WorldWideScience

Sample records for hemorrhagic volume stereotactic-guided

  1. Cirurgia estereotáxica guiada para angiomas cavernosos Stereotactic-guided surgery for cavernous angioma

    Directory of Open Access Journals (Sweden)

    MURILO S. MENESES

    2000-03-01

    Full Text Available Os angiomas cavernosos intracerebrais são lesões que podem causar hemorragias, crises convulsivas e déficits neurológicos. Essa patologia passou a ter diagnóstico mais precoce com o advento da ressonância magnética. A remoção radical por cirurgia é o melhor método de tratamento. Devido a frequente localização subcortical ou profunda, a utilização de métodos de localização por imagem como a estereotaxia apresentam várias vantagens como: menor incisão de pele, craniotomia e manipulação do tecido cerebral, consequentemente com menor morbidade. Apresentamos uma série de nove angiomas cavernosos tratados por ressecção cirúrgica radical guiada por estereotaxia. Em todos os casos o diagnóstico foi realizado por ressonância magnética e houve confirmação anátomo-patológica. A média de idade dos pacientes foi 30 anos, variando entre 20 e 54 anos. Como morbidade transitória, um paciente teve uma crise convulsiva no 3° dia pós-operatório e uma paciente apresentou disfasia e hemiparesia no 2° dia pós-operatório, com recuperação total na evolução. No total, a remoção foi radical em todos os casos e os pacientes permanecem sem nenhum déficit neurológico relacionado à cirurgia.Intracerebral cavernous angiomas may cause hemorrhage, epileptic seizures and neurological deficits. The diagnosis of these lesions became easier with the advent of the magnetic resonance image (MRI. Radical resection is the treatment of choice. Due to frequent subcortical or deep location, image-guided techniques, such as stereotactic-guided surgery, offer many advantages as smaller skin incision and craniotomy, less brain manipulation with consequently lower morbidity. We present a series of nine cavernous angiomas treated by stereotactic-guided radical surgical resection. The diagnosis was done by MRI and confirmed by pathologic studies in all cases. Mean age of patients was 30 years old (range 20-54 years. Postoperative morbidity

  2. Risk for postpartum hemorrhage, transfusion, and hemorrhage-related morbidity at low, moderate, and high volume hospitals.

    Science.gov (United States)

    Merriam, Audrey A; Wright, Jason D; Siddiq, Zainab; D'Alton, Mary E; Friedman, Alexander M; Ananth, Cande V; Bateman, Brian T

    2018-04-01

    The objective of this study was to characterize risk for and temporal trends in postpartum hemorrhage across hospitals with different delivery volumes. This study used the Nationwide Inpatient Sample (NIS) to characterize risk for postpartum hemorrhage from 1998 to 2011. Hospitals were classified as having either low, moderate or high delivery volume (≤1000, 1001 to 2000, >2000 deliveries per year, respectively). The primary outcomes included postpartum hemorrhage, transfusion, and related severe maternal morbidity. Adjusted models were created to assess factors associated with hemorrhage and transfusion. Of 55,140,088 deliveries included for analysis 1,512,212 (2.7%) had a diagnosis of postpartum hemorrhage and 361,081 (0.7%) received transfusion. Risk for morbidity and transfusion increased over the study period, while the rate of hemorrhage was stable ranging from 2.5 to 2.9%. After adjustment, hospital volume was not a major risk factor for transfusion or hemorrhage. While obstetric volume does not appear to be a major risk factor for either transfusion or hemorrhage, given that transfusion and hemorrhage-related maternal morbidity are increasing across hospital volume categories, there is an urgent need to improve obstetrical care for postpartum hemorrhage. Those risk factors are able to discriminate women at increased risk supports routine use of hemorrhage risk assessment.

  3. Comparison of intensity-modulated tomotherapy with stereotactically guided conformal radiotherapy for brain tumors.

    Science.gov (United States)

    Khoo, V S; Oldham, M; Adams, E J; Bedford, J L; Webb, S; Brada, M

    1999-09-01

    Intensity-modulated radiotherapy (IMRT) offers the potential to more closely conform dose distributions to the target, and spare organs at risk (OAR). Its clinical value is still being defined. The present study aims to compare IMRT with stereotactically guided conformal radiotherapy (SCRT) for patients with medium size convex-shaped brain tumors. Five patients planned with SCRT were replanned with the IMRT-tomotherapy method using the Peacock system (Nomos Corporation). The planning target volume (PTV) and relevant OAR were assessed, and compared relative to SCRT plans using dose statistics, dose-volume histograms (DVH), and the Radiation Therapy Oncology Group (RTOG) stereotactic radiosurgery criteria. The median and mean PTV were 78 cm3 and 85 cm3 respectively (range 62-119 cm3). The differences in PTV doses for the whole group (Peacock-SCRT +/-1 SD) were 2%+/-1.8 (minimum PTV), and 0.1%+/-1.9 (maximum PTV). The PTV homogeneity achieved by Peacock was 12.1%+/-1.7 compared to 13.9%+/-1.3 with SCRT. Using RTOG guidelines, Peacock plans provided acceptable PTV coverage for all 5/5 plans compared to minor coverage deviations in 4/5 SCRT plans; acceptable homogeneity index for both plans (Peacock = 1.1 vs. SCRT = 1.2); and comparable conformity index (1.4 each). As a consequence of the transaxial method of arc delivery, the optic nerves received mean and maximum doses that were 11.1 to 11.6%, and 10.3 to 15.2% higher respectively with Peacock plan. The maximum optic lens, and brainstem dose were 3.1 to 4.8% higher, and 0.6% lower respectively with Peacock plan. However, all doses remained below the tolerance threshold (5 Gy for lens, and 50 Gy for optic nerves) and were clinically acceptable. The Peacock method provided improved PTV coverage, albeit small, in this group of convex tumors. Although the OAR doses were higher using the Peacock plans, all doses remained within the clinically defined threshold and were clinically acceptable. Further improvements may be

  4. MRI-guided vacuum-assisted breast biopsy: comparison with stereotactically guided and ultrasound-guided techniques

    Energy Technology Data Exchange (ETDEWEB)

    Imschweiler, Thomas; Freiwald, Bianka; Kubik-Huch, Rahel A. [Kantonspital Baden AG, Institute for Radiology, Baden (Switzerland); Haueisen, Harald [Kantonspital Aarau AG, Institute for Radiology, Aarau (Switzerland); Kampmann, Gert [Clinica Sant' Anna, Lugano, Sorengo (Switzerland); Rageth, Luzi [Adjumed Services AG, Zurich (Switzerland); Seifert, Burkhardt [Institute for Social and Preventive Medicine, University of Zurich, Division of Biostatistics, Zuerich (Switzerland); Rageth, Christoph [Breast Centre, Zurich (Switzerland)

    2014-01-15

    To analyse the development of MRI-guided vacuum-assisted biopsy (VAB) in Switzerland and to compare the procedure with stereotactically guided and ultrasound-guided VAB. We performed a retrospective analysis of VABs between 2009 and 2011. A total of 9,113 VABs were performed. Of these, 557 were MRI guided. MRI-guided VAB showed the highest growth rate (97 %) of all three procedures. The technical success rates for MRI-guided, stereotactically guided and ultrasound-guided VAB were 98.4 % (548/557), 99.1 % (5,904/5,960) and 99.6 % (2,585/2,596), respectively. There were no significant differences (P = 0.12) between the MRI-guided and the stereotactically guided procedures. The technical success rate for ultrasound-guided VAB was significantly higher than that for MRI-guided VAB (P < 0.001). There were no complications using MRI-guided VAB requiring open surgery. The malignancy diagnosis rate for MRI-guided VAB was similar to that for stereotactically guided VAB (P = 0.35). MRI-guided VAB is a safe and accurate procedure that provides insight into clinical breast findings. (orig.)

  5. Colloid volume loading does not mitigate decreases in central blood volume during simulated hemorrhage while heat stressed

    DEFF Research Database (Denmark)

    Crandall, Craig G; Wilson, Thad E; Marving, Jens

    2012-01-01

    intravenous colloid volume loading (11 ml/kg). Relative changes in torso and regional blood volumes were determined by gamma camera imaging with technetium-99m labeled erythrocytes. Heat stress reduced blood volume in all regions (ranging from 7 to 16%), while subsequent volume loading returned those values......±5%, all P0.05 relative to heat stress alone). These data suggest that blood volume loading during passive heat stress (via 11 ml/kg of a colloid solution) normalizes regional blood volumes in the torso, but does not mitigate the reduction in central blood volume during a simulated hemorrhagic challenge...

  6. Acute volume expansion attenuates hyperthermia-induced reductions in cerebral perfusion during simulated hemorrhage

    DEFF Research Database (Denmark)

    Schlader, Zachary J; Seifert, Thomas; Wilson, Thad E

    2013-01-01

    a simulated hemorrhagic challenge induced by lower-body negative pressure (LBNP). Eight healthy young male subjects underwent a supine baseline period (pre-LBNP), followed by 15- and 30-mmHg LBNP while normothermic, hyperthermic (increased pulmonary artery blood temperature ~1.1°C), and following acute volume......Hyperthermia reduces the capacity to withstand a simulated hemorrhagic challenge, but volume loading preserves this capacity. This study tested the hypotheses that acute volume expansion during hyperthermia increases cerebral perfusion and attenuates reductions in cerebral perfusion during...... infusion while hyperthermic. Primary dependent variables were mean middle cerebral artery blood velocity (MCAvmean), serving as an index of cerebral perfusion; mean arterial pressure (MAP); and cardiac output (thermodilution). During baseline, hyperthermia reduced MCAvmean (P = 0.001) by 12 ± 9% relative...

  7. Noradrenaline and dobutamine effects on the volume expansion with normal saline in rabbits subjected to hemorrhage.

    Science.gov (United States)

    Ramalho, Gualter Lisboa; Vane, Matheus Fachini; Lima, Luciana Cavalcanti; Vane, Lucas Fachini; Amorim, Rosa Beatriz; Domingues, Maria Aparecida; Moraes, José Mariano Soares de; Carvalho, Lídia Raquel de; Tanaka, Pedro Paulo; Vane, Luiz Antonio

    2016-09-01

    To evaluate the effects of dobutamine (DB), noradrenaline (NA), and their combination (NADB), on volume retention in rabbits submitted to hemorrhage. Thirty six rabbits were randomly divided into 6 groups: SHAM, Control, Saline, DB, NA, DB+NA. All the animals, except for SHAM, were subjected to hemorrhage of 25% of the calculated blood volume. Control animals were replaced with their own blood. The other groups received NSS 3 times the volume withdrawn. The intravascular retention, hematocrit, diuresis, central venous pressure, mean arterial pressure, NGAL, dry-to-wet lung weight ratio (DTWR) and the lung and kidney histology were analyzed. Replacement with NSS and NA, DB or NA+DB did not produce differences in the intravascular retention. After hemorrhage, the animals presented a significant decrease in the MAP and CVP, which were maintained until volume replacement. Regarding NGAL, dry-to-wet-lung-weight ratio, lung and kidney histology, there were no statistical differences between the groups. The use of noradrenaline, dobutamine or their combination did not increase the intravascular retention of volume after normal saline infusion.

  8. Assessing intravascular volume by difference in pulse pressure in pigs submitted to graded hemorrhage.

    Science.gov (United States)

    Pestel, Gunther J; Hiltebrand, Luzius B; Fukui, Kimiko; Cohen, Delphine; Hager, Helmut; Kurz, Andrea M

    2006-10-01

    We assessed changes in intravascular volume monitored by difference in pulse pressure (dPP%) after stepwise hemorrhage in an experimental pig model. Six pigs (23-25 kg) were anesthetized (isoflurane 1.5 vol%) and mechanically ventilated to keep end-tidal CO2 (etCO2) at 35 mmHg. A PA-catheter and an arterial catheter were placed via femoral access. During and after surgery, animals received lactated Ringer's solution as long as they were considered volume responders (dPP>13%). Then animals were allowed to stabilize from the induction of anesthesia and insertion of catheters for 30 min. After stabilization, baseline measurements were taken. Five percent of blood volume was withdrawn, followed by another 5%, and then in 10%-increments until death from exsanguination occurred. After withdrawal of 5% of blood volume, all pigs were considered volume responders (dPP>13%); dPP rose significantly from 6.1+/-3.3% to 19.4+/-4.2%. The regression analysis of stepwise hemorrhage revealed a linear relation between blood loss (hemorrhage in %) and dPP (y=0.99*x+14; R2=0.7764; P<.0001). In addition, dPP was the only parameter that changed significantly between baseline and a blood loss of 5% (P<0.01), whereas cardiac output, stroke volume, heart rate, MAP, central venous pressure, pulmonary artery occlusion pressure, and systemic vascular resistance, respectively, remained unchanged. We conclude that in an experimental hypovolemic pig model, dPP correlates well with blood loss.

  9. Fractionated stereotactically guided radiotherapy for pharmacoresistant epilepsy; Fraktionierte, stereotaktisch gefuehrte Radiotherapie der pharmakoresistenten Epilepsie

    Energy Technology Data Exchange (ETDEWEB)

    Grabenbauer, G.G.; Reinhold, C.; Lambrecht, U.; Sauer, R. [Klinik und Poliklinik fuer Strahlentherapie, Friedrich-Alexander-Univ. Erlangen-Nuernberg, Erlangen (Germany); Kerling, F.; Pauli, E.; Stefan, H. [Neurologische Klinik, Abt. Epileptologie, Friedrich-Alexander-Univ. Erlangen-Nuernberg, Erlangen (Germany); Mueller, R.G. [Inst. fuer Medizinische Physik, Friedrich-Alexander-Univ. Erlangen-Nuernberg, Erlangen (Germany); Ganslandt, O. [Neurochirurgische Klinik, Friedrich-Alexander-Univ. Erlangen-Nuernberg, Erlangen (Germany)

    2003-01-01

    Aim: This prospective study evaluated the efficiency of fractionated stereotactically guided radiotherapy as a treatment of pharmacoresistant temporal lobe epilepsy. Patients and Methods: Inclusion criteria were patients aged between 17 and 65 years with one-sided temporally located focus, without sufficient epilepsy control by, antiepileptic drugs or neurosurgery. Between 1997 and 1999, two groups of six patients each were treated with 21 Gy (7 times 3 Gy) and 30 Gy (15 times 2 Gy). Study end points were seizure frequency, intensity, seizure length and neuropsychological parameters. Results: All patients experienced a marked reduction in seizure frequency. The mean reduction of seizures was 37% (range 9-77%, i.e. seizures reduced from a monthly mean number of 11.75 to 7.52) at 18 months following radiation treatment and 46% (23-94%, i.e. 0.2-23 seizures per month) during the whole follow-up time. Seizure length was reduced in five out of eleven patients and intensity of seizures in seven out of eleven patients. Conclusion: Radiotherapy was identified as safe and effective for pharmacoresistant epilepsy since a very good reduction of seizure frequency was observed. It is no substitute for regular use of antiepileptic drugs, but means an appropriate alternative for patients with contraindication against neurosurgery or insufficient seizure reduction after neurosurgery. (orig.) [German] Ziel: Diese prospektive Studie untersuchte die Effizienz einer fraktionierten stereotaktischen Radiotherapie (RT) bei therapieresistenter Temporallappenepilepsie. Patienten und Methoden: Einschlusskriterien waren Patienten im Alter von 17 bis 65 Jahren, die weder medikamentoes noch epilepsiechirurgisch anfallsfrei wurden und einen einseitigen Fokus aufwiesen. Zwei Patientenkohorten zu je sechs Patienten wurden zwischen 1997 und 1999 einer fraktionierten, stereotaktisch gefuehrten Radiotherapie mit 21 Gy (7 x 3 Gy) bzw. 30 Gy (15 x 2 Gy) unterzogen. Endpunkte der Untersuchung waren

  10. Hemorrhagic shock impairs myocardial cell volume regulation and membrane integrity in dogs

    Energy Technology Data Exchange (ETDEWEB)

    Horton, J.W.

    1987-06-01

    An in vitro myocardial slice technique was used to quantitate alterations in cell volume regulation and membrane integrity after 2 h or hemorrhagic shock. After in vitro incubation in Krebs-Ringer-phosphate medium containing trace (/sup 14/C)inulin, values (ml H/sub 2/O/g dry wt) for control nonshocked myocardial slices were 4.03 /plus minus/ 0.11 (SE) for total water, 2.16 /plus minus/ 0.07 for inulin impermeable space, and 1.76 /plus minus/ 0.15 for inulin diffusible space. Shocked myocardial slices showed impaired response to cold incubation. After 2 h of in vivo shock, total tissue water, inulin diffusible space, and inulin impermeable space increased significantly for subendocardium, whereas changes in subepicardium parameters were minimal. Shock-induced cellular swelling was accompanied by an increased total tissue sodium, but no change in tissue potassium. Calcium entry blockade in vivo significantly reduced subendocardial total tissue water as compared with shock-untreated dogs. In addition, calcium entry blockade reduced shock-induced increases in inulin diffusible space. In vitro myocardial slice studies confirm alterations in subendocardial membrane integrity after 2 h of in vivo hemorrhagic shock. Shock-induced abnormalities in myocardial cell volume regulation are reduced by calcium entry blockade in vivo.

  11. Incidental lung volume reduction following fulminant pulmonary hemorrhage in a patient with severe emphysema.

    Science.gov (United States)

    Hetzel, Juergen; Spengler, Werner; Horger, Marius; Boeckeler, Michael

    2015-06-01

    Endoscopic lung volume reduction is an emerging technique meant to improve lung function parameters, quality of life, and exercise tolerance in patients with severe lung emphysema. This is the first report of lung volume reduction by autologous blood in a patient with non-bullous lung emphysema. A 74-year-old woman with heterogeneous lung emphysema developed accidentally diffuse lobar bleeding immediately after valve placement. Due to persistent hemorrhage, the valves had to be removed shortly thereafter. Despite extraction of the valves, respiratory function of the patient improved rapidly indicated also by a drop in the COPD assessment test questionnaire, 3 months later. This was consistent with both improvement of lung function tests and six-minute walking test.

  12. Internet search volumes in brain aneurysms and subarachnoid hemorrhage: Is there evidence of seasonality?

    Science.gov (United States)

    Ku, Jerry C; Alotaibi, Naif M; Wang, Justin; Ibrahim, George M; Schweizer, Tom A; Macdonald, R Loch

    2017-07-01

    Results of previous studies examining seasonal variation in the incidence of aneurysmal subarachnoid hemorrhage (SAH) are conflicting. The aim of this brief report is to investigate whether there is a seasonal effect in online search queries for SAH that may reflect an association between meteorological factors and aneurysm rupture. We used the Google Trends data service to analyze the volume of internet queries for SAH on Google's search engine from January 1, 2004 to November 2016. We used comprehensive search terms and collected data from: USA, Canada, and countries known for their high prevalence of SAH (Finland, and Japan), as well as worldwide search volume. Potential seasonal variations in the data were assessed by comparative non-parametric tests and curve-fit regression model. Our analyses revealed that USA had the highest median value in cumulative search scores (115 vs. 86, 46, 46 for Finland, Canada and Japan, respectively). The term "brain aneurysm" was the commonly used search term among countries, followed by "cerebral aneurysm". There was no evidence of seasonality in any of the countries studied on both univariate tests and regression time-adjusted analysis. There are no seasonal variations in internet search query volume for SAH. Further studies are needed to explore whether online search volumes correlate with the actual incidence of SAH. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Stereotactic-guided laser-induced interstitial thermotherapy (SLITT) in gliomas with intraoperative morphologic monitoring in open MR

    Science.gov (United States)

    Lumenta, Christianto B.; Leonardi, Massimo A.; von Einsiedel, Helga

    2001-01-01

    Stereotactic guided laser-induced interstitial thermotherapy (SLITT) is a minimal invasive method to produce thermo necrosis in cerebral tumor tissue. Clinical data about dose/response relationship and patients outcome is poor. Twenty-four patients with brain tumors were treated with SLITT, totally 30 laser procedures were performed. Under local anesthesia 600 micrometers laser-fiber were inserted by the stererotactic-guided technique. IN open MR the denaturation of the tumor by a Neodym-YAG-laser was monitored using T1-weighted 3D tumor FLASH sequences. Laser energy was applied in steps of 400 to 1200 Joules. Development of necrosis at a mean total energy-dose of 2979 Joules could be monitored in all procedures. Initial signal changes were seen after a mean of 1250 Joules. Mean max total lesion size was 21.2 mm. The higher the total energy, the larger the thermo lesion, but no linear relationship could be seen. Tumor tissue response showed no dependency form tumor grading. Although lesion-size basically is energy dependent, it should be applied individually, since thermo response in brain tumors varies due to different optical properties. Energy application in steps of 500 Joules monitored in near on-line modus in an open MR-system is safe and feasible. Conclusions about the clinical value of SLITT are not definite.

  14. Effect of residue hematoma volume on inflammation factors in hypertensive intracranial hemorrhage

    Directory of Open Access Journals (Sweden)

    You-san ZHANG

    2016-10-01

    Full Text Available Objectives  In this study, the relationships of residue hematoma volume to brain edema and inflammation factors were studied after intracerebral hematoma was evacuated with a frameless stereotactic aspiration. Methods  Eighty-nine patients with hypertensive intracerebral hemorrhage (ICH were treated by frameless stereotactic aspiration. According to residual volume of the hematoma, the patients were divided into gross-total removal of hematoma (GTRH (≤5ml and sub-total removal of hematoma (STRH (≥10ml groups after the operation. The pre-operative and postoperative data of the patients were compared between the two groups. The pre-operative data included age, sex, hematoma volume, time interval from the ictus to the operation, and Glasgow Coma Scale (GCS scores. The post-operative information included edema grade, level of thromboxane B2 (TXB2, 6-keto-prostaglandin F1α(6-K-PGF1α, tumor necrosis factor-α(TNF-α and endothelin (ET in hematoma cavity or cerebral spinal fluid (CSF. Results  There were 46 patients in GTRH group and 43 in STRH group respectively. There was no statistical difference in the pre-operative data between the two groups. The levels of TXB2, 6-K-PGF1α, TNF-αand ET were significantly lower in the GTRH group than in the STRH group at different post-operative time points. There was a significant difference between the two groups. The post-operative CT scan at different time points showed that the brain edema grades were better in the GTRH group than in the STRH group. Conclusions  GTRH is helpful for decreasing ICH-induced injury to brain tissue, which is related to decreased perihematomal edema formation and secondary injury by coagulation end products activated inflammatory cascade. DOI: 10.11855/j.issn.0577-7402.2016.09.12

  15. A Temporal Study of Gene Expression in Rat Lung Following Fixed-volume Hemorrhage

    Science.gov (United States)

    2005-09-13

    NM_031065 CCTGCTGACACACAATGAAAA AACGGCCAGACACAGCAC Xanthine dehydrogenase ( XDH ) NM_017154 TGCCATTGATATTGGACAAGTAG TGCAGCTCCTCCATAGTGAA -Actin...1; RP L10a, ribosomal protein L10a; XDH , xanthine dehydrogenase; Sh, sham hemorrhage; h, hours; H, hemorrhage. B: ratio (H3h/Sh) of geometric means

  16. Recombinant Factor VIIa Reduces Rebleed Hemorrhage Volume in a Swine Aortotomy Model: A Randomized Double-Blinded Study

    Science.gov (United States)

    2008-06-01

    the recommended dose in hemophilia patients with inhibitors, reduced rebleed hemorrhage volume, suggesting that this dose is effective in this swine... acquired on a data acquisition system. Samples from the heart, lung, brain, kidney, and adrenal glands were harvested within 10 min of death and were...trauma and surgical patients with acquired coagulopathy. Curr Surg 63:246Y251, 2006. 12. Klemcke HG, Delgado A, Holcomb JB, Ryan KL, Burke A, DeGuzman

  17. A Prospective Pilot Investigation of Brain Volume, White Matter Hyperintensities, and Hemorrhagic Lesions after Mild Traumatic Brain Injury

    OpenAIRE

    Michael eJarrett; Roger eTam; Enedino eHernández-Torres; Nancy eMartin; Warren ePerera; Yinshan eZhao; Elham eShahinfard; Shiroy eDadachanji; Jack eTaunton; David K B Li; Alexander eRauscher

    2016-01-01

    Traumatic brain injury (TBI) is among the most common neurological disorders. Hemorrhagic lesions and white matter hyperintensities (WMH) are radiological features associated with moderate and severe TBI. Brain volume reductions have also been observed during the months following injury. In concussion, no signs of injury are observed on conventional magnetic resonance imaging (MRI), which may be a true feature of concussion or merely due to the limited sensitivity of imaging techniques used s...

  18. Graphite furnace atomic absorption spectrophotometry--a novel method to quantify blood volume in experimental models of intracerebral hemorrhage.

    Science.gov (United States)

    Kashefiolasl, Sepide; Foerch, Christian; Pfeilschifter, Waltraud

    2013-02-15

    Intracerebral hemorrhage (ICH) accounts for 10% of all strokes and has a significantly higher mortality than cerebral ischemia. For decades, ICH has been neglected by experimental stroke researchers. Recently, however, clinical trials on acute blood pressure lowering or hyperacute supplementation of coagulation factors in ICH have spurred an interest to also design and improve translational animal models of spontaneous and anticoagulant-associated ICH. Hematoma volume is a substantial outcome parameter of most experimental ICH studies. We present graphite furnace atomic absorption spectrophotometric analysis (AAS) as a suitable method to precisely quantify hematoma volumes in rodent models of ICH. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Central Hemodynamics in the Use of Different Methods for Recovering the Circulating Blood Volume in Hemorrhagic Shock

    Directory of Open Access Journals (Sweden)

    V. I. Bolotskikh

    2009-01-01

    Full Text Available Objective: to study the specific features of correction of central hemodynamics in hemorrhagic shock when various treatments are used. Materials and methods. Experiments were made on 38 mongrel dogs in 4 series of experiments: 1 12 dogs under hemorrhagic shock (a control group; 2 10 anemic animals receiving later infusion therapy; 3 10 anemic dogs exposed to HBO (p02=300 kPa; a 60-min session; 4 6 anemic dogs receiving complex treatment (HBO and infusion. Circulatory blood volume (CBV, cardiac index (CI, left ventricular stroke output index (LVSOI, heart rate, and blood pressure (BP were determined in all the animals at the baseline, in 30-, 90-, and 150-min shock (controls at 5 and 60 min after treatment. Results. In the posthemorrhagic period, all hemodynamic parameters were found to be decreased (p<0.01. After infusion therapy (Series 2, the central hemodynamic parameters with CBV normalization remained at the level of 30-min shock. After oxygenation (Series 3 and complex therapy (Series 4, CBV normalization was attended by the recovery of the study circulatory parameters. This was caused by lower hypoxia, activated myocardial metabolic processes, and stimulated adaptive hemodynamic reactions. Reducing the volume of an infusion mixture in Series 4 animals lowers a cardiac load, provides a positive effect in the treatment of terminal conditions. Conclusion. HBO used in the complex therapy of hemorrhagic shock is an important component ensuring the normalization of metabolic processes and hemodynamic homeostasis in posthemorrhagic states.

  20. Regional very low cerebral blood volume predicts hemorrhagic transformation better than diffusion-weighted imaging volume and thresholded apparent diffusion coefficient in acute ischemic stroke.

    Science.gov (United States)

    Campbell, Bruce C V; Christensen, Søren; Butcher, Kenneth S; Gordon, Ian; Parsons, Mark W; Desmond, Patricia M; Barber, P Alan; Levi, Christopher R; Bladin, Christopher F; De Silva, Deidre A; Donnan, Geoffrey A; Davis, Stephen M

    2010-01-01

    Currently, diffusion-weighted imaging (DWI) lesion volume is the most useful magnetic resonance imaging predictor of hemorrhagic transformation (HT). Preliminary studies have suggested that very low cerebral blood volume (VLCBV) predicts HT. We compared HT prediction by VLCBV and DWI using data from the EPITHET study. Normal-percentile CBV values were calculated from the nonstroke hemisphere. Whole-brain masks with CBV thresholds of the <0, 2.5, 5, and 10th percentiles were created. The volume of tissue with VLCBV was calculated within the acute DWI ischemic lesion. HT was graded as per ECASS criteria. HT occurred in 44 of 91 patients. Parenchymal hematoma (PH) occurred in 13 (4 symptomatic) and asymptomatic hemorrhagic infarction (HI) in 31. The median volume of VLCBV was significantly higher in cases with PH. VLCBV predicted HT better than DWI lesion volume and thresholded apparent diffusion coefficient lesion volume in receiver operating characteristic analysis and logistic regression. A cutpoint at 2 mL VLCBV with the <2.5th percentile had 100% sensitivity for PH and, in patients treated with tissue plasminogen activator, defined a population with a 43% risk of PH (95% CI, 23% to 66%, likelihood ratio=16). VLCBV remained an independent predictor of PH in multivariate analysis with traditional clinical risk factors for HT. VLCBV predicted HT after thrombolysis better than did DWI or apparent diffusion coefficient volume in this large patient cohort. The advantage was greatest in patients with smaller DWI volumes. Prediction was better in patients who recanalized. If validated in an independent cohort, the addition of VLCBV to prethrombolysis decision making may reduce the incidence of HT.

  1. COMPARISON OF ELLIPTIC EQUATION – ABC/2 WITH COMPUTERASSISTED SEMIAUTHOMATIC METHODS FOR MEASURING THE VOLUME OF INTRACEREBRAL HEMORRHAGE

    Directory of Open Access Journals (Sweden)

    Dragan Stojanov

    2015-09-01

    Full Text Available Hemorrhage volume, level of consciousness and ventricular extension and expansion of the hematoma are prognostic factors for clinical outcome of intracerebral hemorrhage (ICH. Volumetric measurement of ICH has an important clinical and prognostic meaning. The aim of this study was to compare the methods which are being used to measure ICH volume: the ABC/2 method and semiautomated method with computer volumetric program. Our study represents a retrospective analisys of 54 patients (61.11% male and 38.89% female patients with mean age 67.20±10.30 years who underwent computed tomography (CT scan of endocranium. Volumetric measurements were performed by ABC/2 method and computer semiautomated method with volumetric program on Аdvantage Windows 3D Workstation 4.1. Mean value and standard deviation obtained by ABC/2 method were 41.98±35.47, while mean value and standard deviation obtained by computer semiautomated method with volumetric program were 52.12±45.61. There is a statistically significant difference between the values obtained by these two methods (p=0.03. The absolute difference was 10.14 cm3. The values acquired by computer method were by 19.46% higher than those acquired by formula. There is a statstically strong positive correlation between these two methods (r=0.852, p<0.05. Both methods are very useful in determining ICH volume. Our results show that values obtained by computer semiauthomatic method were by 19.46% higher than those obtained by the elliptic equation. Elliptic equation-ABC/2 method is better for measuring regular ICH shapes and fast orientation, while semiautomated computer method is more accurate and more selective.

  2. Does small-volume resuscitation with crystalloids or colloids influence hemostasis and survival of rabbits subjected to lethal uncontrolled hemorrhage?

    Science.gov (United States)

    Kheirabadi, Bijan Shams; Miranda, Nahir; Terrazas, Irasema B; Gonzales, Mary D; Grimm, Rose C; Dubick, Michael A

    2017-01-01

    Prehospital, small-volume resuscitation of combat casualties with a synthetic colloid (6% hydroxyethyl starch [HES] 670/0.75) has been recommended when blood or blood components are unavailable. We studied hemostatic effects of a newer synthetic colloid (6% HES, 130/0.4) compared with either a natural colloid (albumin) or to crystalloids in an uncontrolled hemorrhage model. Spontaneously breathing New Zealand white rabbits (3.4 ± 0.1 kg) were anesthetized, instrumented, and subjected to a splenic injury with uncontrolled bleeding. Fifteen minutes after injury, rabbits were in shock (mean arterial pressure [MAP] = 26 ± 1.3 mm Hg, and received colloids (6% HES, 130/0.4 or 5% albumin at 15 mL/kg), or crystalloids (normal saline at 30 mL/kg or 5% hypertonic saline at 7.5 mL/kg) for resuscitation in two intravenous bolus injections (15 minutes apart) to raise their MAP to 65 mm Hg, n = 9/group. Animals were monitored for 2.5 hours or until death, and blood losses were measured. Blood samples were analyzed for arterial blood gas, complete blood count, and coagulation measures. There were no differences among groups in baseline measures and initial hemorrhage volume (11.9 ± 0.6 mL/kg) at 15 minutes postinjury. Twenty minutes after fluid resuscitation (1 hour postinjury), MAP was higher, shock indices were lower, and blood pH was higher in colloids versus. crystalloids groups (p colloid produced the largest hemodilution (54% decrease in hematocrit, p < 0.05 vs. hypertonic saline). Activated partial thromboplastin time increased approximately 35% above baseline in all groups except in 6% HES 130/0.4 group in which it doubled. Clot strength was reduced (15%) only in the 6% HES 130/0.4 group. 6% HES 130/0.4 resuscitation produced the largest blood loss and 33% survival rate that was not different than the crystalloid groups. Albumin produced the best hemostatic and survival outcomes (78%). Small-volume resuscitation with crystalloids appeared inadequate to treat

  3. Effects of volume and composition of the resuscitative fluids in the treatment of hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Pushpa Sharma

    2012-01-01

    Full Text Available Objectives: To evaluate the effectiveness of normal saline, hypertonic saline, and Ringer′s lactate solution followed by blood infusion in ameliorating the physiological, biochemical, and organ functions following hemorrhagic shock (HS in rats. Materials and Methods: Anesthetized, male Sprague-Dawley rats underwent computer-controlled HS, and were randomly divided into five groups consisting of (1 sham, (2 HS without resuscitation, (3 resuscitation with normal saline, (4 resuscitation with hypertonic saline, and (5 resuscitation with Ringer′s lactate solution. All resuscitated animals were infused with subsequent infusion of shed blood. Animals were continuously monitored for physiological, hemodynamic, biochemical parameters, and organ dysfunctions. Results: Non-resuscitated animals were unable to survive due to hypotension, poor oxygen metabolism, and lactic acidosis. Although these HS related parameters were corrected by all the fluids used in this study, additional blood infusion was more effective than fluid resuscitation alone. Also, hypertonic saline was more effective than Ringer′s lactate solution, and normal saline was the least effective in preserving the liver and kidney functions and muscle damage. Conclusions: All crystalloid fluids were significantly more effective in reversing the HS outcome when used with blood infusion, but hypertonic salinewith blood was more effective in preventing the organ damage than Lactated Ringers solutions or normal saline in the treatment of HS.

  4. Whole-brain 320-detector row dynamic volume CT perfusion detected crossed cerebellar diaschisis after spontaneous intracerebral hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Jun; Chen, Wei-jian; Wang, Mei-hao; Li, Jian-ce; Zhang, Qian; Xia, Neng-zhi; Yang, Yun-jun [Wenzhou Medical University, Department of Radiology, First Affiliated Hospital, Wenzhou (China); Wu, Gui-yun [Cleveland Clinics Foundation, Department of Nuclear Medicine, Imaging Institute, Cleveland, OH (United States); Cheng, Jing-liang; Zhang, Yong [Zhengzhou University, Department of Radiology, First Affiliated Hospital, Zhengzhou (China); Zhuge, Qichuan [Wenzhou Medical University, Department of Neurosurgery, First Affiliated Hospital, Wenzhou (China)

    2014-11-09

    The purpose of this study was to evaluate the value of 320-detector row CT used to detect crossed cerebellar diaschisis (CCD) in patients with unilateral supratentorial spontaneous intracerebral hemorrhage (SICH). We investigated 62 of 156 patients with unilateral supratentorial SICH using 320-detector row CT scanning. Regional cerebral blood flow (rCBF), cerebral blood volume (rCBV), mean transit time (rMTT), and time to peak (rTTP) levels were measured in different regions of interest (ROIs) that were manually outlined on computed tomography perfusion (CTP) for the cerebrum, including normal-appearing brain tissue that surrounded the perilesional low-density area (NA) and the perihematomal low-density area (PA) in all patients and the cerebellum (ipsilateral and contralateral) in CCD-positive patients. Of 62 cases, a total of 14 met the criteria for CCD due to cerebellar perfusion asymmetry on CTP maps. In the quantitative analysis, significant differences were found in the perfusion parameters between the contralateral and ipsilateral cerebellum in CCD-positive cases. No significant differences were found between the CCD-positive group and the CCD-negative group according to the hematoma volume, NIHSS scores, and cerebral perfusion abnormality (each P > 0.05). The correlation analysis of the degree of NA, PA perfusion abnormality, and the degree of CCD severity showed negative and significant linear correlations (R, -0.66∝-0.56; P < 0.05). 320-detector row CT is a robust and practicable method for the comprehensive primary imaging work-up of CCD in unilateral supratentorial SICH patients. (orig.)

  5. Dual-Energy CT in Hemorrhagic Progression of Cerebral Contusion: Overestimation of Hematoma Volumes on Standard 120-kV Images and Rectification with Virtual High-Energy Monochromatic Images after Contrast-Enhanced Whole-Body Imaging.

    Science.gov (United States)

    Bodanapally, U K; Shanmuganathan, K; Issa, G; Dreizin, D; Guang, L; Sudini, K; Fleiter, T R

    2018-02-08

    In patients with hemorrhagic contusions, hematoma volumes are overestimated on follow-up standard 120-kV images obtained after contrast-enhanced whole-body CT. We aimed to retrospectively determine hemorrhagic progression of contusion rates on 120-kV and 190-keV images derived from dual-energy CT and the magnitude of hematoma volume overestimation. We retrospectively analyzed admission and follow-up CT studies in 40 patients with hemorrhagic contusions. After annotating the contusions, we measured volumes from admission and follow-up 120-kV and 190-keV images using semiautomated 3D segmentation. Bland-Altman analysis was used for hematoma volume comparison. On 120-kV images, hemorrhagic progression of contusions was detected in 24 of the 40 patients, while only 17 patients had hemorrhagic progression of contusions on 190-keV images ( P = .008). Hematoma volumes were systematically overestimated on follow-up 120-kV images (9.68 versus 8 mm 3 ; mean difference, 1.68 mm 3 ; standard error, 0.37; P images. There was no significant difference in volumes between admission 120-kV and 190-keV images. Mean and median percentages of overestimation were 29% (95% CI, 18-39) and 22% (quartile 3 - quartile 1 = 36.8), respectively. The 120-kV images, which are comparable with single-energy CT images, significantly overestimated the hematoma volumes, hence the rate of hemorrhagic progression of contusions, after contrast-enhanced whole-body CT. Hence, follow-up of hemorrhagic contusions should be performed on dual-energy CT, and 190-keV images should be used for the assessment of hematoma volumes. © 2018 by American Journal of Neuroradiology.

  6. Hemorrhagic Stroke

    Science.gov (United States)

    A stroke is a medical emergency. There are two types - ischemic and hemorrhagic. Hemorrhagic stroke is the less common type. It happens when ... an artery wall that breaks open. Symptoms of stroke are Sudden numbness or weakness of the face, ...

  7. Endoscopic surgery versus conservative treatment for the moderate-volume hematoma in spontaneous basal ganglia hemorrhage (ECMOH: study protocol for a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Zan Xin

    2012-06-01

    Full Text Available Abstract Background Spontaneous intracerebral hemorrhage is a disease with high morbidity, high disability rate, high mortality, and high economic burden. Whether patients can benefit from surgical evacuation of hematomas is still controversial, especially for those with moderate-volume hematomas in the basal ganglia. This study is designed to compare the efficacy of endoscopic surgery and conservative treatment for the moderate-volume hematoma in spontaneous basal ganglia hemorrhage. Methods Patients meet the criteria will be randomized into the endoscopic surgery group (endoscopic surgery for hematoma evacuation and the best medical treatment or the conservative treatment group (the best medical treatment. Patients will be followed up at 1, 3, and 6 months after initial treatment. The primary outcomes include the Extended Glasgow Outcome Scale and the Modified Rankin Scale. The secondary outcomes consist of the National Institutes of Health Stroke Scale and the mortality. The Barthel Index(BI will also be evaluated. The sample size is 100 patients. Discussion The ECMOH trial is a randomized controlled trial designed to evaluate if endoscopic surgery is better than conservative treatment for patients with moderate-volume hematomas in the basal ganglia. Trial registration Chinese Clinical Trial Registry: ChiCTR-TRC-11001614 (http://www.chictr.org/en/proj/show.aspx?proj=1618

  8. A New Ultra-Small Volume Fluid for Far-Forward, Non-Compressible Hemorrhage and Traumatic Brain Injury

    Science.gov (United States)

    2016-01-01

    improve cardiac function, correct coagulopathy, blunt systemic inflammation and improve tissue oxygenation. In the second study, ALM treatment...resuscitation, hypotensive, non-compressible, truncal, hemorrhage, TBI, coagulopathy, inflammation , ALM, adenosine, lidocaine, magnesium, ROTEM, cardiac...traumatic brain injury (TBI) is a major cause of death on the battlefield. Over 30 years ago, Col. Ronald Bellamy reported in his landmark article The

  9. Dengue hemorrhagic fever

    Science.gov (United States)

    Hemorrhagic dengue; Dengue shock syndrome; Philippine hemorrhagic fever; Thai hemorrhagic fever; Singapore hemorrhagic fever ... Four different dengue viruses are known to cause dengue hemorrhagic fever. Dengue hemorrhagic fever occurs when a person is bitten by ...

  10. Effect of intra-abdominal volume increment technique for the treatment of intra-abdominal hypertension on the liver after resuscitation of hemorrhagic shock in pig

    Directory of Open Access Journals (Sweden)

    Zheng-gang WANG

    2012-02-01

    Full Text Available Objective  To observe the effect of vacuum sealing drainage (VSD assisted intra-abdominal volume increment (IAVI technique on the liver in the treatment of intra-abdominal hypertension (IAH following hemorrhagic shock resuscitation in pigs. Methods  Twelve healthy mini-pigs (Bama, Guangxi were selected for bloodletting from the femoral artery to reproduce hemorrhagic shock model (mean arterial blood pressure, 50mmHg, 1h, and IAH model was successfully reproduced in eight pigs by partial occlusion of portal vein. The eight pigs were randomly divided into the intra-abdominal volume increment treatment (IT group (n=4 and sham operation control (SC group (n=4. Vesical pressure (VP and inferior vena cava pressure (IVCP were observed before shock, 2h after IAH, and 22h after IAVI treatment. Aspartate aminotransferase (AST and alanine aminotransferase (ALT were measured. In addition, the ratio of the abdominal anteroposterior diameter to the transverse diameter was assessed, and the liver CT values were measured after enhanced CT scanning. The pigs were sacrificed 26h after operation. Liver specimens were collected to measure the ratio of wet weight to dry weight and pathological examination. Results  The VP in 8 IAH pigs was 21.16±4.63mmHg. The ratio of abdominal anteroposterior diameter to the transverse diameter increased remarkably 2h after IAH compared with that before shock (1.22±1.41 vs 0.96±0.08, PPvs 42.73±4.92HU, PPPvs 5.14±0.71, PConclusions  The established model could better reproduce the symptoms of IAH after hemorrhagic shock and fluid resuscitation, accompanied by liver damage. IAVI helps to relieve liver functional disturbance after IAH, which is related to decreased intra-abdominal pressure and hypoxia-ischemia of the liver.

  11. Preretinal hemorrhage

    Directory of Open Access Journals (Sweden)

    Eduardo Felippe

    2004-12-01

    Full Text Available A case of Valsalva hemorrhagic retinopathy treated with Nd:YAGlaser indescribed. The patient presented decreased visual acuityafter coughing, and a preretinal hemorrhage was diagnosed in theposterior pole; puncturing the posterior hyaloid face was performedwith Nd:Yag laser. Rapid hemorrhage absorption was observedafter the therapy proposed and visual acuity was recovered. Nd:Yaglaser proved to be safe and efficient in the management of preretinalhemorrhage.

  12. Delayed intracerebral hemorrhage after uneventful embolization of brain arteriovenous malformations is related to volume of embolic agent administered: multivariate analysis of 13 predictive factors.

    Science.gov (United States)

    Ovalle, Fernando; Shay, Sheila D; Mericle, Robert A

    2012-06-01

    The mechanisms and management of delayed intracerebral hemorrhage (dICH) after treatment of brain arteriovenous malformations (AVMs) are poorly understood and widely debated. Many clinical predictive factors have been theorized for dICH after an otherwise uneventful AVM embolization, but there is an absence of data to discern their significance. To analyze 13 proposed predictive factors and to assess their potential in guiding prevention strategies. One hundred sixty-eight embolization procedures were performed on 67 patients with brain AVMs by a single surgeon. Patients were divided into 2 groups: those with symptomatic dICH and control subjects. Thirteen factors were analyzed: age, sex, race, previous ICH, Spetzler-Martin grade, AVM size, eloquence, embolic volume, embolic agent, percent obliteration, and timing, number, and stage of embolizations. Univariate and multivariate analyses were performed on these factors to determine significance. Six procedures were complicated by dICH; 5 (83%) occurred after the final planned procedure. The volume of embolic agent was significantly higher in the dICH group (4.5 ± 1.0 mL) compared with control subjects (1.7 ± 0.2 mL) in both univariate and multivariate analyses (P < .01), even after controlling for AVM size. AVM size was significant in univariate analysis but not multivariate analysis. There were no statistically significant differences between the groups for any of the other possible predictive factors. High volume of embolic agent administered per procedure is an independent predictive factor for dICH. Limiting the injected volume for each procedure may reduce this poorly understood complication.

  13. Terson syndrome in subarachnoid hemorrhage, intracerebral hemorrhage, and traumatic brain injury.

    Science.gov (United States)

    Czorlich, Patrick; Skevas, Christos; Knospe, Volker; Vettorazzi, Eik; Richard, Gisbert; Wagenfeld, Lars; Westphal, Manfred; Regelsberger, Jan

    2015-01-01

    This prospective trial was designed to evaluate the incidence of Terson syndrome in patients suffering from subarachnoid hemorrhage, intracerebral hemorrhage, or traumatic brain injury and whether consequences necessarily derive from the intraocular hemorrhage itself. Two ophthalmologic examinations were performed to identify patients with Terson syndrome. Data on initial Glasgow Coma Scale, Hunt and Hess and Fisher grades, aneurysm site and diameter, and volume of hemorrhage in intracerebral hemorrhage patients were correlated to the location and course of Terson syndrome. Follow-up was performed after 3 months, including clinical and ophthalmologic investigations. The data showed that 16 of 83 subarachnoid hemorrhage patients (19.3%), 2 of 22 intracerebral hemorrhage patients (9.1%), and 1 of 32 traumatic brain injury patients (3.1%) suffered from Terson syndrome. Low Glasgow Coma Scale (p = 0.002), high Hunt and Hess grade (p Terson syndrome. The neurological outcome in subarachnoid hemorrhage patients suffering from Terson syndrome was worse compared with that of subarachnoid hemorrhage patients without Terson syndrome (p = 0.005), and vitrectomy was performed in seven eyes of six patients due to poor visual acuity. Terson syndrome is underestimated in patients with subarachnoid hemorrhage and a rare pathology in intracerebral hemorrhage as well as in traumatic brain injury patients. Spontaneous regression of the intraocular hemorrhage may be seen, but in half of the patients, vitrectomy is necessary to prevent permanent visual deterioration.

  14. Small volume 7.5% NaCl with 6% Dextran-70 or 6% and 10% hetastarch are associated with arrhythmias and death after 60 minutes of severe hemorrhagic shock in the rat in vivo.

    Science.gov (United States)

    Letson, Hayley L; Dobson, Geoffrey P

    2011-06-01

    Hypertonic saline solutions in combination with colloids may have some applications in critically ill patients. Our aim was to examine the effects of small volumes (0.7-1 mL/kg intravenous) of 7.5% NaCl with different colloids on cardiac stability, hemodynamics, and mortality after severe hemorrhagic shock. Male fed Sprague-Dawley rats (300-450 g, n = 48) were anesthetized and randomly assigned to one of six groups: (1) untreated (bleed only), (2) 7.5% NaCl, (3) 7.5% NaCl/6% dextran-70, (4) 7.5% NaCl/6% hetastarch (HES), (5) 6% HES alone, and (6) 7.5% NaCl/10% HES. Hemorrhagic shock was induced by phlebotomy until the mean arterial pressure (MAP) was 35 mm Hg to 40 mm Hg and continued for 20 minutes until ∼40% blood loss. Animals were left in shock for 60 minutes at 34°C. 0.3 mL (animals with no deaths. Addition of 6% HES to hypertonic saline resulted in aberrant arrhythmias and 38% mortality. Six percent HES alone was proarrhythmic and led to 38% mortality. 7.5% NaCl with 10% HES resulted in 100% mortality (p Small volumes of 7.5% NaCl led to fewer arrhythmias and a 2.6 times survival benefit over untreated rats, and a partial resuscitation of MAP into the "permissive range." Dextran-70 or HES in 7.5% NaCl were proarrhythmic and HES led to increased mortality (p critical for successful resuscitation, care should be exercised when using dextran-70 or 6 and 10% HES in small volume hypertonic saline solutions for early hypotensive resuscitation.

  15. Viral Hemorrhagic Fevers

    Science.gov (United States)

    ... 4 viruses that cause two other hemorrhagic fevers, dengue hemorrhagic fever and yellow fever. Virus Families Information ... 2014 Content source: Centers for Disease Control and Prevention National Center for Emerging and Zoonotic Infectious Diseases ( ...

  16. Intracerebral hemorrhage in children

    African Journals Online (AJOL)

    Ihab Zidan

    2012-04-01

    Apr 1, 2012 ... count for 14%17 to 46%18 of hemorrhagic stroke in children and nearly 50%13 of intraparenchymal hemorrhage. Hematologic abnormalities are reported to be the major risk factor in 10% to 30% of hemorrhagic strokes in most series. ..... We are grateful to our patients, paramedical staff, nurses, lab-.

  17. Intracerebral hemorrhage in children

    African Journals Online (AJOL)

    Ihab Zidan

    2012-04-01

    Apr 1, 2012 ... count for 14%17 to 46%18 of hemorrhagic stroke in children and nearly 50%13 of intraparenchymal hemorrhage. Hematologic abnormalities are reported to be the major risk factor in 10% to 30% of hemorrhagic strokes in most series. ... specific symptoms like: deterioration of general condition, in- creased ...

  18. Retrospective Methods Analysis of Semiautomated Intracerebral Hemorrhage Volume Quantification From a Selection of the STICH II Cohort (Early Surgery Versus Initial Conservative Treatment in Patients With Spontaneous Supratentorial Lobar Intracerebral Haematomas).

    Science.gov (United States)

    Haley, Mark D; Gregson, Barbara A; Mould, W Andrew; Hanley, Daniel F; Mendelow, Alexander David

    2018-02-01

    The ABC/2 method for calculating intracerebral hemorrhage (ICH) volume has been well validated. However, the formula, derived from the volume of an ellipse, assumes the shape of ICH is elliptical. We sought to compare the agreement of the ABC/2 formula with other methods through retrospective analysis of a selection of the STICH II cohort (Early Surgery Versus Initial Conservative Treatment in Patients With Spontaneous Supratentorial Lobar Intracerebral Haematomas). From 390 patients, 739 scans were selected from the STICH II image archive based on the availability of a CT scan compatible with OsiriX DICOM viewer. ICH volumes were calculated by the reference standard semiautomatic segmentation in OsiriX software and compared with calculated arithmetic methods (ABC/2, ABC/2.4, ABC/3, and 2/3SC) volumes. Volumes were compared by difference plots for specific groups: randomization ICH (n=374), 3- to 7-day postsurgical ICH (n=206), antithrombotic-associated ICH (n=79), irregular-shape ICH (n=703) and irregular-density ICH (n=650). Density and shape were measured by the Barras ordinal shape and density groups (1-5). The ABC/2.4 method had the closest agreement to the semiautomatic segmentation volume in all groups, except for the 3- to 7-day postsurgical ICH group where the ABC/3 method was superior. Although the ABC/2 formula for calculating elliptical ICH is well validated, it must be used with caution in ICH scans where the elliptical shape of ICH is a false assumption. We validated the adjustment of the ABC/2.4 method in randomization, antithrombotic-associated, heterogeneous-density, and irregular-shape ICH. URL: http://www.isrctn.com/ISRCTN22153967. Unique identifier: ISRCTN22153967. © 2018 American Heart Association, Inc.

  19. Thalamic hemorrhage. A prospective study of 100 patients.

    Science.gov (United States)

    Kumral, E; Kocaer, T; Ertübey, N O; Kumral, K

    1995-06-01

    The clinical features of thalamic hemorrhage in terms of localization are of great interest in many studies. To better understand the relationship between the localization of thalamic hemorrhage and clinical features. we evaluated the characteristics of patients with four different topographic types of thalamic hemorrhage. We prospectively studied 100 patients with thalamic hemorrhage who were admitted consecutively to our primary care unit. We divided them into two groups according to large (> 2 cm in diameter and/or > 4 mL in volume) and small thalamic hemorrhage. Four topographic subgroups (large and small) were compared to identify clinical syndromes associated with distinct lesion locations. All patients with posterolateral thalamic hemorrhage had severe sensorimotor deficit. Neuropsychological disturbances in patients with posterolateral thalamic hemorrhage were prominent, with primarily transcortical aphasia in those with left-sided lesions and hemineglect and anosognosia in those with right-sided lesions. Several variants of vertical gaze dysfunction, skew ocular deviation, gaze preference toward the site of the lesion, and miotic pupils were frequent in posterolateral thalamic hemorrhage, particularly in the large type. Patients with small and large anterolateral thalamic hemorrhage were characterized by severe motor and sensory deficits; language and oculomotor disturbances were also observed, although less frequently than in posterolateral hemorrhage. Sensorimotor deficits were observed in patients with medial thalamic hemorrhage (moderate in small hemorrhages and severe in large hemorrhages because of involvement of the adjacent internal capsule). Language disturbances in patients with left-sided lesions and neglect in patients with right-sided lesions were seen only in large medial thalamic hemorrhage. Dorsal thalamic hemorrhage was rare and characterized by mild and transient sensorimotor disturbances. Among patients with dorsal thalamic hemorrhages

  20. Is cerebral hemorrhage approaching?

    Energy Technology Data Exchange (ETDEWEB)

    Kawano, Hirokazu; Suzuki, Yukiko; Yoneyama, Takumi; Hamasuna, Ryouichi; Fujime, Kenichi; Goya, Tomokazu [Junwakai Memorial Hospital, Miyazaki (Japan)

    2001-09-01

    In Junwakai Memorial Hospital, from May, 2000 to April, 2001, 1042 patients underwent MRI examination to detect intracerebral microbleed (MB). This series included 481 hypertensive cases and 109 intra-cerebral and cerebellar hemorrhage patients. MB was identified by MRI GRASS image that detects hemosiderin with high sensitivity. The occurrence of MB is high in men and increased with the age. The hypertensive patients showed increased frequency of MB in proportion to the duration of hypertension. Almost all of the symptomatic cerebral and cerebellar hemorrhage cases showed multiple MBs except for massive hemorrhagic lesions. Therefore, MB can be an antecedant feature of the inpending symptomatic intracerebral and cerebellar hemorrhages. (author)

  1. Modeling intracerebral hemorrhage growth and response to anticoagulation.

    Directory of Open Access Journals (Sweden)

    Charles H Greenberg

    Full Text Available The mechanism for hemorrhage enlargement in the brain, a key determinant of patient outcome following hemorrhagic stroke, is unknown. We performed computer-based stochastic simulation of one proposed mechanism, in which hemorrhages grow in "domino" fashion via secondary shearing of neighboring vessel segments. Hemorrhages were simulated by creating an initial site of primary bleeding and an associated risk of secondary rupture at adjacent sites that decayed over time. Under particular combinations of parameters for likelihood of secondary rupture and time-dependent decay, a subset of lesions expanded, creating a bimodal distribution of microbleeds and macrobleeds. Systematic variation of the model to simulate anticoagulation yielded increases in both macrobleed occurrence (26.9%, 53.2%, and 70.0% of all hemorrhagic events under conditions simulating no, low-level, and high-level anticoagulation and final hemorrhage size (median volumes 111, 276, and 412 under the same three conditions, consistent with data from patients with anticoagulant-related brain hemorrhages. Reversal from simulated high-level anticoagulation to normal coagulation was able to reduce final hemorrhage size only if applied relatively early in the course of hemorrhage expansion. These findings suggest that a model based on a secondary shearing mechanism can account for some of the clinically observed properties of intracerebral hemorrhage, including the bimodal distribution of volumes and the enhanced hemorrhage growth seen with anticoagulation. Future iterations of this model may be useful for elucidating the effects of hemorrhage growth of factors related to secondary shearing (such as small vessel pathology or time-dependent decay (such as hemostatic agents.

  2. Massive fetomaternal hemorrhage

    DEFF Research Database (Denmark)

    Larsen, Rune; Berkowicz, Adela; Lousen, Thea

    2008-01-01

    BACKGROUND: The clearance of D+ red blood cells (RBCs) from the circulation in D- individuals mediated by passively administered anti-D occurs by opsonization with the antibody and subsequent removal in the spleen. Few data exist on the kinetics of clearance of large volumes of D+ RBCs from...... the maternal circulation by anti-D in clinical cases of massive fetomaternal hemorrhage (FMH). CASE REPORT: A 33-year-old D- woman delivered a D+ female infant by emergency cesarean section for suspected fetal anemia. A massive FMH, initially estimated to be approximately 142 mL of RBCs, was found. In addition...... had no detectable anti-D 6 months after delivery. RESULTS: No clearance of fetal cells was apparent after the insufficient dose of IM anti-D. The IV administration of anti-D caused accelerated clearance of D+ fetal RBCs with a t1/2 of 24.5 hours. D+ reticulocytes comprised 4.2 percent of all D+ cells...

  3. Hemorrhagic prepatellar bursitis

    Energy Technology Data Exchange (ETDEWEB)

    Donahue, F. [Dept. of Radiology, Musculoskeletal Section, Univ. of Miami/Jackson Memorial Hospital, Miami, FL (United States); Turkel, D. [Dept. of Radiology, Musculoskeletal Section, Univ. of Miami/Jackson Memorial Hospital, Miami, FL (United States); Mnaymneh, W. [Dept. of Orthopedics, Univ. of Miami/Jackson Memorial Hospital, Miami, FL (United States); Ghandur-Mnaymneh, L. [Dept. of Pathology, Univ. of Miami/Jackson Memorial Hospital, Miami, FL (United States)

    1996-04-01

    Simple prepatellar bursitis is easily diagnosed both clinically and by MRI. MRI shows the typical T1 and T2 lengthening of fluid within the bursa. However, because of complex MRI appearance of hemorrhage, chronic hemorrhagic bursitis and the size of the prepatellar mass the clinical and MRI appearance can be very different. (orig.)

  4. Physiologic Aspects of Porcine Hemorrhage. III. Heart Rate and Arterial Blood Pressure Changes during Spontaneous Recovery from 30 and 50 Percent Blood Volume Loss in the Conscious Animal.

    Science.gov (United States)

    1981-07-01

    Ltiti. Rt.port. No. 9Y -7~/C ~ /3 TT~r .~E,.....e ~- TYPE OF REPORT a PERIOD COVERED Heart Rate and Arterial Blood Pressure Changes ,lnterim ’Jan-Dec W80...we are highly indebted to Ann L. Wilkinson for the innumerable hours she spent in typing , proofreading, and assembling the manuscript, and to Lottie B...weight dictated by this equa- tion is illustrated in Figure 1. 80- Porcine Blood Volume 79 78 77- 76 75 I 15 20 25 30 Body Weight 1kgl lI ( ’r( I. Blod

  5. CT Attenuation Analysis of Carotid Intraplaque Hemorrhage.

    Science.gov (United States)

    Saba, L; Francone, M; Bassareo, P P; Lai, L; Sanfilippo, R; Montisci, R; Suri, J S; De Cecco, C N; Faa, G

    2017-11-30

    Intraplaque hemorrhage is considered a leading parameter of carotid plaque vulnerability. Our purpose was to assess the CT characteristics of intraplaque hemorrhage with histopathologic correlation to identify features that allow for confirming or ruling out the intraplaque hemorrhage. This retrospective study included 91 patients (67 men; median age, 65 ± 7 years; age range, 41-83 years) who underwent CT angiography and carotid endarterectomy from March 2010 to May 2013. Histopathologic analysis was performed for the tissue characterization and identification of intraplaque hemorrhage. Two observers assessed the plaque's attenuation values by using an ROI (≥ 1 and ≤2 mm2). Receiver operating characteristic curve, Mann-Whitney, and Wilcoxon analyses were performed. A total of 169 slices were assessed (59 intraplaque hemorrhage, 63 lipid-rich necrotic core, and 47 fibrous); the average values of the intraplaque hemorrhage, lipid-rich necrotic core, and fibrous tissue were 17.475 Hounsfield units (HU) and 18.407 HU, 39.476 HU and 48.048 HU, and 91.66 HU and 93.128 HU, respectively, before and after the administration of contrast medium. The Mann-Whitney test showed a statistically significant difference of HU values both in basal and after the administration of contrast material phase. Receiver operating characteristic analysis showed a statistical association between intraplaque hemorrhage and low HU values, and a threshold of 25 HU demonstrated the presence of intraplaque hemorrhage with a sensitivity and specificity of 93.22% and 92.73%, respectively. The Wilcoxon test showed that the attenuation of the plaque before and after administration of contrast material is different (intraplaque hemorrhage, lipid-rich necrotic core, and fibrous tissue had P values of .006, .0001, and .018, respectively). The results of this preliminary study suggest that CT can be used to identify the presence of intraplaque hemorrhage according to the attenuation. A threshold of 25

  6. [Persistent hematuria after embolization for hemorrhagic complication following percutaneous nephrolithotomy: value of the study of red blood cell volume in urine].

    Science.gov (United States)

    Demey, Alexis; Colomb, Frédéric; Pebeyre, Bruno; Raffaelli, Charles; Garcia, Grégory; Toubol, Jacques; Chevallier, Daniel; Amiel, Jean

    2003-06-01

    Percutaneous nephrolithotomy is associated with a high risk of complications, particularly bleeding, which makes it a potentially invasive technique. Management of haemorrhagic complications sometimes requires the use of embolization. Recurrence after embolization can occur as a result of revascularization or recanalization of vessels, but post-embolization infarction can also lead to persistent haematuria. The authors report the clinical case of a 36-year-old patient presenting with recurrence of severe haematuria after two successive highly selective embolizations. Analysis of the mean corpuscular volume of red cells in the urine confirmed the parenchymal and non-vascular origin of the bleeding, corresponding to a post-embolization syndrome. This analysis therefore constitutes a simple way to avoid repeated embolization or surgical exploration.

  7. Mortality after hemorrhagic stroke

    DEFF Research Database (Denmark)

    González-Pérez, Antonio; Gaist, David; Wallander, Mari-Ann

    2013-01-01

    , 54.6% for 80-89 years; SAH: 20.3% for 20-49 years, 56.7% for 80-89 years; both p-trend stroke patients...... = 0.03). CONCLUSIONS: More than one-third of individuals die in the first month after hemorrhagic stroke, and patients younger than 50 years are more likely to die after ICH than SAH. Short-term case fatality has decreased over time. Patients who survive hemorrhagic stroke have a continuing elevated...

  8. Glibenclamide for the Treatment of Ischemic and Hemorrhagic Stroke

    Directory of Open Access Journals (Sweden)

    Nicholas Caffes

    2015-03-01

    Full Text Available Ischemic and hemorrhagic strokes are associated with severe functional disability and high mortality. Except for recombinant tissue plasminogen activator, therapies targeting the underlying pathophysiology of central nervous system (CNS ischemia and hemorrhage are strikingly lacking. Sur1-regulated channels play essential roles in necrotic cell death and cerebral edema following ischemic insults, and in neuroinflammation after hemorrhagic injuries. Inhibiting endothelial, neuronal, astrocytic and oligodendroglial sulfonylurea receptor 1–transient receptor potential melastatin 4 (Sur1–Trpm4 channels and, in some cases, microglial KATP (Sur1–Kir6.2 channels, with glibenclamide is protective in a variety of contexts. Robust preclinical studies have shown that glibenclamide and other sulfonylurea agents reduce infarct volumes, edema and hemorrhagic conversion, and improve outcomes in rodent models of ischemic stroke. Retrospective studies suggest that diabetic patients on sulfonylurea drugs at stroke presentation fare better if they continue on drug. Additional laboratory investigations have implicated Sur1 in the pathophysiology of hemorrhagic CNS insults. In clinically relevant models of subarachnoid hemorrhage, glibenclamide reduces adverse neuroinflammatory and behavioral outcomes. Here, we provide an overview of the preclinical studies of glibenclamide therapy for CNS ischemia and hemorrhage, discuss the available data from clinical investigations, and conclude with promising preclinical results that suggest glibenclamide may be an effective therapeutic option for ischemic and hemorrhagic stroke.

  9. Monitoring of plethysmography variability index and total hemoglobin levels during cesarean sections with antepartum hemorrhage for early detection of bleeding

    Directory of Open Access Journals (Sweden)

    Ahmed Elsakka

    2017-01-01

    Conclusion: Plethysmography variability index and non invasive hemoglobin monitoring as well can be used for optimization of intravascular volume status during cesarean sections in parturients with antepartum hemorrhage.

  10. Viral hemorrhagic septicemia

    Science.gov (United States)

    Batts, William N.; Winton, James R.

    2012-01-01

    Viral hemorrhagic septicemia (VHS) is one of the most important viral diseases of finfish worldwide. In the past, VHS was thought to affect mainly rainbow trout Oncorhynchus mykiss reared at freshwater facilities in Western Europe where it was known by various names including Egtved disease and infectious kidney swelling and liver degeneration (Wolf 1988). Today, VHS is known as an important source of mortality for cultured and wild fish in freshwater and marine environments in several regions of the northern hemisphere (Dixon 1999; Gagné et al. 2007; Kim and Faisal 2011; Lumsden et al. 2007; Marty et al. 1998, 2003; Meyers and Winton 1995; Skall et al. 2005b; Smail 1999; Takano et al. 2001). Viral hemorrhagic septicemia is caused by the fish rhabdovirus, viral hemorrhagic septicemia virus (VHSV), a member of the genus Novirhabdovirus of the family Rhabdoviridae

  11. Postpartum hemorrhage: a continuing challenge

    National Research Council Canada - National Science Library

    Lockhart, Evelyn

    2015-01-01

    .... Many postpartum hemorrhages (PPHs) do not have identifiable risk factors; maternity units should therefore have obstetric hemorrhageprotocols in place for all parturients as every pregnancy has the potential to be complicated by hemorrhage...

  12. Marburg Hemorrhagic Fever (Marburg HF)

    Science.gov (United States)

    ... Submit Search the CDC Marburg hemorrhagic fever (Marburg HF) Note: Javascript is disabled or is not supported ... Fever (VHF) Information for Specific Groups, References... Marburg HF Outbreak Distribution Map Factsheet: Marburg Hemorrhagic Fever [PDF – ...

  13. Ebola hemorrhagic Fever.

    Science.gov (United States)

    Burnett, Mark W

    2014-01-01

    Ebola hemorrhagic fever is an often-fatal disease caused by a virus of the Filoviridae family, genus Ebolavirus. Initial signs and symptoms of the disease are nonspecific, often progressing on to a severe hemorrhagic illness. Special Operations Forces Medical Providers should be aware of this disease, which occurs in sporadic outbreaks throughout Africa. Treatment at the present time is mainly supportive. Special care should be taken to prevent contact with bodily fluids of those infected, which can transmit the virus to caregivers. 2014.

  14. Mechanisms of hemorrhagic cystitis

    Science.gov (United States)

    Haldar, Subhash; Dru, Christopher; Bhowmick, Neil A

    2014-01-01

    The vast majority of cases of infectious cystitis are easily treated, and most patients have no long-term complications. However, hemorrhagic cystitis is a potentially deadly complication associated with pelvic radiation therapy, chemotherapy, and stem-cell transplant therapy. The focus of current understanding, and hence therapy, is directed toward urothelial cell death. However, the primary functional ramification of inflammatory bladder disease is the loss of compliance due to muscular expansion. Recent studies on smooth muscle response in models of bladder inflammation demonstrate a process of pyroptotic cell death that potentiates further muscle hyperplasia. These findings may support alternative interventions for subjects with hemorrhagic cystitis refractive to current therapy. PMID:25374922

  15. Non-aneurysmal subarachnoid hemorrhage

    DEFF Research Database (Denmark)

    Bashir, Asma; Mikkelsen, Ronni; Sørensen, Leif

    2017-01-01

    Purpose Repeat imaging in patients with non-aneurysmal subarachnoid hemorrhage (NASAH) remains controversial. We aim to report our experience with NASAH with different hemorrhage patterns, and to investigate the need for further diagnostic workup to determine the underlying cause of hemorrhage. M...

