phenomena called quasi-stationary states, which are explored in particular in the concrete setting of one-dimensional Hamiltonian lattices and physical applications in condensed matter systems.  The self-contained and pedagogical approach is blended with a unique balance between mathematical rigor, physics insights and concrete applications. End of chapter exercises and (more demanding) res...

Invariant metrics for Hamiltonian systems

International Nuclear Information System (INIS)

Rangarajan, G.; Dragt, A.J.; Neri, F.

1991-05-01

In this paper, invariant metrics are constructed for Hamiltonian systems. These metrics give rise to norms on the space of homeogeneous polynomials of phase-space variables. For an accelerator lattice described by a Hamiltonian, these norms characterize the nonlinear content of the lattice. Therefore, the performance of the lattice can be improved by minimizing the norm as a function of parameters describing the beam-line elements in the lattice. A four-fold increase in the dynamic aperture of a model FODO cell is obtained using this procedure. 7 refs

Approximate symmetries of Hamiltonians

Science.gov (United States)

Chubb, Christopher T.; Flammia, Steven T.

2017-08-01

We explore the relationship between approximate symmetries of a gapped Hamiltonian and the structure of its ground space. We start by considering approximate symmetry operators, defined as unitary operators whose commutators with the Hamiltonian have norms that are sufficiently small. We show that when approximate symmetry operators can be restricted to the ground space while approximately preserving certain mutual commutation relations. We generalize the Stone-von Neumann theorem to matrices that approximately satisfy the canonical (Heisenberg-Weyl-type) commutation relations and use this to show that approximate symmetry operators can certify the degeneracy of the ground space even though they only approximately form a group. Importantly, the notions of "approximate" and "small" are all independent of the dimension of the ambient Hilbert space and depend only on the degeneracy in the ground space. Our analysis additionally holds for any gapped band of sufficiently small width in the excited spectrum of the Hamiltonian, and we discuss applications of these ideas to topological quantum phases of matter and topological quantum error correcting codes. Finally, in our analysis, we also provide an exponential improvement upon bounds concerning the existence of shared approximate eigenvectors of approximately commuting operators under an added normality constraint, which may be of independent interest.

Momentum and hamiltonian in complex action theory

DEFF Research Database (Denmark)

Nagao, Keiichi; Nielsen, Holger Frits Bech

2012-01-01

$-parametrized wave function, which is a solution to an eigenvalue problem of a momentum operator $\\hat{p}$, in FPI with a starting Lagrangian. Solving the eigenvalue problem, we derive the momentum and Hamiltonian. Oppositely, starting from the Hamiltonian we derive the Lagrangian in FPI, and we are led...

Diffeomorphism invariance in the Hamiltonian formulation of General Relativity

International Nuclear Information System (INIS)

Kiriushcheva, N.; Kuzmin, S.V.; Racknor, C.; Valluri, S.R.

2008-01-01

It is shown that when the Einstein-Hilbert Lagrangian is considered without any non-covariant modifications or change of variables, its Hamiltonian formulation leads to results consistent with principles of General Relativity. The first-class constraints of such a Hamiltonian formulation, with the metric tensor taken as a canonical variable, allow one to derive the generator of gauge transformations, which directly leads to diffeomorphism invariance. The given Hamiltonian formulation preserves general covariance of the transformations derivable from it. This characteristic should be used as the crucial consistency requirement that must be met by any Hamiltonian formulation of General Relativity

Reaction monitoring using hyperpolarized NMR with scaling of heteronuclear couplings by optimal tracking

Science.gov (United States)

Zhang, Guannan; Schilling, Franz; Glaser, Steffen J.; Hilty, Christian

2016-11-01

Off-resonance decoupling using the method of Scaling of Heteronuclear Couplings by Optimal Tracking (SHOT) enables determination of heteronuclear correlations of chemical shifts in single scan NMR spectra. Through modulation of J-coupling evolution by shaped radio frequency pulses, off resonance decoupling using SHOT pulses causes a user-defined dependence of the observed J-splitting, such as the splitting of 13C peaks, on the chemical shift offset of coupled nuclei, such as 1H. Because a decoupling experiment requires only a single scan, this method is suitable for characterizing on-going chemical reactions using hyperpolarization by dissolution dynamic nuclear polarization (D-DNP). We demonstrate the calculation of [13C, 1H] chemical shift correlations of the carbanionic active sites from hyperpolarized styrene polymerized using sodium naphthalene as an initiator. While off resonance decoupling by SHOT pulses does not enhance the resolution in the same way as a 2D NMR spectrum would, the ability to obtain the correlations in single scans makes this method ideal for determination of chemical shifts in on-going reactions on the second time scale. In addition, we present a novel SHOT pulse that allows to scale J-splittings 50% larger than the respective J-coupling constant. This feature can be used to enhance the resolution of the indirectly detected chemical shift and reduce peak overlap, as demonstrated in a model reaction between p-anisaldehyde and isobutylamine. For both pulses, the accuracy is evaluated under changing signal-to-noise ratios (SNR) of the peaks from reactants and reaction products, with an overall standard deviation of chemical shift differences compared to reference spectra of 0.02 ppm when measured on a 400 MHz NMR spectrometer. Notably, the appearance of decoupling side-bands, which scale with peak intensity, appears to be of secondary importance.

An approach for obtaining integrable Hamiltonians from Poisson-commuting polynomial families

Science.gov (United States)

Leyvraz, F.

2017-07-01

We discuss a general approach permitting the identification of a broad class of sets of Poisson-commuting Hamiltonians, which are integrable in the sense of Liouville. It is shown that all such Hamiltonians can be solved explicitly by a separation of variables ansatz. The method leads in particular to a proof that the so-called "goldfish" Hamiltonian is maximally superintegrable and leads to an elementary identification of a full set of integrals of motion. The Hamiltonians in involution with the "goldfish" Hamiltonian are also explicitly integrated. New integrable Hamiltonians are identified, among which some have the property of being isochronous, that is, all their orbits have the same period. Finally, a peculiar structure is identified in the Poisson brackets between the elementary symmetric functions and the set of Hamiltonians commuting with the "goldfish" Hamiltonian: these can be expressed as products between elementary symmetric functions and Hamiltonians. The structure displays an invariance property with respect to one element and has both a symmetry and a closure property. The meaning of this structure is not altogether clear to the author, but it turns out to be a powerful tool.

Empirical Hamiltonians

International Nuclear Information System (INIS)

Peggs, S.; Talman, R.

1987-01-01

As proton accelerators get larger, and include more magnets, the conventional tracking programs which simulate them run slower. The purpose of this paper is to describe a method, still under development, in which element-by-element tracking around one turn is replaced by a single man, which can be processed far faster. It is assumed for this method that a conventional program exists which can perform faithful tracking in the lattice under study for some hundreds of turns, with all lattice parameters held constant. An empirical map is then generated by comparison with the tracking program. A procedure has been outlined for determining an empirical Hamiltonian, which can represent motion through many nonlinear kicks, by taking data from a conventional tracking program. Though derived by an approximate method this Hamiltonian is analytic in form and can be subjected to further analysis of varying degrees of mathematical rigor. Even though the empirical procedure has only been described in one transverse dimension, there is good reason to hope that it can be extended to include two transverse dimensions, so that it can become a more practical tool in realistic cases

Effective hamiltonian within the microscopic unitary nuclear model

International Nuclear Information System (INIS)

Avramenko, V.I.; Blokhin, A.L.

1989-01-01

Within the microscopic version of the unitary collective model with the horizontal mixing the effective Hamiltonian for 18 O and 18 Ne nuclei is constructed. The algebraic structure of the Hamiltonian is compared to the familiar phenomenological ones with the SU(3)-mixing terms which describe the coupled rotational and vibrational spectra. The Hamiltonian, including central nuclear and Coulomb interaction, is diagonalized on the basis of three SU(3) irreducible representations with two orbital symmetries. 32 refs.; 2 figs.; 4 tabs

Homotopical Dynamics IV: Hopf invariants and hamiltonian flows

OpenAIRE

Cornea, Octavian

2001-01-01

In a non-compact context the first natural step in the search for periodic orbits of a hamiltonian flow is to detect bounded ones. In this paper we show that, in a non-compact setting, certain algebraic topological constraints imposed to a gradient flow of the hamiltonian function $f$ imply the existence of bounded orbits for the hamiltonian flow of $f$. Once the existence of bounded orbits is established, under favorable circumstances, application of the $C^{1}$-closing lemma leads to period...

Effective magnetic Hamiltonians

Czech Academy of Sciences Publication Activity Database

Drchal, Václav; Kudrnovský, Josef; Turek, I.

2013-01-01

Roč. 26, č. 5 (2013), s. 1997-2000 ISSN 1557-1939 R&D Projects: GA ČR GA202/09/0775 Institutional support: RVO:68378271 Keywords : effective magnetic Hamiltonian * ab initio * magnetic structure Subject RIV: BE - Theoretical Physics Impact factor: 0.930, year: 2013

Polynomial Similarity Transformation Theory: A smooth interpolation between coupled cluster doubles and projected BCS applied to the reduced BCS Hamiltonian

Energy Technology Data Exchange (ETDEWEB)

Degroote, M. [Rice Univ., Houston, TX (United States); Henderson, T. M. [Rice Univ., Houston, TX (United States); Zhao, J. [Rice Univ., Houston, TX (United States); Dukelsky, J. [Consejo Superior de Investigaciones Cientificas (CSIC), Madrid (Spain). Inst. de Estructura de la Materia; Scuseria, G. E. [Rice Univ., Houston, TX (United States)

2018-01-03

We present a similarity transformation theory based on a polynomial form of a particle-hole pair excitation operator. In the weakly correlated limit, this polynomial becomes an exponential, leading to coupled cluster doubles. In the opposite strongly correlated limit, the polynomial becomes an extended Bessel expansion and yields the projected BCS wavefunction. In between, we interpolate using a single parameter. The e ective Hamiltonian is non-hermitian and this Polynomial Similarity Transformation Theory follows the philosophy of traditional coupled cluster, left projecting the transformed Hamiltonian onto subspaces of the Hilbert space in which the wave function variance is forced to be zero. Similarly, the interpolation parameter is obtained through minimizing the next residual in the projective hierarchy. We rationalize and demonstrate how and why coupled cluster doubles is ill suited to the strongly correlated limit whereas the Bessel expansion remains well behaved. The model provides accurate wave functions with energy errors that in its best variant are smaller than 1% across all interaction stengths. The numerical cost is polynomial in system size and the theory can be straightforwardly applied to any realistic Hamiltonian.

A local inverse spectral theorem for Hamiltonian systems

International Nuclear Information System (INIS)

Langer, Matthias; Woracek, Harald

2011-01-01

We consider (2 × 2)-Hamiltonian systems of the form y'(x) = zJH(x)y(x), x in [s − , s + ). If a system of this form is in the limit point case, an analytic function is associated with it, namely its Titchmarsh–Weyl coefficient q H . The (global) uniqueness theorem due to de Branges says that the Hamiltonian H is (up to reparameterization) uniquely determined by the function q H . In this paper we give a local uniqueness theorem; if the Titchmarsh–Weyl coefficients q H 1 and q H 2 corresponding to two Hamiltonian systems are exponentially close, then the Hamiltonians H 1 and H 2 coincide (up to reparameterization) up to a certain point of their domain, which depends on the quantitative degree of exponential closeness of the Titchmarsh–Weyl coefficients

Contact symmetries and Hamiltonian thermodynamics

International Nuclear Information System (INIS)

Bravetti, A.; Lopez-Monsalvo, C.S.; Nettel, F.

2015-01-01

It has been shown that contact geometry is the proper framework underlying classical thermodynamics and that thermodynamic fluctuations are captured by an additional metric structure related to Fisher’s Information Matrix. In this work we analyse several unaddressed aspects about the application of contact and metric geometry to thermodynamics. We consider here the Thermodynamic Phase Space and start by investigating the role of gauge transformations and Legendre symmetries for metric contact manifolds and their significance in thermodynamics. Then we present a novel mathematical characterization of first order phase transitions as equilibrium processes on the Thermodynamic Phase Space for which the Legendre symmetry is broken. Moreover, we use contact Hamiltonian dynamics to represent thermodynamic processes in a way that resembles the classical Hamiltonian formulation of conservative mechanics and we show that the relevant Hamiltonian coincides with the irreversible entropy production along thermodynamic processes. Therefore, we use such property to give a geometric definition of thermodynamically admissible fluctuations according to the Second Law of thermodynamics. Finally, we show that the length of a curve describing a thermodynamic process measures its entropy production

Generic Local Hamiltonians are Gapless

Science.gov (United States)

Movassagh, Ramis

2017-12-01

We prove that generic quantum local Hamiltonians are gapless. In fact, we prove that there is a continuous density of states above the ground state. The Hamiltonian can be on a lattice in any spatial dimension or on a graph with a bounded maximum vertex degree. The type of interactions allowed for include translational invariance in a disorder (i.e., probabilistic) sense with some assumptions on the local distributions. Examples include many-body localization and random spin models. We calculate the scaling of the gap with the system's size when the local terms are distributed according to a Gaussian β orthogonal random matrix ensemble. As a corollary, there exist finite size partitions with respect to which the ground state is arbitrarily close to a product state. When the local eigenvalue distribution is discrete, in addition to the lack of an energy gap in the limit, we prove that the ground state has finite size degeneracies. The proofs are simple and constructive. This work excludes the important class of truly translationally invariant Hamiltonians where the local terms are all equal.

Hamiltonian formulation for the Martin-Taylor model

International Nuclear Information System (INIS)

Vasconcelos, D.B.; Viana, R.L.

1993-01-01

Locally stochastic layer and its optimization are studied. In order to accomplish this task, it is employed a Hamiltonian formulation of magnetic field line flow with a subsequent application of Escande-Doveil renormalization method which have been extensively used to obtain accurate estimates of stochasticity thresholds in systems exhibiting Hamiltonian chaos. (author)

Hamiltonian structure of linearly extended Virasoro algebra

International Nuclear Information System (INIS)

Arakelyan, T.A.; Savvidi, G.K.

1991-01-01

The Hamiltonian structure of linearly extended Virasoro algebra which admits free bosonic field representation is described. An example of a non-trivial extension is found. The hierarchy of integrable non-linear equations corresponding to this Hamiltonian structure is constructed. This hierarchy admits the Lax representation by matrix Lax operator of second order

Remarks on Hamiltonian structures in G2-geometry

International Nuclear Information System (INIS)

Cho, Hyunjoo; Salur, Sema; Todd, A. J.

2013-01-01

In this article, we treat G 2 -geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G 2 -structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G 2 -structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry

Dependence of two-neutron momentum densities on total pair momentum

Energy Technology Data Exchange (ETDEWEB)

Carlson, Joseph A [Los Alamos National Laboratory; Wiringa, R B [ANL; Schiavilla, R [JEFFERSON LAB; Pieper, Steven C [ANL

2008-01-01

Two-nucleon momentum distributions are calculated for the ground states of {sup 3}He and {sup 4}He as a function of the nucleons' relative and total momenta. We use variational Monte Carlo wave functions derived from a realistic Hamiltonian with two- and three-nucleon potentials. The momentum distribution of pp pairs is found to be much smaller than that of pn pairs for values of the relative momentum in the range (300--500) MeV/c and vanishing total momentum. Howeer, as the totalmomentum increases to 400 MeV/c, the ratio of pp to pn pairs in this relative momentum range grows and approaches the limit 1/2 for {sup 3}He and 1/4 for {sup 4}He, corresponding to the ratio of pp to pn pairs in these nuclei. This behavior should be easily observable in two-nucleon knock-out processes, such as A(e, e'pN).

QCD string with quarks. 2. Light cone Hamiltonian

International Nuclear Information System (INIS)

Dubin, A.Yu.; Kaidalov, A.B.; Simonov, Yu.A.

1994-01-01

The light-cone Hamiltonian is derived from the general gauge - and Lorentz - invariant expression for the qq-bar Green function. The resulting Hamiltonian contains in a non-additive way contributions from quark and string degrees of freedom

Linear Port-Hamiltonian Systems on Infinite-dimensional Spaces

CERN Document Server

Jacob, Birgit

2012-01-01

This book provides a self-contained introduction to the theory of infinite-dimensional systems theory and its applications to port-Hamiltonian systems. The textbook starts with elementary known results, then progresses smoothly to advanced topics in current research. Many physical systems can be formulated using a Hamiltonian framework, leading to models described by ordinary or partial differential equations. For the purpose of control and for the interconnection of two or more Hamiltonian systems it is essential to take into account this interaction with the environment. This book is the fir

Local modular Hamiltonians from the quantum null energy condition

Science.gov (United States)

Koeller, Jason; Leichenauer, Stefan; Levine, Adam; Shahbazi-Moghaddam, Arvin

2018-03-01

The vacuum modular Hamiltonian K of the Rindler wedge in any relativistic quantum field theory is given by the boost generator. Here we investigate the modular Hamiltonian for more general half-spaces which are bounded by an arbitrary smooth cut of a null plane. We derive a formula for the second derivative of the modular Hamiltonian with respect to the coordinates of the cut which schematically reads K''=Tv v . This formula can be integrated twice to obtain a simple expression for the modular Hamiltonian. The result naturally generalizes the standard expression for the Rindler modular Hamiltonian to this larger class of regions. Our primary assumptions are the quantum null energy condition—an inequality between the second derivative of the von Neumann entropy of a region and the stress tensor—and its saturation in the vacuum for these regions. We discuss the validity of these assumptions in free theories and holographic theories to all orders in 1 /N .

Periodic solutions of asymptotically linear Hamiltonian systems without twist conditions

Energy Technology Data Exchange (ETDEWEB)

Cheng Rong [Coll. of Mathematics and Physics, Nanjing Univ. of Information Science and Tech., Nanjing (China); Dept. of Mathematics, Southeast Univ., Nanjing (China); Zhang Dongfeng [Dept. of Mathematics, Southeast Univ., Nanjing (China)

2010-05-15

In dynamical system theory, especially in many fields of applications from mechanics, Hamiltonian systems play an important role, since many related equations in mechanics can be written in an Hamiltonian form. In this paper, we study the existence of periodic solutions for a class of Hamiltonian systems. By applying the Galerkin approximation method together with a result of critical point theory, we establish the existence of periodic solutions of asymptotically linear Hamiltonian systems without twist conditions. Twist conditions play crucial roles in the study of periodic solutions for asymptotically linear Hamiltonian systems. The lack of twist conditions brings some difficulty to the study. To the authors' knowledge, very little is known about the case, where twist conditions do not hold. (orig.)

On local Hamiltonians and dissipative systems

Energy Technology Data Exchange (ETDEWEB)

Castagnino, M. [CONICET-Institutos de Fisica Rosario y de Astronomia y Fisica del Espacio Casilla de Correos 67, Sucursal 28, 1428, Buenos Aires (Argentina); Gadella, M. [Facultad de Ciencias Exactas, Ingenieria y Agrimensura UNR, Rosario (Argentina) and Departamento de Fisica Teorica, Facultad de Ciencias c. Real de Burgos, s.n., 47011 Valladolid (Spain)]. E-mail: manuelgadella@yahoo.com.ar; Lara, L.P. [Facultad de Ciencias Exactas, Ingenieria y Agrimensura UNR, Rosario (Argentina)

2006-11-15

We study a type of one-dimensional dynamical systems on the corresponding two-dimensional phase space. By using arguments related to the existence of integrating factors for Pfaff equations, we show that some one-dimensional non-Hamiltonian systems like dissipative systems, admit a Hamiltonian description by sectors on the phase plane. This picture is not uniquely defined and is coordinate dependent. A simple example is exhaustively discussed. The method, is not always applicable to systems with higher dimensions.

Isoscalar and isovector pairing in a formalism of quartets

Energy Technology Data Exchange (ETDEWEB)

Sambataro, M., E-mail: michelangelo.sambataro@ct.infn.it [Istituto Nazionale di Fisica Nucleare – Sezione di Catania, Via S. Sofia 64, I-95123 Catania (Italy); Sandulescu, N., E-mail: sandulescu@theory.nipne.ro [National Institute of Physics and Nuclear Engineering, P.O. Box MG-6, Magurele, Bucharest (Romania); Johnson, C.W., E-mail: cjohnson@mail.sdsu.edu [Department of Physics, San Diego State University, 5500 Campanile Drive, San Diego, CA 92182-1233 (United States)

2015-01-05

Isoscalar (T=0, J=1) and isovector (T=1, J=0) pairing correlations in the ground state of self-conjugate nuclei are treated in terms of alpha-like quartets built by two protons and two neutrons coupled to total isospin T=0 and total angular momentum J=0. Quartets are constructed dynamically via an iterative variational procedure and the ground state is represented as a product of such quartets. It is shown that the quartet formalism describes accurately the ground state energies of realistic isovector plus isoscalar pairing Hamiltonians in nuclei with valence particles outside the {sup 16}O, {sup 40}Ca and {sup 100}Sn cores. Within the quartet formalism we analyze the competition between isovector and isoscalar pairing correlations and find that for nuclei with the valence nucleons above the cores {sup 40}Ca and {sup 100}Sn the isovector correlations account for the largest fraction of the total pairing correlations. This is not the case for sd-shell nuclei for which isoscalar correlations prevail. Contrary to many mean-field studies, isovector and isoscalar pairing correlations mix significantly in the quartet approach.

Residual gauge invariance of Hamiltonian lattice gauge theories

International Nuclear Information System (INIS)

Ryang, S.; Saito, T.; Shigemoto, K.

1984-01-01

The time-independent residual gauge invariance of Hamiltonian lattice gauge theories is considered. Eigenvalues and eigenfunctions of the unperturbed Hamiltonian are found in terms of Gegengauer's polynomials. Physical states which satisfy the subsidiary condition corresponding to Gauss' law are constructed systematically. (orig.)

Nested Sampling with Constrained Hamiltonian Monte Carlo

OpenAIRE

Betancourt, M. J.

2010-01-01

Nested sampling is a powerful approach to Bayesian inference ultimately limited by the computationally demanding task of sampling from a heavily constrained probability distribution. An effective algorithm in its own right, Hamiltonian Monte Carlo is readily adapted to efficiently sample from any smooth, constrained distribution. Utilizing this constrained Hamiltonian Monte Carlo, I introduce a general implementation of the nested sampling algorithm.

Intertwined Hamiltonians in two-dimensional curved spaces

International Nuclear Information System (INIS)

Aghababaei Samani, Keivan; Zarei, Mina

2005-01-01

The problem of intertwined Hamiltonians in two-dimensional curved spaces is investigated. Explicit results are obtained for Euclidean plane, Minkowski plane, Poincare half plane (AdS 2 ), de Sitter plane (dS 2 ), sphere, and torus. It is shown that the intertwining operator is related to the Killing vector fields and the isometry group of corresponding space. It is shown that the intertwined potentials are closely connected to the integral curves of the Killing vector fields. Two problems are considered as applications of the formalism presented in the paper. The first one is the problem of Hamiltonians with equispaced energy levels and the second one is the problem of Hamiltonians whose spectrum is like the spectrum of a free particle

Some advances in pairing theory

International Nuclear Information System (INIS)

Rowe, D.J.

2001-01-01

Two advances are reviewed in the application of pairing-force theory in the nuclear shell model. The first exploits a discovery that a wide range of two-nucleon interactions conserve seniority as a good quantum number. As a consequence, the eigenstates of a Hamiltonian with such an interaction belong to irreducible representations of a compact unitary-symplectic group. This makes it possible to extend the simply-solvable models with J=0 pairing forces to a much richer set of models and still obtain states uniquely classified by their seniority and angular momentum quantum numbers. Moreover, many of the low-lying energy levels of such models can be obtained algebraically; in technical terms, the models are in some cases completely solvable and in other cases partially solvable by algebraic methods. The second advance exploits the discovery that, in a coherent state representation, states of good nucleon number can be projected analytically from BCS vacuum and excited quasiparticle states. This makes it possible to perform calculations in a number-projected BCS basis without losing much of the advantage of working of the quasiparticle scheme. (Author)

NLO renormalization in the Hamiltonian truncation

Science.gov (United States)

Elias-Miró, Joan; Rychkov, Slava; Vitale, Lorenzo G.

2017-09-01

Hamiltonian truncation (also known as "truncated spectrum approach") is a numerical technique for solving strongly coupled quantum field theories, in which the full Hilbert space is truncated to a finite-dimensional low-energy subspace. The accuracy of the method is limited only by the available computational resources. The renormalization program improves the accuracy by carefully integrating out the high-energy states, instead of truncating them away. In this paper, we develop the most accurate ever variant of Hamiltonian Truncation, which implements renormalization at the cubic order in the interaction strength. The novel idea is to interpret the renormalization procedure as a result of integrating out exactly a certain class of high-energy "tail states." We demonstrate the power of the method with high-accuracy computations in the strongly coupled two-dimensional quartic scalar theory and benchmark it against other existing approaches. Our work will also be useful for the future goal of extending Hamiltonian truncation to higher spacetime dimensions.

Noncanonical Hamiltonian methods in plasma dynamics

International Nuclear Information System (INIS)

Kaufman, A.N.

1982-01-01

A Hamiltonian approach to plasma dynamics is described. The Poisson bracket of two observables g 1 and g 2 is given by using an antisymmetric tensor J, and must satisfy the Jacobi condition. The J can be obtained by elementary tensor analysis. The evolution in time of an observable g is given in terms of the Poisson bracket and a Hamiltonian H(Z). The guiding-center description of particle motion was presented by Littlejohn. The ponderomotive drift and force, the wave-induced oscillation-center velocity, and the gyrofrequency shift are obtained. The Lie transform yields the wave-induced increment to the gyromomentum. In the coulomb model for a Vlasov system, the dynamical variable is the Vlasov distribution f(z). The Hamiltonian functional and the Poisson bracket are obtained. The coupling of f(z) to the Maxwell field appears in the Poisson bracket. The evolution equation yields the Vlasov-Maxwell system. (Kato, T.)

Equivalence of Lagrangian and Hamiltonian BRST quantizations

International Nuclear Information System (INIS)

Grigoryan, G.V.; Grigoryan, R.P.; Tyutin, I.V.

1992-01-01

Two approaches to the quantization of gauge theories using BRST symmetry are widely used nowadays: the Lagrangian quantization, developed in (BV-quantization) and Hamiltonian quantization, formulated in (BFV-quantization). For all known examples of field theory (Yang-Mills theory, gravitation etc.) both schemes give equivalent results. However the equivalence of these approaches in general wasn't proved. The main obstacle in comparing of these formulations consists in the fact, that in Hamiltonian approach the number of ghost fields is equal to the number of all first-class constraints, while in the Lagrangian approach the number of ghosts is equal to the number of independent gauge symmetries, which is equal to the number of primary first-class constraints only. This paper is devoted to the proof of the equivalence of Lagrangian and Hamiltonian quantizations for the systems with first-class constraints only. This is achieved by a choice of special gauge in the Hamiltonian approach. It's shown, that after integration over redundant variables on the functional integral we come to effective action which is constructed according to rules for construction of the effective action in Lagrangian quantization scheme

Hamiltonian evolutions of twisted polygons in RPn

International Nuclear Information System (INIS)

Beffa, Gloria Marì; Wang, Jing Ping

2013-01-01

In this paper we find a discrete moving frame and their associated invariants along projective polygons in RP n , and we use them to describe invariant evolutions of projective N-gons. We then apply a reduction process to obtain a natural Hamiltonian structure on the space of projective invariants for polygons, establishing a close relationship between the projective N-gon invariant evolutions and the Hamiltonian evolutions on the invariants of the flow. We prove that any Hamiltonian evolution is induced on invariants by an invariant evolution of N-gons—what we call a projective realization—and both evolutions are connected explicitly in a very simple way. Finally, we provide a completely integrable evolution (the Boussinesq lattice related to the lattice W 3 -algebra), its projective realization in RP 2 and its Hamiltonian pencil. We generalize both structures to n-dimensions and we prove that they are Poisson, defining explicitly the n-dimensional generalization of the planar evolution (a discretization of the W n -algebra). We prove that the generalization is completely integrable, and we also give its projective realization, which turns out to be very simple. (paper)

An algorithm for finding a similar subgraph of all Hamiltonian cycles

Science.gov (United States)

Wafdan, R.; Ihsan, M.; Suhaimi, D.

2018-01-01

This paper discusses an algorithm to find a similar subgraph called findSimSubG algorithm. A similar subgraph is a subgraph with a maximum number of edges, contains no isolated vertex and is contained in every Hamiltonian cycle of a Hamiltonian Graph. The algorithm runs only on Hamiltonian graphs with at least two Hamiltonian cycles. The algorithm works by examining whether the initial subgraph of the first Hamiltonian cycle is a subgraph of comparison graphs. If the initial subgraph is not in comparison graphs, the algorithm will remove edges and vertices of the initial subgraph that are not in comparison graphs. There are two main processes in the algorithm, changing Hamiltonian cycle into a cycle graph and removing edges and vertices of the initial subgraph that are not in comparison graphs. The findSimSubG algorithm can find the similar subgraph without using backtracking method. The similar subgraph cannot be found on certain graphs, such as an n-antiprism graph, complete bipartite graph, complete graph, 2n-crossed prism graph, n-crown graph, n-möbius ladder, prism graph, and wheel graph. The complexity of this algorithm is O(m|V|), where m is the number of Hamiltonian cycles and |V| is the number of vertices of a Hamiltonian graph.

Hamiltonian constraint in polymer parametrized field theory

International Nuclear Information System (INIS)

Laddha, Alok; Varadarajan, Madhavan

2011-01-01

Recently, a generally covariant reformulation of two-dimensional flat spacetime free scalar field theory known as parametrized field theory was quantized using loop quantum gravity (LQG) type ''polymer'' representations. Physical states were constructed, without intermediate regularization structures, by averaging over the group of gauge transformations generated by the constraints, the constraint algebra being a Lie algebra. We consider classically equivalent combinations of these constraints corresponding to a diffeomorphism and a Hamiltonian constraint, which, as in gravity, define a Dirac algebra. Our treatment of the quantum constraints parallels that of LQG and obtains the following results, expected to be of use in the construction of the quantum dynamics of LQG: (i) the (triangulated) Hamiltonian constraint acts only on vertices, its construction involves some of the same ambiguities as in LQG and its action on diffeomorphism invariant states admits a continuum limit, (ii) if the regulating holonomies are in representations tailored to the edge labels of the state, all previously obtained physical states lie in the kernel of the Hamiltonian constraint, (iii) the commutator of two (density weight 1) Hamiltonian constraints as well as the operator correspondent of their classical Poisson bracket converge to zero in the continuum limit defined by diffeomorphism invariant states, and vanish on the Lewandowski-Marolf habitat, (iv) the rescaled density 2 Hamiltonian constraints and their commutator are ill-defined on the Lewandowski-Marolf habitat despite the well-definedness of the operator correspondent of their classical Poisson bracket there, (v) there is a new habitat which supports a nontrivial representation of the Poisson-Lie algebra of density 2 constraints.

Snyder noncommutativity and pseudo-Hermitian Hamiltonians from a Jordanian twist

International Nuclear Information System (INIS)

Castro, P.G.; Kullock, R.; Toppan, F.

2011-01-01

Nonrelativistic quantum mechanics and conformal quantum mechanics are de- formed through a Jordanian twist. The deformed space coordinates satisfy the Snyder noncommutativity. The resulting deformed Hamiltonians are pseudo-Hermitian Hamiltonians of the type discussed by Mostafazadeh. The quantization scheme makes use of the so-called 'unfolded formalism' discussed in previous works. A Hopf algebra structure, compatible with the physical interpretation of the coproduct, is introduced for the Universal Enveloping Algebra of a suitably chosen dynamical Lie algebra (the Hamiltonian is contained among its generators). The multi-particle sector, uniquely determined by the deformed 2-particle Hamiltonian, is composed of bosonic particles. (author)

Non-stoquastic Hamiltonians in quantum annealing via geometric phases

Science.gov (United States)

Vinci, Walter; Lidar, Daniel A.

2017-09-01

We argue that a complete description of quantum annealing implemented with continuous variables must take into account the non-adiabatic Aharonov-Anandan geometric phase that arises when the system Hamiltonian changes during the anneal. We show that this geometric effect leads to the appearance of non-stoquasticity in the effective quantum Ising Hamiltonians that are typically used to describe quantum annealing with flux qubits. We explicitly demonstrate the effect of this geometric non-stoquasticity when quantum annealing is performed with a system of one and two coupled flux qubits. The realization of non-stoquastic Hamiltonians has important implications from a computational complexity perspective, since it is believed that in many cases quantum annealing with stoquastic Hamiltonians can be efficiently simulated via classical algorithms such as Quantum Monte Carlo. It is well known that the direct implementation of non-stoquastic Hamiltonians with flux qubits is particularly challenging. Our results suggest an alternative path for the implementation of non-stoquasticity via geometric phases that can be exploited for computational purposes.

The Artificial Hamiltonian, First Integrals, and Closed-Form Solutions of Dynamical Systems for Epidemics

Science.gov (United States)

Naz, Rehana; Naeem, Imran

2018-03-01

The non-standard Hamiltonian system, also referred to as a partial Hamiltonian system in the literature, of the form {\\dot q^i} = {partial H}/{partial {p_i}},\\dot p^i = - {partial H}/{partial {q_i}} + {Γ ^i}(t,{q^i},{p_i}) appears widely in economics, physics, mechanics, and other fields. The non-standard (partial) Hamiltonian systems arise from physical Hamiltonian structures as well as from artificial Hamiltonian structures. We introduce the term `artificial Hamiltonian' for the Hamiltonian of a model having no physical structure. We provide here explicitly the notion of an artificial Hamiltonian for dynamical systems of ordinary differential equations (ODEs). Also, we show that every system of second-order ODEs can be expressed as a non-standard (partial) Hamiltonian system of first-order ODEs by introducing an artificial Hamiltonian. This notion of an artificial Hamiltonian gives a new way to solve dynamical systems of first-order ODEs and systems of second-order ODEs that can be expressed as a non-standard (partial) Hamiltonian system by using the known techniques applicable to the non-standard Hamiltonian systems. We employ the proposed notion to solve dynamical systems of first-order ODEs arising in epidemics.