  16. Magnesium in subarachnoid hemorrhage

    NARCIS (Netherlands)

    Bergh, W.M. (Walter Marcel) van den

    2004-01-01

    The main objective of this thesis was to determine the role of serum magnesium in the pathophysiology after subarachnoid hemorrhage (SAH) and to assess the effect of magnesium treatment in reducing cerebral ischemia in experimental SAH and in improving clinical outcome in patients with

  17. Spontaneous Intracerebral Hemorrhage: Computed Tomographic Characteristics and Outcome

    Directory of Open Access Journals (Sweden)

    Aimara de la Caridad Vergara Santos

    2015-12-01

    Full Text Available Background: strokes are the third leading cause of death among adults and 10-15 % of them are due to spontaneous intracerebral hemorrhage. Objective: to characterize spontaneous intracerebral hemorrhage through computed tomography scan and its outcome. Methods: a case series study was conducted comprising patients diagnosed with spontaneous intracerebral hemorrhage admitted to the Arnaldo Milián Castro Provincial University Hospital in Villa Clara from January 2009 to January 2010. Tomographic variables of interest were derived from evaluation of spontaneous intracerebral hematomas. Results: fifty-nine cases of spontaneous intracerebral hemorrhage were studied, 23 were located in lobar regions, 4 had severe midline shift, and 2 showed volume greater than 80 ml. Eight out of eleven with extension into the ventricular system had an unfavorable outcome. Among those with thalamic hemorrhage, patients with diameter larger than 4cm and extension into the ventricular system died. Patients with putaminal hemorrhage larger than 4 cm and posterior fossa hematoma with hydrocephalus had a poor outcome, as well as most individuals (55 with other mass effects. Most lobar hematomas (14 out of 23 had a satisfactory outcome, unlike cerebellar and brainstem hematomas. Conclusions: tomographic variables that had a negative impact on the outcome were: volume greater than 80 ml, severe midline shift, diameter larger than 4 cm, extension into the ventricular system, hydrocephalus, other signs of mass effect and brainstem location.

  18. Radiation-induced hemorrhagic cystitis.

    Science.gov (United States)

    Alesawi, Anwar M; El-Hakim, Assaad; Zorn, Kevin C; Saad, Fred

    2014-09-01

    To better understand the mechanism of radiation-induced hemorrhagic cystitis and the advantages and disadvantages of available treatment options for bladder hemorrhage as well as preventive measures. There have been several attempts recently to manage hemorrhagic cystitis with hyperbaric oxygen therapy, transurethral coagulation using Greenlight potassium-titanyl-phosphate laser and other different treatment modalities, but we still need more investigation on larger cohort studies. Hemorrhagic cystitis is an uncommon urological problem. It is most often caused by radiation therapy and cyclophosphamide, but can be associated with other contributing factors. Technological advances in radiation therapy have resulted in greater treatment efficacy, with significant reduction in side-effects such as hemorrhagic cystitis. Higher dose radiation treatment, however, is more often associated with problematic hemorrhagic cystitis. Treatment of hemorrhagic cystitis is multifactorial and can range from simple bladder irrigation to cystectomy with urinary diversion.

  19. Predictors of outcome for non-traumatic intracerebral hemorrhage.

    Science.gov (United States)

    Jamil, Syed A; Khan, Abdul S; Akturk, Zekeriya

    2008-07-01

    To evaluate the prognosis, neurologic outcome, and predictors of survival in patients with non-traumatic intracerebral hemorrhage. We evaluated prospectively a cohort of 96 Saudi adult males and females with stroke during the month of July 2005 at Arar Central Hospital, Riyadh, Kingdom of Saudi Arabia. Out of 103 patients, 96 patients, who were diagnosed as having intracerebral hemorrhage (ICH) presenting to the emergency department for initial evaluation, were included, except those with recurrent intracerebral hemorrhage, arteriovenous malformation, subarachnoid hemorrhage, traumatic brain injury, hemorrhagic infarctions, and patients receiving anticoagulant therapy. No patient underwent any neurosurgical procedure. The results of 96 patients were analyzed. The mean age at ICH was 67.2 (+/-14.7) years (range, 30-100 years), and mean Glasgow coma scale (GCS) score on admission was 8.42 (+/-1.73) and (range, 4-13). Mean ICH volume on initial CT scan was 10.61 (+/-14.01) ml3 (range, 1-63). Mean pulse pressure on hospital arrival was 81.9 (+/-22.8) mm Hg (range, 70-120 mm Hg). In uni-variate analysis, GCS score (p=0.0005), ICH volume (p=0.001), mass effect (p=0.001), and presence of intraventricular hemorrhage (p=0.0005) were all associated with 30-days mortality, while in multivariable analysis, the most significant independent predictors of 30-day mortality were, GCS score and the intraventricular extension of hemorrhage. This model may aid in making decisions quickly and easily regarding the appropriate level of care for such patients with intracerebral hemorrhage.

  20. Korean Hemorrhagic Fever.

    Science.gov (United States)

    1980-03-01

    STANDARDS-1963-A ?H "LEVEtf® AD <o KOREAN HEMORRHAGIC F EVER A D A 09 47 Final Report HO WANG LEE, M. D. March 1980 i MIL . IIB«I . Mm k iw...Korea Med. Univ. 10: 817-827, 1983. 23. Umenai, T., Lee, H. W., Lee, P. W., Saito, T., Toyoda, T., Hongo , M., Yoshinaga, K., Nobunaga, T. Horiuchi, T

  1. Bacterial hemorrhagic enterocolitis.

    Science.gov (United States)

    Ina, Kenji; Kusugami, Kazuo; Ohta, Michio

    2003-01-01

    Bacterial diarrhea can be classified into two clinical entities, noninflammatory diarrhea and inflammatory diarrhea syndromes. The latter type of diarrhea is characterized by bloody and puruloid mucus stool, and is often accompanied by fever, tenesmus, and severe abdominal pain. Pathogenic bacteria causing the inflammatory diarrhea syndrome include Salmonella, Vibrio, Shigella, enteroinvasive and enterohemorrhagic Escherichia coli, Campylobacter, Yersinia, Chlamydia, and Clostridium difficile. The pathologic changes in the inflammatory diarrhea syndrome range from a superficial exudative enterocolitis to a transmural enterocolitis with overt ulceration. This syndrome is also designated as bacterial hemorrhagic enterocolitis because of its usual manifestation by bloody diarrhea. The diagnostic approach needs information on the patient's age, travel history, epidemiological associations, sexual practice, and medical history, including usage of antibiotics. Bacterial information can be obtained by microscopic study, culture, and the identification of specific bacterial toxins. Flexible colonoscopy with biopsy is useful for the differentiation of bacterial hemorrhagic enterocolitis from idiopathic ulcerative colitis and ischemic colitis. Physicians should be familiar with the diagnostic modalities used to detect the specific pathogens causing hemorrhagic bacterial enterocolitis; namely, bacterial culture, serology, histology, and nucleic acid technologies.

  2. Severe Postpartum Hemorrhage from Uterine Atony: A Multicentric Study

    Directory of Open Access Journals (Sweden)

    Carlos Montufar-Rueda

    2013-01-01

    Full Text Available Objective. Postpartum hemorrhage (PPH is an important cause of maternal mortality (MM around the world. Seventy percent of the PPH corresponds to uterine atony. The objective of our study was to evaluate multicenter PPH cases during a 10-month period, and evaluate severe postpartum hemorrhage management. Study Design. The study population is a cohort of vaginal delivery and cesarean section patients with severe postpartum hemorrhage secondary to uterine atony. The study was designed as a descriptive, prospective, longitudinal, and multicenter study, during 10 months in 13 teaching hospitals. Results. Total live births during the study period were 124,019 with 218 patients (0.17% with severe postpartum hemorrhage (SPHH. Total maternal deaths were 8, for mortality rate of 3.6% and a MM rate of 6.45/100,000 live births (LB. Maternal deaths were associated with inadequate transfusion therapy. Conclusions. In all patients with severe hemorrhage and subsequent hypovolemic shock, the most important therapy is intravascular volume resuscitation, to reduce the possibility of target organ damage and death. Similarly, the current proposals of transfusion therapy in severe or massive hemorrhage point to early transfusion of blood products and use of fresh frozen plasma, in addition to packed red blood cells, to prevent maternal deaths.

  3. Hemorrhagic radiation cystitis.

    Science.gov (United States)

    Mendenhall, William M; Henderson, Randal H; Costa, Joseph A; Hoppe, Bradford S; Dagan, Roi; Bryant, Curtis M; Nichols, Romaine C; Williams, Christopher R; Harris, Stephanie E; Mendenhall, Nancy P

    2015-06-01

    The optimal management of persistent hemorrhagic radiation cystitis is ill-defined. Various options are available and include oral agents (ie, sodium pentosan polysulfate), intravenous drugs (ie, WF10), topical agents (ie, formalin), hyperbaric oxygen, and endoscopic procedures (ie, electrical cautery, argon plasma coagulation, laser coagulation). In general, it is best to manage patients conservatively and intervene only when necessary with the option least likely to exacerbate the cystitis. More aggressive measures should be employed only when more conservative approaches fail. Bladder biopsies should be avoided, unless findings suggest a bladder tumor, because they may precipitate a complication.

  4. Post-tonsillectomy hemorrhage

    DEFF Research Database (Denmark)

    Heidemann, Christian; Wallén, Mia; Aakesson, Marie

    2008-01-01

    Post-tonsillectomy hemorrhage (PTH) is a relatively common and potentially life-threatening complication. The objective of this study was to examine the rate of PTH and identify risk factors. A retrospective cohort study was carried out including all tonsillectomies (430 patients) performed...... at Odense University Hospital (OUH) or Svendborg Hospital (SH), Denmark. PTH occurred in 52 patients (12.1%). Of the 180 patients treated with coblation technique, 41 (22.7%) had PTH. There were no fatal bleeding episodes. Multiple regression analysis resulted in three significant covariates: "Coblation...

  5. Angioembolization for pelvic hemorrhage control

    DEFF Research Database (Denmark)

    Hauschild, Oliver; Aghayev, Emin; von Heyden, Johanna

    2012-01-01

    BACKGROUND: Hemorrhage from pelvic vessels is a potentially lethal complication of pelvic fractures. There is ongoing controversy on the ideal treatment strategy for patients with pelvic hemorrhage. The aim of the study was to analyze the role of angiography and subsequent embolization in patient...

  6. Intracerebral Hemorrhage in Eclampsia

    Directory of Open Access Journals (Sweden)

    Ye. M. Shifman

    2008-01-01

    Full Text Available The classical triad of symptoms is a basis for making the diagnosis of eclampsia. Nevertheless, none pregnancy complication fails to differ in clinical manifestations, the uncertainty and ambiguity of maternal and fetal prognosis, and in the direct causes of fatal outcomes. The authors present an account of a case of maternal mortality. A 17-year-old primigravida with a history of arterial hypertension at gestational weeks 31—32 developed a series of seizures and lost consciousness. She was diagnosed as having eclampsia complicated by acute ischemic attack. Emergency cesarean delivery was made. Postoperatively, the puerpera was transferred to the neurosurgery unit to be examined and treated. Computed tomography revealed intracerebral hemorrhage, with blood entering the brain ventricles, and occlusive hydrocephalus from the fourth ventricular level. Ventricular drainage was made as described by Arendt. The prognosis was poor. The patient’s death was stated on postpartum day 5. The authors consider that the publication and discussion of such cases should give a better insight into the development of eclampsia and its life-threatening complications. Fortunately, eclampsia is rare, the incidence of its complications is even less. But each such a case deserves a detailed and thoughtful discussion. Key words: eclampsia, intracerebral hemorrhage.

  7. Aphasia Following Left Putaminal Hemorrhage at a Rehabilitation Hospital.

    Science.gov (United States)

    Maeshima, Shinichiro; Okamoto, Sayaka; Okazaki, Hideto; Funahashi, Reisuke; Hiraoka, Shigenori; Hori, Hirokazu; Yagihashi, Kei; Fuse, Ikuko; Tanaka, Shinichiro; Asano, Naoki; Sonoda, Shigeru

    2017-11-09

    We aimed to clarify the relationship between aphasia and hematoma type/volume in patients with left putaminal hemorrhage admitted to a rehabilitation facility. We evaluated the relationship between the presence, type, and severity of aphasia and hematoma type/volume in 92 patients with putaminal hemorrhage aged 29-83 years. Hematoma type and volume were evaluated on the basis of CT images obtained at stroke onset. The Standard Language Test for Aphasia was conducted as part of the initial assessment. Aphasia was observed in 79 of 92 patients. A total of 31 patients had fluent aphasia, while 48 had non-fluent aphasia. Non-fluent aphasia often involved hematoma on the anterior limb of the internal capsule, while fluent aphasia often involved hematoma on the posterior limb of internal capsule. When the hematoma volume exceeded 20 mL, patients experienced difficulty in repeating spoken words. When hematoma volume exceeded 40 mL, non-fluent aphasia was observed in all patients. Our findings suggest that hematoma type and volume not only influence the development of aphasia following putaminal hemorrhage but also play a major role in determining the patient's fluency and repetition ability. © 2017 S. Karger AG, Basel.

  8. Hemorrhagic shock: The "physiology approach"

    Directory of Open Access Journals (Sweden)

    Fabrizio Giuseppe Bonanno

    2012-01-01

    Full Text Available A shift of approach from ′clinics trying to fit physiology′ to the one of ′physiology to clinics′, with interpretation of the clinical phenomena from their physiological bases to the tip of the clinical iceberg, and a management exclusively based on modulation of physiology, is finally surging as the safest and most efficacious philosophy in hemorrhagic shock. ATLS® classification and recommendations on hemorrhagic shock are not helpful because antiphysiological and potentially misleading. Hemorrhagic shock needs to be reclassified in the direction of usefulness and timing of intervention: in particular its assessment and management need to be tailored to physiology.

  9. Hemorrhagic Lacrimation and Epistaxis in Acute Hemorrhagic Edema of Infancy

    Directory of Open Access Journals (Sweden)

    Shireen Mreish

    2016-01-01

    Full Text Available Acute hemorrhagic edema of infancy is an uncommon benign cutaneous vasculitis. Despite its worrisome presentation, it carries good prognosis with rarely reported systemic involvement. Management of these cases has been an area of debate with majority of physicians adopting conservative modalities. We report a case that presented with classic triad of rash, low grade fever, and peripheral edema along with two rarely reported manifestations in literature: hemorrhagic lacrimation and epistaxis.

  10. [Subarachnoid hemorrhage associated to subhyaloid hemorrhage: "Terson syndrome"].

    Science.gov (United States)

    Castaño-Duque, C H; Pons-Irazazabal, L C; López-Moreno, J L

    1997-07-01

    The combination of subarachnoid hemorrhage (SAH) and subhyaloid hemorrhage is known as 'Terson syndrome'. Retinal hemorrhage is commonly observed clinically in the optic fundi of patients with SAH, however, subhyaloid hemorrhage of the globe in the setting of SAH has been rarely on CT of the brain. Several mechanisms of subhyaloid hemorrhage have been proposed: a. A sudden increase in intracranial pressure (ICP) forces blood from the subarachnoid space directly into the preretinal space. b. A sudden rise in ICP is thought to decrease venous return to the cavernous sinus from the veins draining the globe. The increased retinal venous pressure results in stasis followed by vessel rupture. c. A sudden rise in ICP obstructs both the retinochoroidal anastomoses and the central retinal vein due to a rapid effusion of CSF through the communication of the subarachnoid space with the optic nerve sheat. This produces an acute decrease in venous drainage from the retina and results in stasis and hemorrhage. A 35 year old man, with a history of a non controlled arterial hypertension, dilated cardiopathy and 'agitation episodes'. He had a spontaneous intracranial hemorrhage, consistent in a parenchymal hematoma ruptured into ventricles and subarachnoid space. The CT showed through optic nerve sheath this hemorrhage extended to subhyaloid space. The patient came in coma 'dépassé' and brain death. We report a case of Terson syndrome demonstrated by CT. This CT allow see the blood from the subarachnoid space erupt directly into the preretinal space through optic nerve sheath, confirming one the proposed mechanism for this syndrome.

  11. Neuroprotective strategies following intraparenchymal hemorrhage.

    Science.gov (United States)

    Babadjouni, Robin Moshe; Radwanski, Ryan E; Walcott, Brian P; Patel, Arati; Durazo, Ramon; Hodis, Drew M; Emanuel, Benjamin A; Mack, William J

    2017-12-01

    Intracerebral hemorrhage and, more specifically, intraparenchymal hemorrhage, are devastating disease processes with poor clinical outcomes. Primary injury to the brain results from initial hematoma expansion while secondary hemorrhagic injury occurs from blood-derived products such as hemoglobin, heme, iron, and coagulation factors that overwhelm the brains natural defenses. Novel neuroprotective treatments have emerged that target primary and secondary mechanisms of injury. Nonetheless, translational application of neuroprotectants from preclinical to clinical studies has yet to show beneficial clinical outcomes. This review summarizes therapeutic agents and neuroprotectants in ongoing clinical trials aimed at targeting primary and secondary mechanisms of injury after intraparenchymal hemorrhage. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  12. Crimean-Congo hemorrhagic fever

    OpenAIRE

    Ergonul, O.

    2016-01-01

    Crimean Congo hemorrhagic fever virus (CCHFV) is a geographically widespread pathogen that causes severe hemorrhagic fever with high mortality. Although it is primarily zoonosis, sporadic cases and outbreaks of CCHF affecting humans do occur. The disease is endemic in many countries in Africa, Europe and Asia, and during 2002-2006, is has been reported in Turkey. People become infected through tick bites (especially Hyalomma spp.), by crushing infected ticks, after contact with a patient with...

  13. Evaluation of the Efficiency of Treatment for Massive Obstetric Hemorrhage

    Directory of Open Access Journals (Sweden)

    S. V. Barinov

    2014-01-01

    Full Text Available Objective: to evaluate the efficiency of therapy for massive obstetric hemorrhage, by applying thromboelastography (TEG. Subjects and methods. Sixty six patients with massive obstetric hemorrhage who were divided into two groups: a study (A; n=37 and comparison (B; n=29 groups were examined. A control group (C; n=30 comprised women with physiological blood loss during labor. The efficiency of TEG was evaluated from the volume of blood loss and the frequency of hysterectomy.Results. Fibrin clot density, MA have the highest prognostic capacity to identify the risk of massive obstetric hemorrhage [AUC=0.83 (95% CI 0.79—0.87; р=0.001]. A therapeutic and diagnostic set for massive obstetric hemorrhage, by applying TEG, can reduce the number of hysterectomies by 3. 1 times (p=0.02, the volume of blood loss by 1.3 times (p=0.03, and the use of fresh frozen plasma by 2.0 times (p=0.01. Conclusion. Rapid evaluation of the blood coagulation system, by using a TEG® 5000 device (Haemoscope Corp., USA makes it possible to perform timely pathogenetic sound therapy, to prevent a critical condition, and to implement organ-sparing tactics.  

  14. Spontaneous Intracapsular Tonsillar Hemorrhage

    Directory of Open Access Journals (Sweden)

    Güçlü Beriat

    2012-07-01

    Full Text Available In this case report, we discussed a case of spontaneous intracapsular tonsillar haemorrhage appearing as a tumor medial to the left palatine tonsil and clinging to the tonsillar tissue with a pedicle. The patient was a 30 years old healthy pregnant woman. She had a growing sensation of a lump in her oropharynx and dysphagia in the past three months. She had no history of acute and chronic tonsillitis or trauma. On examination, a mobile brown mass with a 2 cm diameter having a small pedicle at the upper pole of the left palatine tonsil was seen. Other laboratory results were normal. The mass was excised under general anesthesia. Histological evaluation revealed tonsillar intracapsular bleeding with lymphoepi-thelial tissue and acute hemorrhagic fields bounded by a capsule. A postpartum tonsillectomy was planned for our patient. Tonsillectomy must be performed to patients followed up with this diagnosis in order to differentiate between dyspha-gia, risks of bleeding and aspiration, and malignant tumors.

  15. Prognostic Significance of Hyponatremia in Acute Intracerebral Hemorrhage: Pooled Analysis of the Intensive Blood Pressure Reduction in Acute Cerebral Hemorrhage Trial Studies.

    Science.gov (United States)

    Carcel, Cheryl; Sato, Shoichiro; Zheng, Danni; Heeley, Emma; Arima, Hisatomi; Yang, Jie; Wu, Guojun; Chen, Guofang; Zhang, Shihong; Delcourt, Candice; Lavados, Pablo; Robinson, Thompson; Lindley, Richard I; Wang, Xia; Chalmers, John; Anderson, Craig S

    2016-07-01

    To determine the association of hyponatremia at presentation with clinical and imaging outcomes in patients with acute intracerebral hemorrhage. Retrospective pooled analysis of prospectively collected data from 3,243 participants of the pilot and main phases of the Intensive Blood Pressure Reduction in Acute Cerebral Hemorrhage Trials 1 and 2 (international, multicenter, open, blinded endpoint, randomized controlled trials designed to assess the effects of early intensive blood pressure lowering in patients with acute intracerebral hemorrhage). Clinical hospital sites in 21 countries. Patients with predominantly mild-moderate severity of spontaneous intracerebral hemorrhage within 6 hours of onset and elevated systolic blood pressure (150-220 mm Hg) were included in the study. Patients were assigned to receive intensive (target systolic blood pressure, < 140 mm Hg within 1 hr) or guideline-recommended (target systolic blood pressure, < 180 mm Hg) blood pressure-lowering therapy. Presentation hyponatremia was defined as serum sodium less than 135 mEq/L. The primary outcome was death at 90 days. Multivariable logistic regression was used to assess the association of hyponatremia with important clinical events. Of 3,002 patients with available data, 349 (12%) had hyponatremia. Hyponatremia was associated with death (18% vs 11%; multivariable-adjusted odds ratio, 1.81; 95% CI, 1.28-2.57; p < 0.001) and larger baseline intracerebral hemorrhage volume (multivariable adjusted, p = 0.046) but not with baseline perihematomal edema volume nor with growth of intracerebral hemorrhage or perihematomal edema during the initial 24 hours. Hyponatremia at presentation is associated with increased mortality in patients with predominantly deep and modest volume intracerebral hemorrhage through mechanisms that seem independent of growth in intracerebral hemorrhage or perihematomal edema.

  16. Efficacy and safety of recombinant activated factor VII for acute intracerebral hemorrhage

    DEFF Research Database (Denmark)

    Mayer, Stephan A; Brun, Nikolai C; Begtrup, Kamilla

    2008-01-01

    patients with intracerebral hemorrhage to receive placebo (268 patients), 20 microg of rFVIIa per kilogram of body weight (276 patients), or 80 microg of rFVIIa per kilogram (297 patients) within 4 hours after the onset of stroke. The primary end point was poor outcome, defined as severe disability...... or death according to the modified Rankin scale 90 days after the stroke. RESULTS: Treatment with 80 microg of rFVIIa per kilogram resulted in a significant reduction in growth in volume of the hemorrhage. The mean estimated increase in volume of the intracerebral hemorrhage at 24 hours was 26...... in the placebo group (9% vs. 4%, P=0.04). CONCLUSIONS: Hemostatic therapy with rFVIIa reduced growth of the hematoma but did not improve survival or functional outcome after intracerebral hemorrhage. (ClinicalTrials.gov number, NCT00127283 [ClinicalTrials.gov].)....

  17. Emergent embolization for control of massive hemorrhage from a splanchnic artery with a new coaxial catheter system

    Energy Technology Data Exchange (ETDEWEB)

    Okazaki, M.; Higashihara, H.; Koganemaru, F.; Ono, H.; Fujimitsu, R.; Yamasaki, S.; Toyoshima, H.; Sato, S.; Hoashi, T.; Kimura, T. (Fukuoka Univ. Hospital (Japan). Dept. of Diagnostic Radiology)

    1992-01-01

    Emergent superselective embolization with a 3.0 F (1 mm) coaxial catheter and a steerable guidewire was performed in 27 patients with massive hemorrhage from a small-caliber splanchnic artery. Eight patients had intraperitoneal hemorrhage, 3 had hemobilia, 9 had gastric hemorrhage, and 7 had intestinal hemorrhage. Out of 27 patients, 7 had hemorrhage from a splanchnic artery pseudoaneurysm. Complete cessation of bleeding was obtained in all patients initially, but in 3 patients gastric hemorrhage recurred later. Otherwise, there was no rebleeding nor any major complication such as marked infarction of tissue or misplacement of embolic materials. This coaxial catheter system was highly reliable for achieving superselective catheterization in small-caliber arteries, minimizing the volume of infarcted tissue and allowing maximal preservation of splanchnic organic function. We conclude that this system represents a major advance in interventional radiology. (orig.).

  18. Age-dependent effect of treadmill exercise on hemorrhage-induced neuronal cell death in rats

    OpenAIRE

    Yoon, Jin-Hwan; Lee, Hee-Hyuk; Yi, Eun-Surk; Baek, Soon Gi

    2013-01-01

    Intracerebral hemorrhage (ICH) is a major cause of death and disability in the elderly. In the present study, we examined the age-dependence of the effect of treadmill exercise on the intrastriatal hemorrhage-induced neuronal cell death in rats. Young (8 weeks old) and old (64 weeks old) Sprague-Dawley male rats were used in the present study. Intrastriatal hemorrhage was induced by injection of 0.2 U collagenase (1 μL volume) into the striatum using a stereotaxic instrument. The rats in the ...

  19. Title:- retrobulbar hemorrhage

    African Journals Online (AJOL)

    Dr.Gagan

    recovery. Key words: orbital trauma, retrobulbar haemorrhage, retrobulbar haematoma, visual loss, orbital fracture, ... fracture and thrombolytic agents. Loss of vision as a. 3-12 complication of maxillofacial trauma ... once the hydraulic system of the orbit is full, even small changes in volume can cause a dramatic increase in ...

  20. MR imaging of ovarian hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Nishino, Mizuki E-mail: mizuki@mbox.kyoto-inet.or.jp; Hayakawa, Katsumi; Iwasaku, Kazuhiro; Togashi, Kaori; Ueda, Hiroyuki; Sago, Tadashi; Noguchi, Masato

    2004-07-01

    Background: To review MR appearances of ovarian hemorrhage, and to describe its characteristic imaging findings. Methods: 12 women (age range, 20-44, mean, 26 years) with suspected ovarian hemorrhage underwent pelvic MR examinations. We retrospectively reviewed MR findings regarding signal intensities, localization, and wall enhancement of adnexal masses, and signal intensities of ascites. Results: Adnexal masses were detected in all cases. In eight cases, adnexal mass exhibited intermediate signal intensity on T1WI, and intermediate to low signal intensity on T2WI. In other case, adnexal mass exhibited marked hyperintensity on T1WI. In the remaining three cases, cystic mass with low signal intensity on T1WI and high signal intensity on T2WI was noted. Ascites was present in all cases, and showed intermediate signal on T1WI and intermediate to low signal on T2WI. Conclusions: In ovarian hemorrhage, hemorrhagic ascites and adnexal mass was visualized with specific MR signal intensity. Due to its sensitivity for identifying blood, MR imaging is useful in the diagnosis of ovarian hemorrhage, especially when ultrasonography findings are not definitive.

  1. Hemorrhagic stroke and cerebral paragonimiasis.

    Science.gov (United States)

    Xia, Yong; Ju, Yan; Chen, Jing; You, Chao

    2014-11-01

    We retrospectively analyzed the clinical and imaging characteristics, diagnosis, and treatment outcomes of 10 patients with hemorrhagic cerebral paragonimiasis (CP), and we evaluated the influence of Paragonimus infection on cerebrovascular damage. Ten patients (7 male and 3 female; median age 15.7 years, range 4-46 years) with hemorrhagic CP were diagnosed between April 2009 and January 2013. All patients underwent the head computed tomography scans and 9 patients underwent MRI examinations. Four patients underwent computed tomographic angiography, magnetic resonance angiography, and digital subtraction angiography. Liquid-based cytological examination of cerebrospinal fluid was performed in 7 patients. Follow-up examinations were performed for 9 cases for a period of 12 to 62 months. Hemorrhagic CP accounted for 37% of CP cases (10/27). No patients were initially diagnosed with CP. The major symptoms of hemorrhagic CP included acute headache, vomiting, hemiparalysis, epilepsy, blurred vision, sensory impairment, and tinnitus. Four cases were surgically treated. Most symptoms markedly improved, but fine motor dysfunction and mental dysfunction remained in 3 surgical patients. Hemorrhagic stroke typically occurred during the acute stage and in the early stages of further Paragonimus migration. Delay of treatment increased the risk of initial and recurrent stroke. © 2014 American Heart Association, Inc.

  2. Impact of leukoaraiosis on parenchymal hemorrhage in elderly patients treated with thrombolysis.

    Science.gov (United States)

    Nighoghossian, Norbert; Abbas, Fatima; Cho, Tae-Hee; Geraldo, Ana Filipa; Cottaz, Vincent; Janecek, Elie; Mechtouff, Laura; Bischoff, Magali; El Khoury, Carlos; Schott, Anne Marie; Derex, Laurent; Hermier, Marc; Tisserand, Louis Guy; Amelie, Roxana; Chamard, Leila; Berthezene, Yves

    2016-10-01

    Severity of vascular damage of white matter may predict hemorrhagic transformation (HT). We assess the relationship between leukoaraiosis (LA) severity and the type of hemorrhagic transformation in elderly patients treated with thrombolysis. We retrospectively analyzed the clinical data and pretreatment magnetic resonance imaging (MRI) of 180 consecutive ischemic stroke patients aged over 75 years. LA severity was graded according to the Fazekas scale, and acute diffusion-weighted-imaging (DWI) lesion volumes were semi-automatically outlined. Predictors of hemorrhagic infarction (HI) and parenchymal hemorrhage (PH) were identified using logistic regression analysis and exact multinomial logistic analysis. HT occurred in 31 patients (17 %). Baseline National Institute of Health Stroke Score (NIHSS; p = 0.008), severe LA (p = 0.02), and diffusion lesion volume (p = 0.02) were predictors of HT in univariable logistic regression. Adjusted to lesion volume and baseline NIHSS score, exact multinomial logistic analysis showed that severe LA was the only independent predictor of parenchymal hemorrhage (p = 0.03). In elderly patients, LA severity better predicts parenchymal hemorrhage than infarct size.

  3. Impact of leukoaraiosis on parenchymal hemorrhage in elderly patients treated with thrombolysis

    Energy Technology Data Exchange (ETDEWEB)

    Nighoghossian, Norbert; Cho, Tae-Hee; Cottaz, Vincent; Mechtouff, Laura; Derex, Laurent [Universite Lyon 1, Department of Stroke, Neurological Hospital, Lyon (France); Abbas, Fatima; Schott, Anne Marie [Hospices Civils de Lyon, Pole Information Medicale Evaluation Recherche, Lyon (France); Geraldo, Ana Filipa; Janecek, Elie; Hermier, Marc; Tisserand, Louis Guy; Amelie, Roxana; Chamard, Leila; Berthezene, Yves [Universite Lyon 1, Department of Neuroradiology, Neurological Hospital, Bron, Lyon (France); Bischoff, Magali; El Khoury, Carlos [RESUVAL Stroke Network, Lyon (France)

    2016-10-15

    Severity of vascular damage of white matter may predict hemorrhagic transformation (HT). We assess the relationship between leukoaraiosis (LA) severity and the type of hemorrhagic transformation in elderly patients treated with thrombolysis. We retrospectively analyzed the clinical data and pretreatment magnetic resonance imaging (MRI) of 180 consecutive ischemic stroke patients aged over 75 years. LA severity was graded according to the Fazekas scale, and acute diffusion-weighted-imaging (DWI) lesion volumes were semi-automatically outlined. Predictors of hemorrhagic infarction (HI) and parenchymal hemorrhage (PH) were identified using logistic regression analysis and exact multinomial logistic analysis. HT occurred in 31 patients (17 %). Baseline National Institute of Health Stroke Score (NIHSS; p = 0.008), severe LA (p = 0.02), and diffusion lesion volume (p = 0.02) were predictors of HT in univariable logistic regression. Adjusted to lesion volume and baseline NIHSS score, exact multinomial logistic analysis showed that severe LA was the only independent predictor of parenchymal hemorrhage (p = 0.03). In elderly patients, LA severity better predicts parenchymal hemorrhage than infarct size. (orig.)

  4. The mechanism of pathological changes of intraventricular hemorrhage in dogs.

    Science.gov (United States)

    Dai, Jiong; Li, Shanquan; Li, Xiaoxiong; Xiong, Wenhao; Qiu, Yongming

    2009-01-01

    Intraventricular hemorrhage (IVH) is an independent risk factor for both morbidity and mortality in patients with intracerebral hemorrhage and subarchnoid hemorrhage. The pathophysiological mechanisms by which blood within the ventricles causes brain damage are still poorly understood. We developed a canine (dog) model with long-term survival. To study the mechanisms of pathological changes associated with IVH. The neurological status, cranial computed tomographic findings, and the pathological changes were studied in the dogs with IVH and also in the control dogs, intraventiricular saline injection. In all the dogs in the control group there were no abnormalities in all the three parameters studied. The dogs in the IVH group developed neurological deficits after the blood injection. There was linear relationship between the ventricular volume and blood clot volume in the first week. After the first week, there was progressive enlargement of the ventricular volume, while the clots continued to shrink. There was complete lysis of the clots within 4 weeks. Pathological studies showed distruction of the ependymal lining of the ventricular system, subependymal gliosis and ischemia of the neurons in the subependymal areas, prominently around the aqueduct. Ventricular dilation was the prominent feature following intraventricular injection of the blood. The other pathological features included disruption of ependymal lining, subependymal gliosis, and ischemic necrosis of neurons in the periventricular tissue of the third ventricle, aqueduct, and the fourth ventricle. These pathological may have some role in the ventricular dilatation following IVH.

  5. Symptomatic tarlov cyst following spontaneous subarachnoid hemorrhage.

    Science.gov (United States)

    Kong, Woo Keun; Cho, Keun-Tae; Hong, Seung-Koan

    2011-08-01

    Most of Tarlov or perineurial cysts remain asymptomatic throughout the patient's life. The pathogenesis is still unclear. Hemorrhage has been suggested as one of the possible causes and trauma with resultant hemorrhage into subarachnoid space has been suggested as an origin of these cysts. However, Tarlov cysts related to spontaneous subarachnoid hemorrhage has not been reported. The authors report a case of Tarlov cyst which was symptomatic following spontaneous subarachnoid hemorrhage.

  6. Symptomatic Tarlov Cyst Following Spontaneous Subarachnoid Hemorrhage

    OpenAIRE

    Kong, Woo Keun; Cho, Keun-Tae; Hong, Seung-Koan

    2011-01-01

    Most of Tarlov or perineurial cysts remain asymptomatic throughout the patient's life. The pathogenesis is still unclear. Hemorrhage has been suggested as one of the possible causes and trauma with resultant hemorrhage into subarachnoid space has been suggested as an origin of these cysts. However, Tarlov cysts related to spontaneous subarachnoid hemorrhage has not been reported. The authors report a case of Tarlov cyst which was symptomatic following spontaneous subarachnoid hemorrhage.

  7. Postradiosurgery hemorrhage rates of arteriovenous malformations of the brain: influencing factors and evolution with time.

    Science.gov (United States)

    Parkhutik, Vera; Lago, Aida; Tembl, José Ignacio; Vázquez, Juan Francisco; Aparici, Fernando; Mainar, Esperanza; Vázquez, Víctor

    2012-05-01

    The long-term benefit of radiosurgery of brain arteriovenous malformations (AVM), especially nonhemorrhagic cases, is controversial. We calculated hemorrhage rates pre- and posttreatment and analyzed the risk factors for bleeding based on cases followed at our site. One hundred eight patients, age 36 ± 17 years, 56 men. The mean follow-up was 65 ± 44 months (median, 54; interquartile range, 33-94). Most AVMs were small (74.1% <3 cm in diameter); 48.1% were located in an eloquent area, 27.8% had deep drainage, and 39.8% presented with hemorrhage. The annual hemorrhage rate for any undiagnosed AVM was 1.2%, and 3.3% for AVMs with hemorrhagic presentation. Older patients, cortical or subcortical AVMs, and cases with multiple draining veins were less likely to present with bleeding. During the first 36 months postradiosurgery, hemorrhagic AVMs had a rebleeding rate of 2.1%, and a rate of 1.1% from 3 years onwards. Nonhemorrhagic AVMs had a hemorrhage rate of 1.4% during the first 3 years and 0.3% afterward. Arterial hypertension and nidus volume were independent predictors of bleeding after treatment. Mean nidus obliteration time was 37 ± 18 months (median, 32; interquartile range, 25-40), with hemorrhage rate of 1.3% before and 0.6% after obliteration, and 1.9% for AVMs that were not closed at the end of follow-up. Both hemorrhagic and nonhemorrhagic AVMs benefit from radiosurgical therapy, with gradual decrease in their bleeding rates over the years. Albeit small, the risk of hemorrhage persists during the entirety of follow-up, being higher for cases with hemorrhagic presentation and nonobliterated AVM.

  8. Retinal hemorrhage in the battered child.

    Science.gov (United States)

    Eisenbrey, A B

    1979-01-01

    The presence of retinal hemorrhage in head-injured children under 3 years of age is believed to be pathognomonic of battering. When a group of battered children was compared to head-injured children due to other causes, the high incidence of retinal hemorrhage in the battered children was contrasted with the absence of retinal hemorrhage produced by other causes of head injury.

  9. Copeptin Levels in Cerebral Infarction, Intracranial Hemorrhage and Subarachnoid Hemorrhage.

    Science.gov (United States)

    Aksu, Feyza; Gurger, Mehtap; Yilmaz, Mustafa; Atescelik, Metin; Yildiz, Mustafa; Ilhan, Nevin; Ilhan, Selcuk; Goktekin, Mehmet C

    2016-12-01

    To determine copeptin levels in patients with suspected intracranial events and to determine whether copeptin levels could be used in the discrimination of cerebral infarction, intracranial hemorrhage, and subarachnoid hemorrhage in the emergency room. Blood samples were obtained from the patients prior to imaging to determine the levels of copeptin. Patients were divided into diagnostic groups after the imaging. One hundred and seventy-six participants, who were enrolled in the study, were as follows: 50 cerebral infarction (CI) patients (M/F: 24/26), 47 intracranial hemorrhage (ICH) patients (M/F: 27/20), 29 subarachnoid hemorrhage (SAH) patients (M/F: 17/12) and 50 healthy controls. Differences and correlations between groups were analyzed. Plasma levels of copeptin in patients with CI, ICH, and SAH were 5.49 ng/dL (IQR 4.73 to 6.96), 4.50 ng/dL (IQR 3.04 to 9.77), and 5.90 ng/dL (IQR 3.11 to 13.26), respectively. It was found to be 2.0 ng/dL (IQR 1.57 to 2.5) in healthy volunteers. There was no significant correlation between copeptin levels and Intracerebral Hemorrhage Score (ICHS) (r = 0.231, p = 0.118). However, significant positive correlation was found between copeptin levels with the National Institutes of Health Stroke Scale (NIHSS) (r = 0.365, p = 0.009) and the BotterelHunt and Hess Scale (BHHS) (r = 0.590, p = 0.001). The copeptin levels of 41 (32.5%) patients who died were found to be significantly higher than those 85 (67.5%) patients who were discharged (p Copeptin levels in patients with CI, ICH, and SAH are significantly higher than healthy volunteers, but the plasma level of copeptin is not decisive in the discrimination of CI, ICH, and SAH.

  10. Copeptin in aneurysmal subarachnoid hemorrhage

    OpenAIRE

    Tamargo, Rafael J

    2012-01-01

    Copeptin is a peptide derived from pre-provasospression along with arginine vasospressin. In the setting of aneurysmal subarachnoid hemorrhage (SAH), elevated serum copeptin levels correlate with vasospasm, inpatient mortality, mortality at 1 year, and poor functional outcome at 1 year. The potential role of serum copeptin levels in the management of patients with aneurysmal SAH is promising and should be explored further.

  11. Intraventricular hemorrhage of the newborn

    Science.gov (United States)

    ... needed to place a tube (shunt) in the brain to drain fluid. Outlook (Prognosis) How well the infant does depends on how premature the baby is and the grade of the hemorrhage. Less than half of babies with lower-grade ... Babies Read more A. ...

  12. Assessing preventability for obstetric hemorrhage.

    Science.gov (United States)

    Della Torre, Micaela; Kilpatrick, Sarah J; Hibbard, Judith U; Simonson, Louise; Scott, Shirley; Koch, Abby; Schy, Deborah; Geller, Stacie E

    2011-12-01

    We sought to determine preventability for cases of obstetric hemorrhage, identify preventable factors, and compare differences between levels of hospital. We retrospectively reviewed a 1-year cohort of severe and near-miss obstetric hemorrhage in an urban perinatal network. An expert panel, using a validated preventability model, reviewed all cases. Preventability and distribution of preventability factors were compared between levels of hospital care. Sixty-three severe and near-miss obstetric hemorrhage cases were identified from 11 hospitals; 54% were deemed potentially preventable. Overall preventability was not statistically different by level of hospital, and 88% were provider related. The only treatment-related preventability factors were significantly different between levels of hospital and significantly less common in level III hospitals (p < 0.01). The majority of obstetric hemorrhage was preventable. The most common potentially preventable factor was provider treatment error, and this was significantly more common in level II hospitals. New interventions should be focused on decreasing providers' treatment errors. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  13. Reducing postpartum hemorrhage in Africa

    DEFF Research Database (Denmark)

    Lazarus, Jeff; Lalonde, A

    2005-01-01

    Postpartum hemorrhage (PPH) is the leading cause of maternal mortality in sub-Saharan Africa. This is being addressed by leading professional organizations, which point to the importance of a skilled attendant at birth. But they also emphasize that the active management of the third stage of labor...

  14. Advanced imaging improves prediction of hemorrhage after stroke thrombolysis.

    Science.gov (United States)

    Campbell, Bruce C V; Christensen, Søren; Parsons, Mark W; Churilov, Leonid; Desmond, Patricia M; Barber, P Alan; Butcher, Kenneth S; Levi, Christopher R; De Silva, Deidre A; Lansberg, Maarten G; Mlynash, Michael; Olivot, Jean-Marc; Straka, Matus; Bammer, Roland; Albers, Gregory W; Donnan, Geoffrey A; Davis, Stephen M

    2013-04-01

    Very low cerebral blood volume (VLCBV), diffusion, and hypoperfusion lesion volumes have been proposed as predictors of hemorrhagic transformation following stroke thrombolysis. We aimed to compare these parameters, validate VLCBV in an independent cohort using DEFUSE study data, and investigate the interaction of VLCBV with regional reperfusion. The EPITHET and DEFUSE studies obtained diffusion and perfusion magnetic resonance imaging (MRI) in patients 3 to 6 hours from onset of ischemic stroke. EPITHET randomized patients to tissue plasminogen activator (tPA) or placebo, and all DEFUSE patients received tPA. VLCBV was defined as cerebral blood volume2 ml VLCBV threshold defined in EPITHET predicted PH with 100% sensitivity, 72% specificity, 35% positive predictive value, and 100% negative predictive value. Pooling EPITHET and DEFUSE (163 patients, including 23 with PH), regression models using VLCBV (p8 seconds lesion volumes. Excluding VLCBV in regions without reperfusion improved specificity from 61 to 78% in the pooled analysis. VLCBV predicts PH after stroke thrombolysis and appears to be a more powerful predictor than baseline diffusion or hypoperfusion lesion volumes. Reperfusion of regions of VLCBV is strongly associated with post-thrombolysis PH. VLCBV may be clinically useful to identify patients at significant risk of hemorrhage following reperfusion. Copyright © 2012 American Neurological Association.

  15. Dengue hemorrhagic fever: A rare cause of pituitary tumor hemorrhage and reversible vision loss

    Directory of Open Access Journals (Sweden)

    Vimal Kumar

    2011-01-01

    Full Text Available Dengue hemorrhagic fever leading to hemorrhage in pituitary adenoma is not reported till date: We herein report the first case of bilateral visual loss secondary to pituitary adenoma hemorrhage associated with dengue hemorrhagic fever. Urgent transnasal trans sphenoidal decompression of the macroadenoma prevented permanent visual loss in this patient. Pituitary apoplexy should be considered as differential diagnosis of visual deterioration apart from retinal hemorrhage, maculopathy, and optic neuropathy in cases of dengue hemorrhagic fever. Early decompression of optic nerves helped in the restoration of vision.

  16. Mortality Prediction in Patients with Spontaneous Supratentorial Intracerebral Hemorrhage

    Directory of Open Access Journals (Sweden)

    Alexis Suárez Quesada

    2016-03-01

    Full Text Available Background: spontaneous intracerebral hemorrhage is the deadliest, most disabling, and least treatable form of stroke. No therapy has proven to improve its outcome or reduce its mortality. Objective: to identify predictors of mortality in patients with spontaneous supratentorial intracerebral hemorrhage. Methods: a single cohort study was conducted involving 176 patients admitted consecutively to the stroke ward of the Carlos Manuel de Céspedes Provincial General Hospital with neuroimaging and clinical diagnosis of spontaneous supratentorial intracerebral hemorrhage from January 2013 to November 2015. Independent predictors were obtained using multivariable logistic regression. Results: seventy four point four percent of the patients were hypertensive. The median age among those who died was 67.45 ± 14.84 years. Forty three point eight percent of the patients under study died. Subjects with fatal outcome had lower score on the Glasgow Coma Scale (10.00 ± 3.47 vs. 14.00 ± 1.93, higher hematoma volume expressed in cubic centimeters (26.27 ± 36.86 vs. 6.19 ± 19.59, and displacement of the midline structures (2.00 ± 5.95 vs. 0.00 ± 4.49. The following predictors were identified: Glasgow score ≤ 10 points (Exp (B: 10.74; 95 % CI=4.69 to 24.59, hematoma volume ≥ 20 cm3 (Exp (B: 4.44; 95 % CI= 1.95 to 10.06, and pulse pressure ≥ 60 mmHg (Exp (B: 2.42, 95 % CI=1.10 to 5.33. The area under the ROC curve was 0.85. Conclusions: the Glasgow Coma Scale is the most significant independent variable to predict mortality in patients with spontaneous intracerebral hemorrhage.

  17. Desmopressin improves platelet activity in acute intracerebral hemorrhage.

    Science.gov (United States)

    Naidech, Andrew M; Maas, Matthew B; Levasseur-Franklin, Kimberly E; Liotta, Eric M; Guth, James C; Berman, Micheal; Rosenow, Joshua M; Lindholm, Paul F; Bendok, Bernard R; Prabhakaran, Shyam; Bernstein, Richard A; Kwaan, Hau C

    2014-08-01

    Minimizing hematoma growth in high-risk patients is an attractive strategy to improve outcomes after intracerebral hemorrhage. We tested the hypothesis that desmopressin (DDAVP), which improves hemostasis through the release of von Willebrand factor, improves platelet activity after intracerebral hemorrhage. Patients with reduced platelet activity on point-of-care testing alone (5), known aspirin use alone (1), or both (8) received desmopressin 0.4 μg/kg IV. We measured Platelet Function Analyzer-epinephrine (Siemens AG, Germany) and von Willebrand factor antigen from baseline to 1 hour after infusion start and hematoma volume from the diagnostic to a follow-up computed tomographic scan. We enrolled 14 patients with of mean age 66.8±14.6 years, 11 (85%) of whom were white and 8 (57%) were men. Mean Platelet Function Analyzer-epinephrine results shortened from 192±18 seconds pretreatment to 124±15 seconds (P=0.01) 1 hour later, indicating improved plate activity. von Willebrand factor antigen increased from 242±96% to 289±103% activity (P=0.004), indicating the expected increase in von Willebrand factor. Of 7 (50%) patients who received desmopressin within 12 hours of intracerebral hemorrhage symptom onset, changes in hematoma volume were modest, -0.5 (-1.4 to 8.4) mL and only 2 had hematoma growth. One patient had low blood pressure and another had a new fever within 6 hours of desmopressin administration. Intravenous desmopressin was well tolerated and improved platelet activity after acute intracerebral hemorrhage. Larger studies are needed to determine its potential effects on reducing hematoma growth versus platelet transfusion or placebo. http://www.clinicaltrials.gov. Unique identifier: NCT00961532. © 2014 American Heart Association, Inc.

  18. Imaging of adrenal and renal hemorrhage.

    Science.gov (United States)

    Hammond, Nancy A; Lostumbo, Antonella; Adam, Sharon Z; Remer, Erick M; Nikolaidis, Paul; Yaghmai, Vahid; Berggruen, Senta M; Miller, Frank H

    2015-10-01

    Hemorrhage of the kidneys and adrenal glands has many etiologies. In the adrenal glands, trauma, anticoagulation, stress, sepsis, surgery, and neoplasms are common causes of hemorrhage. In the kidneys, reasons for hemorrhage include trauma, bleeding diathesis, vascular diseases, infection, infarction, hemorrhagic cyst rupture, the Antopol-Goldman lesion, and neoplasms. Angiomyolipoma and renal cell carcinoma are the neoplasms most commonly associated with hemorrhage in the kidneys and adrenal cortical carcinoma, metastases, and pheochromocytoma are associated with hemorrhage in the adrenal glands. Understanding the computed tomography and magnetic resonance imaging features, and causes of hemorrhage in the kidneys and adrenal glands is critical. It is also important to keep in mind that mimickers of hemorrhage exist, including lymphoma in both the kidneys and adrenal glands, and melanoma metastases in the adrenal glands. Appropriate imaging follow-up of renal and adrenal hemorrhage should occur to exclude an underlying malignancy as the cause. If there is suspicion for malignancy that cannot be definitively diagnosed on imaging, surgery or biopsy may be warranted. Angiography may be indicated when there is a suspected underlying vascular disease. Unnecessary intervention, such as nephrectomy, may be avoided in patients with benign causes or no underlying disease. Appropriate management is dependent on accurate diagnosis of the cause of renal or adrenal hemorrhage and it is incumbent upon the radiologist to determine the etiology.

  19. Acitretin-induced subungual hemorrhage.

    Science.gov (United States)

    Aydogan, Kenan; Karadogan, Serap Koran; Tunali, Sukran

    2007-05-01

    A 20-year-old woman with a 2-year history of histologically confirmed palmoplantar keratoderma due to psoriasis, resistant to several topical agents, was admitted to the Department of Dermatology, Uludag University, Bursa, Turkey. Therapy with oral acitretin (0.5 mg/kg/day, 35 mg/day) was initiated. A month after starting acitretin treatment, she noted slight reddening of the second left fingernail. Clinical examination revealed red-brown discoloration of the second fingernail associated with subungual hemorrhage involving the proximal nail bed (lunula region) (Fig. 1). The nail change was asymptomatic. The patient complained only of discoloration underneath the nail plate. No abnormalities were detected on the skin, mucous membranes, or toenails/other fingernails. The patient denied exposure to microtrauma or any other drugs. The erythrocyte sedimentation rate, full blood cell count, electrolytes, renal and hepatic tests, and serum lipids were normal. Coagulation tests, including blood clotting time, international normalized ratio, activated partial thromboplastin time, thrombin time, platelet number, and function tests, were within normal levels. Treatment with acitretin was discontinued, and the nail change resolved completely after 3 weeks. A similar episode of subungual hemorrhage recurred, however, within 48 h after re-challenge with a lower dose of acitretin (25 mg/day). The drug was definitively stopped and the eruption faded again within a week. An objective causality assessment suggests that subungual hemorrhage was probably related to acitretin in this patient.

  20. Cerebral vasospasm after subarachnoid hemorrhage.

    Science.gov (United States)

    Janjua, Nazli; Mayer, Stephan A

    2003-04-01

    To summarize new pathophysiologic insights and recent advances in the diagnosis and treatment of cerebral vasospasm after aneurysmal subarachnoid hemorrhage. Important, newly recognized mediators of cerebral arterial spasm after subarachnoid hemorrhage include superoxide free radicals, ferrous hemoglobin (which acts as a nitric oxide scavenger), endothelins, protein kinase C, and rho kinase. Microvascular dysfunction and autoregulatory failure also has been an area of increasing research focus in recent years. New diagnostic modalities include measures of cerebral blood flow such as single-photon emission computed tomography and perfusion computed tomography, magnetic resonance imaging, intracranial brain oxygen tension probes, and jugular venous oxygen saturation monitors. Proton magnetic resonance spectroscopy and microdialysis can detect tissue biochemical abnormalities, but these techniques have not found their way into routine clinical practice as of yet. In addition to nimodipine and hypertensive hypervolemic therapy, promising new treatments for vasospasm or its ischemic complications include magnesium sulfate, fasudil hydrochloride, tirilazad mesylate, erythropoietin, and induced hypothermia. Balloon angioplasty has emerged as the primary weapon for treating medically refractory ischemia from vasospasm and in many centers is being used as a first-line treatment or even prophylactically. The neurointensive care management of vasospasm after subarachnoid hemorrhage has evolved significantly over the past 10 years, with many new diagnostic modalities and promising treatments now available. Clinical trials are needed to evaluate the efficacy of these new techniques and to further define the optimal management of this often devastating complication. Copyright 2003 Lippincott Williams & Wilkins

  1. [Crimean-Congo hemorrhagic fever].

    Science.gov (United States)

    Saijo, Masayuki; Moriikawa, Shigeru; Kurane, Ichiro

    2004-12-01

    Crimean-Congo hemorrhagic fever (CCHF) is an acute infectious disease caused by CCHF virus (CCHFV), a member of the family Bunyaviridae, genus Nairovirus. The case fatality rate of CCHF ranges from 10-40%. Because CCHF is not present in Japan, many Japanese virologists and clinicians are not very familiar with this disease. However, there remains the possibility of an introduction of CCHFV or other hemorrhagic fever viruses into Japan from surrounding endemic areas. Development of diagnostic laboratory capacity for viral hemorrhagic fevers is necessary even in countries without these diseases. At the National Institute of Infectious Diseases, Tokyo, Japan, laboratory-based systems such as recombinant protein-based antibody detection, antigen-capture and pathological examination have been developed. In this review article, epidemiologic and clinical data on CCHF in the Xinjiang Uygur Autonomous Region, compiled through field investigations and diagnostic testing utilizing the aforementioned laboratory systems, are presented. CCHFV infections are closely associated with the environmental conditions, life styles, religion, occupation, and human economic activities. Based on these data, preventive measures for CCHFV infections are also discussed.

  2. Cellular edema regulates tissue capillary perfusion after hemorrhage resuscitation.

    Science.gov (United States)

    Zakaria, El Rasheid; Li, Na; Matheson, Paul J; Garrison, Richard N

    2007-10-01

    Hemorrhage-induced activation of endothelial cell Na+/H+ -exchanger results in cellular swelling, which physically impedes capillary filling and compromises gut perfusion. We hypothesized that correction of the vascular volume deficit by conventional resuscitation does not improve capillary filling unless cellular swelling is prevented. Also, we hypothesized that adjunctive direct peritoneal resuscitation (DPR) with topical peritoneal dialysis solution (Delflex; Fresenius USA, Inc., Ogden, Ut) enhances capillary filling and gut perfusion by mechanisms that are independent of the Na+/H+ function. In vivo intravital videomicroscopy and Doppler velocimeter were used by us to measure microvascular diameter and flow, capillary filling (index of functional capillary density, FCD), and endothelial cell function in the terminal ileum of anesthetized rats. Rats were bled to 50% mean arterial pressure for 60 min and resuscitated with the shed blood plus 2 volumes of saline (conventional resuscitation). Prevention of endothelial cell swelling was achieved with topical amiloride (specific Na+/H+ inhibitor) in the tissue bath before hemorrhage or simultaneously with conventional resuscitation. DPR was simulated by instillation of Delflex in the tissue bath as adjunctive to conventional resuscitation. Sham no hemorrhage group and a simulated DPR group that received topical amiloride treatment served as controls. Conventional resuscitation from hemorrhagic shock restored and maintained central hemodynamics but caused progressive and persistent intestinal vasoconstriction and hypoperfusion associated with low FCD and endothelial cell dysfunction. Prevention of endothelial cell swelling when combined with conventional resuscitation, preserved endothelial cell function, and restored local intestinal microvascular variables to near-prehemorrhage levels. Simulated adjunctive DPR produced rapid, sustained, and generalized vasodilation associated with restoration of endothelial cell

  3. Effects of a Single Dose of Parecoxib on Inflammatory Response and Ischemic Tubular Injury Caused by Hemorrhagic Shock in Rats

    Directory of Open Access Journals (Sweden)

    Mariana Takaku

    2018-01-01

    Full Text Available Parecoxib, a selective COX-2 inhibitor, is used to improve analgesia in postoperative procedures. Here we evaluated whether pretreatment with a single dose of parecoxib affects the function, cell injury, and inflammatory response of the kidney of rats subjected to acute hemorrhage. Inflammatory response was determined according to serum and renal tissue cytokine levels (IL-1α, IL-1β, IL-6, IL-10, and TNF-α. Forty-four adult Wistar rats anesthetized with sevoflurane were randomized into four groups: placebo/no hemorrhage (Plc/NH; parecoxib/no hemorrhage (Pcx/NH; placebo/hemorrhage (Plc/H; and parecoxib/hemorrhage (Pcx/H. Pcx groups received a single dose of intravenous parecoxib while Plc groups received a single dose of placebo (isotonic saline. Animals in hemorrhage groups underwent bleeding of 30% of blood volume. Renal function and renal histology were then evaluated. Plc/H showed the highest serum levels of cytokines, suggesting that pretreatment with parecoxib reduced the inflammatory response in rats subjected to hemorrhage. No difference in tissue cytokine levels between groups was observed. Plc/H showed higher percentage of tubular dilation and degeneration, indicating that parecoxib inhibited tubular injury resulting from renal hypoperfusion. Our findings indicate that pretreatment with a single dose of parecoxib reduced the inflammatory response and tubular renal injury without altering renal function in rats undergoing acute hemorrhage.

  4. Genetics Home Reference: hereditary hemorrhagic telangiectasia

    Science.gov (United States)

    ... Osler-Weber-Rendu syndrome Health Topic: Arteriovenous Malformations Genetic and Rare Diseases Information Center (1 link) Hereditary hemorrhagic telangiectasia Additional NIH Resources (1 link) National ...

  5. Hemorrhagic cystitis: A challenge to the urologist

    Science.gov (United States)

    Manikandan, R.; Kumar, Santosh; Dorairajan, Lalgudi N.

    2010-01-01

    Severe hemorrhagic cystitis often arises from anticancer chemotherapy or radiotherapy for pelvic malignancies. Infectious etiologies are less common causes except in immunocompromised hosts. These cases can be challenging problems for the urologist and a source of substantial morbidity and sometimes mortality for the patients. A variety of modalities of treatment have been described for the management of hemorrhagic cystitis but there is none that is uniformly effective. Some progress has been made in the understanding and management of viral hemorrhagic cystitis. This article reviews the common causes of severe hemorrhagic cystitis and the currently available management options. PMID:20877590

  6. Hemorrhagic cystitis: A challenge to the urologist

    Directory of Open Access Journals (Sweden)

    R Manikandan

    2010-01-01

    Full Text Available Severe hemorrhagic cystitis often arises from anticancer chemotherapy or radiotherapy for pelvic malignancies. Infectious etiologies are less common causes except in immunocompromised hosts. These cases can be challenging problems for the urologist and a source of substantial morbidity and sometimes mortality for the patients. A variety of modalities of treatment have been described for the management of hemorrhagic cystitis but there is none that is uniformly effective. Some progress has been made in the understanding and management of viral hemorrhagic cystitis. This article reviews the common causes of severe hemorrhagic cystitis and the currently available management options.

  7. The Roles of Thrombospondins in Hemorrhagic Stroke

    Directory of Open Access Journals (Sweden)

    Xuan Wu

    2017-01-01

    Full Text Available Hemorrhagic stroke is a devastating cerebrovascular disease with significant morbidity and mortality worldwide. Thrombospondins (TSPs, as matricellular proteins, belong to the TSP family which is comprised of five members. All TSPs modulate a variety of cellular functions by binding to various receptors. Recently, TSPs gained attention in the area of hemorrhagic stroke, especially TSP-1. TSP-1 participates in angiogenesis, the inflammatory response, apoptosis, and fibrosis after hemorrhagic stroke through binding to various molecules including but not limited to CD36, CD47, and TGF-β. In this review, we will discuss the roles of TSPs in hemorrhagic stroke and focus primarily on TSP-1.

  8. Necrostatin-1 Reduces Neurovascular Injury after Intracerebral Hemorrhage

    Directory of Open Access Journals (Sweden)

    Melanie D. King

    2014-01-01

    Full Text Available Intracerebral hemorrhage (ICH is the most common form of hemorrhagic stroke, accounting for 15% of all strokes. ICH has the highest acute mortality and the worst long-term prognosis of all stroke subtypes. Unfortunately, the dearth of clinically effective treatment options makes ICH the least treatable form of stroke, emphasizing the need for novel therapeutic targets. Recent work by our laboratory identified a novel role for the necroptosis inhibitor, necrostatin-1, in limiting neurovascular injury in tissue culture models of hemorrhagic injury. In the present study, we tested the hypothesis that necrostatin-1 reduces neurovascular injury after collagenase-induced ICH in mice. Necrostatin-1 significantly reduced hematoma volume by 54% at 72 h after-ICH, as compared to either sham-injured mice or mice administered an inactive, structural analogue of necrostatin-1. Necrostatin-1 also limited cell death by 48%, reduced blood-brain barrier opening by 51%, attenuated edema development to sham levels, and improved neurobehavioral outcomes after ICH. These data suggest a potential clinical utility for necrostatin-1 and/or novel necroptosis inhibitors as an adjunct therapy to reduce neurological injury and improve patient outcomes after ICH.

  9. Cerebral Pilocytic Astrocytoma with Spontaneous Intracranial Hemorrhage in Adults

    Directory of Open Access Journals (Sweden)

    Hao-Ming Li

    2008-11-01

    Full Text Available Pilocytic astrocytomas are found predominantly in the pediatric population; reports of these tumors are extremely rare in adults. We report 2 cases of adult pilocytic astrocytoma with intracranial hemorrhage. A 32-year-old male presented with neck stiffness and severe headache, and a 34-year-old male was referred for headache and double vision. Computed tomography (CT and magnetic resonance imaging (MRI revealed a well-enhanced and circumscribed cystic hemorrhagic tumor with mural nodule over the cerebral hemisphere region. Perfusion-weighted MRI (PWI was also performed in both patients. The measured relative cerebral blood volume ratios of the mural nodules in these 2 cases were, respectively, 1.34 and 2.81 when compared with normal white matter. After surgical resection, microscopic examination of the lesions showed pilocytic astrocytomas. Since pilocytic astrocytoma and other cystic tumors with mural nodule (such as hemangioblastoma have similar findings on conventional CT and MRI, PWI is helpful in the differential diagnosis. The literature on hemorrhagic pilocytic astrocytoma is also reviewed.

  10. Aspirin and aneurysmal subarachnoid hemorrhage.

    Science.gov (United States)

    Gross, Bradley A; Rosalind Lai, Pui Man; Frerichs, Kai U; Du, Rose

    2014-12-01

    Recent evidence has suggested a potential beneficial effect of aspirin on the risk of aneurysm rupture. This benefit must be weighed against its potential adverse effects as an antiplatelet agent in the setting of acute aneurysmal subarachnoid hemorrhage (SAH). A total of 747 consecutive patients with cerebral aneurysms were reviewed, comparing demographics, aneurysm features, presenting clinical and radiographic grades, vasospasm, and outcome at 1 year between patients with aneurysmal SAH taking aspirin on presentation and those who were not. The rate of hemorrhagic presentation was significantly greater in patients not taking aspirin (40% vs. 28%; P = 0.016). Among 274 patients presenting with aneurysmal SAH, there was no significant difference in presenting clinical (Hunt and Hess) and radiographic (Fisher) grade between patients taking aspirin and those who were not. There was also no significant difference in the rate of subsequent angiographic and delayed cerebral ischemia. Multivariate analysis of outcome at 1 year found only increasing age (odds ratio [OR] 1.07, 95% confidence interval [CI] 1.04-1.12), Hunt and Hess grade (OR 3.01, 95% CI 1.81-5.03), and associated hypertension (OR 3.30, 95% CI 1.39-7.81) to be statistically significant risk factors for poor outcome (death or dependence), whereas aspirin use was not associated with poor outcome (OR 1.19, 95% CI 0.35-4.09; P = 0.78). In the present study, patients taking aspirin had a lower rate of hemorrhagic presentation. In addition, taking aspirin did not adversely impact presenting clinical grade or radiographic grade, vasospasm, and outcome in the setting of aneurysmal SAH. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Pulmonary hemorrhage resulting from leptospirosis

    Directory of Open Access Journals (Sweden)

    Mauro Razuk Filho

    2016-07-01

    Full Text Available Leptospirosis is one of the most widespread zoonoses in the world, although the mechanisms responsible for the pathogenesis of spirochetes of the genus Leptospira are largely unknown. Human infection occurs either by direct contact with infected animals or indirectly, through contact with water or soil contaminated with urine, as the spirochetes easily penetrate human skin. The present report exposes the case of a female patient, diagnosed with leptospirosis after having had contact with a dog infected by Leptospira sp. that developed pulmonary hemorrhage, acute respiratory distress syndrome and acute renal failure.

  12. Injury of the mammillothalamic tract in patients with thalamic hemorrhage

    Directory of Open Access Journals (Sweden)

    Hyeok Gyu eKwon

    2014-04-01

    Full Text Available Objective:Injury of the mammillothalamic tract(MTT has been suggested as one of the plausible pathogenic mechanisms of memory impairment in patients with thalamic hemorrhage; however, it has not been clearly demonstrated so far. We attempted to investigate whether injury of the MTT documented by diffusion tensor tractography(DTT following thalamic hemorrhage correlates with cognitive impairment. Methods:We recruited 22 patients with a thalamic hemorrhage and 20 control subjects. MTTs were reconstructed using the probabilistic tractography method. Patients were classified into two subgroups: Reconstructed group-patients whose MTT was reconstructed in the affected hemisphere and Non-reconstructed group-patients whose MTT was not reconstructed.Results:MTT was reconstructed in five(22.7%,Reconstructed group patients in the affected hemisphere and was not reconstructed in the remaining 17 patients(77.3%,Non-reconstructed group. In addition, the MTT was not reconstructed even in the unaffected hemisphere in four patients(23.5% in Non-reconstructed group. Fractional anisotropy and mean diffusivity values of the affected hemisphere in Reconstructed group also did not show significant differences from those in the unaffected hemisphere of Reconstructed group and the control group(p>0.05. However, the tract volume of the affected hemisphere in Reconstructed group was significantly lower than that of the unaffected hemisphere in Reconstructed group and the control group(pConclusion:A large portion of patients with thalamic hemorrhage appeared to suffer severe injury of the ipsi-lesional MTT(77.3% and 18.2% of these patients appeared to suffer severe injury even in the contra-lesional MTT. In addition, the remaining 22.7% of patients who had preserved integrity of the ipsi-lesional MTT appeared to suffer partial injury of the ipsi-lesional MTT.

  13. Minocycline in Acute Cerebral Hemorrhage: An Early Phase Randomized Trial.

    Science.gov (United States)

    Fouda, Abdelrahman Y; Newsome, Andrea S; Spellicy, Samantha; Waller, Jennifer L; Zhi, Wenbo; Hess, David C; Ergul, Adviye; Edwards, David J; Fagan, Susan C; Switzer, Jeffrey A

    2017-10-01

    Minocycline is under investigation as a neurovascular protective agent for stroke. This study evaluated the pharmacokinetic, anti-inflammatory, and safety profile of minocycline after intracerebral hemorrhage. This study was a single-site, randomized controlled trial of minocycline conducted from 2013 to 2016. Adults ≥18 years with primary intracerebral hemorrhage who could have study drug administered within 24 hours of onset were included. Patients received 400 mg of intravenous minocycline, followed by 400 mg minocycline oral daily for 4 days. Serum concentrations of minocycline after the last oral dose and biomarkers were sampled to determine the peak concentration, half-life, and anti-inflammatory profile. A total of 16 consecutive eligible patients were enrolled, with 8 randomized to minocycline. Although the literature supports a time to peak concentration (Tmax) of 1 hour for oral minocycline, the Tmax was estimated to be at least 6 hours in this cohort. The elimination half-life (available on 7 patients) was 17.5 hours (SD±3.5). No differences were observed in inflammatory biomarkers, hematoma volume, or perihematomal edema. Concentrations remained at neuroprotective levels (>3 mg/L) throughout the dosing interval in 5 of 7 patients. In intracerebral hemorrhage, a 400 mg dose of minocycline was safe and achieved neuroprotective serum concentrations. However, oral administration led to delayed absorption in these critically ill patients and should not be used when rapid, high concentrations are desired. Given the safety and pharmacokinetic profile of minocycline in intracerebral hemorrhage and promising data in the treatment of ischemic stroke, intravenous minocycline is an excellent candidate for a prehospital treatment trial. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01805895. © 2017 American Heart Association, Inc.

  14. BILATERAL INTRAOCULAR HEMORRHAGE SECONDARY TO CEREBRAL VENOUS SINUS THROMBOSIS.

    Science.gov (United States)

    Kunle-Hassan, Feyi; Dattani, Minaxi; Snead, Martin; Subash, Mala

    2016-10-05

    To report a case of bilateral intraocular hemorrhage secondary to cerebral venous sinus thrombosis with no associated intracranial hemorrhage. Case report. A 32-year-old Asian gentleman presented with left reduced vision as a result of a left subhyaloid macular hemorrhage associated with severe headache. Right retinal hemorrhages were also present. Magnetic resonance imaging and computed tomography brain imaging demonstrated cerebral transverse venous sinus thrombosis. Intraocular hemorrhage has previously been described in association with intracranial hemorrhage and in particular subarachnoid hemorrhage (Terson syndrome). We describe a similar clinical picture in the context of cerebral venous sinus thrombosis with no associated intracranial hemorrhage.

  15. Migraine and risk of hemorrhagic stroke

    DEFF Research Database (Denmark)

    Gaist, David; González-Pérez, Antonio; Ashina, Messoud

    2014-01-01

    to select 10,000 controls free from hemorrhagic stroke. Using unconditional logistic regression models, we calculated the risk of hemorrhagic stroke associated with migraine, adjusting for age, sex, calendar year, alcohol, body mass index, hypertension, previous cerebrovascular disease, oral contraceptive...

  16. Factors Influencing Mortality in Hemorrhagic Stroke | Dawodu ...

    African Journals Online (AJOL)

    Background Mortality in hemorrhagic stroke is very high. The factors influencing it have not been well studied in Africans. Objectives The aim of this study was to determine the mortality rate in hemorrhagic strokes and the factors that influence it, such as Glasgow coma scale score and admitting blood pressure. Methods

  17. A Case of Idiopathic Spontaneous Intratesticular Hemorrhage

    Directory of Open Access Journals (Sweden)

    Takumi Takeuchi

    2017-09-01

    On visual inspection, the whole testis was black. The spermatic cord was neither distorted nor black. Testicular torsion could not be completely ruled out; thus, left orchiectomy was performed. Histopathology revealed diffuse intratesticular hemorrhage without the necrosis of seminiferous tubular cells. We encountered a case of idiopathic spontaneous intratesticular hemorrhage.

  18. Hemorrhage Control for Major Traumatic Vascular Injuries

    Science.gov (United States)

    2016-10-01

    and it is unclear if this contributed to the high (46%) mortality in OPEN patients with thoracic aortic injury. Intra- abdominal arterial hemorrhage...Endovascular therapy for overcoming challenges presented with blunt abdominal aortic injury. Vascular and endovascular surgery 2012;46:329-331. 23...systematically define the clinical and logistical issues surrounding traditional open vascular surgery and catheter-based hemorrhage control. The

  19. First Outbreak of Dengue Hemorrhagic Fever, Bangladesh

    OpenAIRE

    Rahman, Mahbubur; Rahman, Khalilur; Siddque, A. K.; Shoma, Shereen; Kamal, A.H.M.; Ali, K.S.; Nisaluk, Ananda; Robert F Breiman

    2002-01-01

    During the first countrywide outbreak of dengue hemorrhagic fever in Bangladesh, we conducted surveillance for dengue at a hospital in Dhaka. Of 176 patients, primarily adults, found positive for dengue, 60.2% had dengue fever, 39.2% dengue hemorrhagic fever, and 0.6% dengue shock syndrome. The Dengue virus 3 serotype was detected in eight patients.

  20. Detecting fetomaternal hemorrhage by flow cytometry

    DEFF Research Database (Denmark)

    Dziegiel, Morten Hanefeld; Nielsen, Leif Kofoed; Berkowicz, Adela

    2006-01-01

    The aim of this review is to summarize the most recent developments in the area of detection of fetomaternal hemorrhage by flow cytometry.......The aim of this review is to summarize the most recent developments in the area of detection of fetomaternal hemorrhage by flow cytometry....

  1. A case of idiopathic omental hemorrhage

    Directory of Open Access Journals (Sweden)

    Toshimitsu Hosotani

    2016-05-01

    Full Text Available With the exception of trauma, intraperitoneal hemorrhage in young women is caused by the high frequency of ectopic pregnancy and ovarian bleeding. Here, we describe a case of idiopathic omental hemorrhage, which is a rare cause of intraperitoneal hemorrhage. Intraperitoneal hemorrhage was suspected in a 38-year-old Japanese woman based on contrast-enhanced computed tomography. Her last menstrual period was 23 days prior, and ovarian bleeding was considered based on bloody ascites revealed by culdocentesis. She underwent emergency surgery for hypovolemic shock. Although both ovaries were of normal size and no abnormal findings were observed, we performed a partial omentectomy because multiple clots were attached only to the greater omentum. Postoperatively, no rebleeding occurred, and she was discharged 11 days after the surgery. Because she did not have a clear history of trauma and underlying disease, idiopathic omental hemorrhage was diagnosed.

  2. Admission Heart Rate Predicts Poor Outcomes in Acute Intracerebral Hemorrhage: The Intensive Blood Pressure Reduction in Acute Cerebral Hemorrhage Trial Studies.

    Science.gov (United States)

    Qiu, Miaoyan; Sato, Shoichiro; Zheng, Danni; Wang, Xia; Carcel, Cheryl; Hirakawa, Yoichiro; Sandset, Else C; Delcourt, Candice; Arima, Hisatomi; Wang, Jiguang; Chalmers, John; Anderson, Craig S

    2016-06-01

    Faster heart rate predicts higher mortality in coronary heart disease and acute ischemic stroke, but its prognostic significance in intracerebral hemorrhage remains uncertain. We aimed to determine the effect of admission heart rate on clinical and imaging outcomes in patients with intracerebral hemorrhage. A post hoc pooled analysis of the pilot and main phases of the Intensive Blood Pressure Reduction in Acute Cerebral Hemorrhage Trial (INTERACT 1 and 2). Clinical outcomes were mortality and modified Rankin Scale score at 90 days; and imaging outcome was absolute growth in hematoma volume during the initial 24 hours. Patients were divided into 4 categories according to baseline heart rate (<65, 65-74, 75-84, and ≥85 bpm) and analyzed using multivariable adjusted models with the lowest heart rate group as the reference. Of 3185 patients with available data, higher admission heart rate was associated with both mortality and worse modified Rankin Scale score: adjusted hazard ratio for heart rate (≥85 versus <65 bpm) 1.50 (95% confidence interval, 1.07-2.11) and adjusted odds ratio 1.33 (95% confidence interval, 1.08-1.63), respectively (both P-trend <0.05). There was no significant relationship between heart rate and absolute growth in hematoma volume (P-trend, 0.196). Higher admission heart rate is independently associated with death and poor functional outcome after acute intracerebral hemorrhage. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00226096 and NCT00716079. © 2016 American Heart Association, Inc.

  3. The physiology of blood loss and shock: New insights from a human laboratory model of hemorrhage.

    Science.gov (United States)

    Schiller, Alicia M; Howard, Jeffrey T; Convertino, Victor A

    2017-04-01

    The ability to quickly diagnose hemorrhagic shock is critical for favorable patient outcomes. Therefore, it is important to understand the time course and involvement of the various physiological mechanisms that are active during volume loss and that have the ability to stave off hemodynamic collapse. This review provides new insights about the physiology that underlies blood loss and shock in humans through the development of a simulated model of hemorrhage using lower body negative pressure. In this review, we present controlled experimental results through utilization of the lower body negative pressure human hemorrhage model that provide novel insights on the integration of physiological mechanisms critical to the compensation for volume loss. We provide data obtained from more than 250 human experiments to classify human subjects into two distinct groups: those who have a high tolerance and can compensate well for reduced central blood volume (e.g. hemorrhage) and those with low tolerance with poor capacity to compensate.We include the conceptual introduction of arterial pressure and cerebral blood flow oscillations, reflex-mediated autonomic and neuroendocrine responses, and respiration that function to protect adequate tissue oxygenation through adjustments in cardiac output and peripheral vascular resistance. Finally, unique time course data are presented that describe mechanistic events associated with the rapid onset of hemodynamic failure (i.e. decompensatory shock). Impact Statement Hemorrhage is the leading cause of death in both civilian and military trauma. The work submitted in this review is important because it advances the understanding of mechanisms that contribute to the total integrated physiological compensations for inadequate tissue oxygenation (i.e. shock) that arise from hemorrhage. Unlike an animal model, we introduce the utilization of lower body negative pressure as a noninvasive model that allows for the study of progressive

  4. Construction of a Cerebral Hemorrhage Test System Operated in Real-time

    Science.gov (United States)

    Li, Gen; Sun, Jian; Ma, Ke; Yan, Qingguang; Zheng, Xiaolin; Qin, Mingxin; Jin, Gui; Ning, Xu; Zhuang, Wei; Feng, Hua; Huang, Shiyuwei

    2017-02-01

    The real-time monitoring and evaluation of the severity and progression of cerebral hemorrhage is essential to its intensive care and its successful emergency treatment. Based on magnetic induction phase shift technology combined with a PCI data acquisition system and LabVIEW software, this study established a real-time monitoring system for cerebral hemorrhage. To test and evaluate the performance of the system, the authors performed resolution conductivity experiments, salted water simulation experiments and cerebral hemorrhage experiments in rabbits and found that when the conductivity difference was 0.73 S/m, the phase difference was 13.196°. The phase difference change value was positively proportional to the volume of saline water, and the conductivity value was positively related to the phase difference of liquid under the same volume conditions. After injecting 3 mL blood into six rabbits, the average change in the blood phase difference was -2.03783 ± 0.22505°, and it was positively proportional to the volume of blood, which was consistent with the theoretical results. The results show that the system can monitor the progressive development of cerebral hemorrhage in real-time and has the advantages of low cost, small size, high phase accuracy, and good clinical application potentiality.

  5. [Non-traumatic vitreous hemorrhage].

    Science.gov (United States)

    Conart, J-B; Berrod, J-P

    2016-02-01

    Spontaneous vitreous hemorrhage is a serious disease whose incidence is 7 per 100,000 people per year. Posterior vitreous detachment with or without retinal tear, diabetic retinopathy, vascular proliferation after retinal vein occlusion, age-related macular degeneration and Terson's syndrome are the most common causes. Repeated ultrasonography may ignore a retinal tear or detachment and delay vitrectomy that is the only treatment for serious forms. The occurrence of retinal tear or detachment is a surgical emergency as well as rubeosis or diabetic tractional retinal detachment involving the macula. Intravitreal injection of antiangiogenic agents are helpful in clearing the vitreous cavity, facilitating laser photocoagulation and reducing the risks of bleeding during preretinal neovascular membranes dissection. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  6. Compression of the posterior fossa venous sinuses by epidural hemorrhage simulating venous sinus thrombosis: CT and MR findings

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sumit; Ramakrishnaiah, Raghu H.; Hegde, Shilpa V.; Glasier, Charles M. [University of Arkansas for Medical Sciences, Pediatric Radiology, Little Rock, AR (United States)

    2016-01-15

    Posterior fossa dural venous sinus thrombus is a well-described complication of head trauma, especially when fracture crosses the dural sinus grooves or in association with epidural hemorrhage. We have found that post-traumatic posterior fossa epidural hematoma compressing a dural venous sinus can mimic dural venous thrombus. To discuss the CT and MRI findings of posterior fossa epidural hemorrhages simulating sinus thrombosis, to make radiologists aware of this important imaging pitfall. We describe radiologic findings in four children in whom a posterior fossa epidural hemorrhage mimicked dural venous sinus thrombus. Routine CT head and CT venography were obtained on Toshiba volume and helical CT scanners. MRI and MR venography were performed on a Philips scanner. In all cases there was medial displacement and compression of the posterior fossa dural venous sinuses without intraluminal thrombosis. The epidural hemorrhage was seen tracking along sinus grooves in the occipital bone, peeling the dura containing the sinuses from the calvarium and compressing the sinus, simulating thrombosis on axial CT views. Both venous sinus thrombosis and posterior fossa epidural hemorrhages in children are well-described complications of head trauma. Posterior fossa epidural hemorrhage can mimic a sinus thrombus by compressing and displacing the sinuses. It is important to recognize this pitfall because treatment of a suspected thrombus with anticoagulation can worsen epidural hemorrhage. (orig.)

  7. Superficial Siderosis after Germinal Matrix Hemorrhage.

    Science.gov (United States)

    Yilmaz, U; Meyer, S; Gortner, L; Körner, H; Türkyilmaz, M; Simgen, A; Reith, W; Mühl-Benninghaus, R

    2016-12-01

    Germinal matrix hemorrhage is a frequent complication of prematurity and can be associated with adverse neurodevelopmental outcome, depending on its severity. In addition to parenchymal damage, intraventricular residues of hemorrhage and hydrocephalus MR imaging findings include superficial siderosis. The purpose of this study was to investigate the prevalence and location of superficial siderosis in patients with a history of germinal matrix hemorrhage. We retrospectively identified patients with a history of germinal matrix hemorrhage who underwent MR imaging in our institution between 2008 and 2016. Imaging was evaluated for the presence and location of superficial siderosis. The presence of subependymal siderosis and evidence of hydrocephalus were assessed. Thirty-seven patients with a history of germinal matrix hemorrhage were included; 86.5% had preterm births. The mean age at the first MR imaging was 386 days (range 2-5140 days). The prevalence of superficial siderosis was 67.6%. Superficial siderosis was detected significantly more often when MR imaging was performed within the first year of life (82.8% versus 12.5%, P germinal matrix hemorrhage, but it dissolves and has a low prevalence thereafter. A prospective analysis of its initial severity and speed of dissolution during this first year might add to our understanding of the pathophysiology of neurodevelopmental impairment after germinal matrix hemorrhages. © 2016 by American Journal of Neuroradiology.

  8. VITREOUS HEMORRHAGE FROM CARBON MONOXIDE RETINOPATHY.

    Science.gov (United States)

    Levin, Moran; Hall, Jason P; Guerami, Amir

    2016-01-01

    To report the observation of a case of carbon monoxide poisoning in a 5-year-old child causing significant vision loss, retinal hemorrhages, and bilateral vitreous hemorrhage. A 5-year-old male patient underwent ophthalmologic examination including indirect ophthalmoscopy with a 20D lens, slit-lamp biomicroscopy, and bilateral 25 gauge pars plana vitrectomies. The patient did not fix and follow, but did blink in response to bright light. Pupils were reactive without afferent pupillary defect. Anterior examination was unremarkable and intraocular pressures were normal. Dilated funduscopic examination showed diffuse white, fluffy appearing vitreous haze bilaterally overlying the macula with scattered retinal hemorrhages and Roth spots throughout both retinas. The patient subsequently underwent 25 gauge pars plana vitrectomies in each eye, and findings during surgery were suggestive of vitreous hemorrhage in both eyes. Vitreous biopsy did not reveal any infectious or inflammatory cells. This is the second case of carbon monoxide poisoning causing vitreous changes. Given our findings, along with retinal hemorrhages, disk edema, retinal vein tortuosity, and internal limiting membrane hemorrhages, vitreous hemorrhage can be included as a manifestation of carbon monoxide retinopathy.

  9. A benchmark approach to hemorrhage risk management of cavernous malformations.

    Science.gov (United States)

    Kashefiolasl, Sepide; Bruder, Markus; Brawanski, Nina; Herrmann, Eva; Seifert, Volker; Tritt, Stephanie; Konczalla, Juergen

    2018-02-02

    Despite the low annual risk of hemorrhage associated with a cavernous malformation (CM) (0.6%-1.1% per year), the risk of rehemorrhage rate and severity of neurologic deficits is significantly higher; therefore, we aimed to evaluate the rupture risk of CMs depending on various factors. We retrospectively analyzed medical records of all patients with CM admitted to our institution between 1999 and April 2016. Cavernoma volume, location of the lesion, existence of a developmental venous anomaly (DVA), number of cavernomas, and patient characteristics (sex, age, hypertension, and antithrombotic therapy) were assessed. One hundred fifty-four patients with CM were included; 89 (58%) ruptured CMs were identified. In statistical univariable analysis, the existence of a DVA was significantly higher in the ruptured cavernoma group ( p DVA ( p DVA ( p DVA are associated with a higher hemorrhage risk. CM volume (≥1 cm 3 ) and the existence of a DVA were independently in accordance with the anatomical location high risk factors for CM rupture. © 2018 American Academy of Neurology.

  10. Troponin elevation in subarachnoid hemorrhage

    Directory of Open Access Journals (Sweden)

    Ioannis N. Mavridis

    2015-03-01

    Full Text Available Troponin (tr elevation in aneurysmal subarachnoid hemorrhage (SAH patients is often difficult to be appropriately assessed by clinicians, causing even disagreements regarding its management between neurosurgeons and cardiologists. The purpose of this article was to review the literature regarding the clinical interpretation of tr elevation in SAH. We searched for articles in PubMed using the key words: “troponin elevation” and “subarachnoid hemorrhage”. All of them, as well as relative neurosurgical books, were used for this review. Some type of cardiovascular abnormality develops in most SAH patients. Neurogenic stunned myocardium is a frequent SAH complication, due to catecholamine surge which induces cardiac injury, as evidenced by increased serum tr levels, electrocardiographic (ECG changes and cardiac wall motion abnormalities. Tr elevation, usually modest, is an early and specific marker for cardiac involvement after SAH and its levels peak about two days after SAH. Cardiac tr elevation predictors include poor clinical grade, intraventricular hemorrhage, loss of consciousness at ictus, global cerebral edema, female sex, large body surface area, lower systolic blood pressure, higher heart rate and prolonged Q-Tc interval. Elevated tr levels are associated with disability and death (especially tr >1 μg/L, worse neurological grade, systolic and diastolic cardiac dysfunction, pulmonary congestion, longer intensive care unit stay and incidence of vasospasm. Tr elevation is a common finding in SAH patients and constitutes a rightful cause of worry about the patients' cardiac function and prognosis. It should be therefore early detected, carefully monitored and appropriately managed by clinicians.

  11. Fetomaternal hemorrhage in women undergoing elective cesarean section

    DEFF Research Database (Denmark)

    Perslev, Anette; Jørgensen, Finn Stener; Nielsen, Leif Kofoed

    2010-01-01

    Objective. To investigate the degree of fetomaternal hemorrhage (FMH) caused by elective cesarean section. Design. Descriptive study. Settings. University Hospitals in Copenhagen, Denmark. Population. Women scheduled for elective cesarean section, in the period September 2007 to January 2009...... of fetal red blood cells (fRBCs) using flow cytometry. FMH associated with cesarean section was defined as the difference between the volumes of fRBCs in the two samples. Main Outcome Measures. The frequency and volume of FMH caused by elective cesarean section. Results. 207 women were included...... in the study. FMH was detected in 38 cases (18.4%). Of these, 22 women (10.6%) had FMH of less than 1 ml fRBCs, 13 women (6.3%) had FMH between 1 and 4 ml fRBCs, and three women (1.4%) had FMH above 4 ml fRBCs. Conclusions. We found no evidence for recommending general screening for FMH in connection...

  12. Modeling of vision loss due to vitreous hemorrhage by Monte Carlo simulation.

    Science.gov (United States)

    Al-Saeed, Tarek A; El-Zaiat, Sayed Y

    2014-08-01

    Vitreous hemorrhage is the leaking of blood into the vitreous humor which results from different diseases. Vitreous hemorrhage leads to vision problems ranging from mild to severe cases in which blindness occurs. Since erythrocytes are the major scatterers in blood, we are modeling light propagation in vitreous humor with erythrocytes randomly distributed in it. We consider the total medium (vitreous humor plus erythrocytes) as a turbid medium and apply Monte Carlo simulation. Then, we calculate the parameters characterizing vision loss due to vitreous hemorrhage. This work shows that the increase of the volume fraction of erythrocytes results in a decrease of the total transmittance of the vitreous body and an increase in the radius of maximum transmittance, the width of the circular strip of bright area, and the radius of the shadow area.

  13. Hemorrhagic chondroid chordoma mimicking pituitary apoplexy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, H.J.; Kalnin, A.J.; Holodny, A.I. [Dept. of Radiology, University Hospital, Newark, NJ (United States); Schulder, M.; Grigorian, A. [Dept. of Neurosurgery, University Hospital, Newark, NJ (United States); Sharer, L.R. [Dept. of Pathology, University Hospital, Newark, NJ (United States)

    1998-11-01

    We describe a hemorrhagic chondroid chordoma involving the sella turcica with suprasellar extension. The CT and MRI appearances mimiked a hemorrhagic pituitary adenoma. Chondroid chordoma is a variant composed of elements of both chordoma and cartilaginous tissue. An uncommon bone neoplasm, located almost exclusively in the spheno-occipital region, it is usually not considered in the differential diagnosis of a tumor with acute hemorrhage in the sellar region. We discuss the clinical and radiological characteristics which may allow one to differentiate chondroid chordoma from other tumors of this area. (orig.) With 3 figs., 9 refs.

  14. Subconjunctival hemorrhage: risk factors and potential indicators

    Directory of Open Access Journals (Sweden)

    Tarlan B

    2013-06-01

    Full Text Available Bercin Tarlan,1 Hayyam Kiratli21Department of Ophthalmology, Kozluk State Hospital, Batman, Turkey; 2Ocular Oncology Service, Hacettepe University Schoolof Medicine, Ankara, TurkeyAbstract: Subconjunctival hemorrhage is a benign disorder that is a common cause of acute ocular redness. The major risk factors include trauma and contact lens usage in younger patients, whereas among the elderly, systemic vascular diseases such as hypertension, diabetes, and arteriosclerosis are more common. In patients in whom subconjunctival hemorrhage is recurrent or persistent, further evaluation, including workup for systemic hypertension, bleeding disorders, systemic and ocular malignancies, and drug side effects, is warranted.Keywords: subconjunctival hemorrhage, contact lens, hypertension, red eye

  15. Multidisciplinary In Situ Simulation-Based Training as a Postpartum Hemorrhage Quality Improvement Project.

    Science.gov (United States)

    Lutgendorf, Monica A; Spalding, Carmen; Drake, Elizabeth; Spence, Dennis; Heaton, Jason O; Morocco, Kristina V

    2017-03-01

    obstetric emergencies and postpartum hemorrhage after simulation training compared to before training. For managing hypertensive emergencies, the post-training mean score was 4.14 compared to a pretraining mean score of 3.88 (p = 0.01, 95% confidence interval [CI] = 0.06-0.47). For shoulder dystocia, the post-training mean score was 4.29 compared to a pretraining mean score of 3.66 (p = 0.001, 95% CI = 0.41-0.88). For postpartum hemorrhage, the post-training mean score was 4.35 compared to pretraining mean score of 3.86 (p = 0.001, 95% CI = 0.36-0.63). We also observed a decrease in the time to prepare simulated blood products over the course of the simulation, and a decreasing trend of postpartum hemorrhage cases, which continued after initiating the postpartum hemorrhage simulation exercise. Postpartum hemorrhage remains a leading cause of maternal morbidity and mortality in the United States. Comprehensive hemorrhage protocols have been shown to improve outcomes related to postpartum hemorrhage, and a critical component in these processes include communication, teamwork, and team-based practice/simulation. As medicine becomes increasingly complex, the ability to practice in a safe setting is ever more critical, especially for low-volume, high-stakes events such as postpartum hemorrhage. These events require well-functioning teams and systems coupled with rapid assessment and appropriate clinical action to ensure best patient outcomes. We have shown that a multidisciplinary in situ simulation exercise improves self-reported comfort with managing obstetric emergencies, and is a safe and effective way to practice skills and improve systems processes in the health care setting. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.

  16. A combined trauma model of chest and abdominal trauma with hemorrhagic shock--description of a new porcine model.

    Science.gov (United States)

    Hildebrand, Frank; Weuster, Matthias; Mommsen, Philipp; Mohr, Juliane; Fröhlich, Matthias; Witte, Ingo; Keibl, Claudia; Ruchholtz, Steffen; Seekamp, Andreas; Pape, Hans-Christoph; Flohe, Sascha; van Griensven, Martijn

    2012-12-01

    Despite the high incidence and prognostic relevance of hemorrhagic shock and abdominal and blunt chest trauma in multiply injured patients, there are no animal models combining these injuries. Therefore, we established a new porcine multiple trauma model consisting of blunt chest trauma, penetrating abdominal trauma (two incisions in the right upper liver lobe using a four-edged scalpel and subsequent liver packing), and pressure-controlled hemorrhagic shock with a mean arterial pressure of 30 ± 5 mmHg (a maximum of 45% of the total blood volume). The combined traumatic insult led to severe signs of hemorrhagic shock and impaired pulmonary function. In conclusion, a consistent, reproducible, and clinically relevant porcine model of multisystem injury with controlled (pressure-controlled blood withdrawal) and uncontrolled components of hemorrhage (liver laceration) with the potential for rebleeding was established.

  17. Splenectomy Versus Sham Splenectomy in a Swine Model of Controlled Hemorrhagic Shock.

    Science.gov (United States)

    Boysen, Søren R; Caulkett, Nigel A; Brookfield, Caroline E; Warren, Amy; Pang, Jessica M

    2016-10-01

    Splenectomy is controversial in acute hemorrhagic shock models. To compare splenectomized (SP) versus sham-splenectomized (SSP) swine during acute controlled hemorrhage. Twenty-six male Landrace White swine (mean body weight ± standard deviation, 33.8 ± 2.9 kg) were used. Ethics approval was obtained. Landrace swine underwent splenectomy (n = 13) or sham-splenectomy (n = 13), were bled to mean arterial blood pressure (MAP) of 40 mm Hg, which was held for 60 min, given 125 mL IV RescueFlow, held for a further 60 min, given whole blood, and held for a final 60 min. Tissue oxygen saturation, thromboelastography, oncotic pressure, urine volume and specific gravity, complete blood count, serum chemistry, body temperature, hematocrit, total solids, arterial and mixed venous blood gas, bispectral index, SAP, MAP, DAP, cardiac index, total blood volume (TBV) removed and returned, rate of hemorrhage and transfusion, spleen weight, heart rate (HR), arterial pH, lactate, PaO2, PaCO2, respiratory rate, cranial mesenteric and renal artery blood flow were recorded. Groups were compared using two-way ANOVA with post hoc Bonferroni (P splenectomy for the duration of the experiment (P splenectomy (P Splenectomy likely accounts for the transient increase in hematocrit and the higher HR in SP swine prior to hemorrhage, and the differences in TBV removed between the two groups during hemorrhage. With a fixed end point model using a moderate rate of acute hemorrhage and an MAP of 40 mm Hg, splenectomy is not necessary and may confound results.

  18. Is gut the "motor" for producing hepatocellular dysfunction after trauma and hemorrhagic shock?

    Science.gov (United States)

    Wang, P; Ba, Z F; Cioffi, W G; Bland, K I; Chaudry, I H

    1998-02-01

    Although studies suggest that the gut may be the "motor" responsible for producing sepsis and multiple organ failure after injury, it is not known whether enterectomy prior to the onset of hemorrhage alters proinflammatory cytokines TNF and IL-6 and, if so, whether hepatocellular dysfunction and damage are prevented or attenuated under such conditions. Under methoxyflurane anesthesia, an enterectomy in the rat was performed by excision of the duodenum, jejunum, and ileum. The rats were then bled to and maintained at a mean arterial pressure of 40 mm Hg until 40% of the maximal shed volume was returned in the form of Ringer's lactate. The animals were then resuscitated with four times the volume of shed blood with Ringer's lactate over 1 h. At 1.5 h after the completion of resuscitation, hepatocellular function [i.e., the maximal velocity (Vmax) and transport efficiency (Km) of indocyanine green (ICG) clearance] was assessed by an in vivo ICG clearance technique. Blood samples were taken for the measurement of TNF, IL-6, and liver enzymes (i.e., SGPT and SGOT). Cardiac output and microvascular blood flow were determined by ICG dilution and laser Doppler flowmetry, respectively. The increase in circulating levels of TNF but not IL-6 was prevented by enterectomy prior to hemorrhage. The reduced Vmax and K(m) and elevated SGPT and SGOT following hemorrhage and resuscitation, however, were not significantly affected by prior enterectomy. Moreover, enterectomy before hemorrhage further reduced hepatic perfusion. Since enterectomy prior to the onset of hemorrhage does not prevent or attenuate the reduced ICG clearance and elevated liver enzymes despite downregulation of TNF production, it appears that the small intestine does not play a significant role in producing hepatocellular dysfunction and injury following trauma and hemorrhagic shock.

  19. Impaired gut lipid absorptive capacity after trauma-hemorrhage and resuscitation.

    Science.gov (United States)

    Kerner, J; Wang, P; Chaudry, I H

    1995-10-01

    Although the barrier function of the intestinal mucosa is impaired after hemorrhage, it remains unclear whether this is associated with a deficit in mucosal function. The aim of this study, therefore, was to determine whether trauma-hemorrhage affects the in vivo lipid absorptive capacity of the gut and, if so, to characterize the uptake process of free fatty acids in isolated enterocytes. To study this, rats were anesthetized, a laparotomy was performed (i.e., trauma was induced), and various blood vessels were cannulated. For in vivo lipid absorption, the main intestinal lymph vessel was cannulated and a jejunostomy feeding tube was inserted. The animals were bled to and maintained at a mean arterial pressure of 40 mmHg until 40% of shed blood volume was returned in the form of Ringer lactate. They were then resuscitated with four times the volume of maximal bleed out with Ringer lactate. The in vivo and in vitro lipid absorptive capacities were assessed by measuring lymph triglyceride output after a fat load and by determining the linoleic acid uptake rates on isolated enterocytes, respectively. The results show that the in vivo lipid absorption capacity of the gut is severely depressed after trauma-hemorrhage and resuscitation. Similarly, in enterocytes isolated from hemorrhaged rats, fatty acid uptake capacity, as reflected by the decreased maximal uptake rates, was significantly reduced: 1.2 +/- 0.2 and 2.6 +/- 0.6 nmol.min-1 x 10(6) cells-1 for hemorrhaged and sham, respectively. Thus gut lipid absorptive function is depressed after trauma-hemorrhage and resuscitation, which is at least partially due to the depressed uptake mechanism of the enterocyte.

  20. Age-dependent effect of treadmill exercise on hemorrhage-induced neuronal cell death in rats.

    Science.gov (United States)

    Yoon, Jin-Hwan; Lee, Hee-Hyuk; Yi, Eun-Surk; Baek, Soon Gi

    2013-01-01

    Intracerebral hemorrhage (ICH) is a major cause of death and disability in the elderly. In the present study, we examined the age-dependence of the effect of treadmill exercise on the intrastriatal hemorrhage-induced neuronal cell death in rats. Young (8 weeks old) and old (64 weeks old) Sprague-Dawley male rats were used in the present study. Intrastriatal hemorrhage was induced by injection of 0.2 U collagenase (1 μL volume) into the striatum using a stereotaxic instrument. The rats in the exercise groups were forced to run on a treadmill for 30 min daily for 7 days. Lesion size was determined by Nissl staining. Apoptosis was assessed by the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay. In the present results, induction of hemorrhage increased lesion size and enhanced apoptosis. Treadmill exercise decreased the lesion size with suppressing apoptosis. However, the size of lesion induced by hemorrhage and the number of apoptotic cells were not different between young and old rats. Treadmill exercise significantly reduced the ICH-induced lesion size and the number of apoptotic cells irrespective of age. The data suggest that treadmill exercise may provide therapeutic value against ICH by suppressing neuronal apoptosis regardless of age.

  1. Incidence of Intraventricular Hemorrhage and Post Hemorrhagic Hydrocephalus in Preterm Infants

    Directory of Open Access Journals (Sweden)

    Negar Sajjadian

    2010-07-01

    Full Text Available "nGerminal matrix-intraventricular hemorrhage (IVH is the most common variety of neonatal intracranial hemorrhage and is characteristics of the premature infant. The importance of the lesion relates not only to its high incidence but to their attendant complications (IC: hydrocephalus. Brain sonography is the procedure of choice in diagnosis of germinal matrix- intraventricular hemorrhage and hydrocephalus. In this study we have used brain sonography for detection of intraventricular hemorrhage and post hemorrhagic hydrocephalus and their incidences. The studied population was consisted of premature neonate (birth weight equal or less than 1500g and gestational age equal or less than 37 weeks who admitted in Mofid Hospital NICU (Tehran, Iran during a one year period. For all neonate (including criteria brain sonography in first week of life was done and in presence of IVH, serial Brain sonography was done weekly for detection of hydrocephalus. A total of 57 neonate entered the study. Intraventicular-germinal matrix hemorrhage was seen in 64.4% (35 patients. Forty percent of patients with intraventricular-germinal matrix hemorrhage had grade I, 11% grade II, 25.7% grade III, 2.8% grade VI. Hydrocephalus was detected in 20 percent of patients who had intraventricular-germinal matrix hemorrhage. That incidence of IVH in our study in comparison with other area and situation is higher. Hydrocephaly had direct relation with severity of IVH. This shows that with control of risk factor of IVH, we can control Post hemorrhagic hydrocephalus.

  2. Terson syndrome with bilateral optic nerve sheath hemorrhage.

    Science.gov (United States)

    Gauntt, Chiaki D; Sherry, Richard G; Kannan, Chithra

    2007-09-01

    A 53-year-old man presented with an acute headache and mental status changes due to rupture of an anterior choroidal artery aneurysm. A preoperative CT scan demonstrated subarachnoid hemorrhage, bilateral optic nerve sheath hemorrhage, and bilateral intraocular hemorrhage. Ophthalmoscopy and B-scan ocular ultrasound disclosed vitreous hemorrhages, features consistent with Terson syndrome. This is the first CT report of Terson syndrome showing bilateral optic nerve sheath hemorrhage.

  3. Diagnosis and Management of Subarachnoid Hemorrhage.

    Science.gov (United States)

    Suarez, Jose I

    2015-10-01

    The purpose of this article is to present the epidemiology, clinical presentation, and management of patients with subarachnoid hemorrhage (SAH). SAH is a neurologic emergency that carries high morbidity and mortality. Patients with SAH are at risk for several significant neurologic complications, including hydrocephalus, cerebral edema, delayed cerebral ischemia, rebleeding, seizures, and neuroendocrine abnormalities that lead to impaired body regulation of sodium, water, and glucose. The incidence of SAH has remained stable, but mortality of hospitalized patients has significantly declined over the past 3 decades. Many common therapies for SAH have created controversy, and various recent neuroprotective clinical trials have produced negative results. However, the publication of two consensus guidelines by the American Heart Association/American Stroke Association and the Neurocritical Care Society have provided a clarification for what should constitute best practice for patients with SAH. The most important of those recommendations include the following: admission of patients to high-volume centers (defined as more than 35 patients with SAH per year) under the management of a specialized and multidisciplinary team; early identification and management of the bleeding source; evaluation and treatment decision for unsecured aneurysms by a multidisciplinary team made up of cerebrovascular neurosurgeons, endovascular practitioners, and neurointensivists; management of patients in the neurocritical care unit with oral nimodipine, blood pressure control, euvolemia, and frequent monitoring for neurologic and systemic complications; and delayed cerebral ischemia secondary to cerebral vasospasm should be treated with induced hypertension and endovascular therapies once confirmed. SAH is a devastating neurologic disease. Management of patients with SAH should adhere to currently available treatment guidelines. Several aspects of SAH management remain controversial and need

  4. Submacular hemorrhage secondary to congenital toxoplasmosis.

    Science.gov (United States)

    Costa, Ana Luiza Fontes de Azevedo; Martins, Thiago Gonçalves Dos Santos; Moncada, Francisco Javier Solano; Motta, Mário Martins dos Santos

    2014-01-01

    We report the case of a patient with congenital toxoplasmosis and submacular hemorrhage caused by a neovascular membrane who underwent an intravitreal injection of C3F8 and bevacizumab, and had a good visual recovery.

  5. Current management of massive hemorrhage in trauma

    DEFF Research Database (Denmark)

    Johansson, Pär I; Stensballe, Jakob; Ostrowski, Sisse R

    2012-01-01

    ABSTRACT: Hemorrhage remains a major cause of potentially preventable deaths. Trauma and massive transfusion are associated with coagulopathy secondary to tissue injury, hypoperfusion, dilution, and consumption of clotting factors and platelets. Concepts of damage control surgery have evolved...

  6. Glioblastoma Multiforme Presenting as Spontaneous Intracerebral Hemorrhage

    Directory of Open Access Journals (Sweden)

    Cagatay Ozdol

    2014-06-01

    Full Text Available Brain tumors with concomitant intracerebral hemorrhage are rarely encountered. Hemorrhage as the initial presentation of a brain tumour may pose some diagnostic problems, especially if the tumour is small or the hemorrhage is abundant. We present a 47-year-old man who admitted to the emergency department with sudden onset headache, right blurred vision and gait disturbance. A non-contrast cranial computerized tomography scan performed immediately after his admission revealed a well circumscribed right occipitoparietal haematoma with intense peripheral edema causing compression of the ipsilateral ventricles. On 6th hour of his admission the patient%u2019s neurological status deteriorated and he subsequently underwent emergent craniotomy and microsurgical evacuation of the haematoma. The histopathological examination of the mass was consistent with a glioblastoma multiforme. Neoplasms may be hidden behind each case of spontaneous intracerebral hemorrhage. Histological sampling and investigation is mandatory in the presence of preoperative radiological features suggesting a neoplasm.

  7. Treatment of hemorrhagic radiation cystitis with formalin

    Energy Technology Data Exchange (ETDEWEB)

    Belis, J.A.; Milam, D.F.

    1976-02-01

    Two patients with intractable vesical hemorrhage secondary to pelvic irradiation were treated at West Virginia University Medical Center. Technique, indications, complications, and controversies associated with formalin therapy are discussed.

  8. Previously undiagnosed hemophilia patient with intracerebral hemorrhage

    Directory of Open Access Journals (Sweden)

    Eray Atalay

    2015-09-01

    Full Text Available Intracranial bleeding in hemophilia patients is a rare but a mortal complication. Diagnosis of hemophilia in adulthood is an uncommon occurrence. In this case report an adult patient with intracranial hemorrhage is presented.

  9. Curbing Inflammation in hemorrhagic trauma: a review

    Directory of Open Access Journals (Sweden)

    MAURICIO GODINHO

    Full Text Available Trauma is one of the world's leading causes of death within the first 40 years of life and thus a significant health problem. Trauma accounts for nearly a third of the lost years of productive life before 65 years of age and is associated with infection, hemorrhagic shock, reperfusion syndrome, and inflammation. The control of hemorrhage, coagulopathy, optimal use of blood products, balancing hypo and hyperperfusion, and hemostatic resuscitation improve survival in cases of trauma with massive hemorrhage. This review discusses inflammation in the context of trauma-associated hemorrhagic shock. When one considers the known immunomodulatory effects of traumatic injury, allogeneic blood transfusion, and the overlap between patient populations, it is surprising that so few studies have assessed their combined effects on immune function. We also discuss the relative benefits of curbing inflammation rather than attempting to prevent it.

  10. Ultrasound diagnosis of adrenal hemorrhage in meningococcemia

    Energy Technology Data Exchange (ETDEWEB)

    Sarnaik, A.P.; Sanfilippo, D.J.K.; Slovis, T.L.

    1988-07-01

    Adrenal hemorrhage (AH) is a well-described complication of the neonatal period, anticoagulant therapy, and overwhelming bacterial infection especially with N. meningitis. Until recently the diagnosis of acute AH was based predominantly on autopsy findings. Ultrasound and computed tomography examinations have been successfully used for antemortem detection of AH in neonates and anticoagulated patients. We report two patients with fulminant meningococcal infection who demonstrated bilateral adrenal hemorrhages on ultrasonography.

  11. Reperfusion hemorrhage following superior mesenteric artery stenting.

    LENUS (Irish Health Repository)

    Moore, Michael

    2012-02-03

    Percutaneous transluminal angioplasty and stent placement is now an established treatment option for chronic mesenteric ischemia and is associated with low mortality and morbidity rates. We present a case of reperfusion hemorrhage complicating endovascular repair of superior mesenteric artery stenosis. Although a recognized complication following repair of carotid stenosis, hemorrhage has not previously been reported following mesenteric endovascular reperfusion. We describe both spontaneous cessation of bleeding and treatment with coil embolization.

  12. [Endoscopy in upper gastrointestinal tract hemorrhage].

    Science.gov (United States)

    Marañón Sepúlveda, M

    1990-01-01

    There are several changes in the role that endoscopy plays in upper gastrointestinal hemorrhage. We propose indications and make point about the factors than an endoscopist must have in mind referring to timing the endoscopy study. In the experience of our Hospital (Hospital Central Norte de Petroleos Mexicanos, Mexico City), during 20 years we found a diminution in the prevalence of duodenal ulceration and an increase in gastric ulceration, erosive gastritis an neoplasies as causes of upper gastrointestinal hemorrhage.

  13. Delayed appearance of high altitude retinal hemorrhages.

    Directory of Open Access Journals (Sweden)

    Daniel Barthelmes

    Full Text Available BACKGROUND: Retinal hemorrhages have been described as a component of high altitude retinopathy (HAR in association with altitude illness. In this prospective high altitude study, we aimed to gain new insights into the pathophysiology of HAR and explored whether HAR could be a valid early indicator of altitude illness. METHODOLOGY/PRINCIPAL FINDINGS: 28 mountaineers were randomly assigned to two ascent profiles during a research expedition to Mt. Muztagh Ata (7546 m/24,751 ft. Digital fundus photographs were taken prior to expedition at 490 m (1,607 ft, during expedition at 4497 m (14,750 ft = base camp, 5533 m (18,148 ft, 6265 m (20,549 ft, 6865 m (22,517 ft and 4.5 months thereafter at 490 m. Number, size and time of occurrence of hemorrhages were recorded. Oxygen saturation (SpO₂ and hematocrit were also assessed. 79% of all climbers exhibited retinal hemorrhages during the expedition. Number and area of retinal bleeding increased moderately to medium altitudes (6265 m. Most retinal hemorrhages were detected after return to base camp from a high altitude. No post-expeditional ophthalmic sequelae were detected. Significant negative (SpO₂ Beta: -0.4, p<0.001 and positive (hematocrit Beta: 0.2, p = 0.002, time at altitude Beta: 0.33, p = 0.003 correlations with hemorrhages were found. CONCLUSIONS/SIGNIFICANCE: When closely examined, a very large amount of climbers exhibit retinal hemorrhages during exposure to high altitudes. The incidence of retinal hemorrhages may be greater than previously appreciated as a definite time lag was observed between highest altitude reached and development of retinal bleeding. Retinal hemorrhages should not be considered warning signs of impending severe altitude illness due to their delayed appearance.

  14. Argentine hemorrhagic fever: a primate model.

    Science.gov (United States)

    Weissenbacher, M C; Calello, M A; Colillas, O J; Rondinone, S N; Frigerio, M J

    1979-01-01

    Experimental Junin virus infection of a New World primate, Callithrix jacchus, was evaluated. The virus produced anorexia, loss of weight, thrombocytopenia, leukopenia, and hemorrhagic and neurological symptoms and terminated in death. Virus was recovered from urine, blood samples and all tissues taken at autopsy. These preliminary observations show that several aspects of the experimental disease in C. jacchus are quite similar to severe natural Argentine hemorrhagic fever of man.

  15. Fluid-attenuated inversion recovery hyperintensity in acute ischemic stroke may not predict hemorrhagic transformation.

    Science.gov (United States)

    Campbell, Bruce C V; Costello, Craig; Christensen, Søren; Ebinger, Martin; Parsons, Mark W; Desmond, Patricia M; Barber, P Alan; Butcher, Kenneth S; Levi, Christopher R; De Silva, Deidre A; Lansberg, Maarten G; Mlynash, Michael; Olivot, Jean-Marc; Straka, Matus; Bammer, Roland; Albers, Gregory W; Donnan, Geoffrey A; Davis, Stephen M

    2011-01-01

    Fluid-attenuated inversion recovery (FLAIR) hyperintensity within an acute cerebral infarct may reflect delayed onset time and increased risk of hemorrhage after thrombolysis. Given the important implications for clinical practice, we examined the prevalence of FLAIR hyperintensity in patients 3-6 h from stroke onset and its relationship to parenchymal hematoma (PH). Baseline DWI and FLAIR imaging with subsequent hemorrhage detection (ECASS criteria) were prospectively obtained in patients 3-6 h after stroke onset from the pooled EPITHET and DEFUSE trials. FLAIR hyperintensity within the region of the acute DWI lesion was rated qualitatively (dichotomized as visually obvious or subtle (i.e. only visible after careful windowing)) and quantitatively (using relative signal intensity (RSI)). The association of FLAIR hyperintensity with hemorrhage was then tested alongside established predictors (very low cerebral blood volume (VLCBV) and diffusion (DWI) lesion volume) in logistic regression analysis. There were 49 patients with pre-treatment FLAIR imaging (38 received tissue plasminogen activator (tPA), 5 developed PH). FLAIR hyperintensity within the region of acute DWI lesion occurred in 48/49 (98%) patients, was obvious in 18/49 (37%) and subtle in 30/49 (61%). Inter-rater agreement was 92% (κ = 0.82). The prevalence of obvious FLAIR hyperintensity did not differ between studies obtained in the 3-4.5 h and 4.5-6 h time periods (40% vs. 33%, p = 0.77). PH was poorly predicted by obvious FLAIR hyperintensity (sensitivity 40%, specificity 64%, positive predictive value 11%). In univariate logistic regression, VLCBV (p = 0.02) and DWI lesion volume (p = 0.03) predicted PH but FLAIR lesion volume (p = 0.87) and RSI (p = 0.11) did not. In ordinal logistic regression for hemorrhage grade adjusted for age and baseline stroke severity (NIHSS), increased VLCBV (p = 0.002) and DWI lesion volume (p = 0.003) were associated with hemorrhage but FLAIR lesion volume (p = 0.66) and

  16. Impaired Fracture Healing after Hemorrhagic Shock

    Directory of Open Access Journals (Sweden)

    Philipp Lichte

    2015-01-01

    Full Text Available Impaired fracture healing can occur in severely injured patients with hemorrhagic shock due to decreased soft tissue perfusion after trauma. We investigated the effects of fracture healing in a standardized pressure controlled hemorrhagic shock model in mice, to test the hypothesis that bleeding is relevant in the bone healing response. Male C57/BL6 mice were subjected to a closed femoral shaft fracture stabilized by intramedullary nailing. One group was additionally subjected to pressure controlled hemorrhagic shock (HS, mean arterial pressure (MAP of 35 mmHg for 90 minutes. Serum cytokines (IL-6, KC, MCP-1, and TNF-α were analyzed 6 hours after shock. Fracture healing was assessed 21 days after fracture. Hemorrhagic shock is associated with a significant increase in serum inflammatory cytokines in the early phase. Histologic analysis demonstrated a significantly decreased number of osteoclasts, a decrease in bone quality, and more cartilage islands after hemorrhagic shock. μCT analysis showed a trend towards decreased bone tissue mineral density in the HS group. Mechanical testing revealed no difference in tensile failure. Our results suggest a delay in fracture healing after hemorrhagic shock. This may be due to significantly diminished osteoclast recruitment. The exact mechanisms should be studied further, particularly during earlier stages of fracture healing.

  17. PATHOGENESIS OF HEMORRHAGIC DUE TO DENGUE VIRUS

    Directory of Open Access Journals (Sweden)

    Arief Suseno

    2015-01-01

    Full Text Available Dengue is a viral disease that is mediated by a mosquito, which causes morbidity and mortality. Viruses can increase vascular permeability which can lead to hemorrhagic diathesis or disseminated intravascular coagulation (DIC known as dengue hemorrhagic fever (DHF. In Indonesia, dengue hemorrhagic fever (DHF are caused by dengue virus infection which was found to be endemic accompanied by an explosion of extraordinary events that appear at various specified period. The diagnosis of dengue is determined based on the criteria of the World Health Organization (WHO, 1999, which are sudden high fever accompanied by a marked tendency to hemorrhage positive tourniquet test, petechiae, ecchymosis, purpura, mucosal hemorrhagic, hematemesis or melena and thrombocytopenia. The problem that still exists today is the mechanism of thrombocytopenia in patients with varying degrees of dengue involving levels of vWF (von Willebrand factor and prostaglandin I2 (PGI2 can not be explained. The mechanism of hemorrhagic in dengue virus infections acquired as a result of thrombocytopenia, platelet disfunction decreased coagulation factors, vasculopathy with endothelial injury and disseminated intravascular coagulation (DIC.

  18. [Origin and development of hemorrhagic stroke].

    Science.gov (United States)

    Zheng, Guo-Qing; Huang, Pei-Xin

    2005-01-01

    Research works were done on origin and development of the denomination, the acute stage of etiopathogenisis and pathogenesis, therapeutical priniciple and therapeutical methods in hemorrhagic stroke. Stroke was divided into is chemic and hemorrhagic until the end of the Qing dynasty. In 1997, Terminology of Traditional Chinese Medicine Treatment-Disease Part of National Standard formally included the term hemorrhagic stroke. Before 1950s-1960s, the pathogenesis emphasizes the up-stirring of liver, the adverse-rising of both blood and qi. A proper remedy should to subdue the liver yang, calm down the endopathic wind and clear heat. Since 1970s, it has been considered that the disorder is closely related with the spleen and stomach. The focal pathogenesis was blocked passage of the middle jiao, disorder of qi in ascending and descending and the abnormal flow of qi and blood. Since 1980s, it was claimed that hemorrhagic stroke belongs to blood syndrome of TCM. The vital pathogenesis was accumulation of blood stasis in acute stage of hemorrhagic stroke. The key point of therapeutical method was to promote blood circulation to remove blood stasis. In recent years, the theories of endogenous toxic factor, consumption, yin and yang syndrome, and the therapeutical method of antidote, assisting the vital qi, especially the development of common therapeutical methods were developed, with an abundance of differential diagnosis and treatment in hemorrhagic stroke.

  19. Terson syndrome. Results of vitrectomy and the significance of vitreous hemorrhage in patients with subarachnoid hemorrhage.

    Science.gov (United States)

    Kuhn, F; Morris, R; Witherspoon, C D; Mester, V

    1998-03-01

    The purpose of study A was to assess the effectiveness of vitrectomy for Terson syndrome. The purpose of study B was to determine the incidence and significance of vitreous hemorrhage in patients with subarachnoid hemorrhage. Study A is a retrospective review of case series. Study B is a prospective study. Study A examined a consecutive series of 4 children (7 eyes) and 23 adults (26 eyes). Study B examined a consecutive series of 100 patients. Subjects in study A underwent pars plana vitrectomy for dense vitreous hemorrhage following intracranial hemorrhage. In study B, ophthalmoscopic examination of patients undergoing neurosurgery for ruptured cerebral aneurysms was used. In study A, the extent and rapidity of visual recovery and intraoperative and postoperative complications were examined. In study B, the incidences of intraocular hemorrhage and Terson syndrome in the cohort and the significance of the presence of vitreous hemorrhage in patients with subarachnoid hemorrhage were examined. Study A: There was substantial and rapid visual improvement in 25 of the 26 eyes (96%) of the adult patients, with 21 eyes (81%) achieving > or = 20/30 final visual acuity. Only limited improvement was achieved in children's eyes (Terson syndrome was 8%. All patients with Terson syndrome and 89% of the patients with other types of intraocular hemorrhage had a history of coma compared with 46% of those without intraocular hemorrhage (P = 0.0003). Vitreous hemorrhage in patients surviving subarachnoid hemorrhage appears to be more common than previously thought, underscoring the need for routine funduscopic screening. Surgical intervention is highly effective in hastening visual rehabilitation of adults with Terson syndrome. The less encouraging results in infants may be due to amblyopia or direct brain damage caused by the cerebrovascular incident.

  20. The Third, Intensive Care Bundle With Blood Pressure Reduction in Acute Cerebral Hemorrhage Trial

    Science.gov (United States)

    2017-07-05

    Cerebral Hemorrhage; Stroke; Hypertension; Diabetes; Anticoagulant-induced Bleeding; Cerebral Vascular Disorder; Brain Disorder; Hemorrhage; Intracranial Hemorrhages; Cardiovascular Diseases; Central Nervous System Diseases

  1. Acute hemorrhagic shock decreases airway resistance in anesthetized rat.

    Science.gov (United States)

    Bayat, Sam; Albu, Gergely; Layachi, Skander; Portier, Flore; Fathi, Marc; Peták, Ferenc; Habre, Walid

    2011-08-01

    We studied the relation between changes in pulmonary and systemic hemodynamics to those in the airway resistance, respiratory tissue mechanics, and thoracic gas volume (TGV) following acute hemorrhage and blood reinfusion in rats. Forced oscillation technique was used to measure airway resistance (Raw), respiratory tissue damping, and elastance at baseline and after stepwise 1-ml blood withdrawals up to 5 ml total, followed by stepwise reinfusion up to full restoration. Mean systemic (Pam) and pulmonary arterial pressures and suprarenal aortic blood flow were measured at each step. In supplemental animals, plethysmographic TGV, Pam, and respiratory mechanics measurements were performed. Blood volume loss (BVL) led to proportional decreases in Raw (66.5 ± 8.8 vs. 44.8 ± 9.0 cmH(2)O·s·l(-1) with 5 ml, P TGV significantly increased with acute BVL (3.7 ± 0.2 vs. 4.2 ± 0.2 ml, P = 0.01). Stepwise reinfusions produced opposite changes in the above parameters, with Raw reaching a higher value than baseline (P = 0.001) upon full volume restoration. Both adrenalin (P = 0.015) and noradrenalin levels were elevated (P = 0.010) after 5-ml blood withdrawal. Our data suggest that the decreases in Raw following BVL may be attributed to the following: 1) an increased TGV enhancing airway parenchymal tethering forces; and 2) an increase in circulating catecholamines. The apparent beneficial effect of a reduction in Raw in acute hemorrhagic shock is counteracted by an increase in dead space and the appearance of peripheral mechanical heterogeneities due to de-recruitment of the pulmonary vasculature.

  2. Infection after intracerebral hemorrhage: risk factors and association with outcomes in the ethnic/racial variations of intracerebral hemorrhage study.

    Science.gov (United States)

    Lord, Aaron S; Langefeld, Carl D; Sekar, Padmini; Moomaw, Charles J; Badjatia, Neeraj; Vashkevich, Anastasia; Rosand, Jonathan; Osborne, Jennifer; Woo, Daniel; Elkind, Mitchell S V

    2014-12-01

    Risk factors for infections after intracerebral hemorrhage (ICH) and their association with outcomes are unknown. We hypothesized there are predictors of poststroke infection and infections drive worse outcomes. We determined prevalence of infections in a multicenter, triethnic study of ICH. We performed univariate and multivariate analyses to determine the association of infection with admission characteristics and hospital complications. We performed logistic regression on association of infection with outcomes after controlling for known determinants of prognosis after ICH (volume, age, infratentorial location, intraventricular hemorrhage, and Glasgow Coma Scale). Among 800 patients, infections occurred in 245 (31%). Admission characteristics associated with infection in multivariable models were ICH volume (odds ratio [OR], 1.02/mL; 95% confidence interval [CI], 1.01-1.03), lower Glasgow Coma Scale (OR, 0.91 per point; 95% CI, 0.87-0.95), deep location (reference lobar: OR, 1.90; 95% CI, 1.28-2.88), and black race (reference white: OR, 1.53; 95% CI, 1.01-2.32). In a logistic regression of admission and hospital factors, infections were associated with intubation (OR, 3.1; 95% CI, 2.1-4.5), dysphagia (with percutaneous endoscopic gastrostomy: OR, 3.19; 95% CI, 2.03-5.05 and without percutaneous endoscopic gastrostomy: OR, 2.11; 95% CI, 1.04-4.23), pulmonary edema (OR, 3.71; 95% CI, 1.29-12.33), and deep vein thrombosis (OR, 5.6; 95% CI, 1.86-21.02), but not ICH volume or Glasgow Coma Scale. Infected patients had higher discharge mortality (16% versus 8%; P=0.001) and worse 3-month outcomes (modified Rankin Scale ≥3; 80% versus 51%; PInfection was an independent predictor of poor 3-month outcome (OR, 2.6; 95% CI, 1.8-3.9). There are identifiable risk factors for infection after ICH, and infections predict poor outcomes. © 2014 American Heart Association, Inc.

  3. Prevention and treatment of cerebral vasospasm after aneurysmalsubarachnoid hemorrhage

    Directory of Open Access Journals (Sweden)

    Opančina Valentina D.

    2016-01-01

    Full Text Available Background. Cerebral vasospasm is the most serious complication of subarachnoid hemorrhage. It can be defined as deferred and self-limited condition whose severity is linked to the volume, solidity, prolonged presence and location of subarachnoid blood. Almost 70% of these patients have angiographic manifestation of vasospasm, and circa 50% of these patients experience neurological deficits. The purpose of this article is to concentrate on the current progress and prospective approaches in the prevention and treatment of cerebral vasospasm after aneurismal subarachnoid hemorrhage. Materials and methods. A thorough literature search through the Medline and Ebscodatabases was performed. Original investigations, meta-analyses and reviews from the past 10 years, with accessible full-texts, in the English language, were selected. Prevention and treatment. The main medical approach for prevention of vasospasm includes upkeep of normal blood circulation level and oral Nimodipine. The only type of treatment for cerebral vasospasm, which is recognized at present, is induced hypertension with the maintenance of euvolemia. Percutaneous transluminal angioplasty and/or selective intra-arterial vasodilator therapy are recommended in patients with symptomatic cerebral vasospasm, especially in those without quick response to hypertensive therapy. Conclusion. Novel approaches with immunomodulators, anesthetics, hypothermia, acupuncture, neuroprotective agents and multimodal treatment regimens are under active development and hold promise in the treatment of vasospasm in the coming years.

  4. MR detection of retinal hemorrhages: correlation with graded ophthalmologic exam.

    Science.gov (United States)

    Beavers, Angela J; Stagner, Anna M; Allbery, Sandra M; Lyden, Elizabeth R; Hejkal, Thomas W; Haney, Suzanne B

    2015-08-01

    Dilated fundoscopic exam is considered the gold standard for detecting retinal hemorrhage, but expertise in obtaining this exam is not always immediately available. MRI can detect retinal hemorrhages, but correlation of the grade or severity of retinal hemorrhage on dilated fundoscopic exam with retinal hemorrhage visibility on MRI has not been described. To determine the value of standard brain protocol MRI in detecting retinal hemorrhage and to determine whether there is any correlation with MR detection of retinal hemorrhage and the dilated fundoscopic exam grade of hemorrhage. We conducted a retrospective chart review of 77 children exam or retinal camera images. A staff pediatric radiologist and radiology resident reviewed the MR images. Retinal hemorrhages were graded by a chief ophthalmology resident on a 12-point scale based on the retinal hemorrhage type, size, location and extent as seen on review of retinal camera images and detailed reports by ophthalmologists. Higher scores indicated increased severity of retinal hemorrhages. There was a statistically significant difference in the median grade of retinal hemorrhage examination between children who had retinal hemorrhage detected on MRI and children who did not have retinal hemorrhage detected on MRI (P = 0.02). When examination grade was categorized as low-grade (1-4), moderate-grade (5-8) or high-grade (>8) hemorrhage, there was a statistically significant association between exam grade and diagnosis based on MRI (P = 0.008). For example, only 14% of children with low-grade retinal hemorrhages were identified on MRI compared to 76% of children with high-grade hemorrhages. MR detection of retinal hemorrhage demonstrated a sensitivity of 61%, specificity of 100%, positive predictive value of 100% and negative predictive value of 63%. Retinal hemorrhage was best seen on the gradient recalled echo (GRE) sequences. MRI using routine brain protocol demonstrated 61% sensitivity and 100% specificity

  5. MR detection of retinal hemorrhages: correlation with graded ophthalmologic exam

    Energy Technology Data Exchange (ETDEWEB)

    Beavers, Angela J.; Allbery, Sandra M. [University of Nebraska Medical Center, Department of Radiology, Omaha, NE (United States); Children' s Hospital and Medical Center, Department of Radiology, Omaha, NE (United States); Stagner, Anna M.; Hejkal, Thomas W. [University of Nebraska Medical Center, Department of Ophthalmology, Omaha, NE (United States); Children' s Hospital and Medical Center, Department of Ophthalmology, Omaha, NE (United States); Lyden, Elizabeth R. [University of Nebraska Medical Center, College of Public Health, Omaha, NE (United States); Haney, Suzanne B. [Children' s Hospital and Medical Center, Department of Pediatrics, Omaha, NE (United States); University of Nebraska Medical Center, Department of Pediatrics, Omaha, NE (United States)

    2015-08-15

    Dilated fundoscopic exam is considered the gold standard for detecting retinal hemorrhage, but expertise in obtaining this exam is not always immediately available. MRI can detect retinal hemorrhages, but correlation of the grade or severity of retinal hemorrhage on dilated fundoscopic exam with retinal hemorrhage visibility on MRI has not been described. To determine the value of standard brain protocol MRI in detecting retinal hemorrhage and to determine whether there is any correlation with MR detection of retinal hemorrhage and the dilated fundoscopic exam grade of hemorrhage. We conducted a retrospective chart review of 77 children <2 years old who were seen for head trauma from April 2007 to July 2013 and had both brain MRI and dilated fundoscopic exam or retinal camera images. A staff pediatric radiologist and radiology resident reviewed the MR images. Retinal hemorrhages were graded by a chief ophthalmology resident on a 12-point scale based on the retinal hemorrhage type, size, location and extent as seen on review of retinal camera images and detailed reports by ophthalmologists. Higher scores indicated increased severity of retinal hemorrhages. There was a statistically significant difference in the median grade of retinal hemorrhage examination between children who had retinal hemorrhage detected on MRI and children who did not have retinal hemorrhage detected on MRI (P = 0.02). When examination grade was categorized as low-grade (1-4), moderate-grade (5-8) or high-grade (>8) hemorrhage, there was a statistically significant association between exam grade and diagnosis based on MRI (P = 0.008). For example, only 14% of children with low-grade retinal hemorrhages were identified on MRI compared to 76% of children with high-grade hemorrhages. MR detection of retinal hemorrhage demonstrated a sensitivity of 61%, specificity of 100%, positive predictive value of 100% and negative predictive value of 63%. Retinal hemorrhage was best seen on the gradient

  6. Bilateral subinternal limiting membrane hemorrhage with Terson syndrome.

    Science.gov (United States)

    Friedman, S M; Margo, C E

    1997-12-01

    To report the anatomic location of bilateral dome-shaped posterior pole hemorrhages in a patient with Terson syndrome. Case report. We performed bilateral vitrectomy for vitreous hemorrhage in a patient with Terson syndrome. After removal of vitreous hemorrhage, the tissue overlying a large discrete hemorrhage in the posterior pole was removed, and the tissue from one eye was examined histologically. The discrete dome-shaped hemorrhage in the posterior pole was confined to the retina anteriorly by the internal limiting membrane. Large dome-shaped retinal hemorrhages with Terson syndrome can be located beneath the internal limiting membrane of the retina.

  7. Intravesical silver nitrate for refractory hemorrhagic cystitis.

    Science.gov (United States)

    Montgomery, Brian D; Boorjian, Stephen A; Ziegelmann, Matthew J; Joyce, Daniel D; Linder, Brian J

    2016-09-01

    Hemorrhagic cystitis is a challenging clinical entity with limited evidence available to guide treatment. The use of intravesical silver nitrate has been reported, though supporting literature is sparse. Here, we sought to assess outcomes of patients treated with intravesical silver nitrate for refractory hemorrhagic cystitis. We identified nine patients with refractory hemorrhagic cystitis treated at our institution with intravesical silver nitrate between 2000-2015. All patients had failed previous continuous bladder irrigation with normal saline and clot evacuation. Treatment success was defined as requiring no additional therapy beyond normal saline irrigation after silver nitrate instillation prior to hospital discharge. Median patient age was 80 years (IQR 73, 82). Radiation was the most common etiology for hemorrhagic cystitis 89% (8/9). Two patients underwent high dose (0.1%-0.4%) silver nitrate under anesthesia, while the remaining seven were treated with doses from 0.01% to 0.1% via continuous bladder irrigation for a median of 3 days (range 2-4). All nine patients (100%) had persistent hematuria despite intravesical silver nitrate therapy, requiring additional interventions and red blood cell transfusion during the hospitalization. There were no identified complications related to intravesical silver nitrate instillation. Although well tolerated, we found that intravesical silver nitrate was ineffective for bleeding control, suggesting a limited role for this agent in the management of patients with hemorrhagic cystitis.

  8. Closed-Loop- and Decision-Assist-Guided Fluid Therapy of Human Hemorrhage.

    Science.gov (United States)

    Hundeshagen, Gabriel; Kramer, George C; Ribeiro Marques, Nicole; Salter, Michael G; Koutrouvelis, Aristides K; Li, Husong; Solanki, Daneshvari R; Indrikovs, Alexander; Seeton, Roger; Henkel, Sheryl N; Kinsky, Michael P

    2017-10-01

    We sought to evaluate the efficacy, efficiency, and physiologic consequences of automated, endpoint-directed resuscitation systems and compare them to formula-based bolus resuscitation. Experimental human hemorrhage and resuscitation. Clinical research laboratory. Healthy volunteers. Subjects (n = 7) were subjected to hemorrhage and underwent a randomized fluid resuscitation scheme on separate visits 1) formula-based bolus resuscitation; 2) semiautonomous (decision assist) fluid administration; and 3) fully autonomous (closed loop) resuscitation. Hemodynamic variables, volume shifts, fluid balance, and cardiac function were monitored during hemorrhage and resuscitation. Treatment modalities were compared based on resuscitation efficacy and efficiency. All approaches achieved target blood pressure by 60 minutes. Following hemorrhage, the total amount of infused fluid (bolus resuscitation: 30 mL/kg, decision assist: 5.6 ± 3 mL/kg, closed loop: 4.2 ± 2 mL/kg; p body weight, and urinary output remained stable under decision assist and closed loop and were significantly increased under bolus resuscitation. Mean arterial pressure initially decreased further under bolus resuscitation (-10 mm Hg; p fluid administration. We define efficacy of decision-assist and closed-loop resuscitation in human hemorrhage. In comparison with formula-based bolus resuscitation, both semiautonomous and autonomous approaches were more efficient in goal-directed resuscitation of hemorrhage. They provide favorable conditions for the avoidance of over-resuscitation and its adverse clinical sequelae. Decision-assist and closed-loop resuscitation algorithms are promising technological solutions for constrained environments and areas of limited resources.

  9. Minocycline and Doxycycline, but not Tetracycline, Mitigate Liver and Kidney Injury after Hemorrhagic Shock/Resuscitation*

    Science.gov (United States)

    Kholmukhamedov, Andaleb; Czerny, Christoph; Hu, Jiangting; Schwartz, Justin; Zhong, Zhi; Lemasters, John J.

    2014-01-01

    Background Despite recovery of hemodynamics by fluid resuscitation after hemorrhage, development of the systemic inflammatory response and multiple organ dysfunction syndromes can nonetheless lead to death. Minocycline and doxycycline are tetracycline derivatives that are protective in models of hypoxic, ischemic and oxidative stress. Our Aim was to determine whether minocycline and doxycycline protect liver and kidney and improve survival in a mouse model of hemorrhagic shock and resuscitation. Methods Mice were hemorrhaged to 30 mm Hg for 3 h and then resuscitated with shed blood followed by half the shed volume of lactated Ringer's solution containing tetracycline (10 mg/kg), minocycline (10 mg/kg), doxycycline (5 mg/kg) or vehicle. For pre-plus post-treatment, drugs were administered intraperitoneally prior to hemorrhage followed by second equal dose in Ringer's solution after blood resuscitation. Blood and tissue were harvested after 6 h. Results Serum alanine aminotransferase (ALT) increased to 1988 and 1878 U/L after post-treatment with vehicle and tetracycline, respectively, whereas minocycline and doxycycline post-treatment decreased ALT to 857 and 863 U/L. Pre-plus post-treatment with minocycline and doxycycline also decreased ALT to 849 and 834 U/L. After vehicle, blood creatinine increased to 279 μM, which minocycline and doxycycline post-treatment decreased to 118 and 112 μM. Minocycline and doxycycline pre- plus post-treatment decreased creatinine similarly. Minocycline and doxycycline also decreased necrosis and apoptosis in liver and apoptosis in both liver and kidney, the latter assessed by TUNEL and caspase-3 activation. Lastly after 4.5 h of hemorrhage followed by resuscitation, minocycline and doxycycline (but not tetracycline) post-treatment improved 1-week survival from 38%(vehicle) to 69% and 67%, respectively. Conclusion Minocycline and doxycycline were similarly protective when given before as after blood resuscitation and might therefore

  10. Magnesium, hemostasis, and outcomes in patients with intracerebral hemorrhage.

    Science.gov (United States)

    Liotta, Eric M; Prabhakaran, Shyam; Sangha, Rajbeer S; Bush, Robin A; Long, Alan E; Trevick, Stephen A; Potts, Matthew B; Jahromi, Babak S; Kim, Minjee; Manno, Edward M; Sorond, Farzaneh A; Naidech, Andrew M; Maas, Matthew B

    2017-08-22

    We tested the hypothesis that admission serum magnesium levels are associated with hematoma volume, hematoma growth, and functional outcomes in patients with intracerebral hemorrhage (ICH). Patients presenting with spontaneous ICH were enrolled in an observational cohort study that prospectively collected demographic, clinical, laboratory, radiographic, and outcome data. We performed univariate and adjusted multivariate analyses to assess for associations between serum magnesium levels and initial hematoma volume, final hematoma volume, and in-hospital hematoma growth as radiographic measures of hemostasis, and functional outcome measured by the modified Rankin Scale (mRS) at 3 months. We included 290 patients for analysis. Admission serum magnesium was 2.0 ± 0.3 mg/dL. Lower admission magnesium levels were associated with larger initial hematoma volumes on univariate (p = 0.02), parsimoniously adjusted (p = 0.002), and fully adjusted models (p = 0.006), as well as greater hematoma growth (p = 0.004, p = 0.005, and p = 0.008, respectively) and larger final hematoma volumes (p = 0.02, p = 0.001, and p = 0.002, respectively). Lower admission magnesium level was associated with worse functional outcomes at 3 months (i.e., higher mRS; odds ratio 0.14, 95% confidence interval 0.03-0.64, p = 0.011) after adjustment for age, admission Glasgow Coma Scale score, initial hematoma volume, time from symptom onset to initial CT, and hematoma growth, with evidence that the effect of magnesium is mediated through hematoma growth. These data support the hypothesis that magnesium exerts a clinically meaningful influence on hemostasis in patients with ICH. © 2017 American Academy of Neurology.