Modelling chaotic Hamiltonian systems as a Markov Chain ...

African Journals Online (AJOL)

The behaviour of chaotic Hamiltonian system has been characterised qualitatively in recent times by its appearance on the Poincaré section and quantitatively by the Lyapunov exponent. Studying the dynamics of the two chaotic Hamiltonian systems: the Henon-Heiles system and non-linearly coupled oscillators as their ...

Non-self-adjoint hamiltonians defined by Riesz bases

Energy Technology Data Exchange (ETDEWEB)

Bagarello, F., E-mail: fabio.bagarello@unipa.it [Dipartimento di Energia, Ingegneria dell' Informazione e Modelli Matematici, Facoltà di Ingegneria, Università di Palermo, I-90128 Palermo, Italy and INFN, Università di Torino, Torino (Italy); Inoue, A., E-mail: a-inoue@fukuoka-u.ac.jp [Department of Applied Mathematics, Fukuoka University, Fukuoka 814-0180 (Japan); Trapani, C., E-mail: camillo.trapani@unipa.it [Dipartimento di Matematica e Informatica, Università di Palermo, I-90123 Palermo (Italy)

2014-03-15

We discuss some features of non-self-adjoint Hamiltonians with real discrete simple spectrum under the assumption that the eigenvectors form a Riesz basis of Hilbert space. Among other things, we give conditions under which these Hamiltonians can be factorized in terms of generalized lowering and raising operators.

Classical and quantum mechanics of complex Hamiltonian systems ...

Indian Academy of Sciences (India)

Vol. 73, No. 2. — journal of. August 2009 physics pp. 287–297. Classical and quantum mechanics of complex. Hamiltonian systems: An extended complex phase space ... 1Department of Physics, Ramjas College (University Enclave), University of Delhi,. Delhi 110 ... 1.1 Motivation behind the study of complex Hamiltonians.

Effects of noninstantaneous nonlinear processes on photon-pair generation by spontaneous four-wave mixing

DEFF Research Database (Denmark)

Koefoed, Jacob Gade; Christensen, Jesper Bjerge; Rottwitt, Karsten

2017-01-01

We present a general model, based on a Hamiltonian approach, for the joint quantum state of photon pairs generated through pulsed spontaneous four-wave mixing, including nonlinear phase modulation and a finite material response time. For the case of a silica fiber, it is found that the pair......-production rate depends weakly on the waveguide temperature, due to higher-order Raman scattering events, and more strongly on pump-pair frequency detuning. From the analytical model, a numerical scheme is derived, based on the well-known split-step method. This scheme allows computation of joint states where......-dependent change in quantum-mechanical purity may be observed in silica. This shows that Raman scattering not only introduces noise, but can also drastically change the spectral correlations in photon pairs when pumped with short pulses....

IBM parameters derived from realistic shell-model Hamiltonian via Hn-cooling method

International Nuclear Information System (INIS)

Nakada, Hitoshi

1997-01-01

There is a certain influence of non-collective degrees-of-freedom even in lowest-lying states of medium-heavy nuclei. This influence seems to be significant for some of the IBM parameters. In order to take it into account, several renormalization approaches have been applied. It has been shown in the previous studies that the influence of the G-pairs is important, but does not fully account for the fitted values. The influence of the non-collective components may be more serious when we take a realistic effective nucleonic interaction. To incorporate this influence into the IBM parameters, we employ the recently developed H n -cooling method. This method is applied to renormalize the wave functions of the states consisting of the SD-pairs, for the Cr-Fe nuclei. On this ground, the IBM Hamiltonian and transition operators are derived from corresponding realistic shell-model operators, for the Cr-Fe nuclei. Together with some features of the realistic interaction, the effects of the non-SD degrees-of-freedom are presented. (author)

The hamiltonian index of a graph and its branch-bonds

NARCIS (Netherlands)

Xiong, Liming; Broersma, Haitze J.; Li, Xueliang; Li, Xueliang; Li, MingChu

2004-01-01

Let G be an undirected and loopless finite graph that is not a path. The smallest integer m such that the iterated line graph Lm(G) is hamiltonian is called the hamiltonian index of G, denoted by h(G). A reduction method to determine the hamiltonian index of a graph G with h(G) ≤ 2 is given here. We

15th International Conference on Non-Hermitian Hamiltonians in Quantum Physics

CERN Document Server

Passante, Roberto; Trapani, Camillo

2016-01-01

This book presents the Proceedings of the 15th International Conference on Non-Hermitian Hamiltonians in Quantum Physics, held in Palermo, Italy, from 18 to 23 May 2015. Non-Hermitian operators, and non-Hermitian Hamiltonians in particular, have recently received considerable attention from both the mathematics and physics communities. There has been a growing interest in non-Hermitian Hamiltonians in quantum physics since the discovery that PT-symmetric Hamiltonians can have a real spectrum and thus a physical relevance. The main subjects considered in this book include: PT-symmetry in quantum physics, PT-optics, Spectral singularities and spectral techniques, Indefinite-metric theories, Open quantum systems, Krein space methods, and Biorthogonal systems and applications. The book also provides a summary of recent advances in pseudo-Hermitian Hamiltonians and PT-symmetric Hamiltonians, as well as their applications in quantum physics and in the theory of open quantum systems.

Hamiltonian reduction and supersymmetric mechanics with Dirac monopole

International Nuclear Information System (INIS)

Bellucci, Stefano; Nersessian, Armen; Yeranyan, Armen

2006-01-01

We apply the technique of Hamiltonian reduction for the construction of three-dimensional N=4 supersymmetric mechanics specified by the presence of a Dirac monopole. For this purpose we take the conventional N=4 supersymmetric mechanics on the four-dimensional conformally-flat spaces and perform its Hamiltonian reduction to three-dimensional system. We formulate the final system in the canonical coordinates, and present, in these terms, the explicit expressions of the Hamiltonian and supercharges. We show that, besides a magnetic monopole field, the resulting system is specified by the presence of a spin-orbit coupling term. A comparision with previous work is also carried out

New Hamiltonian constraint operator for loop quantum gravity

Energy Technology Data Exchange (ETDEWEB)

Yang, Jinsong, E-mail: yangksong@gmail.com [Department of Physics, Guizhou university, Guiyang 550025 (China); Institute of Physics, Academia Sinica, Taiwan (China); Ma, Yongge, E-mail: mayg@bnu.edu.cn [Department of Physics, Beijing Normal University, Beijing 100875 (China)

2015-12-17

A new symmetric Hamiltonian constraint operator is proposed for loop quantum gravity, which is well defined in the Hilbert space of diffeomorphism invariant states up to non-planar vertices with valence higher than three. It inherits the advantage of the original regularization method to create new vertices to the spin networks. The quantum algebra of this Hamiltonian is anomaly-free on shell, and there is less ambiguity in its construction in comparison with the original method. The regularization procedure for this Hamiltonian constraint operator can also be applied to the symmetric model of loop quantum cosmology, which leads to a new quantum dynamics of the cosmological model.

New Hamiltonian constraint operator for loop quantum gravity

Directory of Open Access Journals (Sweden)

Jinsong Yang

2015-12-01

Full Text Available A new symmetric Hamiltonian constraint operator is proposed for loop quantum gravity, which is well defined in the Hilbert space of diffeomorphism invariant states up to non-planar vertices with valence higher than three. It inherits the advantage of the original regularization method to create new vertices to the spin networks. The quantum algebra of this Hamiltonian is anomaly-free on shell, and there is less ambiguity in its construction in comparison with the original method. The regularization procedure for this Hamiltonian constraint operator can also be applied to the symmetric model of loop quantum cosmology, which leads to a new quantum dynamics of the cosmological model.

The Hamiltonian structure of general relativistic perfect fluids

International Nuclear Information System (INIS)

Bao, D.; Houston Univ., TX; Marsden, J.; Walton, R.

1985-01-01

We show that the evolution equations for a perfect fluid coupled to general relativity in a general lapse and shift, are Hamiltonian relative to a certain Poisson structure. For the fluid variables, a Lie-Poisson structure associated to the dual of a semi-direct product Lie algebra is used, while the bracket for the gravitational variables has the usual canonical symplectic structure. The evolution is governed by a Hamiltonian which is equivalent to that obtained from a canonical analysis. The relationship of our Hamiltonian structure with other approaches in the literature, such as Clebsch potentials, Lagrangian to Eulerian transformations, and its use in clarifying linearization stability, are discussed. (orig.)

An effective Hamiltonian approach to quantum random walk

Indian Academy of Sciences (India)

2017-02-09

Feb 9, 2017 ... Abstract. In this article we present an effective Hamiltonian approach for discrete time quantum random walk. A form of the Hamiltonian for one-dimensional quantum walk has been prescribed, utilizing the fact that Hamil- tonians are generators of time translations. Then an attempt has been made to ...

Non-isospectrality of the generalized Swanson Hamiltonian and harmonic oscillator

Energy Technology Data Exchange (ETDEWEB)

Midya, Bikashkali; Dube, P P; Roychoudhury, Rajkumar, E-mail: bikash.midya@gmail.com, E-mail: ppdube1@gmail.com, E-mail: raj@isical.ac.in [Physics and Applied Mathematics Unit, Indian Statistical Institute, Kolkata 700108 (India)

2011-02-11

The generalized Swanson Hamiltonian H{sub GS}=w(a-tilde a-tilde{sup {dagger}}+1/2)+{alpha}{alpha}-tilde{sup 2}+{beta}a-tilde{sup {dagger}}{sup 2} with a-tilde = A(x) d/dx + B(x) can be transformed into an equivalent Hermitian Hamiltonian with the help of a similarity transformation. It is shown that the equivalent Hermitian Hamiltonian can be further transformed into the harmonic oscillator Hamiltonian so long as [a-ilde,a-tilde{sup {dagger}}]=constant. However, the main objective of this communication is to show that though the commutator of a-tilde and a-tilde{sup {dagger}} is constant, the generalized Swanson Hamiltonian is not necessarily isospectral to the harmonic oscillator. The reason for this anomaly is discussed in the framework of position-dependent mass models by choosing A(x) as the inverse square root of the mass function. (fast track communication)

Hamiltonian-Driven Adaptive Dynamic Programming for Continuous Nonlinear Dynamical Systems.

Science.gov (United States)

Yang, Yongliang; Wunsch, Donald; Yin, Yixin

2017-08-01

This paper presents a Hamiltonian-driven framework of adaptive dynamic programming (ADP) for continuous time nonlinear systems, which consists of evaluation of an admissible control, comparison between two different admissible policies with respect to the corresponding the performance function, and the performance improvement of an admissible control. It is showed that the Hamiltonian can serve as the temporal difference for continuous-time systems. In the Hamiltonian-driven ADP, the critic network is trained to output the value gradient. Then, the inner product between the critic and the system dynamics produces the value derivative. Under some conditions, the minimization of the Hamiltonian functional is equivalent to the value function approximation. An iterative algorithm starting from an arbitrary admissible control is presented for the optimal control approximation with its convergence proof. The implementation is accomplished by a neural network approximation. Two simulation studies demonstrate the effectiveness of Hamiltonian-driven ADP.

Snyder noncommutativity and pseudo-Hermitian Hamiltonians from a Jordanian twist

Energy Technology Data Exchange (ETDEWEB)

Castro, P.G., E-mail: pgcastro@cbpf.b [Universidade Federal de Juiz de Fora (DM/ICE/UFJF), Juiz de Fora, MG (Brazil). Inst. de Ciencias Exatas. Dept. de Matematica; Kullock, R.; Toppan, F., E-mail: ricardokl@cbpf.b, E-mail: toppan@cbpf.b [Centro Brasileiro de Pesquisas Fisicas (TEO/CBPF), Rio de Janeiro, RJ (Brazil). Coordenacao de Fisica Teorica

2011-07-01

Nonrelativistic quantum mechanics and conformal quantum mechanics are de- formed through a Jordanian twist. The deformed space coordinates satisfy the Snyder noncommutativity. The resulting deformed Hamiltonians are pseudo-Hermitian Hamiltonians of the type discussed by Mostafazadeh. The quantization scheme makes use of the so-called 'unfolded formalism' discussed in previous works. A Hopf algebra structure, compatible with the physical interpretation of the coproduct, is introduced for the Universal Enveloping Algebra of a suitably chosen dynamical Lie algebra (the Hamiltonian is contained among its generators). The multi-particle sector, uniquely determined by the deformed 2-particle Hamiltonian, is composed of bosonic particles. (author)

Problem on eigenfunctions and eigenvalues for effective Hamiltonians in pair channels of four-particle systems

International Nuclear Information System (INIS)

Gurbanovich, N.S.; Zelenskaya, I.N.

1976-01-01

The solution for eigenfunction and eigenvalue for effective Hamiltonians anti Hsub(p) in two-particle channels corresponding to division of four particles into groups (3.1) and (2.2) is very essential in the four-body problem as applied to nuclear reactions. The interaction of anti√sub(p) in each channel may be written in the form of an integral operator which takes account of the structure of a target nucleus or of an incident particle and satisfying the integral equation. While assuming the two-particle potentials to be central, it is possible to expand the effective interactions anti√sub(p) in partial waves and write the radial equation for anti Hsub(p). In the approximation on a mass shell the radial equations for the eigenfunctions of Hsub(p) are reduced to an algebraic equations system. The coefficients of the latter are expressed through the Fourier images for products of wave functions of bound clusters and the two-particle central potential which are localized in a momentum space

Introduction to thermodynamics of spin models in the Hamiltonian limit

Energy Technology Data Exchange (ETDEWEB)

Berche, Bertrand [Groupe M, Laboratoire de Physique des Materiaux, UMR CNRS No 7556, Universite Henri Poincare, Nancy 1, BP 239, F-54506 Vandoeuvre les Nancy, (France); Lopez, Alexander [Instituto Venezolano de Investigaciones CientIficas, Centro de Fisica, Carr. Panamericana, km 11, Altos de Pipe, Aptdo 21827, 1020-A Caracas, (Venezuela)

2006-01-01

A didactic description of the thermodynamic properties of classical spin systems is given in terms of their quantum counterpart in the Hamiltonian limit. Emphasis is on the construction of the relevant Hamiltonian and the calculation of thermal averages is explicitly done in the case of small systems described, in Hamiltonian field theory, by small matrices. The targeted students are those of a graduate statistical physics course.

Hamiltonian dynamics of preferential attachment

International Nuclear Information System (INIS)

Zuev, Konstantin; Papadopoulos, Fragkiskos; Krioukov, Dmitri

2016-01-01

Prediction and control of network dynamics are grand-challenge problems in network science. The lack of understanding of fundamental laws driving the dynamics of networks is among the reasons why many practical problems of great significance remain unsolved for decades. Here we study the dynamics of networks evolving according to preferential attachment (PA), known to approximate well the large-scale growth dynamics of a variety of real networks. We show that this dynamics is Hamiltonian, thus casting the study of complex networks dynamics to the powerful canonical formalism, in which the time evolution of a dynamical system is described by Hamilton’s equations. We derive the explicit form of the Hamiltonian that governs network growth in PA. This Hamiltonian turns out to be nearly identical to graph energy in the configuration model, which shows that the ensemble of random graphs generated by PA is nearly identical to the ensemble of random graphs with scale-free degree distributions. In other words, PA generates nothing but random graphs with power-law degree distribution. The extension of the developed canonical formalism for network analysis to richer geometric network models with non-degenerate groups of symmetries may eventually lead to a system of equations describing network dynamics at small scales. (paper)

Hamiltonian formalisms and symmetries of the Pais–Uhlenbeck oscillator

Directory of Open Access Journals (Sweden)

Krzysztof Andrzejewski

2014-12-01

Full Text Available The study of the symmetry of Pais–Uhlenbeck oscillator initiated in Andrzejewski et al. (2014 [24] is continued with special emphasis put on the Hamiltonian formalism. The symmetry generators within the original Pais and Uhlenbeck Hamiltonian approach as well as the canonical transformation to the Ostrogradski Hamiltonian framework are derived. The resulting algebra of generators appears to be the central extension of the one obtained on the Lagrangian level; in particular, in the case of odd frequencies one obtains the centrally extended l-conformal Newton–Hooke algebra. In this important case the canonical transformation to an alternative Hamiltonian formalism (related to the free higher derivatives theory is constructed. It is shown that all generators can be expressed in terms of the ones for the free theory and the result agrees with that obtained by the orbit method.

The brief time-reversibility of the local Lyapunov exponents for a small chaotic Hamiltonian system

International Nuclear Information System (INIS)

Waldner, Franz; Hoover, William G.; Hoover, Carol G.

2014-01-01

Highlights: •We consider the local Lyapunov spectrum for a four-dimensional Hamilton system. •Its stable periodic motion can be reversed for long times. •In the chaotic motion, time reversal occurs only for a short time. •Perturbations will change this short unstable case into a different stable case. •These observations might relate chaos to the Second Law of Thermodynamics. - Abstract: We consider the local (instantaneous) Lyapunov spectrum for a four-dimensional Hamiltonian system. Its stable periodic motion can be reversed for long times. Its unstable chaotic motion, with two symmetric pairs of exponents, cannot. In the latter case reversal occurs for more than a thousand fourth-order Runge–Kutta time steps, followed by a transition to a new set of paired Lyapunov exponents, unrelated to those seen in the forward time direction. The relation of the observed chaotic dynamics to the Second Law of Thermodynamics is discussed

Multivector field formulation of Hamiltonian field theories: equations and symmetries

Energy Technology Data Exchange (ETDEWEB)

Echeverria-Enriquez, A.; Munoz-Lecanda, M.C.; Roman-Roy, N. [Departamento de Matematica Aplicada y Telematica, Edificio C-3, Campus Norte UPC, Barcelona (Spain)

1999-12-03

We state the intrinsic form of the Hamiltonian equations of first-order classical field theories in three equivalent geometrical ways: using multivector fields, jet fields and connections. Thus, these equations are given in a form similar to that in which the Hamiltonian equations of mechanics are usually given. Then, using multivector fields, we study several aspects of these equations, such as the existence and non-uniqueness of solutions, and the integrability problem. In particular, these problems are analysed for the case of Hamiltonian systems defined in a submanifold of the multimomentum bundle. Furthermore, the existence of first integrals of these Hamiltonian equations is considered, and the relation between Cartan-Noether symmetries and general symmetries of the system is discussed. Noether's theorem is also stated in this context, both the 'classical' version and its generalization to include higher-order Cartan-Noether symmetries. Finally, the equivalence between the Lagrangian and Hamiltonian formalisms is also discussed. (author)

Variational derivation of a time-dependent Hartree-Fock Hamiltonian

International Nuclear Information System (INIS)

Lichtner, P.C.; Griffin, J.J.; Schultheis, H.; Schultheis, R.; Volkov, A.B.

1979-01-01

The variational derivation of the time-dependent Hartree-Fock equation is reviewed. When norm-violating variations are included, a unique time-dependent Hartree-Fock Hamiltonian, which differs from that customarily used in time-dependent Hartree-Fock analyses, is implied. This variationally ''true'' Hartree-Fock Hamiltonian has the same expectation value as the exact Hamiltonian, equal to the average energy of the system. Since this quantity remains constant under time-dependent Hartree-Fock time evolution, we suggest the label ''constant '' for this form of time-dependent Hartree-Fock theory

Hamiltonian formalism of two-dimensional Vlasov kinetic equation.

Science.gov (United States)

Pavlov, Maxim V

2014-12-08

In this paper, the two-dimensional Benney system describing long wave propagation of a finite depth fluid motion and the multi-dimensional Russo-Smereka kinetic equation describing a bubbly flow are considered. The Hamiltonian approach established by J. Gibbons for the one-dimensional Vlasov kinetic equation is extended to a multi-dimensional case. A local Hamiltonian structure associated with the hydrodynamic lattice of moments derived by D. J. Benney is constructed. A relationship between this hydrodynamic lattice of moments and the two-dimensional Vlasov kinetic equation is found. In the two-dimensional case, a Hamiltonian hydrodynamic lattice for the Russo-Smereka kinetic model is constructed. Simple hydrodynamic reductions are presented.

The group of Hamiltonian automorphisms of a star product

OpenAIRE

La Fuente-Gravy, Laurent

2015-01-01

We deform the group of Hamiltonian diffeomorphisms into the group of Hamiltonian automorphisms of a formal star product on a symplectic manifold. We study the geometry of that group and deform the Flux morphism in the framework of deformation quantization.

Port-Hamiltonian approaches to motion generation for mechanical systems

NARCIS (Netherlands)

Sakai, Satoru; Stramigioli, Stefano

This paper gives new motion generation methods for mechanical port-Hamiltonian systems. First, we propose a generation method based on an asymptotic stabilization method without damping assignment. This asymptotic stabilization method preserves the Hamiltonian structure in the closed-loop system

The bi-Hamiltonian structures of the Manin-Radul super KP hierarchy

International Nuclear Information System (INIS)

Panda, S.; Roy, S.

1992-05-01

We consider the ''even-time'' flow of the Manin-Radul supersymmetric KP hierarchy and show that it possesses bi-Hamiltonian structures by deriving two distinct Gelfand-Dikii brackets corresponding to two successive Hamiltonians of the system. A recursion relation involving them is also obtained. We observe that the first Hamiltonian structure defines a supersymmetric Lie algebra since it is a linear algebra among the super fields appearing in the Lax operator whereas the second Hamiltonian structure is a non-linear algebra and so it does not define a Lie algebra. (author). 25 refs

Pairing and low temperature properties of 2 D Fermi-systems with attraction between particles

International Nuclear Information System (INIS)

Gorbar, E.V.; Gusynin, V.P.; Loktev, V.M.

1992-01-01

Proceeding from microscopic model Hamiltonian for the system of Fermi-particles with attraction the effective Lagrangian, admitting the analysis of its superconducting properties at arbitrary fermion concentration, is obtained.Exact solution for gap and chemical potential makes it possible to trace from local pair situation to Cooper pairing. The crucial parameter discriminating between the regions of exotic and normal superconducting behaviour is show to be that of the energy of the bound fermion state, which, however, rapidly disappears with fermion density increasing. The solutions of the equations for the case of finite temperatures are analysed. (author). 42 refs

Hamiltonian description of the ideal fluid

International Nuclear Information System (INIS)

Morrison, P.J.

1998-01-01

The Hamiltonian viewpoint of fluid mechanical systems with few and infinite number of degrees of freedom is described. Rudimentary concepts of finite-degree-of-freedom Hamiltonian dynamics are reviewed, in the context of the passive advection of a scalar or tracer field by a fluid. The notions of integrability, invariant-tori, chaos, overlap criteria, and invariant-tori breakup are described in this context. Preparatory to the introduction of field theories, systems with an infinite number of degrees of freedom, elements of functional calculus and action principles of mechanics are reviewed. The action principle for the ideal compressible fluid is described in terms of Lagrangian or material variables. Hamiltonian systems in terms of noncanonical variables are presented, including several examples of Eulerian or inviscid fluid dynamics. Lie group theory sufficient for the treatment of reduction is reviewed. The reduction from Lagrangian to Eulerian variables is treated along with Clebsch variable decompositions. Stability in the canonical and noncanonical Hamiltonian contexts is described. Sufficient conditions for stability, such as Rayleigh-like criteria, are seen to be only sufficient in the general case because of the existence of negative-energy modes, which are possessed by interesting fluid equilibria. Linearly stable equilibria with negative energy modes are argued to be unstable when nonlinearity or dissipation is added. The energy-Casimir method is discussed and a variant of it that depends upon the notion of dynamical accessibility is described. The energy content of a perturbation about a general fluid equilibrium is calculated using three methods. copyright 1998 The American Physical Society

Multi-symplectic integrators: numerical schemes for Hamiltonian PDEs that conserve symplecticity

Science.gov (United States)

Bridges, Thomas J.; Reich, Sebastian

2001-06-01

The symplectic numerical integration of finite-dimensional Hamiltonian systems is a well established subject and has led to a deeper understanding of existing methods as well as to the development of new very efficient and accurate schemes, e.g., for rigid body, constrained, and molecular dynamics. The numerical integration of infinite-dimensional Hamiltonian systems or Hamiltonian PDEs is much less explored. In this Letter, we suggest a new theoretical framework for generalizing symplectic numerical integrators for ODEs to Hamiltonian PDEs in R2: time plus one space dimension. The central idea is that symplecticity for Hamiltonian PDEs is directional: the symplectic structure of the PDE is decomposed into distinct components representing space and time independently. In this setting PDE integrators can be constructed by concatenating uni-directional ODE symplectic integrators. This suggests a natural definition of multi-symplectic integrator as a discretization that conserves a discrete version of the conservation of symplecticity for Hamiltonian PDEs. We show that this approach leads to a general framework for geometric numerical schemes for Hamiltonian PDEs, which have remarkable energy and momentum conservation properties. Generalizations, including development of higher-order methods, application to the Euler equations in fluid mechanics, application to perturbed systems, and extension to more than one space dimension are also discussed.

Bäcklund transformations and Hamiltonian flows

International Nuclear Information System (INIS)

Zullo, Federico

2013-01-01

In this work we show that, under certain conditions, parametric Bäcklund transformations for a finite dimensional integrable system can be interpreted as solutions to the equations of motion defined by an associated non-autonomous Hamiltonian. The two systems share the same constants of motion. This observation leads to the identification of the Hamiltonian interpolating the iteration of the discrete map defined by the transformations, which indeed in numerical applications can be considered a linear combination of the integrals appearing in the spectral curve of the Lax matrix. An example with the periodic Toda lattice is given. (paper)

Hamiltonian dynamics for complex food webs

Science.gov (United States)

Kozlov, Vladimir; Vakulenko, Sergey; Wennergren, Uno

2016-03-01

We investigate stability and dynamics of large ecological networks by introducing classical methods of dynamical system theory from physics, including Hamiltonian and averaging methods. Our analysis exploits the topological structure of the network, namely the existence of strongly connected nodes (hubs) in the networks. We reveal new relations between topology, interaction structure, and network dynamics. We describe mechanisms of catastrophic phenomena leading to sharp changes of dynamics and hence completely altering the ecosystem. We also show how these phenomena depend on the structure of interaction between species. We can conclude that a Hamiltonian structure of biological interactions leads to stability and large biodiversity.

Dirac-bracket aproach to nearly-geostrophic Hamiltonian balanced models

NARCIS (Netherlands)

Vanneste, J.; Bokhove, Onno

2002-01-01

Dirac’s theory of constrained Hamiltonian systems is applied to derive the Poisson structure of a class of balanced models describing the slow dynamics of geophysical flows. Working with the Poisson structure, instead of the canonical Hamiltonian structure previously considered in this context,

Hamiltonian reduction of SU(2) Yang-Mills field theory

International Nuclear Information System (INIS)

Khvedelidze, A.M.; Pavel, H.-P.

1998-01-01

The unconstrained system equivalent to SU (2) Yang-Mills field theory is obtained in the framework of the generalized Hamiltonian formalism using the method of Hamiltonian reduction. The reduced system is expressed in terms of fields with 'nonrelativistic' spin-0 and spin-2

Structure preserving port-Hamiltonian model reduction of electrical circuits

NARCIS (Netherlands)

Polyuga, R.; Schaft, van der A.J.; Benner, P.; Hinze, M.; Maten, ter E.J.W.

2011-01-01

This paper discusses model reduction of electrical circuits based on a port-Hamiltonian representation. It is shown that by the use of the Kalman decomposition an uncontrollable and/or unobservable port-Hamiltonian system is reduced to a controllable/observable system that inherits the

Hamiltonian boundary term and quasilocal energy flux

International Nuclear Information System (INIS)

Chen, C.-M.; Nester, James M.; Tung, R.-S.

2005-01-01

The Hamiltonian for a gravitating region includes a boundary term which determines not only the quasilocal values but also, via the boundary variation principle, the boundary conditions. Using our covariant Hamiltonian formalism, we found four particular quasilocal energy-momentum boundary term expressions; each corresponds to a physically distinct and geometrically clear boundary condition. Here, from a consideration of the asymptotics, we show how a fundamental Hamiltonian identity naturally leads to the associated quasilocal energy flux expressions. For electromagnetism one of the four is distinguished: the only one which is gauge invariant; it gives the familiar energy density and Poynting flux. For Einstein's general relativity two different boundary condition choices correspond to quasilocal expressions which asymptotically give the ADM energy, the Trautman-Bondi energy and, moreover, an associated energy flux (both outgoing and incoming). Again there is a distinguished expression: the one which is covariant

Comparative study of the requantization of the time-dependent mean field for the dynamics of nuclear pairing

Science.gov (United States)

Ni, Fang; Nakatsukasa, Takashi

2018-04-01

To describe quantal collective phenomena, it is useful to requantize the time-dependent mean-field dynamics. We study the time-dependent Hartree-Fock-Bogoliubov (TDHFB) theory for the two-level pairing Hamiltonian, and compare results of different quantization methods. The one constructing microscopic wave functions, using the TDHFB trajectories fulfilling the Einstein-Brillouin-Keller quantization condition, turns out to be the most accurate. The method is based on the stationary-phase approximation to the path integral. We also examine the performance of the collective model which assumes that the pairing gap parameter is the collective coordinate. The applicability of the collective model is limited for the nuclear pairing with a small number of single-particle levels, because the pairing gap parameter represents only a half of the pairing collective space.

Generalized internal long wave equations: construction, hamiltonian structure and conservation laws

International Nuclear Information System (INIS)

Lebedev, D.R.

1982-01-01

Some aspects of the theory of the internal long-wave equations (ILW) are considered. A general class of the ILW type equations is constructed by means of the Zakharov-Shabat ''dressing'' method. Hamiltonian structure and infinite numbers of conservation laws are introduced. The considered equations are shown to be Hamiltonian in the so-called second Hamiltonian structu

Port Hamiltonian Formulation of Infinite Dimensional Systems I. Modeling

NARCIS (Netherlands)

Macchelli, Alessandro; Schaft, Arjan J. van der; Melchiorri, Claudio

2004-01-01

In this paper, some new results concerning the modeling of distributed parameter systems in port Hamiltonian form are presented. The classical finite dimensional port Hamiltonian formulation of a dynamical system is generalized in order to cope with the distributed parameter and multi-variable case.

Alternative Hamiltonian representation for gravity

International Nuclear Information System (INIS)

Rosas-RodrIguez, R

2007-01-01

By using a Hamiltonian formalism for fields wider than the canonical one, we write the Einstein vacuum field equations in terms of alternative variables. This variables emerge from the Ashtekar's formalism for gravity

Ostrogradski Hamiltonian approach for geodetic brane gravity

International Nuclear Information System (INIS)

Cordero, Ruben; Molgado, Alberto; Rojas, Efrain

2010-01-01

We present an alternative Hamiltonian description of a branelike universe immersed in a flat background spacetime. This model is named geodetic brane gravity. We set up the Regge-Teitelboim model to describe our Universe where such field theory is originally thought as a second order derivative theory. We refer to an Ostrogradski Hamiltonian formalism to prepare the system to its quantization. This approach comprize the manage of both first- and second-class constraints and the counting of degrees of freedom follows accordingly.

The Group of Hamiltonian Automorphisms of a Star Product

Energy Technology Data Exchange (ETDEWEB)

La Fuente-Gravy, Laurent, E-mail: lfuente@ulg.ac.be [Université de Liège, Département de Mathématique (Belgium)

2016-09-15

We deform the group of Hamiltonian diffeomorphisms into a group of Hamiltonian automorphisms, Ham(M,∗), of a formal star product ∗ on a symplectic manifold (M,ω). We study the geometry of that group and deform the Flux morphism in the framework of deformation quantization.

Model reduction of port-Hamiltonian systems as structured systems

NARCIS (Netherlands)

Polyuga, R.V.; Schaft, van der A.J.

2010-01-01

The goal of this work is to demonstrate that a specific projection-based model reduction method, which provides an H2 error bound, turns out to be applicable to port-Hamiltonian systems, preserving the port-Hamiltonian structure for the reduced order model, and, as a consequence, passivity.

The Group of Hamiltonian Automorphisms of a Star Product

International Nuclear Information System (INIS)

La Fuente-Gravy, Laurent

2016-01-01

We deform the group of Hamiltonian diffeomorphisms into a group of Hamiltonian automorphisms, Ham(M,∗), of a formal star product ∗ on a symplectic manifold (M,ω). We study the geometry of that group and deform the Flux morphism in the framework of deformation quantization.

Hamiltonian dynamics

CERN Document Server

Vilasi, Gaetano

2001-01-01

This is both a textbook and a monograph. It is partially based on a two-semester course, held by the author for third-year students in physics and mathematics at the University of Salerno, on analytical mechanics, differential geometry, symplectic manifolds and integrable systems. As a textbook, it provides a systematic and self-consistent formulation of Hamiltonian dynamics both in a rigorous coordinate language and in the modern language of differential geometry. It also presents powerful mathematical methods of theoretical physics, especially in gauge theories and general relativity. As a m

Exact smooth classification of Hamiltonian vector fields on symplectic 2-manifolds

International Nuclear Information System (INIS)

Krouglikov, B.S.