  11. Diffuse glioblastoma resembling acute hemorrhagic leukoencephalitis.

    Science.gov (United States)

    Schettino, Carla; Caranci, Ferdinando; Lus, Giacomo; Signoriello, Elisabetta; Eoli, Marica; Anghileri, Elena; Pollo, Bianca; Melone, Mariarosa A B; Di Iorio, Giuseppe; Finocchiaro, Gaetano; Ugga, Lorenzo; Tedeschi, Enrico

    2017-10-01

    We report the case of a young man with sudden onset of diplopia after an upper respiratory tract infection. Based on the first radiological findings acute hemorrhagic leukoencephalitis, a variant of acute disseminated encephalomyelitis, was suspected and treatment with high dose intravenous dexamethasone was started but it was stopped for intolerance. The patient clinically worsened, developing gait instability, ataxia and ophthalmoplegia; brain MRI performed 20 days later showed severe progression of the disease with subependymal dissemination. After brain biopsy of the right temporal lesion the histological diagnosis was glioblastoma. These findings suggest that MRI features of acute hemorrhagic leukoencephalitis may dissimulate the diagnosis of diffuse glioma/glioblastoma. This case underscores the importance of considering diffuse glioma in the differential diagnosis of atypical signs and symptoms of acute hemorrhagic leukoencephalitis and underlines the relevant role of integrating neuroradiologic findings with neuropathology.

  12. Preexisting cognitive impairment in intracerebral hemorrhage.

    Science.gov (United States)

    Laible, M; Horstmann, S; Möhlenbruch, M; Schueler, S; Rizos, T; Veltkamp, R

    2017-06-01

    Preexisting cognitive impairment is a predictor of cognitive decline after ischemic stroke, but evidence in intracerebral hemorrhage (ICH) is limited. We aimed to determine the prevalence of premorbid cognitive impairment in patients with ICH. We included patients with acute ICH. Pre-ICH cognitive impairment was determined based on the results of the Informant Questionnaire on Cognitive Decline in the Elderly (IQCODE) that uses information from close relatives. Patients were assessed as having been cognitively impaired with an IQCODE score of ≥3.44; an IQCODE ≥4.00 indicated pre-ICH dementia. CT and MRI images were reviewed to determine the extent of white matter lesions and to measure the radial width of the temporal horn as marker of brain atrophy. We investigated differences of cardiovascular risk factors and imaging data between patients with and without pre-ICH cognitive impairment using correlation analyses, uni- and multivariable regression models. Functional neurological state was assessed using the modified Rankin Scale (mRS). The mRS was dichotomized at the level of 3, and a premorbid mRS of 0-2 was considered as functional independency. Among the 89 participants, median age was 70 years (interquartile range 58-78) and 52 (58.4%) were male. IQCODE indicated pre-ICH cognitive impairment in 18.0% (16 of 89), and 83.1% were functionally independent before ICH. Cognitive impairment was associated with a premorbid mRS≥3 (chi squared test, P=0.009). In multivariable analysis, prior stroke/transient ischemic attack (OR 18.29, 95%-CI 1.945-172.033, P=.011) and hematoma volume (OR 0.90, 95%-CI 0.812-0.991, P=.033) were independently associated with pre-ICH cognitive impairment. In conclusion, cognitive impairment frequently precedes ICH. A higher frequency of cerebrovascular events suggests a role of vascular processes in the development of cognitive impairment before ICH. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Risk factors for post-tonsillectomy hemorrhage.

    Science.gov (United States)

    Ikoma, Ryo; Sakane, Sayaka; Niwa, Kazutomo; Kanetaka, Sayaka; Kawano, Toshiro; Oridate, Nobuhiko

    2014-08-01

    The aim of the present study was to investigate the rate of post-tonsillectomy hemorrhage (PTH) in a single institution and to evaluate the clinical risk factors for PTH. We reviewed the records of 692 patients who underwent tonsillectomy (TE) at Yokohama Minami Kyosai Hospital in Japan. PTH grades were grouped into three categories according to the severity of the hemorrhagic episode: (I) minimal hemorrhage that stopped after noninvasive treatment, (II) hemorrhage requiring treatment with local anesthesia, and (III) hemorrhage requiring reoperation under general anesthesia in the operating room. Clinical risk factors such as sex, age (adults vs. children), TE indication, surgeon's skill level, operative time, ligature type, and duration of antibiotic administration for PTH were investigated. Among the 692 patients, 80 (11.6%) showed PTH, with primary and secondary hemorrhage accounting for 1.6% and 10.0%, respectively. A category III PTH was observed in 18 patients; thus, the overall risk of reoperation was 2.6%. The PTH episode most frequently occurred on postoperative days 5 and 6. The frequency of PTH was significantly higher in male patients and in adults (Pskill was also associated with PTH rate. A stepwise multivariate logistic regression revealed that adult age (odds ratio [OR]=18.9) and male gender (OR=3.78) were the clinical risk factors for PTH. It also revealed that male gender (OR=82065335), adult age (OR=10.6), and surgeon's skill level (OR=7.50) were the clinical risk factors for the category III PTH. The risk of PTH was higher in this report compared with previous reports, which may be associated with the definition of PTH. Clinical risk factors for PTH were adult age and male gender. The surgeon's skill level was an additional risk factor for category III PTH. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Prevalence and Characterization of ECG Abnormalities After Intracerebral Hemorrhage

    NARCIS (Netherlands)

    van Bree, Maurits D. R.; Roos, Yvo B. W. E. M.; van der Bilt, Ivo A. C.; Wilde, Arthur A. M.; Sprengers, Marieke E. S.; de Gans, Koen; Vergouwen, Mervyn D. I.

    2010-01-01

    Background Although electrocardiographic (ECG) abnormalities are well known in ischemic stroke and subarachnoid hemorrhage, these changes have only rarely been investigated systematically in patients with intracerebral hemorrhage (ICH). The purpose of this study is to investigate the prevalence and

  15. Intraocular hemorrhage in sudden increased intracranial pressure (Terson syndrome).

    Science.gov (United States)

    Gutierrez Diaz, A; Jimenez Carmena, J; Ruano Martin, F; Diaz Lopez, P; Muñoz Casado, M J

    1979-01-01

    We examined 19 cases with SAH, 4 of which presented intraocular hemorrhages (retinal, subhyaloid and in vitreous). The mortality rate was 50% when the intraocular hemorrhages were present compared to 20% when they were absent.

  16. Pathogenesis and clinical implications of optic disk hemorrhage in glaucoma.

    Science.gov (United States)

    Suh, Min Hee; Park, Ki Ho

    2014-01-01

    The association between optic disk hemorrhage and glaucoma has been studied for many years. Recently, randomized clinical trials have confirmed that disk hemorrhage is a risk factor for development and progression of glaucoma. Disk hemorrhage is more commonly detected in open-angle glaucoma with normal tension than in open-angle glaucoma with high tension. Development of disk hemorrhage possibly is associated with the biomechanical properties of the lamina cribrosa and surrounding tissues, including the intraocular pressure (IOP)-cerebrospinal pressure gradient, arterial pressure, and venous pressure. Disk hemorrhage may be a marker of rapid glaucoma progression, in that localized subclinical structural change predisposes to disk hemorrhage, after which subsequent disease progression is accelerated, and recurrent optic disk hemorrhages are related to rapid structural progression of glaucomatous damage. IOP-lowering therapy can be helpful in halting post-hemorrhage glaucoma progression. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Is Prior Statin Therapy Associated with Increased Hemorrhagic ...

    African Journals Online (AJOL)

    Statins have been suggested to increase the risk of hemorrhagic stroke. We hypothesized that prior statin therapy in patients admitted with hemorrhagic or ischemic stroke in a Grampian population would be associated with an increased risk of intra cerebral hemorrhage (ICH) rather than infarct. A database of all patients ...

  18. Characterization of hemorrhages in the tenderloins of slaughter pigs

    DEFF Research Database (Denmark)

    Dich-Jørgensen, Kristine; McEvoy, Fintan; Larsen, Helle Daugaard

    2016-01-01

    Muscle hemorrhages are regularly observed in especially the tip of the tenderloin muscles of slaughter pigs. In order to characterize the hemorrhages, a macro- and microscopic examination of tenderloins with (n = 5) and without (n = 4) hemorrhages and the associated vertebral column was carried out...

  19. Peritumoral and intratumoral hemorrhage after stereotactic radiosurgery for renal cell carcinoma metastasis to the brain

    Science.gov (United States)

    Ronchini, Nello; Godowicz, Tomasz Tadeusz; Cavazzani, Paolo; Severi, Paolo

    2011-01-01

    Stereotactic Radiosurgery (SRS), provides in a single session, a high dose of radiation to a localized brain tumor volume. Acute adverse reactions after treatment are not uncommon, but are usually transient and generally are well controlled by medication. The authors wish to report this rare complication of intratumoral and peritumoral hemorrhage immediately after LINAC SRS treatment of single temporal lobe metastasis from renal cell carcinoma and discuss plausible causes for this case and its management. A review of the literature on acute intracranial hemorrhage after radiosurgery for metastatic lesions is provided. A 68-year-old man underwent SRS treatment for a single left temporal lobe metastasis. No complications were noticed during frame fixation, treatment itself, or frame removal. Thirty minutes after the end of treatment session the patient acutely became aphasic and right hemiplegic. An urgent CT-scan revealed peritumoral and intratumoral hemorrhage. Patient underwent urgent surgical treatment during which was performed gross total excision of the brain metastasis and total removal of the clot. The patient had a good recovery after surgery and he was discharged with moderate aphasia but able to walk with no other neurological deficits. Stereotactic radiosurgery for metastatic brain tumors should not be considered as a risk-free procedure, especially in cases of neoplasms with high propensity for intratumoral bleeding and, while extremely rare, hemorrhagic complications can occur after treatment. The possibility of acute complications and their consequences have to be discussed with the patient and his or her relatives before radiosurgical treatment. PMID:29296311

  20. [Association of cardiovascular system and endothelial dysfunction indicators in patients with hemorrhagic shock].

    Science.gov (United States)

    Iudakova, T N; Girsh, A O; Maksimishin, S V; Mal'kov, O A

    2013-01-01

    Endothelial dysfunction is a universal mechanism of pathogenesis of many critical conditions. Goal of the study was to assess a relation of cardiovascular system and endothelial dysfunction indicators in patients with hemorrhagic shock. 17 patients with hemorrhagic shock 3 were involved in the study. All patients received infusion therapy, artificial lung ventilation after tracheal intubation and symptomatic treatment in prehospital period. Common volume of blood loose was 2900 +/- 200 mL. The patients received infusion, transfusion, inotrope, antibacterial, respiratory and symptomatic therapy in ICU after surgical treatment. Cardio-vascular system parameters were assessed by Tischenko method of integral reography. Number of red cells, hemoglobin, lactate, endotelin-1 and Wb-factor of venous blood were studied before surgery, in 12 and in 24 hours after. Morphological study of the omentumbiopsy was carried out. Performed correlation analysis showed statistically significant relations of cardiovascular system and endothelial dysfunction indicators in patients with hemorrhagic shock. Endothelial dysfunction occurs in patients with hemorrhagic shock 3. The endothelial dysfunction correlates with parameters of cardio-vascular system and tissue perfusion.

  1. Black Hole Sign: Novel Imaging Marker That Predicts Hematoma Growth in Patients With Intracerebral Hemorrhage.

    Science.gov (United States)

    Li, Qi; Zhang, Gang; Xiong, Xin; Wang, Xing-Chen; Yang, Wen-Song; Li, Ke-Wei; Wei, Xiao; Xie, Peng

    2016-07-01

    Early hematoma growth is a devastating neurological complication after intracerebral hemorrhage. We aim to report and evaluate the usefulness of computed tomography (CT) black hole sign in predicting hematoma growth in patients with intracerebral hemorrhage. Patients with intracerebral hemorrhage were screened for the presence of CT black hole sign on admission head CT performed within 6 hours after onset of symptoms. The black hole sign was defined as hypoattenuatting area encapsulated within the hyperattenuating hematoma with a clearly defined border. The sensitivity, specificity, and positive and negative predictive values of CT black hole sign in predicting hematoma expansion were calculated. Logistic regression analyses were used to assess the presence of the black hole sign and early hematoma growth. A total of 206 patients were enrolled. Black hole sign was found in 30 (14.6%) of 206 patients on the baseline CT scan. The black hole sign was more common in patients with hematoma growth (31.9%) than those without hematoma growth (5.8%; Phole sign in predicting early hematoma growth were 31.9%, 94.1%, 73.3%, and 73.2%, respectively. The time-to-admission CT scan, baseline hematoma volume, and the presence of black hole sign on admission CT independently predict hematoma growth in multivariate model. The CT black hole sign could be used as a simple and easy-to-use predictor for early hematoma growth in patients with intracerebral hemorrhage. © 2016 American Heart Association, Inc.

  2. Extra-Gastrointestinal retroperitoneal giant stromal tumor complicated with intra-tumoral hemorrhage: case report and literature review

    Directory of Open Access Journals (Sweden)

    Suciu B.A.

    2015-02-01

    Full Text Available Gastrointestinal stromal tumors are an uncommon sarcomas with mesenchymal origin that arises in the gastrointestinal tract. Recently, most of the published reports describe such tumors located outside of the gastrointestinal tract, with similar pathological characteristics and are named extra-gastrointestinal stromal tumors. We report the case of a patient suffering for a giant retroperitoneal extra-gastrointestinal stromal tumor, complicated with intra-tumoral hemorrhage. The particularity of this case is the presence of the intra-tumoral hemorrhage in a retroperitoneal extragastrointestinal stromal tumor that grew rapidly in volume (in 1 week.

  3. Subarachnoid hemorrhage after aneurysm surgery

    Directory of Open Access Journals (Sweden)

    Carlos Gilberto Carlotti Junior

    1996-06-01

    Full Text Available The surgical treatment of intracranial aneurysms by clipping is recognized as effective and definitive. However some cases that suffered a new subarachnoid hemorrhage (SAH some time after they were submitted to aneurysm clipping have raised doubts about the concept of "cure"after this treatment. Eleven patients previously submitted to aneurysm clipping who presented a new SAH were analyzed. The time elapsed from surgery to SAH varied from 3 to 10 years. After SAH four patients had a poor outcome. The new episode of SAH occurred due to intrinsic factors of the cerebral vasculature: 1. a weak point of the vessel wall near the previous aneurysm, 2. a weak point of another vessel far from the previous aneurysm, 3. a previous infundibular dilation of the posterior communicating artery; and due to technical problems: 1. aneurysm not identified during the previous treatment, 2. aneurysm deliberately left untreated, 3. persistence of the aneurysm due to inappropriate surgery, 4. persistency of part of the aneurysm neck after clipping and 5. slipping of the clip from the neck of the aneurysm. The measures to prevent new SAH after surgery start with adequate preoperative angiographic studies, a careful inspection of the position of the clip and emptying of the aneurysm. Early angiography studies may reveal a persistent neck and later ones may reveal newly developed aneurysms. In conclusion, SAH after aneurysm clipping is a late and severe phenomenon and the concept of "cure" after this surgery should be interpreted with caution.O tratamento cirúrgico dos aneurismas cerebrais através de sua clipagem é reconhecido como eficaz e definitivo. Entretanto alguns casos sofrem nova hemorragia algum tempo após a cirurgia, deixando dúvidas sobre a "cura" pelo tratamento. Onze pacientes submetidos anteriormente a clipagem do aneurisma e que apresentaram nova hemorragia foram analisados. O intervalo de tempo da cirurgia para a nova hemorragia foi de 3 a 10 anos

  4. Hydrogen gas inhalation inhibits progression to the "irreversible" stage of shock after severe hemorrhage in rats.

    Science.gov (United States)

    Matsuoka, Tadashi; Suzuki, Masaru; Sano, Motoaki; Hayashida, Kei; Tamura, Tomoyoshi; Homma, Koichiro; Fukuda, Keiichi; Sasaki, Junichi

    2017-09-01

    Mortality of hemorrhagic shock primarily depends on whether or not the patients can endure the loss of circulating volume until radical treatment is applied. We investigated whether hydrogen (H2) gas inhalation would influence the tolerance to hemorrhagic shock and improve survival. Hemorrhagic shock was achieved by withdrawing blood until the mean arterial blood pressure reached 30-35 mm Hg. After 60 minutes of shock, the rats were resuscitated with a volume of normal saline equal to four times the volume of shed blood. The rats were assigned to either the H2 gas (1.3% H2, 26% O2, 72.7% N2)-treated group or the control gas (26% O2, 74% N2)-treated group. Inhalation of the specified gas mixture began at the initiation of blood withdrawal and continued for 2 hours after fluid resuscitation. The survival rate at 6 hours after fluid resuscitation was 80% in H2 gas-treated rats and 30% in control gas-treated rats (p gas-treated rats than in the control rats. Despite losing more blood, the increase in serum potassium levels was suppressed in the H2 gas-treated rats after 60 minutes of shock. Fluid resuscitation completely restored blood pressure in the H2 gas-treated rats, whereas it failed to fully restore the blood pressure in the control gas-treated rats. At 2 hours after fluid resuscitation, blood pressure remained in the normal range and metabolic acidosis was well compensated in the H2 gas-treated rats, whereas we observed decreased blood pressure and uncompensated metabolic acidosis and hyperkalemia in the surviving control gas-treated rats. H2 gas inhalation delays the progression to irreversible shock. Clinically, H2 gas inhalation is expected to stabilize the subject until curative treatment can be performed, thereby increasing the probability of survival after hemorrhagic shock.

  5. Extensive Supratentorial Hemorrhages Following Posterior Fossa ...

    African Journals Online (AJOL)

    Agarwal, et al.: Supratentorial hemorrhages following posterior fossa surgery. Author Institution Mapping (AIM). Please note that not all the institutions may get mapped due to non-availability of the requisite information in the Google Map. For AIM of other issues, please check the Archives/Back Issues page on the journal's ...

  6. Social cognition impairments after aneurysmal subarachnoid hemorrhage

    NARCIS (Netherlands)

    Buunk, Anne; Spikman, Jacoba; Veenstra, Wencke; Groen, Rob J.M.; Meiners, Linda

    2016-01-01

    Objective: Impaired social cognition (SC) is a possible underlying cause of behavioral and interpersonal changes after aneurysmal subarachnoid hemorrhage (aSAH). To date, SC has not been investigated after aSAH. Therefore, we aimed to investigate SC after aSAH and its relationship with frontal

  7. [Arbovirus causing hemorrhagic fever at IMSS].

    Science.gov (United States)

    Navarrete-Espinosa, Joel; Gómez-Dantés, Héctor

    2006-01-01

    To know the arbovirus causing hemorrhagic fever in patients at the Mexican Institute of Social Security. A follow-up study was made in patients with probable diagnosis of hemorrhagic dengue. Blood samples were taken to look for dengue fever, yellow fever and San Luis, Tonate and Mayaro encephalitis viruses. Frequencies and proportions of the interest variables were analyzed. 35 patients were studied. Isolation and PCR results of the 13 samples were negative in 12 of them and positive to denguevirus-3 in one of them. The determination of IgM was positive for dengue fever in 25 cases; 2 were positive to Mayaro virus and 8 were negative to what was looked for. Hemorrhages and thrombocytopenia were more frequent in patients infected with dengue and Mayaro viruses; jaundice and encephalopathy were more frequent in the latter, and renal dysfunction, in patients with a negative result. Evolution was satisfactory in all cases, except for one (Mayaro), which presented hemorrhages, thrombocytopenia, jaundice and encephalopathy that lead to death. The results show the risk of appearance and dissemination of several vector-born diseases in Mexico. Thus, they require intensive epidemiological surveillance to identify them and to know their real occurrence and specific clinical profile.

  8. in Cardiac Muscles of Hemorrhagic Shocked Rats

    African Journals Online (AJOL)

    Purpose: To investigate the protective effects of various resuscitating fluids on severe hemorrhagic shocked (HS) rats by comparing the expression changes of hsp90α in cardiac muscles and survival of rats. Methods: Western-blot and immunohistochemistry methods were performed to determine hsp90á expressions in ...

  9. Alkhurma Hemorrhagic Fever in Saudi Arabia

    Centers for Disease Control (CDC) Podcasts

    2010-10-28

    This podcast looks at the epidemiologic characteristics of Alkhurma Hemorrhagic Fever in humans in Najran City, Saudi Arabia. CDC epidemiologist Dr. Adam MacNeil discusses the severity and risk factors for the illness.  Created: 10/28/2010 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 11/17/2010.

  10. Autologous blood transfusion in dogs with thoracic or abdominal hemorrhage: 25 cases (2007-2012).

    Science.gov (United States)

    Higgs, Veronica A; Rudloff, Elke; Kirby, Rebecca; Linklater, Andrew K J

    2015-01-01

    To describe the use and outcome following autologous blood transfusion (ABT) in dogs. Retrospective study (January 2007-July 2012). Private veterinary referral center. Twenty-five dogs that underwent ABT secondary to thoracic or abdominal hemorrhage. None. The hospital transaction database was searched using the keyword "autotransfusion" from January 2007 to July 2012. Data collected included signalment, body weight, etiology of hemorrhage, source and method of collection, volumes and method of ABT administration, use of anticoagulant, reported complications, and outcome. Twenty-five dogs were included for a total of 27 ABTs. Causes of hemorrhage included vascular trauma (14/25 dogs, 56%), ruptured tumor (8/25, 32%), and coagulopathy attributed to brodifacoum toxicosis (3/25, 12%). Autologous blood was collected from the abdominal (19/25, 76%), thoracic (5/25, 20%), or abdominal and thoracic cavities (1/25, 4%). Anticoagulant was added to the ABT blood in 13 of 25 (52%) cases. A median ABT volume of 29.3 mL/kg (range 2.9-406.9 mL/kg) was infused through either a 210 μm blood administration filter (21/27, 78%) or an 18 μm hemonate filter (6/27, 22%). Reported complications that may have been associated with ABT included hypocalcemia (4/17, 24%), hemolyzed serum (5/19, 26%), and prolonged coagulation times (4/5, 80%). These complications were considered of minimal clinical significance. Additional blood products were administered in 17 of 25 (68%) dogs. Seventeen (68%) dogs survived to discharge. Cause of death in the remaining cases was euthanasia or cardiac arrest secondary to uncontrollable hemorrhage. ABT is an adjunct to volume replacement in dogs with thoracic or abdominal hemorrhage secondary to vascular trauma, ruptured tumor, or anticoagulant rodenticide toxicosis. ABT may be used as bridge to definitive hemorrhage control, particularly when other blood products are not available or affordable. Complications may include hypocalcemia, prolonged coagulation

  11. Unraveling the distinctive features of hemorrhagic and non-hemorrhagic snake venom metalloproteinases using molecular simulations

    Science.gov (United States)

    de Souza, Raoni Almeida; Díaz, Natalia; Nagem, Ronaldo Alves Pinto; Ferreira, Rafaela Salgado; Suárez, Dimas

    2016-01-01

    Snake venom metalloproteinases are important toxins that play fundamental roles during envenomation. They share a structurally similar catalytic domain, but with diverse hemorrhagic capabilities. To understand the structural basis for this difference, we build and compare two dynamical models, one for the hemorrhagic atroxlysin-I from Bothrops atrox and the other for the non-hemorraghic leucurolysin-a from Bothrops leucurus. The analysis of the extended molecular dynamics simulations shows some changes in the local structure, flexibility and surface determinants that can contribute to explain the different hemorrhagic activity of the two enzymes. In agreement with previous results, the long Ω-loop (from residue 149 to 177) has a larger mobility in the hemorrhagic protein. In addition, we find some potentially-relevant differences at the base of the S1' pocket, what may be interesting for the structure-based design of new anti-venom agents. However, the sharpest differences in the computational models of atroxlysin-I and leucurolysin-a are observed in the surface electrostatic potential around the active site region, suggesting thus that the hemorrhagic versus non-hemorrhagic activity is probably determined by protein surface determinants.

  12. Hemorrhagic Cholecystitis in an Elderly Patient Taking Aspirin and Cilostazol

    Directory of Open Access Journals (Sweden)

    David S. Morris

    2008-06-01

    Full Text Available Hemorrhage is a rare complication of acute cholecystitis. Patients who develop this complication often are receiving anticoagulation therapy or have a pathologic coagulopathy. We present a case of an elderly patient who developed hemorrhagic cholecystitis while taking aspirin and cilostazol, a phosphodiesterase inhibitor. The patient underwent an emergent abdominal exploration. A large, blood-filled gallbladder was found along with a large hematoma between the liver and gallbladder. We also briefly review the literature regarding hemorrhagic cholecystitis, hemorrhage into the biliary tree, and hemorrhage as a complication of aspirin and phosphodiesterase inhibitor therapy.

  13. Recurrent craniospinal subarachnoid hemorrhage in cerebral amyloid angiopathy

    Directory of Open Access Journals (Sweden)

    Mathew Alexander

    2013-01-01

    Full Text Available Cerebral amyloid angiopathy (CAA usually manifests as cerebral hemorrhage, especially as nontraumatic hemorrhages in normotensive elderly patients. Other manifestations are subarachnoid (SAH, subdural, intraventricular hemorrhage (IVH and superficial hemosiderosis. A 52-year-old hypertensive woman presented with recurrent neurological deficits over a period of 2 years. Her serial brain magnetic resonance imaging and computed tomography scans showed recurrent SAH hemorrhage, and also intracerebral, IVH and spinal hemorrhage, with superficial siderosis. Cerebral angiograms were normal. Right frontal lobe biopsy showed features of CAA. CAA can present with unexplained recurrent SAH hemorrhage, and may be the initial and prominent finding in the course of disease in addition to superficial cortical siderosis and intracerebal and spinal hemorrhages.

  14. Angiographic findings in 2 children with cerebral paragonimiasis with hemorrhage.

    Science.gov (United States)

    Chen, Zhi; Chen, Jingyu; Miao, Hongpin; Li, Fei; Feng, Hua; Zhu, Gang

    2013-05-01

    Hemorrhagic events associated with cerebral paragonimiasis are not rare, especially in children and adolescents; however, angiographic evidence of cerebrovascular involvement has not been reported. The authors describe angiographic abnormalities of the cerebral arteries seen in 2 children in whom cerebral paragonimiasis was associated with hemorrhagic stroke. The patients presented with acute intracerebral and subarachnoid hemorrhage. Angiography revealed a beaded appearance and long segmental narrowing of arteries, consistent with arteritis. In both patients, involved vessels were seen in the area of the hemorrhage. The vascular changes and the hemorrhage, together with new lesions that developed close to the hemorrhage and improved after praziquantel treatment, were attributed to paragonimiasis. Further study of the frequency and mechanism of hemorrhagic cerebrovascular complications associated with cerebral paragonimiasis is needed.

  15. CLINICAL AND MORPHOLOGICAL CLASSIFICATION OF CEREBRAL INTRAVENTRICULAR HEMORRHAGES

    Directory of Open Access Journals (Sweden)

    V. V. Vlasyuk

    2013-01-01

    Full Text Available Inconsistency of the current classification of cerebral intraventricular hemorrhages is discussed in the article. The author explains divergence of including of the subependymal (1st stage and intracerebral (4th stage hemorrhages into this classification. A new classification of cerebral intraventricular hemorrhages including their origin, phases and stages is offered. The most common origin of intraventricular hemorrhages is subependymal hemorrhage (82,2%. Two phases of hemorrhage were distinguished: bleeding phase and resorption phase. Stages of intraventricular hemorrhages reflecting the blood movement after the onset of bleeding are the following: 1 — infill of the up to ½ of the lateral ventricles without their enlargement; 2 — infill of more than ½ of the lateral ventricles with their enlargement; 3 — infill of the IV ventricle, of the cerebellomedullary cistern and its dislocation into the subarachnoid space of the cerebellum, pons varolii, medulla oblongata and spinal cord.

  16. Terson syndrome caused by intraventricular hemorrhage associated with moyamoya disease.

    Science.gov (United States)

    Kim, Ho Sang; Lee, Sang Weon; Sung, Soon Ki; Seo, Eui Kyo

    2012-06-01

    Terson syndrome was originally used to describe a vitreous hemorrhage arising from aneurysmal subrarachnoid hemorrhage. Terson syndrome can be caused by intracranial hemorrhage, subdural or epidural hematoma and severe brain injury but is extremely rare in intraventricular hemorrhage associated with moyamoya disease. A 41-year-old man presented with left visual disturbance. He had a history of intraventicular hemorrhage associated with moyamoya disease three months prior to admission. At that time he was in comatose mentality. Ophthalmologic examination at our hospital detected a vitreous hemorrhage in his left eye, with right eye remaining normal. Vitrectomy with epiretinal membrane removal was performed. After operation his left visual acuity was recovered. Careful ophthalmologic examination is mandatory in patients with hemorrhagic moyamoya disease.

  17. Minimally invasive surgery for spontaneous supratentorial intracerebral hemorrhage: a meta-analysis of randomized controlled trials.

    Science.gov (United States)

    Zhou, Xinyu; Chen, Jianjun; Li, Qi; Ren, Gaoping; Yao, Guoen; Liu, Ming; Dong, Qiang; Guo, Jìng; Li, Leilei; Guo, Jing; Xie, Peng

    2012-11-01

    There has been a nonstandard surgical procedure and extensive international controversy in minimally invasive surgery (MIS) for the management of spontaneous supratentorial intracerebral hemorrhage. This meta-analysis assessed the effectiveness of MIS as compared with other treatment options, including conservative medical treatment and conventional craniotomy, in patients with supratentorial intracerebral hemorrhage. PubMed, Embase, Cochrane Controlled Trials Register (CCTR), Web of Science, European Association for Grey Literature Exploitation (EAGLE), National Technical Information Service (NTIS), Current Controlled Trials, Clinical Trials, International Clinical Trials Registry, Internet Stroke Center, Chinese Biomedical Literature Database (CBM), Chinese National Knowledge Infrastructure (CNKI) (last searched December 2011) were searched. Randomized controlled trials on MIS in patients with computed tomography-confirmed supratentorial intracerebral hemorrhage were included. We excluded low-quality randomized controlled trials. The death or dependence at the end of follow-up was defined as the primary outcome, and the death at the end of follow-up was defined as the secondary outcome. The 313 randomized controlled trials met the included criteria. We only analyzed 12 high-quality randomized controlled trials involving 1955 patients. The quality of the included trials was consistently high. OR of the primary outcome and secondary outcome of MIS both showed significant reductions (OR, 0.54, P<0.00001; OR, 0.53, P<0.00001). Patients with supratentorial intracerebral hemorrhage may benefit more from MIS than other treatment options. The most likely candidates to benefit from MIS are both sexes, age of 30 to 80 years with superficial hematoma, Glasgow Coma Scale score of ≥9, hematoma volume between 25 and 40 mL, and within 72 hours after onset of symptoms. Our study could help select appropriate patients for MIS and guide clinicians to optimize treatment

  18. Hypertonic Saline Dextran Ameliorates Organ Damage in Beagle Hemorrhagic Shock.

    Directory of Open Access Journals (Sweden)

    Jing-xiang Zhao

    Full Text Available The goal of this study was to investigate the effect of hypertonic saline with 6% Dextran-70 (HSD resuscitation on organ damage and the resuscitation efficiency of the combination of HSD and lactated ringers (LR in a model of hemorrhage shock in dogs.Beagles were bled to hold their mean arterial pressure (MAP at 50 ± 5 mmHg for 1 h. After hemorrhage, beagles were divided into three groups (n = 7 to receive pre-hospital resuscitation for 1 h (R1: HSD (4 ml/kg, LR (40 ml/kg, and HSD+LR (a combination of 4 ml/kg HSD and 40 ml/kg LR. Next, LR was transfused into all groups as in-hospital resuscitation (R2. After two hours of observation (R3, autologous blood was transfused. Hemodynamic responses and systemic oxygenation were measured at predetermined phases. Three days after resuscitation, the animals were sacrificed and tissues including kidney, lung, liver and intestinal were obtained for pathological analysis.Although the initial resuscitation with HSD was shown to be faster than LR with regard to an ascending MAP, the HSD group showed a similar hemodynamic performance compared to the LR group throughout the experiment. Compared with the LR group, the systemic oxygenation performance in the HSD group was similar but showed a lower venous-to-arterial CO2 gradient (Pv-aCO2 at R3 (p < 0.05. Additionally, the histology score of the kidneys, lungs and liver were significantly lower in the HSD group than in the LR group (p < 0.05. The HSD+LR group showed a superior hemodynamic response but higher extravascular lung water (EVLW and lower arterial oxygen tension (PaO2 than the other groups (p < 0.05. The HSD+LR group showed a marginally improved systemic oxygenation performance and lower histology score than other groups.Resuscitation after hemorrhagic shock with a bolus of HSD showed a similar hemodynamic response compared with LR at ten times the volume of HSD, but HSD showed superior efficacy in organ protection. Our findings suggest that

  19. The influence of a fentanyl and dexmedetomidine combination on external respiratory functions in acute hemorrhage model

    Directory of Open Access Journals (Sweden)

    Nikolay G. Vengerovich

    2017-01-01

    Full Text Available Background. The synthetic opioid analgesic fentanyl is widely used for prophylaxis and therapy of traumatic shock associated with massive bleeding. Its side effects – skeletal muscle rigidity and respiratory center depression – are especially pronounced with repeated administration. It is rational to apply fentanyl in diminished doses in combination with non-opioid analgesics in order to reduce respiratory disturbances risk.Aim. The aim of the work is to justify the influence of opioid analgesic fentanyl and α2 -adrenomimetic dexmedetomidine combination on external respiratory functions in acute hemorrhage model.Materials and methods. Acute loss of 35–40% of circulating blood volume was modeled in experiments on 75 white mongrel male rats. The external respiratory functions (respiratory rate, respiratory volume, breath volume per minute were estimated in animals of 5 groups: 1 – rats without analgesic help (controls; 2–3 – rats receiving a single fentanyl intramuscular injection (ED99 98,96 mcg/kg or fentanyl together with dexme detomidine (ED99 of combination 67,94 mcg/kg 15 min after acute blood loss; 4–5 – rats receiving the same drugs 15 min, 30, 45 and 60 min later.Results. In experimental acute loss of 35–40% of circulating blood volume, 15 min later a secondary acute respiratory failure developed with a drop of respiratory rate, respiratory volume and volume of breath per minute by 30%, 21 and 47% (p < 0,05. The external respiratory functions recoverеd after 4 h mainly due to the increase of respiratory volume. A single intramuscular injection of fentanyl caused respiratory depression 15 min after experimental blood loss which resulted in the decrease of breath volume per minute to 30–61% (p < 0,05 for 90 min. Four intramuscular injections of fentanyl 15 min, 30, 45 and 60 min after hemorrhage caused a severe respiratory dysfunction, accompanied by apnea periods and Biot’s respiration. Respiratory rate was reduced

  20. [Anesthesiologists at the initial stage of postpartum hemorrhage].

    Science.gov (United States)

    Rackelboom, T; Marcellin, L; Benchetrit, D; Mignon, A

    2014-12-01

    To describe the best practices for management of postpartum hemorrhage (PPH) after vaginal delivery at its initial stage by anesthesiologists. Medline, the Cochrane Library, and international guidelines have been exhaustively analyzed, graded, and discussed by the members of the scientific committee. Early recognition of PPH relies on either a perceived or a quantified blood loss of 500mL and over (using a collecting bag), or the presence of clinical signs of shock (hypotension, tachycardia, tachypnea, altered mental status) (professional consensus). Precise timing of the diagnosis of PPH must be annotated (professional consensus). Once the diagnosis is established, appropriate senior professionals, including the anesthesiologist at the early stage, must be called in. The cornerstones of initial resuscitation are restoration of blood volume and oxygen carrying capacity, achieved, with adequate intravenous access, initially with crystalloids, associated with oxygen by facemask (professional consensus). Initial resuscitation is performed, and its efficiency is assessed by continuous monitoring and hemoglobin bedside tests (Hemocue(®)). Adequate anesthetic technique must be performed to enable the obstetricians to perform a diagnostic procedure (manual removal of placenta, uterine revision), and to most frequently obtain the cessation of bleeding. Hemodynamic stability is required for loco-regional anesthesia, while on the other hand, general anesthesia with rapid sequence induction and intubation is recommended (professional consensus). Anesthesiologists must anticipate in case of failure of initial measures, including in alerting the blood transfusion service and calling for additional help (professional consensus). Adequate management of postpartum hemorrhage (PPH) requires multidisciplinary combined and simultaneous actions. After early recognition, five components are undertaken simultaneously: communication, resuscitation, monitoring, investigating the cause of

  1. Surgical Outcome of Spontaneous Supra Tentorial Intracerebral Hemorrhage.

    Science.gov (United States)

    Rehman, Waqar Aziz; Anwar, Muhammad Sohaib

    2017-01-01

    To assess the risks and benefits of surgical treatment (Open Craniotomy) of Intra-cerebral hematoma (ICH). Twenty seven patients of ICH who underwent surgical treatment at Neurosurgical department of Sheikh Zayed Hospital, Rahim Yar Khan, from 1(st) January 2015 to 31(st) December 2015 were included in this study. The primary outcome measured was death and improvement in GCS Status among survivor's at three months. Mean age of the patients was 58.4±10.7 and majority of patients (48.1%) were in the age range of 60-70 years. There were22.2% patients with ICH volume of >50 ml. Six (6) patients had 8 GCS with 50ml volume, who later died in ICU. Three of the patients who expired developed post-operative pneumothorax. These patients also acquired RTI resulting in deterioration of GCS. The rest of the expired patients showed deterioration in their GCS associated with oedma on brain CT scan. One patient died as a result of re-bleed. Twenty one (21) patients were discharged from hospital, two of these patients were lost in second follow up. Rest of the patients showed a gradual improvement in GCS touching 15/15 by 2(nd) follow up visit. Surgical prognosis of ICH depends on the patients GCS received and size of hemorrhage at the time of presentation. Urgent surgical evacuation in patients with rapid deterioration carries good outcome, hence should be considered.

  2. Detection of acute cerebral hemorrhage in rabbits by magnetic induction

    Energy Technology Data Exchange (ETDEWEB)

    Sun, J.; Jin, G.; Qin, M.X. [College of Biomedical Engineering and Medical Imaging, Third Military Medical University, Chongqing, China, College of Biomedical Engineering and Medical Imaging, Third Military Medical University, Chongqing (China); Wan, Z.B. [Experimental Animal Center, Third Military Medical University, Chongqing, China, Experimental Animal Center, Third Military Medical University, Chongqing (China); Wang, J.B.; Wang, C.; Guo, W.Y. [College of Electronic Engineering, Xidian University, Xi' an, China, College of Electronic Engineering, Xidian University, Xi' an (China); Xu, L.; Ning, X.; Xu, J.; Pu, X.J.; Chen, M.S. [College of Biomedical Engineering and Medical Imaging, Third Military Medical University, Chongqing, China, College of Biomedical Engineering and Medical Imaging, Third Military Medical University, Chongqing (China); Zhao, H.M. [Experimental Animal Center, Third Military Medical University, Chongqing, China, Experimental Animal Center, Third Military Medical University, Chongqing (China)

    2014-02-17

    Acute cerebral hemorrhage (ACH) is an important clinical problem that is often monitored and studied with expensive devices such as computed tomography, magnetic resonance imaging, and positron emission tomography. These devices are not readily available in economically underdeveloped regions of the world, emergency departments, and emergency zones. We have developed a less expensive tool for non-contact monitoring of ACH. The system measures the magnetic induction phase shift (MIPS) between the electromagnetic signals on two coils. ACH was induced in 6 experimental rabbits and edema was induced in 4 control rabbits by stereotactic methods, and their intracranial pressure and heart rate were monitored for 1 h. Signals were continuously monitored for up to 1 h at an exciting frequency of 10.7 MHz. Autologous blood was administered to the experimental group, and saline to the control group (1 to 3 mL) by injection of 1-mL every 5 min. The results showed a significant increase in MIPS as a function of the injection volume, but the heart rate was stable. In the experimental (ACH) group, there was a statistically significant positive correlation of the intracranial pressure and MIPS. The change of MIPS was greater in the ACH group than in the control group. This high-sensitivity system could detect a 1-mL change in blood volume. The MIPS was significantly related to the intracranial pressure. This observation suggests that the method could be valuable for detecting early warning signs in emergency medicine and critical care units.

  3. Ubiquinol decreases hemorrhagic shock/resuscitation‐induced microvascular inflammation in rat mesenteric microcirculation

    Science.gov (United States)

    Shen, Qiuhua; Holloway, Naomi; Thimmesch, Amanda; Wood, John G.; Clancy, Richard L.; Pierce, Janet D.

    2014-01-01

    Abstract Hemorrhagic shock (HS) is a leading cause of death in traumatic injury. Ischemia and hypoxia in HS and fluid resuscitation (FR) creates a condition that facilitates excessive generation of reactive oxygen species (ROS). This is a major factor causing increased leukocyte‐endothelial cell adhesive interactions and inflammation in the microcirculation resulting in reperfusion tissue injury. The aim of this study was to determine if ubiquinol (coenzyme Q10) decreases microvascular inflammation following HS and FR. Intravital microscopy was used to measure leukocyte‐endothelial cell adhesive interactions in the rat mesentery following 1‐h of HS and 2‐h post FR with or without ubiquinol. Hemorrhagic shock was induced by removing ~ 40% of anesthetized Sprague Dawley rats' blood volume to maintain a mean arterial blood pressure mesenteric microcirculation through its antioxidant properties. PMID:25413319

  4. [Tactics of antihypertensive therapy in patients with hypertonic crisis complicated with hemorrhagic stroke].

    Science.gov (United States)

    Storozhakov, G I; Gendlin, G E; Anisimova, A V; Melekhov, A V; Ostrovskaya, Yu I

    2015-01-01

    To determine an optimal tactics of antihypertensive therapy in patients with hypertonic crisis complicated with hemorrhagic stroke. We examined 86 inpatients, 42 men and 44 women, aged 46-87 years, with hypertonic crisis complicated with hemorrhagic stroke. The severity of neurological deficit, parameters of cardiac output and Kaplan-Meier survival curve based on the level of arterial pressure (AP) were assessed. The best survival rate of the patients with systolic blood pressure >162 mm Hg to the 20th min from the beginning of treatment with the greater rate of its increase was established. The efficacy of antihypertensive therapy did not depend on the baseline neurological deficit. The remote survival rate did not depend on such factors as sex, age, baseline AP level, AP, frequency of heart contractions, hematoma's volume.

  5. Stereotactic radiosurgery for sylvian fissure arteriovenous malformations with emphasis on hemorrhage risks and seizure outcomes.

    Science.gov (United States)

    Bowden, Greg; Kano, Hideyuki; Tonetti, Daniel; Niranjan, Ajay; Flickinger, John; Arai, Yoshio; Lunsford, L Dade

    2014-09-01

    Sylvian fissure arteriovenous malformations (AVMs) present substantial management challenges because of the critical adjacent blood vessels and functional brain. The authors investigated the outcomes, especially hemorrhage and seizure activity, after stereotactic radiosurgery (SRS) of AVMs within or adjacent to the sylvian fissure. This retrospective single-institution analysis examined the authors' experiences with Gamma Knife surgery for AVMs of the sylvian fissure in cases treated from 1987 through 2009. During this time, 87 patients underwent SRS for AVMs in the region of the sylvian fissure. Before undergoing SRS, 40 (46%) of these patients had experienced hemorrhage and 36 (41%) had had seizures. The median target volume of the AVM was 3.85 cm(3) (range 0.1-17.7 cm(3)), and the median marginal dose of radiation was 20 Gy (range 13-25 Gy). Over a median follow-up period of 64 months (range 3-275 months), AVM obliteration was confirmed by MRI or angiography for 43 patients. The actuarial rates of confirmation of total obliteration were 35% at 3 years, 60% at 4 and 5 years, and 76% at 10 years. Of the 36 patients who had experienced seizures before SRS, 19 (53%) achieved outcomes of Engel class I after treatment. The rate of seizure improvement was 29% at 3 years, 36% at 5 years, 50% at 10 years, and 60% at 15 years. No seizures developed after SRS in patients who had been seizure free before treatment. The actuarial rate of AVM hemorrhage after SRS was 5% at 1, 5, and 10 years. This rate equated to an annual hemorrhage rate during the latency interval of 1%; no hemorrhages occurred after confirmed obliteration. No permanent neurological deficits developed as an adverse effect of radiation; however, delayed cyst formation occurred in 3 patients. Stereotactic radiosurgery was an effective treatment for AVMs within the region of the sylvian fissure, particularly for smaller-volume AVMs. After SRS, a low rate of hemorrhage and improved seizure control were also

  6. Cerebral Venous Thrombosis Presenting with Subracnoid Hemorrhage

    Directory of Open Access Journals (Sweden)

    Esra Eruyar

    2015-08-01

    Full Text Available Subarachnoid hemorrhage (SAH associated with cerebral venous thrombosis (CVT is rarely reported. In our case, the initial CT shows with suspected lesions that SAH. After the initial diagnosis of SVT with history and neurological examination findings MRV taken and consistend with thrombus signal change. Dural sinus thrombosis with secondary venous hypertension may lead to SAH into the subarachnoid space due to the rupture of fragile, thin-walled cortical veins. Patients with non-traumatic, non-aneurysmal and non-perimesencephalic subaracnoid hemorrhage tend to have clots circumscribed along the cortical convexity, a condition referred as acute cortical SAH. CVT is a potential cause of cortical SAH. This case; SAH may be the first sign of SVT and especially SVT must do in etiologic research without the involvement of the basal sisterna in cases of SAH.

  7. Crimean-Congo hemorrhagic fever in Tajikistan.

    Science.gov (United States)

    Tishkova, Farida H; Belobrova, Evgeniya A; Valikhodzhaeva, Matlyuba; Atkinson, Barry; Hewson, Roger; Mullojonova, Manija

    2012-09-01

    Crimean-Congo hemorrhagic fever (CCHF) is a pathogenic tick-borne disease caused by a single-stranded negative-sense RNA virus classified within the Nairovirus genus of the family Bunyaviridae. Cases of CCHF have been registered in Tajikistan since the disease was first brought to medical attention in 1944. However, historical Tajik manuscripts describe the features of hemorrhagic fever associated with ticks, indicating that the disease might have been known in this region for many years before it was officially characterized. Here we review the historical context of CCHF in Tajikistan, much of which has been described over several decades in the Russian literature, and include reports of recent outbreaks in Tajikistan.

  8. An update on crimean congo hemorrhagic fever

    Directory of Open Access Journals (Sweden)

    Suma B Appannanavar

    2011-01-01

    Full Text Available Crimean Congo hemorrhagic fever (CCHF is one of the deadly hemorrhagic fevers that are endemic in Africa, Asia, Eastern Europe, and the Middle East. It is a tick-borne zoonotic viral disease caused by CCHF virus of genus Nairovirus (family Bunyaviridae. CCHF not only forms an important public health threat but has a significant effect on the healthcare personnel, especially in resource-poor countries. India was always a potentially endemic area until an outbreak hit parts of Gujarat, taking four lives including the treating medical team. The current review is an attempt to summarize the updated knowledge on the disease particularly in modern era, with special emphasis on nosocomial infections. The knowledge about the disease may help answer certain questions regarding entry of virus in India and future threat to community.

  9. Infection control during filoviral hemorrhagic fever outbreaks

    Directory of Open Access Journals (Sweden)

    N Raabe Vanessa

    2012-01-01

    Full Text Available Breaking the human-to-human transmission cycle remains the cornerstone of infection control during filoviral (Ebola and Marburg hemorrhagic fever outbreaks. This requires effective identification and isolation of cases, timely contact tracing and monitoring, proper usage of barrier personal protection gear by health workers, and safely conducted burials. Solely implementing these measures is insufficient for infection control; control efforts must be culturally sensitive and conducted in a transparent manner to promote the necessary trust between the community and infection control team in order to succeed. This article provides a review of the literature on infection control during filoviral hemorrhagic fever outbreaks focusing on outbreaks in a developing setting and lessons learned from previous outbreaks. The primary search database used to review the literature was PUBMED, the National Library of Medicine website.

  10. Impact of hemoglobin nitrite to nitric oxide reductase on blood transfusion for resuscitation from hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Chad Brouse

    2015-01-01

    Full Text Available Background: Transfusion of blood remains the gold standard for fluid resuscitation from hemorrhagic shock. Hemoglobin (Hb within the red blood cell transports oxygen and modulates nitric oxide (NO through NO scavenging and nitrite reductase. Aims: This study was designed to examine the effects of incorporating a novel NO modulator, RRx-001, on systemic and microvascular hemodynamic response after blood transfusion for resuscitation from hemorrhagic shock in a hamster window chamber model. In addition, to RRx-001 the role of low dose of nitrite (1 × 10−9 moles per animal supplementation after resuscitation was studied. Materials and Methods: Severe hemorrhage was induced by arterial controlled bleeding of 50% of the blood volume (BV and the hypovolemic state was maintained for 1 h. The animals received volume resuscitation by an infusion of 25% of BV using fresh blood alone or with added nitrite, or fresh blood treated with RRx-001 (140 mg/kg or RRx-001 (140 mg/kg with added nitrite. Systemic and microvascular hemodynamics were followed at baseline and at different time points during the entire study. Tissue apoptosis and necrosis were measured 8 h after resuscitation to correlate hemodynamic changes with tissue viability. Results: Compared to resuscitation with blood alone, blood treated with RRx-001 decreased vascular resistance, increased blood flow and functional capillary density immediately after resuscitation and preserved tissue viability. Furthermore, in RRx-001 treated animals, both mean arterial pressure (MAP and met Hb were maintained within normal levels after resuscitation (MAP >90 mmHg and metHb <2%. The addition of nitrite to RRx-001 did not significantly improve the effects of RRx-001, as it increased methemoglobinemia and lower MAP. Conclusion: RRx-001 alone enhanced perfusion and reduced tissue damage as compared to blood; it may serve as an adjunct therapy to the current gold standard treatment for resuscitation from

  11. Optic disc hemorrhage in glaucoma: pathophysiology and prognostic significance.

    Science.gov (United States)

    Kim, Ko Eun; Park, Ki Ho

    2017-03-01

    This article reviews the recent findings with regard to the pathophysiology and clinical significance of optic disc hemorrhage in glaucoma. Even though the pathophysiology of disc hemorrhage has been investigated in depth, its underlying mechanism remains unclear. The key disc hemorrhage mechanisms currently under discussion are mechanical vascular disruption and associated vascular susceptibilities. Recent technical advances in spectral-domain optical coherence tomography have yielded more compelling evidence of mechanical vascular disruption behind the pathogenesis of disc hemorrhage in glaucoma. Studies show that disc hemorrhage is associated with structural and functional glaucoma progression. Furthermore, recent findings suggest that disc hemorrhage can have different significances according to its location, recurrence, and associated underlying mechanism. The underlying mechanism of disc hemorrhage is complex like that of glaucoma. The ongoing controversy respecting the role of disc hemorrhage as a risk factor for glaucoma progression notwithstanding, special attention entailing closer follow-up and/or treatment escalation is recommended for patients with disc hemorrhage. Further studies investigating the unrevealed pathogenesis of disc hemorrhage and its prognostic value in glaucoma are warranted.

  12. [Hemorrhagic stress lesions in the gastroduodenal mucosa. Incidence and therapy].

    Science.gov (United States)

    Radovanović, D; Stojanović, D; Kalaba, J

    1995-01-01

    We have observed 428 patients with hemorrhages of the upper gastrointestinal tract; 7% of patients with stress lesions of the gastroduodenal mucosa being the cause of hemorrhages (4.9% were erosional stress hemorrhages and 2.1% were stress ulcera). Surgery is the most common cause of stress hemorrhages of the stomach and duodenum. They occur during the first 5 days after the surgery, whereas 70.59% (n = 12) occur during the first 72 hours. The localization of erosional hemorrhages of the stomach mucosa is mostly diffuse and that is why they are numerous (78.6% of the third degree) and hemorrhages are mostly heavy (the case with stress hemorrhages). Chronic peptic ulcera, especially duodenal (62.5% duodenal ulcera and 37.5% stomach ulcera) present an expressed risk factor for the occurrence of hemorrhagic erosions under the influence of the stress factor. The most common localization of the stress hemorrhagic ulcus is duodenum (66.7%) which is a potential danger for occurrence of the heaviest arterial hemorrhages. After major surgeries and during postoperative periods patients must be preventively protected by "antiulcus therapy" (especially patients with ulcera).

  13. [APPLICATIONS ENDOVASCULAR HEMOSTASIS TREATMENT OF PULMONARY HEMORRHAGE].

    Science.gov (United States)

    Severgin, V E; Shipulin, P P; Agrahari, A; Tronina, E Yu; Kyrylyuk, A A; Polyak, S D; Kozyar, N

    2015-06-01

    Rentgenoendovascular embolization of bronchial arteries was performed in 222 patients about pulmonary hemorrhage (PH) of different nature. Resistant hemostasis was achieved in 198 (89.9%) patients. The possibility of endovascular hemostasis in patients in advanced lung cancer complicated by PH. Hemostasis was ineffective in 24 (10.8%) patients. Died 5 (2.2%) patients due to unresectable lung cancer. The reasons for ineffective hemostasis were analysed.

  14. Submacular hemorrhage secondary to congenital toxoplasmosis

    OpenAIRE

    Costa,Ana Luiza Fontes de Azevedo; Martins,Thiago Gonçalves dos Santos; Moncada, Francisco Javier Solano; Motta,Mário Martins dos Santos

    2014-01-01

    We report the case of a patient with congenital toxoplasmosis and submacular hemorrhage caused by a neovascular membrane who underwent an intravitreal injection of C3F8 and bevacizumab, and had a good visual recovery. Relatamos o caso de uma paciente com toxoplasmose congênita e hemorragia submacular por uma membrana neovascular submetida à injeção intravítrea de C3F8 e bevacizumabe, com boa recuperação visual.

  15. Asymptomatic endoalveolar hemorrhage in a young male

    Directory of Open Access Journals (Sweden)

    Alain Kafyeke

    2016-06-01

    Full Text Available We describe the case of a young male affected by granulomatosis with polyangiitis presenting with non-specific complaints and complicated by the occurrence of a diffuse endoalveolar hemorrhage characterized by atypical clinical and radiological features. The importance of a rapid and aggressive diagnostic and therapeutic approach has to be strongly underlined. Available data regarding prevalence, clinical and radiological characteristics and treatment of this uncommon manifestation have also been hereby reviewed.

  16. Hemorrhagic pulmonary leptospirosis; Leptospirosis hemorragica pulmonar

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V.; Lopez, P. [Complejo Hospitalario Nuestra Senora de la Candelaria. Sant Cruz de Tenerife (Spain)

    2000-07-01

    Leptospirosis is an infectious disease characteristic of humid eastern countries. It is relatively uncommon in the West. it usually presents with either hepatorenal or pulmonary involvement, two forms which generally overlap to a certain degree. We report a case of severe onset hemorrhagic pulmonary leptospirosis in a man who, during the course of the disease, presented multi systemic embolism (spleen, kidney and central nervous system). (Author) 11 refs.

  17. Delayed postoperative hemorrhage complicating chalazion surgery.

    Science.gov (United States)

    Procope, J. A.; Kidwell, E. D.

    1994-01-01

    Chalazion surgery is a common minor ophthalmic surgical procedure used to treat chalazia after conservative measures have failed. Complications are infrequent and generally easily managed with minimal morbidity. This article presents an atypical case of an elderly woman with a history of hypertension who experienced sudden profuse hemorrhaging 10 days after chalazion surgery. The clinical findings are presented along with a brief overview of the relevant vascular anatomy of the eyelid and a discussion of possible etiologic factors. PMID:7807576

  18. Isolated arterioportal fistula presenting with variceal hemorrhage

    OpenAIRE

    Nookala, Anupama; Saberi, Behnam; Ter-Oganesyan, Ramon; Kanel, Gary; Duong, Phillip; Saito, Takeshi

    2013-01-01

    We report a case of life-threatening hematemesis due to portal hypertension caused by an isolated arterioportal fistula (APF). Intrahepatic APFs are extremely rare and are a cause of presinusoidal portal hypertension. Etiologies for APFs are comprised of precipitating trauma, malignancy, and hereditary hemorrhagic telangiectasia, but these were not the case in our patient. Idiopathic APFs are usually due to congenital vascular abnormalities and thus usually present in the pediatric setting. T...

  19. Acute atrial fibrillation during dengue hemorrhagic fever

    Directory of Open Access Journals (Sweden)

    Veloso Henrique Horta

    2003-01-01

    Full Text Available Dengue fever is a viral infection transmitted by the mosquito, Aedes aegypti. Cardiac rhythm disorders, such as atrioventricular blocks and ventricular ectopic beats, appear during infection and are attributed to viral myocarditis. However, supraventricular arrhythmias have not been reported. We present a case of acute atrial fibrillation, with a rapid ventricular rate, successfully treated with intravenous amiodarone, in a 62-year-old man with dengue hemorrhagic fever, who had no structural heart disease.

  20. Superficial vein thrombosis with hemorrhagic cerebral infarction

    Directory of Open Access Journals (Sweden)

    Yu-wei CONG

    2016-01-01

    Full Text Available Background Cerebral superficial vein thrombosis was rare and often misdiagnosed or missed for its various etiological factors, and complicated and nonspecific clinical manifestations. This paper reported one case of superficial vein thrombosis in right fronto-parietal lobe with hemorrhagic infarction. The anatomy of superficial vein, pathophysiological points, diagnosis and treatment of superficial vein thrombosis were reviewed to help to reduce missed diagnosis or misdiagnosis. Methods and Results A 18-year-old male patient had suffered from progressive headache for 4 years and weakness of left limbs for 2 d. Head MRI showed circular space-occupying lesion in right fronto-parietal lobe. Magnetic resonance venography (MRV examination showed the front two-thirds of the superior sagittal sinus was not clear. The lesions were removed and decompressive craniectomy was conducted, showing the brain tissue was pale, partly yellow or dark red, and superficial venous engorgement. Histological observation showed pial superficial vein thrombosis and subpial encephalomalacia, and multifocal hemorrhage of cerebral cortex and local parenchymal hemorrhage. A large number of "grid cells" and vascular "cuff" phenomenan were visible in surrounding tissue, and the parenchymal blood vessel proliferation was obvious. Left hand activity of the patient was obviously limited after the operation. Conclusions Clinical diagnosis of superficial vein thrombosis with hemorrhagic infarction is difficult, and brain imaging and serological examination can provide certain help. Much attention should be paid to the multidisciplinary diagnosis and treatment to reduce misdiagnosis or missed diagnosis, and gather clinical experience. DOI: 10.3969/j.issn.1672-6731.2016.01.007

  1. Crimean-Congo Hemorrhagic Fever, Sudan, 2008

    Centers for Disease Control (CDC) Podcasts

    2010-04-15

    This podcast describes the emergence of the first human cases of Crimean-Congo Hemorrhagic Fever in Sudan in 2008. CDC epidemiologist Dr. Stuart Nichol discusses how the disease was found in Sudan and how it spread in a hospital there.  Created: 4/15/2010 by National Center for Emerging and Zoonotic Infections (proposed).   Date Released: 4/15/2010.

  2. Hemorrhagic Encephalopathy From Acute Baking Soda Ingestion

    Directory of Open Access Journals (Sweden)

    Adrienne Hughes

    2016-09-01

    Full Text Available Baking soda is a readily available household product composed of sodium bicarbonate. It can be used as a home remedy to treat dyspepsia. If used in excessive amounts, baking soda has the potential to cause a variety of serious metabolic abnormalities. We believe this is the first reported case of hemorrhagic encephalopathy induced by baking soda ingestion. Healthcare providers should be aware of the dangers of baking soda misuse and the associated adverse effects.

  3. Hemorrhagic Encephalopathy From Acute Baking Soda Ingestion

    OpenAIRE

    Adrienne Hughes; Alisha Brown; Matthew Valento

    2016-01-01

    Baking soda is a readily available household product composed of sodium bicarbonate. It can be used as a home remedy to treat dyspepsia. If used in excessive amounts, baking soda has the potential to cause a variety of serious metabolic abnormalities. We believe this is the first reported case of hemorrhagic encephalopathy induced by baking soda ingestion. Healthcare providers should be aware of the dangers of baking soda misuse and the associated adverse effects. [West J Emerg Med. 20XX;XX(X...

  4. Hemorrhagic Encephalopathy From Acute Baking Soda Ingestion.

    Science.gov (United States)

    Hughes, Adrienne; Brown, Alisha; Valento, Matthew

    2016-09-01

    Baking soda is a readily available household product composed of sodium bicarbonate. It can be used as a home remedy to treat dyspepsia. If used in excessive amounts, baking soda has the potential to cause a variety of serious metabolic abnormalities. We believe this is the first reported case of hemorrhagic encephalopathy induced by baking soda ingestion. Healthcare providers should be aware of the dangers of baking soda misuse and the associated adverse effects.

  5. Clinical features of multiple spontaneous intracerebral hemorrhages

    Directory of Open Access Journals (Sweden)

    Tao CHANG

    2016-01-01

    Full Text Available Objective To analyze the clinical features of multiple spontaneous intracerebral hemorrhages (MICH. Methods Conservative therapy, puncture and drainage, hematoma removal and/or decompressive craniectomy were used in the treatment of 630 intracerebral hemorrhage (ICH patients, who were divided into 2 groups: 30 cases with MICH and another 600 cases with solitary intracerebral hemorrhage (SICH. Three months after onset, modified Rankin Scale (mRS was used to evaluate the prognosis of all cases. Results Compared with patients in SICH group, the occurrence rate of hypertension > 5 years (P = 0.008, diabetes mellitus (P = 0.024, hypercholesterolemia (P = 0.050 and previous ischemic stroke (P = 0.026 were all significantly higher in MICH group. The mean arterial pressure (MAP level (P = 0.002 and the incidence of limb movement disorder (P = 0.000 were significantly higher in patients with MICH than those with SICH. Basal ganglia and thalamus were the predilection sites of hematoma (P = 0.001. Patients with MICH had worse prognosis compared to those with SICH 3 months after onset (P = 0.006. Conclusions Hypertension > 5 years, diabetes mellitus, hypercholesterolemia and ischemic stroke were identified to be the pathophysiological basis of MICH in this study. All patients with MICH had more serious clinical manifestations after onset and worse prognosis. DOI: 10.3969/j.issn.1672-6731.2016.01.008

  6. Isolated Subarachnoidal Hemorrhage following Carotid Endarterectomy

    Directory of Open Access Journals (Sweden)

    Marie Bodenant

    2010-06-01

    Full Text Available Cerebral hyperperfusion syndrome is a rare but well-described complication following carotid endarterectomy or stenting. Clinical signs are ipsilateral, throbbing, unilateral headache with nausea or vomiting, seizures, and neurological deficits, with or without intracerebral abnormalities on CT scan, such as brain edema or intracerebral hemorrhage. Subarachnoidal hemorrhage is rarely described especially if it occurs isolated. We describe a 74-year-old man with a history of high blood pressure, hypercholesterolemia, atrioventricular block with pacemaker, and ischemic cardiopathy with coronary bypass. He underwent right carotid endarterectomy for a 90% NASCET asymptomatic stenosis. Four days after surgery, he complained of unusual headaches with right, throbbing hemicrania. Nine days after surgery, he presented with left hemiplegia and a partial motor seizure. He had fluctuant altered consciousness, left hemiplegia, and left visual and sensory neglect. Brain CT showed right frontal subarachnoidal hemorrhage without parenchymal bleeding. Cerebral angiography found no cerebral aneurysm, no vascular malformation, but a vasospasm of the left middle cerebral artery. Transcranial Doppler confirmed this vasospasm. Evolution was favorable with no recurrence of seizures but with an improvement of the neurological deficits and vasospasm. Physicians should bear in mind this very rare complication of endarterectomy and immediately perform neuroimaging in case of unusual headache following endarterectomy or angioplasty.

  7. Remote cerebellar hemorrhage after lumbar spinal surgery

    Energy Technology Data Exchange (ETDEWEB)

    Cevik, Belma [Baskent University Faculty of Medicine, Department of Radiology, Fevzi Cakmak Cad. 10. sok. No: 45, Bahcelievler, Ankara 06490 (Turkey)], E-mail: belmac@baskent-ank.edu.tr; Kirbas, Ismail; Cakir, Banu; Akin, Kayihan; Teksam, Mehmet [Baskent University Faculty of Medicine, Department of Radiology, Fevzi Cakmak Cad. 10. sok. No: 45, Bahcelievler, Ankara 06490 (Turkey)

    2009-04-15

    Background: Postoperative remote cerebellar hemorrhage (RCH) as a complication of lumbar spinal surgery is an increasingly recognized clinical entity. The aim of this study was to determine the incidence of RCH after lumbar spinal surgery and to describe diagnostic imaging findings of RCH. Methods: Between October 1996 and March 2007, 2444 patients who had undergone lumbar spinal surgery were included in the study. Thirty-seven of 2444 patients were scanned by CT or MRI due to neurologic symptoms within the first 7 days of postoperative period. The data of all the patients were studied with regard to the following variables: incidence of RCH after lumbar spinal surgery, gender and age, coagulation parameters, history of previous arterial hypertension, and position of lumbar spinal surgery. Results: The retrospective study led to the identification of two patients who had RCH after lumbar spinal surgery. Of 37 patients who had neurologic symptoms, 29 patients were women and 8 patients were men. CT and MRI showed subarachnoid hemorrhage in the folia of bilateral cerebellar hemispheres in both patients with RCH. The incidence of RCH was 0.08% among patients who underwent lumbar spinal surgery. Conclusion: RCH is a rare complication of lumbar spinal surgery, self-limiting phenomenon that should not be mistaken for more ominous pathologic findings such as hemorrhagic infarction. This type of bleeding is thought to occur secondary to venous infarction, but the exact pathogenetic mechanism is unknown. CT or MRI allowed immediate diagnosis of this complication and guided conservative management.

  8. Intraventricular hemorrhage after dural fistula embolization

    Directory of Open Access Journals (Sweden)

    Joana Chaves Gonçalves Rodrigues de Carvalho

    Full Text Available Abstract Background and objectives: Dural arteriovenous fistulas are anomalous shunts between dural arterial and venous channels whose nidus is located between the dural leaflets. For those circumstances when invasive treatment is mandatory, endovascular techniques have grown to become the mainstay of practice, choice attributable to their reported safety and effectiveness. We describe the unique and rare case of a dural arteriovenous fistula treated by transarterial embolization and complicated by an intraventricular hemorrhage. We aim to emphasize some central aspects of the perioperative management of these patients in order to help improving the future approach of similar cases. Case report: A 59-year-old woman with a previously diagnosed Cognard Type IV dural arteriovenous fistula presented for transarterial embolization, performed outside the operating room, under total intravenous anesthesia. The procedure underwent without complications and the intraoperative angiography revealed complete obliteration of the fistula. In the early postoperative period, the patient presented with clinical signs of raised intracranial pressure attributable to a later diagnosed intraventricular hemorrhage, which conditioned placement of a ventricular drain, admission to an intensive care unit, cerebral vasospasm and a prolonged hospital stay. Throughout the perioperative period, there were no changes in the cerebral brain oximetry. The patient was discharged without neurological sequelae. Conclusion: Intraventricular hemorrhage may be a serious complication after the endovascular treatment of dural arteriovenous fistula. A close postoperative surveillance and monitoring allow an early diagnosis and treatment which increases the odds for an improved outcome.

  9. Serotonin nerve terminals in the dorsomedial medulla facilitate sympathetic and ventilatory responses to hemorrhage and peripheral chemoreflex activation.

    Science.gov (United States)

    Kung, Ling-Hsuan; Scrogin, Karie E

    2011-11-01

    Serotonin neurons of the caudal raphe facilitate ventilatory and sympathetic responses that develop following blood loss in conscious rats. Here, we tested whether serotonin projections to the caudal portion of the dorsomedial brain stem (including regions of the nucleus tractus solitarius that receive cardiovascular and chemosensory afferents) contribute to cardiorespiratory compensation following hemorrhage. Injections of the serotonin neurotoxin 5,7-dihydroxytryptamine produced >90% depletion of serotonin nerve terminals in the region of injection. Withdrawal of ∼21% of blood volume over 10 min produced a characteristic three-phase response that included 1) a normotensive compensatory phase, 2) rapid sympathetic withdrawal and hypotension, and 3) rapid blood pressure recovery accompanied by slower recovery of heart rate and sympathetic activity. A gradual tachypnea developed throughout hemorrhage, which quickly reversed with the advent of sympathetic withdrawal. Subsequently, breathing frequency and neural minute volume (determined by diaphragmatic electromyography) declined below baseline following termination of hemorrhage but gradually recovered over time. Lesioned rats showed attenuated sympathetic and ventilatory responses during early compensation and later recovery from hemorrhage. Both ventilatory and sympathetic responses to chemoreceptor activation with potassium cyanide injection were attenuated by the lesion. In contrast, the gain of sympathetic and heart rate baroreflex responses was greater, and low-frequency oscillations in blood pressure were reduced after lesion. Together, the data are consistent with the view that serotonin innervation of the caudal dorsomedial brain stem contributes to sympathetic compensation during hypovolemia, possibly through facilitation of peripheral chemoreflex responses.

  10. Intracranial Hemorrhage Following a 3-week Headache

    Directory of Open Access Journals (Sweden)

    John Jiao

    2017-01-01

    Full Text Available History of present illness: A 35-year-old female presented to the ED with a Glasgow Coma Scale (GCS of 11. Per her boyfriend, the patient was having headaches for the past 3 weeks. She was initially taken to an outside hospital where her GCS was reported as 13. A non-contrast head computed tomography (CT revealed a large lobar intraparenchymal hemorrhage within the left frontal parietal lobe with midline shift. Upon examination, vitals were notable for blood pressure of 209/88mmHg, and her left pupil was fixed and dilated. The patient had extension of her right arm to noxious stimuli, paralysis of her right leg, and purposeful movement of the left arm and left leg. The patient was started on a nicardipine drip in the ED and subsequently taken to the operating room for a decompressive craniectomy. Significant findings: The patient’s head CT showed a significant area of hyperdensity consistent with an intracranial hemorrhage located within the left frontal parietal lobe (red arrow. Additionally, there is rightward midline shift up to 1.1cm (green arrow and entrapment of the right lateral ventricle (blue arrow. Discussion: Intraparenchymal hemorrhage (IPH is associated with high morbidity and mortality. Although the mortality for subarachnoid hemorrhage (SAH has declined steadily over the past several decades, the mortality for IPH mortality has not significantly.1 One of the most serious considerations when treating a patient with IPH is the management of intracranial pressure (ICP.2 Once an IPH is identified, immediate steps should be taken to bring ICP within acceptable levels including elevating the head of the bed to 30 degrees, sedation, and controlling hypertension with medications.2-3 Even with early and aggressive care, the prognosis for IPH remains poor; the 30-day mortality rate for IPH is estimated to be less than 50%, and a 2010 systematic review estimated only 12-39% of IPH patients achieve independent function.4-5 Predictors of

  11. Radiologic findings of diffuse Pulmonary hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Mi Ra; Song, Koun Sik; Lee, Jin Seong; Lim, Tae Hwan [Ulsan Univ. College of Medicine, Seoul (Korea, Republic of)

    1998-12-01

    To describe the chest radiographic and CT findings of diffuse pulmonary hemorrhage. Two radiologists retrospectively analysed the chest radiographic and CT findings of six patients with diffuse pulmonary hemorrhage. Using open lung biopsy(n=3D2) and transbronchial lung biopsy or bronchoalveolar lavage(n=3D4), diagnosis was based on the presence of hemosiderin-laden macrophage or intra-alveolar hemorrhage. Underlying diseases were Wegener's granulomatosis(n=3D2), antiphospholipid antibody syndrome(n=3D2), Henoch-Schonlein purpura(n=3D1), and idopathic pulmonary hemosiderosis(n=3D1). In all patients, sequential chest radiographs, obtained during a one to six-month period, were available. HRCT scans were obtained in five patinets, and conventional CT scans in one. Follow-up HRCT scans were obtained in two. We also analyzed the patterns of involvement, distribution and sequential changes in the pulmonary abnormalities seen on chest radiographs and CT scans. Chest radiographs showed multifocal patchy consolidation(n=3D6), ground-glass opacity(n=3D3), and multiple granular or nodular opacity(n=3D3). These lesions were intermingled in five patients, while in one there was consolidation only. Sequential chest radiographs demonstrated the improvement of initial pulmonary abnormalities and appearance of new lesions elsewhere within 5-6 days, though within 7-25 (average, 13) days, these had almost normalized. HRCT scans showed patchy consolidation(n=3D5), multiple patchy ground-glass opacity(n=3D5), or ill-defined air space nodules(n=3D4). These lesions were intermingled in five patients, and in one, ground-glass opacity only was noted. In two patients there were interlobular septal thickening and intalobular reticular opacity. The distribution of these abnormalities was almost always bilateral, diffuse with no zonal predominancy, and spared the apex of the lung and subpleural region were less affected. Although chest radiographic and CT findings of diffuse pulmonary

  12. PItcHPERFeCT: Primary Intracranial Hemorrhage Probability Estimation using Random Forests on CT.

    Science.gov (United States)

    Muschelli, John; Sweeney, Elizabeth M; Ullman, Natalie L; Vespa, Paul; Hanley, Daniel F; Crainiceanu, Ciprian M

    2017-01-01

    Intracerebral hemorrhage (ICH), where a blood vessel ruptures into areas of the brain, accounts for approximately 10-15% of all strokes. X-ray computed tomography (CT) scanning is largely used to assess the location and volume of these hemorrhages. Manual segmentation of the CT scan using planimetry by an expert reader is the gold standard for volume estimation, but is time-consuming and has within- and across-reader variability. We propose a fully automated segmentation approach using a random forest algorithm with features extracted from X-ray computed tomography (CT) scans. The Minimally Invasive Surgery plus rt-PA in ICH Evacuation (MISTIE) trial was a multi-site Phase II clinical trial that tested the safety of hemorrhage removal using recombinant-tissue plasminogen activator (rt-PA). For this analysis, we use 112 baseline CT scans from patients enrolled in the MISTE trial, one CT scan per patient. ICH was manually segmented on these CT scans by expert readers. We derived a set of imaging predictors from each scan. Using 10 randomly-selected scans, we used a first-pass voxel selection procedure based on quantiles of a set of predictors and then built 4 models estimating the voxel-level probability of ICH. The models used were: 1) logistic regression, 2) logistic regression with a penalty on the model parameters using LASSO, 3) a generalized additive model (GAM) and 4) a random forest classifier. The remaining 102 scans were used for model validation.For each validation scan, the model predicted the probability of ICH at each voxel. These voxel-level probabilities were then thresholded to produce binary segmentations of the hemorrhage. These masks were compared to the manual segmentations using the Dice Similarity Index (DSI) and the correlation of hemorrhage volume of between the two segmentations. We tested equality of median DSI using the Kruskal-Wallis test across the 4 models. We tested equality of the median DSI from sets of 2 models using a Wilcoxon

  13. Terson Syndrome in Aneurysmal Subarachnoid Hemorrhage: A Case Report.

    Science.gov (United States)

    Lee, Sang-Hee; Seo, Jeong-Hwan; Park, Sung-Hee; Won, Yu Hui; Ko, Myoung-Hwan

    2015-08-01

    Terson syndrome refers to oculocerebral syndrome of retinal and vitreous hemorrhage associated with spontaneous subarachnoid hemorrhage or all forms of intracranial bleeding. Recent observations have indicated that patients with spontaneous subarachnoid hemorrhage have an 18% to 20% concurrent incidence of retinal and vitreous hemorrhages with about 4% incidence of vitreous hemorrhage alone. Clinical ophthalmologic findings may have significant diagnostic and prognostic value for clinicians. Here we report a 45-year-old female patient who suffered from blurred vision after subarachnoid hemorrhage. She was diagnosed as Terson syndrome. After vitrectomy, she recovered with normal visual acuity which facilitated the rehabilitative process. We also performed visual evoked potentials to investigate abnormalities of visual dysfunction. Based on this case, we emphasize the importance of early diagnosis of Terson syndrome.

  14. [Vitreous hemorrhage after ruptured intracerebral aneurysms (Terson syndrome) (author's transl)].

    Science.gov (United States)

    Nogaki, H; Tamaki, N; Shirakuni, T; Kudo, H; Matsumoto, S

    1981-03-01

    Operative mortality and morbidity for intracerebral aneurysms has recently reduced with microsurgical technique, so more functional prognosis such as visual disturbance due to fundal hemorrhages has been studied. Here vitreous hemorrhage secondary to ruptured cerebral aneurysms (Terson syndrome) was attentioned. Three patients had more over 2 hours of unconsciousness and one patient experienced repeated episodes of subarachnoid hemorrhage within a week. This suggested rapid increased intracranial pressure resulted in vitreous hemorrhage through the venous congestion, which had been reported by Castrén (1963). All patients became blind because of severe vitreous hemorrhage. First case was followed over 7 years with only conservative therapy, but failed to improve. Another 3 cases regained visual acuity soon after operation. We emphasized vitreous hemorrhage as an important functional prognostic factor after ruptured intracerebral aneurysms and effective results of vitrectomy was showed.

  15. COL4A1 Mutation in Preterm Intraventricular Hemorrhage

    OpenAIRE

    Bilguvar, Kaya; DiLuna, Michael L.; Bizzarro, Matthew J.; Bayri, Yasar; Schneider, Karen C.; Lifton, Richard P.; Gunel, Murat; Ment, Laura R.

    2009-01-01

    Intraventricular hemorrhage is a common complication of preterm infants. Mutations in the type IV procollagen gene, COL4A1, are associated with cerebral small vessel disease with hemorrhage in adults and fetuses. We report a rare variant in COL4A1 associated with intraventricular hemorrhage in dizygotic preterm twins. These results expand the spectrum of diseases attributable to mutations in type IV procollagens.

  16. COL4A1 Mutation in Preterm Intraventricular Hemorrhage

    Science.gov (United States)

    Bilguvar, Kaya; DiLuna, Michael L.; Bizzarro, Matthew J.; Bayri, Yasar; Schneider, Karen C.; Lifton, Richard P.; Gunel, Murat; Ment, Laura R.

    2010-01-01

    Intraventricular hemorrhage is a common complication of preterm infants. Mutations in the type IV procollagen gene, COL4A1, are associated with cerebral small vessel disease with hemorrhage in adults and fetuses. We report a rare variant in COL4A1 associated with intraventricular hemorrhage in dizygotic preterm twins. These results expand the spectrum of diseases attributable to mutations in type IV procollagens. PMID:19840616

  17. Experimental and clinical observations on massive suprachoroidal hemorrhage.

    OpenAIRE

    Lakhanpal, V

    1993-01-01

    We have been able to create a reproducible experimental model of nonexpulsive massive suprachoroidal hemorrhage in a rabbit eye. Massive suprachoroidal hemorrhage was demonstrated on echography and confirmed on histopathologic examination in all eyes. The natural course of the disease suggests that there is very little change in the size of the choroidal detachment in the first 7 days. Maximum liquefaction of the suprachoroidal hemorrhage clot was seen to occur between 7 and 14 days. However,...

  18. Spontaneous adrenal hemorrhage during pregnancy: a case with horseshoe kidney

    Directory of Open Access Journals (Sweden)

    Mohadeseh Amini

    2017-11-01

    Full Text Available Spontaneous adrenal hemorrhage is an acute hemorrhage during pregnancy, which can be tragic for the mother and the baby. We report a unique spontaneous hemorrhage during pregnancy in a case with horseshoe kidney with separated adrenal, presented for the first time in the world. Computed tomography scan showed a horseshoe kidney fused with left normal kidney. Interestingly the adrenal gland was remained in right flank and separated from the horseshoe kidney, which prepares a probable physical stress for the hemorrhage. Diagnosis and surgery were done successfully and the case was fully recovered after several days.

  19. Smart Brain Hemorrhage Diagnosis Using Artificial Neural Networks

    Directory of Open Access Journals (Sweden)

    Santosh H. Suryawanshi

    2015-08-01

    Full Text Available Abstract The fundamental motivation behind this study is to identify the brain hemorrhage and to give accurate treatment so that death rate because of brain hemorrhage can be reduced. This project investigates the possibility of diagnosing brain hemorrhage using an image segmentation of CT scan images using watershed method and feeding of the appropriate inputs extracted from the brain CT image to an artificial neural network for classification. The output generated as the type of brain hemorrhages can be used to verify expert diagnosis and also as learning tool for trainee radiologists to minimize errors in current methods.

  20. Herpes Simplex Encephalitis Complicated by Cerebral Hemorrhage during Acyclovir Therapy.

    Science.gov (United States)

    Harada, Yukinori; Hara, Yuuta

    2017-01-01

    Herpes simplex encephalitis (HSE) can be complicated by adverse events in the acute phase. We herein present the case of a 71-year-old woman with HSE complicated by cerebral hemorrhage. She presented with acute deterioration of consciousness and fever and was diagnosed with HSE based on the detection of herpes simplex virus-1 in the cerebrospinal fluid by a polymerase chain reaction. The cerebral hemorrhage developed during acyclovir therapy; however, its diagnosis was delayed for 2 days. After the conservative treatment of the cerebral hemorrhage, the patient made a near-complete recovery. Cerebral hemorrhage should be considered as an acute-phase complication of HSE.

  1. Intranasal Fentanyl Intoxication Leading to Diffuse Alveolar Hemorrhage.

    Science.gov (United States)

    Ruzycki, Shannon; Yarema, Mark; Dunham, Michael; Sadrzadeh, Hossein; Tremblay, Alain

    2016-06-01

    Increasing rates of opioid abuse, particularly fentanyl, may lead to more presentations of unusual effects of opioid toxicity. Diffuse alveolar hemorrhage is a rare complication of fentanyl overdose. A 45-year-old male presented in hypoxic respiratory failure secondary to diffuse alveolar hemorrhage requiring intubation. Comprehensive drug screening detected fentanyl without exposure to cocaine. Further history upon the patient's recovery revealed exposure to snorted fentanyl powder immediately prior to presentation. Diffuse alveolar hemorrhage is a potential, though rare, presentation of opioid intoxication. Recognition of less common complications of opioid abuse such as diffuse alveolar hemorrhage is important in proper management of overdoses.

  2. Effects of sternal intraosseous and intravenous administration of Hextend on time of administration and hemodynamics in a swine model of hemorrhagic shock.

    Science.gov (United States)

    Johnson, Don; Penaranda, Christian; Phillips, Kent; Rice, Daniel; Vanderhoek, Lauren; Gegel, Brian; Burgert, James; Blanco, Jose

    2015-01-01

    Disasters may cause traumatic injuries leading to hemorrhage. Hemorrhage is the leading cause of death for military and civilian trauma casualties. The US Army's Tactical Combat Casualty Care guidelines recommend administering a 500 mL Hextend bolus via the intravenous (IV) or intraosseous (IO) routes for patients in hypovolemic shock. The purposes of this study were to compare administration time of Hextend and the effects on hemodynamics when Hextend is administered by the sternal IO (SIO) and IV routes in a swine model of hemorrhagic shock. This was a prospective, experimental study with random assignment. The study was implemented at an animal vivarium. Yorkshire-cross (N=21) swine were used. Each swine was hemorrhaged 30 percent of their total blood volume to simulate a class II hemorrhage; 500 mL of Hextend was administered by the SIO and IV routes after hemorrhage. The control group did not receive any resuscitative fluids. The predetermined variables of the study were time of administration and hemodynamics over 8 minutes. Hemodynamic data were collected every 2 minutes until administration was complete. There were no significant differences in the time to administer Hextend between the SIO (616±166 seconds) and the IV groups (534±151 seconds) (p=0.37). There were no significant differences between the SIO and IV groups relative to hemodynamics (p>0.05), but both were significantly different than the control group (p<0.05). The SIO route is an effective method of administering Hextend.

  3. Carbetocin versus oxytocin for prevention of postpartum hemorrhage in patients with severe preeclampsia: a double-blind randomized controlled trial.

    Science.gov (United States)

    Reyes, Osvaldo A; Gonzalez, Geneva M

    2011-11-01

    In patients with severe preeclampsia there is an increased risk of postpartum hemorrhage, but the hemodynamic changes associated with severe preeclampsia make the management of any kind of bleeding particularly troublesome. There are many pharmacological options for the management of postpartum hemorrhage, oxytocin being the first line of treatment. There is as yet no evidence about the safety and efficacy of using carbetocin, an oxytocin agonist, in these patients. We aimed to compare oxytocin with carbetocin for the routine prevention of postpartum hemorrhage in patients with severe preeclampsia. We performed a prospective double-blind randomized controlled trial in 60 women with severe preeclampsia, recruited between July and September 2010. The women were randomized to receive either oxytocin or carbetocin during the third stage of labour. The primary outcome measure was postpartum hemorrhage requiring additional uterotonics, and the secondary outcome measures were the difference in hemoglobin levels between groups, the development of oliguria, and hemodynamic status (mean arterial pressure and heart rate) after administration of the drug. Carbetocin was as effective as oxytocin in the prevention of postpartum hemorrhage in women with severe preeclampsia. Carbetocin had a safety profile similar to that of oxytocin, and it was not associated with the development of oliguria or hypertension in this cohort. Carbetocin is an appropriate alternative to oxytocin for the prevention of postpartum hemorrhage in women with severe preeclampsia. Considering that it appears not to have a major hemodynamic effect in women with severe preeclampsia and that it uses a lower volume per dose than oxytocin, it should be considered a valid option in the management of the third stage of labour in women with hypertensive disorders of pregnancy.

  4. Evacuation of intracerebral hemorrhages by neuroendoscopy with transparent sheath. Experimental study

    Directory of Open Access Journals (Sweden)

    Alvaro Otero-Rodriguez

    2015-03-01

    Full Text Available Objectives: Endoscopic evacuation of intracerebral hemorrhage (ICH has been developed in order to reduce the tissue injury that conventional craniotomy could generate. Experimental studies are important to assess the effectiveness of the technique and its modifications. The objectives of this study are to develop in pig an experimental model of endoscopic evacuation of ICHs, to assess effectiveness of surgical evacuation, and to evaluate a new transparent sheath as complement to the endoscopy. Methods: Autologous blood was infused into the frontal lobe white matter in 16 pigs. In the problem group, endoscopic evacuation was performed with the aid of a new transparent sheath, which has outer and inner sheaths with blunt and closed finals. Pigs were sacrificed at 4 h, 24 h and 5 days. The volumes of hematoma and histopathological features were determined. Results: Residual volume of the problem group was significantly 70.09% lower than in control group, without significant differences in injected volumes, in percentage of subarachnoid hemorrhage, and in time interval from hematoma induction to pig´s death. The vital reaction after hemorrhage was similar in both groups. Conclusions: The experimental model developed is useful to assess endoscopic evacuation of ICHs. The endoscopy is an effective technique in the treatment of ICHs, without increasing the vital reaction secondary to hematoma. The new transparent sheath increases the visualization of surgical field and allows a continuous visual control since the beginning of the procedure. Its closed final prevents unwanted injury of the brain by the instruments used to remove the hematoma.

  5. Management of intracranial hemorrhage in adult patients on extracorporeal membrane oxygenation (ECMO): An observational cohort study.

    Science.gov (United States)

    Fletcher-Sandersjöö, Alexander; Thelin, Eric Peter; Bartek, Jiri; Elmi-Terander, Adrian; Broman, Mikael; Bellander, Bo-Michael

    2017-01-01

    Intracranial hemorrhage (ICH) is a common complication in adults treated with extracorporeal membrane oxygenation (ECMO). The aim of this study was to identify predictors of outcome and investigate intervention strategies following ICH development in ECMO-treated adult patients. We conducted a retrospective review of adult patients (≥18 years) who developed an ICH during ECMO treatment at the Karolinska University Hospital (Stockholm, Sweden) between September 2005 and May 2017. Outcome was assessed by 30-day mortality and Glasgow Outcome Scale (GOS) after 6 months. The statistical analysis was supplemented by a case series of patients who were surgically treated for an ICH. Sixty-five patients developed an ICH during ECMO treatment. 30-day mortality was 74% (n = 48), and was significantly associated with low level of consciousness at ICH diagnosis (p = 0.036), presence of intraparenchymal hematoma (IPH) (p = 0.049), IPH volume (p = 0.002), presence of intraventricular hemorrhage (p = 0.001), subarachnoid hemorrhage Fisher grade (pECMO patients is associated with a high mortality rate. Outcome predictors can help to identify patients where ICH treatment is indicated. Treating a patient with an ICH during ECMO represents an intricate balance between pro- and anticoagulatory demands. Furthermore, surgical treatment is associated with several risks but may be indicated in life-threatening lesions. Prospective studies are warranted.

  6. Tegmental-type primary pontine hemorrhage with mesencephalic extension. Clinico-CT-anatomic correlations

    Energy Technology Data Exchange (ETDEWEB)

    Goto, Noboru; Ishikawa, Hiroshi; Kaneko, Mitsuo; Tanaka, Keisei

    1983-06-01

    In nine autopsy cases of tegmental-type primary pontine hemorrhage, two cases with a mesencephalic extension which was not accurately diagnosed symptomatologically, but which was clearly detected on CT films, were found. Correlative clinico-CT-anatomic reports on this kind of pontine hemorrhage have not been included in the literature. The two patients were both females, 73 and 53 years old. Both were hypertensive and under medical care. They showed disturbances of consciousness and respiration, pin-point pupils, fixed eyes in the midposition, right hemiplegia, right extensor plantar response, etc., but both responded well to painful stimuli on the left half of the body. CT examinations detected a continuous high-density area in the left-sided tegmentum of the pons and midbrain. They died 9 and 21 days later respectively. With the help of an electronic image analyser, a great volume of hematoma was measured in the postmortem brainstem in these cases (17 ml and 14 ml). Precise analyses of the correlations among clinical symptomatology, CT, and anatomical findings, and histological examinations were carried out in an attempt to find the pathogenesis of this disease. In the diagnosis of tegmental-type primary pontine hemorrhage, attention should be paid to a possible mesencephalic involvement as one of the modes of hematoma extension, although it may be rather rare.

  7. Morphometric evaluation of murine pulmonary mast cells in experimental hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    I Kasacka

    2009-06-01

    Full Text Available Respiratory failure resulting frequently in death is one of the complications in the course of post-hemorrhagic changes. A systemic inflammatory reaction plays a significant role in the pathogenesis of this syndrome. Mast cells also contribute to this effect. To broaden our knowledge of the pathogenesis of respiratory insufficiency, we evaluated morphometrically lung mast cells in hemorrhagically shocked rats. Lung sections were stained with alcian blue and safranin, and four separate locations were distinguished: under the lung pleura, around the bronchi and the large vessels, and in the interalveolar septa. A decrease in the area and volume of mast cells and an increase in their circularity index in interalveolar septa and around the bronchi was observed. An enlargement of mast cells around lung vessels was also found. There were no changes in the morphometric parameters of mast cells under pleura. The results suggest an activation and degranulation of mast cells and a role in the inflammatory process causing acute lung injury in hemorrhagic shock.

  8. Effect of neutrophil depletion on gelatinase expression, edema formation and hemorrhagic transformation after focal ischemic stroke

    Directory of Open Access Journals (Sweden)

    Machado Livia S

    2005-08-01

    Full Text Available Abstract Background While gelatinase (MMP-2 and -9 activity is increased after focal ischemia/reperfusion injury in the brain, the relative contribution of neutrophils to the MMP activity and to the development of hemorrhagic transformation remains unknown. Results Anti-PMN treatment caused successful depletion of neutrophils in treated animals. There was no difference in either infarct volume or hemorrhage between control and PMN depleted animals. While there were significant increases in gelatinase (MMP-2 and MMP-9 expression and activity and edema formation associated with ischemia, neutrophil depletion failed to cause any change. Conclusion The main finding of this study is that, in the absence of circulating neutrophils, MMP-2 and MMP-9 expression and activity are still up-regulated following focal cerebral ischemia. Additionally, neutrophil depletion had no influence on indicators of ischemic brain damage including edema, hemorrhage, and infarct size. These findings indicate that, at least acutely, neutrophils are not a significant contributor of gelatinase activity associated with acute neurovascular damage after stroke.

  9. Evaluation of hemodynamic effects of xenon in dogs undergoing hemorrhagic shock.

    Science.gov (United States)

    Franceschi, Ruben C; Malbouisson, Luiz; Yoshinaga, Eduardo; Auler, Jose Otavio Costa; Figueiredo, Luiz Francisco Poli de; Carmona, Maria Jose C

    2013-01-01

    The anesthetic gas xenon is reported to preserve hemodynamic stability during general anesthesia. However, the effects of the gas during shock are unclear. The objective of this study was to evaluate the effect of Xe on hemodynamic stability and tissue perfusion in a canine model of hemorrhagic shock. Twenty-six dogs, mechanically ventilated with a fraction of inspired oxygen of 21% and anesthetized with etomidate and vecuronium, were randomized into Xenon (Xe; n = 13) or Control (C; n = 13) groups. Following hemodynamic monitoring, a pressure-driven shock was induced to reach an arterial pressure of 40 mmHg. Hemodynamic data and blood samples were collected prior to bleeding, immediately after bleeding and 5, 20 and 40 minutes following shock. The Xe group was treated with 79% Xe diluted in ambient air, inhaled for 20 minutes after shock. The mean bleeding volume was 44 mL.kg-1 in the C group and 40 mL.kg-1 in the Xe group. Hemorrhage promoted a decrease in both the cardiac index (pInhalation of xenon did not cause further worsening of hemodynamics or tissue perfusion markers. Xenon did not alter hemodynamic stability or tissue perfusion in an experimentally controlled hemorrhagic shock model. However, further studies are necessary to validate this drug in other contexts.

  10. Evaluation of hemodynamic effects of xenon in dogs undergoing hemorrhagic shock

    Science.gov (United States)

    Franceschi, Ruben C.; Malbouisson, Luiz; Yoshinaga, Eduardo; Auler, José Otavio Costa; de Figueiredo (in memoriam), Luiz Francisco Poli; Carmona, Maria José C.

    2013-01-01

    OBJECTIVES: The anesthetic gas xenon is reported to preserve hemodynamic stability during general anesthesia. However, the effects of the gas during shock are unclear. The objective of this study was to evaluate the effect of Xe on hemodynamic stability and tissue perfusion in a canine model of hemorrhagic shock. METHOD: Twenty-six dogs, mechanically ventilated with a fraction of inspired oxygen of 21% and anesthetized with etomidate and vecuronium, were randomized into Xenon (Xe; n = 13) or Control (C; n = 13) groups. Following hemodynamic monitoring, a pressure-driven shock was induced to reach an arterial pressure of 40 mmHg. Hemodynamic data and blood samples were collected prior to bleeding, immediately after bleeding and 5, 20 and 40 minutes following shock. The Xe group was treated with 79% Xe diluted in ambient air, inhaled for 20 minutes after shock. RESULT: The mean bleeding volume was 44 mL.kg−1 in the C group and 40 mL.kg−1 in the Xe group. Hemorrhage promoted a decrease in both the cardiac index (pxenon did not cause further worsening of hemodynamics or tissue perfusion markers. CONCLUSIONS: Xenon did not alter hemodynamic stability or tissue perfusion in an experimentally controlled hemorrhagic shock model. However, further studies are necessary to validate this drug in other contexts. PMID:23525321

  11. Predictive Factors for Rebleeding After Aneurysmal Subarachnoid Hemorrhage : Rebleeding Aneurysmal Subarachnoid Hemorrhage Study

    NARCIS (Netherlands)

    van Donkelaar, Carlina; Bakker, Nicolaas A.; Veeger, Nic J. G. M.; Uyttenboogaart, Maarten; Metzemaekers, Jan D. M.; Luijckx, Gert-Jan; Groen, Rob J. M.; van Dijk, J. Marc C.

    Background and Purpose-Aneurysmal subarachnoid hemorrhage (aSAH) is a devastating type of stroke associated with high morbidity and mortality. One of the most feared complications is an early rebleeding before aneurysm repair. Predictors for such an often fatal rebleeding are largely unknown. We

  12. Influences on central hemodynamics in hemorrhage of beta 2-adrenergic vascular control mechanisms.

    Science.gov (United States)

    Gustafsson, D; Hillman, J; Lundvall, J

    1982-10-01

    Central hemodynamic responses evoked by standardized hemorrhage (exsanguination of 20 ml x kg bwt-1) were followed during 2 h in cats with intact and blocked vascular beta 2-adrenoceptors using the 'selective' beta 2-blocker, ICI 118, 551. In the first 10 min after bleeding blood pressure and cardiac output (CO) decreased and total peripheral resistance (TPR) increased by the same amount in the 'intact' and beta 2-blocked animals. Whereas blood pressure later on reached approximately the same hypotension level in both groups, other hemodynamic variables were distinctly different. In the 'intact' animals there was a gradual, partial recovery of stroke volume (SV) and CO in the face of a restoration to control of TPR. In the beta 2-blocked animals TPR continued to increase in the face of a maintained low CO and declining SV. The lower SV in the latter group was ascribed to abolition of beta 2-adrenergic restoration of plasma volume via absorption of tissue fluid into the circulation. The gradual decline of TPR in the 'intact' animals was attributed to beta 2-adrenergic dilator interaction with constrictor influences on the resistance vessels. It is concluded that beta-adrenergic vascular control mechanisms help to improve nutritional tissue blood flow during hemorrhage by increasing plasma volume, and hence venous return and CO, and by decreasing TPR. These reflex, beta 2-adrenergic circulatory events are similar to those aimed at in current shock therapy by transfusion and vasodilator treatment.

  13. Plasma 8-iso-Prostaglandin F2α concentrations and outcomes after acute intracerebral hemorrhage.

    Science.gov (United States)

    Du, Quan; Yu, Wen-Hua; Dong, Xiao-Qiao; Yang, Ding-Bo; Shen, Yong-Feng; Wang, Hao; Jiang, Li; Du, Yuan-Feng; Zhang, Zu-Yong; Zhu, Qiang; Che, Zhi-Hao; Liu, Qun-Jie

    2014-11-01

    Higher plasma 8-iso-Prostaglandin F2α concentrations have been associated with poor outcome of severe traumatic brain injury. We further investigated the relationships between plasma 8-iso-Prostaglandin F2α concentrations and clinical outcomes in patients with acute intracerebral hemorrhage. Plasma 8-iso-Prostaglandin F2α concentrations of 128 consecutive patients and 128 sex- and gender-matched healthy subjects were measured by enzyme-linked immunosorbent assay. We assessed their relationships with disease severity and clinical outcomes including 1-week mortality, 6-month mortality and unfavorable outcome (modified Rankin Scale score>2). Plasma 8-iso-Prostaglandin F2α concentrations were substantially higher in patients than in healthy controls. Plasma 8-iso-Prostaglandin F2α concentrations were positively associated with National Institutes of Health Stroke Scale (NIHSS) scores and hematoma volume using a multivariate linear regression. It emerged as an independent predictor for clinical outcomes of patients using a forward stepwise logistic regression. ROC curves identified the predictive values of plasma 8-iso-Prostaglandin F2α concentrations, and found its predictive value was similar to NIHSS scores and hematoma volumes. However, it just numerically added the predictive values of NIHSS score and hematoma volume. Increased plasma 8-iso-Prostaglandin F2α concentrations are associated with disease severity and clinical outcome after acute intracerebral hemorrhage. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Hemorrhagic cytitis after bone marrow transplantation.

    Science.gov (United States)

    Padilla-Fernandez, Barbara; Bastida-Bermejo, J M; Virseda-Rodriguez, A J; Labrador-Gomez, J; Caballero-Barrigon, D; Silva-Abuin, J M; San Miguel-Izquierdo, J F; Lorenzo-Gomez, M F

    2014-03-01

    Hemorrhagic cystitis (HC) presenting with gross hematuria, bladder pain and urinary frequency develops in 13-38% of patients following bone marrow transplantation (BMT). The objective of the study was to study the characteristics of patients suffering hemorrhagic cystitis after hematopoietic stem cell transplantation in our center. We conducted a retrospective chart review of all patients who underwent BMT at our institution between January 1996 and August 2012. We recorded the age, sex, diagnosis, conditioning regimen, interval between BMT and development of symptoms of cystitis and treatment instituted. Five hundred patients underwent BMT in the period of time studied. 52 of them developed hemorrhagic cystitis. The mean age of the affected patients was 39 years; there were 34 males and 18 females. The diagnoses include AML (n=11), ALL (n=8), CML (n=6), MDS (n=11), CLL (n=5), NHL (n=1), HD (n=5), MM (n=2), Medular aplasia((n=3). HC appeared 59.48 days after BMT. There were no differences between sexes. Mortality among the 52 patients was 51.14% but HC was not the cause of death in any patient. Polyomaviruses were detected in the urine of 78.94 % of survivors. Polyomavirus infection with BK and JC types is usually acquired in infancy and the virus remains latent in renal tissue. Immunosuppression facilitates reactivation of the renal infection and replication of the virus responsible for the clinical manifestations of HC. The differential diagnoses include other urinary infections, lithiasis, thrombocytopenia and adverse effects of pharmacological agents. The urologist plays a limited role in the management of this disease.

  15. Heart Rate Variability during Simulated Hemorrhage with Lower Body Negative Pressure in High and Low Tolerant Subjects

    Science.gov (United States)

    2011-11-01

    rate, respiration rate, and pulse character do not consistently change until hemorrhage has progressed to the point of decompensation (i.e., hemodynamic...Absolute Aliens, Turku, Finland). Beat-to-beat stroke volume was derived from the arterial pressure waveform using the pulse contour method (Jansen et...notion that the magni- tude of tachycardia reflects the degree of hypovolemia. However, the reliability of tachycardia in response to hypovolemia has

  16. Intraventricular Hemorrhage in Moderate to Severe Congenital Heart Disease.

    Science.gov (United States)

    Ortinau, Cynthia M; Anadkat, Jagruti S; Smyser, Christopher D; Eghtesady, Pirooz

    2018-01-01

    Determine the prevalence of intraventricular hemorrhage in infants with moderate to severe congenital heart disease, investigate the impact of gestational age, cardiac diagnosis, and cardiac intervention on intraventricular hemorrhage, and compare intraventricular hemorrhage rates in preterm infants with and without congenital heart disease. A single-center retrospective review. A tertiary care children's hospital. All infants admitted to St. Louis Children's Hospital from 2007 to 2012 with moderate to severe congenital heart disease requiring cardiac intervention in the first 90 days of life and all preterm infants without congenital heart disease or congenital anomalies/known genetic diagnoses admitted during the same time period. None. Cranial ultrasound data were reviewed for presence/severity of intraventricular hemorrhage. Head CT and brain MRI data were also reviewed in the congenital heart disease infants. Univariate analyses were undertaken to determine associations with intraventricular hemorrhage, and a final multivariate logistic regression model was performed. There were 339 infants with congenital heart disease who met inclusion criteria and 25.4% were born preterm. Intraventricular hemorrhage was identified on cranial ultrasound in 13.3% of infants, with the majority of intraventricular hemorrhage being low-grade (grade I/II). The incidence increased as gestational age decreased such that intraventricular hemorrhage was present in 8.7% of term infants, 19.2% of late preterm infants, 26.3% of moderately preterm infants, and 53.3% of very preterm infants. There was no difference in intraventricular hemorrhage rates between cardiac diagnoses. Additionally, the rate of intraventricular hemorrhage did not increase after cardiac intervention, with only three infants demonstrating new/worsening high-grade (grade III/IV) intraventricular hemorrhage after surgery. In a multivariate model, only gestational age at birth and African-American race were predictors

  17. Fatal pulmonary hemorrhage after taking anticoagulation medication

    Directory of Open Access Journals (Sweden)

    Samuel P. Hammar

    2015-01-01

    Full Text Available We describe a 64-year-old man with extensive diffuse acute lung hemorrhage, presumably as a result of anticoagulation therapy. We evaluated reports in the literature concerning acute exacerbation (acute lung injury of unknown cause in UIP and other forms of fibrotic interstitial pneumonias. We also evaluated autopsy tissue in this case in order to determine the cause of death in this 64-year-old man, who was initially thought to have an asbestos-related disease. Based on the autopsy findings, this man died as a result of anticoagulation therapy; specifically, the use of Xarelto® (rivaroxaban.

  18. Massive intracerebral hemorrhage associated with Wegener granulomatosis.

    Science.gov (United States)

    Ceri, Mevlut; Ortabozkoyun, Levent; Unverdi, Selman; Kirac, Mustafa; Duranay, Murat

    2012-06-01

    Wegener granulomatosis (WG) is a necrotizing granulomatous vasculitis that predominantly affects airways and kidneys. But central nervous system involvement (7-11%) is an uncommon. Massive ICH may occur in the course of WG, and this serious condition is related with high risk of mortality. Therefore, the new treatment strategies may be considered in addition to classical practices in serious organ involvement and recurrent attack. Here, we present an adult patient with WG whose disease was complicated by a massive intracerebral hemorrhage (ICH), which subsequently led to death.

  19. CT of extracranial hemorrhage and hematomas

    Energy Technology Data Exchange (ETDEWEB)

    Swensen, S.J.; McLeod, R.A.; Stephens, D.H.

    1984-10-01

    Computed tomography was used to examine 100 patients with extracranial hemorrhage. Of these patients, 29 had serial scans that allowed for the study of evolutionary changes. Operation, anticoagulation, and trauma were the prime etiological factors. The most frequent sites included the retroperitoneum (27%), body wall or extremities (24%), peritoneal cavity (19%), and subcapsular (16%) and intraparenchymal (7%) locations. The computed tomographic features were carefully studied and documented. Age-related features included contrast-material extravasation, inhomogeneity, hematocrit effect, attenuation changes, lucent halo, pseudocapsule development, decreased size with time, peripheral calcification, and fascial plane thickening. This report discussed all these findings and their usefulness in diagnosis and patient care.

  20. Arachnoid granulation affected by subarachnoid hemorrhage

    Directory of Open Access Journals (Sweden)

    R.P. Chopard

    1993-11-01

    Full Text Available The purpose of this study was to investigate using light microscopy the fibro-cellular components of arachnoid granulations affected by mild and severe subarachnoid hemorrage. The erythrocytes were in the channels delimitated by collagenous and elastic bundles and arachnoid cells, showing their tortuous and intercommunicating row from the pedicle to the fibrous capsule. The core portion of the pedicle and the center represented a principal route to the bulk outflow of cerebrospinal fluid and erythrocytes. In the severe hemorrhage, the fibrocellular components are desorganized, increasing the extracellular channels. We could see arachnoid granulations without erythrocytes, which cells showed big round nucleous suggesting their transformation into phagocytic cells.

  1. Isolated arterioportal fistula presenting with variceal hemorrhage.

    Science.gov (United States)

    Nookala, Anupama; Saberi, Behnam; Ter-Oganesyan, Ramon; Kanel, Gary; Duong, Phillip; Saito, Takeshi

    2013-05-07

    We report a case of life-threatening hematemesis due to portal hypertension caused by an isolated arterioportal fistula (APF). Intrahepatic APFs are extremely rare and are a cause of presinusoidal portal hypertension. Etiologies for APFs are comprised of precipitating trauma, malignancy, and hereditary hemorrhagic telangiectasia, but these were not the case in our patient. Idiopathic APFs are usually due to congenital vascular abnormalities and thus usually present in the pediatric setting. This is one of the first cases of adult-onset isolated APF who presented with portal hypertension and was successfully managed through endoscopic hemostasis and subsequent interventional radiological embolization.

  2. Spontaneous subdural hematoma associated to Duret hemorrhage

    Directory of Open Access Journals (Sweden)

    William Alves Martins, MD

    2015-03-01

    Full Text Available Subdural hematoma (SH is a neurosurgical emergency, usually caused by head trauma. Non-traumatic causes include aneurysm or arterial–venous malformation rupture, coagulopathy and others. We report the case of a 66 year-old man who developed apparently unprovoked signs of increased intracranial pressure. Brain computed tomography scan showed an acute spontaneous SH, surgically treated. Throughout surgery, a ruptured cortical artery with intensive bleeding appeared and was cauterized. After surgery, patient remained comatose and a new CT demonstrated Duret hemorrhage at the brainstem. Acute spontaneous SH of arterial origin is rare and highly lethal, in which a good prognosis relies on early diagnosis and treatment.

  3. Anti-epileptic Drug (AED) Use in Subarachnoid Hemorrhage (SAH) and Intracranial Hemorrhage (ICH).

    Science.gov (United States)

    Feng, Rui; Mascitelli, Justin; Chartrain, Alexander G; Margetis, Konstantinos; Mocco, J

    2017-10-30

    Aneurysmal subarachnoid hemorrhage (aSAH) and spontaneous intracranial hemorrhage (ICH) are frequently associated with epileptic complications. The use of anti-epileptic drugs (AEDs) for seizure prophylaxis, however, is controversial. In patients with aSAH, nonconvulsive status epilepticus has been associated with poor outcome. Effect of other forms of less severe epileptiform activity on clinical outcome remains unclear. Evidence on efficacy of AEDs in reducing seizure incidence is also mixed. However, increasing number of studies suggest that AEDs may have significant adverse effects on outcome, especially with phenytoin. Similarly, in patients with ICH, the impact of seizures that do not progress to status epilepticus on clinical outcome is controversial, and whether prophylactic AED use has independent effects on outcome remains ambiguous. Currently, there are no large scale randomized control trials investigating the efficacy and safety of AED prophylaxis in patients with hemorrhagic stroke. There are also no trials comparing the efficacy and safety of the different AEDs. Survey based studies have found a wide range of prescribing patterns across treatment centers and clinicians for seizure prophylaxis in patients with hemorrhagic stroke. The lack of clear guidelines and recommendations also highlights the paucity of good quality evidence in this area. In conclusion, a well-designed randomized, double blinded, and appropriately powered trial is needed to evaluate the incidence as well as clinical outcomes in patients with aSAH and ICH who received AED prophylaxis versus controls. The results will be extremely valuable in providing evidence to establish management guidelines for patients with hemorrhagic stroke. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. Endothelial progenitor cells as a therapeutic option in intracerebral hemorrhage

    Directory of Open Access Journals (Sweden)

    Juan Pías-Peleteiro

    2017-01-01

    Full Text Available Intracerebral hemorrhage (ICH is the most severe cerebrovascular disease, which represents a leading cause of death and disability in developed countries. However, therapeutic options are limited, so is mandatory to investigate repairing processes after stroke in order to develop new therapeutic strategies able to promote brain repair processes. Therapeutic angiogenesis and vasculogenesis hold promise to improve outcome of ICH patients. In this regard, circulating endothelial progenitor cells (EPCs have recently been suggested to be a marker of vascular risk and endothelial function. Moreover, EPC levels have been associated with good neurological and functional outcome as well as reduced residual hematoma volume in ICH patients. Finally, experimental and clinical studies indicate that EPC might mediate endothelial cell regeneration and neovascularization. Therefore, EPC-based therapy could be an excellent therapeutic option in ICH. In this mini-review, we discuss the present status of knowledge about the possible therapeutic role of EPCs in ICH, molecular mechanisms, and the future perspectives and strategies for their use in clinical practice.

  5. Intraventricular Hemorrhage after Epidural Blood Patching: An Unusual Complication

    Directory of Open Access Journals (Sweden)

    Mohammad Sorour

    2014-01-01

    Full Text Available The authors present two cases of intraventricular hemorrhage (IVH believed to be a result of epidural blood patching. The first was a 71-year-old woman who had new onset of nontraumatic IVH on computed tomography (CT scan after undergoing an epidural blood patch (EBP. This amount of intraventricular blood was deemed an incidental finding since it was of very small volume to account for her overall symptoms. The second patient, a 29-year-old woman, was found to have nontraumatic IVH three days after undergoing an EBP. This was seen on CT scan of the head for workup of pressure-like headaches, nausea, vomiting, and absence seizures. Conservative management was followed in both instances. Serial CT scan of the head in our first patient displayed complete resolution of her IVH. The second patient did not have follow-up CT scans because her overall clinical picture had improved significantly. This highlights a potential sequel of EBP that may be observed on CT scan of the head. In the event that IVH is detected, signs and symptoms of hydrocephalus should be closely monitored with the consideration for a future workup if warranted by the clinical picture.

  6. Pancreatic digestive enzyme blockade in the small intestine prevents insulin resistance in hemorrhagic shock.

    Science.gov (United States)

    DeLano, Frank A; Schmid-Schönbein, Geert W

    2014-01-01

    Hemorrhagic shock is associated with metabolic defects, including hyperglycemia and insulin resistance, but the mechanisms are unknown. We recently demonstrated that reduction of the extracellular domain of the insulin receptor by degrading proteases may lead to a reduced ability to maintain normal plasma glucose values. In shock, transfer of digestive enzymes from the lumen of the intestine into the systemic circulation after breakdown of the intestinal mucosal barrier causes inflammation and organ dysfunction. Suppression of the digestive enzymes in the lumen of the intestine with protease inhibitors is effective in reducing the level of the inflammatory reactions. To determine the degree to which blockade of digestive enzymes affects insulin resistance in shock, rats were exposed to acute hemorrhagic shock (mean arterial pressure of 30 mmHg for 2 h) at which time all shed blood volume was returned. Digestive proteases in the intestine were blocked with a serine protease inhibitor (tranexamic acid in polyethylene glycol and physiological electrolyte solution), and the density of the insulin receptor was measured with immunohistochemistry in the mesentery microcirculation. The untreated rat without enzyme blockade had significantly attenuated levels of insulin receptor density as compared with control and treated rats. Blockade of the digestive proteases after 60 min of hypotension in the lumen of the small intestine led to a lesser decrease in insulin receptor density compared with controls without protease blockade. Glucose tolerance test indicates a significant increase in plasma glucose levels 2 h after hemorrhagic shock, which are reduced to control values in the presence of protease inhibition in the lumen of the intestine. The transient reduction of the plasma glucose levels after an insulin bolus is significantly attenuated after shock but is restored when digestive enzymes in the lumen of the intestine are blocked. These results suggest that in

  7. Development of a Nonhuman Primate (Rhesus Macaque) Model of Uncontrolled Traumatic Liver Hemorrhage.

    Science.gov (United States)

    Sheppard, Forest R; Macko, Antoni; Fryer, Darren M; Ozuna, Kassandra M; Brown, Alexander K; Crossland, Randy F; Tadaki, Douglas K

    2015-08-01

    Hemorrhage is the leading cause of potentially survivable trauma mortality, necessitating the development of improved therapeutic interventions. The objective of this study was to develop and characterize a reproducible clinically translatable nonhuman primate model of uncontrolled severe hemorrhage. Such a model is required to facilitate the development and meaningful evaluation of human-derived therapeutics. In Rhesus macaques, a laparoscopic left-lobe hepatectomy of 25% (n = 2), 50% (n = 4), or 60% (n = 6) was performed at T = 0 min, with no attempt at hemorrhage control until T = 120 min. A constant-rate infusion of normal saline was administered between T = 15 and 120 min to a total volume of 20 mL/kg. At T = 120 min, a laparotomy was performed to gain surgical hemostasis and quantify blood loss. Physiological parameters were recorded, and blood samples were collected at defined intervals until termination of the study at T = 480 min. Statistical analyses used Student t tests, with P < 0.05 considered statistically significant. Results are reported as mean ± SEM. The calculated percent blood loss for the 25% hepatectomy group was negligible (2.3% ± 0.2%), whereas the 50% and 60% hepatectomy groups exhibited 26.6% ± 7.1% and 24.9% ± 3.8% blood loss, respectively. At T = 5 min, blood pressure for the 25%, 50%, and 60% hepatectomy groups was reduced by 13.8%, 60.8%, and 63.2% from the respective baseline values (P < 0.05). In the 60% hepatectomy group, alterations in thromboelastometry parameters and systemic inflammatory markers were observed. The development of a translatable nonhuman primate model of uncontrolled hemorrhage is an ongoing process. This study demonstrates that 60% hepatectomy offers a significant reproducible injury applicable for the evaluation of human-derived therapeutics.

  8. Effects of low ambient temperature on hemodynamics and oxygen dynamics in a porcine hemorrhagic shock model

    Directory of Open Access Journals (Sweden)

    Xue-feng ZHANG

    2013-02-01

    Full Text Available Objective  To investigate the effects of low ambient temperature on hemodynamics and oxygen dynamics in a porcine hemorrhagic shock model. Methods  Thirty-two healthy adult Bama miniature pigs were randomly divided into four groups (8 each: control (group C, shock under room temperature (22℃, group R, shock under low ambient temperature (–10℃, group L and shock under normal body temperature (keep pulmonary arterial temperature ranged from 38.5 to 39.5℃, group N. The hemorrhagic shock model was reproduced by venous bleeding (40% of total blood volume, and the core temperature (pulmonary arterial temperature and rectal temperature, heart rate (HR, mean arterial pressure (MAP, pulmonary arterial pressure (PAP, pulmonary arterial wedge pressure (PAWP, central venous pressure (CVP, cardiac output (CO, hemoglobin (Hb, saturation of mixed venous blood (SvO2 and blood gas analysis were recorded before reproduction of shock and at different time points after hemorrhagic shock. The whole body oxygen delivery index (DO2I, oxygen uptake index (VO2I, and oxygen extraction ratio (O2ER were calculated. Results  Four pigs died in group N during the experiment, meanwhile, no pig died in other groups. The core temperature in group C, R and L decreased significantly compared with group N (P<0.05, and the core temperature in group L was significantly lower than that in groups C and R from 120 minutes after shock. No difference was found in hemodynamics, oxygen dynamics and prognosis between group R and group L. The HR and VO2I in group N were significantly higher than those in group L and group R, while there was no difference in other indices between the 3 groups. Conclusion  The hemodynamics and oxygen dynamics indices don't worsen in hemorrhagic shock pigs under low ambient temperature, possibly resulting from induced hypothermia caused by anesthesia.

  9. A Rare Cause of Acute Upper Gastrointestinal Hemorrhage

    Directory of Open Access Journals (Sweden)

    T.S. de Vries Reilingh

    2009-11-01

    Full Text Available Acute upper gastrointestinal tract hemorrhage represents a frequent morbidity which can be localized and treated endoscopically. When endoscopic treatment alone is failing, radiological or surgical treatment may be warranted. A case history will be presented regarding a rare cause of intestinal hemorrhage with an extraordinary course of illness.

  10. Intravenous tranexamic acid for hyperacute primary intracerebral hemorrhage

    DEFF Research Database (Denmark)

    Sprigg, Nikola; Robson, Katie; Bath, Philip

    2016-01-01

    RATIONALE: Outcome after intracerebral hemorrhage remains poor. Tranexamic acid is easy to administer, readily available, inexpensive, and effective in other hemorrhagic conditions. AIM: This randomized trial aims to test the hypothesis that intravenous tranexamic acid given within 8 h of spontan...

  11. Postpartum hemorrhage is related to the hemoglobin levels at labor ...

    African Journals Online (AJOL)

    Background: Anemia in pregnancy is common and linked to postpartum hemorrhage in terms of uterine atony. The more severe the anemia, the more likely the greater blood loss and adverse outcome. The aim of this study was to examine the association between anemic women at labor and postpartum hemorrhage (PPH) ...

  12. Hemorrhagic fever with renal syndrome and coexisting hantavirus pulmonary syndrome

    Directory of Open Access Journals (Sweden)

    Young Min Hong

    2012-06-01

    Full Text Available Hemorrhagic fever with renal syndrome (HFRS is an acute viral disease with fever, hemorrhage and renal failure caused by hantavirus infection. Hantavirus induces HFRS or hantavirus pulmonary syndrome (HPS. HPS progression to a life-threatening pulmonary disease is found primarily in the USA and very rarely in South Korea. Here, we report a case of HFRS and coexisting HPS.

  13. An unexpected cause of a recurrent cerebral hemorrhage.

    NARCIS (Netherlands)

    Thijs, R.D.; Hazekamp, M.G.; Rijlaarsdam, M.E.; Willems, S.M.; Schutte, P.J.; Laan, L.A.E.M.

    2005-01-01

    A 4-year-old previously healthy boy presented with a non-traumatic right parietal hemorrhage. A second life-threatening left cerebral hemorrhage occurred three weeks later and was decompressed with a craniotomy. Transthoracic echocardiography revealed a hypermobile elongated tumor of the mitral

  14. Massive fetomaternal hemorrhage as a cause of severe fetal anemia

    Directory of Open Access Journals (Sweden)

    Dobrosavljević Aleksandar

    2016-01-01

    Full Text Available Introduction. Fetomaternal hemorrhage (FMH is a transfu-sion of fetal blood into the maternal circulation. A volume of transfused fetal blood required to cause severe, life-threatening fetal anemia, is not clearly defined. Some authors suggest vol-umes of 80 mL and 150 mL as a threshold which defines mas-sive FMH. Therefore, a rate of massive FMH is 1 : 1,000 and 1 : 5,000 births, respectively. Fetal and neonatal anemia is one of the most serious complications of the FMH. Clinical manifesta-tions of FMH are nonspecific, and mostly it presented as re-duced fetal movements and changes in cardiotocography (CTG. The standard for diagnosing FMH is Kleihaurer-Betke test. Case report. A 34-year-old gravida (G 1, para (P 1 was hospitalized due to uterine contractions at 39 weeks of gesta-tion. CTG monitoring revealed sinusoidal fetal heart rate and clinical examination showed complete cervical dilatation. Im-mediately after admission, the women delivered vaginally. Ap-gar scores were 1 and 2 at the first and fifth minute, respec-tively. Immediately baby was intubated and mechanical ventila-tion started. Initial analysis revealed pronounced acidosis and severe anemia. The patient received intravenous fluid therapy with sodium-bicarbonate as well as red cell transfusion. With all measures, the condition of the baby improved with normaliza-tion of hemoglobin level and blood pH. Kleihaurer-Betke test revealed the presence of fetal red cells in maternal circulation, equivalent to 531 mL blood loss. The level of maternal fetal hemoglobin (HbF and elevated alpha fetoprotein also con-firmed the diagnosis of massive FMH. Conclusion. For the successful diagnosis and management of FMH direct commu-nication between the obstetrician and the pediatrician is neces-sary as presented in this report.

  15. [Pulmonary hemorrhage associated with celiac disease].

    Science.gov (United States)

    Testa, María Eugenia; Maffey, Alberto; Colom, Alejandro; Agüero, Luis; Rogé, Ignacio; Andrewartha, María Sol; Teper, Alejandro

    2012-08-01

    Idiopathic pulmonary hemosiderosis is a severe and potentially fatal disease characterized by recurrent episodes of alveolar hemorrhage, hemoptysis, and anemia. His association with celiac disease, described as Lane- Hamilton syndrome, could be due to the fact that both entities share a common pathogenic immune pathway. We report two patients of 13 years who consulted for hemoptysis and severe anemia that had not responded to immunosuppressive treatment with pulses of methyl prednisolone, oral meprednisone and hydroxychloroquine. Although both children highlight the absence of gastrointestinal symptoms at the time of consultation, the dosage of anti-endomysial and anti-transglutaminase antibodies was positive and biopsy confirmed the presence of intestinal enteropathy. It is emphasized that in patients with diffuse alveolar hemorrhage, even in the absence of gastrointestinal symptoms, the concomitant presence of celiac disease should be evaluated. If celiac disease is present, the incorporation of a gluten-free diet helps to control the symptoms, allows reducing the immunosuppressive treatment and improves the clinical course of both entities.

  16. Postpartum hemorrhage: Clinical and radiologic aspects

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Nam Kyung [Department of Radiology, Pusan National University Hospital, Pusan National University School of Medicine and Medical Research Institute, Pusan National University, 1-10, Ami-Dong, Seo-Gu, Busan 602-739 (Korea, Republic of); Kim, Suk [Department of Radiology, Pusan National University Hospital, Pusan National University School of Medicine and Medical Research Institute, Pusan National University, 1-10, Ami-Dong, Seo-Gu, Busan 602-739 (Korea, Republic of)], E-mail: kimsuk@medimail.co.kr; Lee, Jun Woo; Sol, Yu Li; Kim, Chang Won [Department of Radiology, Pusan National University Hospital, Pusan National University School of Medicine and Medical Research Institute, Pusan National University, 1-10, Ami-Dong, Seo-Gu, Busan 602-739 (Korea, Republic of); Hyun Sung, Kim [Department of Surgery, Pusan National University Hospital, Pusan National University School of Medicine and Medical Research Institute, Pusan National University, Busan 602-739 (Korea, Republic of); Jang, Ho Jin; Suh, Dong Soo [Department of Obstetrics and Gynecology, Pusan National University Hospital, Pusan National University School of Medicine and Medical Research Institute, Pusan National University, Busan 602-739 (Korea, Republic of)

    2010-04-15

    Postpartum hemorrhage (PPH) is a potentially life threatening condition, and it remains the leading cause of maternal morbidity. Uterine atony, lower genital tract lacerations, uterine rupture or inversion, retained products of conception and underlying coagulopathy are some of the common causes of PPH. Most conditions can be diagnosed based on clinical and laboratory evaluation supplemented by ultrasound information. Computed tomography (CT) or magnetic resonance (MR) imaging can provide information for the detection, localization and characterization of PPH in some difficult cases. CT can accurately demonstrate the anatomic location of significant arterial hemorrhage as sites of intravenous contrast material extravasation, which can be as a guide for angiographic intervention. The presence of focal or diffuse intravenous contrast extravasation or a hematoma within the enlarged postpartum uterine cavity on CT can help the diagnosis of uterine atony when the clinical diagnosis of uterine atony is unclear. CT can also provide the information of other alternative conditions such as a puerperal genital hematoma, uterine rupture and concealed hematoma in other sites. MR imaging may be considered as a valuable complement to ultrasound where the ultrasound findings are inconclusive in the diagnosis and differential diagnosis of retained products of conception. Knowledge of the various radiologic appearances of PPH and the correlation with clinical information can ensure correct diagnosis and appropriate and prompt treatment planning in the patients with PPH.

  17. [Molecular epidemiology of Xinjiang hemorrhagic fever viruses].

    Science.gov (United States)

    Tang, Qing; Zhao, Xiu-qin; Wang, Huan-yu; Simayi, Bawudong; Zhang, Yu-zhen; Saijo, Masayuki; Morikawa, Shigeru; Liang, Guo-dong; Kurane, Ichiro

    2005-12-01

    To study the molecular biology of Xinjiang hemorrhagic fever (XHF) viruses, to explore its relationship with other Crimean-Congo hemorrhagic fever viruses, analyzing the epidemic origin and the tendency of geographic distribution of XHF. The S partial segment from the patient and tick samples collected in 2001 and 2002 was tested by RT-PCR, the positive samples were sequenced directly. The nucleotide homology of S partial segment as well as the whole segments were analyzed and the phylogenetic tree of S and M gene segments was drawn by computer. All compared sequences of S partial segments from the patient and tick samples showed a high homology of nucleotide sequences. Phylogenetic tree divided all the analyzed viruses into three groups; Europe, African and Asian group. The Asian group can be divided further into another two branches: the middle Asian branch and the Chinese branch. All the Chinese isolates were clustered into one single group and was easy to be discriminated from the other isolates. The dividing of M segments seemed not completely related to the geographic origin of the viruses. M segment classification was not consistent to the geographic distribution of the viruses. S segments analysis showed the close relationship of genetic background between the patient isolates and the tick isolates. Besides, all the Chinese isolates have the common evolution route and the gene structure characteristics displayed the regional distribution pattern.

  18. Subarachnoid hemorrhage due to retained lumbar drain.

    Science.gov (United States)

    Guppy, Kern H; Silverthorn, James W; Akins, Paul T

    2011-12-01

    Intrathecal spinal catheters (lumbar drains) are indicated for several medical and surgical conditions. In neurosurgical procedures, they are used to reduce intracranial and intrathecal pressures by diverting CSF. They have also been placed for therapeutic access to administer drugs, and more recently, vascular surgeons have used them to improve spinal cord perfusion during the treatment of thoracic aortic aneurysms. Insertion of these lumbar drains is not without attendant complications. One complication is the shearing of the distal end of the catheter with a resultant retained fragment. The authors report the case of a 65-year-old man who presented with a subarachnoid hemorrhage due to the migration of a retained lumbar drain that sheared off during its removal. To the best of the authors' knowledge, this is the first case of rostral migration of a retained intrathecal catheter causing subarachnoid hemorrhage. The authors review the literature on retained intrathecal spinal catheters, and their findings support either early removal of easily accessible catheters or close monitoring with serial imaging.

  19. Remote cerebellar hemorrhage after cervical spinal surgery

    Directory of Open Access Journals (Sweden)

    Po-Hsien Huang

    2013-10-01

    Full Text Available Remote cerebellar hemorrhage (RCH is an unpredictable and rare complication of spinal surgery. We report five cases of RCH following cervical spinal surgery, and summarize another seven similar cases from the literature. Dural opening with cerebrospinal fluid (CSF hypovolemia seems to be an important factor contributing to RCH following cervical spinal surgery. As other authors have proposed, surgical positioning may be another factor contributing to RCH. RCH is thought to be hemorrhagic venous infarction, resulting from the stretching occlusion of the superior cerebellar vein by the cerebellar sag effect. Either intraoperative CSF loss or a postoperative CSF leak from drainage may cause cerebellar sag, further resulting in RCH. RCH is usually self-limiting, and most patients with RCH have an optimal outcome after conservative treatment. Severe cases that involved surgical intervention because of evidence of brainstem compression or hydrocephalus also had acceptable outcomes, compared to spontaneous CH. It has been suggested that one way to prevent RCH is to avoid extensive perioperative loss of CSF, by paying attention to surgical positioning during spinal surgery. We also underline the importance of early diagnosis and CSF expansion in the early treatment of RCH.

  20. Current management of massive hemorrhage in trauma

    Directory of Open Access Journals (Sweden)

    Johansson Pär I

    2012-07-01

    Full Text Available Abstract Hemorrhage remains a major cause of potentially preventable deaths. Trauma and massive transfusion are associated with coagulopathy secondary to tissue injury, hypoperfusion, dilution, and consumption of clotting factors and platelets. Concepts of damage control surgery have evolved prioritizing early control of the cause of bleeding by non-definitive means, while hemostatic control resuscitation seeks early control of coagulopathy. Hemostatic resuscitation provides transfusions with plasma and platelets in addition to red blood cells in an immediate and sustained manner as part of the transfusion protocol for massively bleeding patients. Although early and effective reversal of coagulopathy is documented, the most effective means of preventing coagulopathy of massive transfusion remains debated and randomized controlled studies are lacking. Viscoelastical whole blood assays, like TEG and ROTEM however appear advantageous for identifying coagulopathy in patients with severe hemorrhage as opposed the conventional coagulation assays. In our view, patients with uncontrolled bleeding, regardless of it´s cause, should be treated with hemostatic control resuscitation involving early administration of plasma and platelets and earliest possible goal-directed, based on the results of TEG/ROTEM analysis. The aim of the goal-directed therapy should be to maintain a normal hemostatic competence until surgical hemostasis is achieved, as this appears to be associated with reduced mortality.

  1. Microangiography of the pancreas in experimental hemorrhagic pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Nuutinen, P.; Lempinen, M.; Schroeder, T.; Kivisaari, L.; Standertskjoeld-Nordenstam, C.G.

    1986-08-01

    In experimental hemorrhagic pancreatitis induced with sodium-taurocholate-trypsin, contrast enhancement of the pancreas in computed tomography (CT) has been shown to be decreased in spite of normal pancreatic blood flow. The contrast enhancement in CT depends on blood flow to the organ, capillary permeability and the amount of extracellular fluid in the organ. For further evaluation of the role of microcirculatory changes in our model of hemorrhagic pancreatitis, microangiography was performed in five normal piglets and in ten piglets with acute hemorrhagic pancreatitis. In this experimental model histological studies showed focal necroses, hemorrhages and leucocyte accumulation. In the affected areas microangiography revealed unfilled capillaries and extravasation of contrast medium. Arteries and arterioles were well filled, as in the normal control animals. These severe disturbances in the capillary circulation of the pancreas may explain the decreased contrast enhancement of the pancreas in CT during acute hemorrhagic pancreatitis.

  2. Hemorrhagic hemangioma in the liver: A case report

    Science.gov (United States)

    Kim, Jeong Min; Chung, Woo Jin; Jang, Byoung Kuk; Hwang, Jae Seok; Kim, Yong Hoon; Kwon, Jung Hyeok; Choi, Mi Sun

    2015-01-01

    Hemangioma is the most common type of benign tumor that arises in the liver. Although rupture and hemorrhage of hepatic hemangioma are rare complications, they can be the cause of mortality. The authors report a case of hemorrhagic hepatic hemangioma: in a 54-year-old woman who was admitted with epigastric pain. She had taken oral contraceptives several weeks prior. The results of a blood examination were normal. An abdominal computed tomography scan revealed a tumor in hepatic segment 4, and a hemorrhage inside the cystic mass was suspected. The mass was removed laparoscopically to confirm the tumor properties and control the hemorrhage. The pathologic findings of the resected mass were consistent with hepatic hemangioma with intratumoral hemorrhage. The patient was discharged 8 d after the surgery, without further complications or complaints, and the patient’s condition was found to have improved during follow-up. PMID:26109822

  3. POST-NOAC: Portuguese observational study of intracranial hemorrhage on non-vitamin K antagonist oral anticoagulants.

    Science.gov (United States)

    Marques-Matos, Cláudia; Alves, José Nuno; Marto, João Pedro; Ribeiro, Joana Afonso; Monteiro, Ana; Araújo, José; Silva, Fernando; Grenho, Fátima; Viana-Baptista, Miguel; Sargento-Freitas, João; Pinho, João; Azevedo, Elsa

    2017-08-01

    Background There is a lower reported incidence of intracranial hemorrhage with non-vitamin K antagonist oral anticoagulants compared with vitamin K antagonist. However, the functional outcome and mortality of intracranial hemorrhage patients were not assessed. Aims To compare the outcome of vitamin K antagonists- and non-vitamin K antagonist oral anticoagulants-related intracranial hemorrhage. Methods We included consecutive patients with acute non-traumatic intracranial hemorrhage on oral anticoagulation therapy admitted between January 2013 and June 2015 at four university hospitals. Clinical and demographic data were obtained from individual medical records. Intracranial hemorrhage was classified as intracerebral, extra-axial, or multifocal using brain computed tomography. Three-month functional outcome was assessed using the modified Rankin Scale. Results Among 246 patients included, 24 (9.8%) were anticoagulated with a non-vitamin K antagonist oral anticoagulants and 222 (90.2%) with a vitamin K antagonists. Non-vitamin K antagonist oral anticoagulants patients were older (81.5 vs. 76 years, p = 0.048) and had intracerebral hemorrhage more often (83.3% vs. 63.1%, p = 0.048). We detected a non-significant trend for larger intracerebral hemorrhage volumes in vitamin K antagonists patients ( p = 0.368). Survival analysis adjusted for age, CHA2DS2VASc, HAS-BLED, and anticoagulation reversal revealed that non-vitamin K antagonist oral anticoagulants did not influence three-month mortality (hazard ratio (HR) = 0.83, 95% confidence interval (CI) = 0.39-1.80, p = 0.638). Multivariable ordinal regression for three-month functional outcome did not show a significant shift of modified Rankin Scale scores in non-vitamin K antagonist oral anticoagulants patients (odds ratio (OR) 1.26, 95%CI 0.55-2.87, p = 0.585). Conclusions We detected no significant differences in the three-month outcome between non-vitamin K antagonist oral anticoagulants- and

  4. Glutamate Metabolism in Brain Structures in Experimental Hemorrhagic Shock

    Directory of Open Access Journals (Sweden)

    V. N. Jakovlev

    2017-01-01

    Full Text Available Purpose. To study glutamate metabolism characteristics in phylogenetically different parts of the mammalian brain in experimentally induced hemorrhagic shock (HS in cats.Material and methods. Experiments were performed on 76 cats. HS was induced by intermittent bloodletting from femoral artery at a rate of 10ml/kg•10 minutes, with the average volume of 24±0.8 ml/kg. The bloodletting was discontinued after arterial pressure (BP drop to 60.0±1.5 mmHg. We studied ammonia, glutamate (Gt, and α-ketoglutarate (α-KG levels and glutaminase (GS and glutamate dehydrogenase (GDG activity in specimens harvested from phylogenetically different parts of the brain (cortex, limbic system, diencephalon, and medulla oblongata.Results. In intact animals, the peak GDG activity was found in the medulla oblongata (phylogenetically the oldest part of the brain and the peak GS activity was registered in the sensorimotor cortex (phylogenetically the youngest part of the brain; the glutaminase activity did not depend on the phylogenetic age of brain structures.In the case of HS, Gt metabolism changes began in the sensorimotor cortex manifested by decreased GS activity, which progresses by the 70th minute of the post%hemorrhagic period (PHP accompanied by delayed increase in the GDG and glutaminase activity, as well as Gt accumulation. In the limbic system and diencephalon the Gt metabolism was changing (impaired glutamine synthesis, stimuled Gt synthesis with glutamine desamidization and α%KG amination when developed by the 70th minute of the PHP. Similarly to sensorimotor cortex, changes were associated with Gt accumulation. During the agony, α%KG deficiency developed in all parts of the brain as a result of its increased contribution to Gt synthesis. At the same period of time, in the sensorimotor cortex, limbic system and diencephalon the Gt synthesis from glutamine was stimulated, however, the Gt contribution tothe formation of glutamine was decreased. The

  5. Recurrent vitreous hemorrhage after sutured posterior chamber intraocular lenses.

    Science.gov (United States)

    Fu, Arthur D; McDonald, H Richard; Jumper, J Michael; Aaberg, Thomas M; Smiddy, William E; Robertson, Joseph E; Johnson, Robert N; Ai, Everett

    2004-04-01

    To describe the clinical course and management of patients with late vitreous hemorrhage after scleral suturing of posterior chamber intraocular lenses (PCIOL). The authors reviewed patient demographics, ocular findings, and clinical course of six patients with late (>3 weeks) vitreous hemorrhage after sclera-sutured PCIOL. Intraoperative endoscopy was performed on two patients to better assess the haptic sulcus interaction. Patient age ranged from 39 to 84 years (median 77 years). The interval between scleral suturing of the PCIOL and vitreous hemorrhage ranged from 3 weeks to 68 months (median 5 months). The number of hemorrhages ranged from one to four. The hemorrhage cleared spontaneously in three eyes. Three patients underwent surgery after the hemorrhages including sutured PCIOL removal with concurrent placement of an anterior chamber IOL (ACIOL) (two patients) and resuturing of a PCIOL in a different meridian (one patient). Follow-up ranged from 4 to 36 months, median 19.5 months, starting from the time of the initial postsuturing vitreous hemorrhage. Final vision ranged from 20/20 to hand motions, with four eyes having 20/40 or better vision. Endoscopy revealed a haptic embedded into the pars plicata in one eye but no evidence of neovascularization. Recurrent vitreous hemorrhage may occur as a complication of scleral suturing of PCIOL. The etiology of these hemorrhages does not appear to be related to neovascular proliferation at the haptic suture site, but may be secondary to erosion of the haptic into uveal structures. Not all eyes require reoperation after these hemorrhages; however, good visual results may be achieved by replacing the sutured PCIOL with an ACIOL or by suturing the PCIOL in a different meridian.