1994-10-01

Complete exact classification of Hamiltonian systems with one degree of freedom and Morse Hamiltonian is carried out. As it is a main part of trajectory classification of integrable Hamiltonian systems with two degrees of freedom, the corresponding generalization is considered. The dual problem of classification of symplectic form together with Morse foliation is carried out as well. (author). 10 refs, 16 figs

A Few Expanding Integrable Models, Hamiltonian Structures and Constrained Flows

International Nuclear Information System (INIS)

Zhang Yufeng

2011-01-01

Two kinds of higher-dimensional Lie algebras and their loop algebras are introduced, for which a few expanding integrable models including the coupling integrable couplings of the Broer-Kaup (BK) hierarchy and the dispersive long wave (DLW) hierarchy as well as the TB hierarchy are obtained. From the reductions of the coupling integrable couplings, the corresponding coupled integrable couplings of the BK equation, the DLW equation, and the TB equation are obtained, respectively. Especially, the coupling integrable coupling of the TB equation reduces to a few integrable couplings of the well-known mKdV equation. The Hamiltonian structures of the coupling integrable couplings of the three kinds of soliton hierarchies are worked out, respectively, by employing the variational identity. Finally, we decompose the BK hierarchy of evolution equations into x-constrained flows and t n -constrained flows whose adjoint representations and the Lax pairs are given. (general)

New Hamiltonian structure of the fractional C-KdV soliton equation hierarchy

International Nuclear Information System (INIS)

Yu Fajun; Zhang Hongqing

2008-01-01

A generalized Hamiltonian structure of the fractional soliton equation hierarchy is presented by using of differential forms and exterior derivatives of fractional orders. Example of the fractional Hamiltonian system of the C-KdV soliton equation hierarchy is constructed, which is a new Hamiltonian structure

Hamiltonian formalism for perfect fluids in general relativity

International Nuclear Information System (INIS)

Demaret, J.; Moncrief, V.

1980-01-01

Schutz's Hamiltonian theory of a relativistic perfect fluid, based on the velocity-potential version of classical perfect fluid hydrodynamics as formulated by Seliger and Whitham, is used to derive, in the framework of the Arnowitt, Deser, and Misner (ADM) method, a general partially reduced Hamiltonian for relativistic systems filled with a perfect fluid. The time coordinate is chosen, as in Lund's treatment of collapsing balls of dust, as minus the only velocity potential different from zero in the case of an irrotational and isentropic fluid. A ''semi-Dirac'' method can be applied to quantize astrophysical and cosmological models in the framework of this partially reduced formalism. If one chooses Taub's adapted comoving coordinate system, it is possible to derive a fully reduced ADM Hamiltonian, which is equal to minus the total baryon number of the fluid, generalizing a result previously obtained by Moncrief in the more particular framework of Taub's variational principle, valid for self-gravitating barotropic relativistic perfect fluids. An unconstrained Hamiltonian density is then explicitly derived for a fluid obeying the equation of state p=(gamma-1)rho (1 < or = γ < or = 2), which can adequately describe the phases of very high density attained in a catastrophic collapse or during the early stages of the Universe. This Hamiltonian density, shown to be equivalent to Moncrief's in the particular case of an isentropic fluid, can be simplified for fluid-filled class-A diagonal Bianchi-type cosmological models and appears as a suitable starting point for the study of the canonical quantization of these models

A Hamiltonian functional for the linearized Einstein vacuum field equations

International Nuclear Information System (INIS)

Rosas-RodrIguez, R

2005-01-01

By considering the Einstein vacuum field equations linearized about the Minkowski metric, the evolution equations for the gauge-invariant quantities characterizing the gravitational field are written in a Hamiltonian form by using a conserved functional as Hamiltonian; this Hamiltonian is not the analog of the energy of the field. A Poisson bracket between functionals of the field, compatible with the constraints satisfied by the field variables, is obtained. The generator of spatial translations associated with such bracket is also obtained

The detectability lemma and its applications to quantum Hamiltonian complexity

International Nuclear Information System (INIS)

Aharonov, Dorit; Arad, Itai; Vazirani, Umesh; Landau, Zeph

2011-01-01

Quantum Hamiltonian complexity, an emerging area at the intersection of condensed matter physics and quantum complexity theory, studies the properties of local Hamiltonians and their ground states. In this paper we focus on a seemingly specialized technical tool, the detectability lemma (DL), introduced in the context of the quantum PCP challenge (Aharonov et al 2009 arXiv:0811.3412), which is a major open question in quantum Hamiltonian complexity. We show that a reformulated version of the lemma is a versatile tool that can be used in place of the celebrated Lieb-Robinson (LR) bound to prove several important results in quantum Hamiltonian complexity. The resulting proofs are much simpler, more combinatorial and provide a plausible path toward tackling some fundamental open questions in Hamiltonian complexity. We provide an alternative simpler proof of the DL that removes a key restriction in the original statement (Aharonov et al 2009 arXiv:0811.3412), making it more suitable for the broader context of quantum Hamiltonian complexity. Specifically, we first use the DL to provide a one-page proof of Hastings' result that the correlations in the ground states of gapped Hamiltonians decay exponentially with distance (Hastings 2004 Phys. Rev. B 69 104431). We then apply the DL to derive a simpler and more intuitive proof of Hastings' seminal one-dimensional (1D) area law (Hastings 2007 J. Stat. Mech. (2007) P8024) (both these proofs are restricted to frustration-free systems). Proving the area law for two and higher dimensions is one of the most important open questions in the field of Hamiltonian complexity, and the combinatorial nature of the DL-based proof holds out hope for a possible generalization. Indeed, soon after the first publication of the methods presented here, they were applied to derive exponential improvements to Hastings' result (Arad et al 2011, Aharonov et al 2011) in the case of frustration-free 1D systems. Finally, we also provide a more general

Effective Hamiltonian within the microscopic unitary nuclear model

International Nuclear Information System (INIS)

Filippov, G.F.; Blokhin, A.L.

1989-01-01

A technique of projecting the microscopic nuclear Hamiltonian on the SU(3)-group enveloping algebra is developed. The approach proposed is based on the effective Hamiltonian restored from the matrix elements between the coherent states of the SU(3) irreducible representations. The technique is displayed for almost magic nuclei within the mixed representation basis, and for arbitrary nuclei within the single representation. 40 refs

Hamilton-Jacobi theorems for regular reducible Hamiltonian systems on a cotangent bundle

Science.gov (United States)

Wang, Hong

2017-09-01

In this paper, some of formulations of Hamilton-Jacobi equations for Hamiltonian system and regular reduced Hamiltonian systems are given. At first, an important lemma is proved, and it is a modification for the corresponding result of Abraham and Marsden (1978), such that we can prove two types of geometric Hamilton-Jacobi theorem for a Hamiltonian system on the cotangent bundle of a configuration manifold, by using the symplectic form and dynamical vector field. Then these results are generalized to the regular reducible Hamiltonian system with symmetry and momentum map, by using the reduced symplectic form and the reduced dynamical vector field. The Hamilton-Jacobi theorems are proved and two types of Hamilton-Jacobi equations, for the regular point reduced Hamiltonian system and the regular orbit reduced Hamiltonian system, are obtained. As an application of the theoretical results, the regular point reducible Hamiltonian system on a Lie group is considered, and two types of Lie-Poisson Hamilton-Jacobi equation for the regular point reduced system are given. In particular, the Type I and Type II of Lie-Poisson Hamilton-Jacobi equations for the regular point reduced rigid body and heavy top systems are shown, respectively.

Alternative Hamiltonian representation for gravity

Energy Technology Data Exchange (ETDEWEB)

Rosas-RodrIguez, R [Instituto de Fisica, Universidad Autonoma de Puebla, Apdo. Postal J-48, 72570, Puebla, Pue. (Mexico)

2007-11-15

By using a Hamiltonian formalism for fields wider than the canonical one, we write the Einstein vacuum field equations in terms of alternative variables. This variables emerge from the Ashtekar's formalism for gravity.

Theory of superconductivity. II. Excited Cooper pairs. Why does sodium remain normal down to 0 K?

International Nuclear Information System (INIS)

Fujita, S.

1992-01-01

Based on a generalized BCS Hamiltonian in which the interaction strengths (V 11 , V 22 , V 12 ) among and between electron (12) and hole (2) Cooper pairs are differentiated, the thermodynamic properties of a type-I superconductor below the critical temperature T c are investigated. An expression for the ground-state energy, W - W 0 , relative to the unperturbed Block system is obtained. The usual BCS formulas are obtained in the limits: (all) V jl = V 0 , N 1 (0) = N 2 (0). Any excitations generated through the BCS interaction Hamiltonian containing V jl must involve Cooper pairs of antiparallel spins and nearly opposite momenta. The nonzero momentum or excited Cooper pairs below T c are shown to have an excitation energy band minimum lower than the quasi-electrons, which were regarded as the elementary excitations in the original BCS theory. The energy gap var-epsilon g (T) defined relative to excited and zero-momentum Copper pairs (when V jl > 0) decreases from var-epsilon g (0) to 0 as the temperature T is raised from 0 to T c . If electrons only are available as in a monovalent metal like sodium (V 12 = 0), the energy constant Δ 1 is finite but the energy gap vanishes identically for all T. In agreement with the BCS theory, the present theory predicts that a pure nonmagnetic metal in any dimensions should have a Cooper-pair ground state whose energy is lower than that of the Bloch ground state. Additionally it predicts that a monovalent metal should remain normal down to 0 K, and that there should be no strictly one-dimensional superconductor

Virtual particle-antiparticle pair formation by a scalar particle bound in an external Coulomb field

International Nuclear Information System (INIS)

Darewych, J.W.; Horbatsch, M.; Lev, B.I.; Shapoval, D.V.

1995-01-01

A Hamiltonian variational Fock-space method is used to describe scalar massive particles in an external Coulomb field with strength f=Zα. The use of an ansatz that includes a three-particle state in addition to a single-particle state built on the field-free vacuum enables one to highlight the role played by particle-antiparticle pair formation. Comparison is made with the Klein-Gordon equation in the Feshbach-Villars representation and it is shown explicitly how the virtual pair contribution corrects an O(f 5 ) deficiency present in the energy spectrum of the naive Schroedinger-type single-particle equation. ((orig.))

Modified Dirac Hamiltonian for efficient quantum mechanical simulations of micron sized devices

International Nuclear Information System (INIS)

Habib, K. M. Masum; Ghosh, Avik W.; Sajjad, Redwan N.

2016-01-01

Representing massless Dirac fermions on a spatial lattice poses a potential challenge known as the Fermion Doubling problem. Addition of a quadratic term to the Dirac Hamiltonian provides a possible way to circumvent this problem. We show that the modified Hamiltonian with the additional term results in a very small Hamiltonian matrix when discretized on a real space square lattice. The resulting Hamiltonian matrix is considerably more efficient for numerical simulations without sacrificing on accuracy and is several orders of magnitude faster than the atomistic tight binding model. Using this Hamiltonian and the non-equilibrium Green's function formalism, we show several transport phenomena in graphene, such as magnetic focusing, chiral tunneling in the ballistic limit, and conductivity in the diffusive limit in micron sized graphene devices. The modified Hamiltonian can be used for any system with massless Dirac fermions such as Topological Insulators, opening up a simulation domain that is not readily accessible otherwise.

Modified Dirac Hamiltonian for efficient quantum mechanical simulations of micron sized devices

Energy Technology Data Exchange (ETDEWEB)

Habib, K. M. Masum, E-mail: masum.habib@virginia.edu; Ghosh, Avik W. [Department of Electrical and Computer Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States); Sajjad, Redwan N. [Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

2016-03-14

Representing massless Dirac fermions on a spatial lattice poses a potential challenge known as the Fermion Doubling problem. Addition of a quadratic term to the Dirac Hamiltonian provides a possible way to circumvent this problem. We show that the modified Hamiltonian with the additional term results in a very small Hamiltonian matrix when discretized on a real space square lattice. The resulting Hamiltonian matrix is considerably more efficient for numerical simulations without sacrificing on accuracy and is several orders of magnitude faster than the atomistic tight binding model. Using this Hamiltonian and the non-equilibrium Green's function formalism, we show several transport phenomena in graphene, such as magnetic focusing, chiral tunneling in the ballistic limit, and conductivity in the diffusive limit in micron sized graphene devices. The modified Hamiltonian can be used for any system with massless Dirac fermions such as Topological Insulators, opening up a simulation domain that is not readily accessible otherwise.

Topological color codes and two-body quantum lattice Hamiltonians

Science.gov (United States)

Kargarian, M.; Bombin, H.; Martin-Delgado, M. A.

2010-02-01

Topological color codes are among the stabilizer codes with remarkable properties from the quantum information perspective. In this paper, we construct a lattice, the so-called ruby lattice, with coordination number 4 governed by a two-body Hamiltonian. In a particular regime of coupling constants, in a strong coupling limit, degenerate perturbation theory implies that the low-energy spectrum of the model can be described by a many-body effective Hamiltonian, which encodes the color code as its ground state subspace. Ground state subspace corresponds to a vortex-free sector. The gauge symmetry Z2×Z2 of the color code could already be realized by identifying three distinct plaquette operators on the ruby lattice. All plaquette operators commute with each other and with the Hamiltonian being integrals of motion. Plaquettes are extended to closed strings or string-net structures. Non-contractible closed strings winding the space commute with Hamiltonian but not always with each other. This gives rise to exact topological degeneracy of the model. A connection to 2-colexes can be established via the coloring of the strings. We discuss it at the non-perturbative level. The particular structure of the two-body Hamiltonian provides a fruitful interpretation in terms of mapping onto bosons coupled to effective spins. We show that high-energy excitations of the model have fermionic statistics. They form three families of high-energy excitations each of one color. Furthermore, we show that they belong to a particular family of topological charges. The emergence of invisible charges is related to the string-net structure of the model. The emerging fermions are coupled to nontrivial gauge fields. We show that for particular 2-colexes, the fermions can see the background fluxes in the ground state. Also, we use the Jordan-Wigner transformation in order to test the integrability of the model via introducing Majorana fermions. The four-valent structure of the lattice prevents the

Observation of Resonant Effects in Ultracold Collisions between Heteronuclear Feshbach Molecules

Science.gov (United States)

Ye, Xin; Wang, Fudong; Zhu, Bing; Guo, Mingyang; Lu, Bo; Wang, Dajun

2016-05-01

Magnetic field dependent dimer-dimer collisional losses are studied with ultracold 23 Na87 Rb Feshbach molecules. By ramping the magnetic field across the 347.8 G inter-species Feshbach resonance and removing residual atoms with a magnetic field gradient, ~ 8000 pure NaRb Feshbach molecules with a temperature below 1 μK are produced. By holding the pure molecule sample in a crossed optical dipole trap and measuring the time-dependent loss curves under different magnetic fields near the Feshbach resonance, the dimer-dimer loss rates with respect to the atomic scattering length a are mapped out. We observe a resonant feature at around a = 600a0 and a rising tail at above a = 1600a0 . This behavior resembles previous theoretical works on homonuclear Feshbach molecule, where resonant effects between dimer-dimer collisions tied to tetramer bound states were predicted. Our work shows the possibility of exploring four-body physics within a heteronuclear system. We are supported by Hong Kong RGC General Research Fund no. CUHK403813.

An infinite-order two-component relativistic Hamiltonian by a simple one-step transformation.

Science.gov (United States)

Ilias, Miroslav; Saue, Trond

2007-02-14

The authors report the implementation of a simple one-step method for obtaining an infinite-order two-component (IOTC) relativistic Hamiltonian using matrix algebra. They apply the IOTC Hamiltonian to calculations of excitation and ionization energies as well as electric and magnetic properties of the radon atom. The results are compared to corresponding calculations using identical basis sets and based on the four-component Dirac-Coulomb Hamiltonian as well as Douglas-Kroll-Hess and zeroth-order regular approximation Hamiltonians, all implemented in the DIRAC program package, thus allowing a comprehensive comparison of relativistic Hamiltonians within the finite basis approximation.

A hierarchy of Liouville integrable discrete Hamiltonian equations

Energy Technology Data Exchange (ETDEWEB)

Xu Xixiang [College of Science, Shandong University of Science and Technology, Qingdao 266510 (China)], E-mail: xixiang_xu@yahoo.com.cn

2008-05-12

Based on a discrete four-by-four matrix spectral problem, a hierarchy of Lax integrable lattice equations with two potentials is derived. Two Hamiltonian forms are constructed for each lattice equation in the resulting hierarchy by means of the discrete variational identity. A strong symmetry operator of the resulting hierarchy is given. Finally, it is shown that the resulting lattice equations are all Liouville integrable discrete Hamiltonian systems.

Families of superintegrable Hamiltonians constructed from exceptional polynomials

International Nuclear Information System (INIS)

Post, Sarah; Tsujimoto, Satoshi; Vinet, Luc

2012-01-01

We introduce a family of exactly-solvable two-dimensional Hamiltonians whose wave functions are given in terms of Laguerre and exceptional Jacobi polynomials. The Hamiltonians contain purely quantum terms which vanish in the classical limit leaving only a previously known family of superintegrable systems. Additional, higher-order integrals of motion are constructed from ladder operators for the considered orthogonal polynomials proving the quantum system to be superintegrable. (paper)

SOLVING THE HAMILTONIAN CYCLE PROBLEM USING SYMBOLIC DETERMINANTS

OpenAIRE

Ejov, V.; Filar, J. A.; Lucas, S. K.; Nelson, J. L.

2006-01-01

In this note we show how the Hamiltonian Cycle problem can be reduced to solving a system of polynomial equations related to the adjacency matrix of a graph. This system of equations can be solved using the method of Gröbner bases, but we also show how a symbolic determinant related to the adjacency matrix can be used to directly decide whether a graph has a Hamiltonian cycle.

Hamiltonian derivation of a gyrofluid model for collisionless magnetic reconnection

International Nuclear Information System (INIS)

Tassi, E

2014-01-01

We consider a simple electromagnetic gyrokinetic model for collisionless plasmas and show that it possesses a Hamiltonian structure. Subsequently, from this model we derive a two-moment gyrofluid model by means of a procedure which guarantees that the resulting gyrofluid model is also Hamiltonian. The first step in the derivation consists of imposing a generic fluid closure in the Poisson bracket of the gyrokinetic model, after expressing such bracket in terms of the gyrofluid moments. The constraint of the Jacobi identity, which every Poisson bracket has to satisfy, selects then what closures can lead to a Hamiltonian gyrofluid system. For the case at hand, it turns out that the only closures (not involving integro/differential operators or an explicit dependence on the spatial coordinates) that lead to a valid Poisson bracket are those for which the second order parallel moment, independently for each species, is proportional to the zero order moment. In particular, if one chooses an isothermal closure based on the equilibrium temperatures and derives accordingly the Hamiltonian of the system from the Hamiltonian of the parent gyrokinetic model, one recovers a known Hamiltonian gyrofluid model for collisionless reconnection. The proposed procedure, in addition to yield a gyrofluid model which automatically conserves the total energy, provides also, through the resulting Poisson bracket, a way to derive further conservation laws of the gyrofluid model, associated with the so called Casimir invariants. We show that a relation exists between Casimir invariants of the gyrofluid model and those of the gyrokinetic parent model. The application of such Hamiltonian derivation procedure to this two-moment gyrofluid model is a first step toward its application to more realistic, higher-order fluid or gyrofluid models for tokamaks. It also extends to the electromagnetic gyrokinetic case, recent applications of the same procedure to Vlasov and drift- kinetic systems

Weak KAM for commuting Hamiltonians

International Nuclear Information System (INIS)

Zavidovique, M

2010-01-01

For two commuting Tonelli Hamiltonians, we recover the commutation of the Lax–Oleinik semi-groups, a result of Barles and Tourin (2001 Indiana Univ. Math. J. 50 1523–44), using a direct geometrical method (Stoke's theorem). We also obtain a 'generalization' of a theorem of Maderna (2002 Bull. Soc. Math. France 130 493–506). More precisely, we prove that if the phase space is the cotangent of a compact manifold then the weak KAM solutions (or viscosity solutions of the critical stationary Hamilton–Jacobi equation) for G and for H are the same. As a corollary we obtain the equality of the Aubry sets and of the Peierls barrier. This is also related to works of Sorrentino (2009 On the Integrability of Tonelli Hamiltonians Preprint) and Bernard (2007 Duke Math. J. 136 401–20)

Hamiltonian dynamics of extended objects

Science.gov (United States)

Capovilla, R.; Guven, J.; Rojas, E.

2004-12-01

We consider relativistic extended objects described by a reparametrization-invariant local action that depends on the extrinsic curvature of the worldvolume swept out by the object as it evolves. We provide a Hamiltonian formulation of the dynamics of such higher derivative models which is motivated by the ADM formulation of general relativity. The canonical momenta are identified by looking at boundary behaviour under small deformations of the action; the relationship between the momentum conjugate to the embedding functions and the conserved momentum density is established. The canonical Hamiltonian is constructed explicitly; the constraints on the phase space, both primary and secondary, are identified and the role they play in the theory is described. The multipliers implementing the primary constraints are identified in terms of the ADM lapse and shift variables and Hamilton's equations are shown to be consistent with the Euler Lagrange equations.

Hamiltonian dynamics of extended objects

International Nuclear Information System (INIS)

Capovilla, R; Guven, J; Rojas, E

2004-01-01

We consider relativistic extended objects described by a reparametrization-invariant local action that depends on the extrinsic curvature of the worldvolume swept out by the object as it evolves. We provide a Hamiltonian formulation of the dynamics of such higher derivative models which is motivated by the ADM formulation of general relativity. The canonical momenta are identified by looking at boundary behaviour under small deformations of the action; the relationship between the momentum conjugate to the embedding functions and the conserved momentum density is established. The canonical Hamiltonian is constructed explicitly; the constraints on the phase space, both primary and secondary, are identified and the role they play in the theory is described. The multipliers implementing the primary constraints are identified in terms of the ADM lapse and shift variables and Hamilton's equations are shown to be consistent with the Euler-Lagrange equations

On the restoration of symmetry in paired Fermion systems

International Nuclear Information System (INIS)

Flocard, H.

1997-01-01

We consider the problem of symmetry restoration as treated by the method of variation after projection (VAP) on good quantum numbers. We show that for compact groups, the convergence of the connected-linked expansion of the VAP kernels over the physically relevant interval of integration of the pairing gauge angle is not guaranteed. We propose instead a method which generates approximations of increasing precision which are periodic with respect to the gauge angle while differing from truncations of the Fourier expansion of the VAP kernels. For the projection on good particle number in paired fermion systems, this new approach is shown to be equivalent to an expansion in powers of the pairing tensor. For the lowest order approximation, an analytical integration over the gauge angle is performed explicitly. It provides the algebraic forms of the single particle Hamiltonian and of the pairing field entering generalized Hartree endash Fock endash Bogoljubov equations. Contrary to most approximations, the validity of the expressions for the energy and mean values of operators thus obtained is not a priori restricted where the fluctuation of the operator associated with the broken symmetry is large. We also derive the first-order correction to the pairing-order parameter. We test the quality of the proposed method on a non-trivial soluble model. copyright 1997 Academic Press, Inc

Geometry of quantal adiabatic evolution driven by a non-Hermitian Hamiltonian

International Nuclear Information System (INIS)

Wu Zhaoyan; Yu Ting; Zhou Hongwei

1994-01-01

It is shown by using a counter example, which is exactly solvable, that the quantal adiabatic theorem does not generally hold for a non-Hermitian driving Hamiltonian, even if it varies extremely slowly. The condition for the quantal adiabatic theorem to hold for non-Hermitian driving Hamiltonians is given. The adiabatic evolutions driven by a non-Hermitian Hamiltonian provide examples of a new geometric structure, that is the vector bundle in which the inner product of two parallelly transported vectors generally changes. A new geometric concept, the attenuation tensor, is naturally introduced to describe the decay or flourish of the open quantum system. It is constructed in terms of the spectral projector of the Hamiltonian. (orig.)

Quadratic hamiltonians and relativistic quantum mechanics

International Nuclear Information System (INIS)

Razumov, A.V.; Solov'ev, V.O.; Taranov, A.Yu.

1981-01-01

For the case of a charged scalar field described by a quadratic hamiltonian the equivalent relativistic quantum mechanics is constructed in one-particle sector. Complete investigation of a charged relativistic particle motion in the Coulomb field is carried out. Subcritical as well as supercritical cases are considered. In the course of investigation of the charged scalar particle in the Coulomb field the diagonalization of the quadratic hamiltonian describing the charged scalar quantized field interaction with the external Coulomb field has taken place. Mathematically this problem is bound to the construction of self-conjugated expansions of the symmetric operator. The construction of such expansion is necessary at any small external field magnitude [ru

Hamiltonian mechanics and divergence-free fields

International Nuclear Information System (INIS)

Boozer, A.H.

1986-08-01

The field lines, or integral curves, of a divergence-free field in three dimensions are shown to be topologically equivalent to the trajectories of a Hamiltonian with two degrees of freedom. The consideration of fields that depend on a parameter allow the construction of a canonical perturbation theory which is valid even if the perturbation is large. If the parametric dependence of the magnetic, or the vorticity field is interpreted as time dependence, evolution equations are obtained which give Kelvin's theorem or the flux conservation theorem for ideal fluids and plasmas. The Hamiltonian methods prove especially useful for study of fields in which the field lines must be known throughout a volume of space

Construction of alternative Hamiltonian structures for field equations

Energy Technology Data Exchange (ETDEWEB)

Herrera, Mauricio [Departamento de Fisica, Facultad de Ciencias Fisicas y Matematicas, Universidad de Chile, Santiago (Chile); Hojman, Sergio A. [Departamento de Fisica, Facultad de Ciencias, Universidad de Chile, Santiago (Chile); Facultad de Educacion, Universidad Nacional Andres Bello, Santiago (Chile); Centro de Recursos Educativos Avanzados, CREA, Santiago (Chile)

2001-08-10

We use symmetry vectors of nonlinear field equations to build alternative Hamiltonian structures. We construct such structures even for equations which are usually believed to be non-Hamiltonian such as heat, Burger and potential Burger equations. We improve on a previous version of the approach using recursion operators to increase the rank of the Poisson bracket matrices. Cole-Hopf and Miura-type transformations allow the mapping of these structures from one equation to another. (author)

Maslov index for Hamiltonian systems

Directory of Open Access Journals (Sweden)

Alessandro Portaluri

2008-01-01

Full Text Available The aim of this article is to give an explicit formula for computing the Maslov index of the fundamental solutions of linear autonomous Hamiltonian systems in terms of the Conley-Zehnder index and the map time one flow.

An extended discrete gradient formula for oscillatory Hamiltonian systems

International Nuclear Information System (INIS)

Liu Kai; Shi Wei; Wu Xinyuan

2013-01-01

In this paper, incorporating the idea of the discrete gradient method into the extended Runge–Kutta–Nyström integrator, we derive and analyze an extended discrete gradient formula for the oscillatory Hamiltonian system with the Hamiltonian H(p,q)= 1/2 p T p+ 1/2 q T Mq+U(q), where q:R→R d represents generalized positions, p:R→R d represents generalized momenta and M is an element of R dxd is a symmetric and positive semi-definite matrix. The solution of this system is a nonlinear oscillator. Basically, many nonlinear oscillatory mechanical systems with a partitioned Hamiltonian function lend themselves to this approach. The extended discrete gradient formula presented in this paper exactly preserves the energy H(p, q). We derive some properties of the new formula. The convergence is analyzed for the implicit schemes based on the discrete gradient formula, and it turns out that the convergence of the implicit schemes based on the extended discrete gradient formula is independent of ‖M‖, which is a significant property for the oscillatory Hamiltonian system. Thus, it transpires that a larger step size can be chosen for the new energy-preserving schemes than that for the traditional discrete gradient methods when applied to the oscillatory Hamiltonian system. Illustrative examples show the competence and efficiency of the new schemes in comparison with the traditional discrete gradient methods in the scientific literature. (paper)

A generalized Tu formula and Hamiltonian structures of fractional AKNS hierarchy

International Nuclear Information System (INIS)

Wu, Guo-cheng; Zhang, Sheng

2011-01-01

In this Letter, a generalized Tu formula is firstly presented to construct Hamiltonian structures of fractional soliton equations. The obtained results can be reduced to the classical Hamiltonian hierarchy of AKNS in ordinary calculus. -- Highlights: → A generalized Tu formula is first established based on the fractional variational theory for non-differentiable functions. → Hamiltonian structures of fractional AKNS hierarchy are obtained. → The classical AKNS hierarchy is just a special case of the fractional hierarchy.

A generalized Tu formula and Hamiltonian structures of fractional AKNS hierarchy

Energy Technology Data Exchange (ETDEWEB)

Wu, Guo-cheng, E-mail: wuguocheng2002@yahoo.com.cn [Key Laboratory of Numerical Simulation of Sichuan Province, Neijiang, Sichuan 641112 (China); College of Mathematics and Information Science, Neijiang Normal University, Neijiang, Sichuan 641112 (China); Zhang, Sheng, E-mail: zhshaeng@yahoo.com.cn [School of Mathematical Sciences, Dalian University of Technology, Dalian 116024 (China)

2011-10-03

In this Letter, a generalized Tu formula is firstly presented to construct Hamiltonian structures of fractional soliton equations. The obtained results can be reduced to the classical Hamiltonian hierarchy of AKNS in ordinary calculus. -- Highlights: → A generalized Tu formula is first established based on the fractional variational theory for non-differentiable functions. → Hamiltonian structures of fractional AKNS hierarchy are obtained. → The classical AKNS hierarchy is just a special case of the fractional hierarchy.

Formulation of Hamiltonian mechanics with even and odd Poisson brackets

International Nuclear Information System (INIS)

Khudaverdyan, O.M.; Nersesyan, A.P.

1987-01-01

A possibility is studied as to constrict the odd Poisson bracket and odd Hamiltonian by the given dynamics in phase superspace - the even Poisson bracket and even Hamiltonian so the transition to the new structure does not change the equations of motion. 9 refs

Orbits and variational principles for conservative Hamiltonian systems

International Nuclear Information System (INIS)

Torres del Castillo, G.F.

1989-01-01

It is shown that for any Hamiltonian system whose Hamiltonian is time-independent the equations that determine the orbits followed by the system, without making reference to time, have the form of Hamilton's equations in a phase space of dimension two units smaller than that of the original phase space. By considering the cases of classical mechanics and of geometrical optics, it is shown that this result amounts, respectively, to Maupertuis' least action principle and to Fermat's principle. (Author)

Hamiltonian dynamics of extended objects

Energy Technology Data Exchange (ETDEWEB)

Capovilla, R [Departamento de FIsica, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo Postal 14-740, 07000 Mexico, DF (Mexico); Guven, J [School of Theoretical Physics, Dublin Institute for Advanced Studies, 10 Burlington Road, Dublin 4 (Ireland); Rojas, E [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, Apdo Postal 70-543, 04510 Mexico, DF (Mexico)

2004-12-07

We consider relativistic extended objects described by a reparametrization-invariant local action that depends on the extrinsic curvature of the worldvolume swept out by the object as it evolves. We provide a Hamiltonian formulation of the dynamics of such higher derivative models which is motivated by the ADM formulation of general relativity. The canonical momenta are identified by looking at boundary behaviour under small deformations of the action; the relationship between the momentum conjugate to the embedding functions and the conserved momentum density is established. The canonical Hamiltonian is constructed explicitly; the constraints on the phase space, both primary and secondary, are identified and the role they play in the theory is described. The multipliers implementing the primary constraints are identified in terms of the ADM lapse and shift variables and Hamilton's equations are shown to be consistent with the Euler-Lagrange equations.

Cluster expansion for ground states of local Hamiltonians

Directory of Open Access Journals (Sweden)

Alvise Bastianello

2016-08-01

Full Text Available A central problem in many-body quantum physics is the determination of the ground state of a thermodynamically large physical system. We construct a cluster expansion for ground states of local Hamiltonians, which naturally incorporates physical requirements inherited by locality as conditions on its cluster amplitudes. Applying a diagrammatic technique we derive the relation of these amplitudes to thermodynamic quantities and local observables. Moreover we derive a set of functional equations that determine the cluster amplitudes for a general Hamiltonian, verify the consistency with perturbation theory and discuss non-perturbative approaches. Lastly we verify the persistence of locality features of the cluster expansion under unitary evolution with a local Hamiltonian and provide applications to out-of-equilibrium problems: a simplified proof of equilibration to the GGE and a cumulant expansion for the statistics of work, for an interacting-to-free quantum quench.

Hamiltonian reductions in plasma physics about intrinsic gyrokinetic

International Nuclear Information System (INIS)

Guillebon de Resnes, L. de

2013-01-01

Gyrokinetic is a key model for plasma micro-turbulence, commonly used for fusion plasmas or small-scale astrophysical turbulence, for instance. The model still suffers from several issues, which could imply to reconsider the equations. This thesis dissertation clarifies three of them. First, one of the coordinates caused questions, both from a physical and from a mathematical point of view; a suitable constrained coordinate is introduced, which removes the issues from the theory and explains the intrinsic structures underlying the questions. Second, the perturbative coordinate transformation for gyrokinetic was computed only at lowest orders; explicit induction relations are obtained to go arbitrary order in the expansion. Third, the introduction of the coupling between the plasma and the electromagnetic field was not completely satisfactory; using the Hamiltonian structure of the dynamics, it is implemented in a more appropriate way, with strong consequences on the gyrokinetic equations, especially about their Hamiltonian structure. In order to address these three main points, several other results are obtained, for instance about the origin of the guiding-center adiabatic invariant, about a very efficient minimal guiding center transformation, or about an intermediate Hamiltonian model between Vlasov-Maxwell and gyrokinetic, where the characteristics include both the slow guiding-center dynamics and the fast gyro-angle dynamics. In addition, various reduction methods are used, introduced or developed, e.g. a Lie-transform of the equations of motion, a lifting method to transfer particle reductions to the corresponding Hamiltonian field dynamics, or a truncation method related both to Dirac's theory of constraints and to a projection onto a Lie-subalgebra. Besides gyrokinetic, this is useful to clarify other Hamiltonian reductions in plasma physics, for instance for incompressible or electrostatic dynamics, for magnetohydrodynamics, or for fluid closures including

Convergence to equilibrium under a random Hamiltonian

Science.gov (United States)

Brandão, Fernando G. S. L.; Ćwikliński, Piotr; Horodecki, Michał; Horodecki, Paweł; Korbicz, Jarosław K.; Mozrzymas, Marek

2012-09-01

We analyze equilibration times of subsystems of a larger system under a random total Hamiltonian, in which the basis of the Hamiltonian is drawn from the Haar measure. We obtain that the time of equilibration is of the order of the inverse of the arithmetic average of the Bohr frequencies. To compute the average over a random basis, we compute the inverse of a matrix of overlaps of operators which permute four systems. We first obtain results on such a matrix for a representation of an arbitrary finite group and then apply it to the particular representation of the permutation group under consideration.