  6. Incidence of symptomatic hemorrhage after stereotactic electrode placement.

    Science.gov (United States)

    Sansur, Charles A; Frysinger, Robert C; Pouratian, Nader; Fu, Kai-Ming; Bittl, Markus; Oskouian, Rod J; Laws, Edward R; Elias, W Jeffrey

    2007-11-01

    Intracranial hemorrhage (ICH) is the most significant complication associated with the placement of stereotactic intracerebral electrodes. Previous reports have suggested that hypertension and the use of microelectrode recording (MER) are risk factors for cerebral hemorrhage. The authors evaluated the incidence of symptomatic ICH in a large cohort of patients with various diseases treated with stereotactic electrode placement. They examined the effect of comorbidities on the risk of ICH and independently assessed the risks associated with age, sex, use of MER, diagnosis, target location, hypertension, and previous use of anticoagulant medications. The authors also evaluated the effect of hemorrhage on length of hospital stay and discharge disposition. Between 1991 and 2005, 567 electrodes were placed by two neurosurgeons during 337 procedures in 259 patients. Deep brain stimulation (DBS) was performed in 167 procedures, radiofrequency lesioning (RFL) of subcortical structures in 74, and depth electrodes were used in 96 procedures in patients with epilepsy. Electrodes were grouped according to target, patient diagnosis, use of MER, patient history of hypertension, and patient prior use of anticoagulant medication (stopped 10 days before surgery). The Charlson Comorbidity Index (CCI) was used to evaluate the effect of comorbidities. The CCI score, patient age, length of hospital stay, and discharge status were continuous variables. Symptomatic hemorrhages were grouped as transient or leading to permanent neurological deficits. The risk of hemorrhage leading to permanent neurological deficits in this study was 0.7%, and the risk of symptomatic hemorrhage was 1.2%. A patient history of hypertension was the most significant factor associated with hemorrhage (p = 0.007). Older age, male sex, and a diagnosis of Parkinson disease (PD) were also significantly associated with hemorrhage (p = 0.01, 0.04, 0.007, respectively). High CCI scores, specific target locations, and

  7. Impact of Plasma-Lyte pH 7.4 on acid-base status and hemodynamics in a model of controlled hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Danilo Teixeira Noritomi

    2011-01-01

    Full Text Available OBJECTIVE: Intravenous infusion of crystalloid solutions is a cornerstone of the treatment of hemorrhagic shock. However, crystalloid solutions can have variable metabolic acid-base effects, perpetuating or even aggravating shock-induced metabolic acidosis. The aim of this study was to compare, in a controlled volume-driven porcine model of hemorrhagic shock, the effects of three different crystalloid solutions on the hemodynamics and acid-base balance. METHODS: Controlled hemorrhagic shock (40% of the total blood volume was removed was induced in 18 animals, which were then treated with normal saline (0.9% NaCl, Lactated Ringer's Solution or Plasma-Lyte pH 7.4, in a blinded fashion (n = 6 for each group. Using a predefined protocol, the animals received three times the volume of blood removed. RESULTS: The three different crystalloid infusions were equally capable of reversing the hemorrhage-induced low cardiac output and anuria. The Lactated Ringer's Solution and Plasma-Lyte pH 7.4 infusions resulted in an increased standard base excess and a decreased serum chloride level, whereas treatment with normal saline resulted in a decreased standard base excess and an increased serum chloride level. The Plasma-Lyte pH 7.4 infusions did not change the level of the unmeasured anions. CONCLUSION: Although the three tested crystalloid solutions were equally able to attenuate the hemodynamic and tissue perfusion disturbances, only the normal saline induced hyperchloremia and metabolic acidosis.

  8. [Digestive tract hemorrhages of cirrhotic patients. Relation between hepatic insufficiency and the hemorrhagic lesion].

    Science.gov (United States)

    Franco, D; Deporte, A; Darragon, T; Bismuth, H

    1975-12-06

    The cause of upper gastrointestinal bleeding was studied in 85 cirrhotic patients by emergency endoscopy. In every patient, one or several lesions were observed and the site of bleeding was ascertained in 59. The two main causes were oesophago-gastric varices (46 p.cent) and acute mucosal lesions(42 p.cent). The source of bleeding appeared to be related to the degree of liver function impairment. In patients with no or moderate liver function impariment, bleeding usually originated from varices or from drug-associated mucosal erosions. Patients with severe impairment of liver function most often bled from spontaneous acute oeso-gastro-duodenal ulcerations. These ulcerations resembled what has been described in "stress" hemorrhage. Because of the relationship between liver function and the cause of hemorrhage, mortality was lower in variceal bleeders (29 p.cent) than in patients with spontaneous ulcerations (83 p.cent). In patients with severely impaired liver function, portacaval shunt was rarely indicated since hemorrhage was generally due to acute mucosal ulcerations.

  9. Bilateral adrenal hemorrhage in polycythemia vera

    Directory of Open Access Journals (Sweden)

    Shruti Bhandari

    2016-09-01

    Full Text Available Bilateral adrenal hemorrhage (BAH is a rare complication typically seen in critically ill patients, which can lead to acute adrenal insufficiency and death unless it is recognized promptly and treated appropriately. We describe the case of a 64-year-old man with polycythemia vera found to be unresponsive with fever, hypotension, tachycardia, and hypoglycemia. Electrocardiogram showed ST-elevation with elevated troponin, hemoglobin, prothrombin time, and partial thromboplastin time. He required aggressive ventilator and vasopressor support. Despite primary coronary intervention, he remained hypotensive. Random cortisol level was low. He received stress dose hydrocortisone with immediate hemodynamic stability. BAH was highly suspected and was confirmed by non-contrast abdominal computed tomography. Prompt recognition and timely initiated treatment remain crucial to impact the mortality associated with acute adrenal insufficiency.

  10. Spinal subarachnoid hemorrhage complicating oral anticoagulant therapy

    Energy Technology Data Exchange (ETDEWEB)

    Cihangiroglu, Mutlu E-mail: mmutlucihan@hotmail.com; Bulut, Serpil; Nayak, Sundeep

    2001-09-01

    Spinal subarachnoid hemorrhage (SAH) is rare clinical entity possible owing to the diluting and fibrinolytic effects of cerebrospinal fluid (CSF). When it occurs, it is most commonly encountered in the thoracic segment of the subarachnoid space. We present a case of a 50-year-old man who sustained spinal SAH in the cervical and thoracic segments related to anticoagulant therapy. He progressed to significant neurological deficit since he was inoperable, an observation that supports the need for decompression surgery. We should be aware of potential hematomyelia should a patient on anticoagulant therapy develop neurological symptoms localized to the spinal cord. When available, magnetic resonance (MR) imaging is the modality of choice to diagnose and follow-up spinal SAH.

  11. Continuous EEG Monitoring in Aneurysmal Subarachnoid Hemorrhage

    DEFF Research Database (Denmark)

    Kondziella, Daniel; Friberg, Christian Kærsmose; Wellwood, Ian

    2015-01-01

    BACKGROUND: Continuous EEG (cEEG) may allow monitoring of patients with aneurysmal subarachnoid hemorrhage (SAH) for delayed cerebral ischemia (DCI) and seizures, including non-convulsive seizures (NCSz), and non-convulsive status epilepticus (NCSE). We aimed to evaluate: (a) the diagnostic...... accuracy of cEEG as a confirmatory test, (b) the prognostic value of EEG patterns suggestive of seizures and DCI, and (c) the effectiveness of intensified neuromonitoring using cEEG in terms of improved clinical outcome following SAH. METHODS: A systematic review was performed with eligible studies...... selected from multiple indexing databases through June 2014. The methodological quality of these studies was assessed using the Quality Assessment of Diagnostic Accuracy Studies-2. RESULTS: Eighteen studies were identified, including cEEG data from 481 patients with aneurysmal SAH. NCSz were diagnosed in 7...

  12. Magnetic resonance imaging of aneurysmal subarachnoid hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Toshihide; Shimosegawa, Eku; Inugami, Atsushi; Shishido, Fumio; Fujita, Hideaki; Ito, Hiroshi; Uemura, Kazuo; Yasui, Nobuyuki (Research Inst. of Brain and Blood Vessels, Akita (Japan))

    1991-11-01

    Magnetic resonance imaging of subarachnoid hemorrhage (SAH) due to aneurysm rupture was evaluated in relation to CT findings in nine patients. Six patients were studied within 3 days and the other three patients were studied 4 to 6 days from the ictus of SAH using a 0.5 Tesla superconducting unit. In all of the patients, hematoma in the subarachnoid space and ventricles was demonstrated by the proton density-weighted spin echo sequence, which showed that bloody cerebrospinal fluid (CSF) had a higher signal intensity than brain tissue or normal CSF. Magnetic resonance imaging was more sensitive in detecting SAH and more informative as to the site of the ruptured aneurysm than CT. Despite some limitations in applying it to patients with acute SAH, magnetic resonace imaging has clear advantages in the diagnosis of SAH. (author).

  13. [Virological study of simian hemorrhagic fever].

    Science.gov (United States)

    Shevtosova, Z V; Karmysheva, V Ia; Chumakov, M P

    1975-01-01

    The results of a comparative study of different routes of inoculation of simian hemorrhagic fever (SHF) virus to Macaca monkeys are presented as well as the results of virological examinations of sick animals. Only the parenteral route of inoculation has been found to be effective. After virus penetration, a long-term viremia and generalization of the infection are observed. The virus is found in the brain, the spinal cord and bone marrow, the spleen, the liver, the kidneys, the cerebrospinal fluid, the urine and nasopharyngeal washings. By the fluorescent antibody technique the virus-specific antigen is demonstrated in the capillary endothelium, neurons and glial cells of the brain, and in the reticulo-endothelial and macrophagal elements of parenchymatous organs.

  14. [Interventional treatment of massive hemorrhage after percutaneous nephrolithotomy].

    Science.gov (United States)

    Zhao, Yilei; Zhong, Baishu; Xu, Shunliang; Shen, Bohua; Tan, Fuqing

    2014-08-13

    To explore the diagnostic and therapeutic measures of massive hemorrhage after percutaneous nephrolithotomy (PCNL) unresponsive to conservative treatment. The clinical data of 36 cases of massive hemorrhage occurring after PCNL from January 2010 to January 2014 at our hospital were analyzed. There were 21 males and 15 females with an average age of 46.7 years. There were left (n = 22) and right (n = 14) cases. Severe hemorrhage had an average onset of Days 3-4 (range, 1 to 7) after PCNL. Clinical manifestations included a drainage of fresh red blood liquids out of kidney fistula accompanied by red gross hematuria. Conservative measures were ineffective. On computed tomography angiography (CTA), pseudoaneurysm (n = 22) and arteriovenous fistula (n = 5) were found. Digital subtraction angiography (DSA) and coil embolization were successfully performed in 27 cases whose hemorrhage stopped in 1-3 days after embolization and kidney function returned to normal. Another 9 cases had no obvious hemorrhage on CTA. And venous hemorrhage was considered and conservative treatment succeeded. Renal arterial CTA is an ideal for assessing massive hemorrhage after PCNL unresponsive to conservative treatment. DSA and coil embolization are the preferred treatments.

  15. Spontaneous spinal subarachnoid hemorrhage after severe coughing: a case report.

    Science.gov (United States)

    Oji, Yutaka; Noda, Kazuyuki; Tokugawa, Joji; Yamashiro, Kazuo; Hattori, Nobutaka; Okuma, Yasuyuki

    2013-12-23

    Spinal subarachnoid hemorrhage has many causes including trauma, vascular malformations, aneurysms, spinal cord tumors, coagulation abnormalities, use of anticoagulants, systemic lupus erythematosus, or Behçet's disease. We report on a rare case of a spontaneous spinal subarachnoid hemorrhage after severe coughing of unknown origin. To the best of our knowledge, this is the first report of spontaneous spinal subarachnoid hemorrhage after severe coughing. A 66-year-old Japanese woman initially complained of headache with severe back pain after severe coughing. She was referred to our neurology department 6 days after her first visit to our hospital. No neurological deficits were revealed except for meningism. Computed tomography of her head revealed no abnormality. A lumbar puncture showed bloody cerebrospinal fluid with xanthochromia. Cerebral angiography revealed no abnormality. Magnetic resonance imaging of her lumbar spine revealed subarachnoid hemorrhage. Spinal angiography revealed no abnormality. The diagnosis of spontaneous spinal subarachnoid hemorrhage was made. She recovered with conservative treatment and her neurological status was normal 2 years after the onset. Spontaneous spinal subarachnoid hemorrhage could be caused by rapid changes in intrathoracic and intra-abdominal pressure. Spontaneous subarachnoid hemorrhage should be considered when sudden back pain associated with severe headache develops. Even though emergent surgical decompression is necessary when the neurological state progressively deteriorates, conservative treatment with close monitoring of the symptoms can be recommended for patients with a stable neurological status.

  16. Cerebellar hemorrhage as a first presentation of acquired Hemophilia A.

    Science.gov (United States)

    Micic, Dejan; Williams, Eliot C; Medow, Joshua E

    2011-08-01

    Acquired hemophilia A (AHA) is an uncommon coagulation disorder caused by the development of autoantibodies against coagulation factor VIII (FVIII). While intracranial hemorrhage is a known complication of AHA, intracranial hemorrhage as the presenting manifestation of AHA has only been described in three previous case reports. We report a case of an 86-year-old woman with no previously reported history of coagulopathy presenting with an acute intraparenchymal cerebellar hemorrhage and laboratory studies demonstrating an isolated prolonged activated partial thromboplastin time (aPTT). We discuss an approach to the prolonged aPTT, and review the literature concerning the diagnosis and treatment of AHA. Occipital decompressive craniectomy with evacuation of the hemorrhage was performed. Eight hours following the procedure, the patient's status acutely declined with demonstration of a reoccurrence of the cerebellar hemorrhage and new right frontal lobe hemorrhage. After discussion with the patient's family, life-sustaining support measures were withdrawn. Postmortem analysis revealed a low FVIII activity level and the presence of FVIII inhibitor. The presentation of intracranial hemorrhage with an isolated prolonged aPTT is concerning for an acquired hemophilia with FVIII deficiency. Other causes of isolated prolonged aPTT such as a lupus anticoagulant must also be considered. Preoperative identification and work-up of the coagulation abnormality is essential to guide initial treatment.

  17. Nosocomial infections in patients with spontaneous intracerebral hemorrhage.

    Science.gov (United States)

    Hinduja, Archana; Dibu, Jamil; Achi, Eugene; Patel, Anand; Samant, Rohan; Yaghi, Shadi

    2015-05-01

    Nosocomial infections are frequent complications in patients with intracerebral hemorrhage. To determine the prevalence, risk factors, and outcomes of nosocomial infections in patients with intracerebral hemorrhage. Prospectively collected data on patients with spontaneous intracerebral hemorrhage between January 2009 and June 2012 were retrospectively reviewed. Patients who had nosocomial infection during the hospital stay were compared with patients who did not. Poor outcome was defined as death or discharge to a long-term nursing facility. At least 1 nosocomial infection developed in 26% of 202 patients with intracerebral hemorrhage. The most common infections were pneumonia (18%), urinary tract infection (12%), meningitis or ventriculitis (3%), and bacteremia (1%). On univariate analysis, independent predictors of nosocomial infection were intraventricular hemorrhage, hydrocephalus, low score on the Glasgow Coma Scale at admission, hyperglycemia at admission, and treatment with mechanical ventilation. On multivariate regression analysis, the only significant predictor of nosocomial infection was intraventricular hemorrhage (odds ratio, 5.4; 95% CI, 1.2-11.4; P = .02). Patients with nosocomial infection were more likely than those without to require a percutaneous gastrostomy tube (odds ratio, 33.1, 95% CI, 23.3-604.4; P nosocomial pneumonia were also more likely to have a poor outcome (P infection among patients with intracerebral hemorrhage. ©2015 American Association of Critical-Care Nurses.

  18. Intraoperative Hemorrhage and Postoperative Sequelae after Intraoral Vertical Ramus Osteotomy to Treat Mandibular Prognathism

    Directory of Open Access Journals (Sweden)

    Chun-Ming Chen

    2015-01-01

    Full Text Available Objective. To investigate the factors affecting intraoperative hemorrhage and postoperative sequelae after orthognathic surgery. Materials and Methods. Eighty patients with mandibular prognathism underwent surgical mandibular setback with intraoral vertical ramus osteotomy (IVRO. The correlation between the blood loss volume and postoperative VAS with the gender, age, and operating time was assessed using the t-test and Spearman rank correlation coefficient. The correlation between the magnitude of mandibular setback with the presence of TMJ clicking symptoms and lip sensation was also assessed. Results. The mean operating time and blood loss volume for men and women were 249.52 min and 229.39 min, and 104.03 mL and 86.12 mL, respectively. The mean VAS in men and women was 3.21 and 2.93, and 1.79 and 1.32 on the first and second postoperative days. There is no gender difference in the operating time, blood loss, VAS, TMJ symptoms, and lip numbness. The magnitude of mandibular setback was not correlated with immediate and long-term postoperative lip numbness. Conclusion. There are no gender differences in the intraoperative hemorrhage and postoperative sequelae (pain, lip numbness, and TMJ symptoms. In addition, neither symptom was significantly correlated with the amount of mandibular setback.

  19. Circadian variation in clinical features and outcome of intracerebral hemorrhage: The INTERACT studies.

    Science.gov (United States)

    Zheng, Danni; Sato, Shoichiro; Cao, Yong-Jun; Arima, Hisatomi; Carcel, Cheryl; Chalmers, John; Anderson, Craig S

    2016-01-01

    Previous studies consistently reported a diurnal variation in the occurrence of intracerebral hemorrhage (ICH), with a morning peak. However, limited knowledge exists on the circadian pattern of ICH severity and outcome. This study aimed to determine possible associations between ICH onset time and admission severity and 90-day outcomes using the combined data set of the pilot and main-phase Intensive blood pressure (BP) reduction in an acute cerebral hemorrhage trial (INTERACT). The ICH onset time was categorized into three groups (1: 00:00-07:59; 2: 08:00-15:59; and 3: 16:00-23:59). We found an association between onset time and low Glasgow Coma Scale score: aOR (time 1: 1.72, 95% CI 1.12-2.66; time 3: 1.95, 95% CI 1.31-2.89, p = 0.003; in comparison to time 2). There was no association between onset time and volume of ICH (adjusted p = 0.354) or 90-day outcomes of death or major disability, and death and major disability separately (all adjusted p > 0.4). The results showed that more severe cases of ICH patients, defined by a reduced level of consciousness, had late afternoon to early morning stroke onset, but this was unrelated to baseline hematoma volume or location. There was no circadian influence on ICH clinical outcome.

  20. Severe secondary postpartum hemorrhage: a historical cohort.

    Science.gov (United States)

    Dossou, Mathieu; Debost-Legrand, Anne; Déchelotte, Pierre; Lémery, Didier; Vendittelli, Françoise

    2015-06-01

    The principal objective of our study was to describe the frequency of severe secondary postpartum hemorrhages (PPH). Our secondary objectives were to describe the different causes of PPH and to assess if the PPH etiologies varied by parity. This is a historical cohort study covering the period from January 1, 2004, through February 13, 2013, in a level III maternity ward. Women were eligible if they were treated for severe secondary PPH during their postpartum hospitalization or were admitted for it after discharge but before the 42nd day postpartum, regardless of the type of delivery. Women were excluded if they gave birth before 22 weeks of gestation or if they had experienced only an immediate PPH (≤ 24 hours after delivery). Eligible patients were identified by the hospital's administrative software. Primiparas and multiparas were compared with Student's t test and a chi-squared or Fisher's exact test. The incidence of severe secondary PPH was 0.23 percent (n = 60/26,023). The mean time between delivery and PPH onset was 13.4 ± 10.8 days. The women's mean age was 30.4 ± 5.7 years and their mean body mass index was 23.4 ± 5.7 kg/m². Placental retention was the cause to which these hemorrhages were most frequently attributed (30.0%). Subinvolution of the placental bed was noted in 13.3 percent of the patients, endometritis in 10.0 percent, pseudoaneurysm of the uterine artery in 3.3 percent, and excessively strong resumption of menses in 3.3 percent; no cause could be determined for 16.7 percent of the cases. Neither clinical signs nor causes differed by parity. Secondary PPH is rare. Accurate diagnosis is based most often on histopathologic findings. © 2015 Wiley Periodicals, Inc.

  1. (-)-DEPRENYL INHIBITS VASCULAR HYPERPERMEABILITY FOLLOWING HEMORRHAGIC SHOCK

    Science.gov (United States)

    J., Binu Tharakan; Whaley, Greg; Hunter, Felicia A.; Smythe, W. Roy; Childs, Ed W.

    2010-01-01

    Recent studies from our laboratory demonstrated the involvement of endothelial cell reactive oxygen species (ROS) formation and activation of apoptotic signaling in vascular hyperpermeability following hemorrhagic shock (HS). The objective of this study was to determine if (-)-deprenyl, an antioxidant with anti-apoptotic properties would attenuate HS-induced vascular hyperpermeability. In rats, HS was induced by withdrawing blood to reduce the MAP to 40 mmHg for 60 minutes followed by resuscitation for 60 minutes. To study hyperpermeability, the rats were injected with FITC-albumin (50 mg/kg) and the changes in integrated optical intensity of the mesenteric post-capillary venules were obtained intra and extra vascularly utilizing intravital microscopy. Mitochondrial ROS formation and mitochondrial transmembrane potential (ΔΨm) were studied using dihydrorhodamine 123 and JC-1 respectively. Mitochondrial release of cytochrome c was determined using ELISA and caspase-3 activity by a fluorometric assay. Parallel studies were performed in rat lung microvascular endothelial cells (RLMEC) utilizing pro-apoptotic BAK as inducer of hyperpermeability. Hemorrhagic shock induced vascular hyperpermeability, mitochondrial ROS formation, decrease in ΔΨm, release of cytochrome c and caspase-3 activation (p < 0.05). (-)-Deprenyl (0.15 mg/Kg) attenuated all these effects (p < 0.05). Similarly in RLMEC, (-)-deprenyl attenuated BAK peptide induced monolayer hyperpermeability (p < 0.05), ROS formation, decrease in ΔΨm, cytochrome c release (p < 0.05) and activation of caspase-3 (p < 0.05). The protective effects of (-)-deprenyl on vascular barrier functions may be due to its protective effects on ΔΨm thereby preventing mitochondrial release of cytochrome c and caspase-3 mediated disruption of endothelial adherens junctions. PMID:19373132

  2. Cerebral paragonimiasis that manifested as intracranial hemorrhage.

    Science.gov (United States)

    Chen, Jingyu; Chen, Zhi; Li, Fei; Lin, Jiangkai; Meng, Hui; Feng, Hua

    2010-12-01

    The purpose of this study was to review 14 rare cases of cerebral paragonimiasis that first manifested as intracranial hemorrhage (ICH), and to investigate the characteristics of clinical manifestation, diagnosis, and treatment of the disease. The authors have encountered 14 cases of cerebral paragonimiasis in patients between the ages of 6 and 16 years (mean age 11.5 years) who presented with sudden headache, nausea, and vomiting. Three of them were affected with varying degrees of limb hemiplegia, and in 1 this was combined with high fever; the blood eosinophil count and enzyme-linked immunosorbent assay showed positive results too. The ICHs were observed with cranial CT and MR imaging, and lung lesions were also detected in 5 cases on chest CT scans. Ten of the diagnosed cases were treated with oral praziquantel. Three of these patients were given carbamazepine from the beginning of parasiticidal treatment to prevent seizures; 4 of the remaining 7 patients experienced epileptic seizures during the treatment process. Four patients needed surgery to remove the lesions, and these individuals received praziquantel treatment right after the surgery. Pathological examinations demonstrated eosinophilic granuloma in these patients. There was no disease recurrence or epilepsy in 11-40 months of follow-up; however, mild hemiplegia could still be observed in 2 cases after 12 months and 17 months of follow-up. The possibility of cerebral paragonimiasis should be considered when ICH is detected in young patients who are either from an endemic area or have recently visited such an area; the relatively small amount of hemorrhage in cerebral paragonimiasis is often represented as small lesions surrounded by disproportionately larger edema on the imaging study. Preventive antiepileptic drugs should be used along with the administration of parasiticide.

  3. Blood volume measurement with indocyanine green pulse spectrophotometry: dose and site of dye administration

    NARCIS (Netherlands)

    Germans, M.R.; de Witt Hamer, P.C.; van Boven, L.J.; Zwinderman, K.A.H.; Bouma, G.J.

    2010-01-01

    (1) To determine the optimal administration site and dose of indocyanine green (ICG) for blood volume measurement using pulse spectrophotometry, (2) to assess the variation in repeated blood volume measurements for patients after subarachnoid hemorrhage and (3) to evaluate the safety and efficacy of

  4. Volume depletion and natriuresis in patients with a ruptured intracranial aneurysm

    NARCIS (Netherlands)

    Wijdicks, E. F.; Vermeulen, M.; ten Haaf, J. A.; Hijdra, A.; Bakker, W. H.; van Gijn, J.

    1985-01-01

    We studied the sodium balance and changes in plasma volume by an isotope dilution technique in the first week after an aneurysmal subarachnoid hemorrhage in 21 patients. In 11 of the patients, the plasma volume decreased by more than 10%. This was accompanied by a negative sodium balance and

  5. Cerebral hemorrhagic infarction after radiation for pituitary adenoma

    Energy Technology Data Exchange (ETDEWEB)

    Ogaki, Satoko; Suzuki, Masatsune; Shimano, Hitoshi; Toyoshima, Hideo; Sone, Hirohito; Okuda, Yukichi; Yamada, Nobuhiro [Tsukuba Univ., Ibaraki (Japan). Inst. of Clinical Medicine; Suzuki, Seiji; Suzuki, Hiroaki [National Hospital Tokyo Disaster Medical Center, Tachikawa (Japan)

    2002-10-01

    We report a case of cerebral hemorrhagic infarction after radiation for pituitary adenoma. A 55-year-old woman was hospitalized to check for aldosteronism, post-operative pituitary function, and recurrence of thyroid cancer. She had short-term memory disturbance beginning two months prior to admission. Brain MRI showed a T1 and T2 high intensity lesion of her left anterolateral thalamus. Brain MRA revealed a narrowing in her left middle cerebral artery. The abnormal brain lesion was diagnosed as cerebral hemorrhagic infarction. She had received radiation therapy for pituitary adenoma 20 years earlier. It was considered that her cerebral hemorrhagic infarction was caused by radiation therapy. (author)

  6. Alveolar Hemorrhage After Scuba Diving: A Case Report

    Directory of Open Access Journals (Sweden)

    Ming-Ju Tsai

    2010-07-01

    Full Text Available Self-contained underwater breathing apparatus (scuba diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving.

  7. A segmentation algorithm of intracranial hemorrhage CT image

    Science.gov (United States)

    Wang, Haibo; Chen, Zhiguo; Wang, Jianzhi

    2011-10-01

    To develop a computer aided detection (CAD) system that improves diagnostic accuracy of intracranial hemorrhage on cerebral CT. A method for CT image segmentation of brain is proposed, with which, several regions that are suspicious of hemorrhage can be segmented rapidly and effectively. Extracting intracranial area algorithm is introduced firstly to extract intracranial area. Secondly, FCM is employed twice, we named it with TFCM. FCM is first employed to identify areas of intracranial hemorrhage. Finally, FCM is employed to segment the lesions. Experimental results on real medical images demonstrate the efficiency and effectiveness.

  8. Hemorrhagic Acalculous Cholecystitis: An Unusual Location of Uremic Bleeding

    Directory of Open Access Journals (Sweden)

    Yi-Chun Lai

    2009-09-01

    Full Text Available Hemorrhagic acalculous cholecystitis is a rare but potentially fatal disease. An increased bleeding tendency is present in both acute and chronic renal failure with impaired platelet function. We herein present a case of hemorrhagic acalculous cholecystitis in a hemodialysis patient who suffered from acute abdomen and upper gastrointestinal bleeding. The pathogenesis may have been associated with ischemia and reperfusion injury, eventually leading to necrosis of the gall-bladder wall. Abdominal ultrasound can aid in diagnosis. Biliary colic, jaundice, and melena are the typical symptoms of hemorrhagic cholecystitis, particularly in a patient with unexplained gastrointestinal bleeding.

  9. Characterization of hemorrhages in the ham topsides and tenderloins of slaughter pigs

    DEFF Research Database (Denmark)

    Dich-Jørgensen, Kristine; Larsen, Helle Daugaard; Leifsson, Páll S.

    2017-01-01

    The aim of the study was to characterize the different types of muscle hemorrhages in the ham and tenderloin of CO2-stunned slaughter pigs. The distinct types of hemorrhages were characterized according to their distribution and size. The hemorrhages in the ham were multiple, pinpoint hemorrhages...

  10. Computed Tomographic Blend Sign Is Associated With Computed Tomographic Angiography Spot Sign and Predicts Secondary Neurological Deterioration After Intracerebral Hemorrhage.

    Science.gov (United States)

    Sporns, Peter B; Schwake, Michael; Schmidt, Rene; Kemmling, André; Minnerup, Jens; Schwindt, Wolfram; Cnyrim, Christian; Zoubi, Tarek; Heindel, Walter; Niederstadt, Thomas; Hanning, Uta

    2017-01-01

    Significant early hematoma growth in patients with intracerebral hemorrhage is an independent predictor of poor functional outcome. Recently, the novel blend sign (BS) has been introduced as a new imaging sign for predicting hematoma growth in noncontrast computed tomography. Another parameter predicting increasing hematoma size is the well-established spot sign (SS) visible in computed tomographic angiography. We, therefore, aimed to clarify the association between established SS and novel BS and their values predicting a secondary neurological deterioration. Retrospective study inclusion criteria were (1) spontaneous intracerebral hemorrhage confirmed on noncontrast computed tomography and (2) noncontrast computed tomography and computed tomographic angiography performed on admission within 6 hours after onset of symptoms. We defined a binary outcome (secondary neurological deterioration versus no secondary deterioration). As secondary neurological deterioration, we defined (1) early hemicraniectomy under standardized criteria or (2) secondary decrease of Glasgow Coma Scale of >3 points, both within the first 48 hours after symptom onset. Of 182 patients with spontaneous intracerebral hemorrhage, 37 (20.3%) presented with BS and 39 (21.4%) with SS. Of the 81 patients with secondary deterioration, 31 (38.3%) had BS and SS on admission. Multivariable logistic regression analysis identified hematoma volume (odds ratio, 1.07 per mL; P≤0.001), intraventricular hemorrhage (odds ratio, 3.08; P=0.008), and the presence of BS (odds ratio, 11.47; P≤0.001) as independent predictors of neurological deterioration. The BS, which is obtainable in noncontrast computed tomography, shows a high correlation with the computed tomographic angiography SS and is a reliable predictor of secondary neurological deterioration after spontaneous intracerebral hemorrhage. © 2016 American Heart Association, Inc.

  11. Beneficial effects of elevating cardiac preload on left-ventricular diastolic function and volume during heat stress

    DEFF Research Database (Denmark)

    Brothers, R M; Pecini, Redi; Dalsgaard, Morten

    2014-01-01

    conditions prior to and during a simulated hemorrhagic challenge. Heat stress did not change indices of diastolic function. Subsequent volume infusion elevated indices of diastolic function, specifically early diastolic mitral annular tissue velocity (E') and early diastolic propagation velocity (E) relative......Volume loading normalizes tolerance to a simulated hemorrhagic challenge in heat-stressed individuals, relative to when these individuals are thermoneutral. The mechanism(s) by which this occurs is unknown. This project tested two unique hypotheses; that is, the elevation of central blood volume...... via volume loading while heat stressed would 1) increase indices of left ventricular diastolic function, and 2) preserve left ventricular end-diastolic volume (LVEDV) during a subsequent simulated hemorrhagic challenge induced by lower-body negative pressure (LBNP). Indices of left ventricular...

  12. NNDSS - Table II. Cryptosporidiosis to Dengue Hemorrhagic Fever

    Data.gov (United States)

    U.S. Department of Health & Human Services — NNDSS - Table II. Cryptosporidiosis to Dengue Hemorrhagic Fever - 2014. In this Table, all conditions with a 5-year average annual national total of more than or...

  13. Life Satisfaction and Return to Work After Aneurysmal Subarachnoid Hemorrhage

    NARCIS (Netherlands)

    Passier, Patricia E. C. A.; Visser-Meily, Johanna M. A. Anne; Rinkel, Gabriel J. E.; Lindeman, Eline; Post, Marcel W. M.

    2011-01-01

    This study was conducted to investigate life satisfaction and employment status after aneurysmal subarachnoid hemorrhage (SAH) and to explain the associations between life satisfaction and demographic, disease-related, psychological, and personality characteristics. Subjects with SAH (n = 141)

  14. Spontaneous Perinephric Hemorrhage Associated with Urolithiasis in Pregnancy

    Directory of Open Access Journals (Sweden)

    Leah P. McMann

    2004-01-01

    Full Text Available Spontaneous perinephric hematoma in the absence of anticoagulation, arteritis, or trauma is uncommon. We report the case of a postpartum patient with nephrolithiasis who initially presented to the obstetric service with a spontaneous perinephric hemorrhage.

  15. Myocarditis in patients with subarachnoid hemorrhage : A histopathologic study

    NARCIS (Netherlands)

    van der Bilt, Ivo A C; Vendeville, Jean Paul; van de Hoef, Tim P.; Begieneman, Mark P V; Lagrand, Wim K.; Kros, Johan M.; Wilde, Arthur A M; Rinkel, Gabriel J E; Niessen, Hans W M

    Cardiac abnormalities after subarachnoid hemorrhage (SAH) such as electrocardiographic changes, echocardiographic wall motion abnormalities, and elevated troponin levels are independently associated with a poor prognosis. They are caused by catecholaminergic stress coinciding with influx of

  16. Acute cerebral paragonimiasis presenting as hemorrhagic stroke in a child.

    Science.gov (United States)

    Chen, Zhi; Zhu, Gang; Lin, Jiangkai; Wu, Nan; Feng, Hua

    2008-08-01

    A hemorrhagic stroke in children is rarely secondary to cerebral paragonimiasis. We describe a 9-year-old boy in whom an intracerebral hemorrhage was the leading clinical indication of acute cerebral paragonimiasis. He was hospitalized because of a sudden onset of headache, right hemiparesis, and dysarthria. A computed tomography scan revealed an intracerebral hemorrhage in the left parietal lobe. Magnetic resonance angiography did not confirm any vascular abnormalities at the location of the hematoma. Four weeks later, he presented with right hemiparesis again, and fever. A diagnosis of cerebral paragonimiasis was based on repeated magnetic resonance imaging of the brain and an enzyme-linked immunosorbent assay for paragonimiasis. The patient gradually recovered with praziquantel treatment. Cerebral paragonimiasis should be considered in the differential diagnosis of hemorrhagic strokes in children in areas where paragonimiasis is epidemic.

  17. Staphylococcus endocarditis associated with infectious vasculitis and recurrent cerebral hemorrhages

    NARCIS (Netherlands)

    van de Beek, Diederik; Rabinstein, Alejandro A.; Peters, Steve G.; Cloft, Harry; Wijdicks, Eelco F. M.

    2008-01-01

    BACKGROUND: Patients with infectious endocarditis, who do not respond to conservative medical therapy usually need rapid valve surgery. This poses a difficult dilemma in patients with intracranial aneurysms and hemorrhage, although endovascular treatment of infectious aneurysms might be an advantage

  18. Ebola Viral Hemorrhagic Disease Outbreak in West Africa- Lessons ...

    African Journals Online (AJOL)

    . Anthony K. Mbonye*1 ... Background: There has been a rapid spread of Ebola Viral Hemorrhagic disease in Guinea, Liberia and Sierra. Leone since March 2014. ..... spots to minimize on transportation of Ebola patients for long distances.

  19. Risk factors for medical complications of acute hemorrhagic stroke

    Directory of Open Access Journals (Sweden)

    Jangala Mohan Sidhartha

    2015-08-01

    Conclusions: Our study has assessed that hypertension followed by diabetes mellitus are the major risk factors for medical complications of hemorrhagic stroke. Female mortality rate was more when compared to males.

  20. Prediction of outcome after subarachnoid hemorrhage : Timing of clinical assessment

    NARCIS (Netherlands)

    van Donkelaar, Carlina E.; Bakker, Nicolaas A.; Veeger, Nic J. G. M.; Uyttenboogaart, Maarten; Metzemaekers, Jan D. M.; Eshghi, Omid S.; Mazuri, Aryan; Foumani, Mahrouz; Luijckx, Gert-Jan; Groen, Rob J. M.; van Dijk, J. Marc C.

    OBJECTIVE Currently, early prediction of outcome after spontaneous subarachnoid hemorrhage (SAH) lacks accuracy despite multiple studies addressing this issue. The clinical condition of the patient on admission as assessed using the World Federation of Neurosurgical Societies (WFNS) grading scale is

  1. Data Hemorrhages in the Health-Care Sector

    Science.gov (United States)

    Johnson, M. Eric

    Confidential data hemorrhaging from health-care providers pose financial risks to firms and medical risks to patients. We examine the consequences of data hemorrhages including privacy violations, medical fraud, financial identity theft, and medical identity theft. We also examine the types and sources of data hemorrhages, focusing on inadvertent disclosures. Through an analysis of leaked files, we examine data hemorrhages stemming from inadvertent disclosures on internet-based file sharing networks. We characterize the security risk for a group of health-care organizations using a direct analysis of leaked files. These files contained highly sensitive medical and personal information that could be maliciously exploited by criminals seeking to commit medical and financial identity theft. We also present evidence of the threat by examining user-issued searches. Our analysis demonstrates both the substantial threat and vulnerability for the health-care sector and the unique complexity exhibited by the US health-care system.

  2. Hemorrhagic pneumonia in mink caused by Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Salomonsen, Charlotte Mark

    experiencing outbreaks of hemorrhagic pneumonia among their mink was that the disease always started in the mink kits, never in the adults. Furthermore, 39% reported that most deaths occurred in the male mink. The results presented in this thesis suggest that factors of the mink make them more prone to develop......Hemorrhagic pneumonia in mink is an acute and fatal disease caused by Pseudomonas aeruginosa. The mink are typically found dead without prior clinical symptoms. The disease can be highly contagious and varying mortalities on the farm level has been reported. Hemorrhagic pneumonia in mink...... is seasonal with outbreaks almost exclusively occurring from September to November in Denmark. In human medicine, P. aeruginosa is regarded as a pathogen for immune compromised individuals but no underlying disease or immune defect has been identified in mink dying of hemorrhagic pneumonia. In fact, little...

  3. Improvement in Outcomes of Major Obstetric Hemorrhage Through Systematic Change.

    Science.gov (United States)

    Skupski, Daniel W; Brady, David; Lowenwirt, Isaac P; Sample, Jason; Lin, Stephanie N; Lohana, Rahul; Eglinton, Gary S

    2017-10-01

    To report the outcomes over 14 years of sustained systematic institutional focus on the care of women with major obstetric hemorrhage, defined as estimated blood loss greater than 1,500 mL. A retrospective cohort study of women with major obstetric hemorrhage at our hospital from 2000 to 2014 compares baseline conditions (age, multiparity, prior cesarean delivery, morbidly adherent placenta), morbidity (lowest mean temperature, lowest mean pH, coagulopathy, hysterectomy), and mortality among three time periods (period 1=January 2000 to December 2001, period 2=January 2002 to August 2005, period 3=September 2005 to December 2014). We also describe the systematic changes that helped to sustain our improved outcomes. During the three time periods, there were 5,811, 12,912, and 38,971 births; the rate of major obstetric hemorrhage increased over these periods: 2.1, 3.8 and 5.3 cases per 1,000 births, respectively. Two deaths from hemorrhage occurred in period 1 and none thereafter. Among women who experienced massive hemorrhage, morbidity significantly improved in each successive period: median lowest pH increased from 7.23 to 7.34 to 7.35 (periods 2 and 3 significantly higher than period 1), median lowest maternal temperature (°C) improved, 35.2 to 36.1 to 36.4 (all difference significant), and the rate of coagulopathy decreased, 58.3% to 28.6% to 13.2% (period 3 significantly lower than periods 1 and 2) (all P values obstetric rapid response team, instituted a massive transfusion protocol and use of uterine balloon tamponade, and promoted a culture of safety in two ways-through more intensive education regarding hemorrhage and escalation (encouraging all staff to contact senior leaders). A sustained level of patient safety is achievable when treating major obstetric hemorrhage, as shown by a progressive decrease in morbidity despite increasing rates of hemorrhage.

  4. Fatal cerebral edema and intracranial hemorrhage associated with hypernatremic dehydration

    Energy Technology Data Exchange (ETDEWEB)

    Mocharla, R. [Department of Radiology, Slot 105, Arkansas Children`s Hospital, 800 Marshall Street, Litte Rock, AR 72202-3591 (United States); Schexnayder, S.M. [Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR (United States)]|[Department of Critical Care Medicine, University of Arkansas for Medical Sciences and Arkansas Children`s Hospital, Little Rock, AR (United States); Glasier, C.M. [Department of Radiology, Slot 105, Arkansas Children`s Hospital, 800 Marshall Street, Litte Rock, AR 72202-3591 (United States)]|[Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR (United States)

    1997-10-01

    We report neuroimaging findings of intracranial hemorrhage and cerebral edema in an infant with obtundation and seizures, initially suspected to be secondary to non-accidental trauma but finally attributed to hypernatremic dehydration. Neuroimaging findings due to hypernatremic dehydration have not been previously described in the radiologic literature. Hypernatremia should be included in the differential diagnosis of intracranial hemorrhage in the infant without evidence of nonaccidental trauma. (orig.). With 1 fig.

  5. Appendicular bleeding: an excepcional cause of lower hemorrhage

    Directory of Open Access Journals (Sweden)

    Marta Magaz-Martínez

    Full Text Available Chronic complications of acute appendicitis managed in a conservative manner are not frequent. We present a case of acute lower gastrointestinal hemorrhage in a young patient with a previous acute appendicitis without surgical intervention. The colonoscopy detected an appendicular bleeding which was surgically treated. The anatomopathological diagnosis was granulomatous appendicitis. The clinical evolution of the patient was favorable without bleeding recurrence. Appendicular hemorrhage can be an unusual complication -however potentially severe- of acute appendicitis not treated surgically.

  6. Subconjunctival hemorrhage and vision loss after regional ocular anesthesia.

    Science.gov (United States)

    Behera, Umesh Chandra; Panda, Lapam; Gupta, Sumi; Modi, Rohit Ramesh

    2017-04-22

    To report two cases of retinal vascular occlusion and associated subconjunctival hemorrhage in needle optic nerve injury during local bulbar anesthesia. Surgical records of these two subjects who presented with acute vision loss after cataract extraction were studied, and systemic workup and ocular imaging were carried out to establish the cause. Computerized tomography showed evidence of optic nerve injury. Subconjunctival hemorrhage could be an associated clinical finding in hypodermic needle injury-related retinal vascular occlusion during ocular anesthesia.

  7. A Laparoscopic Swine Model of Noncompressible Torso Hemorrhage

    Science.gov (United States)

    2014-01-01

    2014;77: S77 S82. Copyright * 2014 by Lippincott Williams & Wilkins) KEY WORDS: Noncompressible torso hemorrhage; splenectomy; swine. Hemorrhage remains...Base San Antonio-Lackland, San Antonio, Texas; email: james.ross.43@us.af.mil. DOI: 10.1097/TA.0000000000000385 Copyright © 2014 Lippincott Williams...laparoscopic liver injury on animal physiology, biochemistry , and mortality. The study con- sisted of two groups as follows: swinewith spleen (spleen

  8. Atropine Pharmacokinetics are Affected by Moderate Hemorrhage and Hypothyroidism

    Science.gov (United States)

    1989-12-01

    Moderate Hemorrhage and Hypothyroidism 12. PERSONAL AUTHOR(S) R.C. Smallridge, B. Chernow, S. Teich, C. Kinzer, C. Umstott, G. Geelhoed, _ Ppmnl i n 13a...moderate hemorrhage and hypothyroidism ROBERT C. SMALLRIDGE, MD: BART CHERNOW, MD: STEVEN TEICH, MD, CAROL KINZER: CAROLYN UMSTOTT: GLEN GEELHOED. MD...under resting conditions. logic responses (heart rate, mydriasis, inhibition of Pharmacokinetic studies were performed in mongrel logi reo (a rat . dogs

  9. Threshold Switchable Particles (TSPs) To Control Internal Hemorrhage

    Science.gov (United States)

    2016-09-01

    of their wounds .[1] In civilian hospitals, hemorrhage results in 15–25% of trauma deaths.[2] These data suggest that treatment should focus on...Blood clotting; Nanoparticles; Trauma 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON...Incompressible hemorrhage • Bleeding • Blood clotting • Nanoparticles • Trauma 3. OVERALL PROJECT SUMMARY Comments on Administrative and Logistical Matters

  10. Possible sexual transmission of Crimean-Congo hemorrhagic fever

    OpenAIRE

    Natalia Yurievna Pshenichnaya; Irina Stanislavovna Sydenko; Elena Pavlovna Klinovaya; Elena Borisovna Romanova; Alexey Sergeevich Zhuravlev

    2016-01-01

    Three cases of family transmission of laboratory-confirmed Crimean-Congo hemorrhagic fever (CCHF) among spouses are reported. These spouses had sexual contact at the end of the incubation period or during the early stage of the mild form of CCHF, without any hemorrhagic symptoms in the first infected spouse. This report demonstrates that sexual contact may represent a real risk of CCHF transmission, even if the patient only experiences mild symptoms.

  11. Possible sexual transmission of Crimean-Congo hemorrhagic fever

    Directory of Open Access Journals (Sweden)

    Natalia Yurievna Pshenichnaya

    2016-04-01

    Full Text Available Three cases of family transmission of laboratory-confirmed Crimean-Congo hemorrhagic fever (CCHF among spouses are reported. These spouses had sexual contact at the end of the incubation period or during the early stage of the mild form of CCHF, without any hemorrhagic symptoms in the first infected spouse. This report demonstrates that sexual contact may represent a real risk of CCHF transmission, even if the patient only experiences mild symptoms.

  12. Pulmonary hemorrhage following anabolic agent abuse: Two cases

    OpenAIRE

    Hvid-Jensen, Helene S.; Rasmussen, Finn; Bendstrup, Elisabeth

    2016-01-01

    Numerous adverse effects follow anabolic agent abuse. Pulmonary hemorrhage is not considered one of them. We present two cases of young male bodybuilders who developed diffuse alveolar bleeding as a result of anabolic steroid abuse. Diffuse alveolar hemorrhage associated with anabolic agent abuse has not been described previously in the literature. Both patients developed acute dyspnea and hemoptysis with consistent radiological findings. In both cases symptoms promptly resolved with cessatio...

  13. Clinical Features of Hemorrhagic Moyamoya Disease in China.

    Science.gov (United States)

    Ge, Peicong; Zhang, Qian; Ye, Xun; Liu, Xingju; Deng, Xiaofeng; Li, Hao; Wang, Rong; Zhang, Yan; Zhang, Dong; Cao, Yong; Wang, Shuo; Zhao, Jizong

    2017-10-01

    To elucidate the clinical features of patients with hemorrhagic moyamoya disease (MMD) in China. We retrospectively reviewed 471 patients with hemorrhagic MMD at Beijing Tiantan Hospital. Clinical features and radiologic findings were analyzed. The mean age at diagnosis was 35.3 ± 11.5 years, with 1 peak distribution in patients from 35 to 39 years of age. The ratio of women to men was 1.2:1. Familial occurrence was 3.8%. The primary symptoms at initial presentation were intraventricular hemorrhage (42.0%), intracerebral hemorrhage (23.6%), intracerebral hemorrhage with intraventricular hemorrhage (18.3%), and subarachnoid hemorrhage (16.1%). Before the diagnosis, 68 patients experienced a second episode of bleeding. Rebleeding tends to be common within 6 years after the first bleeding (83.8%). The second bleeding episode was characterized by a change in which hemisphere bleeding occurred in 7 patients (10.3%) and by the type of bleeding in 23 patients (33.8%). Most patients presented with Suzuki stage 3 or 4 MMD (61.7%). Posterior cerebral artery involvement was observed in 28 (18.4%) patients. Forty-three intracranial aneurysms were identified in 39 patients (8.3%). A 1-peak pattern in age distribution and mild female dominance in sex distribution were observed in patients with hemorrhagic MMD. Rebleeding tends to be common within 6 years after the first bleeding; however, some cases of rebleeding occur after a long period. Furthermore, the second bleeding episode was characterized frequently by a change in hemisphere and the type of bleeding. Early surgical treatment in both hemispheres is recommended. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Treatment of TBI and Concomitant Hemorrhage with Ghrelin

    Science.gov (United States)

    2011-07-01

    Hemorrhage with Ghrelin PRINCIPAL INVESTIGATOR: Rongqian Wu CONTRACTING ORGANIZATION: The Feinstein Institute for Medical Research...Concomitant Hemorrhage with Ghrelin 5b. GRANT NUMBER W81XWH-09-1-0400 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Rongqian Wu...concomitantly due to multiple injuries. In this project, we determined the long-term effect of ghrelin , a ‘gut-brain’ hormone, in a highly military

  15. Rabbit model of uncontrolled hemorrhagic shock and hypotensive resuscitation

    OpenAIRE

    Rezende-Neto,J.B.; Rizoli,S.B.; Andrade,M.V.; Lisboa,T.A.; Cunha-Melo,J.R.

    2010-01-01

    Clinically relevant animal models capable of simulating traumatic hemorrhagic shock are needed. We developed a hemorrhagic shock model with male New Zealand rabbits (2200-2800 g, 60-70 days old) that simulates the pre-hospital and acute care of a penetrating trauma victim in an urban scenario using current resuscitation strategies. A laparotomy was performed to reproduce tissue trauma and an aortic injury was created using a standardized single puncture to the left side of the infrarenal aort...

  16. Formalin irrigation for hemorrhagic chronic radiation proctitis.

    Science.gov (United States)

    Ma, Teng-Hui; Yuan, Zi-Xu; Zhong, Qing-Hua; Wang, Huai-Ming; Qin, Qi-Yuan; Chen, Xiao-Xia; Wang, Jian-Ping; Wang, Lei

    2015-03-28

    To assess the efficacy and safety of a modified topical formalin irrigation method in refractory hemorrhagic chronic radiation proctitis (CRP). Patients with CRP who did not respond to previous medical treatments and presented with grade II-III rectal bleeding according to the Common Terminology Criteria for Adverse Events were enrolled. Patients with anorectal strictures, deep ulcerations, and fistulas were excluded. All patients underwent flexible endoscopic evaluation before treatment. Patient demographics and clinical data, including primary tumor, radiotherapy and previous treatment options, were collected. Patients received topical 4% formalin irrigation in a clasp-knife position under spinal epidural anesthesia in the operating room. Remission of rectal bleeding and related complications were recorded. Defecation, remission of bleeding, and other symptoms were investigated at follow-up. Endoscopic findings in patients with rectovaginal fistulas were analyzed. Twenty-four patients (19 female, 5 male) with a mean age of 61.5 ± 9.5 years were enrolled. The mean time from the end of radiotherapy to the onset of bleeding was 11.1 ± 9.0 mo (range: 2-24 mo). Six patients (25.0%) were blood transfusion dependent. The median preoperative Vienna Rectoscopy Score (VRS) was 3 points. Nineteen patients (79.2%) received only one course of topical formalin irrigation, and five (20.8%) required a second course. No side effects were observed. One month after treatment, bleeding cessation was complete in five patients and obvious in 14; the effectiveness rate was 79.1% (19/24). For long-term efficacy, 5/16, 1/9 and 0/6 patients complained of persistent bleeding at 1, 2 and 5 years after treatment, respectively. Three rectovaginal fistulas were found at 1 mo, 3 mo and 2 years after treatment. Univariate analysis showed associations of higher endoscopic VRS and ulceration score with risk of developing rectovaginal fistula. Modified formalin irrigation is an effective and safe

  17. Massive and recurrent diverticular hemorrhage, risk factors and treatment.

    Science.gov (United States)

    Gilshtein, Hayim; Kluger, Yoram; Khoury, Areen; Issa, Nidal; Khoury, Wisam

    2016-09-01

    Diverticular hemorrhage may be massive or recurrent, requiring surgical management. The aim of our study is to define risk factors that predict rebleeding or need for urgent operation in patients with diverticular hemorrhage. Retrospective study was conducted on patients who were admitted for diverticular hemorrhage. Data pertaining to patient and bleeding characteristics, method of diagnosis, blood transfusion and type of operation were collected. Multivariate analysis model compared patients who experienced single bleeding episode with those with recurrent episodes, and patients who underwent surgery with those who did not. One hundred and four patients met the inclusion criteria. Thirty four patients experienced more than one bleeding episode. Ten patients needed surgery for recurrent bleeding. Five patients presented with hemodynamic instability, none of them required surgical treatment. Neither patients' comorbidity nor anticoagulant and antiaggregant treatments were associated with increased risk for recurrent hemorrhage. Diabetes mellitus was correlated with decreased risk for recurrent hemorrhage, OR = 0.21, (CI 95% (0.06-0.73)); p = 0.014. Independent risk factor for massive recurrent diverticular hemorrhage requiring surgery was right sided diverticulosis, OR = 4.6(CI 95% (2.1-19)); p = 0.006. Right colon diverticulosis rather than patient characteristics and medical treatment should prompt for aggressive management with lower threshold for surgical intervention. Copyright © 2016 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

  18. Maternal outcomes after uterine balloon tamponade for postpartum hemorrhage.

    Science.gov (United States)

    Martin, Emmanuelle; Legendre, Guillaume; Bouet, Pierre-Emmanuel; Cheve, Marie-Therese; Multon, Olivier; Sentilhes, Loïc

    2015-04-01

    To evaluate maternal outcomes following uterine balloon tamponade in the management of postpartum hemorrhage. Retrospective case-series. Two French hospitals, a level 3 university referral center and a level 2 private hospital. All women who underwent balloon tamponade treatment for primary postpartum hemorrhage. Uterine tamponade was used after standard treatment of postpartum hemorrhage had failed. The study population was divided into two groups, successful cases where the bleeding stopped after the balloon tamponade, and failures requiring subsequent surgery or embolization. Success rates. Uterine tamponade was used in 49 women: 30 (61%) after vaginal delivery and 19 (39%) after cesarean section. Uterine atony was the main cause of hemorrhage (86%). The overall success rate was 65%. Of 17 failures, surgery was required in 16 cases, including hysterectomy in 11, and uterine artery embolization in one case. Demographic and obstetric characteristics did not differ significantly between the success and failure groups. No complications were directly attributed to the balloon tamponade in the postpartum period. Two women had a subsequent full-term pregnancy without recurrence of postpartum hemorrhage. Balloon tamponade is an effective, safe and readily available method for treating primary postpartum hemorrhage and could reduce the need for invasive procedures. © 2015 Nordic Federation of Societies of Obstetrics and Gynecology.

  19. Protection against myxomatosis and rabbit viral hemorrhagic disease with recombinant myxoma viruses expressing rabbit hemorrhagic disease virus capsid protein.

    OpenAIRE

    Bertagnoli, Stéphane; Gelfi, Jacqueline; Le Gall, Ghislaine; Boilletot, Eric; Vautherot, Jean-François; Rasschaert, Denis; Laurent, Sylvie; Petit, Frédérique; Boucraut-Baralon, Corine; Milon, Alain

    1996-01-01

    Two myxoma virus-rabbit hemorrhagic disease virus (RHDV) recombinant viruses were constructed with the SG33 strain of myxoma virus to protect rabbits against myxomatosis and rabbit viral hemorrhagic disease. These recombinant viruses expressed the RHDV capsid protein (VP60). The recombinant protein, which is 60 kDa in size, was antigenic, as revealed by its reaction in immunoprecipitation with antibodies raised against RHDV. Both recombinant viruses induced high levels of RHDV- and myxoma vir...

  20. ANESTHETIC MANAGEMENT OF ATONIC POST - PARTUM HEMORRHAGE WITH HEMORRHAGIC SHOCK AND IMPENDING CARDIAC ARREST FOR EMERGENCY PERIPARTUM HYSTERECTOMY

    Directory of Open Access Journals (Sweden)

    Ravishankar

    2015-07-01

    Full Text Available Post - partum hemorrhagic complication is a critical situation for an anesthesiologist, which requires timely and skillful anesthetic management. A massive post - partum bleeding leading to severe hypovolemic shock may result in life threatening cardio - pulmonary arrest. Here is a case report of 25 year old with atonic post - partum hemorrhage resulting in hypovolemic shock & impending cardiac arrest and successful anesthetic management for emergency peripartum hysterectomy to save the life of the patient.

  1. Report of Intracerebral Hemorrhage Following Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Akvan Paymard

    2017-03-01

    Full Text Available Background and Objectives: Stroke is a rare complication of myocardial infarction (AMI. Aspirin, plavix, and enoxaparin are among drug treatments for myocardial infarction, which lead to stroke. The present study is a case report of stroke after myocardial infarction, which discusses patient’s records and clinical history along with paraclinical findings. Case Report: The patient was a 60-year-old man with a history of heart disease and diabetes, presented with severe chest pain and dyspnea to the Emergency Department of Yasuj Sajad Hospital on January 29, 2015, and after taking ECG, it was found that there was no signs of myocardial infarction, but troponin test was positive two times. The diagnosis was myocardial infarction without ST segment elevation. The patient took aspirin and plavix, and after subcutaneous injection of enoxaparin at the dose of 80 mg, his level of consciousness decreased, which caused GCS:5, right-side mydriasis, and motor paralysis in the left half of the body, therefore, CT was performed, and the patient that had about 90 ml hemorrhage in temporoparietal lobe. The patient was transformed to the operating room and 60 ml blood was removed using partial lobectomy and a microscope. After hospitalization in ICU for several days, the patient was extubated under the SIMV mode. Considering the high prevalence of heart disease, especially increasing rate of myocardial infarction in the country, anticoagulants should be more carefully used and after administration of this group of drugs, patients be regularly monitored for side effects.

  2. Primary pontine hemorrhage. A clinical study

    Energy Technology Data Exchange (ETDEWEB)

    Saito, Jun; Kagimoto, Hiroshi; Maeda, Masanobu; Soda, Takao [Shimane Prefectural Central Hospital, Izumo (Japan)

    2002-07-01

    We studied the relationship between outcome and clinical symptoms or CT findings of 34 cases with primary pontine hemorrhage diagnosed by CT scan from April 1994 to March 1999. This series comprised 19 males and 15 females ranging in age from 45 to 89 years with a mean of 67.1 years. According to their outcome at discharge, the cases were divided into 6 groups. Sixteen cases died within 2 weeks after onset (group AD), 4 cases died with complication in the chronic phase (group D), 3 cases were severely disabled to bed-ridden state (group C), 2 cases recovered to a daily life with wheelchair (group B), 4 cases recovered to a daily life with partial assistance (group A), and 5 cases showed a full recovery (group J). The factors significantly correlated with bed outcome are as follows: young age, consciousness disturbance, respiratory disturbance, tachycardia over 90 beats per minute, hyperthermia over 39 deg C, abnormal pupils, loss of oculocephalic reflex, tetraplegia, decerebrate rigidity, bilateral extension or over 30 mm transverse diameter of the hematoma. (author)

  3. Crimean-Congo hemorrhagic fever in Iran

    Science.gov (United States)

    Keshtkar-Jahromi, Maryam; Sajadi, Mohammad M.; Ansari, Hossein; Mardani, Masoud; Naieni, Kourosh Holakouie

    2014-01-01

    The presence of Crimean-Congo hemorrhagic fever virus (CCHFV) in Iran was first identified in studies of livestock sera and ticks in the 1970s, but the first human infection was not diagnosed until 1999. Since that time, the number of cases of CCHF in Iran has markedly increased. Through January 2012, articles in the published literature have reported a total of 870 confirmed cases, with 126 deaths, for a case fatality rate (CFR) of 17.6%. The disease has been seen in 26 of the country’s 31 provinces, with the greatest number of cases in Sistan and Baluchestan, Isfahan, Fars, Tehran, Khorasan, and Khuzestan provinces. The increase in CCHF in Iran has paralleled that in neighboring Turkey, though the number of cases in Turkey has been much larger, with an overall CFR of around 5%. In this article, we review the features of CCHF in Iran, including its history, epidemiology, animal and tick reservoirs, current surveillance and control programs, diagnostic methods, clinical features and experience with ribavirin therapy, and consider possible explanations for the difference in the CFR of CCHF between Iran and Turkey. The emergence of CCHF in Iran calls for countermeasures at many levels to protect the population, but also provides opportunities for studying the epidemiology, diagnosis and management of the disease. PMID:23872313

  4. Hemorrhagic fever with renal syndrome in Montenegro.

    Science.gov (United States)

    Gledovic, Z B; Jeknic, A S; Grgurevic, A D; Rakocevic, B B; Bozovic, B R; Mugosa, B V

    2008-09-01

    The objective of the study was to analyze the epidemiological features of hemorrhagic fever with renal syndrome (HFRS) in Montenegro. The study included 169 cases of HFRS diagnosed in the period between 1995 and 2005 according to the clinical symptoms and serological confirmation. For the analysis of the demographic characteristics of the cases, as well as of the chronological and topographical features of the disease, a descriptive epidemiological method was employed. The average incidence rate in the observed period was 2.6 per 100,000. In the observed period, 8 people died; the average case fatality rate was 4.8% (range: 0.1-15%). Among the diseased persons, 116 were males and 53 were females; most of the cases were adults. The greatest number of HFRS cases occurred during the summer months. The highest incidence rates were registered in the northeastern, rural part of the country. The most frequent type of hantaviruses in Montenegro were Dobrava-Belgrade and Hantaan, carried by rodent species, i.e., the yellow-neck mouse and the striped-field mouse. It is likely that HFRS in Montenegro will become more common in the near future, unless public health control measures are taken.

  5. Diffuse Alveolar Hemorrhage Associated with Edoxaban Therapy

    Directory of Open Access Journals (Sweden)

    Kenichi Nitta

    2016-01-01

    Full Text Available Introduction. The main adverse effect of anticoagulant therapy is bleeding, and major bleeding, including intracranial, gastrointestinal, and retroperitoneal bleeding, has been reported as an adverse effect of edoxaban, a direct oral anticoagulant (DOAC. Bleeding during systemic anticoagulation with edoxaban presents a therapeutic conundrum, because there is currently no safe or efficacious reversal agent to stop major bleeding. Case Report. A 51-year-old woman had multiple traumatic injuries, including lower limb fractures. On day 8, she developed deep venous thrombosis, and edoxaban was administered orally. On day 38, she developed fungemia, which was treated with an antifungal drug. On day 43, she presented with dyspnea. Chest computed tomography scan showed bilateral diffuse ground-glass opacities in the whole lung fields. The results of the subsequent workup (i.e., serum levels of the antineutrophil cytoplasmic antibody, antinuclear antibody, and antiglomerular basement membrane antibody and microbiological study were unremarkable. Based on these findings, her condition was diagnosed as diffuse alveolar hemorrhage (DAH associated with edoxaban therapy. The lung opacities disappeared spontaneously after edoxaban therapy was discontinued. Conclusion. DAH is a dangerous complication associated with edoxaban therapy. DOACs, including edoxaban, should be prescribed with caution, especially for patients in a critical condition.

  6. Evaluation of hemodynamic effects of xenon in dogs undergoing hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Ruben C. Franceschi

    2013-01-01

    Full Text Available OBJECTIVES: The anesthetic gas xenon is reported to preserve hemodynamic stability during general anesthesia. However, the effects of the gas during shock are unclear. The objective of this study was to evaluate the effect of Xe on hemodynamic stability and tissue perfusion in a canine model of hemorrhagic shock. METHOD: Twenty-six dogs, mechanically ventilated with a fraction of inspired oxygen of 21% and anesthetized with etomidate and vecuronium, were randomized into Xenon (Xe; n = 13 or Control (C; n = 13 groups. Following hemodynamic monitoring, a pressure-driven shock was induced to reach an arterial pressure of 40 mmHg. Hemodynamic data and blood samples were collected prior to bleeding, immediately after bleeding and 5, 20 and 40 minutes following shock. The Xe group was treated with 79% Xe diluted in ambient air, inhaled for 20 minutes after shock. RESULT: The mean bleeding volume was 44 mL.kg-1 in the C group and 40 mL.kg-1 in the Xe group. Hemorrhage promoted a decrease in both the cardiac index (p<0.001 and mean arterial pressure (p<0.001. These changes were associated with an increase in lactate levels and worsening of oxygen transport variables in both groups (p<0.05. Inhalation of xenon did not cause further worsening of hemodynamics or tissue perfusion markers. CONCLUSIONS: Xenon did not alter hemodynamic stability or tissue perfusion in an experimentally controlled hemorrhagic shock model. However, further studies are necessary to validate this drug in other contexts.

  7. The effects of antioxidants on a porcine model of liver hemorrhage.

    Science.gov (United States)

    Orfanos, Nikolaos F; Mylonas, Anastasios I; Karmaniolou, Iosifina I; Stergiou, Irene P; Lolis, Evangelos D; Dimas, Cleanthi; Papalois, Apostolos E; Kondi-Pafiti, Agathi I; Smyrniotis, Vasileios E; Arkadopoulos, Nikolaos F

    2016-06-01

    The aim of this study is to assess the efficacy of the combination of N-acetylcysteine (NAC) and deferoxamine (DFO) in the resuscitation from hemorrhagic shock in a porcine model of bleeding during hepatectomy. Twenty-one pigs were divided randomly to three groups: Sham (S) group, n = 5; fluid (F) resuscitation group, n = 8; and fluid plus NAC plus DFO (NAC&DFO) resuscitation group, n = 8. The animals of groups F and NAC&DFO were subjected to left hepatectomy and controlled hemorrhage from the traumatic liver surface. Shock was established within 10 minutes and maintained for 30 minutes at mean arterial pressure (MAP) of 30 to 40 mm Hg. Resuscitation followed the shock period with crystalloids and colloids. Group NAC&DFO received additionally NAC and DFO in doses of 200 mg/kg and 65 mg/kg, respectively. The total time of the experiment was 6 hours. Animal weight, blood loss, excised liver mass, and MAP at the end of the shock period were comparable between experimental groups. Group NAC&DFO received significantly lower volume of both crystalloids and colloids (35% and 42% less, respectively) compared to group F. Hepatocellular proliferation (proliferating cell nuclear antigen) was higher in the antioxidant group. Apoptosis, measured by caspase-3, was restored to sham group levels when NAC and DFO were administered. Our experimental study showed that coadministration of NAC and DFO during liver hemorrhage can decrease the amounts of fluids needed for resuscitation. Moreover, the antioxidant combination restores the energy dependent apoptosis and proliferation of the hepatocytes.

  8. Detection of CT occult aneurismal subarachnoid hemorrhage using a novel spectrophotometric analysis of cerebral spinal fluid

    Science.gov (United States)

    Salgaonkar, Vasant A.; Bhadri, Prashant R.; Huang, Jian; Kumar, Alla S.; Pyne, Gail J.; Caffery, James, Jr.; Clark, Joseph F.; Shukla, Rakesh; Beyette, Fred R., Jr.

    2005-04-01

    In North America, approximately 30,000 people annually suffer an aneurismal subarachnoid hemorrhage (SAH). Using computerized tomography (CT), the blood is generally not visible after 12 hours. Currently lumbar puncture (LP) results are equivocal for diagnosing SAH largely because of technical limitations in performing a quick and objective evaluation. Having ruptured once, an aneurysm is statistically more likely to rupture again. Therefore, for those individuals with a sentinel (or warning) hemorrhage, detection within the first 12 hours is paramount. We present a diagnostic technology based on visible spectroscopy to quickly and objectively assess low-blood volume SAH from a diagnostic spinal tap. This technology provides clinicians, with the resources necessary for assessing patients with suspected aneurismal SAH beyond the current 12-hour limitation imposed by CT scans. This aids in the improvement of patient care and results in rapid and appropriate treatment of the patient. To perform this diagnosis, we quantify bilirubin and hemoglobin in human CSF over a range of concentrations. Because the bilirubin and hemoglobin spectra overlap quantification is problematic. To solve this problem, two algorithmic approaches are presented: a statistical or a random stochastic component known as Partial Least Square (PLS) and a control theory based mathematical model. These algorithms account for the noise and distortion from blood in CSF leading to the quantification of bilirubin and methemoglobin spectroscopically. The configurations for a hardware platform is introduced, that is portable and user-friendly composed of specific components designed to have the sensitivity and specificity required. This aids in measuring bilirubin in CSF, hemorrhagic-CSF and CSF-like solutions. The prototype uses purpose built algorithms contained within the platform, such that physicians can use it in the hospital and lab as a point of care diagnostic test.

  9. Xenon neuroprotection in experimental stroke: interactions with hypothermia and intracerebral hemorrhage.

    Science.gov (United States)

    Sheng, Siyuan P; Lei, Beilei; James, Michael L; Lascola, Christopher D; Venkatraman, Talaignair N; Jung, Jin Yong; Maze, Mervyn; Franks, Nicholas P; Pearlstein, Robert D; Sheng, Huaxin; Warner, David S

    2012-12-01

    Xenon has been proven to be neuroprotective in experimental brain injury. The authors hypothesized that xenon would improve outcome from focal cerebral ischemia with a delayed treatment onset and prolonged recovery interval. Rats were subjected to 70 min temporary focal ischemia. Ninety minutes later, rats were treated with 0, 15, 30, or 45% Xe for 20 h or 0 or 30% Xe for 8, 20, or 44 h. Outcome was measured after 7 days. In another experiment, after ischemia, rats were maintained at 37.5° or 36.0°C for 20 h with or without 30% Xe. Outcome was assessed 28 days later. Finally, mice were subjected to intracerebral hemorrhage with or without 30% Xe for 20 h. Brain water content, hematoma volume, rotarod function, and microglial activation were measured. Cerebral infarct sizes (mean±SD) for 0, 15, 30, and 45% Xe were 212±27, 176±55, 160±32, and 198±54 mm, respectively (P=0.023). Neurologic scores (median±interquartile range) followed a similar pattern (P=0.002). Infarct size did not vary with treatment duration, but neurologic score improved (P=0.002) at all xenon exposure durations (8, 20, and 44 h). Postischemic treatment with either 30% Xe or subtherapeutic hypothermia (36°C) had no effect on 28-day outcome. Combination of these interventions provided long-term benefit. Xenon improved intracerebral hemorrhage outcome measures. Xenon improved focal ischemic outcome at 7, but not 28 days postischemia. Xenon combined with subtherapeutic hypothermia produced sustained recovery benefit. Xenon improved intracerebral hemorrhage outcome. Xenon may have potential for clinical stroke therapy under carefully defined conditions.

  10. Therapeutic effect of minimally invasive intracranial hematoma evacuation in the treatment of hypertensive cerebral hemorrhage and TCD evaluation

    Directory of Open Access Journals (Sweden)

    Zi-Hao Zhang

    2017-06-01

    Full Text Available Objective: To explore the therapeutic effect of minimally invasive intracranial hematoma evacuation in the treatment of hypertensive cerebral hemorrhage and the value of dynamic TCD monitoring in predicting the neurological function recovery. Methods: A total of 70 patients with hypertensive cerebral hemorrhage who were admitted in our hospital were included in the study and divided into the minimally invasive group and conservative group with 35 cases in each group according to different treatment protocols. The patients in the two groups were given drug conservative treatments. On this basis, the patients in the minimally invasive group were given urokinase in combined with minimally invasive hematoma puncture with YL-1 type needle. TCD was performed before treatment, 1 d, 5 d, 10 d, and 21 d after treatment. The hematoma and edema volume was calculated. NIHSS was used to evaluate the neurological function recovery. Results: Vs, Vd, and Vm after treatment in the minimally invasive group were significantly elevated, while PI was significantly reduced. Vs, Vd, and Vm after treatment in the conservative group were reduced first and elevated later, while PI was elevated first and reduced later, and reached the lowest/peak 10d after treatment. Vs, Vd, and Vm 5 d, 10 d, and 21 d after treatment in the minimally invasive group were significantly higher than those in the conservative group, while PI was significantly lower than that in the conservative group. The hematoma and edema volume after treatment in the two groups was significantly reduced. The hematoma and edema volume at each timing point was significantly lower than that in the conservative group. NIHSS score after treatment in the minimally invasive group was significantly reduced. NIHSS score in the conservative group was elevated first and reduced later, reached the peak 10d after treatment, and at each timing point was higher than that in the minimally invasive group. Conclusions: The

  11. Circulatory Management Focusing on Preventing Intraventricular Hemorrhage and Pulmonary Hemorrhage in Preterm Infants

    Directory of Open Access Journals (Sweden)

    Bai-Horng Su

    2016-12-01

    Full Text Available The goal of modern neonatal care of extremely preterm infants is to reduce mortality and long-term neurological impairments. Preterm infants frequently experience cerebral intraventricular or pulmonary hemorrhage, which usually occurs within 72 hours after birth and can lead to long-term neurological sequelae and mortality. These serious hemorrhagic complications are closely related to perinatal hemodynamic changes, including an increase in the afterload on the left ventricle of the heart after the infant is separated from the placenta, and an increased preload from a left-to-right shunt caused by a hemodynamically significant patent ductus arteriosus (PDA. The left ventricle of a preterm myocardium has limited ability to respond to such an increase in afterload and preload, and this can result in cardiac dysfunction and hemodynamic deterioration. We suggest that delayed umbilical cord clamping or umbilical cord milking to maintain optimal blood pressure and systemic blood flow (SBF, careful assessment to keep the afterload at an acceptable level, and a strategy of early targeted treatment of significant PDA to improve perfusion during this critical time period may reduce or prevent these serious complications in preterm infants.

  12. Computed tomography angiography spot sign predicts intraprocedural aneurysm rupture in subarachnoid hemorrhage.

    Science.gov (United States)

    Burkhardt, Jan-Karl; Neidert, Marian Christoph; Stienen, Martin Nikolaus; Schöni, Daniel; Fung, Christian; Roethlisberger, Michel; Corniola, Marco Vincenzo; Bervini, David; Maduri, Rodolfo; Valsecchi, Daniele; Tok, Sina; Schatlo, Bawarjan; Bijlenga, Philippe; Schaller, Karl; Bozinov, Oliver; Regli, Luca

    2017-07-01

    To analyze whether the computed tomography angiography (CTA) spot sign predicts the intraprocedural rupture rate and outcome in patients with aneurysmal subarachnoid hemorrhage (aSAH). From a prospective nationwide multicenter registry database, 1023 patients with aneurysmal subarachnoid hemorrhage (aSAH) were analyzed retrospectively. Descriptive statistics and logistic regression analysis were used to compare spot sign-positive and -negative patients with aneurysmal intracerebral hemorrhage (aICH) for baseline characteristics, aneurysmal and ICH imaging characteristics, treatment and admission status as well as outcome at discharge and 1-year follow-up (1YFU) using the modified Rankin Scale (mRS). A total of 218 out of 1023 aSAH patients (21%) presented with aICH including 23/218 (11%) patients with spot sign. Baseline characteristics were comparable between spot sign-positive and -negative patients. There was a higher clip-to-coil ratio in patients with than without aICH (both spot sign positive and negative). Median aICH volume was significantly higher in the spot sign-positive group (50 ml, 13-223 ml) than in the spot sign-negative group (18 ml, 1-416; p sign-positive aICH thus were three times as likely as those with spot sign-negative aICH to show an intraoperative aneurysm rupture [odds ratio (OR) 3.04, 95% confidence interval (CI) 1.04-8.92, p = 0.046]. Spot sign-positive aICH patients showed a significantly worse mRS at discharge (p = 0.039) than patients with spot sign-negative aICH (median mRS 5 vs. 4). Logistic regression analysis showed that the spot sign was an aICH volume-dependent predictor for outcome. Both spot sign-positive and -negative aICH patients showed comparable rates of hospital death, death at 1YFU and mRS at 1YFU. In this multicenter data analysis, patients with spot sign-positive aICH showed higher aICH volumes and a higher rate of intraprocedural aneurysm rupture, but comparable long-term outcome to spot sign-negative a

  13. Incidence of retinal hemorrhages in abusive head trauma.

    Science.gov (United States)

    Gaffar, Majida A; Esernio-Jenssen, Debra; Kodsi, Sylvia R

    2013-01-01

    To evaluate whether a relationship exists between the presence of retinal hemorrhages and confessions and/or identified perpetrators in cases of abusive head trauma. A retrospective chart review was conducted of all abusive head trauma cases. All cases that met criteria for abusive head trauma were placed into one of three categories: perpetrator confessed (category A), perpetrator identified without confession (category B), and no perpetrator identified (category C). Forty-eight cases met the criteria for abusive head trauma, with 18, 16, and 14 cases in categories A, B, and C, respectively. Retinal hemorrhages were identified in 16 of 18 (88%) cases in category A, 12 of 16 (75%) in category B, and 6 of 14 (43%) in category C. A statistically significant difference regarding the presence of retinal hemorrhages was seen for perpetrator identified (28 of 34 or 82%) compared to no perpetrator identified (6 of 14 or 43%) (P = .034). The difference in retinal hemorrhages was correlated to the higher incidence of acute presentation in the perpetrator identified group (31 of 34 or 91%) compared to that in the perpetrator not identified group (9 of 14 or 64%) (P = .023). The incidence of retinal hemorrhages in abusive head trauma for identified perpetrators, regardless of a confession, is similar. However, there is a statistically significant decrease in the incidence of retinal hemorrhages in abusive head trauma when comparing identified perpetrators to non-identified perpetrators. This decreased incidence of retinal hemorrhages was statistically correlated to a lower incidence of acute presentation in victims of abusive head trauma without an identified perpetrator.[J Pediatr Ophthalmol Strabismus 2013;50(3):169-172.]. Copyright 2013, SLACK Incorporated.

  14. [Marburg and Ebola hemorrhagic fevers--pathogens, epidemiology and therapy].

    Science.gov (United States)

    Stock, Ingo

    2014-09-01

    Marburg and Ebola hemorrhagic fevers are severe, systemic viral diseases affecting humans and non-human primates. They are characterized by multiple symptoms such as hemorrhages, fever, headache, muscle and abdominal pain, chills, sore throat, nausea, vomiting and diarrhea. Elevated liver-associated enzyme levels and coagulopathy are also associated with these diseases. Marburg and Ebola hemorrhagic fevers are caused by (Lake victoria) Marburg virus and different species of Ebola viruses, respectively. They are enveloped, single-stranded RNA viruses and belong to the family of filoviridae. Case fatality rates of filovirus disease outbreaks are among the highest reported for any human pathogen, ranging from 25 to 90% or more. Outbreaks of Marburg and Ebola hemorrhagic fever occur in certain regions of equatorial Africa at irregular intervals. Since 2000, the number of outbreaks has increased. In 2014, the biggest outbreak of a filovirus-induced hemorrhagic fever that has been documented so far occurred from March to July 2014 in Guinea, Sierra Leone, Liberia and Nigeria. The outbreak was caused by a new variant of Zaire Ebola-Virus, affected more than 2600 people (stated 20 August) and was associated with case-fatality rates of up to 67% (Guinea). Treatment of Marburg and Ebola hemorrhagic fevers is symptomatic and supportive, licensed antiviral agents are currently not available. Recently, BCX4430, a promising synthetic adenosine analogue with high in vitro and in vivo activity against filoviruses and other RNA viruses, has been described. BCX4430 inhibits viral RNA polymerase activity and protects cynomolgus macaques from Marburg virus infection when administered as late as 48 hours after infection. Nucleic acid-based products, recombinant vaccines and antibodies appear to be less suitable for the treatment of Marburg and Ebola hemorrhagic fevers.

  15. Hemostatic proteins and their association with hematoma growth in patients with acute intracerebral hemorrhage.

    Science.gov (United States)

    Martí-Fàbregas, Joan; Borrell, Montserrat; Silva, Yolanda; Delgado-Mederos, Raquel; Martínez-Ramírez, Sergi; de Juan-Delago, Manuel; Tirado, Isabel; Alejaldre, Aída; Marín, Rebeca; Martí-Vilalta, Josep-Lluis; Fontcuberta, Jordi

    2010-12-01

    We tested the hypothesis that proteins of hemostasia could be associated with hematoma growth (HG) in patients with acute intracerebral hemorrhage. We prospectively studied patients with spontaneous supratentorial intracerebral hemorrhage within the first 6 hours after the onset of symptoms. HG was defined as an increase > 33% in the volume of hematoma on CT obtained 24 to 72 hours after the onset of symptoms in comparison with the CT obtained at admission. We collected admission and follow-up blood samples. We measured fibrinogen, factor XIII, thrombin activatable fibrinolysis inhibitor, plasminogen activator inhibitor, plasminogen, α₂-antiplasmin, tissue plasminogen activator, d-dimer, thrombomodulin, thrombin-antithrombin complex, and plasmin-antiplasmin complex. We included 90 patients with a mean age of 71 ± 10.8 years; 61% were men. HG was observed in 35 (39%) of the patients. Mean baseline and follow-up protein measurements showed no difference between the groups with and without HG. The analysis of variance showed that factor XIII activity decreased in the non-HG group in the 24 to 72 hours sample, whereas it increased in the HG group (P = 0.001). Factor XIII was the only measured protein related to HG. The levels at the follow-up sample decreased in the non-HG group and increased in the HG group. Further studies are needed to confirm this association.

  16. Effects of propofol sedation during the early postoperative period in hemorrhagic stroke patients.

    Science.gov (United States)

    Hung, Yu-Chang; Lee, E-Jian; Chen, Hung-Yi; Ko, Shih-Wei; Shyr, Ming-Hwang; Chen, Tsung-Ying

    2009-09-01

    The early postoperative period is a critical time for patients after receiving a decompressive craniotomy. Prompt detection and early management of postoperative recurrent/residual hemorrhagic complications may dramatically improve clinical outcomes. The present cohort retrospective study involved 135 patients who received decompressive craniotomy and intensive care unit (ICU) supervision as life-saving measures. The purpose of the study was to evaluate the effects of propofol sedation on the clinical outcome during the ICU stay. The patients' demographic data, hemodynamic variables, the dose of propofol used during the first 48 hours after surgery, residual/recurrent blood clot volume after surgery, and neurologic and clinical outcomes were reviewed. The propofol dosages used for sedation were further divided into three categories: 3.33 mg/kg/hr, based on the doses infused during the first 12 hours after surgery. Our results indicated that the patients of the propofol-sedated group had a significantly smaller amount of residual/recurrent blood clot (p postoperative period after craniotomy in hemorrhagic stroke patients, because it improved both neurologic and clinical outcomes. However, early postoperative use of propofol sedation at larger dosages warrants special attention.

  17. Surfactant for pulmonary hemorrhage in neonates.

    Science.gov (United States)

    Aziz, Abdul; Ohlsson, Arne

    2008-04-16

    In the late 1960's and 1970's, pulmonary hemorrhage (PH) occurred mainly in full term infants with severe pre-existing illness. The incidence of PH was quoted as 1.3 per 1,000 live births. In the older medical literature, the risk factors associated with PH included the severity of the associated illness, intrauterine growth restriction, patent ductus arteriosus (PDA), coagulopathy, and the need for assisted ventilation. Presently, PH occurs mainly in preterm ventilated infants with severe respiratory distress syndrome (RDS) who often have a PDA and have received surfactant. Currently, PH complicates the hospital course of 3-5% of preterm infants with RDS. Although not clear, the cause of PH is thought to be due to a rapid lowering of intrapulmonary pressure, which facilitates left to right shunting across a patent ductus arteriosus and an increase in pulmonary blood flow. Retrospective case reports and one prospective uncontrolled study that used surfactant for PH in neonates have shown promising results in treating PH. To evaluate the effect of surfactant treatment compared to placebo or no intervention on mortality in neonates with pulmonary hemorrhage. In addition, the review will evaluate the effect of surfactant treatment on neonatal morbidities associated with PH compared to placebo or no intervention. The following databases were searched in January 2008: The Cochrane Central Register of Controlled Trials (CENTRAL, The Cochrane Library, Issue 4, 2007) and MEDLINE from 1966 and EMBASE from 1980 to the time of the full review using the OVID interface. The proceedings of the Annual Meetings of the Pediatric Academic Societies and the European Society of Pediatric Research published in Pediatric Research or electronically on their web sites were searched from 1994 to the time of the full review. Science citation index (Web of Science) was searched for authors quoting key references of observational studies. Randomised or quasi-randomised controlled trials that

  18. Comparison of fluid types for resuscitation in acute hemorrhagic shock and evaluation of gastric luminal and transcutaneous Pco2 in Leghorn chickens.

    Science.gov (United States)

    Wernick, Morena B; Steinmetz, Hanspeter W; Martin-Jurado, Olga; Howard, Judith; Vogler, Barbara; Vogt, Rainer; Codron, Daryl; Hatt, Jean-Michel

    2013-06-01

    The objective of this study was to compare the effects of 3 different fluid types for resuscitation after experimentally induced hemorrhagic shock in anesthetized chickens and to evaluate partial pressures of carbon dioxide measured in arterial blood (Paco2), with a transcutaneous monitor (TcPco2), with a gastric intraluminal monitor (GiPco2), and by end tidal measurements (Etco2) under stable conditions and after induced hemorrhagic shock. Hemorrhagic shock was induced in 40 white leghorn chickens by removing 50% of blood volume by phlebotomy under general anesthesia. Birds were divided into 4 groups: untreated (control group) and treated with intravenous hetastarch (haes group), with a hemoglobin-based oxygen carrier (hemospan group), or by autotransfusion (blood group). Respiratory rates, heart rates, and systolic arterial blood pressure (SAP) were compared at 8 time points (baseline [T0]; at the loss of 10% [T10%], 20% [T20%], 30% [T30%], 40% [T40%], and 50% [T50%] of blood volume; at the end of resuscitation [RES]; and at the end of anesthesia [END]). Packed cell volume (PCV) and blood hemoglobin content were compared at 6 time points (T0, T50%, RES, and 1, 3, and 7 days after induced hemorrhagic shock). Measurements of Paco2, TcPco2, GiPco2, and Etco2 were evaluated at 2 time points (T0 and T50%), and venous lactic acid concentrations were evaluated at 3 time points (T0, T50%, and END). No significant differences were found in mortality, respiratory rate, heart rate, PCV, or hemoglobin values among the 4 groups. Birds given fluid resuscitation had significantly higher SAPs after fluid administration than did birds in the control group. In all groups, PCV and hemoglobin concentrations began to rise by day 3 after phlebotomy, and baseline values were reached 7 days after blood removal. At T0, TcPco2 did not differ significantly from Paco2, but GiPco2 and Etco2 differed significantly from Paco2. After hemorrhagic shock, GiPco2 and TcPco2 differed significantly

  19. Course of Participation after Subarachnoid Hemorrhage.

    Science.gov (United States)

    Kruisheer, Elize M; Huenges Wajer, Irene M C; Visser-Meily, Johanna M A; Post, Marcel W M

    2017-05-01

    The study aimed to investigate participation problems in patients with subarachnoid hemorrhage (SAH), and the course of participation between 3 and 12 months post-SAH, and to identify determinants of this course. This is a prospective cohort study. The study was done in the SAH outpatient clinic at the University Medical Center Utrecht. Subjects included patients independent in activities of daily living who visited the SAH outpatient clinic for a routine follow-up visit 3 months after the event. Participation was assessed using the restrictions scale of the Utrecht Scale for Evaluation of Rehabilitation-Participation at 3, 6, and 12 months post-SAH. Repeated measures analysis of variance was conducted to identify possible determinants of participation (demographic and SAH characteristics, mood, and cognition). One hundred patients were included. Three months after SAH, the most commonly reported restrictions concerned work/unpaid work/education (70.5%), housekeeping (50.0%), and going out (45.2%). Twelve months post-SAH, patients felt most restricted in work/unpaid work/education (24.5%), housekeeping (23.5%), and chores in and around the house (16.3%). Participation scores increased significantly between 3 and 6 months, and between 3 and 12 months, post-SAH. The course of participation was associated with mood, cognition, and gender, but was in the multivariate analysis only determined by mood (F [1, 74] = 18.31, P = .000, partial eta squared: .20), showing lower participation scores at each time point for patients with mood disturbance. Participation in functionally independent SAH patients improved over time. However, 1 out of 3 patients (34.9%) still reported one or more participation restrictions 12 months post-SAH. Mood disturbance was negatively associated with the course of participation after SAH. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  20. Submacular hemorrhage: A study amongst Indian eyes

    Directory of Open Access Journals (Sweden)

    Ekta Rishi

    2012-01-01

    Full Text Available Aim: To evaluate the management outcomes amongst various treatment modalities for submacular hemorrhage (SMH in Indian subjects. Settings and Design: Retrospective, single-center study. Materials and Methods: Patients presenting with SMH between 1999 and 2006 were included. Treatment modalities included: vitrectomy with subretinal recombinant tissue plasminogen activator (r-tPA assisted SMH evacuation (group 1, n = 14; pneumatic displacement with intravitreal r-tPA and gas (group 2, n = 25; and pneumatic displacement with intraocular gas (group 3, n = 7. Favorable anatomical outcome was defined as complete displacement of SMH from fovea and favorable functional outcome was defined as a gain of >2 Snellen lines from the baseline. Kruskal-Wallis, analysis of variance (ANOVA, and Chi-square tests were used to compare the three groups, while Mann-Whitney and independent t-test were used to evaluate the influence of duration and size of SMH on outcomes. Results: There was no difference amongst groups in terms of favorable anatomical (P = 0.121 or functional outcomes (P = 0.611. Eyes with median duration of SMH less than 7.5 days had a significantly higher probability of achieving favorable anatomical outcome compared to eyes with SMH >14.5 days (P = 0.042. However, duration of SMH did not influence functional outcome (P = 0.595. Similarly, size of SMH did not affect anatomical (P = 0.578 or functional (P = 0.381 outcome. Median follow-up was 31.5, 6.5, and 2.5 months in the three groups, respectively. Conclusions: Co- existing posterior segment conditions and duration of SMH may influence the choice of treatment modality and treatment outcomes. Pneumatic displacement with r-tPA and r-tPA assisted vitrectomy appear to be favorable options for the management of SMH.

  1. Sensorineural hearing loss in hemorrhagic dengue?

    Science.gov (United States)

    Ribeiro, Bruna Natália Freire; Guimarães, Alexandre Caixeta; Yazawa, Felipe; Takara, Tammy Fumiko Messias; de Carvalho, Guilherme Machado; Zappelini, Carlos Eduardo Monteiro

    2015-01-01

    Dengue is an acute febrile infectious disease, with high fever followed by symptoms flu-like. Dengue hemorrhagic fever (DHF) is a vascular leak syndrome and could present spontaneous bleeding and worsening of symptoms after some days. Dengue could have some ENT manifestations, however hearing loss is not one of them. Sudden hearing loss is considered as sensorineural or perceptual hearing loss with a sudden onset in a person without other prior otological history. The relation between infectious diseases and sudden hearing are been investigated, some viruses were already linked, but the relation between dengue virus and sudden hearing still remains unknown. This article has the goal of presenting a case of DHF that evolved with SSHL in his hospitalization process. We report a 60 years-male patient of with DHF who developed bilateral secretory otitis media and sensorineural hearing loss after the fifth day of onset of symptoms. His hearing loss remained even after 7 months and the patient was referred for hearing aid fitting. This is the first case report that brings together DHF and sudden hearing loss. In the development of this case no other cause to sudden hearing loss was found and the correlation between dengue and hearing loss was questioned. In the literature review was found that some viruses, as mumps virus, varicella-zoster virus and HSV-1 and HSV-2 are related to sudden hearing loss, all of them fit in the viral theory. Besides the viral theory of sudden hearing loss, there is the vascular theory that is the occlusion of the end artery that supplies the cochlea. DHF has a vascular commitment, and the hypothesis of a vascular cause could be elicited in this case. Many studies in this area are needed and this article has the objective of elicit the discussion about the subject. Could dengue be associated with sensorineural hearing loss? Copyright © 2015. Published by Elsevier Ltd.

  2. Blood Pressure Management After Intracerebral Hemorrhage.

    Science.gov (United States)

    Sato, Shoichiro; Carcel, Cheryl; Anderson, Craig S

    2015-12-01

    Elevated blood pressure (BP), which presents in approximately 80 % of patients with acute intracerebral hemorrhage (ICH), is associated with increased risk of poor outcome. The Second Intensive Blood Pressure Reduction in Acute Cerebral Haemorrhage Trial (INTERACT2) study, a multinational, multicenter, randomized controlled trial published in 2013, demonstrated better functional outcomes with no harm for patients with acute spontaneous ICH within 6 h of onset who received target-driven, early intensive BP lowering (systolic BP target <140 mmHg within 1 h, continued for 7 days) and suggested that greater and faster reduction in BP might enhance the treatment effect by limiting hematoma growth. The trial resulted in revisions of guidelines for acute management of ICH, in which intensive BP lowering in patients with acute ICH is recommended as safe and effective treatment for improving functional outcome. BP lowering is also the only intervention that is proven to reduce the risk of recurrent ICH. Current evidences from several randomized trials, including PROGRESS and SPS3, indicate that long-term strict BP control in patients with ICH is safe and could offer additional benefits in major reduction in risk of recurrent ICH. The latest American Heart Association/American Stroke Association (AHA/ASA) guidelines recommended a target BP of <130/80 mmHg after ICH, but supporting evidence is limited. Randomized controlled trials are needed that focus on strict BP control, initiated early after onset of the disease and continued long-term, to demonstrate effective prevention of recurrent stroke and other major vascular events without additional harms in the ICH population.

  3. Optimal management of hereditary hemorrhagic telangiectasia

    Directory of Open Access Journals (Sweden)

    Garg N

    2014-10-01

    Full Text Available Neetika Garg,1 Monica Khunger,2 Arjun Gupta,3 Nilay Kumar4 1Department of Medicine, Beth Israel Deaconess Medical Center, Boston, MA, USA; 2Department of Medicine, All India Institute of Medical Sciences, New Delhi, India; 3Department of Medicine, UT Southwestern Medical Center, Dallas, TX, USA; 4Department of Medicine, Cambridge Health Alliance/Harvard Medical School, Cambridge, MA, USA Abstract: Hereditary hemorrhagic telangiectasia (HHT, also known by the eponym Osler–Weber–Rendu syndrome, is a group of related disorders inherited in an autosomal dominant fashion and characterized by the development of arteriovenous malformations (AVM in the skin, mucous membranes, and/or internal organs such as brain, lungs, and liver. Its prevalence is currently estimated at one in 5,000 to 8,000. Most cases are due to mutations in the endoglin (HHT1 or ACVRLK1 (HHT2 genes. Telangiectasias in nasal and gastrointestinal mucosa generally present with recurrent/chronic bleeding and iron deficiency anemia. Larger AVMs occur in lungs (~40%–60% of affected individuals, liver (~40%–70%, brain (~10%, and spine (~1%. Due to the devastating and potentially fatal complications of some of these lesions (for example, strokes and brain abscesses with pulmonary AVMs, presymptomatic screening and treatment are of utmost importance. However, due to the rarity of this condition, many providers lack an appreciation for the whole gamut of its manifestations and complications, age-dependent penetrance, and marked intrafamilial variation. As a result, HHT remains frequently underdiagnosed and many families do not receive the appropriate screening and treatments. This article provides an overview of the clinical features of HHT, discusses the clinical and genetic diagnostic strategies, and presents an up-to-date review of literature and detailed considerations regarding screening for visceral AVMs, preventive modalities, and treatment options. Keywords: arteriovenous

  4. MR imaging findings of retinal hemorrhage in a case of nonaccidental trauma

    Energy Technology Data Exchange (ETDEWEB)

    Altinok, Deniz; Saleem, Sheena; Smith, Wilbur [Children' s Hospital of Michigan, Department of Pediatric Imaging, Detroit, MI (United States); Zhang, Zaixiang [Wayne State University School of Medicine, Department of Radiology, Detroit, MI (United States); Markman, Lisa [Children' s Hospital of Michigan, Child Protection Team, Detroit, MI (United States)

    2009-03-15

    Retinal hemorrhage is a well-recognized manifestation of child abuse found in many babies with shaken baby syndrome. The presence of retinal hemorrhage is generally associated with more severe neurological damage and a worse clinical outcome. MR imaging findings of retinal hemorrhages are not well described in the pediatric literature. We present a 6-month-old boy with new-onset seizures, subdural hemorrhage and bilateral retinal hemorrhages that were detected by MRI and confirmed by indirect ophthalmoscopy. This case demonstrates the MR imaging findings of retinal hemorrhages and the importance of radiologists being able to recognize these specific imaging features. (orig.)

  5. Terson syndrome: a case report suggesting the mechanism of vitreous hemorrhage.

    Science.gov (United States)

    Ogawa, T; Kitaoka, T; Dake, Y; Amemiya, T

    2001-09-01

    To present a patient with Terson syndrome and to propose a mechanism for vitreous hemorrhage. Observational case report. A 50-year-old woman with subarachnoid hemorrhage and unilateral vitreous hemorrhage. Detailed examination with fluorescein angiography and funduscopy. Site of dye leakage on fluorescein angiography in the eye with vitreous hemorrhage. Fluorescein angiography showed the leakage site at the margin of the disc in the eye with vitreous hemorrhage after the vitreous hemorrhage had been removed. The damage to peripapillary tissues demonstrated by fluorescein leakage suggests that intracranial hypertension affects peripapillary structures through the intervaginal space of the optic nerve sheath.

  6. Control of Postpartum Hemorrhage Using Vacuum-Induced Uterine Tamponade.

    Science.gov (United States)

    Purwosunu, Yuditiya; Sarkoen, Widyastuti; Arulkumaran, Sabaratnam; Segnitz, Jan

    2016-07-01

    Postpartum hemorrhage is the leading cause of maternal mortality worldwide. Vacuum-induced uterine tamponade is a possible alternative approach to balloon tamponade systems for the treatment of postpartum hemorrhage resulting from atony. In a prospective proof-of-concept investigation of 10 women with vaginal deliveries in a hospital setting who failed first-line therapies for postpartum hemorrhage, tamponade was used. Vacuum-induced uterine tamponade was created through a device inserted transvaginally into the uterine cavity. An occlusion balloon built into the device shaft was inflated at the level of the external cervical os to create a uterine seal. Negative pressure was created by attaching a self-contained, mobile, electrically powered, pressure-regulated vacuum pump with a sterile graduated canister. In all 10 cases, the suction created an immediate seal at the cervical os, 50-250 mL of residual blood was evacuated from the uterine cavity, the uterus collapsed and regained tone within minutes, and hemorrhaging was controlled. The device remained in place for a minimum of 1 hour and up to 6.5 hours in one case while vaginal and perineal lacerations were easily repaired. This preliminary investigation suggests that a device designed to create vacuum-induced uterine tamponade may be a reasonable alternative to other devices used to treat atonic postpartum hemorrhage.

  7. Ebola hemorrhagic Fever: novel biomarker correlates of clinical outcome.

    Science.gov (United States)

    McElroy, Anita K; Erickson, Bobbie R; Flietstra, Timothy D; Rollin, Pierre E; Nichol, Stuart T; Towner, Jonathan S; Spiropoulou, Christina F

    2014-08-15

    Ebola hemorrhagic fever (EHF) outbreaks occur sporadically in Africa and result in high rates of death. The 2000-2001 outbreak of Sudan virus-associated EHF in the Gulu district of Uganda led to 425 cases, of which 216 were laboratory confirmed, making it the largest EHF outbreak on record. Serum specimens from this outbreak had been preserved in liquid nitrogen from the time of collection and were available for analysis. Available samples were tested using a series of multiplex assays to measure the concentrations of 55 biomarkers. The data were analyzed to identify statistically significant associations between the tested biomarkers and hemorrhagic manifestations, viremia, and/or death. Death, hemorrhage, and viremia were independently associated with elevated levels of several chemokines and cytokines. Death and hemorrhage were associated with elevated thrombomodulin and ferritin levels. Hemorrhage was also associated with elevated levels of soluble intracellular adhesion molecule. Viremia was independently associated with elevated levels of tissue factor and tissue plasminogen activator. Finally, samples from nonfatal cases had higher levels of sCD40L. These novel associations provide a better understanding of EHF pathophysiology and a starting point for researching new potential targets for therapeutic interventions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  8. A case of repeated intracerebral hemorrhages secondary to ventriculoperitoneal shunt

    Directory of Open Access Journals (Sweden)

    Jinbing Zhao

    2015-03-01

    Full Text Available Ventriculoperitoneal shunt is a routinely performed treatment in neurosurgical department. Intracerebral hemorrhage, as a complication after shunt catheterization, is really rare but with high mortality. In this study, we reported a case of a 74-year-old man who suffered from repeated intracerebral hemorrhage after ventriculoperitoneal shunt. The first hemorrhage happened 63 h after the 1st surgery, and most hematomas were located in the ipsilateral occipital lobe and intraventricles, along the ventricular catheter. Fresh blood clot casts blocked the external ventricular draining catheter, which was inserted into the right front horn during the 3rd surgery, indicating new intraventricular bleeding happened. A large hematoma in ipsilateral frontal lobe was detected on the 3rd day after the removal of external ventricular draining catheter. Different hemorrhagic locations and time points were encountered on the same case. We discussed the possible causes of repeated hemorrhage for this case, and the pre-operative preparation including risk evaluation in future clinical work.

  9. Lymphocytic choriomeningitis virus infection in FVB mouse produces hemorrhagic disease.

    Directory of Open Access Journals (Sweden)

    Frederick J Schnell

    2012-12-01

    Full Text Available The viral family Arenaviridae includes a number of viruses that can cause hemorrhagic fever in humans. Arenavirus infection often involves multiple organs and can lead to capillary instability, impaired hemostasis, and death. Preclinical testing for development of antiviral or therapeutics is in part hampered due to a lack of an immunologically well-defined rodent model that exhibits similar acute hemorrhagic illness or sequelae compared to the human disease. We have identified the FVB mouse strain, which succumbs to a hemorrhagic fever-like illness when infected with lymphocytic choriomeningitis virus (LCMV. FVB mice infected with LCMV demonstrate high mortality associated with thrombocytopenia, hepatocellular and splenic necrosis, and cutaneous hemorrhage. Investigation of inflammatory mediators revealed increased IFN-γ, IL-6 and IL-17, along with increased chemokine production, at early times after LCMV infection, which suggests that a viral-induced host immune response is the cause of the pathology. Depletion of T cells at time of infection prevented mortality in all treated animals. Antisense-targeted reduction of IL-17 cytokine responsiveness provided significant protection from hemorrhagic pathology. F1 mice derived from FVB×C57BL/6 mating exhibit disease signs and mortality concomitant with the FVB challenged mice, extending this model to more widely available immunological tools. This report offers a novel animal model for arenavirus research and pre-clinical therapeutic testing.

  10. Predictors of Symptomatic Cerebral Vasospasm in Spontaneous Subarachnoid Hemorrhage

    Directory of Open Access Journals (Sweden)

    Ezequiel López Espinosa

    2014-10-01

    Full Text Available Background: subarachnoid hemorrhage accounts for only 2 to 5 % of all cerebrovascular diseases; however it causes approximately 25 % of all deaths related to them. Objective: to identify the factors contributing to the prediction of symptomatic cerebral vasospasm in patients diagnosed with subarachnoid hemorrhage. Methods: a prospective longitudinal study was conducted in 73 patients aged 15 years or more with subarachnoid hemorrhage admitted to the Carlos Manuel de Céspedes Provincial General Hospital in Granma province from January 2010 through October 2011. Descriptive and inferential statistics in addition to clinical epidemiology resources were used. Results: among the patients studied, 15 developed symptomatic cerebral vasospasm (20.5 %. Closely-related factors included: advanced age, loss of consciousness at the time of onset, intracranial hypertension as major clinical syndrome, water-electrolyte imbalance and respiratory arrhythmias. Low scores on the Glasgow Coma scale and high scores on the Hunt and Hess scale and the World Federation of Neurosurgical Societies scale are related to the presence of symptomatic cerebral vasospasm in spontaneous subarachnoid hemorrhage. Conclusions: in most cases, diagnosis of vasospasm after subarachnoid hemorrhage is clinically established. Relying on clinical predictors can be useful.

  11. Factors associated with in-hospital mortality following intracerebral hemorrhage: a three-year study in Tehran, Iran.

    Science.gov (United States)

    Togha, Mansooreh; Bakhtavar, Khadigeh

    2004-06-14

    Primary intracerebral hemorrhage (ICH) is one of the common vascular insults with a relatively high rate of mortality. The aim of the current study was to determine the mortality rate and to evaluate the influence of various factors on the mortality of patients with intracerebral hemorrhage (ICH). Demographic characteristics along with clinical features and neuroimaging information on 122 patients with primary ICH admitted to Sina Hospital between 1999-2002 were assessed by multivariate analysis. Of 122 patients diagnosed with intracerebral hemorrhage, 70 were men and 52 were women. Sixty-nine percent of subjects were between 60 to 80 years of age. A history of hypertension was the primary cause in 67.2% of participants and it was found more frequent compared to other cardiovascular risk factors such as a history of ischemic heart disease (17.2%), diabetes mellitus (18%) and cigarette smoking (13.1%). The overall mortality rate among ICH patients admitted to the hospital was 46.7%. About one third of the deaths occurred within the first two days after brain injury. Factor independently associated with in-hospital mortality were Glasgow Coma Scale (GCS) score (volume of hematoma and and intraventricular hematoma. Higher rate of mortality were observed during the first two weeks of hospitalization following ICH. Neuroimaging features along with GCS score can help the clinicians in developing their prognosis.

  12. Factors associated with in-hospital mortality following intracerebral hemorrhage: a three-year study in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Bakhtavar Khadigeh

    2004-06-01

    Full Text Available Abstract Background Primary intracerebral hemorrhage (ICH is one of the common vascular insults with a relatively high rate of mortality. The aim of the current study was to determine the mortality rate and to evaluate the influence of various factors on the mortality of patients with intracerebral hemorrhage (ICH. Demographic characteristics along with clinical features and neuroimaging information on 122 patients with primary ICH admitted to Sina Hospital between 1999–2002 were assessed by multivariate analysis. Results Of 122 patients diagnosed with intracerebral hemorrhage, 70 were men and 52 were women. Sixtynine percent of subjects were between 60 to 80 years of age. A history of hypertension was the primary cause in 67.2% of participants and it was found more frequent compared to other cardiovascular risk factors such as a history of ischemic heart disease (17.2%, diabetes mellitus (18% and cigarette smoking (13.1%. The overall mortality rate among ICH patients admitted to the hospital was 46.7%. About one third of the deaths occurred within the first two days after brain injury. Factor independently associated with in-hospital mortality were Glasgow Coma Scale (GCS score (≤ 8, diabetes mellitus disease, volume of hematoma and and intraventricular hematoma. Conclusion Higher rate of mortality were observed during the first two weeks of hospitalization following ICH. Neuroimaging features along with GCS score can help the clinicians in developing their prognosis.

  13. Effects of different types of fluid resuscitation for hemorrhagic shock on splanchnic organ microcirculation and renal reactive oxygen species formation.

    Science.gov (United States)

    Wu, Chun-Yu; Chan, Kuang-Cheng; Cheng, Ya-Jung; Yeh, Yu-Chang; Chien, Chiang-Ting

    2015-12-11

    than in the other groups. Although fluid resuscitation with NS restored the MAP and decreased lactatemia following hemorrhagic shock, intestinal microcirculation was restored only by other volume expanders, namely 3% HTS, GEL, and HES. However, reperfusion-induced renal ROS formation was significantly higher when synthetic colloids were used.

  14. Beneficial effects of elevating cardiac preload on left-ventricular diastolic function and volume during heat stress

    DEFF Research Database (Denmark)

    Brothers, R M; Pecini, Redi; Dalsgaard, M

    2014-01-01

    Volume loading normalizes tolerance to a simulated hemorrhagic challenge in heat-stressed individuals, relative to when these individuals are thermoneutral. The mechanism(s) by which this occurs is unknown. This project tested two unique hypotheses; that is, the elevation of central blood volume ...

  15. 17-DMAG Diminishes Hemorrhage-Induced Small Intestine Injury by Elevating Bcl-2 Protein and Inhibiting iNOS Pathway, TNF-alpha Increase, and Caspase-3 Activation

    Science.gov (United States)

    2011-06-03

    Blood Flow Metab 2004, 24:419-31. 14. Jiang X and Wang, X: Cytochrome-c-mediated apoptosis. Annu Rev Biochem 2004, 73:87- 106. 15. Lakhani SA...variety of injuries, ranging from wound trauma to stroke, aneurysm , birth labor, or blast impact. Hemorrhage lowers the levels of oxygen and nutrition...of their calculated blood volume [32] removed by cardiac puncture over a period of 1 minute using a 26 gauge needle and 1.0 ml syringe essentially

  16. Ultrasound-induced lung hemorrhage: Role of acoustic boundary conditions at the pleural surface

    Science.gov (United States)

    O'Brien, William D.; Kramer, Jeffrey M.; Waldrop, Tony G.; Frizzell, Leon A.; Miller, Rita J.; Blue, James P.; Zachary, James F.

    2002-02-01

    In a previous study [J. Acoust. Soc. Am. 108, 1290 (2000)] the acoustic impedance difference between intercostal tissue and lung was evaluated as a possible explanation for the enhanced lung damage with increased hydrostatic pressure, but the hydrostatic-pressure-dependent impedance difference alone could not explain the enhanced occurrence of hemorrhage. In that study, it was hypothesized that the animal's breathing pattern might be altered as a function of hydrostatic pressure, which in turn might affect the volume of air inspired and expired. The acoustic impedance difference between intercostal tissue and lung would be affected with altered lung inflation, thus altering the acoustic boundary conditions. In this study, 12 rats were exposed to 3 volumes of lung inflation (inflated: approximately tidal volume; half-deflated: half-tidal volume; deflated: lung volume at functional residual capacity), 6 rats at 8.6-MPa in situ peak rarefactional pressure (MI of 3.1) and 6 rats at 16-MPa in situ peak rarefactional pressure (MI of 5.8). Respiration was chemically inhibited and a ventilator was used to control lung volume and respiratory frequency. Superthreshold ultrasound exposures of the lungs were used (3.1-MHz, 1000-Hz PRF, 1.3-μs pulse duration, 10-s exposure duration) to produce lesions. Deflated lungs were more easily damaged than half-deflated lungs, and half-deflated lungs were more easily damaged than inflated lungs. In fact, there were no lesions observed in inflated lungs in any of the rats. The acoustic impedance difference between intercostal tissue and lung is much less for the deflated lung condition, suggesting that the extent of lung damage is related to the amount of acoustic energy that is propagated across the pleural surface boundary.

  17. Predicting of mortality in patients with intracrani al hemorrhage: A review article

    Directory of Open Access Journals (Sweden)

    Farzad Rahmani

    2014-11-01

    Full Text Available Introduction: Stroke is one of the important and common diseases, which can lead to permanent disability or even death to people. Intracranial hemorrhage (ICH is a type of stroke that is associated with high mortality despite improved diagnostic and treatment methods, as well as the mortality rate remains high. Methods: In the present review article, reputable internet databases since 2000 were analyzed. Studies that discussed the predicting mortality of ICH were included in this review. Results: For predicting the mortality rates in patients with primary ICH, physicians use several methods such as level of consciousness, bleeding volume and multiple rating systems. In this review, we introduce three scoring system of ICH in patients with ICH. Conclusion: Perhaps its cut-off point of these three score systems were different in different societies according to conditions and facilities therefore it is needed to review these scores and record their results in different societies.

  18. Normal saline influences coagulation and endothelial function after traumatic brain injury and hemorrhagic shock in pigs

    DEFF Research Database (Denmark)

    Dekker, Simone E; Sillesen, Martin; Bambakidis, Ted

    2014-01-01

    BACKGROUND: Traumatic brain injury (TBI) and hemorrhagic shock (HS) are the leading causes of trauma-related deaths. These insults disrupt coagulation and endothelial systems. This study investigated whether previously reported differences in lesion size and brain swelling during normal saline (NS......), colloids (Hextend [HEX]), and fresh frozen plasma (FFP) resuscitation are associated with differential effects on coagulation and endothelial systems. METHODS: We subjected 15 Yorkshire swine to TBI and HS (40% blood volume), and kept in HS for 2 hours before resuscitation with NS, HEX, or FFP. Markers...... of endothelial activation (E-selectin, Intercellular adhesion molecule [ICAM]-1), coagulation activation (prothrombin fragment 1 + 2), and natural anticoagulation (activated protein C [aPC]) were determined in serum and brain whole cell lysates. RESULTS: Serum levels of aPC were greater in the NS group (203 ± 30...

  19. Thoracic epidural anesthesia attenuates hemorrhagic-induced splanchnic hypo-perfusion in post-resuscitation experimental hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Amir S Madjid

    2008-06-01

    Full Text Available The purpose of present study was to assess the effects of thoracic epidural anesthesia on splanchnic perfusion, bacterial translocation and histopathologic changes in experimental hemorrhagic shock in short-tailed macaques (Macaca nemestrina. Sixteen Macaca nemestrinas were randomly assigned to one of two groups i.e. the lidocaine group (n = 8, receiving general anesthesia plus lidocaine thoracic epidural anesthesia; and the saline group (n = 8, receiving general anesthesia alone as control. Hemorrhagic shock was induced by withdrawing blood gradually to a mean arterial pressure (MAP of 40 mm Hg, and maintained for 60 minutes. Animals were then resuscitated with their own blood and ringer lactate solution (RL. After resuscitation, epidural lidocaine 2% was given in the lidocaine group and saline in the control group. Resuscitation that was performed after one hour hemorrhagic shock, with hemodynamic variables and urine output returned to normal, revealed there was no improvement of splanchnic perfusion. PgCO2, P(g-aCO2, and pHi remained in critical value and tended to deteriorate in the saline group. Contrast to saline group, splanchnic perfusion in lidocaine group tended to improve. This condition was supported by the finding of less bacterial translocation and better histopathologic changes in lidocaine thoracic epidural anesthesia group than in saline group. This study concludes that lidocaine thoracic epidural anesthesia attenuates splachnic hypoperfusion in post-resuscitation hemorrhagic shock in Macaca nemestrina. (Med J Indones 2008; 17: 73-81Keywords: thoracic epidural anesthesia, lidocaine, hemorrhagic shock, splanchnic hypoperfusion, bacterial translocation

  20. [Bilateral adrenal hemorrhage due to adrenal metastasis of lung cancer].

    Science.gov (United States)

    Tamura, Keita; Furuse, Hiroshi; Sugiyama, Takayuki; Kato, Taiki; Suzuki, Takahisa; Kai, Fumitake; Nagata, Masao; Otsuka, Atsushi; Takayama, Tatsuya; Ishii, Yasuo; Mugiya, Soichi; Ozono, Seiichiro

    2013-01-01

    A 58-year-old man presented with nausea and left flank pain. The patient was referred to our hospital based on clear detection of anemia and computed tomography findings of bilateral adrenal tumors with hemorrhage and a mass in the apex of the left lung. Right adrenal artery embolization had no effect on enlargement of the right adrenal hematoma or advanced anemia. Right adrenalectomy was then performed in an attempt to control hemorrhaging and make a definitive diagnosis, and the patient's anemia improved following the operation. Histopathological diagnosis suggested adrenal metastasis of lung adenocarcinoma, which was subsequently diagnosed given similarities in transbronchial biopsy findings to those in the right adrenal gland. Adrenal hemorrhage due to metastasis of lung cancer is an extremely rare condition; indeed, to our knowledge, the present case is only the 26th reported worldwide. However, prognosis for this mortal condition may be improved should patients receive adrenalectomy followed by an appropriate treatment regimen.

  1. Anabolic steroid abuse causing recurrent hepatic adenomas and hemorrhage

    Science.gov (United States)

    Martin, Nicole M; Dayyeh, Barham K Abu; Chung, Raymond T

    2008-01-01

    Anabolic steroid abuse is common among athletes and is associated with a number of medical complications. We describe a case of a 27-year-old male bodybuilder with multiple hepatic adenomas induced by anabolic steroids. He initially presented with tumor hemorrhage and was treated with left lateral hepatic segmentectomy. Regression of the remaining tumors was observed with cessation of steroid use. However, 3 years and a half after his initial hepatic segmentectomy, he presented with recurrent tumor enlargement and intraperitoneal hemorrhage in the setting of steroid abuse relapse. Given his limited hepatic reserve, he was conservatively managed with embolization of the right accessory hepatic artery. This is the first reported case of hepatic adenoma re-growth with recidivistic steroid abuse, complicated by life-threatening hemorrhage. While athletes and bodybuilders are often aware of the legal and social ramifications of steroid abuse, they should continue to be counseled about its serious medical risks. PMID:18680242

  2. Cerebral Vasospasm after Subarachnoid Hemorrhage and Tadalafil-Nimodipine Hypothesis

    Directory of Open Access Journals (Sweden)

    Rayka Sharifian

    2013-07-01

    Full Text Available Cerebral vasospasm following subarachnoid hemorrhage (SAH is a common reaction induced by multiple factors with unclear mechanisms. This complication is difficult to treat and puts patient at risk for developing a delayed ischemic neurological deficit that can lead to substantial morbidity and mortality. Although numerous strategies have been suggested for the treatment and prevention of cerebral vasospasm following SAH, no definitive effect has been concluded in this regard. In this paper, we hypothesize that phosphodiesterase-5 inhibitors, tadalafil, can be used together with nimodipine, a calcium channel blocker, to prevent vasospasm in patients with subarachnoid hemorrhage. With synergic effects, the proposed drugs can promote relaxation of smooth muscles in spastic vessels. Keywords: Cerebral vasospasm; nimodipine; phosphodiesterase-5 inhibitor; subarachnoid hemorrhage; tadalafil

  3. Crimean-Congo hemorrhagic fever in Iran and neighboring countries.

    Science.gov (United States)

    Chinikar, S; Ghiasi, S M; Hewson, R; Moradi, M; Haeri, A

    2010-02-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic viral disease that is asymptomatic in infected livestock, but a serious threat to humans. Human infections begin with nonspecific febrile symptoms, but progress to a serious hemorrhagic syndrome with a case fatality rate of 2-50%. Although the causative virus is often transmitted by ticks, livestock-to-human and human-to-human transmissions also occur. The disease is one of the most widely distributed viral hemorrhagic fevers occurring in Africa, the Middle East, Asia, and some parts of Europe. In this study, we have focused on the CCHF situation in Iran and neighboring countries and provide evidence of over 5000 confirmed cases of CCHF in a single period/season.

  4. Crimean-Congo hemorrhagic fever in Iran and neighboring countries

    DEFF Research Database (Denmark)

    Chinikar, S; Ghiasi, Seyed Mojtaba; Hewson, R

    2010-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic viral disease that is asymptomatic in infected livestock, but a serious threat to humans. Human infections begin with nonspecific febrile symptoms, but progress to a serious hemorrhagic syndrome with a case fatality rate of 2-50%. Although...... the causative virus is often transmitted by ticks, livestock-to-human and human-to-human transmissions also occur. The disease is one of the most widely distributed viral hemorrhagic fevers occurring in Africa, the Middle East, Asia, and some parts of Europe. In this study, we have focused on the CCHF situation...... in Iran and neighboring countries and provide evidence of over 5000 confirmed cases of CCHF in a single period/season....

  5. Hemostatic resuscitation in postpartum hemorrhage - a supplement to surgery

    DEFF Research Database (Denmark)

    Ekelund, Kim; Hanke, Gabriele; Stensballe, Jakob

    2015-01-01

    BACKGROUND: Postpartum hemorrhage is a potentially life-threatening albeit preventable condition that persists as a leading cause of maternal death. Identification of safe and cost-effective hemostatic treatment options remains crucial as a supplement to surgery and uterotonic agents. OBJECTIVE......: This review summarizes the background, current evidence and recommendations with regard to the role of fibrinogen, tranexamic acid, prothrombin complex concentrate, desmopressin, and recombinant factor VIIa in the treatment of patients with postpartum hemorrhage. The benefits and evidence behind traditional...... identified from PubMed, EMBASE, Cochrane Library databases, and ClinicalTrial gov. RESULTS: Viscoelastic hemostatic assays were found to provide a real-time continuum of coagulation and fibrinolysis when introduced as a supplement in transfusion management of postpartum hemorrhage. Fibrinogen should...

  6. Efficacy observation of danshen injection iontophoresis treatment for vitreous hemorrhage

    Directory of Open Access Journals (Sweden)

    Jing Hao

    2013-11-01

    Full Text Available AIM: To probe into the clinical value of danshen injection iontophoresis in treatment of vitreous hemorrhage. METHODS: Eighty-eight vitreous hemorrhage patients(88 eyeswere selected from June 2012 to June 2013 in our hospital. The patients were divided into observation group and control group randomly, with 44 cases(44 eyesin each group. The patients in control group were treated with xueshuantong clinical drug treatment. The patients in observation group were treated with danshen injection iontophoresis clinical drug treatment. The clinical treatment and visual recovery situations of the patients in two groups were compared and analyzed. RESULTS: The cure rate and total effective rate of observation group were 75% and 95%. The cure rate and total effective rate of control group were 59% and 77%. There were statistically significant differences(PPCONCLUSION: Danshen injection iontophoresis therapy has positive role in improving clinical outcomes and promoting visual function for patients with vitreous hemorrhage.

  7. Imaging findings of hemorrhagic cystitis in pediatric oncology patients

    Energy Technology Data Exchange (ETDEWEB)

    McCarville, M.B.; Hoffer, F.A. [Department of Diagnostic Imaging, St. Jude Children' s Research Hospital, Memphis, TN (United States); Gingrich, J.R. [Dept. of Surgery, Division of Urology, St. Jude Children' s Research Hospital, Memphis, TN (United States); Jenkins, J.J. III [Dept. of Pathology, St. Jude Children' s Research Hospital, Memphis, TN (United States)

    2000-03-01

    In pediatric oncology patients, hemorrhagic cystitis may be a life-threatening complication of bone-marrow transplantation, chemotherapy, and/or radiation therapy. The inciting agent in urine can affect the entire urothelium from the renal collecting system to the bladder, and the severity of disease can vary. The radiologist often plays a key role in the diagnosis, follow-up, and occasionally the treatment of hemorrhagic cystitis and its complications. This review discusses the imaging findings in the kidneys and bladder in patients with hemorrhagic cystitis both before and after treatment for this disease. Findings on two-dimensional sonography, color Doppler and power Doppler sonography, computed tomography, magnetic resonance imaging, antegrade pyleography, and cystography are presented. (orig.)

  8. Innovative use of intravesical tacrolimus for hemorrhagic radiation cystitis.

    Science.gov (United States)

    Dave, Chirag N; Chaus, Fahad; Chancellor, Michael B; Lajness, Michelle; Peters, Kenneth M

    2015-10-01

    Hemorrhagic cystitis is a rare and severe late complication of pelvic radiation, and there is no regulatory-approved drug treatment. We present an 81-year-old man with a history of localized prostate cancer, which was treated with external beam radiation therapy and subsequently developed severe hemorrhagic radiation cystitis for which he has failed several treatments. We present the novel use of intravesical tacrolimus for the treatment of refractory radiation cystitis and gross hematuria. The patient tolerated the treatment well, and it resulted in the resolution of his gross hematuria without further consideration for formalin instillation or cystectomy and diversion. Intravesical tacrolimus is a safe, minimally invasive, and promising treatment option for radiation hemorrhagic cystitis.

  9. Hemorrhagic Stroke Associated with Pulmonary Edema and Catastrophic Cardiac Failure

    Directory of Open Access Journals (Sweden)

    Jiun-Chang Lee

    2008-06-01

    Full Text Available Cerebral arteriovenous fistula (AVF is a vascular malformation that is rare in the pediatric population. Older children with cerebral AVF tend to present with neurologic problems related to intracranial venous hypertension or intracranial hemorrhage. Cardiac and pulmonary complications following acute neurologic injury such as subarachnoid hemorrhage are common in adults, but are rarely reported in children. However, complications have been reported in cases of enterovirus 71 rhombencephalitis in infants and children and can cause high morbidity and mortality. Here, we report a 14-year-old boy who presented with cardiac failure associated with pulmonary edema following cerebral hemorrhagic stroke due to AVF. After aggressive investigation and management, we intervened before significant hypoxia and hypotension developed, potentially reducing the risk of long-term adverse neurologic consequences in this patient.

  10. Anabolic steroid abuse causing recurrent hepatic adenomas and hemorrhage.

    Science.gov (United States)

    Martin, Nicole M; Abu Dayyeh, Barham K; Chung, Raymond T

    2008-07-28

    Anabolic steroid abuse is common among athletes and is associated with a number of medical complications. We describe a case of a 27-year-old male bodybuilder with multiple hepatic adenomas induced by anabolic steroids. He initially presented with tumor hemorrhage and was treated with left lateral hepatic segmentectomy. Regression of the remaining tumors was observed with cessation of steroid use. However, 3 years and a half after his initial hepatic segmentectomy, he presented with recurrent tumor enlargement and intraperitoneal hemorrhage in the setting of steroid abuse relapse. Given his limited hepatic reserve, he was conservatively managed with embolization of the right accessory hepatic artery. This is the first reported case of hepatic adenoma re-growth with recidivistic steroid abuse, complicated by life-threatening hemorrhage. While athletes and bodybuilders are often aware of the legal and social ramifications of steroid abuse, they should continue to be counseled about its serious medical risks.

  11. A schizophrenic patient with cerebral infarctions after hemorrhagic shock

    Directory of Open Access Journals (Sweden)

    Youichi Yanagawa

    2013-01-01

    Full Text Available We herein report the fourth case of cerebral infarction, concomitant with hemorrhagic shock, in English literature. A 33-year-old male, who had been diagnosed with schizophrenia and given a prescription for Olanzapine, was discovered with multiple self-inflicted bleeding cuts on his wrist. On arrival, he was in hemorrhagic shock without verbal responsiveness, but his vital signs were normalized following infusion of Lactate Ringer′s solution. The neuroradiological studies revealed multiple cerebral ischemic lesions without any vascular abnormality. He was diagnosed with speech apraxia, motor aphasia, and dysgraphia, due to multiple cerebral infarctions. As there was no obvious causative factor with regard to the occurrence of cerebral infarction in the patient, the hypoperfusion due to hemorrhagic shock, and the thromboembolic tendency due to Olanzapine, might have acted together to lead to the patient′s cerebral ischemia.

  12. Terson syndrome with no cerebral hemorrhage: A case report.

    Science.gov (United States)

    Jing, Xiao-Bin; Sun, Li-Qian

    2014-01-01

    The present study reports the case of a 33-year-old male who presented with Terson syndrome with no cerebral hemorrhage secondary to traumatic brain injury (TBI). A computed tomography scan of the patient, who had sustained an impact injury to the right occipital region, showed no cerebral lesion. Ophthalmoscopy clearly demonstrated vitreous hemorrhage in both eye globes. Vitreous hemorrhage, which results from an abrupt increase in intracranial pressure (ICP), is associated with TBI. In this case, the visual disturbance was attributed to Terson syndrome secondary to TBI. Therefore, close ophthalmological and radiological evaluation is required in patients with TBI, in order to enable the diagnosis of Terson syndrome and an early vitrectomy.

  13. Manual of Hemorrhagic Fever with Renal Syndrome

    Science.gov (United States)

    1989-04-01

    studies of antibody avidities in IAHA through the course of infection were carried out with rotavirus and togavirus systems (122), and the mechanism...IAHA buffer. a. Blood is collected from several candidate donors in volumes of 5 ml and the IAHA sensitivity is tested by box titration. The blood...syndrome as candidate members of the Bunyaviridae family. Arch Virol 78 : 137-144, 1983 50. Martin ML, Regnery HL, Sasso DR, McCormick JB, Palmer EL

  14. Urotensinergic system genes in experimental subarachnoid hemorrhage.

    Science.gov (United States)

    Muñoz-Sánchez, M Á; Rodríguez-Rodríguez, A; Egea-Guerrero, J J; Gordillo-Escobar, E; Vilches-Arenas, Á; Carrillo-Vico, A; Guerrero, J M; Murillo-Cabezas, F

    2017-01-09

    Cerebral vasospasm, one of the main complications of subarachnoid hemorrhage (SAH), is characterized by arterial constriction and mainly occurs from day 4 until the second week after the event. Urotensin-II (U-II) has been described as the most potent vasoconstrictor peptide in mammals. An analysis is made of the serum U-II concentrations and mRNA expression levels of U-II, urotensin related peptide (URP) and urotensin receptor (UT) genes in an experimental murine model of SAH. An experimental study was carried out. Experimental operating room of the Biomedicine Institute of Seville (IBiS), Virgen del Rocío University Hospital (Seville, Spain). 96 Wistar rats: 74 SAH and 22 sham intervention animals. Day 1: blood sampling, followed by the percutaneous injection of 100μl saline (sham) or blood (SAH) into the subarachnoid space. Day 5: blood sampling, followed by sacrifice of the animals. Weight, early mortality, serum U-II levels, mRNA values for U-II, URP and UT. Serum U-II levels increased in the SAH group from day 1 (0.62pg/mL [IQR 0.36-1.08]) to day 5 (0.74pg/mL [IQR 0.39-1.43]) (p<0.05), though not in the sham group (0.56pg/mL [IQR 0.06-0.83] day 1; 0.37pg/mL [IQR 0.23-0.62] day 5; p=0.959). Between-group differences were found on day 5 (p<0.05). The ROC analysis showed that the day 5 serum U-II levels (AUC=0.691), URP mRNA (AUC=0.706) and UT mRNA (AUC=0.713) could discriminate between sham and SAH rats. The normal serum U-II concentration range in rats was 0.56pg/mL (IQR 0.06-0.83). The urotensinergic system is upregulated on day 5 in an experimental model of SAH. Copyright © 2016 Elsevier España, S.L.U. y SEMICYUC. All rights reserved.

  15. Etiology and outcome determinants of intracerebral hemorrhage in a south Indian population, A hospital-based study

    Directory of Open Access Journals (Sweden)

    Sunil K Narayan

    2012-01-01

    Full Text Available Background: There is paucity of methodologically sound published studies on intracerebral hemorrhage (ICH from India, on pub med/embase search. Aims: To explore etiology of ICH and correlate the causes, location, and size of hemorrhage to clinical outcome. Materials and Methods: A hospital-based descriptive study from South Indian eastern coastal town of Puducherry; 60 consecutive subjects aged > 12 years, predominantly of inbred Tamil population, with head CT evidence of intracerebral hemorrhage not associated with trauma and brain tumors, were recruited. Outcome at three months was measured using Glasgow Outcome scale, NIHSS and mortality. SPSS v 19 was used for statistical analysis. Results: Commonest etiological factor was hypertension, followed by bleeding diathesis, thrombolysis for myocardial infarction, and cortical vein thrombosis. Most frequent locations of hematoma were basal ganglia, thalamus, internal capsule, and cerebral and cerebellar parenchyma. Hematoma volume correlated significantly with systolic and mean arterial pressure but not with diastolic blood pressure. Poor outcome was correlated to size (P < 0.05 and intraventricular extension of hematoma (P < 0.05, and to systolic, diastolic and mean arterial pressure, but not to age, gender, smoking, alcoholism, ischemic heart disease, and blood sugar level. Among diabetic patients with ICH, the size of hematoma (P = 0.04 and severity of coma (P = 0.01 at admission were significantly worse compared to the non-diabetic, but not the outcome at three months [Glasgow outcome scale or mortality (P = 0.94 and 0.14]. Conclusions: The location of hemorrhage and correlation with outcome agreed with the patterns described for the non-white races in prior reports. Independence of outcome to diabetic status despite a more severe initial presentation may indicate importance of good care, even in high risk groups.

  16. Treatment with beta-hydroxybutyrate and melatonin is associated with improved survival in a porcine model of hemorrhagic shock.

    Science.gov (United States)

    Mulier, Kristine E; Lexcen, Daniel R; Luzcek, Elizabeth; Greenberg, Joseph J; Beilman, Gregory J

    2012-02-01

    The neuroprotective ketone β-hydroxybutyrate (BHB) and the antioxidant melatonin have been found at elevated levels in hibernating mammals. Previous studies in rat models of hemorrhagic shock have suggested a benefit. We compared infusion of 4M BHB and 43 mM melatonin (BHB/M) to 4M sodium chloride and 20% DMSO (control solution) to evaluate for potential benefits in porcine hemorrhagic shock. Hemorrhagic shock was induced to obtain systolic blood pressures <50 mmHg for 60 min. Pigs were treated with a bolus of either BHB/M (n=9) or control solution (n=8) followed by 4-h infusion of the either BHB/M or control solution. All animals were then resuscitated for 20 h after shock. Physiological data were continually recorded, and blood samples were taken at intervals throughout the experiment. Serum samples were analyzed via high resolution NMR for metabolomic response. BHB/M treatment significantly increased 24-h survival time when compared to treatment with control solution (100% versus 62%; p=0.050), with a trend toward decreased volume of resuscitative fluid administered to animals receiving BHB/M. BHB/M-treated animals had lower base deficit and higher oxygen consumption when compared to animals receiving control solution. Serum metabolite profiles revealed increases in β-hydroxybutyrate (BHB), succinate, 2-oxovalerate and adipate with BHB/M treatment as compared with animals treated with control infusion. Infusion of BHB/M conferred a survival benefit over infusion of control solution in hemorrhagic shock. BHB and its products of metabolism are identified in serum of animals subjected to shock and treated with BHB/M. Further preclinical studies are needed to clarify the mechanisms of action of this promising treatment strategy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  17. [Anesthetic management of severe or worsening postpartum hemorrhage].