Continuum-time Hamiltonian for the Baxter's model

International Nuclear Information System (INIS)

Libero, V.L.

1983-01-01

The associated Hamiltonian for the symmetric eight-vertex model is obtained by taking the time-continuous limit in an equivalent Ashkin-Teller model. The result is a Heisenberg Hamiltonian with coefficients J sub(x), J sub(y) and J sub(z) identical to those found by Sutherland for choices of the parameters a, b, c and d that bring the model close to the transition. The change in the operators is accomplished explicitly, the relation between the crossover operator for the Ashkin-Teller model and the energy operator for the eight-vertex model being obtained in a transparent form. (Author) [pt

Quantum-circuit model of Hamiltonian search algorithms

International Nuclear Information System (INIS)

Roland, Jeremie; Cerf, Nicolas J.

2003-01-01

We analyze three different quantum search algorithms, namely, the traditional circuit-based Grover's algorithm, its continuous-time analog by Hamiltonian evolution, and the quantum search by local adiabatic evolution. We show that these algorithms are closely related in the sense that they all perform a rotation, at a constant angular velocity, from a uniform superposition of all states to the solution state. This makes it possible to implement the two Hamiltonian-evolution algorithms on a conventional quantum circuit, while keeping the quadratic speedup of Grover's original algorithm. It also clarifies the link between the adiabatic search algorithm and Grover's algorithm

Hamiltonian structure of the integrable coupling of the Jaulent-Miodek hierarchy

International Nuclear Information System (INIS)

Zhang, Yufeng; Fan, Engui

2006-01-01

A scheme for deducing Hamiltonian structures of the higher-dimensional hierarchies of evolution equations is presented which is devoting to obtaining the Hamiltonian structures of integrable coupling of the Jaulent-Miodek hierarchy

Image-based visual servo control using the port-Hamiltonian Approach

NARCIS (Netherlands)

Muñoz Arias, Mauricio; El Hawwary, Mohamed; Scherpen, Jacquelien M.A.

2015-01-01

This work is devoted to an image-based visual servo control strategy for standard mechanical systems in the port-Hamiltonian framework. We utilize a change of variables that transforms the port-Hamiltonian system into one with constant mass-inertia matrix, and we use an interaction matrix that

Phase transitions in the Hubbard Hamiltonian

International Nuclear Information System (INIS)

Chaves, C.M.; Lederer, P.; Gomes, A.A.

1977-05-01

Phase transition in the isotropic non-degenerate Hubbard Hamiltonian within the renormalization group techniques is studied, using the epsilon = 4 - d expansion to first order in epsilon. The functional obtained from the Hubbard Hamiltonian displays full rotation symmetry and describes two coupled fields: a vector spin field, with n components and a non-soft scalar charge field. This coupling is pure imaginary, which has interesting consequences on the critical properties of this coupled field system. The effect of simple constraints imposed on the charge field is considered. The relevance of the coupling between the fields in producing Fisher renormalization of the critical exponents is discussed. The possible singularities introduced in the charge-charge correlation function by the coupling are also discussed

Hamiltonian partial differential equations and applications

CERN Document Server

Nicholls, David; Sulem, Catherine

2015-01-01

This book is a unique selection of work by world-class experts exploring the latest developments in Hamiltonian partial differential equations and their applications. Topics covered within are representative of the field’s wide scope, including KAM and normal form theories, perturbation and variational methods, integrable systems, stability of nonlinear solutions as well as applications to cosmology, fluid mechanics and water waves. The volume contains both surveys and original research papers and gives a concise overview of the above topics, with results ranging from mathematical modeling to rigorous analysis and numerical simulation. It will be of particular interest to graduate students as well as researchers in mathematics and physics, who wish to learn more about the powerful and elegant analytical techniques for Hamiltonian partial differential equations.

Diffusion Monte Carlo approach versus adiabatic computation for local Hamiltonians

Science.gov (United States)

Bringewatt, Jacob; Dorland, William; Jordan, Stephen P.; Mink, Alan

2018-02-01

Most research regarding quantum adiabatic optimization has focused on stoquastic Hamiltonians, whose ground states can be expressed with only real non-negative amplitudes and thus for whom destructive interference is not manifest. This raises the question of whether classical Monte Carlo algorithms can efficiently simulate quantum adiabatic optimization with stoquastic Hamiltonians. Recent results have given counterexamples in which path-integral and diffusion Monte Carlo fail to do so. However, most adiabatic optimization algorithms, such as for solving MAX-k -SAT problems, use k -local Hamiltonians, whereas our previous counterexample for diffusion Monte Carlo involved n -body interactions. Here we present a 6-local counterexample which demonstrates that even for these local Hamiltonians there are cases where diffusion Monte Carlo cannot efficiently simulate quantum adiabatic optimization. Furthermore, we perform empirical testing of diffusion Monte Carlo on a standard well-studied class of permutation-symmetric tunneling problems and similarly find large advantages for quantum optimization over diffusion Monte Carlo.

Path-integral isomorphic Hamiltonian for including nuclear quantum effects in non-adiabatic dynamics

Science.gov (United States)

Tao, Xuecheng; Shushkov, Philip; Miller, Thomas F.

2018-03-01

We describe a path-integral approach for including nuclear quantum effects in non-adiabatic chemical dynamics simulations. For a general physical system with multiple electronic energy levels, a corresponding isomorphic Hamiltonian is introduced such that Boltzmann sampling of the isomorphic Hamiltonian with classical nuclear degrees of freedom yields the exact quantum Boltzmann distribution for the original physical system. In the limit of a single electronic energy level, the isomorphic Hamiltonian reduces to the familiar cases of either ring polymer molecular dynamics (RPMD) or centroid molecular dynamics Hamiltonians, depending on the implementation. An advantage of the isomorphic Hamiltonian is that it can easily be combined with existing mixed quantum-classical dynamics methods, such as surface hopping or Ehrenfest dynamics, to enable the simulation of electronically non-adiabatic processes with nuclear quantum effects. We present numerical applications of the isomorphic Hamiltonian to model two- and three-level systems, with encouraging results that include improvement upon a previously reported combination of RPMD with surface hopping in the deep-tunneling regime.

Resolving the issue of branched Hamiltonian in modified Lanczos-Lovelock gravity

Science.gov (United States)

Ruz, Soumendranath; Mandal, Ranajit; Debnath, Subhra; Sanyal, Abhik Kumar

2016-07-01

The Hamiltonian constraint H_c = N{H} = 0, defines a diffeomorphic structure on spatial manifolds by the lapse function N in general theory of relativity. However, it is not manifest in Lanczos-Lovelock gravity, since the expression for velocity in terms of the momentum is multivalued. Thus the Hamiltonian is a branch function of momentum. Here we propose an extended theory of Lanczos-Lovelock gravity to construct a unique Hamiltonian in its minisuperspace version, which results in manifest diffeomorphic invariance and canonical quantization.

Time and a physical Hamiltonian for quantum gravity.

Science.gov (United States)

Husain, Viqar; Pawłowski, Tomasz

2012-04-06

We present a nonperturbative quantization of general relativity coupled to dust and other matter fields. The dust provides a natural time variable, leading to a physical Hamiltonian with spatial diffeomorphism symmetry. The surprising feature is that the Hamiltonian is not a square root. This property, together with the kinematical structure of loop quantum gravity, provides a complete theory of quantum gravity, and puts applications to cosmology, quantum gravitational collapse, and Hawking radiation within technical reach. © 2012 American Physical Society

Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

Science.gov (United States)

Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

2018-01-01

In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

On the topological entropy of an optical Hamiltonian flow

OpenAIRE

Niche, Cesar J.

2000-01-01

In this article we prove two formulas for the topological entropy of an F-optical Hamiltonian flow induced by a C^{\\infty} Hamiltonian, where F is a Lagrangian distribution. In these formulas, we calculate the topological entropy as the exponential growth rate of the average of the determinant of the differential of the flow, restricted to the Lagrangian distribution or to a proper modification.

Effective Hamiltonian for protected edge states in graphene

International Nuclear Information System (INIS)

Winkler, R.; Deshpande, H.

2017-01-01

Edge states in topological insulators (TIs) disperse symmetrically about one of the time-reversal invariant momenta Λ in the Brillouin zone (BZ) with protected degeneracies at Λ. Commonly TIs are distinguished from trivial insulators by the values of one or multiple topological invariants that require an analysis of the bulk band structure across the BZ. We propose an effective two-band Hamiltonian for the electronic states in graphene based on a Taylor expansion of the tight-binding Hamiltonian about the time-reversal invariant M point at the edge of the BZ. This Hamiltonian provides a faithful description of the protected edge states for both zigzag and armchair ribbons, though the concept of a BZ is not part of such an effective model. In conclusion, we show that the edge states are determined by a band inversion in both reciprocal and real space, which allows one to select Λ for the edge states without affecting the bulk spectrum.

Lagrangian-Hamiltonian unified formalism for autonomous higher order dynamical systems

International Nuclear Information System (INIS)

Prieto-Martinez, Pedro Daniel; Roman-Roy, Narciso

2011-01-01

The Lagrangian-Hamiltonian unified formalism of Skinner and Rusk was originally stated for autonomous dynamical systems in classical mechanics. It has been generalized for non-autonomous first-order mechanical systems, as well as for first-order and higher order field theories. However, a complete generalization to higher order mechanical systems is yet to be described. In this work, after reviewing the natural geometrical setting and the Lagrangian and Hamiltonian formalisms for higher order autonomous mechanical systems, we develop a complete generalization of the Lagrangian-Hamiltonian unified formalism for these kinds of systems, and we use it to analyze some physical models from this new point of view. (paper)

Effective Hamiltonian theory: recent formal results and non-nuclear applications

International Nuclear Information System (INIS)

Brandow, B.H.

1981-01-01

Effective Hamiltonian theory is discussed from the points of view of the unitary transformation method and degenerate perturbation theory. It is shown that the two approaches are identical term by term. The main features of a formulation of the coupled-cluster method for open-shell systems are outlined. Finally, recent applications of the many-body linked-cluster form of degenerate perturbation theory are described: the derivation of effective spin Hamiltonians in magnetic insulator systems, the derivation and calculation ab initio of effective π-electron Hamiltonians for planar conjugated hydrocarbon molecules, and understanding the so-called valence fluctuation phenomenon exhibited by certain rare earth compounds

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Hamiltonian description of bubble dynamics

International Nuclear Information System (INIS)

Maksimov, A. O.

2008-01-01

The dynamics of a nonspherical bubble in a liquid is described within the Hamiltonian formalism. Primary attention is focused on the introduction of the canonical variables into the computational algorithm. The expansion of the Dirichlet-Neumann operator in powers of the displacement of a bubble wall from an equilibrium position is obtained in the explicit form. The first three terms (more specifically, the second-, third-, and fourth-order terms) in the expansion of the Hamiltonian in powers of the canonical variables are determined. These terms describe the spectrum and interaction of three essentially different modes, i.e., monopole oscillations (pulsations), dipole oscillations (translational motions), and surface oscillations. The cubic nonlinearity is analyzed for the problem associated with the generation of Faraday ripples on the wall of a bubble in an acoustic field. The possibility of decay processes occurring in the course of interaction of surface oscillations for the first fifteen (experimentally observed) modes is investigated.

Hamiltonian PDEs and Frobenius manifolds

International Nuclear Information System (INIS)

Dubrovin, Boris A

2008-01-01

In the first part of this paper the theory of Frobenius manifolds is applied to the problem of classification of Hamiltonian systems of partial differential equations depending on a small parameter. Also developed is a deformation theory of integrable hierarchies including the subclass of integrable hierarchies of topological type. Many well-known examples of integrable hierarchies, such as the Korteweg-de Vries, non-linear Schroedinger, Toda, Boussinesq equations, and so on, belong to this subclass that also contains new integrable hierarchies. Some of these new integrable hierarchies may be important for applications. Properties of the solutions to these equations are studied in the second part. Consideration is given to the comparative study of the local properties of perturbed and unperturbed solutions near a point of gradient catastrophe. A Universality Conjecture is formulated describing the various types of critical behaviour of solutions to perturbed Hamiltonian systems near the point of gradient catastrophe of the unperturbed solution.

Hamiltonian PDEs and Frobenius manifolds

Energy Technology Data Exchange (ETDEWEB)

Dubrovin, Boris A [Steklov Mathematical Institute, Russian Academy of Sciences, Moscow (Russian Federation)

2008-12-31

In the first part of this paper the theory of Frobenius manifolds is applied to the problem of classification of Hamiltonian systems of partial differential equations depending on a small parameter. Also developed is a deformation theory of integrable hierarchies including the subclass of integrable hierarchies of topological type. Many well-known examples of integrable hierarchies, such as the Korteweg-de Vries, non-linear Schroedinger, Toda, Boussinesq equations, and so on, belong to this subclass that also contains new integrable hierarchies. Some of these new integrable hierarchies may be important for applications. Properties of the solutions to these equations are studied in the second part. Consideration is given to the comparative study of the local properties of perturbed and unperturbed solutions near a point of gradient catastrophe. A Universality Conjecture is formulated describing the various types of critical behaviour of solutions to perturbed Hamiltonian systems near the point of gradient catastrophe of the unperturbed solution.

A Hamiltonian approach to Thermodynamics

Energy Technology Data Exchange (ETDEWEB)

Baldiotti, M.C., E-mail: baldiotti@uel.br [Departamento de Física, Universidade Estadual de Londrina, 86051-990, Londrina-PR (Brazil); Fresneda, R., E-mail: rodrigo.fresneda@ufabc.edu.br [Universidade Federal do ABC, Av. dos Estados 5001, 09210-580, Santo André-SP (Brazil); Molina, C., E-mail: cmolina@usp.br [Escola de Artes, Ciências e Humanidades, Universidade de São Paulo, Av. Arlindo Bettio 1000, CEP 03828-000, São Paulo-SP (Brazil)

2016-10-15

In the present work we develop a strictly Hamiltonian approach to Thermodynamics. A thermodynamic description based on symplectic geometry is introduced, where all thermodynamic processes can be described within the framework of Analytic Mechanics. Our proposal is constructed on top of a usual symplectic manifold, where phase space is even dimensional and one has well-defined Poisson brackets. The main idea is the introduction of an extended phase space where thermodynamic equations of state are realized as constraints. We are then able to apply the canonical transformation toolkit to thermodynamic problems. Throughout this development, Dirac’s theory of constrained systems is extensively used. To illustrate the formalism, we consider paradigmatic examples, namely, the ideal, van der Waals and Clausius gases. - Highlights: • A strictly Hamiltonian approach to Thermodynamics is proposed. • Dirac’s theory of constrained systems is extensively used. • Thermodynamic equations of state are realized as constraints. • Thermodynamic potentials are related by canonical transformations.

A Hamiltonian approach to Thermodynamics

International Nuclear Information System (INIS)

Baldiotti, M.C.; Fresneda, R.; Molina, C.

2016-01-01

In the present work we develop a strictly Hamiltonian approach to Thermodynamics. A thermodynamic description based on symplectic geometry is introduced, where all thermodynamic processes can be described within the framework of Analytic Mechanics. Our proposal is constructed on top of a usual symplectic manifold, where phase space is even dimensional and one has well-defined Poisson brackets. The main idea is the introduction of an extended phase space where thermodynamic equations of state are realized as constraints. We are then able to apply the canonical transformation toolkit to thermodynamic problems. Throughout this development, Dirac’s theory of constrained systems is extensively used. To illustrate the formalism, we consider paradigmatic examples, namely, the ideal, van der Waals and Clausius gases. - Highlights: • A strictly Hamiltonian approach to Thermodynamics is proposed. • Dirac’s theory of constrained systems is extensively used. • Thermodynamic equations of state are realized as constraints. • Thermodynamic potentials are related by canonical transformations.

Multidimensional supersymmetric quantum mechanics: spurious states for the tensor sector two Hamiltonian.

Science.gov (United States)

Chou, Chia-Chun; Kouri, Donald J

2013-04-25

We show that there exist spurious states for the sector two tensor Hamiltonian in multidimensional supersymmetric quantum mechanics. For one-dimensional supersymmetric quantum mechanics on an infinite domain, the sector one and two Hamiltonians have identical spectra with the exception of the ground state of the sector one. For tensorial multidimensional supersymmetric quantum mechanics, there exist normalizable spurious states for the sector two Hamiltonian with energy equal to the ground state energy of the sector one. These spurious states are annihilated by the adjoint charge operator, and hence, they do not correspond to physical states for the original Hamiltonian. The Hermitian property of the sector two Hamiltonian implies the orthogonality between spurious and physical states. In addition, we develop a method for construction of a specific form of the spurious states for any quantum system and also generate several spurious states for a two-dimensional anharmonic oscillator system and for the hydrogen atom.

Scattering theory of infrared divergent Pauli-Fierz Hamiltonians

CERN Document Server

Derezinski, J

2003-01-01

We consider in this paper the scattering theory of infrared divergent massless Pauli-Fierz Hamiltonians. We show that the CCR representations obtained from the asymptotic field contain so-called {\\em coherent sectors} describing an infinite number of asymptotically free bosons. We formulate some conjectures leading to mathematically well defined notion of {\\em inclusive and non-inclusive scattering cross-sections} for Pauli-Fierz Hamiltonians. Finally we give a general description of the scattering theory of QFT models in the presence of coherent sectors for the asymptotic CCR representations.

Spectral properties of almost-periodic Hamiltonians

International Nuclear Information System (INIS)

Lima, R.

1983-12-01

We give a description of some spectral properties of almost-periodic hamiltonians. We put the stress on some particular points of the proofs of the existence of absolutely continuous or pure point spectrum [fr

Integrable Hamiltonian systems and spectral theory

CERN Document Server

Moser, J

1981-01-01

Classical integrable Hamiltonian systems and isospectral deformations ; geodesics on an ellipsoid and the mechanical system of C. Neumann ; the Schrödinger equation for almost periodic potentials ; finite band potentials ; limit cases, Bargmann potentials.

Compact invariant sets of the Bianchi VIII and Bianchi IX Hamiltonian systems

International Nuclear Information System (INIS)

Starkov, Konstantin E.

2011-01-01

In this Letter we prove that all compact invariant sets of the Bianchi VIII Hamiltonian system are contained in the set described by several simple linear equalities and inequalities. Moreover, we describe invariant domains in which the phase flow of this system has no recurrence property and show that there are no periodic orbits and neither homoclinic, nor heteroclinic orbits contained in the zero level set of its Hamiltonian. Similar results are obtained for the Bianchi IX Hamiltonian system. -- Highlights: → Zero level set of Hamiltonian of Bianchi VIII/IX systems contains no periodic orbits. → Similar conditions for homoclinic/heteroclinic orbits are given. → General nonexistence conditions of compact invariant sets are got.

Compact invariant sets of the Bianchi VIII and Bianchi IX Hamiltonian systems

Energy Technology Data Exchange (ETDEWEB)

Starkov, Konstantin E., E-mail: konst@citedi.mx [CITEDI-IPN, Av. del Parque 1310, Mesa de Otay, Tijuana, BC (Mexico)

2011-08-22

In this Letter we prove that all compact invariant sets of the Bianchi VIII Hamiltonian system are contained in the set described by several simple linear equalities and inequalities. Moreover, we describe invariant domains in which the phase flow of this system has no recurrence property and show that there are no periodic orbits and neither homoclinic, nor heteroclinic orbits contained in the zero level set of its Hamiltonian. Similar results are obtained for the Bianchi IX Hamiltonian system. -- Highlights: → Zero level set of Hamiltonian of Bianchi VIII/IX systems contains no periodic orbits. → Similar conditions for homoclinic/heteroclinic orbits are given. → General nonexistence conditions of compact invariant sets are got.

On time-dependent Hamiltonian realizations of planar and nonplanar systems

Science.gov (United States)

Esen, Oğul; Guha, Partha

2018-04-01

In this paper, we elucidate the key role played by the cosymplectic geometry in the theory of time dependent Hamiltonian systems in 2 D. We generalize the cosymplectic structures to time-dependent Nambu-Poisson Hamiltonian systems and corresponding Jacobi's last multiplier for 3 D systems. We illustrate our constructions with various examples.

Self-adjoint Hamiltonians with a mass jump: General matching conditions

International Nuclear Information System (INIS)

Gadella, M.; Kuru, S.; Negro, J.

2007-01-01

The simplest position-dependent mass Hamiltonian in one dimension, where the mass has the form of a step function with a jump discontinuity at one point, is considered. The most general matching conditions at the jumping point for the solutions of the Schroedinger equation that provide a self-adjoint Hamiltonian are characterized

Instability in Hamiltonian systems

Directory of Open Access Journals (Sweden)

A. Pumarino

2005-11-01

Besides proving the existence of Arnold diffusion for a new family of three degrees of freedom Hamiltonian systems, another goal of this book is not only to show how Arnold-like results can be extended to substantially larger sets of parameters, but also how to obtain effective estimates on the splitting of separatrices size when the frequency of the perturbation belongs to open real sets.

Integrable quadratic classical Hamiltonians on so(4) and so(3, 1)

International Nuclear Information System (INIS)

Sokolov, Vladimir V; Wolf, Thomas

2006-01-01

We investigate a special class of quadratic Hamiltonians on so(4) and so(3, 1) and describe Hamiltonians that have additional polynomial integrals. One of the main results is a new integrable case with an integral of sixth degree

A possible method for non-Hermitian and Non-PT-symmetric Hamiltonian systems.

Directory of Open Access Journals (Sweden)

Jun-Qing Li

Full Text Available A possible method to investigate non-Hermitian Hamiltonians is suggested through finding a Hermitian operator η+ and defining the annihilation and creation operators to be η+ -pseudo-Hermitian adjoint to each other. The operator η+ represents the η+ -pseudo-Hermiticity of Hamiltonians. As an example, a non-Hermitian and non-PT-symmetric Hamiltonian with imaginary linear coordinate and linear momentum terms is constructed and analyzed in detail. The operator η+ is found, based on which, a real spectrum and a positive-definite inner product, together with the probability explanation of wave functions, the orthogonality of eigenstates, and the unitarity of time evolution, are obtained for the non-Hermitian and non-PT-symmetric Hamiltonian. Moreover, this Hamiltonian turns out to be coupled when it is extended to the canonical noncommutative space with noncommutative spatial coordinate operators and noncommutative momentum operators as well. Our method is applicable to the coupled Hamiltonian. Then the first and second order noncommutative corrections of energy levels are calculated, and in particular the reality of energy spectra, the positive-definiteness of inner products, and the related properties (the probability explanation of wave functions, the orthogonality of eigenstates, and the unitarity of time evolution are found not to be altered by the noncommutativity.

Noncanonical Hamiltonian density formulation of hydrodynamics and ideal MHD

International Nuclear Information System (INIS)

Morrison, P.J.; Greene, J.M.

1980-04-01

A new Hamiltonian density formulation of a perfect fluid with or without a magnetic field is presented. Contrary to previous work the dynamical variables are the physical variables, rho, v, B, and s, which form a noncanonical set. A Poisson bracket which satisfies the Jacobi identity is defined. This formulation is transformed to a Hamiltonian system where the dynamical variables are the spatial Fourier coefficients of the fluid variables

Pairing of parafermions of order 2: seniority model

International Nuclear Information System (INIS)

Nelson, Charles A

2004-01-01

As generalizations of the fermion seniority model, four multi-mode Hamiltonians are considered to investigate some of the consequences of the pairing of parafermions of order 2. Two- and four-particle states are explicitly constructed for H A ≡ -GA†A with A† ≡ 1/2 Σ m>0 c† m c† -m and the distinct H C ≡ -GC†C with C† ≡ 1/2 Σ m>0 c† -m c† m , and for the time-reversal invariant H (-) ≡ -G(A† - C†)(A - C) and H (+) ≡ -G(A† + C†)(A + C), which has no analogue in the fermion case. The spectra and degeneracies are compared with those of the usual fermion seniority model

Pairing in the BCS and LN approximations using continuum single particle level density

International Nuclear Information System (INIS)

Id Betan, R.M.; Repetto, C.E.

2017-01-01

Understanding the properties of drip line nuclei requires to take into account the correlations with the continuum spectrum of energy of the system. This paper has the purpose to show that the continuum single particle level density is a convenient way to consider the pairing correlation in the continuum. Isospin mean-field and isospin pairing strength are used to find the Bardeen–Cooper–Schrieffer (BCS) and Lipkin–Nogami (LN) approximate solutions of the pairing Hamiltonian. Several physical properties of the whole chain of the Tin isotope, as gap parameter, Fermi level, binding energy, and one- and two-neutron separation energies, were calculated and compared with other methods and with experimental data when they exist. It is shown that the use of the continuum single particle level density is an economical way to include explicitly the correlations with the continuum spectrum of energy in large scale mass calculation. It is also shown that the computed properties are in good agreement with experimental data and with more sophisticated treatment of the pairing interaction.

Continuous versus discrete structures II -- Discrete Hamiltonian systems and Helmholtz conditions

OpenAIRE

Cresson, Jacky; Pierret, Frédéric

2015-01-01

We define discrete Hamiltonian systems in the framework of discrete embeddings. An explicit comparison with previous attempts is given. We then solve the discrete Helmholtz's inverse problem for the discrete calculus of variation in the Hamiltonian setting. Several applications are discussed.

Super Hamiltonian structure of the even order SKP hierarchy without reduction

International Nuclear Information System (INIS)

Watanabe, Yoshihide

1987-01-01

The super Hamiltonian operator which is different from that of Manin and Radul is derived from the even order SKP hierarchy without reduction and in terms of the operator, the equation in the hierarchy is written in a Hamiltonian form. (orig.)

From GCM energy kernels to Weyl-Wigner Hamiltonians: a particular mapping

International Nuclear Information System (INIS)

Galetti, D.

1984-01-01

A particular mapping is established which directly connects GCM energy kernels to Weyl-Wigner Hamiltonians, under the assumption of gaussian overlap kernel. As an application of this mapping scheme the collective Hamiltonians for some giant resonances are derived. (Author) [pt

A progressive diagonalization scheme for the Rabi Hamiltonian

International Nuclear Information System (INIS)

Pan, Feng; Guan, Xin; Wang, Yin; Draayer, J P

2010-01-01

A diagonalization scheme for the Rabi Hamiltonian, which describes a qubit interacting with a single-mode radiation field via a dipole interaction, is proposed. It is shown that the Rabi Hamiltonian can be solved almost exactly using a progressive scheme that involves a finite set of one variable polynomial equations. The scheme is especially efficient for the lower part of the spectrum. Some low-lying energy levels of the model with several sets of parameters are calculated and compared to those provided by the recently proposed generalized rotating-wave approximation and a full matrix diagonalization.

Divide and conquer approach to quantum Hamiltonian simulation

Science.gov (United States)

Hadfield, Stuart; Papageorgiou, Anargyros

2018-04-01

We show a divide and conquer approach for simulating quantum mechanical systems on quantum computers. We can obtain fast simulation algorithms using Hamiltonian structure. Considering a sum of Hamiltonians we split them into groups, simulate each group separately, and combine the partial results. Simulation is customized to take advantage of the properties of each group, and hence yield refined bounds to the overall simulation cost. We illustrate our results using the electronic structure problem of quantum chemistry, where we obtain significantly improved cost estimates under very mild assumptions.

Hamiltonian cycles in polyhedral maps

Indian Academy of Sciences (India)

We present a necessary and sufficient condition for existence of a contractible, non-separating and non-contractible separating Hamiltonian cycle in the edge graph of polyhedral maps on surfaces.We also present algorithms to construct such cycles whenever it exists where one of them is linear time and another is ...

Lie transforms and their use in Hamiltonian perturbation theory

International Nuclear Information System (INIS)

Cary, J.R.

1978-06-01

A review is presented of the theory of Lie transforms as applied to Hamiltonian systems. We begin by presenting some general background on the Hamiltonian formalism and by introducing the operator notation for canonical transformations. We then derive the general theory of Lie transforms. We derive the formula for the new Hamiltonian when one uses a Lie transform to effect a canonical transformation, and we use Lie transforms to prove a very general version of Noether's theorem, or the symmetry-equals-invariant theorem. Next we use the general Lie transform theory to derive Deprit's perturbation theory. We illustrate this perturbation theory by application to two well-known problems in classical mechanics. Finally we present a chapter on conventions. There are many ways to develop Lie transforms. The last chapter explains the reasons for the choices made here

A current value Hamiltonian Approach for Discrete time Optimal Control Problems arising in Economic Growth

OpenAIRE

Naz, Rehana

2018-01-01

Pontrygin-type maximum principle is extended for the present value Hamiltonian systems and current value Hamiltonian systems of nonlinear difference equations for uniform time step $h$. A new method termed as a discrete time current value Hamiltonian method is established for the construction of first integrals for current value Hamiltonian systems of ordinary difference equations arising in Economic growth theory.

Simple model for deriving sdg interacting boson model Hamiltonians: 150Nd example

Science.gov (United States)

Devi, Y. D.; Kota, V. K. B.

1993-07-01

A simple and yet useful model for deriving sdg interacting boson model (IBM) Hamiltonians is to assume that single-boson energies derive from identical particle (pp and nn) interactions and proton, neutron single-particle energies, and that the two-body matrix elements for bosons derive from pn interaction, with an IBM-2 to IBM-1 projection of the resulting p-n sdg IBM Hamiltonian. The applicability of this model in generating sdg IBM Hamiltonians is demonstrated, using a single-j-shell Otsuka-Arima-Iachello mapping of the quadrupole and hexadecupole operators in proton and neutron spaces separately and constructing a quadrupole-quadrupole plus hexadecupole-hexadecupole Hamiltonian in the analysis of the spectra, B(E2)'s, and E4 strength distribution in the example of 150Nd.

Simple model for deriving sdg interacting boson model Hamiltonians: 150Nd example

International Nuclear Information System (INIS)

Devi, Y.D.; Kota, V.K.B.

1993-01-01

A simple and yet useful model for deriving sdg interacting boson model (IBM) Hamiltonians is to assume that single-boson energies derive from identical particle (pp and nn) interactions and proton, neutron single-particle energies, and that the two-body matrix elements for bosons derive from pn interaction, with an IBM-2 to IBM-1 projection of the resulting p-n sdg IBM Hamiltonian. The applicability of this model in generating sdg IBM Hamiltonians is demonstrated, using a single-j-shell Otsuka-Arima-Iachello mapping of the quadrupole and hexadecupole operators in proton and neutron spaces separately and constructing a quadrupole-quadrupole plus hexadecupole-hexadecupole Hamiltonian in the analysis of the spectra, B(E2)'s, and E4 strength distribution in the example of 150 Nd

Hamiltonian path integrals

International Nuclear Information System (INIS)

Prokhorov, L.V.

1982-01-01

Problems related to consideration of operator nonpermutability in Hamiltonian path integral (HPI) are considered in the review. Integrals are investigated using trajectories in configuration space (nonrelativistic quantum mechanics). Problems related to trajectory integrals in HPI phase space are discussed: the problem of operator nonpermutability consideration (extra terms problem) and corresponding equivalence rules; ambiguity of HPI usual recording; transition to curvilinear coordinates. Problem of quantization of dynamical systems with couplings has been studied. As in the case of canonical transformations, quantization of the systems with couplings of the first kind requires the consideration of extra terms

Large-scale stochasticity in Hamiltonian systems

International Nuclear Information System (INIS)

Escande, D.F.

1982-01-01

Large scale stochasticity (L.S.S.) in Hamiltonian systems is defined on the paradigm Hamiltonian H(v,x,t) =v 2 /2-M cos x-P cos k(x-t) which describes the motion of one particle in two electrostatic waves. A renormalization transformation Tsub(r) is described which acts as a microscope that focusses on a given KAM (Kolmogorov-Arnold-Moser) torus in phase space. Though approximate, Tsub(r) yields the threshold of L.S.S. in H with an error of 5-10%. The universal behaviour of KAM tori is predicted: for instance the scale invariance of KAM tori and the critical exponent of the Lyapunov exponent of Cantori. The Fourier expansion of KAM tori is computed and several conjectures by L. Kadanoff and S. Shenker are proved. Chirikov's standard mapping for stochastic layers is derived in a simpler way and the width of the layers is computed. A simpler renormalization scheme for these layers is defined. A Mathieu equation for describing the stability of a discrete family of cycles is derived. When combined with Tsub(r), it allows to prove the link between KAM tori and nearby cycles, conjectured by J. Greene and, in particular, to compute the mean residue of a torus. The fractal diagrams defined by G. Schmidt are computed. A sketch of a methodology for computing the L.S.S. threshold in any two-degree-of-freedom Hamiltonian system is given. (Auth.)

Redesign of the DFT/MRCI Hamiltonian

Energy Technology Data Exchange (ETDEWEB)

Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M., E-mail: Christel.Marian@hhu.de [Institute of Theoretical and Computational Chemistry, Heinrich-Heine-University Düsseldorf, Universitätsstraße 1, 40225 Düsseldorf (Germany)

2016-01-21

The combined density functional theory and multireference configuration interaction (DFT/MRCI) method of Grimme and Waletzke [J. Chem. Phys. 111, 5645 (1999)] is a well-established semi-empirical quantum chemical method for efficiently computing excited-state properties of organic molecules. As it turns out, the method fails to treat bi-chromophores owing to the strong dependence of the parameters on the excitation class. In this work, we present an alternative form of correcting the matrix elements of a MRCI Hamiltonian which is built from a Kohn-Sham set of orbitals. It is based on the idea of constructing individual energy shifts for each of the state functions of a configuration. The new parameterization is spin-invariant and incorporates less empirism compared to the original formulation. By utilizing damping techniques together with an algorithm of selecting important configurations for treating static electron correlation, the high computational efficiency has been preserved. The robustness of the original and redesigned Hamiltonians has been tested on experimentally known vertical excitation energies of organic molecules yielding similar statistics for the two parameterizations. Besides that, our new formulation is free from artificially low-lying doubly excited states, producing qualitatively correct and consistent results for excimers. The way of modifying matrix elements of the MRCI Hamiltonian presented here shall be considered as default choice when investigating photophysical processes of bi-chromophoric systems such as singlet fission or triplet-triplet upconversion.

A Monte Carlo procedure for Hamiltonians with small nonlocal correction terms

International Nuclear Information System (INIS)

Mack, G.; Pinn, K.

1986-03-01

We consider lattice field theories whose Hamiltonians contain small nonlocal correction terms. We propose to do simulations for an auxiliarly polymer system with field dependent activities. If a nonlocal correction term to the Hamiltonian is small, it need to be evaluated only rarely. (orig.)

Hamiltonian cycle problem and Markov chains

CERN Document Server

Borkar, Vivek S; Filar, Jerzy A; Nguyen, Giang T

2014-01-01

This book summarizes a line of research that maps certain classical problems of discrete mathematics and operations research - such as the Hamiltonian cycle and the Travelling Salesman problems - into convex domains where continuum analysis can be carried out.

Variable Delay in port-Hamiltonian Telemanipulation

NARCIS (Netherlands)

Secchi, C; Stramigioli, Stefano; Fantuzzi, C.

2006-01-01

In several applications involving bilateral telemanipulation, master and slave act at different power scales. In this paper a strategy for passively dealing with variable communication delay in scaled port-Hamiltonian based telemanipulation over packet switched networks is proposed.

Symplectic Integrators to Stochastic Hamiltonian Dynamical Systems Derived from Composition Methods

Directory of Open Access Journals (Sweden)

Tetsuya Misawa

2010-01-01

Full Text Available “Symplectic” schemes for stochastic Hamiltonian dynamical systems are formulated through “composition methods (or operator splitting methods” proposed by Misawa (2001. In the proposed methods, a symplectic map, which is given by the solution of a stochastic Hamiltonian system, is approximated by composition of the stochastic flows derived from simpler Hamiltonian vector fields. The global error orders of the numerical schemes derived from the stochastic composition methods are provided. To examine the superiority of the new schemes, some illustrative numerical simulations on the basis of the proposed schemes are carried out for a stochastic harmonic oscillator system.

RG-Whitham dynamics and complex Hamiltonian systems

Directory of Open Access Journals (Sweden)

A. Gorsky

2015-06-01

Full Text Available Inspired by the Seiberg–Witten exact solution, we consider some aspects of the Hamiltonian dynamics with the complexified phase space focusing at the renormalization group (RG-like Whitham behavior. We show that at the Argyres–Douglas (AD point the number of degrees of freedom in Hamiltonian system effectively reduces and argue that anomalous dimensions at AD point coincide with the Berry indexes in classical mechanics. In the framework of Whitham dynamics AD point turns out to be a fixed point. We demonstrate that recently discovered Dunne–Ünsal relation in quantum mechanics relevant for the exact quantization condition exactly coincides with the Whitham equation of motion in the Ω-deformed theory.

Symplectic and Hamiltonian structures of nonlinear evolution equations

International Nuclear Information System (INIS)

Dorfman, I.Y.

1993-01-01

A Hamiltonian structure on a finite-dimensional manifold can be introduced either by endowing it with a (pre)symplectic structure, or by describing the Poisson bracket with the help of a tensor with two upper indices named the Poisson structure. Under the assumption of nondegeneracy, the Poisson structure is nothing else than the inverse of the symplectic structure. Also in the degenerate case the distinction between the two approaches is almost insignificant, because both presymplectic and Poisson structures split into symplectic structures on leaves of appropriately chosen foliations. Hamiltonian structures that arise in the theory of evolution equations demonstrate something new in this respect: trying to operate in local terms, one is induced to develop both approaches independently. Hamiltonian operators, being the infinite-dimensional counterparts of Poisson structures, were the first to become the subject of investigations. A considerable period of time passed before the papers initiated research in the theory of symplectic operators, being the counterparts of presymplectic structures. In what follows, we focus on the main achievements in this field

Multiple Time-Step Dual-Hamiltonian Hybrid Molecular Dynamics - Monte Carlo Canonical Propagation Algorithm.

Science.gov (United States)

Chen, Yunjie; Kale, Seyit; Weare, Jonathan; Dinner, Aaron R; Roux, Benoît

2016-04-12

A multiple time-step integrator based on a dual Hamiltonian and a hybrid method combining molecular dynamics (MD) and Monte Carlo (MC) is proposed to sample systems in the canonical ensemble. The Dual Hamiltonian Multiple Time-Step (DHMTS) algorithm is based on two similar Hamiltonians: a computationally expensive one that serves as a reference and a computationally inexpensive one to which the workload is shifted. The central assumption is that the difference between the two Hamiltonians is slowly varying. Earlier work has shown that such dual Hamiltonian multiple time-step schemes effectively precondition nonlinear differential equations for dynamics by reformulating them into a recursive root finding problem that can be solved by propagating a correction term through an internal loop, analogous to RESPA. Of special interest in the present context, a hybrid MD-MC version of the DHMTS algorithm is introduced to enforce detailed balance via a Metropolis acceptance criterion and ensure consistency with the Boltzmann distribution. The Metropolis criterion suppresses the discretization errors normally associated with the propagation according to the computationally inexpensive Hamiltonian, treating the discretization error as an external work. Illustrative tests are carried out to demonstrate the effectiveness of the method.

Classical mechanics Hamiltonian and Lagrangian formalism

CERN Document Server

Deriglazov, Alexei

2016-01-01

This account of the fundamentals of Hamiltonian mechanics also covers related topics such as integral invariants and the Noether theorem. With just the elementary mathematical methods used for exposition, the book is suitable for novices as well as graduates.

Solving a Hamiltonian Path Problem with a bacterial computer

Directory of Open Access Journals (Sweden)

Treece Jessica

2009-07-01

Full Text Available Abstract Background The Hamiltonian Path Problem asks whether there is a route in a directed graph from a beginning node to an ending node, visiting each node exactly once. The Hamiltonian Path Problem is NP complete, achieving surprising computational complexity with modest increases in size. This challenge has inspired researchers to broaden the definition of a computer. DNA computers have been developed that solve NP complete problems. Bacterial computers can be programmed by constructing genetic circuits to execute an algorithm that is responsive to the environment and whose result can be observed. Each bacterium can examine a solution to a mathematical problem and billions of them can explore billions of possible solutions. Bacterial computers can be automated, made responsive to selection, and reproduce themselves so that more processing capacity is applied to problems over time. Results We programmed bacteria with a genetic circuit that enables them to evaluate all possible paths in a directed graph in order to find a Hamiltonian path. We encoded a three node directed graph as DNA segments that were autonomously shuffled randomly inside bacteria by a Hin/hixC recombination system we previously adapted from Salmonella typhimurium for use in Escherichia coli. We represented nodes in the graph as linked halves of two different genes encoding red or green fluorescent proteins. Bacterial populations displayed phenotypes that reflected random ordering of edges in the graph. Individual bacterial clones that found a Hamiltonian path reported their success by fluorescing both red and green, resulting in yellow colonies. We used DNA sequencing to verify that the yellow phenotype resulted from genotypes that represented Hamiltonian path solutions, demonstrating that our bacterial computer functioned as expected. Conclusion We successfully designed, constructed, and tested a bacterial computer capable of finding a Hamiltonian path in a three node

Solving a Hamiltonian Path Problem with a bacterial computer

Science.gov (United States)

Baumgardner, Jordan; Acker, Karen; Adefuye, Oyinade; Crowley, Samuel Thomas; DeLoache, Will; Dickson, James O; Heard, Lane; Martens, Andrew T; Morton, Nickolaus; Ritter, Michelle; Shoecraft, Amber; Treece, Jessica; Unzicker, Matthew; Valencia, Amanda; Waters, Mike; Campbell, A Malcolm; Heyer, Laurie J; Poet, Jeffrey L; Eckdahl, Todd T

2009-01-01

Background The Hamiltonian Path Problem asks whether there is a route in a directed graph from a beginning node to an ending node, visiting each node exactly once. The Hamiltonian Path Problem is NP complete, achieving surprising computational complexity with modest increases in size. This challenge has inspired researchers to broaden the definition of a computer. DNA computers have been developed that solve NP complete problems. Bacterial computers can be programmed by constructing genetic circuits to execute an algorithm that is responsive to the environment and whose result can be observed. Each bacterium can examine a solution to a mathematical problem and billions of them can explore billions of possible solutions. Bacterial computers can be automated, made responsive to selection, and reproduce themselves so that more processing capacity is applied to problems over time. Results We programmed bacteria with a genetic circuit that enables them to evaluate all possible paths in a directed graph in order to find a Hamiltonian path. We encoded a three node directed graph as DNA segments that were autonomously shuffled randomly inside bacteria by a Hin/hixC recombination system we previously adapted from Salmonella typhimurium for use in Escherichia coli. We represented nodes in the graph as linked halves of two different genes encoding red or green fluorescent proteins. Bacterial populations displayed phenotypes that reflected random ordering of edges in the graph. Individual bacterial clones that found a Hamiltonian path reported their success by fluorescing both red and green, resulting in yellow colonies. We used DNA sequencing to verify that the yellow phenotype resulted from genotypes that represented Hamiltonian path solutions, demonstrating that our bacterial computer functioned as expected. Conclusion We successfully designed, constructed, and tested a bacterial computer capable of finding a Hamiltonian path in a three node directed graph. This proof

General formalism of Hamiltonians for realizing a prescribed evolution of a qubit

International Nuclear Information System (INIS)

Tong, D.M.; Chen, J.-L.; Lai, C.H.; Oh, C.H.; Kwek, L.C.

2003-01-01

We investigate the inverse problem concerning the evolution of a qubit system, specifically we consider how one can establish the Hamiltonians that account for the evolution of a qubit along a prescribed path in the projected Hilbert space. For a given path, there are infinite Hamiltonians which can realize the same evolution. A general form of the Hamiltonians is constructed in which one may select the desired one for implementing a prescribed evolution. This scheme can be generalized to higher dimensional systems

Multi-Hamiltonian structure of Lotka-Volterra and quantum Volterra models

International Nuclear Information System (INIS)

Cronstroem, C.; Noga, M.

1995-01-01

We consider evolution equations of the Lotka-Volterra type, and elucidate especially their formulation as canonical Hamiltonian systems. The general conditions under which these equations admit several conserved quantities (multi-Hamiltonians) are analysed. A special case, which is related to the Liouville model on a lattice, is considered in detail, both as a classical and as a quantum system. (orig.)

On the time evolution operator for time-dependent quadratic Hamiltonians

International Nuclear Information System (INIS)

Fernandez, F.M.

1989-01-01

The Schroedinger equation with a time-dependent quadratic Hamiltonian is investigated. The time-evolution operator is written as a product of exponential operators determined by the Heisenberg equations of motion. This product operator is shown to be global in the occupation number representation when the Hamiltonian is Hermitian. The success of some physical applications of the product-form representation is explained

Purely non-local Hamiltonian formalism, Kohno connections and ∨-systems

International Nuclear Information System (INIS)

Arsie, Alessandro; Lorenzoni, Paolo

2014-01-01

In this paper, we extend purely non-local Hamiltonian formalism to a class of Riemannian F-manifolds, without assumptions on the semisimplicity of the product ○ or on the flatness of the connection ∇. In the flat case, we show that the recurrence relations for the principal hierarchy can be re-interpreted using a local and purely non-local Hamiltonian operators and in this case they split into two Lenard-Magri chains, one involving the even terms, the other involving the odd terms. Furthermore, we give an elementary proof that the Kohno property and the ∨-system condition are equivalent under suitable assumptions and we show how to associate a purely non-local Hamiltonian structure to any ∨-system, including degenerate ones

Spontaneous symmetry breaking and neutral stability in the noncanonical Hamiltonian formalism

International Nuclear Information System (INIS)

Morrison, P.J.; Eliezer, S.

1985-10-01

The noncanonical Hamiltonian formalism is based upon a generalization of the Poisson bracket, a particular form of which is possessed by continuous media fields. Associated with this generalization are special constants of motion called Casimirs. These are constants that can be viewed as being built into the phase space, for they are invariant for all Hamiltonians. Casimirs are important because when added to the Hamiltonian they yield an effective Hamiltonian that produces equilibrium states upon variation. The stability of these states can be ascertained by a second variation. Goldstone's theorem, in its usual context, determines zero eigenvalues of the mass matrix for a given vacuum state, the equilibrium with minimum energy. Here, since for fluids and plasmas the vacuum state is uninteresting, we examine symmetry breaking for general equilibria. Broken symmetries imply directions of neutral stability. Two examples are presented: the nonlinear Alfven wave of plasma physics and the Korteweg-de Vries soliton. 46 refs

Hamiltonian formulation of the supermembrane

International Nuclear Information System (INIS)

Bergshoeff, E.; Sezgin, E.; Tanii, Y.

1987-06-01

The Hamiltonian formulation of the supermembrane theory in eleven dimensions is given. The covariant split of the first and second class constraints is exhibited, and their Dirac brackets are computed. Gauge conditions are imposed in such a way that the reparametrizations of the membrane with divergence free 2-vectors are unfixed. (author). 10 refs

Nuclear structure and magnetic moment of the unstable 12B-12N mirror pair

International Nuclear Information System (INIS)

Zheng Yongnan; Zhou Dongmei; Yuan Daqing; Zuo Yi; Fan Ping; Xu Yongjun; Zhu Jiazheng; Wang Zhiqiang; Luo Hailong; Zhang Xizhen; Zhu Shengyun; Mihara, M.; Matsuta, K.; Fukuda, M.; Minamisono, T.; Suzuki, T.

2010-01-01

Magnetic moments of the A=12 unstable mirror pair nuclides 12 B and 12 N have been measured by the β-NMR technique. The experimentally measured magnetic moments are μ( 12 B)=1.00(17)μ N and μ( 12 N)=0.4571(1)μ N . The improved shell model using an SFO Hamiltonian with enhanced spin-isospin monopole proton-neutron interaction and modified single-particle energies is employed to calculate the magnetic moments of 12 B and 12 N. The calculation yields μ( 12 B)=0.929μ N and μ( 12 N)=0.452μ N and has produced a new magic number 6 for the short-lived unstable mirror pair nuclides 12 B and 12 N. (authors)

Hamiltonian formulation of reduced magnetohydrodynamics

International Nuclear Information System (INIS)

Morrison, P.J.; Hazeltine, R.D.

1983-07-01

Reduced magnetohydrodynamics (RMHD) has become a principal tool for understanding nonlinear processes, including disruptions, in tokamak plasmas. Although analytical studies of RMHD turbulence have been useful, the model's impressive ability to simulate tokamak fluid behavior has been revealed primarily by numerical solution. The present work describes a new analytical approach, not restricted to turbulent regimes, based on Hamiltonian field theory. It is shown that the nonlinear (ideal) RMHD system, in both its high-beta and low-beta versions, can be expressed in Hanmiltonian form. Thus a Poisson bracket, [ , ], is constructed such that each RMHD field quantitity, xi/sub i/, evolves according to xi/sub i/ = [xi/sub i/,H], where H is the total field energy. The new formulation makes RMHD accessible to the methodology of Hamiltonian mechanics; it has lead, in particular, to the recognition of new RMHD invariants and even exact, nonlinear RMHD solutions. A canonical version of the Poisson bracket, which requires the introduction of additional fields, leads to a nonlinear variational principle for time-dependent RMHD

Photochemical deposition of NiCoO x thin films from Ni/Co heteronuclear triketonate complexes

International Nuclear Information System (INIS)

Buono-Core, G.E.; Tejos, M.; Cabello, G.; Guzman, N.; Hill, R.H.

2006-01-01

UV light irradiation of thin films of a polyketonate Ni/Co heteronuclear complex, NiCo(DBA) 2 [DBA, dibenzoylacetone)], spin coated on Si(1 0 0) substrates produced NiCoO x mixed oxides as amorphous films. On annealing at 600 deg. C under air, the mixed oxide film decomposed to NiO and CoO as indicated by XRD measurements. The morphology of the as-deposited films was examined by AFM analysis showing a smooth surface with low rms roughness values. The ratio of Ni/Co (1.08) present in the film reflects the stoichiometry in the starting compound within the experimental error, as shown by XPS analysis. The large amount of carbon (20.8%) detected on the surface of the film may be due to the presence of phenyl rings in the precursor complex

Functional integral and effective Hamiltonian t-J-V model of strongly correlated electron system

International Nuclear Information System (INIS)

Belinicher, V.I.; Chertkov, M.V.

1990-09-01

The functional integral representation for the generating functional of t-J-V model is obtained. In the case close to half filling this functional integral representation reduces the conventional Hamiltonian of t-J-V model to the Hamiltonian of the system containing holes and spins 1/2 at each lattice size. This effective Hamiltonian coincides with that one obtained one of the authors by different method. This Hamiltonian and its dynamical variables can be used for description of different magnetic phases of t-J-V model. (author). 16 refs

Necessary conditions for super-integrability of Hamiltonian systems

Energy Technology Data Exchange (ETDEWEB)

Maciejewski, Andrzej J. [Institute of Astronomy, University of Zielona Gora, Podgorna 50, PL-65-246 Zielona Gora (Poland)], E-mail: maciejka@astro.ia.uz.zgora.pl; Przybylska, Maria [Torun Centre for Astronomy, N. Copernicus University, Gagarina 11, PL-87-100 Torun (Poland)], E-mail: maria.przybylska@astri.uni.torun.pl; Yoshida, Haruo [National Astronomical Observatory, 2-21-1 Osawa, Mitaka, 181-8588 Tokyo (Japan)], E-mail: h.yoshida@nao.ac.jp

2008-08-18

We formulate a general theorem which gives a necessary condition for the maximal super-integrability of a Hamiltonian system. This condition is expressed in terms of properties of the differential Galois group of the variational equations along a particular solution of the considered system. An application of this general theorem to natural Hamiltonian systems of n degrees of freedom with a homogeneous potential gives easily computable and effective necessary conditions for the super-integrability. To illustrate an application of the formulated theorems, we investigate: three known families of integrable potentials, and the three body problem on a line.

The intrinsic stochasticity of near-integrable Hamiltonian systems

Energy Technology Data Exchange (ETDEWEB)

Krlin, L [Ceskoslovenska Akademie Ved, Prague (Czechoslovakia). Ustav Fyziky Plazmatu

1989-09-01

Under certain conditions, the dynamics of near-integrable Hamiltonian systems appears to be stochastic. This stochasticity (intrinsic stochasticity, or deterministic chaos) is closely related to the Kolmogorov-Arnold-Moser (KAM) theorem of the stability of near-integrable multiperiodic Hamiltonian systems. The effect of the intrinsic stochasticity attracts still growing attention both in theory and in various applications in contemporary physics. The paper discusses the relation of the intrinsic stochasticity to the modern ergodic theory and to the KAM theorem, and describes some numerical experiments on related astrophysical and high-temperature plasma problems. Some open questions are mentioned in conclusion. (author).

Hamiltonian formulation of QCD in the Schwinger gauge

International Nuclear Information System (INIS)

Schutte, D.

1989-01-01

The structure of the Hamiltonian related to a regularized non-Abelian gauge field theory is discussed in the light of different choices for gauge-invariant wave functionals (loop space, Coulomb, axial, Schwinger gauge). Arguments are given for the suggestion that the Schwinger gauge offers a specially suited framework for the computation of bound-state (hadron) properties. The most important reasons are the manifest rotation invariance, the lack of a Gribov horizon (giving standard many-body techniques a better chance), and the fact that a regularization analogous to the lattice regularization is easily implementable. Some details of the Schwinger-gauge Hamiltonian theory are discussed

Quantum finance Hamiltonian for coupon bond European and barrier options.

Science.gov (United States)

Baaquie, Belal E

2008-03-01

Coupon bond European and barrier options are financial derivatives that can be analyzed in the Hamiltonian formulation of quantum finance. Forward interest rates are modeled as a two-dimensional quantum field theory and its Hamiltonian and state space is defined. European and barrier options are realized as transition amplitudes of the time integrated Hamiltonian operator. The double barrier option for a financial instrument is "knocked out" (terminated with zero value) if the price of the underlying instrument exceeds or falls below preset limits; the barrier option is realized by imposing boundary conditions on the eigenfunctions of the forward interest rates' Hamiltonian. The price of the European coupon bond option and the zero coupon bond barrier option are calculated. It is shown that, is general, the constraint function for a coupon bond barrier option can -- to a good approximation -- be linearized. A calculation using an overcomplete set of eigenfunctions yields an approximate price for the coupon bond barrier option, which is given in the form of an integral of a factor that results from the barrier condition times another factor that arises from the payoff function.

Entanglement and co-tunneling of two equivalent protons in hydrogen bond pairs

Science.gov (United States)

Smedarchina, Zorka; Siebrand, Willem; Fernández-Ramos, Antonio

2018-03-01

A theoretical study is reported of a system of two identical symmetric hydrogen bonds, weakly coupled such that the two mobile protons can move either separately (stepwise) or together (concerted). It is modeled by two equivalent quartic potentials interacting through dipolar and quadrupolar coupling terms. The tunneling Hamiltonian has two imaginary modes (reaction coordinates) and a potential with a single maximum that may turn into a saddle-point of second order and two sets of (inequivalent) minima. Diagonalization is achieved via a modified Jacobi-Davidson algorithm. From this Hamiltonian the mechanism of proton transfer is derived. To find out whether the two protons move stepwise or concerted, a new tool is introduced, based on the distribution of the probability flux in the dividing plane of the transfer mode. While stepwise transfer dominates for very weak coupling, it is found that concerted transfer (co-tunneling) always occurs, even when the coupling vanishes since the symmetry of the Hamiltonian imposes permanent entanglement on the motions of the two protons. We quantify this entanglement and show that, for a wide range of parameters of interest, the lowest pair of states of the Hamiltonian represents a perfect example of highly entangled quantum states in continuous variables. The method is applied to the molecule porphycene for which the observed tunneling splitting is calculated in satisfactory agreement with experiment, and the mechanism of double-proton tunneling is found to be predominantly concerted. We show that, under normal conditions, when they are in the ground state, the two porphycene protons are highly entangled, which may have interesting applications. The treatment also identifies the conditions under which such a system can be handled by conventional one-instanton techniques.

Hamiltonian dynamics on the symplectic extended phase space for autonomous and non-autonomous systems

International Nuclear Information System (INIS)

Struckmeier, Juergen

2005-01-01

We will present a consistent description of Hamiltonian dynamics on the 'symplectic extended phase space' that is analogous to that of a time-independent Hamiltonian system on the conventional symplectic phase space. The extended Hamiltonian H 1 and the pertaining extended symplectic structure that establish the proper canonical extension of a conventional Hamiltonian H will be derived from a generalized formulation of Hamilton's variational principle. The extended canonical transformation theory then naturally permits transformations that also map the time scales of the original and destination system, while preserving the extended Hamiltonian H 1 , and hence the form of the canonical equations derived from H 1 . The Lorentz transformation, as well as time scaling transformations in celestial mechanics, will be shown to represent particular canonical transformations in the symplectic extended phase space. Furthermore, the generalized canonical transformation approach allows us to directly map explicitly time-dependent Hamiltonians into time-independent ones. An 'extended' generating function that defines transformations of this kind will be presented for the time-dependent damped harmonic oscillator and for a general class of explicitly time-dependent potentials. In the appendix, we will re-establish the proper form of the extended Hamiltonian H 1 by means of a Legendre transformation of the extended Lagrangian L 1

Global stability and quadratic Hamiltonian structure in Lotka-Volterra and quasi-polynomial systems

Energy Technology Data Exchange (ETDEWEB)

Szederkenyi, Gabor; Hangos, Katalin M

2004-04-26

We show that the global stability of quasi-polynomial (QP) and Lotka-Volterra (LV) systems with the well-known logarithmic Lyapunov function is equivalent to the existence of a local generalized dissipative Hamiltonian description of the LV system with a diagonal quadratic form as a Hamiltonian function. The Hamiltonian function can be calculated and the quadratic dissipativity neighborhood of the origin can be estimated by solving linear matrix inequalities.

Global stability and quadratic Hamiltonian structure in Lotka-Volterra and quasi-polynomial systems

Science.gov (United States)

Szederkényi, Gábor; Hangos, Katalin M.

2004-04-01

We show that the global stability of quasi-polynomial (QP) and Lotka-Volterra (LV) systems with the well-known logarithmic Lyapunov function is equivalent to the existence of a local generalized dissipative Hamiltonian description of the LV system with a diagonal quadratic form as a Hamiltonian function. The Hamiltonian function can be calculated and the quadratic dissipativity neighborhood of the origin can be estimated by solving linear matrix inequalities.

Global stability and quadratic Hamiltonian structure in Lotka-Volterra and quasi-polynomial systems

International Nuclear Information System (INIS)

Szederkenyi, Gabor; Hangos, Katalin M.

2004-01-01

We show that the global stability of quasi-polynomial (QP) and Lotka-Volterra (LV) systems with the well-known logarithmic Lyapunov function is equivalent to the existence of a local generalized dissipative Hamiltonian description of the LV system with a diagonal quadratic form as a Hamiltonian function. The Hamiltonian function can be calculated and the quadratic dissipativity neighborhood of the origin can be estimated by solving linear matrix inequalities

Discrete variable representation for singular Hamiltonians

DEFF Research Database (Denmark)

Schneider, B. I.; Nygaard, Nicolai

2004-01-01

We discuss the application of the discrete variable representation (DVR) to Schrodinger problems which involve singular Hamiltonians. Unlike recent authors who invoke transformations to rid the eigenvalue equation of singularities at the cost of added complexity, we show that an approach based...

Infinite projected entangled-pair state algorithm for ruby and triangle-honeycomb lattices

Science.gov (United States)

Jahromi, Saeed S.; Orús, Román; Kargarian, Mehdi; Langari, Abdollah

2018-03-01

The infinite projected entangled-pair state (iPEPS) algorithm is one of the most efficient techniques for studying the ground-state properties of two-dimensional quantum lattice Hamiltonians in the thermodynamic limit. Here, we show how the algorithm can be adapted to explore nearest-neighbor local Hamiltonians on the ruby and triangle-honeycomb lattices, using the corner transfer matrix (CTM) renormalization group for 2D tensor network contraction. Additionally, we show how the CTM method can be used to calculate the ground-state fidelity per lattice site and the boundary density operator and entanglement entropy (EE) on an infinite cylinder. As a benchmark, we apply the iPEPS method to the ruby model with anisotropic interactions and explore the ground-state properties of the system. We further extract the phase diagram of the model in different regimes of the couplings by measuring two-point correlators, ground-state fidelity, and EE on an infinite cylinder. Our phase diagram is in agreement with previous studies of the model by exact diagonalization.

Hamiltonian reduction of Kac-Moody algebras

International Nuclear Information System (INIS)

Kimura, Kazuhiro

1991-01-01

Feigin-Fucks construction provides us methods to treat rational conformal theories in terms of free fields. This formulation enables us to describe partition functions and correlation functions in the Fock space of free fields. There are several attempt extending to supersymmetric theories. In this report authors present an explicit calculation of the Hamiltonian reduction based on the free field realization. In spite of the results being well-known, the relations can be clearly understood in the language of bosons. Authors perform the hamiltonian reduction by imposing a constraint with appropriate gauge transformations which preserve the constraint. This approaches enables us to gives the geometric interpretation of super Virasoro algebras and relations of the super gravity. In addition, author discuss the properties of quantum groups by using the explicit form of the group element. It is also interesting to extend to super Kac-Moody algebras. (M.N.)

Effective Hamiltonian for high Tc Cu oxides

International Nuclear Information System (INIS)

Fukuyama, H.; Matsukawa, H.

1989-01-01

Effective Hamiltonian has been derived for CuO 2 layers in the presence of extra holes doped mainly into O-sites by taking both on-site and intersite Coulomb interaction into account. A special case with a single hole has been examined in detail. It is found that there exist various types of bound states, singlet and triplet with different spatial symmetry, below the hole bank continuum. The spatial extent of the Zhang-Rice singlet state, which is most stabilized, and the effective transfer integral between these singlet states are seen to be very sensitive to the relative magnitude of the direct and the indirect transfer integrals between O-sites. Effective Hamiltonian for the case of electron doping has also been derived

Boundary Hamiltonian Theory for Gapped Topological Orders

Science.gov (United States)

Hu, Yuting; Wan, Yidun; Wu, Yong-Shi

2017-06-01

We report our systematic construction of the lattice Hamiltonian model of topological orders on open surfaces, with explicit boundary terms. We do this mainly for the Levin-Wen string-net model. The full Hamiltonian in our approach yields a topologically protected, gapped energy spectrum, with the corresponding wave functions robust under topology-preserving transformations of the lattice of the system. We explicitly present the wavefunctions of the ground states and boundary elementary excitations. The creation and hopping operators of boundary quasi-particles are constructed. It is found that given a bulk topological order, the gapped boundary conditions are classified by Frobenius algebras in its input data. Emergent topological properties of the ground states and boundary excitations are characterized by (bi-) modules over Frobenius algebras.

Can model Hamiltonians describe the electron–electron interaction in π-conjugated systems?: PAH and graphene

International Nuclear Information System (INIS)

Chiappe, G; Louis, E; San-Fabián, E; Vergés, J A

2015-01-01

Model Hamiltonians have been, and still are, a valuable tool for investigating the electronic structure of systems for which mean field theories work poorly. This review will concentrate on the application of Pariser–Parr–Pople (PPP) and Hubbard Hamiltonians to investigate some relevant properties of polycyclic aromatic hydrocarbons (PAH) and graphene. When presenting these two Hamiltonians we will resort to second quantisation which, although not the way chosen in its original proposal of the former, is much clearer. We will not attempt to be comprehensive, but rather our objective will be to try to provide the reader with information on what kinds of problems they will encounter and what tools they will need to solve them. One of the key issues concerning model Hamiltonians that will be treated in detail is the choice of model parameters. Although model Hamiltonians reduce the complexity of the original Hamiltonian, they cannot be solved in most cases exactly. So, we shall first consider the Hartree–Fock approximation, still the only tool for handling large systems, besides density functional theory (DFT) approaches. We proceed by discussing to what extent one may exactly solve model Hamiltonians and the Lanczos approach. We shall describe the configuration interaction (CI) method, a common technology in quantum chemistry but one rarely used to solve model Hamiltonians. In particular, we propose a variant of the Lanczos method, inspired by CI, that has the novelty of using as the seed of the Lanczos process a mean field (Hartree–Fock) determinant (the method will be named LCI). Two questions of interest related to model Hamiltonians will be discussed: (i) when including long-range interactions, how crucial is including in the Hamiltonian the electronic charge that compensates ion charges? (ii) Is it possible to reduce a Hamiltonian incorporating Coulomb interactions (PPP) to an ‘effective’ Hamiltonian including only on-site interactions (Hubbard)? The

Hamiltonian approach to second order gauge invariant cosmological perturbations

Science.gov (United States)

Domènech, Guillem; Sasaki, Misao

2018-01-01

In view of growing interest in tensor modes and their possible detection, we clarify the definition of tensor modes up to 2nd order in perturbation theory within the Hamiltonian formalism. Like in gauge theory, in cosmology the Hamiltonian is a suitable and consistent approach to reduce the gauge degrees of freedom. In this paper we employ the Faddeev-Jackiw method of Hamiltonian reduction. An appropriate set of gauge invariant variables that describe the dynamical degrees of freedom may be obtained by suitable canonical transformations in the phase space. We derive a set of gauge invariant variables up to 2nd order in perturbation expansion and for the first time we reduce the 3rd order action without adding gauge fixing terms. In particular, we are able to show the relation between the uniform-ϕ and Newtonian slicings, and study the difference in the definition of tensor modes in these two slicings.

Skyrme's interaction beyond the mean-field. The DGCM+GOA Hamiltonian of nuclear quadrupole motion

International Nuclear Information System (INIS)

Kluepfel, Peter

2008-01-01

This work focuses on the microscopic description of nuclear collective quadrupole motion within the framework of the dynamic Generator-Coordinate-Method(DGCM)+Gaussian-Overlap-Approximation(GOA). Skyrme-type effective interactions are used as the fundamental many-particle interaction. Starting from a rotational invariant, polynomial and topologic consistent formulation of the GCM+GOA Hamiltonian an interpolation scheme for the collective masses and potential is developed. It allows to define the collective Hamiltonian of fully triaxial collective quadrupole dynamics from a purely axial symmetric configuration space. The substantial gain in performance allows the self-consistent evaluation of the dynamic quadrupole mass within the ATDHF-cranking model. This work presents the first large-scale analysis of quadrupole correlation energies and lowlying collective states within the DGCM+GOA model. Different Skyrme- and pairing interactions are compared from old standards up to more recent parameterizations. After checking the validity of several approximations to the DGCM+GOA model - both on the mean-field and the collective level - we proceed with a detailed investigation of correlation effects along the chains of semi-magic isotopes and isotones. This finally allows to define a set of observables which are hardly affected by collective correlations. Those observables were used for a refit of a Skyrme-type effective interaction which is expected to cure most of the problems of the recent parameterizations. Preparing further work, estimates for the correlated ground state energy are proposed which can be evaluated directly from the mean-field model. (orig.)

Skyrme's interaction beyond the mean-field. The DGCM+GOA Hamiltonian of nuclear quadrupole motion

Energy Technology Data Exchange (ETDEWEB)

Kluepfel, Peter

2008-07-29

This work focuses on the microscopic description of nuclear collective quadrupole motion within the framework of the dynamic Generator-Coordinate-Method(DGCM)+Gaussian-Overlap-Approximation(GOA). Skyrme-type effective interactions are used as the fundamental many-particle interaction. Starting from a rotational invariant, polynomial and topologic consistent formulation of the GCM+GOA Hamiltonian an interpolation scheme for the collective masses and potential is developed. It allows to define the collective Hamiltonian of fully triaxial collective quadrupole dynamics from a purely axial symmetric configuration space. The substantial gain in performance allows the self-consistent evaluation of the dynamic quadrupole mass within the ATDHF-cranking model. This work presents the first large-scale analysis of quadrupole correlation energies and lowlying collective states within the DGCM+GOA model. Different Skyrme- and pairing interactions are compared from old standards up to more recent parameterizations. After checking the validity of several approximations to the DGCM+GOA model - both on the mean-field and the collective level - we proceed with a detailed investigation of correlation effects along the chains of semi-magic isotopes and isotones. This finally allows to define a set of observables which are hardly affected by collective correlations. Those observables were used for a refit of a Skyrme-type effective interaction which is expected to cure most of the problems of the recent parameterizations. Preparing further work, estimates for the correlated ground state energy are proposed which can be evaluated directly from the mean-field model. (orig.)

Transparency in port-Hamiltonian based telemanipulation

NARCIS (Netherlands)

Secchi, C; Stramigioli, Stefano; Fantuzzi, C.

2005-01-01

After stability, transparency is the major issue in the design of a telemanipulation system. In this paper we exploit a behavioral approach in order to provide an index for the evaluation of transparency in port-Hamiltonian based teleoperators. Furthermore we provide a transparency analysis of

Transparency in Port-Hamiltonian-Based Telemanipulation

NARCIS (Netherlands)

Secchi, Cristian; Stramigioli, Stefano; Fantuzzi, Cesare

After stability, transparency is the major issue in the design of a telemanipulation system. In this paper, we exploit the behavioral approach in order to provide an index for the evaluation of transparency in port-Hamiltonian-based teleoperators. Furthermore, we provide a transparency analysis of

Discrete variational Hamiltonian mechanics

International Nuclear Information System (INIS)

Lall, S; West, M

2006-01-01

The main contribution of this paper is to present a canonical choice of a Hamiltonian theory corresponding to the theory of discrete Lagrangian mechanics. We make use of Lagrange duality and follow a path parallel to that used for construction of the Pontryagin principle in optimal control theory. We use duality results regarding sensitivity and separability to show the relationship between generating functions and symplectic integrators. We also discuss connections to optimal control theory and numerical algorithms

A novel scheme for Liouville's equation with a discontinuous Hamiltonian and applications to geometrical optics

NARCIS (Netherlands)

Lith, van B.S.; Thije Boonkkamp, ten J.H.M.; IJzerman, W.L.; Tukker, T.W.

2015-01-01

We compute numerical solutions of Liouville's equation with a discontinuous Hamiltonian. We assume that the underlying Hamiltonian system has a well-defined behaviour even when the Hamiltonian is discontinuous. In the case of geometrical optics such a discontinuity yields the familiar Snell's law or

A novel scheme for Liouville's equation with a discontinuous Hamiltonian and applications to geometrical optics

NARCIS (Netherlands)

van Lith, B.S.; ten Thije Boonkkamp, J.H.M.; IJzerman, W.L.; Tukker, T.W.

A novel scheme is developed that computes numerical solutions of Liouville’s equation with a discontinuous Hamiltonian. It is assumed that the underlying Hamiltonian system has well-defined behaviour even when the Hamiltonian is discontinuous. In the case of geometrical optics such a discontinuity

Symmetry-adaptation and selection rules for effective crystal field Hamiltonians

International Nuclear Information System (INIS)

Tuszynski, J.A.

1986-01-01

The intention of this paper is to systematically derive an effective Hamiltonian in the presence of crystal fields in such a way as to incorporate relativistic effects and higher order perturbation corrections including configuration mixing. This Hamiltonian will then be conveniently represented as a symmetry-adapted series of one- and two-body double tensor operators whose matrix elements will be analyzed for selection rules. 16 references, 4 tables

A geometric Hamiltonian description of composite quantum systems and quantum entanglement

Science.gov (United States)

Pastorello, Davide

2015-05-01

Finite-dimensional Quantum Mechanics can be geometrically formulated as a proper classical-like Hamiltonian theory in a projective Hilbert space. The description of composite quantum systems within the geometric Hamiltonian framework is discussed in this paper. As summarized in the first part of this work, in the Hamiltonian formulation the phase space of a quantum system is the Kähler manifold given by the complex projective space P(H) of the Hilbert space H of the considered quantum theory. However the phase space of a bipartite system must be P(H1 ⊗ H2) and not simply P(H1) × P(H2) as suggested by the analogy with Classical Mechanics. A part of this paper is devoted to manage this problem. In the second part of the work, a definition of quantum entanglement and a proposal of entanglement measure are given in terms of a geometrical point of view (a rather studied topic in recent literature). Finally two known separability criteria are implemented in the Hamiltonian formalism.

Interpolation approach to Hamiltonian-varying quantum systems and the adiabatic theorem

International Nuclear Information System (INIS)

Pan, Yu; James, Matthew R.; Miao, Zibo; Amini, Nina H.; Ugrinovskii, Valery

2015-01-01

Quantum control could be implemented by varying the system Hamiltonian. According to adiabatic theorem, a slowly changing Hamiltonian can approximately keep the system at the ground state during the evolution if the initial state is a ground state. In this paper we consider this process as an interpolation between the initial and final Hamiltonians. We use the mean value of a single operator to measure the distance between the final state and the ideal ground state. This measure resembles the excitation energy or excess work performed in thermodynamics, which can be taken as the error of adiabatic approximation. We prove that under certain conditions, this error can be estimated for an arbitrarily given interpolating function. This error estimation could be used as guideline to induce adiabatic evolution. According to our calculation, the adiabatic approximation error is not linearly proportional to the average speed of the variation of the system Hamiltonian and the inverse of the energy gaps in many cases. In particular, we apply this analysis to an example in which the applicability of the adiabatic theorem is questionable. (orig.)

Construction of Vibronic Diabatic Hamiltonian for Excited-State Electron and Energy Transfer Processes.

Science.gov (United States)

Xie, Yu; Jiang, Shengshi; Zheng, Jie; Lan, Zhenggang

2017-12-21

Photoinduced excited-state electron and energy transfer processes are crucial in biological photoharvesting systems and organic photovoltaic devices. We discuss the construction of a diabatic vibronic Hamiltonian for the proper treatment of these processes involving the projection approach acting on both electronic wave functions and vibrational modes. In the electronic part, the wave function projection approach is used to construct the diabatic Hamiltonian in which both local excited states and charge-transfer states are included on the same footing. For the vibrational degrees of freedom, the vibronic couplings in the diabatic Hamiltonian are obtained in the basis of the pseudonormal modes localized on each monomer site by applying delocalized-to-localized mode projection. This systematic approach allows us to construct the vibronic diabatic Hamiltonian in molecular aggregates.

Painlevé IV Hamiltonian systems and coherent states

International Nuclear Information System (INIS)

Bermudez, D; Contreras-Astorga, A; Fernández C, D J

2015-01-01

Schrödinger Hamiltonians with third-order differential ladder operators are linked to the Painlevé IV equation. Some of these appear from applying SUSY QM to the harmonic oscillator. Departing from them, we will build coherent states as eigenstates of the annihilation operator, then as displaced versions of the extremal states, both involving the third-order ladder operators, and finally as displaced extremal states using linearized ladder operators. To each Hamiltonian corresponds two families of coherent states for fixed ladder operators: one in the infinite dimension subspace associated with the oscillator spectrum and another in the finite dimension one generated by the eigenstates created by SUSY QM. (paper)

Phase transition in the non-degenerate Hubbard Hamiltonian

International Nuclear Information System (INIS)

Chaves, C.M.; Lederer, P.; Gomes, A.A.

1976-01-01

Phase transition in the isotropic non-degenerate Hubbard Hamiltonian within the renormalization group techniques, using the epsilon = 4 - d expansion to first order in epsilon, is studied. The functional obtained from the Hubbard Hamiltonian displays full rotation symmetry and describes two coupled fields: a vector spin field, with n components and a non-soft scalar charge field. The possibility of tricritical behavior then emerges. The effects of simple constraints imposed on the charge field is considered. The relevance of the coupling between the fields in producing Fisher renormalization of the critical exponents is discussed. The possible singularities introduced in the charge-charge correlation function by the coupling are also discussed

Floquet-Green function formalism for harmonically driven Hamiltonians

International Nuclear Information System (INIS)

Martinez, D F

2003-01-01

A method is proposed for the calculation of the Floquet-Green function of a general Hamiltonian with harmonic time dependence. We use matrix continued fractions to derive an expression for the 'dynamical effective potential' that can be used to calculate the Floquet-Green function of the system. We demonstrate the formalism for the simple case of a space-periodic (in the tight-binding approximation) Hamiltonian with a defect whose on-site energy changes harmonically with time. We study the local density of states for this system and the behaviour of the localized states as a function of the different parameters that characterize the system

Passivation controller design for turbo-generators based on generalised Hamiltonian system theory

NARCIS (Netherlands)

Cao, M.; Shen, T.L.; Song, Y.H.

2002-01-01

A method of pre-feedback to formulate the generalised forced Hamiltonian system model for speed governor control systems is proposed. Furthermore, passivation controllers are designed based on the scheme of Hamiltonian structure for single machne infinite bus and multimachine power systems. In

Lagrangian and Hamiltonian Formulation of Transmission Line Systems with Boundary Energy Flow

NARCIS (Netherlands)

Jeltsema, Dimitri; Schaft, Arjan J. van der

The classical Lagrangian and Hamiltonian formulation of an electrical transmission line is reviewed and extended to allow for varying boundary conditions, The method is based on the definition of an infinite-dimensional analogue of the affine Lagrangian and Hamiltonian input-output systems

An integrable Hamiltonian hierarchy and its constrained flows with generalized Hamiltonian regular representations, as well as its expanding integrable system

International Nuclear Information System (INIS)

Zhang Yufeng

2003-01-01

A new subalgebra of loop algebra A-tilde 2 is first constructed. It follows that an isospectral problem is established. Using Tu-pattern gives rise to a new integrable hierarchy, which possesses bi-Hamiltonian structure. As its reduction cases, the well-known standard Schrodinger equation and MKdV equation are presented, respectively. Furthermore, by making use of bi-symmetry constraints, generalized Hamiltonian regular representations for the hierarchy are obtained. At last, we obtain an expanding integrable system of this hierarchy by applying a scalar transformation between two isospectral problems and constructing a five-dimensional loop algebra G-tilde. In particular, the expanding integrable models of Schrodinger equation and MKdV equation are presented, respectively

Hamiltonian structure of gravitational field theory

International Nuclear Information System (INIS)

Rayski, J.

1992-01-01

Hamiltonian generalizations of Einstein's theory of gravitation introducing a laminar structure of spacetime are discussed. The concepts of general relativity and of quasi-inertial coordinate systems are extended beyond their traditional scope. Not only the metric, but also the coordinate system, if quantized, undergoes quantum fluctuations

Adaptive control of port-Hamiltonian systems

NARCIS (Netherlands)

Dirksz, D.A.; Scherpen, J.M.A.; Edelmayer, András

2010-01-01

In this paper an adaptive control scheme is presented for general port-Hamiltonian systems. Adaptive control is used to compensate for control errors that are caused by unknown or uncertain parameter values of a system. The adaptive control is also combined with canonical transformation theory for

Port-Hamiltonian Systems on Open Graphs

NARCIS (Netherlands)

Schaft, A.J. van der; Maschke, B.M.

2010-01-01

In this talk we discuss how to define in an intrinsic manner port-Hamiltonian dynamics on open graphs. Open graphs are graphs where some of the vertices are boundary vertices (terminals), which allow interconnection with other systems. We show that a directed graph carries two natural Dirac

Density functional approach for pairing in finite size systems

International Nuclear Information System (INIS)

Hupin, G.

2011-09-01

The combination of functional theory where the energy is written as a functional of the density, and the configuration mixing method, provides an efficient description of nuclear ground and excited state properties. The specific pathologies that have been recently observed, show the lack of a clear underlying justification associated to the breaking and the restoration of symmetries within density functional theory. This thesis focuses on alternative treatments of pairing correlations in finite many body systems that consider the breaking and the restoration of the particle number conservation. The energy is written as a functional of a projected quasi-particle vacuum and can be linked to the one obtained within the configuration mixing framework. This approach has been applied to make the projection either before or after the application of the variational principle. It is more flexible than the usual configuration mixing method since it can handle more general effective interactions than the latter. The application to the Krypton isotopes shows the feasibility and the efficiency of the method to describe pairing near closed shell nuclei. Following a parallel path, a theory where the energy is written as a functional of the occupation number and natural orbitals is proposed. The new functional is benchmarked in an exactly solvable model, the pairing Hamiltonian. The efficiency and the applicability of the new theory have been tested for various pairing strengths, single particle energy spectra and numbers of particles. (author)

Hamiltonian theory of vacuum helical torus lines of magnetic force

International Nuclear Information System (INIS)

Gnudi, Giovanni; Hatori, Tadatsugu

1994-01-01

For making plasma into equilibrium state, the lines of magnetic force must have magnetic surfaces. However in a helical system, space is divided into the region having magnetic surface structure and the region that does not have it. Accordingly, it is an important basic research for the plasma confinement in a helical system to examine where is the boundary of both regions and how is the large area structure of the lines of magnetic force in the boundary region. The lines of magnetic force can be treated as a Hamilton mechanics system, and it has been proved that the Hamiltonian for the lines of magnetic force can be expressed by a set of canonical variables and the function of time. In this research, the Hamiltonian that describes the lines of magnetic force of helical system torus coordination in vacuum was successfully determined concretely. Next, the development of new linear symplectic integration method was carried out. The important supports for the theory of determining Hamiltonian are Lie transformation and paraxial expansion. The procedure is explained. In Appendix, Lie transformation, Hamiltonian for the lines of magnetic force, magnetic potential, Taylor expansion of the potential, cylindrical limit approximation, helical toroidal potential and integrable model are described. (K.I.)

Partial quantization of Lagrangian-Hamiltonian systems

International Nuclear Information System (INIS)

Amaral, C.M. do; Soares Filho, P.C.

1979-05-01

A classical variational principle is constructed in the Weiss form, for dynamical systems with support spaces of the configuration-phase kind. This extended principle rules the dynamics of classical systems, partially Hamiltonian, in interaction with Lagrangean parameterized subsidiary dynamics. The variational family of equations obtained, consists of an equation of the Hamilton-Jacobi type, coupled to a family of differential equations of the Euler-Lagrange form. The basic dynamical function appearing in the equations is a function of the Routh kind. By means of an ansatz induced by the variationally obtained family, a generalized set of equation, is proposed constituted by a wave equation of Schroedinger type, coupled to a family of equations formaly analog to those Euler-Lagrange equations. A basic operator of Routh type appears in our generalized set of equations. This operator describes the interaction between a quantized Hamiltonian dynamics, with a parameterized classical Lagrangean dynamics in semi-classical closed models. (author) [pt

Paired Hall states

International Nuclear Information System (INIS)

Greiter, M.

1992-01-01

This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

Multi-Hamiltonian formulations and stability of higher-derivative extensions of 3d Chern-Simons

Energy Technology Data Exchange (ETDEWEB)

Abakumova, V.A.; Kaparulin, D.S.; Lyakhovich, S.L. [Tomsk State University, Physics Faculty, Tomsk (Russian Federation)

2018-02-15

Most general third-order 3d linear gauge vector field theory is considered. The field equations involve, besides the mass, two dimensionless constant parameters. The theory admits two-parameter series of conserved tensors with the canonical energy-momentum being a particular representative of the series. For a certain range of the model parameters, the series of conserved tensors include bounded quantities. This makes the dynamics classically stable, though the canonical energy is unbounded in all the instances. The free third-order equations are shown to admit constrained multi-Hamiltonian form with the 00-components of conserved tensors playing the roles of corresponding Hamiltonians. The series of Hamiltonians includes the canonical Ostrogradski's one, which is unbounded. The Hamiltonian formulations with different Hamiltonians are not connected by canonical transformations. This means, the theory admits inequivalent quantizations at the free level. Covariant interactions are included with spinor fields such that the higher-derivative dynamics remains stable at interacting level if the bounded conserved quantity exists in the free theory. In the first-order formalism, the interacting theory remains Hamiltonian and therefore it admits quantization, though the vertices are not necessarily Lagrangian in the third-order field equations. (orig.)

Problems with the definition of renormalized Hamiltonians for momentum-space renormalization transformations

NARCIS (Netherlands)

Enter, Aernout C.D. van; Fernández, Roberto

For classical lattice systems with finite (Ising) spins, we show that the implementation of momentum-space renormalization at the level of Hamiltonians runs into the same type of difficulties as found for real-space transformations: Renormalized Hamiltonians are ill-defined in certain regions of the

Blocking Radial Diffusion in a Double-Waved Hamiltonian Model

International Nuclear Information System (INIS)

Martins, Caroline G L; De Carvalho, R Egydio; Marcus, F A; Caldas, I L

2011-01-01

A non-twist Hamiltonian system perturbed by two waves with particular wave numbers can present Robust Tori, barriers created by the vanishing of the perturbing Hamiltonian at some defined positions. When Robust Tori exist, any trajectory in phase space passing close to them is blocked by emergent invariant curves that prevent the chaotic transport. We analyze the breaking up of the RT as well the transport dependence on the wave numbers and on the wave amplitudes. Moreover, we report the chaotic web formation in the phase space and how this pattern influences the transport.

Some sufficient conditions for Hamiltonian property in terms of ...

Indian Academy of Sciences (India)

[1, D], or Wf (G) ≥ f (1). 2 n2 + [f(2) − 3. 2 f(1)]n − 2[f(2) − f(1)] for a monotonically decreasing function f(x) on x ∈ [1, D], then G is Hamiltonian, unless G ∼= K∗ n or K2∨3K1. Proof. Assume that G is not a Hamiltonian graph with degree sequence (d1,d2,...,dn), where d1 ≤ d2 ≤ ··· ≤ dn and n ≥ 3. By Lemma 1, there is a ...

Noether symmetries and integrability in time-dependent Hamiltonian mechanics

Directory of Open Access Journals (Sweden)

Jovanović Božidar

2016-01-01

Full Text Available We consider Noether symmetries within Hamiltonian setting as transformations that preserve Poincaré-Cartan form, i.e., as symmetries of characteristic line bundles of nondegenerate 1-forms. In the case when the Poincaré-Cartan form is contact, the explicit expression for the symmetries in the inverse Noether theorem is given. As examples, we consider natural mechanical systems, in particular the Kepler problem. Finally, we prove a variant of the theorem on complete (non-commutative integrability in terms of Noether symmetries of time-dependent Hamiltonian systems.

Constraints and Hamiltonian in light-front quantized field theory

International Nuclear Information System (INIS)

Srivastava, P.P.

1993-01-01

Self-consistent hamiltonian formulation of scalar theory on the null plane is constructed and quantized following the Dirac procedure. The theory contains also constraint equations which would give, if solved, to a nonlocal Hamiltonian. In contrast to the equal-time formulation we obtain a different description of the spontaneous symmetry breaking in the continuum and the symmetry generators are found to annihilate the light-front vacuum. Two examples are given where the procedure cannot be applied self-consistently. The corresponding theories are known to be ill-defined from the equal-time quantization. (author)

The mathematics of a quantum Hamiltonian computing half adder Boolean logic gate

International Nuclear Information System (INIS)

Dridi, G; Julien, R; Hliwa, M; Joachim, C

2015-01-01

The mathematics behind the quantum Hamiltonian computing (QHC) approach of designing Boolean logic gates with a quantum system are given. Using the quantum eigenvalue repulsion effect, the QHC AND, NAND, OR, NOR, XOR, and NXOR Hamiltonian Boolean matrices are constructed. This is applied to the construction of a QHC half adder Hamiltonian matrix requiring only six quantum states to fullfil a half Boolean logical truth table. The QHC design rules open a nano-architectronic way of constructing Boolean logic gates inside a single molecule or atom by atom at the surface of a passivated semi-conductor. (paper)

The mathematics of a quantum Hamiltonian computing half adder Boolean logic gate.

Science.gov (United States)

Dridi, G; Julien, R; Hliwa, M; Joachim, C

2015-08-28

The mathematics behind the quantum Hamiltonian computing (QHC) approach of designing Boolean logic gates with a quantum system are given. Using the quantum eigenvalue repulsion effect, the QHC AND, NAND, OR, NOR, XOR, and NXOR Hamiltonian Boolean matrices are constructed. This is applied to the construction of a QHC half adder Hamiltonian matrix requiring only six quantum states to fullfil a half Boolean logical truth table. The QHC design rules open a nano-architectronic way of constructing Boolean logic gates inside a single molecule or atom by atom at the surface of a passivated semi-conductor.

Construction of Hamiltonians by supervised learning of energy and entanglement spectra

Science.gov (United States)

Fujita, Hiroyuki; Nakagawa, Yuya O.; Sugiura, Sho; Oshikawa, Masaki

2018-02-01

Correlated many-body problems ubiquitously appear in various fields of physics such as condensed matter, nuclear, and statistical physics. However, due to the interplay of the large number of degrees of freedom, it is generically impossible to treat these problems from first principles. Thus the construction of a proper model, namely, effective Hamiltonian, is essential. Here, we propose a simple supervised learning algorithm for constructing Hamiltonians from given energy or entanglement spectra. We apply the proposed scheme to the Hubbard model at the half-filling, and compare the obtained effective low-energy spin model with several analytic results based on the high-order perturbation theory, which have been inconsistent with each other. We also show that our approach can be used to construct the entanglement Hamiltonian of a quantum many-body state from its entanglement spectrum as well. We exemplify this using the ground states of the S =1 /2 two-leg Heisenberg ladders. We observe a qualitative difference between the entanglement Hamiltonians of the two phases (the Haldane and the rung singlet phase) of the model due to the different origin of the entanglement. In the Haldane phase, we find that the entanglement Hamiltonian is nonlocal by nature, and the locality can be restored by introducing the anisotropy and turning the ground state into the large-D phase. Possible applications to the model construction from experimental data and to various problems of strongly correlated systems are discussed.

Effective Hamiltonians, two level systems, and generalized Maxwell-Bloch equations

International Nuclear Information System (INIS)

Sczaniecki, L.

1981-02-01

A new method is proposed involving a canonical transformation leading to the non-secular part of time-independent perturbation calculus. The method is used to derive expressions for effective Shen-Walls Hamiltonians which, taken in the two-level approximation and on the inclusion of non-Hamiltonian terms into the dynamics of the system, lead to generalized Maxwell-Bloch equations. The rotating wave approximation is written anew within the framework of our formalism. (author)

Homoclinic Orbits for a Class of Nonperiodic Hamiltonian Systems with Some Twisted Conditions

Directory of Open Access Journals (Sweden)

Qi Wang

2013-01-01

Full Text Available By the Maslov index theory, we will study the existence and multiplicity of homoclinic orbits for a class of asymptotically linear nonperiodic Hamiltonian systems with some twisted conditions on the Hamiltonian functions.

Isovector pairing in self-conjugate nuclei in a formalism of quartets

International Nuclear Information System (INIS)

Sambataro, M; Sandulescu, N

2014-01-01

The isovector proton-neutron pairing in self-conjugate nuclei is treated in a formalism of quartets. Quartets are four-body correlated structures built from two neutrons and two protons coupled to total isospin T = 0. The ground state of the isovector pairing Hamiltonian is described as a product of quartets. We review both the case in which the quartets are constrained to be all identical and the case in which they are allowed to be distinct from one another. The quality of the two approaches is tested by making comparisons with exact shell model calculations for N = Z nuclei with valence nucleons outside the 16 O, 40 Ca, and 100 Sn cores. We consider both spherical and axially deformed mean fields. Both approaches are found to be very accurate. In the applications to a deformed mean field, in particular, the formalism with distinct quartets gives rise to results which are basically exact

Quantum mechanical path integrals with Wiener measures for all polynomial Hamiltonians

International Nuclear Information System (INIS)

Klauder, J.R.; Daubechies, I.

We construct arbitrary matrix elements of the quantum evolution operator for a wide class of self-adjoint canonical Hamiltonians, including those which are polynomial in the Heisenberg operators, as the limit of well-defined path integrals involving Wiener measure on phase space, as a diffusion constant diverges. A related construction achieves a similar result for an arbitrary spin Hamiltonian. (orig.)

Hamiltonian Chaos and Fractional Dynamics

International Nuclear Information System (INIS)

Combescure, M

2005-01-01

This book provides an introduction and discussion of the main issues in the current understanding of classical Hamiltonian chaos, and of its fractional space-time structure. It also develops the most complex and open problems in this context, and provides a set of possible applications of these notions to some fundamental questions of dynamics: complexity and entropy of systems, foundation of classical statistical physics on the basis of chaos theory, and so on. Starting with an introduction of the basic principles of the Hamiltonian theory of chaos, the book covers many topics that can be found elsewhere in the literature, but which are collected here for the readers' convenience. In the last three parts, the author develops topics which are not typically included in the standard textbooks; among them are: - the failure of the traditional description of chaotic dynamics in terms of diffusion equations; - he fractional kinematics, its foundation and renormalization group analysis; - 'pseudo-chaos', i.e. kinetics of systems with weak mixing and zero Lyapunov exponents; - directional complexity and entropy. The purpose of this book is to provide researchers and students in physics, mathematics and engineering with an overview of many aspects of chaos and fractality in Hamiltonian dynamical systems. In my opinion it achieves this aim, at least provided researchers and students (mainly those involved in mathematical physics) can complement this reading with comprehensive material from more specialized sources which are provided as references and 'further reading'. Each section contains introductory pedagogical material, often illustrated by figures coming from several numerical simulations which give the feeling of what's going on, and thus is very useful to the reader who is not very familiar with the topics presented. Some problems are included at the end of most sections to help the reader to go deeper into the subject. My one regret is that the book does not

A modified chaos-based communication scheme using Hamiltonian forms and observer

International Nuclear Information System (INIS)

Lopez-Mancilla, D; Cruz-Hernandez, C; Posadas-Castillo, C

2005-01-01

In this work, a modified chaos-based communication scheme is presented. In particular, we use the modified scheme proposed by Lopez-Mancilla and Cruz-Hernandez (2005), that improves the basic scheme for chaotic masking using a single transmission channel proposed by Cuomo and coworkers (1993). It is extended for a special class of Generalized Hamiltonian systems. Substantial differences that significantly affect the reception quality of the sent message, with or without considering noise effect in the transmission channel are given. We use two Hamiltonian Lorenz systems unidirectionally coupled, the first like a master/transmitter system and the other like a slave/receiver system in order to illustrate with numerical simulations the effectiveness of the modified scheme, using chaos synchronization with Hamiltonian forms and observer

The Schwinger Model on S 1: Hamiltonian Formulation, Vacuum and Anomaly

Science.gov (United States)

Stuart, David

2014-12-01

We present a Hamiltonian formulation of the Schwinger model with spatial domain taken to be the circle. It is shown that, in Coulomb gauge, the Hamiltonian is a semi-bounded, self-adjoint operator which is invariant under the group of large gauge transformations. There is a nontrivial action of on fermionic Fock space and its vacuum. This action plays a role analogous to that played by the spectral flow in the infinite Dirac sea formalism. The formulation allows (1) a description of the anomaly and its relation to the group action, and (2) an explicit identification of the vacuum. The anomaly in the chiral conservation law appears as a consequence of insisting upon semi-boundedness and gauge invariance of the quantized Hamiltonian.

A modified chaos-based communication scheme using Hamiltonian forms and observer

Energy Technology Data Exchange (ETDEWEB)

Lopez-Mancilla, D [Engineering Faculty, Baja California Autonomous University (UABC), Km. 103, Carretera Tijuana-Ensenada, 22860, Ensenada, B.C. (Mexico); Cruz-Hernandez, C [Telematics Direction, Scientific Research and Advanced Studies of Ensenada (CICESE), Km. 107 Carretera Tijuana-Ensenada, 22860 Ensenada, B.C. (Mexico); Posadas-Castillo, C [Engineering Faculty, Baja California Autonomous University (UABC), Km. 103, Carretera Tijuana-Ensenada, 22860, Ensenada, B.C. (Mexico); Faculty of Engineering Mechanic and Electrical (FIME), Nuevo Leon Autonomous University (UANL), Pedro de alba s/n Cd. Universitaria San Nicolas de los Garza N.L. (Mexico)

2005-01-01

In this work, a modified chaos-based communication scheme is presented. In particular, we use the modified scheme proposed by Lopez-Mancilla and Cruz-Hernandez (2005), that improves the basic scheme for chaotic masking using a single transmission channel proposed by Cuomo and coworkers (1993). It is extended for a special class of Generalized Hamiltonian systems. Substantial differences that significantly affect the reception quality of the sent message, with or without considering noise effect in the transmission channel are given. We use two Hamiltonian Lorenz systems unidirectionally coupled, the first like a master/transmitter system and the other like a slave/receiver system in order to illustrate with numerical simulations the effectiveness of the modified scheme, using chaos synchronization with Hamiltonian forms and observer.

Surface Andreev Bound States and Odd-Frequency Pairing in Topological Superconductor Junctions

Science.gov (United States)

Tanaka, Yukio; Tamura, Shun

2018-04-01

In this review, we summarize the achievement of the physics of surface Andreev bound states (SABS) up to now. The route of this activity has started from the physics of SABS of unconventional superconductors where the pair potential has a sign change on the Fermi surface. It has been established that SABS can be regarded as a topological edge state with topological invariant defined in the bulk Hamiltonian. On the other hand, SABS accompanies odd-frequency pairing like spin-triplet s-wave or spin-singlet p-wave. In a spin-triplet superconductor junction, induced odd-frequency pairing can penetrate into a diffusive normal metal (DN) attached to the superconductor. It causes so called anomalous proximity effect where the local density of states of quasiparticle in DN has a zero energy peak. When bulk pairing symmetry is spin-triplet px-wave, the anomalous proximity effect becomes prominent and the zero bias voltage conductance is always quantized independent of the resistance in DN and interface. Finally, we show that the present anomalous proximity effect is realized in an artificial topological superconducting system, where a nanowire with spin-orbit coupling and Zeeman field is put on the conventional spin-singlet s-wave superconductor.

Symmetry and resonance in Hamiltonian systems

NARCIS (Netherlands)

Tuwankotta, J.M.; Verhulst, F.

2000-01-01

In this paper we study resonances in two degrees of freedom, autonomous, hamiltonian systems. Due to the presence of a symmetry condition on one of the degrees of freedom, we show that some of the resonances vanish as lower order resonances. After giving a sharp estimate of the resonance domain, we

Symmetry and resonance in Hamiltonian systems

NARCIS (Netherlands)

Tuwankotta, J.M.; Verhulst, F.

1999-01-01

In this paper we study resonances in two degrees of freedom, autonomous, hamiltonian systems. Due to the presence of a symmetry condition on one of the degrees of freedom, we show that some of the resonances vanish as lower order resonances. After determining the size of the resonance domain, we

arXiv Lightcone Effective Hamiltonians and RG Flows

CERN Document Server

Fitzpatrick, A. Liam; Katz, Emanuel; Vitale, Lorenzo G.; Walters, Matthew T.

We present a prescription for an effective lightcone (LC) Hamiltonian that includes the effects of zero modes, focusing on the case of Conformal Field Theories (CFTs) deformed by relevant operators. We show how the prescription resolves a number of issues with LC quantization, including i) the apparent non-renormalization of the vacuum, ii) discrepancies in critical values of bare parameters in equal-time vs LC quantization, and iii) an inconsistency at large N in CFTs with simple AdS duals. We describe how LC quantization can drastically simplify Hamiltonian truncation methods applied to some large N CFTs, and discuss how the prescription identifies theories where these simplifications occur. We demonstrate and check our prescription in a number of examples.

Riemannian geometry of Hamiltonian chaos: hints for a general theory.

Science.gov (United States)

Cerruti-Sola, Monica; Ciraolo, Guido; Franzosi, Roberto; Pettini, Marco

2008-10-01

We aim at assessing the validity limits of some simplifying hypotheses that, within a Riemmannian geometric framework, have provided an explanation of the origin of Hamiltonian chaos and have made it possible to develop a method of analytically computing the largest Lyapunov exponent of Hamiltonian systems with many degrees of freedom. Therefore, a numerical hypotheses testing has been performed for the Fermi-Pasta-Ulam beta model and for a chain of coupled rotators. These models, for which analytic computations of the largest Lyapunov exponents have been carried out in the mentioned Riemannian geometric framework, appear as paradigmatic examples to unveil the reason why the main hypothesis of quasi-isotropy of the mechanical manifolds sometimes breaks down. The breakdown is expected whenever the topology of the mechanical manifolds is nontrivial. This is an important step forward in view of developing a geometric theory of Hamiltonian chaos of general validity.

Hamiltonians and variational principles for Alfvén simple waves

International Nuclear Information System (INIS)

Webb, G M; Hu, Q; Roux, J A le; Dasgupta, B; Zank, G P

2012-01-01

The evolution equations for the magnetic field induction B with the wave phase for Alfvén simple waves are expressed as variational principles and in the Hamiltonian form. The evolution of B with the phase (which is a function of the space and time variables) depends on the generalized Frenet–Serret equations, in which the wave normal n (which is a function of the phase) is taken to be tangent to a curve X, in a 3D Cartesian geometry vector space. The physical variables (the gas density, fluid velocity, gas pressure and magnetic field induction) in the wave depend only on the phase. Three approaches are developed. One approach exploits the fact that the Frenet equations may be written as a 3D Hamiltonian system, which can be described using the Nambu bracket. It is shown that B as a function of the phase satisfies a modified version of the Frenet equations, and hence the magnetic field evolution equations can be expressed in the Hamiltonian form. A second approach develops an Euler–Poincaré variational formulation. A third approach uses the Frenet frame formulation, in which the hodograph of B moves on a sphere of constant radius and uses a stereographic projection transformation due to Darboux. The equations for the projected field components reduce to a complex Riccati equation. By using a Cole–Hopf transformation, the Riccati equation reduces to a linear second order differential equation for the new variable. A Hamiltonian formulation of the second order differential equation then allows the system to be written in the Hamiltonian form. Alignment dynamics equations for Alfvén simple waves give rise to a complex Riccati equation or, equivalently, to a quaternionic Riccati equation, which can be mapped onto the Riccati equation obtained by stereographic projection. (paper)

Jacobi fields of completely integrable Hamiltonian systems

International Nuclear Information System (INIS)

Giachetta, G.; Mangiarotti, L.; Sardanashvily, G.

2003-01-01

We show that Jacobi fields of a completely integrable Hamiltonian system of m degrees of freedom make up an extended completely integrable system of 2m degrees of freedom, where m additional first integrals characterize a relative motion

Air parcels and air particles: Hamiltonian dynamics

NARCIS (Netherlands)

Bokhove, Onno; Lynch, Peter

We present a simple Hamiltonian formulation of the Euler equations for fluid flow in the Lagrangian framework. In contrast to the conventional formulation, which involves coupled partial differential equations, our "innovative'' mathematical formulation involves only ordinary differential equations

Quadratic time dependent Hamiltonians and separation of variables

International Nuclear Information System (INIS)

Anzaldo-Meneses, A.

2017-01-01

Time dependent quantum problems defined by quadratic Hamiltonians are solved using canonical transformations. The Green’s function is obtained and a comparison with the classical Hamilton–Jacobi method leads to important geometrical insights like exterior differential systems, Monge cones and time dependent Gaussian metrics. The Wei–Norman approach is applied using unitary transformations defined in terms of generators of the associated Lie groups, here the semi-direct product of the Heisenberg group and the symplectic group. A new explicit relation for the unitary transformations is given in terms of a finite product of elementary transformations. The sequential application of adequate sets of unitary transformations leads naturally to a new separation of variables method for time dependent Hamiltonians, which is shown to be related to the Inönü–Wigner contraction of Lie groups. The new method allows also a better understanding of interacting particles or coupled modes and opens an alternative way to analyze topological phases in driven systems. - Highlights: • Exact unitary transformation reducing time dependent quadratic quantum Hamiltonian to zero. • New separation of variables method and simultaneous uncoupling of modes. • Explicit examples of transformations for one to four dimensional problems. • New general evolution equation for quadratic form in the action, respectively Green’s function.

Universal localizing bounds for compact invariant sets of natural polynomial Hamiltonian systems

International Nuclear Information System (INIS)

Starkov, Konstantin E.

2008-01-01

In this Letter we study the localization problem of compact invariant sets of natural Hamiltonian systems with a polynomial Hamiltonian. Our results are based on applying the first order extremum conditions. We compute universal localizing bounds for some domain containing all compact invariant sets of a Hamiltonian system by using one quadratic function of a simple form. These bounds depend on the value of the total energy of the system, degree and some coefficients of a potential and, in addition, some positive number got as a result of a solution of one maximization problem. Besides, under some quasihomogeneity condition(s) we generalize our construction of the localization set

Universal localizing bounds for compact invariant sets of natural polynomial Hamiltonian systems

Energy Technology Data Exchange (ETDEWEB)

Starkov, Konstantin E. [CITEDI-IPN, Av. del Parque 1310, Mesa de Otay, Tijuana, BC (Mexico)], E-mail: konst@citedi.mx

2008-10-06

In this Letter we study the localization problem of compact invariant sets of natural Hamiltonian systems with a polynomial Hamiltonian. Our results are based on applying the first order extremum conditions. We compute universal localizing bounds for some domain containing all compact invariant sets of a Hamiltonian system by using one quadratic function of a simple form. These bounds depend on the value of the total energy of the system, degree and some coefficients of a potential and, in addition, some positive number got as a result of a solution of one maximization problem. Besides, under some quasihomogeneity condition(s) we generalize our construction of the localization set.

Extended hamiltonian formalism and Lorentz-violating lagrangians

Directory of Open Access Journals (Sweden)

Don Colladay

2017-09-01

Full Text Available A new perspective on the classical mechanical formulation of particle trajectories in Lorentz-violating theories is presented. Using the extended hamiltonian formalism, a Legendre Transformation between the associated covariant lagrangian and hamiltonian varieties is constructed. This approach enables calculation of trajectories using Hamilton's equations in momentum space and the Euler–Lagrange equations in velocity space away from certain singular points that arise in the theory. Singular points are naturally de-singularized by requiring the trajectories to be smooth functions of both velocity and momentum variables. In addition, it is possible to identify specific sheets of the dispersion relations that correspond to specific solutions for the lagrangian. Examples corresponding to bipartite Finsler functions are computed in detail. A direct connection between the lagrangians and the field-theoretic solutions to the Dirac equation is also established for a special case.

Extended hamiltonian formalism and Lorentz-violating lagrangians

Science.gov (United States)

Colladay, Don

2017-09-01

A new perspective on the classical mechanical formulation of particle trajectories in Lorentz-violating theories is presented. Using the extended hamiltonian formalism, a Legendre Transformation between the associated covariant lagrangian and hamiltonian varieties is constructed. This approach enables calculation of trajectories using Hamilton's equations in momentum space and the Euler-Lagrange equations in velocity space away from certain singular points that arise in the theory. Singular points are naturally de-singularized by requiring the trajectories to be smooth functions of both velocity and momentum variables. In addition, it is possible to identify specific sheets of the dispersion relations that correspond to specific solutions for the lagrangian. Examples corresponding to bipartite Finsler functions are computed in detail. A direct connection between the lagrangians and the field-theoretic solutions to the Dirac equation is also established for a special case.

Astrophysical evidence for the non-Hermitian but PT-symmetric Hamiltonian of conformal gravity

International Nuclear Information System (INIS)

Mannheim, P.D.

2013-01-01

In this review we discuss the connection between two seemingly disparate topics, macroscopic gravity on astrophysical scales and Hamiltonians that are not Hermitian but PT symmetric on microscopic ones. In particular we show that the quantum-mechanical unitarity problem of the fourth-order derivative conformal gravity theory is resolved by recognizing that the scalar product appropriate to the theory is not the Dirac norm associated with a Hermitian Hamiltonian but is instead the norm associated with a non-Hermitian but PT-symmetric Hamiltonian. Moreover, the fourth-order theory Hamiltonian is not only not Hermitian, it is not even diagonalizable, being of Jordan-block form. With PT symmetry we establish that conformal gravity is consistent at the quantum-mechanical level. In consequence, we can apply the theory to data, to find that the theory is capable of naturally accounting for the systematics of the rotation curves of a large and varied sample of 138 spiral galaxies without any need for dark matter. The success of the fits provides evidence for the relevance of non-diagonalizable but PT-symmetric Hamiltonians to physics. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

On the integrability of a Hamiltonian reduction of a 2+1-dimensional non-isothermal rotating gas cloud system

International Nuclear Information System (INIS)

Rogers, C; Schief, W K

2011-01-01

A 2+1-dimensional version of a non-isothermal gas dynamic system with origins in the work of Ovsiannikov and Dyson on spinning gas clouds is shown to admit a Hamiltonian reduction which is completely integrable when the adiabatic index γ = 2. This nonlinear dynamical subsystem is obtained via an elliptic vortex ansatz which is intimately related to the construction of a Lax pair in the integrable case. The general solution of the gas dynamic system is derived in terms of Weierstrass (elliptic) functions. The latter derivation makes use of a connection with a stationary nonlinear Schrödinger equation and a Steen–Ermakov–Pinney equation, the superposition principle of which is based on the classical Lamé equation

A Class of Hamiltonians for a Three-Particle Fermionic System at Unitarity

Energy Technology Data Exchange (ETDEWEB)

Correggi, M., E-mail: michele.correggi@gmail.com [Università degli Studi Roma Tre, Largo San Leonardo Murialdo 1, Dipartimento di Matematica e Fisica (Italy); Dell’Antonio, G. [“Sapienza” Università di Roma, P.le A. Moro 5, Dipartimento di Matematica (Italy); Finco, D. [Università Telematica Internazionale Uninettuno, Corso V. Emanuele II 39, Facoltà di Ingegneria (Italy); Michelangeli, A. [Scuola Internazionale Superiore di Studi Avanzati, Via Bonomea 265 (Italy); Teta, A. [“Sapienza” Università di Roma, P.le A. Moro 5, Dipartimento di Matematica (Italy)

2015-12-15

We consider a quantum mechanical three-particle system made of two identical fermions of mass one and a different particle of mass m, where each fermion interacts via a zero-range force with the different particle. In particular we study the unitary regime, i.e., the case of infinite two-body scattering length. The Hamiltonians describing the system are, by definition, self-adjoint extensions of the free Hamiltonian restricted on smooth functions vanishing at the two-body coincidence planes, i.e., where the positions of two interacting particles coincide. It is known that for m larger than a critical value m{sup ∗} ≃ (13.607){sup −1} a self-adjoint and lower bounded Hamiltonian H{sub 0} can be constructed, whose domain is characterized in terms of the standard point-interaction boundary condition at each coincidence plane. Here we prove that for m ∈ (m{sup ∗},m{sup ∗∗}), where m{sup ∗∗} ≃ (8.62){sup −1}, there is a further family of self-adjoint and lower bounded Hamiltonians H{sub 0,β}, β ∈ ℝ, describing the system. Using a quadratic form method, we give a rigorous construction of such Hamiltonians and we show that the elements of their domains satisfy a further boundary condition, characterizing the singular behavior when the positions of all the three particles coincide.

A Class of Hamiltonians for a Three-Particle Fermionic System at Unitarity

International Nuclear Information System (INIS)

Correggi, M.; Dell’Antonio, G.; Finco, D.; Michelangeli, A.; Teta, A.

2015-01-01

We consider a quantum mechanical three-particle system made of two identical fermions of mass one and a different particle of mass m, where each fermion interacts via a zero-range force with the different particle. In particular we study the unitary regime, i.e., the case of infinite two-body scattering length. The Hamiltonians describing the system are, by definition, self-adjoint extensions of the free Hamiltonian restricted on smooth functions vanishing at the two-body coincidence planes, i.e., where the positions of two interacting particles coincide. It is known that for m larger than a critical value m ∗ ≃ (13.607) −1 a self-adjoint and lower bounded Hamiltonian H 0 can be constructed, whose domain is characterized in terms of the standard point-interaction boundary condition at each coincidence plane. Here we prove that for m ∈ (m ∗ ,m ∗∗ ), where m ∗∗ ≃ (8.62) −1 , there is a further family of self-adjoint and lower bounded Hamiltonians H 0,β , β ∈ ℝ, describing the system. Using a quadratic form method, we give a rigorous construction of such Hamiltonians and we show that the elements of their domains satisfy a further boundary condition, characterizing the singular behavior when the positions of all the three particles coincide

A Class of Quasi-exact Solutions of Rabi Hamiltonian

International Nuclear Information System (INIS)

Pan Feng; Yao Youkun; Xie Mingxia; Han Wenjuan; Draayer, J.P.

2007-01-01

A class of quasi-exact solutions of the Rabi Hamiltonian, which describes a two-level atom interacting with a single-mode radiation field via a dipole interaction without the rotating-wave approximation, are obtained by using a wavefunction ansatz. Exact solutions for part of the spectrum are obtained when the atom-field coupling strength and the field frequency satisfy certain relations. As an example, the lowest exact energy level and the corresponding atom-field entanglement at the quasi-exactly solvable point are calculated and compared to results from the Jaynes-Cummings and counter-rotating cases of the Rabi Hamiltonian.

Useful forms of the Hamiltonian for ion-optical systems

International Nuclear Information System (INIS)

Davies, W.G.

1991-04-01

The symbiosis of differential algebra and the Lie-algebraic formulation of optics provides a set of very powerful tools for analyzing and understanding the orbit dynamics of complex accelerators up to very high orders. In order to use these tools effectively it is usually necessary to express the Hamiltonian in the appropriate coordinate system. In this report, the relativistic Hamiltonian is derived in curvilinear (the fundamental coordinate system for ion-optics), Cartesian and polar coordinates, in forms suitable for solving problems in ion optics and accelerator physics both with and without the help of differential algebra

High Field In Vivo 13C Magnetic Resonance Spectroscopy of Brain by Random Radiofrequency Heteronuclear Decoupling and Data Sampling

Science.gov (United States)

Li, Ningzhi; Li, Shizhe; Shen, Jun

2017-06-01

In vivo 13C magnetic resonance spectroscopy (MRS) is a unique and effective tool for studying dynamic human brain metabolism and the cycling of neurotransmitters. One of the major technical challenges for in vivo 13C-MRS is the high radio frequency (RF) power necessary for heteronuclear decoupling. In the common practice of in vivo 13C-MRS, alkanyl carbons are detected in the spectra range of 10-65ppm. The amplitude of decoupling pulses has to be significantly greater than the large one-bond 1H-13C scalar coupling (1JCH=125-145 Hz). Two main proton decoupling methods have been developed: broadband stochastic decoupling and coherent composite or adiabatic pulse decoupling (e.g., WALTZ); the latter is widely used because of its efficiency and superb performance under inhomogeneous B1 field. Because the RF power required for proton decoupling increases quadratically with field strength, in vivo 13C-MRS using coherent decoupling is often limited to low magnetic fields (protons via weak long-range 1H-13C scalar couplings, which can be decoupled using low RF power broadband stochastic decoupling. Recently, the carboxylic/amide 13C-MRS technique using low power random RF heteronuclear decoupling was safely applied to human brain studies at 7T. Here, we review the two major decoupling methods and the carboxylic/amide 13C-MRS with low power decoupling strategy. Further decreases in RF power deposition by frequency-domain windowing and time-domain random under-sampling are also discussed. Low RF power decoupling opens the possibility of performing in vivo 13C experiments of human brain at very high magnetic fields (such as 11.7T), where signal-to-noise ratio as well as spatial and temporal spectral resolution are more favorable than lower fields.

Conventional hamiltonian for first-order differential systems

International Nuclear Information System (INIS)

Farias, J.R.

1984-01-01

Lagrangian systems corresponding to a given set of 2n first-order ordinary differential equations are singular ones. In despite this, it is shown that these systems can be put into a Hamiltonian form in the usual manner. (Author) [pt

Ab initio Hamiltonian approach to light nuclei and quantum field theory

International Nuclear Information System (INIS)

Vary, James P.

2009-01-01

A basis-function approach that has proven successful for solving the nonrelativistic strongly interacting nuclear many-body problem and appears promising for solving relativistic field theory in a light-front Hamiltonian framework is presented. Both conventional nuclear manybody theory and light-front field theory face common issues within the Hamiltonian approach - i.e. how to; (1) define the Hamiltonian; (2) renormalize to a finite space; (3) solve for non-perturbative observables, preserving as many symmetries as possible; and (4) take the continuum limit. Each of these challenges requires a substantial undertaking but appears solvable. Advances in computational physics, both algorithms and parallel computers, have proven essential to the recent progress. I will present results that illustrate the recent advances and indicate the path forward to ever more realistic applications

NATO Advanced Study Institute on Hamiltonian Dynamical Systems and Applications

CERN Document Server

2008-01-01

Physical laws are for the most part expressed in terms of differential equations, and natural classes of these are in the form of conservation laws or of problems of the calculus of variations for an action functional. These problems can generally be posed as Hamiltonian systems, whether dynamical systems on finite dimensional phase space as in classical mechanics, or partial differential equations (PDE) which are naturally of infinitely many degrees of freedom. This volume is the collected and extended notes from the lectures on Hamiltonian dynamical systems and their applications that were given at the NATO Advanced Study Institute in Montreal in 2007. Many aspects of the modern theory of the subject were covered at this event, including low dimensional problems as well as the theory of Hamiltonian systems in infinite dimensional phase space; these are described in depth in this volume. Applications are also presented to several important areas of research, including problems in classical mechanics, continu...

Chaos and order in models of black hole pairs

International Nuclear Information System (INIS)

Levin, Janna

2006-01-01

Chaos in the orbits of black hole pairs has by now been confirmed by several independent groups. While the chaotic behavior of binary black hole orbits is no longer argued, it remains difficult to quantify the importance of chaos to the evolutionary dynamics of a pair of comparable mass black holes. None of our existing approximations are robust enough to offer convincing quantitative conclusions in the most highly nonlinear regime. It is intriguing to note that, in three different approximations to a black hole pair built of a spinning black hole and a nonspinning companion, two approximations exhibit chaos and one approximation does not. The fully relativistic scenario of a spinning test mass around a Schwarzschild black hole shows chaos, as does the post-Newtonian Lagrangian approximation. However, the approximately equivalent post-Newtonian Hamiltonian approximation does not show chaos when only one body spins. It is well known in dynamical systems theory that one system can be regular while an approximately related system is chaotic, so there is no formal conflict. However, the physical question remains: Is there chaos for comparable mass binaries when only one object spins? We are unable to answer this question given the poor convergence of the post-Newtonian approximation to the fully relativistic system. A resolution awaits better approximations that can be trusted in the highly nonlinear regime

Hamiltonian Anomalies from Extended Field Theories

Science.gov (United States)

Monnier, Samuel

2015-09-01

We develop a proposal by Freed to see anomalous field theories as relative field theories, namely field theories taking value in a field theory in one dimension higher, the anomaly field theory. We show that when the anomaly field theory is extended down to codimension 2, familiar facts about Hamiltonian anomalies can be naturally recovered, such as the fact that the anomalous symmetry group admits only a projective representation on the Hilbert space, or that the latter is really an abelian bundle gerbe over the moduli space. We include in the discussion the case of non-invertible anomaly field theories, which is relevant to six-dimensional (2, 0) superconformal theories. In this case, we show that the Hamiltonian anomaly is characterized by a degree 2 non-abelian group cohomology class, associated to the non-abelian gerbe playing the role of the state space of the anomalous theory. We construct Dai-Freed theories, governing the anomalies of chiral fermionic theories, and Wess-Zumino theories, governing the anomalies of Wess-Zumino terms and self-dual field theories, as extended field theories down to codimension 2.

Effective Hamiltonians for phosphorene and silicene

International Nuclear Information System (INIS)

Lew Yan Voon, L C; Lopez-Bezanilla, A; Wang, J; Zhang, Y; Willatzen, M

2015-01-01

We derived the effective Hamiltonians for silicene and phosphorene with strain, electric field and magnetic field using the method of invariants. Our paper extends the work of Geissler et al 2013 (New J. Phys. 15 085030) on silicene, and Li and Appelbaum 2014 (Phys. Rev. B 90, 115439) on phosphorene. Our Hamiltonians are compared to an equivalent one for graphene. For silicene, the expression for band warping is obtained analytically and found to be of different order than for graphene. We prove that a uniaxial strain does not open a gap, resolving contradictory numerical results in the literature. For phosphorene, it is shown that the bands near the Brillouin zone center only have terms in even powers of the wave vector. We predict that the energies change quadratically in the presence of a perpendicular external electric field but linearly in a perpendicular magnetic field, as opposed to those for silicene which vary linearly in both cases. Preliminary ab initio calculations for the intrinsic band structures have been carried out in order to evaluate some of the k⋅p parameters. (paper)

Quantum recurrence and fractional dynamic localization in ac-driven perfect state transfer Hamiltonians

International Nuclear Information System (INIS)

Longhi, Stefano

2014-01-01

Quantum recurrence and dynamic localization are investigated in a class of ac-driven tight-binding Hamiltonians, the Krawtchouk quantum chain, which in the undriven case provides a paradigmatic Hamiltonian model that realizes perfect quantum state transfer and mirror inversion. The equivalence between the ac-driven single-particle Krawtchouk Hamiltonian H -hat (t) and the non-interacting ac-driven bosonic junction Hamiltonian enables to determine in a closed form the quasi energy spectrum of H -hat (t) and the conditions for exact wave packet reconstruction (dynamic localization). In particular, we show that quantum recurrence, which is predicted by the general quantum recurrence theorem, is exact for the Krawtchouk quantum chain in a dense range of the driving amplitude. Exact quantum recurrence provides perfect wave packet reconstruction at a frequency which is fractional than the driving frequency, a phenomenon that can be referred to as fractional dynamic localization

Superradiance, disorder, and the non-Hermitian Hamiltonian in open quantum systems

Energy Technology Data Exchange (ETDEWEB)

Celardo, G. L.; Biella, A.; Giusteri, G. G.; Mattiotti, F. [Dipartimento di Matematica e Fisica and Interdisciplinary Laboratories for Advanced Materials Physics, Università Cattolica, via Musei 41, 25121 Brescia (Italy); Zhang, Y.; Kaplan, L. [Department of Physics and Engineering Physics, Tulane University, New Orleans, Louisiana 70118 (United States)

2014-10-15

We first briefly review the non-Hermitian effective Hamiltonian approach to open quantum systems and the associated phenomenon of superradiance. We next discuss the superradiance crossover in the presence of disorder and the relationship between superradiance and the localization transition. Finally, we investigate the regime of validity of the energy-independent effective Hamiltonian approximation and show that the results obtained by these methods are applicable to realistic physical systems.

Optimal control methods for rapidly time-varying Hamiltonians

International Nuclear Information System (INIS)

Motzoi, F.; Merkel, S. T.; Wilhelm, F. K.; Gambetta, J. M.

2011-01-01

In this article, we develop a numerical method to find optimal control pulses that accounts for the separation of timescales between the variation of the input control fields and the applied Hamiltonian. In traditional numerical optimization methods, these timescales are treated as being the same. While this approximation has had much success, in applications where the input controls are filtered substantially or mixed with a fast carrier, the resulting optimized pulses have little relation to the applied physical fields. Our technique remains numerically efficient in that the dimension of our search space is only dependent on the variation of the input control fields, while our simulation of the quantum evolution is accurate on the timescale of the fast variation in the applied Hamiltonian.

Hamiltonian dynamics of spatially-homogeneous Vlasov-Einstein systems

International Nuclear Information System (INIS)

Okabe, Takahide; Morrison, P. J.; Friedrichsen, J. E. III; Shepley, L. C.

2011-01-01

We introduce a new matter action principle, with a wide range of applicability, for the Vlasov equation in terms of a conjugate pair of functions. Here we apply this action principle to the study of matter in Bianchi cosmological models in general relativity. The Bianchi models are spatially-homogeneous solutions to the Einstein field equations, classified by the three-dimensional Lie algebra that describes the symmetry group of the model. The Einstein equations for these models reduce to a set of coupled ordinary differential equations. The class A Bianchi models admit a Hamiltonian formulation in which the components of the metric tensor and their time derivatives yield the canonical coordinates. The evolution of anisotropy in the vacuum Bianchi models is determined by a potential due to the curvature of the model, according to its symmetry. For illustrative purposes, we examine the evolution of anisotropy in models with Vlasov matter. The Vlasov content is further simplified by the assumption of cold, counter-streaming matter, a kind of matter that is far from thermal equilibrium and is not describable by an ordinary fluid model nor other more simplistic matter models. Qualitative differences and similarities are found in the dynamics of certain vacuum class A Bianchi models and Bianchi type I models with cold, counter-streaming Vlasov-matter potentials analogous to the curvature potentials of corresponding vacuum models.

Additional integrals of the motion of classical Hamiltonian wave systems

International Nuclear Information System (INIS)

Shul'man, E.I.

1989-01-01

It is shown that a classical Hamiltonian wave system that possesses at least one additional integral of the motion with quadratic principal part has an infinite number of such integrals in the cases of both nondegenerate and degenerate dispersion laws. Conditions under which in a space of dimension d ≥ 2 a system with nondegenerate dispersion law is completely integratable and its Hamiltonian can be reduced to normal form are found. In the case of a degenerate dispersion law integrals are not sufficient for complete integrability

Reaction Hamiltonian and state-to-state description of chemical reactions

International Nuclear Information System (INIS)

Ruf, B.A.; Kresin, V.Z.; Lester, W.A. Jr.

1985-08-01

A chemical reaction is treated as a quantum transition from reactants to products. A specific reaction Hamiltonian (in second quantization formalism) is introduced. The approach leads to Franck-Condon-like factor, and adiabatic method in the framework of the nuclear motion problems. The influence of reagent vibrational state on the product energy distribution has been studied following the reaction Hamiltonian method. Two different cases (fixed available energy and fixed translational energy) are distinguished. Results for several biomolecular reactions are presented. 40 refs., 5 figs

Pairing and seniority in an equations-of-motion approach to nuclear structure theory

International Nuclear Information System (INIS)

Covello, A.; Andreozzi, F.; Gargano, A.; Porrino, A.

1990-01-01

In this paper, some achievements of an equations-of-motion approach to nuclear structure theory are discussed. As an introduction to the main subject, a brief survey of some early work is given. We then describe a formalism for treating the pairing-force problem and show, by numerical appllications, that at the lowest order of approximation it provides an advantageous alternative to the BCS method. Finally, we discuss how to treat a general shell-model Hamiltonian within the framework of the seniority scheme. This makes it possible to further reduce seniority-truncated shell-model spaces, as is illustrated by examples. (orig.)

Coherent states of systems with quadratic Hamiltonians

Energy Technology Data Exchange (ETDEWEB)

Bagrov, V.G., E-mail: bagrov@phys.tsu.ru [Department of Physics, Tomsk State University, Tomsk (Russian Federation); Gitman, D.M., E-mail: gitman@if.usp.br [Tomsk State University, Tomsk (Russian Federation); Pereira, A.S., E-mail: albertoufcg@hotmail.com [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Instituto de Fisica

2015-06-15

Different families of generalized coherent states (CS) for one-dimensional systems with general time-dependent quadratic Hamiltonian are constructed. In principle, all known CS of systems with quadratic Hamiltonian are members of these families. Some of the constructed generalized CS are close enough to the well-known due to Schroedinger and Glauber CS of a harmonic oscillator; we call them simply CS. However, even among these CS, there exist different families of complete sets of CS. These families differ by values of standard deviations at the initial time instant. According to the values of these initial standard deviations, one can identify some of the families with semiclassical CS. We discuss properties of the constructed CS, in particular, completeness relations, minimization of uncertainty relations and so on. As a unknown application of the general construction, we consider different CS of an oscillator with a time dependent frequency. (author)

Coherent states of systems with quadratic Hamiltonians

International Nuclear Information System (INIS)

Bagrov, V.G.; Gitman, D.M.; Pereira, A.S.

2015-01-01

Different families of generalized coherent states (CS) for one-dimensional systems with general time-dependent quadratic Hamiltonian are constructed. In principle, all known CS of systems with quadratic Hamiltonian are members of these families. Some of the constructed generalized CS are close enough to the well-known due to Schroedinger and Glauber CS of a harmonic oscillator; we call them simply CS. However, even among these CS, there exist different families of complete sets of CS. These families differ by values of standard deviations at the initial time instant. According to the values of these initial standard deviations, one can identify some of the families with semiclassical CS. We discuss properties of the constructed CS, in particular, completeness relations, minimization of uncertainty relations and so on. As a unknown application of the general construction, we consider different CS of an oscillator with a time dependent frequency. (author)

Quantization of non-Hamiltonian physical systems

International Nuclear Information System (INIS)

Bolivar, A.O.

1998-09-01

We propose a general method of quantization of non-Hamiltonian physical systems. Applying it, for example, to a dissipative system coupled to a thermal reservoir described by the Fokker-Planck equation, we are able to obtain the Caldeira-Leggett master equation, the non-linear Schroedinger-Langevin equation and Caldirola-Kanai equation (with an additional term), as particular cases. (author)

Edge-disjoint Hamiltonian cycles in hypertournaments

DEFF Research Database (Denmark)

Thomassen, Carsten

2006-01-01

We introduce a method for reducing k-tournament problems, for k >= 3, to ordinary tournaments, that is, 2-tournaments. It is applied to show that a k-tournament on n >= k + 1 + 24d vertices (when k >= 4) or on n >= 30d + 2 vertices (when k = 3) has d edge-disjoint Hamiltonian cycles if and only...

Hamiltonian diagonalization in foliable space-times: A method to find the modes

International Nuclear Information System (INIS)

Castagnino, M.; Ferraro, R.

1989-01-01

A way to obtain modes diagonalizing the canonical Hamiltonian of a minimally coupled scalar quantum field, in a foliable space-time, is shown. The Cauchy data for these modes are found to be the eigenfunctions of a second-order differential operator that could be interpreted as the squared Hamiltonian for the first-quantized relativistic particle in curved space

Random walks and a simple chirally invariant lattice Hamiltonian without fermion doubling

International Nuclear Information System (INIS)

Belyea, C.I.

1992-01-01

It is shown that there is a simple chirally-invariant lattice Hamiltonian for fermions which is doubling-free but non-Hermitian and which may be valuable in lattice Hamiltonian studies of quantum chromodynamics. A connection is established between the existence of random walk representations of spinor propagators and this doubling-free formulation, in analogy with Wilson fermions. 15 refs

Quantum control mechanism analysis through field based Hamiltonian encoding

International Nuclear Information System (INIS)

Mitra, Abhra; Rabitz, Herschel

2006-01-01

Optimal control of quantum dynamics in the laboratory is proving to be increasingly successful. The control fields can be complex, and the mechanisms by which they operate have often remained obscure. Hamiltonian encoding (HE) has been proposed as a method for understanding mechanisms in quantum dynamics. In this context mechanism is defined in terms of the dominant quantum pathways leading to the final state of the controlled system. HE operates by encoding a special modulation into the Hamiltonian and decoding its signature in the dynamics to determine the dominant pathway amplitudes. Earlier work encoded the modulation directly into the Hamiltonian operators. This present work introduces the alternative scheme of field based HE, where the modulation is encoded into the control field and not directly into the Hamiltonian operators. This distinct form of modulation yields a new perspective on mechanism and is computationally faster than the earlier approach. Field based encoding is also an important step towards a laboratory based algorithm for HE as it is the only form of encoding that may be experimentally executed. HE is also extended to cover systems with noise and uncertainty and finally, a hierarchical algorithm is introduced to reveal mechanism in a stepwise fashion of ever increasing detail as desired. This new hierarchical algorithm is an improvement over earlier approaches to HE where the entire mechanism was determined in one stroke. The improvement comes from the use of less complex modulation schemes, which leads to fewer evaluations of Schroedinger's equation. A number of simulations are presented on simple systems to illustrate the new field based encoding technique for mechanism assessment

Hamiltonian approach to GR. Pt. 2. Covariant theory of quantum gravity

Energy Technology Data Exchange (ETDEWEB)

Cremaschini, Claudio [Faculty of Philosophy and Science, Silesian University in Opava, Institute of Physics and Research Center for Theoretical Physics and Astrophysics, Opava (Czech Republic); Tessarotto, Massimo [University of Trieste, Department of Mathematics and Geosciences, Trieste (Italy); Faculty of Philosophy and Science, Silesian University in Opava, Institute of Physics, Opava (Czech Republic)

2017-05-15

A non-perturbative quantum field theory of General Relativity is presented which leads to a new realization of the theory of covariant quantum gravity (CQG-theory). The treatment is founded on the recently identified Hamiltonian structure associated with the classical space-time, i.e., the corresponding manifestly covariant Hamilton equations and the related Hamilton-Jacobi theory. The quantum Hamiltonian operator and the CQG-wave equation for the corresponding CQG-state and wave function are realized in 4-scalar form. The new quantum wave equation is shown to be equivalent to a set of quantum hydrodynamic equations which warrant the consistency with the classical GR Hamilton-Jacobi equation in the semiclassical limit. A perturbative approximation scheme is developed, which permits the adoption of the harmonic oscillator approximation for the treatment of the Hamiltonian potential. As an application of the theory, the stationary vacuum CQG-wave equation is studied, yielding a stationary equation for the CQG-state in terms of the 4-scalar invariant-energy eigenvalue associated with the corresponding approximate quantum Hamiltonian operator. The conditions for the existence of a discrete invariant-energy spectrum are pointed out. This yields a possible estimate for the graviton mass together with a new interpretation about the quantum origin of the cosmological constant. (orig.)

Centrifugal distortion coefficients of asymmetric-top molecules: Reduction of the octic terms of the rotational Hamiltonian

Science.gov (United States)

Ramachandra Rao, Ch. V. S.

1983-11-01

The rotational Hamiltonian of an asymmetric-top molecule in its standard form, containing terms up to eighth degree in the components of the total angular momentum, is transformed by a unitary transformation with parameters Spqr to a reduced Hamiltonian so as to avoid the indeterminacies inherent in fitting the complete Hamiltonian to observed energy levels. Expressions are given for the nine determinable combinations of octic constants Θ' i ( i = 1 to 9) which are invariant under the unitary transformation. A method of reduction suitable for energy calculations by matrix diagonalization is considered. The relations between the coefficients of the transformed Hamiltonian, for suitable choice of the parameters Spqr, and those of the reduced Hamiltonian are given. This enables the determination of the nine octic constants Θ' i in terms of the experimental constants.

Hamiltonian structure for rescaled integrable Lorenz systems

International Nuclear Information System (INIS)

Haas, F.; Goedert, J.

1993-01-01

It is shown that three among the known invariants for the Lorenz system recast the original equations into a Hamiltonian form. This is made possible by an appropriate time-dependent rescaling and the use of a generalized formalism with non-trivial structure functions. (author)

Periodic Hamiltonian hierarchies and non-uniqueness of ...

Indian Academy of Sciences (India)

2016-12-02

Dec 2, 2016 ... Ca. 1. Introduction. Through the past few decades, research in supersym- ... The subject of periodic Hamiltonians has been exam- ined for a long time ... The plan of this paper is as follows: In §2, a brief resume of SUSYQM is ...

Optimized t-expansion method for the Rabi Hamiltonian

International Nuclear Information System (INIS)

Travenec, Igor; Samaj, Ladislav

2011-01-01

A polemic arose recently about the applicability of the t-expansion method to the calculation of the ground state energy E 0 of the Rabi model. For specific choices of the trial function and very large number of involved connected moments, the t-expansion results are rather poor and exhibit considerable oscillations. In this Letter, we formulate the t-expansion method for trial functions containing two free parameters which capture two exactly solvable limits of the Rabi Hamiltonian. At each order of the t-series, E 0 is assumed to be stationary with respect to the free parameters. A high accuracy of E 0 estimates is achieved for small numbers (5 or 6) of involved connected moments, the relative error being smaller than 10 -4 (0.01%) within the whole parameter space of the Rabi Hamiltonian. A special symmetrization of the trial function enables us to calculate also the first excited energy E 1 , with the relative error smaller than 10 -2 (1%). -- Highlights: → We study the ground state energy of the Rabi Hamiltonian. → We use the t-expansion method with an optimized trial function. → High accuracy of estimates is achieved, the relative error being smaller than 0.01%. → The calculation of the first excited state energy is made. The method has a general applicability.

Multiple multi-orbit fermionic and bosonic pairing and rotational SU(3) algebras

International Nuclear Information System (INIS)

Kota, V.K.B.

2017-01-01

In nuclei with valence nucleons that are identical nucleons and occupy r number of j-orbits, there will be 2 r-1 number of multiple pairing (quasi-spin) SU(2) algebras with the generalized pair creation operator S + being a sum of single-j pair creation operators with arbitrary phases. Also, for each set of phases there will be a corresponding Sp(2Ω) algebra in U(2Ω) ⊃ Sp(2Ω); Ω = ∑ (2j+1)/2. Using this correspondence, derived is the condition for a general one-body operator of angular momentum rank k to be a quasi-spin scalar or a vector vis-a-vis the phases in S + . These will give special seniority selection rules for electromagnetic transitions. We found that the phase choice advocated by Arvieu and Moszkowski gives pairing Hamiltonians having maximum correlation with well known effective interactions. All the results derived for identical fermion systems are shown to extend to identical boson systems such as sd, sp, sdg and sdpf interacting boson models (IBM's) with SU(2) → SU(1,1) and Sp(2/Omega) → SO(2Ω). Going beyond pairing, for a given set of oscillator orbits, there are multiple rotational SU(3) algebras both in shell model and IBM's. Different SU(3) algebras in IBM's are shown, using sdg IBM as an example, to give different geometric shapes.

Treatment of the intrinsic Hamiltonian in particle-number nonconserving theories

International Nuclear Information System (INIS)

Hergert, H.; Roth, R.

2009-01-01

We discuss the implications of using an intrinsic Hamiltonian in theories without particle-number conservation, e.g., the Hartree-Fock-Bogoliubov approximation, where the Hamiltonian's particle-number dependence leads to discrepancies if one naively replaces the particle-number operator by its expectation value. We develop a systematic expansion that fixes this problem and leads to an a posteriori justification of the widely-used one- plus two-body form of the intrinsic kinetic energy in nuclear self-consistent field methods. The expansion's convergence properties as well as its practical applications are discussed for several sample nuclei.

Hamiltonian models for the Madelung fluid and generalized Langevin equations

International Nuclear Information System (INIS)

Nonnenmacher, T.F.

1985-01-01

We present a Hamiltonian formulation of some type of an 'electromagnetic' Madelung fluid leading to a fluid mechanics interpretation of the Aharonov-Bohm effect and to a subsidary condition to be required in order to make the correspondence between Schroedinger's quantum mechanics and Madelung's fluid mechanics unique. Then we discuss some problems related with the Brownian oscillator. Our aim is to start out with a Hamiltonian for the composite system with surrounding heat bath) and to finally arrive at a stochastic differential equation with completely determined statistical properties. (orig./HSI)

Reality of Energy Spectra in Multi-dimensional Hamiltonians Having Pseudo Hermiticity with Respect to the Exchange Operator

International Nuclear Information System (INIS)

Nanayakkara, Asiri

2005-01-01

The pseudo Hermiticity with respect to the exchange operators of N-D complex Hamiltonians is investigated. It is shown that if an N-D Hamiltonian is pseudo Hermitian and any eigenfunction of it retains π α T symmetry then the corresponding eigen value is real, where π α is an exchange operator with respect to the permutation α of coordinates and T is the time reversal operator. We construct a special class of N-D pseudo Hermitian Hamiltonians with respect to exchange operators from both N/2-D and N-D general complex Hamiltonians. Examples are presented for Hamiltonians with πT symmetry (π:x↔y, p x ↔p y ) and the reality of these systems are investigated.

A simple global representation for second-order normal forms of Hamiltonian systems relative to periodic flows

International Nuclear Information System (INIS)

Avendaño-Camacho, M; Vallejo, J A; Vorobjev, Yu

2013-01-01

We study the determination of the second-order normal form for perturbed Hamiltonians relative to the periodic flow of the unperturbed Hamiltonian H 0 . The formalism presented here is global, and can be easily implemented in any computer algebra system. We illustrate it by means of two examples: the Hénon–Heiles and the elastic pendulum Hamiltonians. (paper)

Equilibrium Solutions of the Logarithmic Hamiltonian Leapfrog for the N-body Problem

Science.gov (United States)

Minesaki, Yukitaka

2018-04-01

We prove that a second-order logarithmic Hamiltonian leapfrog for the classical general N-body problem (CGNBP) designed by Mikkola and Tanikawa and some higher-order logarithmic Hamiltonian methods based on symmetric multicompositions of the logarithmic algorithm exactly reproduce the orbits of elliptic relative equilibrium solutions in the original CGNBP. These methods are explicit symplectic methods. Before this proof, only some implicit discrete-time CGNBPs proposed by Minesaki had been analytically shown to trace the orbits of elliptic relative equilibrium solutions. The proof is therefore the first existence proof for explicit symplectic methods. Such logarithmic Hamiltonian methods with a variable time step can also precisely retain periodic orbits in the classical general three-body problem, which generic numerical methods with a constant time step cannot do.

A unified theoretical framework for mapping models for the multi-state Hamiltonian.

Science.gov (United States)

Liu, Jian

2016-11-28

We propose a new unified theoretical framework to construct equivalent representations of the multi-state Hamiltonian operator and present several approaches for the mapping onto the Cartesian phase space. After mapping an F-dimensional Hamiltonian onto an F+1 dimensional space, creation and annihilation operators are defined such that the F+1 dimensional space is complete for any combined excitation. Commutation and anti-commutation relations are then naturally derived, which show that the underlying degrees of freedom are neither bosons nor fermions. This sets the scene for developing equivalent expressions of the Hamiltonian operator in quantum mechanics and their classical/semiclassical counterparts. Six mapping models are presented as examples. The framework also offers a novel way to derive such as the well-known Meyer-Miller model.

New bi-Hamiltonian systems on the plane

Science.gov (United States)

Tsiganov, A. V.

2017-06-01

We discuss several new bi-Hamiltonian integrable systems on the plane with integrals of motion of third, fourth, and sixth orders in momenta. The corresponding variables of separation, separated relations, compatible Poisson brackets, and recursion operators are also presented in the framework of the Jacobi method.

Skyrme's interaction beyond the mean-field. The DGCM+GOA Hamiltonian of nuclear quadrupole motion

Energy Technology Data Exchange (ETDEWEB)

Kluepfel, Peter

2008-07-29

This work focuses on the microscopic description of nuclear collective quadrupole motion within the framework of the dynamic Generator-Coordinate-Method(DGCM)+Gaussian-Overlap-Approximation(GOA). Skyrme-type effective interactions are used as the fundamental many-particle interaction. Starting from a rotational invariant, polynomial and topologic consistent formulation of the GCM+GOA Hamiltonian an interpolation scheme for the collective masses and potential is developed. It allows to define the collective Hamiltonian of fully triaxial collective quadrupole dynamics from a purely axial symmetric configuration space. The substantial gain in performance allows the self-consistent evaluation of the dynamic quadrupole mass within the ATDHF-cranking model. This work presents the first large-scale analysis of quadrupole correlation energies and lowlying collective states within the DGCM+GOA model. Different Skyrme- and pairing interactions are compared from old standards up to more recent parameterizations. After checking the validity of several approximations to the DGCM+GOA model - both on the mean-field and the collective level - we proceed with a detailed investigation of correlation effects along the chains of semi-magic isotopes and isotones. This finally allows to define a set of observables which are hardly affected by collective correlations. Those observables were used for a refit of a Skyrme-type effective interaction which is expected to cure most of the problems of the recent parameterizations. Preparing further work, estimates for the correlated ground state energy are proposed which can be evaluated directly from the mean-field model. (orig.)

Tsallis thermostatistics for finite systems: a Hamiltonian approach

Science.gov (United States)

Adib, Artur B.; Moreira, Andrã© A.; Andrade, José S., Jr.; Almeida, Murilo P.

2003-05-01

The derivation of the Tsallis generalized canonical distribution from the traditional approach of the Gibbs microcanonical ensemble is revisited (Phys. Lett. A 193 (1994) 140). We show that finite systems whose Hamiltonians obey a generalized homogeneity relation rigorously follow the nonextensive thermostatistics of Tsallis. In the thermodynamical limit, however, our results indicate that the Boltzmann-Gibbs statistics is always recovered, regardless of the type of potential among interacting particles. This approach provides, moreover, a one-to-one correspondence between the generalized entropy and the Hamiltonian structure of a wide class of systems, revealing a possible origin for the intrinsic nonlinear features present in the Tsallis formalism that lead naturally to power-law behavior. Finally, we confirm these exact results through extensive numerical simulations of the Fermi-Pasta-Ulam chain of anharmonic oscillators.

Hamiltonian systems in accelerator physics

International Nuclear Information System (INIS)

Laslett, L.J.

1985-06-01

General features of the design of annular particle accelerators or storage rings are outlined and the Hamiltonian character of individual-ion motion is indicated. Examples of phase plots are presented, for the motion in one spatial degree of freedom, of an ion subject to a periodic nonlinear focusing force. A canonical transformation describing coupled nonlinear motion also is given, and alternative types of graphical display are suggested for the investigation of long-term stability in such cases. 7 figs

Iterated Hamiltonian type systems and applications

Science.gov (United States)

Tiba, Dan

2018-04-01

We discuss, in arbitrary dimension, certain Hamiltonian type systems and prove existence, uniqueness and regularity properties, under the independence condition. We also investigate the critical case, define a class of generalized solutions and prove existence and basic properties. Relevant examples and counterexamples are also indicated. The applications concern representations of implicitly defined manifolds and their perturbations, motivated by differential systems involving unknown geometries.

Geometry and Hamiltonian mechanics on discrete spaces

International Nuclear Information System (INIS)

Talasila, V; Clemente-Gallardo, J; Schaft, A J van der

2004-01-01

Numerical simulation is often crucial for analysing the behaviour of many complex systems which do not admit analytic solutions. To this end, one either converts a 'smooth' model into a discrete (in space and time) model, or models systems directly at a discrete level. The goal of this paper is to provide a discrete analogue of differential geometry, and to define on these discrete models a formal discrete Hamiltonian structure-in doing so we try to bring together various fundamental concepts from numerical analysis, differential geometry, algebraic geometry, simplicial homology and classical Hamiltonian mechanics. For example, the concept of a twisted derivation is borrowed from algebraic geometry for developing a discrete calculus. The theory is applied to a nonlinear pendulum and we compare the dynamics obtained through a discrete modelling approach with the dynamics obtained via the usual discretization procedures. Also an example of an energy-conserving algorithm on a simple harmonic oscillator is presented, and its effect on the Poisson structure is discussed

Quantum mechanical Hamiltonian models of discrete processes

International Nuclear Information System (INIS)

Benioff, P.

1981-01-01

Here the results of other work on quantum mechanical Hamiltonian models of Turing machines are extended to include any discrete process T on a countably infinite set A. The models are constructed here by use of scattering phase shifts from successive scatterers to turn on successive step interactions. Also a locality requirement is imposed. The construction is done by first associating with each process T a model quantum system M with associated Hilbert space H/sub M/ and step operator U/sub T/. Since U/sub T/ is not unitary in general, M, H/sub M/, and U/sub T/ are extended into a (continuous time) Hamiltonian model on a larger space which satisfies the locality requirement. The construction is compared with the minimal unitary dilation of U/sub T/. It is seen that the model constructed here is larger than the minimal one. However, the minimal one does not satisfy the locality requirement

Integrable Hamiltonian systems and interactions through quadratic constraints

International Nuclear Information System (INIS)

Pohlmeyer, K.

1975-08-01

Osub(n)-invariant classical relativistic field theories in one time and one space dimension with interactions that are entirely due to quadratic constraints are shown to be closely related to integrable Hamiltonian systems. (orig.) [de

Hamiltonian formulation and statistics of an attracting system of nonlinear oscillators

International Nuclear Information System (INIS)

Tasso, H.

1987-10-01

An attracting system of r nonlinear oscillators of an extended van der Pol type was investigated with respect to Hamiltonian formulation. The case of r=2 is rather simple, though nontrivial. For r>2 the tests with Jacobi's identity and Frechet derivatives are negative if Hamiltonians in the natural variables are looked for. Independently, a Liouville theorem is proved and equilibrium statistics is made possible, which leads to a Gaussian distribution in the natural variables. (orig.)

The lattice spinor QED Hamiltonian critique of the continuous space approach

International Nuclear Information System (INIS)

Sidorov, A.V.; Zastavenko, L.G.

1993-01-01

We give the irreproachable, from the point of view of gauge invariance, derivation of the lattice spinor QED Hamiltonian. Our QED Hamiltonian is manifestly gauge invariant. We point out important defects of the continuous space formulation of the QED that make, in our opinion, the lattice QED obviously preferable to the continuous space QED. We state that it is impossible to give a continuous space QED formulation which is compatible with the condition of gauge invariance. 17 refs

Supersymmetric Extension of Non-Hermitian su(2 Hamiltonian and Supercoherent States

Directory of Open Access Journals (Sweden)

Omar Cherbal

2010-12-01

Full Text Available A new class of non-Hermitian Hamiltonians with real spectrum, which are written as a real linear combination of su(2 generators in the form H=ωJ_3+αJ_−+βJ_+, α≠β, is analyzed. The metrics which allows the transition to the equivalent Hermitian Hamiltonian is established. A pseudo-Hermitian supersymmetic extension of such Hamiltonians is performed. They correspond to the pseudo-Hermitian supersymmetric systems of the boson-phermion oscillators. We extend the supercoherent states formalism to such supersymmetic systems via the pseudo-unitary supersymmetric displacement operator method. The constructed family of these supercoherent states consists of two dual subfamilies that form a bi-overcomplete and bi-normal system in the boson-phermion Fock space. The states of each subfamily are eigenvectors of the boson annihilation operator and of one of the two phermion lowering operators.

Reductions of topologically massive gravity I: Hamiltonian analysis of second order degenerate Lagrangians

Science.gov (United States)

Ćaǧatay Uçgun, Filiz; Esen, Oǧul; Gümral, Hasan

2018-01-01

We present Skinner-Rusk and Hamiltonian formalisms of second order degenerate Clément and Sarıoğlu-Tekin Lagrangians. The Dirac-Bergmann constraint algorithm is employed to obtain Hamiltonian realizations of Lagrangian theories. The Gotay-Nester-Hinds algorithm is used to investigate Skinner-Rusk formalisms of these systems.

Recent progress in heteronuclear long-range NMR of complex carbohydrates: 3D H2BC and clean HMBC

DEFF Research Database (Denmark)

Meier, Sebastian; Petersen, Bent O.; Duus, Jens Øllgaard

2009-01-01

carbohydrates whose structure has been determined by NMR, not least due to the enhanced resolution offered by the third dimension in 3D H2BC and the improved spectral quality due to artifact suppression in clean HMBC. Hence these new experiments set the scene to take advantage of the sensitivity boost achieved...... by the latest generation of cold probes for NMR structure determination of even larger and more complex carbohydrates in solution.......The new NMR experiments 3D H2BC and clean HMBC are explored for challenging applications to a complex carbohydrate at natural abundance of 13C. The 3D H2BC experiment is crucial for sequential assignment as it yields heteronuclear one- and two-bond together with COSY correlations for the 1H spins...

Determination of Hamiltonian matrix for IBM4 and compare it is self value with shells model

International Nuclear Information System (INIS)

Slyman, S.; Hadad, S.; Souman, H.

2004-01-01

The Hamiltonian is determined using the procedure OAI and the mapping of (IBM4) states into the shell model, which is based on the seniority classification scheme. A boson sub-matrix of the shell model Hamiltonian for the (sd) 4 configuration is constructed, and is proved to produce the same eigenvalues as the shell model Hamiltonian for the corresponding fermion states. (authors)

Steiner systems and large non-Hamiltonian hypergraphs

Directory of Open Access Journals (Sweden)

Zsolt Tuza

2006-10-01

Full Text Available From Steiner systems S(k − 2, 2k − 3, v, we construct k-uniform hyper- graphs of large size without Hamiltonian cycles. This improves previous estimates due to G. Y. Katona and H. Kierstead [J. Graph Theory 30 (1999, pp.  205–212].

Synthesis and investigation of new heteronuclear [Zn-La] coordination compounds based on unsaturated lanthanum complex with N,N'-tetraethyl-N''-trichloacetylphosphortriamide

International Nuclear Information System (INIS)

Amyirkhanov, O.V.; Sliva, T.Yu.; Moroz, O.V.; Trush, Je.A.; Frits'kij, Yi.O.

2011-01-01

New heteronuclear [Zn-La] coordination compounds, perspective luminescent materials, with general formulas [Zn(Ve)La(X) 2 (Ac)] ({Zn-La;Ve;X}) and [Zn(Vp)La(X) 2 (Ac)] ({Zn-La;Vp;X}) have been synthesized HX=CCl 3 C(O)NHP(O)[N(C 2 H 5 ) 2 ] 2 - N,N'-tetraethyl-N''-trichloracetylphosphortriamide, H 2 Ve and H 2 Vp are products of the condensation of 1,2-diaminoethane and 1,3-diaminopropane with o-vanillin, respectively). The composition of [Zn-La] complexes has been determined, and the coordination mode of a phosphorylated ligand has been suggested by element analysis, IR- and 1 H, 31 P NMR-spectroscopy.

Gauged Hamiltonians for free particle on surfaces in configuration and phase spaces

Directory of Open Access Journals (Sweden)

M Dehghani

2016-06-01

Full Text Available We present a method to gauge second class systems consisted of two constraints in the chain structure. In this method we added a momentum counterpart of Wess Zumino coordinate to primary constraint and used the first class condition to find a new and gauged Hamiltonian. Primary constraints were assumed as identities in configuration and phase space and we tried to find general Hamiltonians

Error bounds for molecular Hamiltonians inverted from experimental data

International Nuclear Information System (INIS)

Geremia, J.M.; Rabitz, Herschel

2003-01-01

Inverting experimental data provides a powerful technique for obtaining information about molecular Hamiltonians. However, rigorously quantifying how laboratory error propagates through the inversion algorithm has always presented a challenge. In this paper, we develop an inversion algorithm that realistically treats experimental error. It propagates the distribution of observed laboratory measurements into a family of Hamiltonians that are statistically consistent with the distribution of the data. This algorithm is built upon the formalism of map-facilitated inversion to alleviate computational expense and permit the use of powerful nonlinear optimization algorithms. Its capabilities are demonstrated by identifying inversion families for the X 1 Σ g + and a 3 Σ u + states of Na 2 that are consistent with the laboratory data

Quantum Hamiltonian reduction and conformal field theories

International Nuclear Information System (INIS)

Bershadsky, M.

1991-01-01

It is proved that irreducible representation of the Virasoro algebra can be extracted from an irreducible representation space of the SL (2, R) current algebra by putting a constraint on the latter using the BRST formalism. Thus there is a SL(2, R) symmetry in the Virasoro algebra which is gauged and hidden. This construction of the Virasoro algebra is the quantum analog of the Hamiltonian reduction. The author then naturally leads to consider an SL(2, R) Wess-Zumino-Witten model. This system is related to the quantum field theory of the coadjoint orbit of the Virasoro group. Based on this result he presents the canonical derivation of the SL(2, R) current algebra in Polyakov's theory of two dimensional gravity; it is manifestation of the SL(2, R) symmetry in the conformal field theory hidden by the quantum Hamiltonian reduction. He discusses the quantum Hamiltonian reduction of the SL(n, R) current algebra for the general type of constraints labeled by index 1 ≤ l ≤ (n - 1) and claim that it leads to the new extended conformal algebras W n l . For l = 1 he recovers the well known W n algebra introduced by A. Zamolodchikov. For SL(3, R) Wess-Zumino-Witten model there are two different possibilities of constraining it. The first possibility gives the W 3 algebra, while the second leads to the new chiral algebra W 3 2 generated by the stress-energy tensor, two bosonic supercurrents with spins 3/2 and the U(1) current. He conjectures a Kac formula that describes the highly reducible representation for this algebra. He also makes some speculations concerning the structure of W gravity

g Algebra and two-dimensional quasiexactly solvable Hamiltonian ...

Indian Academy of Sciences (India)

Keywords. g2 algebra; quasiexactly solvable Hamiltonian; hidden algebra; Poschl–Teller potential. ... space of the polynomials, restricting to a linear transformation on this space, the associ- .... The operators L6 and L7 are the positive root.

Exact solution of the generalized time-dependent Jaynes-Cummings Hamiltonian

International Nuclear Information System (INIS)

Gruver, J.L.; Aliaga, J.; Cerdeira, H.A.; Proto, A.N.

1993-04-01

A time-dependent generalization of the Jaynes-Cummings Hamiltonian is studied using the maximum entropy formalism. The approach, related to a semi-Lie algebra, allows to find three different sets of physical relevant operators which describe the dynamics of the system for any temporal dependence. It is shown how the initial conditions of the operators are determined via the maximum entropy principle density operator, where the inclusion of the temperature turns the description of the problem into a thermodynamical one. The generalized time-independent Jaynes-Cummings Hamiltonian is exactly solved as a particular example. (author). 14 refs

Resolutions of Identity for Some Non-Hermitian Hamiltonians. II. Proofs

Directory of Open Access Journals (Sweden)

Andrey V. Sokolov

2011-12-01

Full Text Available This part is a continuation of the Part I where we built resolutions of identity for certain non-Hermitian Hamiltonians constructed of biorthogonal sets of their eigen- and associated functions for the spectral problem defined on entire axis. Non-Hermitian Hamiltonians under consideration are taken with continuous spectrum and the following cases are examined: an exceptional point of arbitrary multiplicity situated on a boundary of continuous spectrum and an exceptional point situated inside of continuous spectrum. In the present work the rigorous proofs are given for the resolutions of identity in both cases.

Nonstandard conserved Hamiltonian structures in dissipative/damped systems: Nonlinear generalizations of damped harmonic oscillator

International Nuclear Information System (INIS)

Pradeep, R. Gladwin; Chandrasekar, V. K.; Senthilvelan, M.; Lakshmanan, M.

2009-01-01

In this paper we point out the existence of a remarkable nonlocal transformation between the damped harmonic oscillator and a modified Emden-type nonlinear oscillator equation with linear forcing, xe+αxx+βx 3 +γx=0, which preserves the form of the time independent integral, conservative Hamiltonian, and the equation of motion. Generalizing this transformation we prove the existence of nonstandard conservative Hamiltonian structure for a general class of damped nonlinear oscillators including Lienard-type systems. Further, using the above Hamiltonian structure for a specific example, namely, the generalized modified Emden equation xe+αx q x+βx 2q+1 =0, where α, β, and q are arbitrary parameters, the general solution is obtained through appropriate canonical transformations. We also present the conservative Hamiltonian structure of the damped Mathews-Lakshmanan oscillator equation. The associated Lagrangian description for all the above systems is also briefly discussed.

Hamiltonian formulation of anomaly free chiral bosons

International Nuclear Information System (INIS)

Abdalla, E.; Abdalla, M.C.B.; Devecchi, F.P.; Zadra, A.

1988-01-01

Starting out of an anomaly free Lagrangian formulation for chiral scalars, which a Wess-Zumino Term (to cancel the anomaly), we formulate the corresponding hamiltonian problem. Ther we use the (quantum) Siegel invariance to choose a particular, which turns out coincide with the obtained by Floreanini and Jackiw. (author) [pt

Hamiltonian theory of guiding-center motion

Energy Technology Data Exchange (ETDEWEB)

Littlejohn, R.G.

1980-05-01

A Hamiltonian treatment of the guiding center problem is given which employs noncanonical coordinates in phase space. Separation of the unperturbed system from the perturbation is achieved by using a coordinate transformation suggested by a theorem of Darboux. As a model to illustrate the method, motion in the magnetic field B=B(x,y)z is studied. Lie transforms are used to carry out the perturbation expansion.

Hamiltonian theory of guiding-center motion

International Nuclear Information System (INIS)

Littlejohn, R.G.

1980-05-01

A Hamiltonian treatment of the guiding center problem is given which employs noncanonical coordinates in phase space. Separation of the unperturbed system from the perturbation is achieved by using a coordinate transformation suggested by a theorem of Darboux. As a model to illustrate the method, motion in the magnetic field B=B(x,y)z is studied. Lie transforms are used to carry out the perturbation expansion

Simulating continuous-time Hamiltonian dynamics by way of a discrete-time quantum walk

International Nuclear Information System (INIS)

Schmitz, A.T.; Schwalm, W.A.

2016-01-01

Much effort has been made to connect the continuous-time and discrete-time quantum walks. We present a method for making that connection for a general graph Hamiltonian on a bigraph. Furthermore, such a scheme may be adapted for simulating discretized quantum models on a quantum computer. A coin operator is found for the discrete-time quantum walk which exhibits the same dynamics as the continuous-time evolution. Given the spectral decomposition of the graph Hamiltonian and certain restrictions, the discrete-time evolution is solved for explicitly and understood at or near important values of the parameters. Finally, this scheme is connected to past results for the 1D chain. - Highlights: • A discrete-time quantum walk is purposed which approximates a continuous-time quantum walk. • The purposed quantum walk could be used to simulate Hamiltonian dynamics on a quantum computer. • Given the spectra decomposition of the Hamiltonian, the quantum walk is solved explicitly. • The method is demonstrated and connected to previous work done on the 1D chain.

A Hamiltonian approach to model and analyse networks of ...

Indian Academy of Sciences (India)

2015-09-24

Sep 24, 2015 ... Gyroscopes; energy harvesters; synchronization; Hamiltonian mechanics. ... ideas and methods from nonlinear dynamics system theory, in particular, ... deploy highly sensitive, lowpower, magnetic and electric field sensors.

Newton algorithm for Hamiltonian characterization in quantum control

International Nuclear Information System (INIS)

Ndong, M; Sugny, D; Salomon, J

2014-01-01

We propose a Newton algorithm to characterize the Hamiltonian of a quantum system interacting with a given laser field. The algorithm is based on the assumption that the evolution operator of the system is perfectly known at a fixed time. The computational scheme uses the Crank–Nicholson approximation to explicitly determine the derivatives of the propagator with respect to the Hamiltonians of the system. In order to globalize this algorithm, we use a continuation method that improves its convergence properties. This technique is applied to a two-level quantum system and to a molecular one with a double-well potential. The numerical tests show that accurate estimates of the unknown parameters are obtained in some cases. We discuss the numerical limits of the algorithm in terms of the basin of convergence and the non-uniqueness of the solution. (paper)

Witnessing eigenstates for quantum simulation of Hamiltonian spectra

Science.gov (United States)

Santagati, Raffaele; Wang, Jianwei; Gentile, Antonio A.; Paesani, Stefano; Wiebe, Nathan; McClean, Jarrod R.; Morley-Short, Sam; Shadbolt, Peter J.; Bonneau, Damien; Silverstone, Joshua W.; Tew, David P.; Zhou, Xiaoqi; O’Brien, Jeremy L.; Thompson, Mark G.

2018-01-01

The efficient calculation of Hamiltonian spectra, a problem often intractable on classical machines, can find application in many fields, from physics to chemistry. We introduce the concept of an “eigenstate witness” and, through it, provide a new quantum approach that combines variational methods and phase estimation to approximate eigenvalues for both ground and excited states. This protocol is experimentally verified on a programmable silicon quantum photonic chip, a mass-manufacturable platform, which embeds entangled state generation, arbitrary controlled unitary operations, and projective measurements. Both ground and excited states are experimentally found with fidelities >99%, and their eigenvalues are estimated with 32 bits of precision. We also investigate and discuss the scalability of the approach and study its performance through numerical simulations of more complex Hamiltonians. This result shows promising progress toward quantum chemistry on quantum computers. PMID:29387796

Experimental Hamiltonian identification for controlled two-level systems

International Nuclear Information System (INIS)

Schirmer, S.G.; Kolli, A.; Oi, D.K.L.

2004-01-01

We present a strategy to empirically determine the internal and control Hamiltonians for an unknown two-level system (black box) subject to various (piecewise constant) control fields when direct readout by measurement is limited to a single, fixed observable

Hamiltonian Monte Carlo study of the N=1 Wess-Zumino model on the lattice in 1+1 dimensions

International Nuclear Information System (INIS)

Schiller, A.

1984-01-01

1+1 dimensional models with restricted supersymmetry are studied. The problems of formulating supersymmetric models on the lattice are overcome by working in the Hamiltonian lattice formulation and using restricted supersymmetry algebra involving only the Hamiltonian. For the two-dimensional Wess-Zumino model a lattice Hamiltonian suitable for the local Hamiltonian method is obtained. Using this method field theoretical models with fermions and scalar Higgs fields are investigated. Emphasis is laid on supersymmetry breaking and soliton formation

The hamiltonian structures of the KP hierarchy

International Nuclear Information System (INIS)

Das, A.; Panda, S.; Huang Wenjui

1991-01-01

We obtain the two hamiltonian structures of the KP hierarchy following the method of Drinfeld and Sokolov. We point out how the second structure of Drinfeld and Sokolov needs to be modified in the present case. We briefly comment on the connection between these structures and the W 1+∞ algebra. (orig.)

On the quantization of sectorially Hamiltonian dissipative systems

Energy Technology Data Exchange (ETDEWEB)

Castagnino, M. [Instituto de Fisica de Rosario, 2000 Rosario (Argentina); Instituto de Astronomia y Fisica del Espacio, Casilla de Correos 67, Sucursal 28, 1428 Buenos Aires (Argentina); Gadella, M. [Instituto de Fisica de Rosario, 2000 Rosario (Argentina); Departamento de Fisica Teorica, Atomica y Optica, Facultad de Ciencias, Universidad de Valladolid, 47005 Valladolid (Spain)], E-mail: manuelgadella@yahoo.com.ar; Lara, L.P. [Instituto de Fisica de Rosario, 2000 Rosario (Argentina); Facultad Regional Rosario, UTN, 2000 Rosario (Argentina)

2009-10-15

We present a theoretical discussion showing that, although some dissipative systems may have a sectorial Hamiltonian description, this description does not allow for canonical quantization. However, a quantum Liouville counterpart of these systems is possible, although it is not unique.

On the quantization of sectorially Hamiltonian dissipative systems

International Nuclear Information System (INIS)

Castagnino, M.; Gadella, M.; Lara, L.P.

2009-01-01

We present a theoretical discussion showing that, although some dissipative systems may have a sectorial Hamiltonian description, this description does not allow for canonical quantization. However, a quantum Liouville counterpart of these systems is possible, although it is not unique.

Relating Lagrangian and Hamiltonian Formalisms of LC Circuits

NARCIS (Netherlands)

Clemente-Gallardo, Jesús; Scherpen, Jacquelien M.A.

2003-01-01

The Lagrangian formalism earlier defined for (switching) electrical circuits, is adapted to the Lagrangian formalism defined on Lie algebroids. This allows us to define regular Lagrangians and consequently, well-defined Hamiltonian descriptions of arbitrary LC networks. The relation with other

Parametrization of open systems with effective quadratic hamiltonians plus stochastic force

International Nuclear Information System (INIS)

Hernandez, E.S.; Mizrahi, S.S.

1981-12-01

The evolution generated by general dissipative Hamiltonians is analyzed when a stochastic force is included. A mapping technique allows to easily write the equations of motion for the observables of interest. A general dissipativity condition is extracted, whose fullfilment guarantees that thermal equilibrium is reached as the final stage of the evolution. Several existing frictional Hamiltonians are examined and it is seen that the correlation of the fluctuating force is essential to the destruction of a constant of motion inherent to pure quantal behaviour. (Author) [pt