    Science.gov (United States)

    Aya, A G; Ducloy-Bouthors, A-S; Rugeri, L; Gris, J-C

    2014-12-01

    Risk factors of maternal morbidity and mortality during postpartum hemorrhage (PPH) include non-optimal anesthetic management. As the anesthetic management of the initial phase is addressed elsewhere, the current chapter is dedicated to the management of severe PPH. A literature search was performed using PubMed and Medline databases, and the Cochrane Library, for articles published from 2003 up to and including 2013. Several keywords related to anesthetic and critical care practice, and obstetrical management were used, in various combinations. Guidelines from several societies and organisations were also read. When PPH worsens, one should ask for additional team personnel (professional consensus). Patients should be monitored for heart rate, blood pressure, skin and mucosal pallor, bleeding at skin puncture sites, diuresis and the volume of genital bleeding (grade B). Because of the possible rapid worsening of coagulapathy, patients should undergo regular evaluation of coagulation status (professional consensus). Prevention and management of hypothermia should be considered (professional consensus), by warming intravenous fluids and blood products, and by active body warming (grade C). Antibiotics should be given, if not already administered at the initial phase (professional consensus). Vascular fluids must be given (grade B), the choice being left at the physician discretion. Blood products transfusion should be decided based on the clinical severity of PPH (professional consensus). Priority is given to red blood cells (RBC) transfusion, with the aim to maintain Hb concentration>8g/dL. The first round of products could include 3 units of RBC (professional consensus), and the following round 3 units of RBC, and 3 units of fresh frozen plasma (FFP). The FFP:RBC ratio should be kept between 1:2 and 1:1 (professional consensus). Depending on the etiology of PPH, the early administration of FFP is left at the discretion of the physician (professional consensus

  18. Effects of intraosseous erythropoietin during hemorrhagic shock in swine.

    Directory of Open Access Journals (Sweden)

    Vesna Borovnik-Lesjak

    Full Text Available OBJECTIVE: To determine whether erythropoietin given during hemorrhagic shock (HS ameliorates organ injury while improving resuscitation and survival. METHODS: Three series of 24 pigs each were studied. In an initial series, 50% of the blood volume (BV was removed in 30 minutes and normal saline (threefold the blood removed started at minute 90 infusing each third in 30, 60, and 150 minutes with shed blood reinfused at minute 330 (HS-50BV. In a second series, the same HS-50BV protocol was used but removing an additional 15% of BV from minute 30 to 60 (HS-65BV. In a final series, blood was removed as in HS-65BV and intraosseous vasopressin given from minute 30 (0.04 U/kg min(-1 until start of shed blood reinfusion at minute 150 (HS-65BV+VP. Normal saline was reduced to half the blood removed and given from minute 90 to 120 in half of the animals. In each series, animals were randomized 1:1 to receive erythropoietin (1,200 U/kg or control solution intraosseously after removing 10% of the BV. RESULTS: In HS-50BV, O2 consumption remained near baseline yielding minimal lactate increases, 88% resuscitability, and 60% survival at 72 hours. In HS-65BV, O2 consumption was reduced and lactate increased yielding 25% resuscitability. In HS-65BV+VP, vasopressin promoted hemodynamic stability yielding 92% resuscitability and 83% survival at 72 hours. Erythropoietin did not affect resuscitability or subsequent survival in any of the series but increased interleukin-10, attenuated lactate increases, and ameliorated organ injury based on lesser troponin I, AST, and ALT increases and lesser neurological deficits in the HS-65BV+VP series. CONCLUSIONS: Erythropoietin given during HS in swine failed to alter resuscitability and 72 hour survival regardless of HS severity and concomitant treatment with fluids and vasopressin but attenuated acute organ injury. The studies also showed the efficacy of vasopressin and restrictive fluid resuscitation for hemodynamic

  19. Outcome Following a Negative CT Angiogram for Gastrointestinal Hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Chan, Victoria, E-mail: drvictoriac@gmail.com; Tse, Donald, E-mail: donald.tse@gmail.com; Dixon, Shaheen, E-mail: shaheen7noorani@gmail.com [John Radcliffe Hospital, Department of Radiology, Level 2 (United Kingdom); Shrivastava, Vivek, E-mail: vivshriv@yahoo.com [Hull Royal Infirmary, Department of Radiology (United Kingdom); Bratby, Mark, E-mail: mark.bratby@ouh.nhs.uk; Anthony, Suzie, E-mail: suzie.anthony@ouh.nhs.uk; Patel, Rafiuddin, E-mail: rafiuddin.patel@ouh.nhs.uk; Tapping, Charles, E-mail: charles.tapping@ouh.nhs.uk; Uberoi, Raman, E-mail: raman.uberoi@orh.nhs.uk [John Radcliffe Hospital, Department of Radiology, Level 2 (United Kingdom)

    2015-04-15

    ObjectiveThis study was designed to evaluate the role of a negative computed tomography angiogram (CTA) in patients who present with gastrointestinal (GI) hemorrhage.MethodsA review of all patients who had CTAs for GI hemorrhage over an 8-year period from January 2005 to December 2012 was performed. Data for patient demographics, location of hemorrhage, hemodynamic stability, and details of angiograms and/or the embolization procedure were obtained from the CRIS/PACS database, interventional radiology database, secure electronic medical records, and patient’s clinical notes.ResultsA total of 180 patients had 202 CTAs during the 8-year period: 87 CTAs were performed for upper GI hemorrhage (18 positive for active bleeding, 69 negative) and 115 for lower GI hemorrhage (37 positive for active bleeding, 78 negative); 58.7 % (37/63) of patients with upper GI bleed and 77.4 % (48/62) of patients with lower GI bleed who had an initial negative CTA did not rebleed without the need for radiological or surgical intervention. This difference was statistically significant (p = 0.04). The relative risk of rebleeding, following a negative CTA, in lower GI bleeding versus upper GI bleeding patients is 0.55 (95 % confidence interval 0.32–0.95).ConclusionsPatients with upper GI bleed who had negative CTAs usually require further intervention to stop the bleeding. In contrast, most patients presenting with lower GI hemorrhage who had a negative first CTA were less likely to rebleed.

  20. Clinical predictors of hemorrhagic transformation in non lacunar ischemic stroke

    Directory of Open Access Journals (Sweden)

    Natalia R. Balian

    2017-04-01

    Full Text Available Hemorrhagic transformation is a complex phenomenon where brain tissue bleeds, which could be associated or not to an increase in the neurological deficit after the acute ischemic stroke. The aim of our study was to evaluate clinical predictors of hemorrhagic transformation in patients with non-lacunar ischemic stroke. We performed a prospective analysis of the clinical records and images of patients with non-lacunar ischemic stroke. Demographics, vascular risk factors, previous medications and the information of the event in patients with and without hemorrhagic transformation were here compared. We included in this study 747 patients with non-lacunar stroke, the mean age was 77 ± 11 years and 61% were females. In the univariate analysis, the age, a history of hypertension, atrial fibrillation, chronic kidney disease and the previous use of oral anticoagulation resulted statistically significant. In the multivariate analysis of logistic regression adjusted by age and vascular risk factors: the age > 80 years (OR 3.6, CI 95% 1.8-7.6, the pulse pressure > 60 mmHg at admission (OR 5.3, CI 95% 3.2-9.1, the chronic kidney disease (OR 3, CI 95% 2.5-3.8 and the presence of previous atrial fibrillation (OR 3.5, CI 95% 2.1-6.1 were associated with and increased risk of hemorrhagic transformation. The predictors of hemorrhagic transformation in our cohort showed a relationship with severe vascular illness. The identification of these patients could influence therapeutic decisions that could increase the risk of hemorrhagic transformation

  1. Putative role of prostaglandin receptor in intracerebral hemorrhage

    Directory of Open Access Journals (Sweden)

    Shekher eMohan

    2012-10-01

    Full Text Available Each year, approximately 795,000 people experience a new or recurrent stroke. Of all strokes, 84% are ischemic, 13% are intracerebral hemorrhage (ICH strokes and 3% are subarachnoid hemorrhage (SAH strokes. Despite the decreased incidence of ischemic stroke, there has been no change in the incidence of hemorrhagic stroke in the last decade. ICH is a devastating disease 37-38% of patients between the ages of 45-64 die within 30 days. In an effort to prevent ischemic and hemorrhagic strokes we and others have been studying the role of prostaglandins and their receptors. Prostaglandins are bioactive lipids derived from the metabolism of arachidonic acid. They sustain homeostatic functions and mediate pathogenic mechanisms, including the inflammatory response. Most prostaglandins are produced from specific enzymes and act upon cells via distinct G-protein coupled receptors. The presence of multiple prostaglandin receptor’s cross-reactivity and coupling to different signal transduction pathways allow differentiated cells to respond to prostaglandins in a unique manner. Due to the number of prostaglandin receptors, prostaglandin-dependent signaling can function either to promote neuronal survival or injury following acute excitotoxicity, hypoxia, and stress induced by ICH. To better understand the mechanisms of neuronal survival and neurotoxicity mediated by prostaglandin receptors, it is essential to understand downstream signaling. Several groups including ours have discovered unique roles for prostaglandin receptors in rodent models of ischemic stroke, excitotoxicity, and Alzheimer disease, highlighting the emerging role of prostaglandin receptor signaling in hemorrhagic stroke with a focus on cyclic-adenosine monophosphate (cAMP and calcium (Ca2+ signaling. We review current ICH data and discuss future directions notably on prostaglandin receptors, which may lead to the development of unique therapeutic targets against hemorrhagic stroke and

  2. Prehospital Systolic Hypertension and Outcomes in Patients with Spontaneous Intracerebral Hemorrhage.

    Science.gov (United States)

    Hatcher, Stacy; Chen, Connie; Govindarajan, Prasanthi

    2017-01-26

    It is well known that hematoma volume and expansion is associated with poor outcomes in patients with spontaneous intracerebral hemorrhage (sICH). The factors associated with hematoma volume and possible expansion include the use of anticoagulant medications, autoimmune or bacterial diseases that reduce platelet production, and genetic defects of Von Willebrand factor causing inhibition or reduction of platelet aggregation. However, little is known about the role of elevated systolic blood pressure (SBP) on hematoma volume and its ultimate role on sICH when identified in the prehospital setting. Our objectives were to determine the prevalence of elevated SBP among diagnosed sICH patients transported by emergency medical services (EMS), and to explore possible associations between prehospital elevated SBP and hematoma volume. This is a hypothesis-generating study for which we used a retrospective observational design. The subjects included 243 adult patients who were seen and treated for sICH in an emergency department serving a county hospital in a large metropolitan city. Elevated SBP in the setting of sICH was defined as ≥140 mm Hg. A univariate analysis was performed to investigate associations between patient demographics, elevated SBP, and sICH characteristics with the pre-determined outcome of hematoma volume. We then performed a multivariable logistic regression model to determine if elevated prehospital SBP remained associated with hematoma volume. The number of subjects with a hospital-based diagnosis of sICH was 243. Of those, 193 (79%) were transported by an ambulance. Among those transported by ambulance, 180 (93%) had a documented prehospital SBP; out of those patients with a documented SBP, 173 (96%) showed an elevated SBP of ≥140 mm Hg, and 82 (46%) had a hematoma volume of ≥30 mL. Our univariate analysis showed that sICH patients with an elevated prehospital SBP of ≥140 mm Hg were associated with hematoma volume. The multivariable regression

  3. Broadband diffuse optical spectroscopy assessment of hemorrhage- and hemoglobin-based blood substitute resuscitation

    Science.gov (United States)

    Lee, Jangwoen; Kim, Jae G.; Mahon, Sari; Tromberg, Bruce J.; Mukai, David; Kreuter, Kelly; Saltzman, Darin; Patino, Renee; Goldberg, Robert; Brenner, Matthew

    2009-07-01

    Hemoglobin-based oxygen carriers (HBOCs) are solutions of cell-free hemoglobin (Hb) that have been developed for replacement or augmentation of blood transfusion. It is important to monitor in vivo tissue hemoglobin content, total tissue hemoglobin [THb], oxy- and deoxy-hemoglobin concentrations ([OHb], [RHb]), and tissue oxygen saturation (StO2=[OHb]/[THb]×100%) to evaluate effectiveness of HBOC transfusion. We designed and constructed a broadband diffuse optical spectroscopy (DOS) prototype system to measure bulk tissue absorption and scattering spectra between 650 and 1000 nm capable of accurately determining these tissue hemoglobin component concentrations in vivo. Our purpose was to assess the feasibility of using DOS to optically monitor tissue [OHb], [RHb], StO2, and total tissue hemoglobin concentration ([THb]=[OHb]+[RHb]) during HBOC infusion using a rabbit hypovolemic shock model. The DOS prototype probe was placed on the shaved inner thigh muscle of the hind leg to assess concentrations of [OHb], [RHb], [THb], as well as StO2. Hemorrhagic shock was induced in intubated New Zealand white rabbits (N=6) by withdrawing blood via a femoral arterial line to 20% blood loss (10-15 cc/kg). Hemoglobin glutamer-200 (Hb-200) 1:1 volume resuscitation was administered following the hemorrhage. These values were compared against traditional invasive measurements, serum hemoglobin concentration (sHGB), systemic blood pressure, heart rate, and blood gases. DOS revealed increases of [THb], [OHb], and tissue hemoglobin oxygen saturation after Hb-200 infusion, while blood total hemoglobin values continued did not increase; we speculate, due to hyperosmolality induced hemodilution. DOS enables noninvasive in vivo monitoring of tissue hemoglobin and oxygenation parameters during shock and volume expansion with HBOC and potentially enables the assessment of efficacy of resuscitation efforts using artificial blood substitutes.

  4. Cerebral inflammatory response and predictors of admission clinical grade after aneurysmal subarachnoid hemorrhage.

    Science.gov (United States)

    Hanafy, Khalid A; Morgan Stuart, R; Fernandez, Luis; Schmidt, J Michael; Claassen, Jan; Lee, Kiwon; Sander Connolly, E; Mayer, Stephan A; Badjatia, Neeraj

    2010-01-01

    Poor admission clinical grade is the most important determinant of outcome after aneurysmal subarachnoid hemorrhage (aSAH); however, little attention has been focused on independent predictors of poor admission clinical grade. We hypothesized that the cerebral inflammatory response initiated at the time of aneurysm rupture contributes to ultra-early brain injury and poor admission clinical grade. We sought to identify factors known to contribute to cerebral inflammation as well as markers of cerebral dysfunction that were associated with poor admission clinical grade. Between 1997 and 2008, 850 consecutive SAH patients were enrolled in our prospective database. Demographic data, physiological parameters, and location and volume of blood were recorded. After univariate analysis, significant variables were entered into a logistic regression model to identify significant associations with poor admission clinical grade (Hunt-Hess grade 4-5). Independent predictors of poor admission grade included a SAH sum score >15/30 (odds ratio [OR] 2.3, 95% confidence interval [CI] 1.5-3.6), an intraventricular hemorrhage sum score >1/12 (OR 3.1, 95% CI 2.1-4.8), aneurysm size >10mm (OR 1.7, 95% CI 1.1-2.6), body temperature 38.3 degrees C (OR 2.5, 95% CI 1.1-5.4), and hyperglycemia >200mg/dL (OR 2.7, 95% CI 1.6-4.5). In a large, consecutive series of prospectively enrolled patients with SAH, the inflammatory response at the time of aneurysm rupture, as reflected by the volume and location of the hemoglobin burden, hyperthermia, and perturbed glucose metabolism, independently predicts poor admission Hunt-Hess grade. Strategies for mitigating the inflammatory response to aneurysmal rupture in the hyper-acute setting may improve the admission clinical grade, which may in turn improve outcomes. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  5. Hyperglycemia and Clinical Outcome in Aneurysmal Subarachnoid Hemorrhage A Meta-Analysis

    NARCIS (Netherlands)

    Kruyt, Nyika D.; Biessels, Geert Jan; de Haan, Rob J.; Vermeulen, Marinus; Rinkel, Gabriel J. E.; Coert, Bert; Roos, Yvo B. W. E. M.

    2009-01-01

    Background and Purpose-Hyperglycemia may worsen outcome after aneurysmal subarachnoid hemorrhage. We performed a systematic review to investigate the relation between admission hyperglycemia and outcome after aneurysmal subarachnoid hemorrhage. Methods-We included cohort studies or clinical trials

  6. Ideal resuscitation pressure for uncontrolled hemorrhagic shock in different ages and sexes of rats

    National Research Council Canada - National Science Library

    Li, Tao; Zhu, Yu; Tian, Kunlun; Xue, Mingying; Peng, Xiaoyong; Lan, Dan; Liu, Liangming

    2013-01-01

    Our previous studies demonstrated that 50-60 mmHg mean arterial blood pressure was the ideal target hypotension for uncontrolled hemorrhagic shock during the active hemorrhage in sexually mature rats...

  7. Postpancreatectomy hemorrhage (PPH): an International Study Group of Pancreatic Surgery (ISGPS) definition

    NARCIS (Netherlands)

    Wente, Moritz N.; Veit, Johannes A.; Bassi, Claudio; Dervenis, Christos; Fingerhut, Abe; Gouma, Dirk J.; Izbicki, Jakob R.; Neoptolemos, John P.; Padbury, Robert T.; Sarr, Michael G.; Yeo, Charles J.; Buechler, Markus W.

    2007-01-01

    BACKGROUND: Postoperative hemorrhage is one of the most severe complications after pancreatic surgery. Due to the lack of an internationally accepted, universal definition of postpancreatectomy hemorrhage (PPH), the incidences reported in the literature vary considerably, even in reports from

  8. Fever after aneurysmal subarachnoid hemorrhage: relation with extent of hydrocephalus and amount of extravasated blood

    NARCIS (Netherlands)

    Dorhout Mees, Sanne M.; Luitse, Merel J. A.; van den Bergh, Walter M.; Rinkel, Gabriel J. E.

    2008-01-01

    BACKGROUND AND PURPOSE: Fever after aneurysmal subarachnoid hemorrhage is associated with poor outcome. Because hydrocephalus and extravasated blood may influence thermoregulation, we determined whether these factors increase the risk for fever after subarachnoid hemorrhage. METHODS: Fever within 14

  9. Postcoital Hemorrhage of a Recurrent Seminal Vesicle Cyst Requiring Embolization

    Directory of Open Access Journals (Sweden)

    Eric Royston

    2014-09-01

    Full Text Available Herein is a case of a 23-year-old man with recurrence of a seminal vesicle cyst after percutaneous drainage and laparoscopic excision complicated by hemorrhage requiring embolization. He presented to the emergency department for pain after ejaculation. Computed tomographic scan of his pelvis revealed extravasation of contrast near his cyst and pelvic fluid collection suspicious for a hematoma. The patient had steadily decreasing hemoglobin and hematocrit levels. An interventional radiologist performed an embolization of the left seminal vesicle cystic arteries. Hemoglobin and hematocrit values improved and he was discharged. Hemorrhage resolved with embolization procedure and pain dissipated over the course of follow up care.

  10. Phylogeny of the Viral Hemorrhagic Septicemia Virus in European Aquaculture

    DEFF Research Database (Denmark)

    Cieslak, Michael; Mikkelsen, Susie Sommer; Skall, Helle F.

    2016-01-01

    One of the most valuable aquaculture fish in Europe is the rainbow trout, Oncorhynchus mykiss, but the profitability of trout production is threatened by a highly lethal infectious disease, viral hemorrhagic septicemia (VHS), caused by the VHS virus (VHSV). For the past few decades, the subgenogr......One of the most valuable aquaculture fish in Europe is the rainbow trout, Oncorhynchus mykiss, but the profitability of trout production is threatened by a highly lethal infectious disease, viral hemorrhagic septicemia (VHS), caused by the VHS virus (VHSV). For the past few decades...

  11. Plasma cell pododermatitis with chronic footpad hemorrhage in two cats.

    Science.gov (United States)

    Taylor, J E; Schmeitzel, L P

    1990-08-01

    Plasma cell pododermatitis was diagnosed in 2 cats with enlargement of the metacarpal and metatarsal footpads, ulceration of one of the affected footpads, and a history of chronic hemorrhage from the ulcerations. One cat was anemic (PCV, 14.6%). The ulcers were debrided and sutured to control hemorrhage, and the cats were treated with immunosuppressive doses of corticosteroids. Both cats had considerable reduction in footpad size after 3 to 4 weeks of treatment. Although there is evidence to suggest that plasma cell pododermatitis might be immune-mediated, or perhaps an allergic disease, the cause has yet to be determined.

  12. Alveolar hemorrhage as the initial presentation of systemic lupus erythematosus.

    Science.gov (United States)

    de Holanda, Bruna A; Barreto, Isabela G Menna; de Araujo, Isadora S Gomes; de Araujo, Daniel B

    2016-01-01

    Alveolar hemorrhage (AH) is a rare syndrome that can often occur in autoimmune diseases, blood clotting disorders, infection or by acute inhalation injury, presenting rapid evolution and high mortality, especially with late diagnosis and treatment. Among the autoimmune diseases, there are reported cases in patients with primary antiphospholipid syndrome (PAPS), vasculitis and systemic lupus erythematosus (SLE). An early diagnosis is an essential tool in the successful management of this complication, requiring aggressive treatment based on vigorous immunosuppression and broad-spectrum antibiotic. We describe here a case of alveolar hemorrhage associated with glomerulonephritis as the open presentation in a patient with SLE.

  13. Surgery for Patients With Spontaneous Deep Supratentorial Intracerebral Hemorrhage

    Science.gov (United States)

    Zheng, Jun; Li, Hao; Zhao, He-Xiang; Guo, Rui; Lin, Sen; Dong, Wei; Ma, Lu; Fang, Yuan; Tian, Meng; Liu, Ming; You, Chao

    2016-01-01

    Abstract Spontaneous intracerebral hemorrhage (sICH) is one of the most dangerous cerebrovascular diseases, especially when in deep brain. The treatment of spontaneous deep supratentorial intracerebral hemorrhage is still controversial. We conducted a retrospective case-control study using propensity score matching to compare the efficacy of surgery and conservative treatment for patients with deep surpatentorial hemorrhage. We observed the outcomes of consecutive patients with spontaneous deep supratentorial hemorrhage retrospectively from December 2008 to July 2013. Clinical outcomes of surgery and conservative treatments were compared in patients with deep sICH using propensity score matching method. The primary outcome was neurological function status at 6 months post ictus. The second outcomes included mortality at 30 days and 6 months, and the incidence of complications. Subgroup analyses of 6-month outcome were conducted. Sixty-three (22.66%) of the 278 patients who received surgery had a favorable neurological function status at 6 months, whereas in the conservative group, 66 of 278 (23.74%) had the same result (P = 0.763). The 30-day mortality in the surgical group was 19.06%, whereas 30.58% in the conservative group (P = 0.002). There was significant difference in the mortality at 6 months after ictus as well (23.38% vs 36.33%, P = 0.001). The subgroup analyses showed significantly better outcomes for the surgical group when hematoma was >40 mL (13.33% vs 0%, P = 0.005) or complicated with intraventricular hemorrhage (16.67% vs 7.27%, P = 0.034). For complications, the risk of pulmonary infection, gastrointestinal hemorrhage, urinary infection, pulmonary embolus, and need for tracheostomy/long term ventilation in the surgical group was higher than the conservative group (31.29% vs 15.47%, P < 0.001; 6.83% vs 3.96%, P = 0.133; 2.88% vs 1.80%, P = 0.400; 1.80% vs 1.08%, P = 0.476; 32.73% vs 23.38%, P = 0

  14. A state-wide obstetric hemorrhage quality improvement initiative.

    Science.gov (United States)

    Bingham, Debra; Lyndon, Audrey; Lagrew, David; Main, Elliott K

    2011-01-01

    The mission of the California Maternal Quality Care Collaborative is to eliminate preventable maternal death and injury and to promote equitable maternity care in California. This article describes California Maternal Quality Care Collaborative's (CMQCC's) statewide multistakeholder quality improvement initiative to improve readiness, recognition, response, and reporting of maternal hemorrhage at birth and details the essential role of nurses in its success. In partnership with the State Department of Maternal, Child, and Adolescent Health, CMQCC identified maternal hemorrhage as a significant quality improvement opportunity. CMQCC organized a multidisciplinary, multistakeholder task force to develop a strategy for addressing obstetric (OB) hemorrhage. The OB Hemorrhage Task Force, co-chaired by nurse and physician team leaders, identified four priorities for action and developed a comprehensive hemorrhage guideline. CMQCC is using a multilevel strategy to disseminate the guideline, including an open access toolkit, a minimal support-mentoring model, a county partnership model, and a 30-hospital learning collaborative. In participating hospitals, nurses have been the primary drivers in developing both general and massive hemorrhage policies and procedures, ensuring the availability of critical supplies, organizing team debriefing after a stage 2 (or greater) hemorrhage, hosting skills stations for measuring blood loss, and running obstetric (OB) hemorrhage drills. Each of these activities requires effort and leadership skill, even in hospitals where clinicians are convinced that these changes are needed. In some hospitals, the burden to convince physicians of the value of these new practices has rested primarily upon nurses. Thus, the statewide initiative in which nurse and physician leaders work together models the value of teamwork and provides a real-time demonstration of the potential for effective interdisciplinary collaboration to make a difference in the

  15. Presentation of moyamoya disease with occipital hemorrhage: a case report

    Directory of Open Access Journals (Sweden)

    Serkan Demir

    2012-12-01

    Full Text Available Moyamoya disease is a cerebrovascular disease which is characterized with stenosis and occlusions at the distal part of internal carotid artery and at the proximal part of anterior and middle cerebral arteries. It rarely causes temporary or recurrent hemiparesis due to intracranial hemorrhage while symptoms like headache, convulsion, nystagmus, aphasia and ataxia may also occur. In this paper, we present a case of Moyamoya disease which was diagnosed with a 23 year old female patient who was admitted to our emergency department with headache, nausea and vomiting complaints and whose radiological findings showed occipital lobe hemorrhage.

  16. Dengue hemorrhagic fever and acute hepatitis: a case report

    Directory of Open Access Journals (Sweden)

    Maria Paula Gomes Mourão

    Full Text Available Dengue fever is the world's most important viral hemorrhagic fever disease, the most geographically wide-spread of the arthropod-born viruses, and it causes a wide clinical spectrum of disease. We report a case of dengue hemorrhagic fever complicated by acute hepatitis. The initial picture of classical dengue fever was followed by painful liver enlargement, vomiting, hematemesis, epistaxis and diarrhea. Severe liver injury was detected by laboratory investigation, according to a syndromic surveillance protocol, expressed in a self-limiting pattern and the patient had a complete recovery. The serological tests for hepatitis and yellow fever viruses were negative. MAC-ELISA for dengue was positive.

  17. Parasellar dermoid tumor with intra-tumoral hemorrhage

    Energy Technology Data Exchange (ETDEWEB)

    Mamata, H.; Yanagimachi, N.; Matsuyama, S. [Department of Radiology I, Tokai University School of Medicine, Kanagawa (Japan); Matsumae, M.; Takamiya, Y.; Tsugane, R. [Department of Neurosurgery, Tokai University School of Medicine, Kanagawa (Japan)

    1998-12-01

    We report a case of parasellar dermoid tumor with intra-tumoral hemorrhage. It is rare for a dermoid tumor that hemorrhage was detected as high attenuation on the initial CT. In the present case, the tumor content included a little fat component and mostly cholesterin-rich fluid which resulted in extremely low signal intensity on T2-weighted and high signal on T1-weighted MR images. In addition to this, hemosiderin accumulation in the tumor could be the reason for low signal intensity on T2-weighted images. (orig.) With 3 figs., 19 refs.

  18. Endovascular treatment of a post-traumatic adrenal hemorrhage in a pediatric patient: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Gun; Jung, Hyun Seok [Dept. of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of)

    2016-12-15

    Adrenal hemorrhage following blunt trauma is a rare occurrence. We report here the case of a 5-year-old child with adrenal hemorrhage, which developed as a result of an accidental fall. Embolization treatment of adrenal hemorrhage was successfully performed. To the best of our knowledge, this is the first report of adrenal hemorrhage occurring in a child which was treated with transcatheter embolization.

  19. BK virus-associated hemorrhagic cystitis after pediatric stem cell transplantation

    OpenAIRE

    Han, Seung Beom; Cho, Bin; Kang, Jin Han

    2014-01-01

    Hemorrhagic cystitis is a common stem cell transplantation-related complication. The incidence of early-onset hemorrhagic cystitis, which is related to the pretransplant conditioning regimen, has decreased with the concomitant use of mesna and hyperhydration. However, late-onset hemorrhagic cystitis, which is usually caused by the BK virus, continues to develop. Although the BK virus is the most common pathogenic microorganism of poststem cell transplantation late-onset hemorrhagic cystitis, ...

  20. Hemorrhagic cystitis with massive bleeding from nontyphoidal Salmonella infection: A case report

    OpenAIRE

    Na, Sun-Kyung; Jung, Hye-Kyung; Kim, Young Shin; Yun, Hye-Won; Chung, Jung-Wha; Jung, Ka-Young; Shim, Ki-Nam; Jung, Sung-Ae

    2013-01-01

    Hemorrhagic cystitis is defined by lower urinary tract symptoms that include dysuria, hematuria, and hemorrhage and is caused by viral or bacterial infection or chemotherapeutic agents. Reports of hemorrhagic cystitis caused by non-typhoidal salmonella (NTS) are extremely rare. We report a case of a 41-year-old man with hemorrhagic cystitis from NTS that caused massive bleeding and shock. The patient was hospitalized for uncontrolled diabetes and obstructive uropathy related to severe cystiti...

  1. CLINICAL AND NEUROIMAGING STUDIES IN PATIENTS WITH ACUTE SPONTANEOUS INTRACEREBRAL HEMORRHAGE.

    Directory of Open Access Journals (Sweden)

    Мaya P. Danovska

    2014-03-01

    Full Text Available Objective: To define the prognostic value of clinical and neuroimaging parameters on the 30-th day mortality and clinical outcome after spontaneous intracerebral hemorrhage (sICH. Materials and methods: we examined 88 patients with sICH admitted to Neurology Clinic, UMHAT Pleven within 48 hours after clinical symptoms onset. Glasgow Coma Scale (GCS score was used to assess the primary stroke severity; neurological deficit on admission was assessed by National Institute of Health Stroke Scale (NIHSS; clinical outcome at discharge was evaluated by modified Rankin Scale (mRS and by Glasgow Outcome Scale (GOS on the 30-th day after sICH onset. Hematoma volume was measured by the formula of Kothari: AxBxC/2 in ml. The statistical analysis was performed by SPSS 19.0 and Statgraphics plus 4.1 for Windows. Results: Initial assessment of primary stroke severity and neurological deficit by GCS и NIHSS, hematoma localization and volume were found strongly correlated with the clinical outcome on the 30-th day after the sICH onset. Age and vascular risk factors did not correlate with the clinical outcome. Male patients had better survival on the 30-th day compared with the female ones. Discussion: Neurological deficit on admission, hematoma localization and volume were found reliable predictors of the 30-th day clinical outcome that could serve for early stratification of patients and optimal choice of therapeutic approach.

  2. Dramatic resolution of vitreous hemorrhage after an intravitreal injection of dobesilate.

    Science.gov (United States)

    Cuevas, Pedro; Outeiriño, Luis Antonio; Azanza, Carlos; Angulo, Javier; Giménez-Gallego, Guillermo

    2015-01-01

    Vitreous hemorrhages are important clinical manifestations of proliferative diabetic retinopathy. Non-cleared vitreous hemorrhages could lead to hemosiderosis bulbi and glaucoma. Here, we describe the case of a type 2 diabetic patient presenting anterior segment and vitreous hemorrhages that resolved three days after treatment with a single intravitreal injection of dobesilate.

  3. Systematic Characterization of the Computed Tomography Angiography Spot Sign in Primary Intracerebral Hemorrhage Identifies Patients at Highest Risk for Hematoma Expansion

    Science.gov (United States)

    Delgado Almandoz, Josser E.; Yoo, Albert J.; Stone, Michael J.; Schaefer, Pamela W.; Goldstein, Joshua N.; Rosand, Jonathan; Oleinik, Alexandra; Lev, Michael H.; Gonzalez, R. Gilberto; Romero, Javier M.

    2012-01-01

    Background and Purpose The presence of active contrast extravasation (the spot sign) on computed tomography (CT) angiography has been recognized as a predictor of hematoma expansion in patients with intracerebral hemorrhage. We aim to systematically characterize the spot sign to identify features that are most predictive of hematoma expansion and construct a spot sign scoring system. Methods We retrospectively reviewed CT angiograms performed in all patients who presented to our emergency department over a 9-year period with primary intracerebral hemorrhage and had a follow-up noncontrast head CT within 48 hours of the baseline CT angiogram. Three neuroradiologists reviewed the CT angiograms and determined the presence and characteristics of spot signs according to strict radiological criteria. Baseline and follow-up intracerebral hemorrhage volumes were determined by computer-assisted volumetric analysis. Results We identified spot signs in 71 of 367 CT angiograms (19%), 6 of which were delayed spot signs (8%). The presence of any spot sign increased the risk of significant hematoma expansion (69%, OR=92, Pictus to CT angiogram evaluation. Conclusion The spot sign score predicts significant hematoma expansion in primary intracerebral hemorrhage. If validated in other data sets, it could be used to select patients for early hemostatic therapy. PMID:19574553

  4. Rapid breakdown of microvascular barriers and subsequent hemorrhagic transformation after delayed recombinant tissue plasminogen activator treatment in a rat embolic stroke model.

    Science.gov (United States)

    Dijkhuizen, Rick M; Asahi, Minoru; Wu, Ona; Rosen, Bruce R; Lo, Eng H

    2002-08-01

    Thrombolytic therapy with recombinant tissue plasminogen activator (rtPA) after stroke increases risk of hemorrhagic transformation, particularly in areas with blood-brain barrier leakage. Our aim was to characterize acute effects of rtPA administration on the integrity of microvascular barriers. Stroke was induced in spontaneously hypertensive rats by unilateral embolic middle cerebral artery occlusion. Six hours after stroke, rtPA was intravenously administered (n=10). Controls received saline (n=4). Extravasation of the large-diameter contrast agent monocrystalline iron oxide nanocolloid (MION) was assessed with susceptibility contrast-enhanced MRI during rtPA injection. In addition, we performed perfusion MRI and diffusion-weighted MRI. After MRI, 2 hours after rtPA treatment, intracerebral hemorrhage was quantified with a spectrophotometric hemoglobin assay. Late rtPA treatment resulted in increased hemorrhage volume (8.4+/-1.7 versus 2.9+/-0.9 micro L in controls; Pcerebral blood flow index was 22.8+/-19.7% [of contralateral] at 0.5 hours before and 22.4+/-18.0% at 1 hour after rtPA administration). The DeltaR2* changes during rtPA delivery in MION-injected animals indicate extravasation of MION, which reflects increased permeability of the blood-brain barrier. This implies that late rtPA treatment rapidly aggravates early ischemia-induced damage to microvascular barriers, thereby enhancing hemorrhagic transformation.

  5. Protection against myxomatosis and rabbit viral hemorrhagic disease with recombinant myxoma viruses expressing rabbit hemorrhagic disease virus capsid protein.

    Science.gov (United States)

    Bertagnoli, S; Gelfi, J; Le Gall, G; Boilletot, E; Vautherot, J F; Rasschaert, D; Laurent, S; Petit, F; Boucraut-Baralon, C; Milon, A

    1996-08-01

    Two myxoma virus-rabbit hemorrhagic disease virus (RHDV) recombinant viruses were constructed with the SG33 strain of myxoma virus to protect rabbits against myxomatosis and rabbit viral hemorrhagic disease. These recombinant viruses expressed the RHDV capsid protein (VP60). The recombinant protein, which is 60 kDa in size, was antigenic, as revealed by its reaction in immunoprecipitation with antibodies raised against RHDV. Both recombinant viruses induced high levels of RHDV- and myxoma virus-specific antibodies in rabbits after immunization. Inoculations by the intradermal route protected animals against virulent RHDV and myxoma virus challenges.

  6. Volume replacement with hydroxyethyl starch or Ringer lactate solution in hemorrhagic gastroenteritis dogs with parvovirusReposição volêmica com hidroxietilamido ou solução de ringer lactato em cães com gastroenterite hemorrágica por parvovírus

    Directory of Open Access Journals (Sweden)

    Eduardo Ghiggi

    2013-09-01

    Full Text Available Parvovirus is an infectious viral disease, highly contagious, affecting dogs causing acute enteritis. Dehydration is a minor problem and acute evolution, which is the main focus of treatment. The objective of this study was to evaluate two treatments volume replacement in dogs with confirmed diagnosis of parvovirus infection by antigen detection in stool by ELISA. A total of 15 dogs, mixed, male and female, aged from 3 to 6 months, these four they had died during treatment and 11 were included in the study. Patients were randomly divided into two groups: hydroxyethyl starch 130/0.4 (HES, n=6 and Group Ringer Lactate (RL, n=5, which received fluid resuscitation with hydroxyethyl starch 130/0.4 and Ringer’s solution lactate, respectively, based on calculations of fluid deficit. All animals received intravenously: cephalothin, metronidazole, ranitidine and metoclopramide. During hospitalization, every 12 hours were evaluated arterial blood gas, electrolyte dosing and clinical examination (heart rate, respiratory rate, rectal temperature, capillary refill time, vomiting, appetite, dehydration, weight gain, hematochezia, melena, hematemesis and presence abdominal pain and 24 hours each blood count was performed. In group RL was increase in the values of PaO2 and decreases in hemoglobin, hematocrit, phosphorus and magnesium, and group HES, a decrease in the percentage of dehydration, hemoglobin, phosphorus and potassium. There were no differences in other parameters between the groups. Both treatments were effective in fluid replacement of patients, no difference in any variable analyzed. A parvovirose é uma doença infecciosa viral, altamente contagiosa, que acomete cães causando enterite aguda. A desidratação é um problema secundário e de evolução aguda, sendo este o foco principal do tratamento. O objetivo deste estudo foi avaliar dois tratamentos de reposição volêmica em cães com diagnóstico confirmado de parvovirose por detec

  7. Prediction of coma and anisocoria based on computerized tomography findings in patients with supratentorial intracerebral hemorrhage.

    Science.gov (United States)

    Song, Zhi; Zheng, Wen; Zhu, Haixia; Chen, Yiwei; Fan, Xuejun; Hou, Deren; Deng, Hao

    2012-07-01

    Coma and anisocoria are the two common signs of a crucial state of neurological dysfunction. The ability to forecast the occurrence of these conditions would help clinicians make clinical risk assessments and decisions. From October 2006 to September 2008, 118 patients with supratentorial intracerebral hemorrhage (SICH) were enrolled in this retrospective investigation. Patients were distributed into 3 groups according to occurrence of the signs of coma and/or anisocoria in the observation unit during a 30-day period. Group 1 included 52 patients who had normal or impaired consciousness, group 2 included 27 patients who had coma with no anisocoria and group 3 consisted of 39 patients who had coma with anisocoria. The clinical characteristics and parameters on computerized tomography (CT) findings were compared using univariate analysis to determine the factors that were related to the level of consciousness. Logistic regression models established the predictive equations for coma and anisocoria. Univariate analysis revealed that hematoma volume, the score of intraventricular hemorrhage (IVH score) and the amplitude of midline shift were the factors related to coma and anisocoria. Mean hematoma volume was 24.0 ± 13.0 ml, 53.6 ± 12.6 ml and 80.5 ± 24.6 ml, the mean amplitudes of midline shift were 1.3 ± 2.0 mm, 5.9 ± 4.9 mm and 10.1 ± 5.5 mm, and the mean IVH score was 0.8 ± 1.3, 3.3 ± 3.3 and 5.9 ± 3.4 in groups 1, 2 and 3, respectively. Multivariate analysis showed that hematoma volume and IVH score were independent prognostic factors for coma and anisocoria. The predictive equations for coma and anisocoria were LogitP = 0.279X(HV) + 0.521X(IVH)-18.164 and LogitP = 0.125X(HV)+0.326X(IVH)-6.864, respectively. Hematoma volume and IVH score were the independent prognostic factors for coma and anisocoria. Logistic regression models established the fitted predictive equations, which could help clinicians make clinical risk assessments and decisions. Crown

  8. Nitroglycerin Attenuates Vasoconstriction of HBOC-201 during Hemorrhagic Shock Resuscitation

    Science.gov (United States)

    2010-01-01

    Noack E. Nitric oxide (NO) formation from nitrovasodilators occurs independently of hemoglobin or non-heme iron . Eur 1 Pharmacol 1987;142:465-9...gen monitoring during hemorrhagic shock and resuscitation: a comparison or lactated Ringer’s solution, hypertonic saline dextran , and HBOC-201.1

  9. Evaluation of patients with Crimean-Congo hemorrhagic fever in ...

    African Journals Online (AJOL)

    Background: Crimean-Congo hemorrhagic fever (CCHF), which is associated with a high mortality rate in the Black Sea region of Turkey, has received increasing attention. Objective: In this study, the epidemiological features, clinical and laboratory findings, treatments, and outcomes of patients diagnosed with CCHF ...

  10. Characterization of a hemorrhage-inducing component present in ...

    African Journals Online (AJOL)

    Better characterization of individual snake venom toxins is useful for analyzing the association of their toxic domains and relevant antigenic epitopes. Here we analyzed the Bitis arietans hemorrhagic-inducing toxin present in a representative venom sample. Among the 1´ to 5´ protein peaks isolated using a Sephacryl S 100 ...

  11. Intrauterine skull depression and intracranial hemorrhage in a premature infant

    Energy Technology Data Exchange (ETDEWEB)

    Batton, G.D.; DiCarmine, F.; Boal, D.K.

    1988-04-01

    The authors describe a case of a premature infant born with a parietal skull depression who suffered an intraventricular hemorrhage and an ipsilateral intracerebral injury. At 21 months of life the infant's gross motor milestones were delayed and he had moderate spastic hemiplegia. Although skull depressions at birth are usually benign, they may be associated with long-term neurologic sequelae.

  12. Subarachnoid hemorrhage: risks of aneurysm rupture and delayed cerebral ischemia

    NARCIS (Netherlands)

    de Rooij, N.K.

    2013-01-01

    Three percent of the population harbors an intracranial aneurysm. A minority of these aneurysms will rupture and cause a subarachnoid hemorrhage (SAH). SAH is a devastating disease with high case fatality and morbidity. A major contributor to the poor outcome after SAH is delayed cerebral ischemia

  13. Clinical observation of two treatments for vitreous hemorrhage

    Directory of Open Access Journals (Sweden)

    He-Yi Li

    2014-08-01

    Full Text Available AIM: To investigate the indications and therapeutic effect of the conservative treatment and surgical treatment for vitreous hemorrhage.METHODS: Hemorrhage reasons, degree of illness, and treatment and final results of vitreous hemorrhage were recorded from 2008 to 2013, and curative effect of different treatments was analyzed.RESULTS: Selected 22 cases(24 eyesof conservative treatment, vision degree of 6 eyes(25%had raised, 5 eyes(21%occurred secondary retinal detachment without treatment, 3 eyes(12.5%suffered neovascular glaucoma were underwent operation, but the vision had lost completely. In 26 cases(31 eyesof control(operationgroup, vision of 17 eyes(55%had improved, 2 eyes(6.5%suffered the second operation, 2 eyes(6.5%suffered the third surgery, 3 eyes(10%suffered eyeball atrophy. The number of ultimate vision improved with conservative treatment were significantly lower than the number of cases with surgical treatment(PCONCLUSION: The surgical treatment is still visible vitreous hemorrhage treatment means of positive, but there will be eyeball atrophy and other serious complications, so we should choose a different methods in according to the different treatment objects and treatment time.

  14. Phonemic Characteristics of Apraxia of Speech Resulting from Subcortical Hemorrhage

    Science.gov (United States)

    Peach, Richard K.; Tonkovich, John D.

    2004-01-01

    Reports describing subcortical apraxia of speech (AOS) have received little consideration in the development of recent speech processing models because the speech characteristics of patients with this diagnosis have not been described precisely. We describe a case of AOS with aphasia secondary to basal ganglia hemorrhage. Speech-language symptoms…

  15. Pulmonary hemorrhage in pediatric lupus anticoagulant hypoprothrombinemia syndrome.

    Science.gov (United States)

    Kim, Ji Soo; Kim, Min Jae; Bae, E Young; Jeong, Dae Chul

    2014-04-01

    Lupus anticoagulant-hypoprothrombinemia syndrome (LAHPS), a very rare disease that is caused by the presence of antifactor II antibodies, is usually counterbalanced by the prothrombotic effect of lupus anticoagulant (LAC). Patients with LAHPS are treated using fresh frozen plasma, steroids, immunosuppressive agents, and immunoglobulins for managing the disease and controlling hemorrhages. Notably, steroids are the important treatment for treating hypoprothrombinemia and controlling the bleeding. However, some patients suffer from severe, life-threatening hemorrhages, when factor II levels remain very low in spite of treatment with steroids. Here, we report a case of LAHPS in a 15-year-old girl who experienced pulmonary hemorrhage with rapid progression. She was referred to our hospital owing to easy bruising and prolonged bleeding. She was diagnosed with LAHPS that presented with pancytopenia, positive antinuclear antibody, proloned prothrombin time, activated partial thromboplastin time, positive LAC antibody, and factor II deficiency. Her treatment included massive blood transfusion, high-dose methylprednisolone, vitamin K, and immunoglobulin. However, she died due to uncontrolled pulmonary hemorrhage.

  16. Prevalence and associated risk factors of ante‑partum hemorrhage ...

    African Journals Online (AJOL)

    Objective: The aim of this study was to determine the prevalence and associated risk factors of antepartum hemorrhage (APH) in the third trimester of Arab women residing in Qatar and their neonatal outcome. Design and Setting: A prospective hospital‑based study was conducted in the Women's Hospital and Maternity ...

  17. The effects of treating hypertension following aneurysmal subarachnoid hemorrhage

    NARCIS (Netherlands)

    Wijdicks, E. F.; Vermeulen, M.; Murray, G. D.; Hijdra, A.; van Gijn, J.

    1990-01-01

    We investigated in a consecutive series of 134 patients with aneurysmal subarachnoid hemorrhage whether institution of antihypertensive treatment was related to the incidence of cerebral ischemia and rebleeding. The aim of hypertensive treatment was to reduce the diastolic blood pressure to levels

  18. Non-operative management of arterial liver hemorrhages

    Energy Technology Data Exchange (ETDEWEB)

    Goerich, J.; Rilinger, N.; Vogel, J.; Sokiranski, R.; Brambs, H.J. [Dept. of Radiology, University of Ulm (Germany); Brado, M. [Dept. of Radiology, Univ. of Heidelberg (Germany); Huppert, P. [Dept. of Radiology, Univ. of Tuebingen (Germany); Siech, M.; Ganzauge, F.; Beger, H.G. [Dept. of Surgery, Univ. of Ulm (Germany)

    1999-02-01

    A retrospective evaluation of embolotherapy in patients with arterial liver hemorrhages was carried out. Twenty-six patients, ranging in age from 10 days to 77 years with active arterial liver hemorrhages, underwent non-surgical embolotherapy. Bleeding was attributed to trauma (n = 21), tumor (n = 3), pancreatitis (n = 1), or unknown cause (n = 1). Twenty-nine embolizations were performed via a transfemoral (n = 26) or biliary (n = 2) approach. One bare Wallstent was placed into the common hepatic artery via to an axillary route to cover a false aneurysm due to pancreatitis. Treatment was controlled in 4 patients by cholangioscopy (n = 2) or by intravascular ultrasound (n = 2). Prior surgery had failed in 3 patients. Intervention controlled the hemorrhage in 24 of 26 (92 %) patients within 24 h. Embolotherapy failed in 1 patient with pancreatic carcinoma and occlusion of the portal vein. In 1 patient with an aneurysm of the hepatic artery treated by Wallstent insertion, total occlusion was not achieved in the following days, as demonstrated by CT and angiography. However, colour Doppler flow examination showed no flow in the aneurysm 6 months later. Complications were one liver abscess, treated successfully by percutaneous drainage for 10 days, and one gallbladder necrosis after superselective embolization of the cystic artery. Embolization is a effective tool with a low complication rate in the treatment of liver artery hemorrhage, even in patients in whom surgery has failed. (orig.) (orig.) With 2 figs., 26 refs.

  19. Separate prediction of intracerebral hemorrhage and ischemic stroke

    NARCIS (Netherlands)

    B.S. Ferket (Bart); B.J.H. van Kempen (Bob); R.G. Wieberdink (Renske); E.W. Steyerberg (Ewout); P.J. Koudstaal (Peter Jan); A. Hofman (Albert); E. Shahar (Eyal); R.F. Gottesman (Rebecca); W.D. Rosamond (Wayne); J.R. Kizer (Jorge); R.A. Kronmal (Richard); B.M. Psaty (Bruce); W.T. Longstreth Jr. (W.); T.H. Mosley (Thomas); A.R. Folsom (Aaron); M.G.M. Hunink (Myriam); M.A. Ikram (Arfan)

    2014-01-01

    textabstractObjectives: To develop and validate 10-year cumulative incidence functions of intracerebral hemorrhage (ICH) and ischemic stroke (IS). Methods: We used data on 27,493 participants from 3 population-based cohort studies: the Atherosclerosis Risk in Communities Study, median age 54 years,

  20. Beyond maternal mortality : obstetric hemorrhage in a Malawian district

    NARCIS (Netherlands)

    Beltman, Jogchum; Van Den Akker, Thomas; Van Lonkhuijzen, Luc; Schmidt, Aniek; Chidakwani, Richard; Van Roosmalen, Jos

    2011-01-01

    Objective. To identify substandard care factors in the management of obstetric hemorrhage at district hospital level in rural Malawi. Design. Retrospective hospital-based cohort study. Setting. Thyolo District Hospital. Population. Women who delivered at this facility in 2005. Methods. All cases of

  1. Prevention of Postpartum Hemorrhage: Options for Home Births in ...

    African Journals Online (AJOL)

    This paper sought to determine the safety and feasibility of home-based prophylaxis of postpartum hemorrhage (PPH) with misoprostol, including assessment of the need for referrals and additional interventions. In rural Tigray, Ethiopia, traditional birth attendants (TBAs) in intervention areas were trained to administer ...

  2. Antidepressants during pregnancy and postpartum hemorrhage: a systematic review

    NARCIS (Netherlands)

    Bruning, A.H.L.; Heller, H.M.; Kieviet, N.; Bakker, P.C.A.M.; de Groot, C.J.M.; Dolman, K.M.; Honig, A.

    2015-01-01

    The use of antidepressants in pregnancy is increasing. Concerns have risen about the use of antidepressants during pregnancy and the risk of postpartum hemorrhage (PPH). The aim of this systematic review is to summarize evidence on the association between use of antidepressants during pregnancy and

  3. Subretinal Hemorrhage after Photodynamic Therapy for Juxtapapillary Retinal Capillary Hemangioma

    Directory of Open Access Journals (Sweden)

    Takayuki Baba

    2011-04-01

    Full Text Available A 75-year-old Japanese woman presented with a juxtapapillary retinal capillary hemangioma (RCH in her left eye. Twelve months after the initial examination, the size of the hemangioma had increased and the exudation from the RCH involved the macula. Her best-corrected visual acuity (BCVA had decreased from 0.8 to 0.3. A total of five intravitreal injections of bevacizumab (IVB; 1.25 mg was given but the RCH did not respond. A photodynamic therapy (PDT was done using multiple laser spots to avoid damaging the optic nerve head. After the first PDT, the subfoveal fluid was reduced but not completely gone. One week after the second PDT, a massive subretinal hemorrhage developed. The subretinal hemorrhage was successfully displaced by injecting intraocular sulfur hexafluoride (SF6 gas. At the 3-year follow-up examination, no subretinal hemorrhage or fluid was observed at the macula and the BCVA remained at 0.05. Our case was resistant to the combination of anti-vascular endothelial growth factor (VEGF and PDT and had a rare massive subretinal hemorrhage. A further collection of RCH cases treated with anti-VEGF and PDT that would justify this treatment is necessary.

  4. White Centered Retinal Hemorrhages in Vitamin B12 Deficiency Anemia

    Directory of Open Access Journals (Sweden)

    Claus Zehetner

    2011-05-01

    Full Text Available Background: To report a case of severe vitamin B12 deficiency anemia presenting with white centered retinal hemorrhages. Methods: Interventional case report. Results: A 40-year-old man, general practitioner himself, presented with a 1-day history of diminished left visual acuity and a drop-shaped central scotoma. The corrected visual acuities were 20/20, OD and 20/100, OS. Ophthalmic examination revealed bilaterally pale tarsal conjunctiva, discretely icteric bulbar conjunctiva and disseminated white centered intraretinal hemorrhages with foveal involvement. OCT imaging through these lesions revealed a retinal thickening caused by a sub-ILM accumulation of hyperreflective and inhomogeneous deposits within the nerve fiber layer. Immediate laboratory work-up showed severe megaloblastic anemia caused by vitamin B12 deficiency requiring erythrocyte transfusions. Discussion: Most reports of white centered retinal hemorrhages have been described in patients with leukemic retinopathy and bacterial endocarditis. It is interesting that this case of vitamin B12 deficiency anemia retinopathy has a clinically indistinguishable fundus appearance. This is probably due to the common pathology of capillary disruption and subsequent hemostatic fibrin plug formation. In megaloblastic anemia, direct anoxia results in endothelial dysfunction. The loss of impermeability allows extrusion of whole blood and subsequent diffusion from the disrupted site throughout and above the nerve fiber layer. Therefore the biomicroscopic pattern of white centered hemorrhages observed in anemic retinopathy is most likely due to the clot formation as the reparative sequence after capillary rupture.

  5. Hemorrhagic colitis as a presenting feature of Wegener granulomatosis.

    Science.gov (United States)

    Qian, Qi; Cornell, Lynn; Chandan, Vishal; Hartman, Robert; Caples, Sean

    2010-12-01

    Wegener granulomatosis (WG) is an idiopathic small vessel vasculitis involving primarily airway and kidneys. Intestinal involvement of WG is rare and usually occurs after several years of WG and its treatment. We report a case of WG, presented initially as rapid-onset hemorrhagic pancolitis without any preexisting or concurrent illness or any medication use. A 79-year-old previously healthy woman presented with 2-day duration of bloody diarrhea. Colonoscopy showed pancolitis with numerous ulcers; the biopsy showed foci of inflammation, ulceration and hemorrhage in the lamina propria, without features of chronic inflammatory bowel disease. Her stool studies were negative for infection. She subsequently developed pulmonary hemorrhage and kidney dysfunction. Kidney biopsy showed pauci-immune necrotizing glomerulonephritis. She responded to a combination therapy of steroids, cyclophosphamide and plasmapheresis with resolution of intestinal and pulmonary symptoms and improvement of kidney function. This case represents the first known example of colitis as an initial presentation of WG without confounding etiologic factors. Hemorrhagic colitis, although uncommon, may be the major presenting feature of WG.

  6. The Acute Inflammatory Response in Trauma / Hemorrhage and ...

    African Journals Online (AJOL)

    Traumatic injury/hemorrhagic shock (T/HS) elicits an acute inflammatory response that may result in death. Inflammation describes a coordinated series of molecular, cellular, tissue, organ, and systemic responses that drive the pathology of various diseases including T/HS and traumatic brain injury (TBI). Inflammation is a ...

  7. Histamine in hemorrhagic shock - A new approach with microdialysis

    NARCIS (Netherlands)

    Raum, M; Nagelschmidt, M; Rixen, D; Keiser, F; Gregor, S; Tiling, T; Bouillon, B; Neugebauer, E; Redl, H

    2005-01-01

    Microdialysis is a new approach for monitoring after hemorrhagic shock. The advantage of microdialysis is the local measurement of microcirculation and local changes of mediators. Until now this was mostly used in neuromonitoring. In this experiment we were focussed on the local changes of histamine

  8. Response to Imported Case of Marburg Hemorrhagic Fever, the Netherlands

    NARCIS (Netherlands)

    Timen, Aura; Koopmans, Marion P. G.; Vossen, Ann C. T. M.; van Doornum, Gerard J. J.; Guenther, Stephan; van den Berkmortel, Franchette; Verduin, Kees M.; Dittrich, Sabine; Emmerich, Petra; Osterhaus, Albert D. M. E.; van Dissel, Jaap T.; Coutinho, Roel A.

    On July 10, 2008, Marburg hemorrhagic fever was confirmed in a Dutch patient who had vacationed recently in Uganda. Exposure most likely occurred in the Python Cave (Maramagambo Forest), which harbors bat species that elsewhere in Africa have been found positive for Marburg virus. A

  9. Spatial analysis of hemorrhagic fever with renal syndrome in China

    NARCIS (Netherlands)

    L.Q. Fang; L. Yan (Lei); S. Liang (Song); S.J. de Vlas (Sake); D. Feng (Dan); X.N. Han (Xiao); W.-J. Zhao (Wen-Juan); B. Xu (Bing); L. Bian (Ling); H. Yang (Honghui); P. Gong (Peng); J.H. Richardus (Jan Hendrik); W.-C. Cao (Wu-Chun)

    2006-01-01

    textabstractBackground: Hemorrhagic fever with renal syndrome (HFRS) is endemic in many provinces with high incidence in mainland China, although integrated intervention measures including rodent control, environment management and vaccination have been implemented for over ten years. In this study,

  10. Pattern and location of intracerebral hemorrhage in Enugu, South ...

    African Journals Online (AJOL)

    Relevant data were obtained, and statistical analysis was done using SPSS version 19 (IBM Corporation, New York, USA). Results: A total of 139 (17.4%) out of 799 scans done over the period under review were analyzed. The frequency of lobar and deep cerebral hemorrhages (LH and DCHs) was 46.8% and 53.2%, ...

  11. Neuroanatomical considerations of isolated hearing loss in thalamic hemorrhage

    Directory of Open Access Journals (Sweden)

    Nitin Agarwal, M.D.

    2016-12-01

    Conclusion: Presumably, this neurological deficit was caused by a hypertensive hemorrhage in the posterior right thalamus. The following case and discussion will review the potential neuroanatomical pathways that we suggest could make isolated hearing loss be part of a “thalamic syndrome.”

  12. Management of Hemorrhagic Pseudoaneurysmal Arteriovenous Fistula of the Sphenopalatine Artery

    Directory of Open Access Journals (Sweden)

    Ajeet Gordhan

    2013-01-01

    Full Text Available n-Butyl cyanoacrylate (n-BCA embolization of a hemorrhagic pseudoaneurysmal arteriovenous fistula of the sphenopalatine artery in a patient with paranasal sinus squamous cell carcinoma treated with regional surgery and radiation has, to our knowledge, not been previously reported.

  13. Subarachnoid hemorrhage: long-term consequences & stem cell treatment

    NARCIS (Netherlands)

    Kooijman, E.

    2014-01-01

    Subarachnoid hemorrhage (SAH) represents a considerable health problem that strikes patients at a relatively young age. At present, limited options are available to treat the devastating consequences of SAH. The endovascular puncture model is a suitable animal model to study the pathophysiological

  14. Propranolol Treatment of Cavernous Malformations with Symptomatic Hemorrhage.

    Science.gov (United States)

    Zabramski, Joseph M; Kalani, M Yashar S; Filippidis, Aristotelis S; Spetzler, Robert F

    2016-04-01

    Cerebral cavernous malformations are more common than generally thought, affecting approximately 1 in every 250 adults. Most of these lesions are asymptomatic or have a relatively benign course, but a small minority behave aggressively and present with recurrent episodes of symptomatic hemorrhage. A safe and effective medical treatment option for the management of this latter group would be useful. Propranolol has recently been shown to be effective in the treatment of infantile hemangioma, a close pathologic counterpart of cavernous malformations. These results suggest a potential role for propranolol treatment in the management of patients with symptomatic cavernous malformations. Low-dose propranolol (20 mg, three times daily) was used to treat 2 adult female patients in their mid- to late fifties, both of whom had symptomatic cavernous malformations and a history of repeated hemorrhage. Serial magnetic resonance imaging studies after the initiation of propranolol demonstrated regression of the lesions and no evidence of recurrent hemorrhage. Propranolol may offer a safe and effective treatment for patients who have cavernous malformations with symptomatic hemorrhage. Additional studies are needed to confirm these findings. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Continuing versus Stopping Prestroke Antihypertensive Therapy in Acute Intracerebral Hemorrhage

    DEFF Research Database (Denmark)

    Krishnan, Kailash; Scutt, Polly; Woodhouse, Lisa

    2016-01-01

    BACKGROUND AND PURPOSE: More than 50% of patients with acute intracerebral hemorrhage (ICH) are taking antihypertensive drugs before ictus. Although antihypertensive therapy should be given long term for secondary prevention, whether to continue or stop such treatment during the acute phase of ICH...

  16. Review of past and present Ebola hemorrhagic fever outbreaks in ...

    African Journals Online (AJOL)

    Background: Ebola Hemorrhagic Fever (EHF) has become well known all over the world, especially following the West African outbreak in Guinea, Sierra Leone and Liberia (December 2013). The Ebola virus was first discovered in the Democratic Republic of Congo (DRC), an African country that has continued to register ...

  17. Spontaneous Intracerebral Hemorrhage Image Analysis Methods: A Survey

    Science.gov (United States)

    Pérez, Noel; Valdés, Jose; Guevara, Miguel; Silva, Augusto

    Spontaneous intracerebral hemorrhages (ICH) account for 10-30% of all strokes and are a result of acute bleeding into the brain due to ruptures of small penetrating arteries. Despite major advancements in the management of ischemic strokes and other causes of hemorrhagic strokes, such as ruptured aneurysm, arteriovenous malformations (AVMs), or cavernous angioma, during the past several decades, limited progress has been made in the treatment of ICH, and the prognosis for patients who suffer them remains poor. The societal impact of these hemorrhagic strokes is magnified by the fact that affected patients typically are a decade younger than those afflicted with ischemic strokes. The ICH continues to kill or disable most of their victims. Some studies show that those who suffer ICH have a 30-day mortality rate of 35-44% and a 6-month mortality rate approaching 50%. Approximately 700,000 new strokes occur in the United States annually and approximately 15% are hem-orrhagic strokes related to ICH. The poor outcome associated with ICH is related to the extent of brain damage. ICH produces direct destruction and compression of surrounding brain tissue. Direct compression causes poor perfusion and venous drainage to surrounding penumbra at risk, resulting in ischemia to the tissues that most need perfusion [16].

  18. Diffuse alveolar hemorrhage in a young woman with systemic lupus ...

    African Journals Online (AJOL)

    Diffuse Alveolar Hemorrhage (DAH) is rarely reported complication of Systemic Lupus Erythematosus (SLE). A young woman diagnosed SLE, with a previously normal plain chest radiograph, developed acute onset cough, dyspnoea and hemoptysis. The repeat urgent chest radiograph revealed alveolar opacities. The triad ...

  19. Response to imported case of Marburg hemorrhagic fever, the Netherland

    NARCIS (Netherlands)

    Timen, A.; Koopmans, M.P.G.; Vossen, A.C.T.M.; van Doornum, G.J.J.; Günther, S.; van den Berkmortel, F.; Verduin, K.M.; Dittrich, S.; Emmerich, P.; Osterhaus, A.D.M.E.; van Dissel, J.T.; Coutinho, R.A.

    2009-01-01

    On July 10, 2008, Marburg hemorrhagic fever was confirmed in a Dutch patient who had vacationed recently in Uganda. Exposure most likely occurred in the Python Cave (Maramagambo Forest), which harbors bat species that elsewhere in Africa have been found positive for Marburg virus. A

  20. Response to imported case of Marburg hemorrhagic fever, the Netherlands

    NARCIS (Netherlands)

    Timen, A.; Koopmans, M.P.; Vossen, A.C.; Doornum, G.J.J. van; Gunther, S.; Berkmortel, F. van den; Verduin, K.M.; Dittrich, S.; Emmerich, P.; Osterhaus, A.D.; Dissel, J.T. van; Coutinho, R.A.

    2009-01-01

    On July 10, 2008, Marburg hemorrhagic fever was confirmed in a Dutch patient who had vacationed recently in Uganda. Exposure most likely occurred in the Python Cave (Maramagambo Forest), which harbors bat species that elsewhere in Africa have been found positive for Marburg virus. A

  1. Complications of hemorrhagic and ischemic stroke : a CT perfusion evaluation

    NARCIS (Netherlands)

    Dankbaar, J.W.|info:eu-repo/dai/nl/314079408

    2010-01-01

    In this thesis the use of CT-perfusion (CTP) imaging in the evaluation of the most severe complications of subarachnoid hemorrhage (SAH)) and ischemic stroke was explored. These complications are delayed cerebral ischemia (DCI) after SAH and damage to the blood-brain barrier (BBB) after ischemic

  2. Aneurysmal Subarachnoid Hemorrhage and Neuroinflammation: A Comprehensive Review

    Directory of Open Access Journals (Sweden)

    Brandon P. Lucke-Wold

    2016-04-01

    Full Text Available Aneurysmal subarachnoid hemorrhage (SAH can lead to devastating outcomes including vasospasm, cognitive decline, and even death. Currently, treatment options are limited for this potentially life threatening injury. Recent evidence suggests that neuroinflammation plays a critical role in injury expansion and brain damage. Red blood cell breakdown products can lead to the release of inflammatory cytokines that trigger vasospasm and tissue injury. Preclinical models have been used successfully to improve understanding about neuroinflammation following aneurysmal rupture. The focus of this review is to provide an overview of how neuroinflammation relates to secondary outcomes such as vasospasm after aneurysmal rupture and to critically discuss pharmaceutical agents that warrant further investigation for the treatment of subarachnoid hemorrhage. We provide a concise overview of the neuroinflammatory pathways that are upregulated following aneurysmal rupture and how these pathways correlate to long-term outcomes. Treatment of aneurysm rupture is limited and few pharmaceutical drugs are available. Through improved understanding of biochemical mechanisms of injury, novel treatment solutions are being developed that target neuroinflammation. In the final sections of this review, we highlight a few of these novel treatment approaches and emphasize why targeting neuroinflammation following aneurysmal subarachnoid hemorrhage may improve patient care. We encourage ongoing research into the pathophysiology of aneurysmal subarachnoid hemorrhage, especially in regards to neuroinflammatory cascades and the translation to randomized clinical trials.

  3. Crimean-Congo Hemorrhagic Fever Virus in Bulgaria and Turkey

    Czech Academy of Sciences Publication Activity Database

    Mertens, M.; Schuster, I.; Sas, M. A.; Vatansever, Z.; Hubálek, Zdeněk; Güven, E.; Deniz, A.; Georgiev, G.; Peshev, R.; Groschup, M. H.

    2016-01-01

    Roč. 16, č. 9 (2016), s. 619-623 ISSN 1530-3667 EU Projects: European Commission(XE) 261504 - EDENEXT Institutional support: RVO:68081766 Keywords : Crimean-Congo hemorrhagic fever virus: CCHFV * domestic animals * ELISA * epidemiology Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.045, year: 2016

  4. Coexistent Intracerebral and Subdural Hemorrhage : A case Report

    Directory of Open Access Journals (Sweden)

    Khati C

    1999-01-01

    Full Text Available Subdural and Intracerebral Hemorrhage, occuring simultaneously in a patient is a very rare condition. The few case reports found in literature occurred in situations of trauma, coagulopathy, CNS malignancy and in dialysis dependant patients. We report one such case where both conditions coexisted, in the background of poorly controlled hypertension. The possible pathogenesis in this case is discussed.

  5. Repeated outbreaks of Viral hemorrhagic fevers in Uganda ...

    African Journals Online (AJOL)

    Background: Since the year 2000, Uganda has experienced repeated outbreaks of viral hemorrhagic fevers (VHF). Ebola VHF outbreak occurred in the districts of Gulu in 2000, Bundibugyo, 2007, Luwero, 2011, Kibaale in July 2012, Luwero in November 2012. Marburg VHF was earlier reported in Ibanda in 2007.

  6. Postpartum hemorrhage is related to the hemoglobin levels at labor ...

    African Journals Online (AJOL)

    Kaima A. Frass

    2015-01-06

    Jan 6, 2015 ... Abstract Background: Anemia in pregnancy is common and linked to postpartum hemorrhage in terms of uterine atony. The more severe the anemia, the more likely the greater blood loss and adverse outcome. The aim of this study was to examine the association between anemic women at labor and ...

  7. Lens-sparing vitreous surgery for infantile amblyogenic vitreous hemorrhage.

    Science.gov (United States)

    Capone, Antonio

    2003-12-01

    To report on a series of infants with amblyogenic vitreous and/or subinternal limiting membrane hemorrhage managed by lens-sparing vitrectomy. Retrospective case series studying retinal attachment status and visual acuity. Eleven eyes sustained vitreous hemorrhage as a consequence of shaken baby syndrome, 1 due to hyaloidal canal hemorrhage extending into the vitreous, 1 due to Terson syndrome, 1 due to birth trauma, and 2 due to a presumed coagulation disorder. Age of the patients at the time of surgery ranged from 2 to 23 months (age adjusted for prematurity). Follow-up ranged from 7 to 81 months (mean, 28 months). Ten eyes had visual improvement. Two infants with shaken baby syndrome had bilateral nonrecordable flash visual evoked potential before surgery; one eye of one infant had a better than expected visual outcome after surgery. One eye sustained a retinal tear without detachment. One eye in an infant with severe shaken baby syndrome and traumatic retinopathy developed a total rhegmatogenous retinal detachment with proliferative vitreoretinopathy. Infantile amblyogenic vitreous hemorrhage may be effectively managed by lens-sparing vitreous surgery. Visual outcome of shaken baby syndrome may be limited as a consequence of structural damage to the retina, optic nerve, or posterior visual pathways.

  8. Studies on hemorrhagic pneumonia in Moschus sifanicus | Lu ...

    African Journals Online (AJOL)

    A series of investigations were carried out including epidemiology, etiology and pathology on hemorrhagic pneumonia in Moschus sifanicus, which had prevailed in Xinglong Mountain National Nature Reserve District in Gansu province of China. The results indicated that the prevalence of this disease could be correlated ...

  9. Gastrointestinal bleeding in patients with hereditary hemorrhagic telangiectasia

    DEFF Research Database (Denmark)

    Kjeldsen, A D; Kjeldsen, J

    2000-01-01

    Gastrointestinal bleeding occurs in a number of patients with hereditary hemorrhagic telangiectasia (HHT) and may lead to a high transfusion need. The aim of this study was to estimate the occurrence and severity of gastrointestinal bleeding in a geographically well defined HHT population....

  10. Island Sign: An Imaging Predictor for Early Hematoma Expansion and Poor Outcome in Patients With Intracerebral Hemorrhage.

    Science.gov (United States)

    Li, Qi; Liu, Qing-Jun; Yang, Wen-Song; Wang, Xing-Chen; Zhao, Li-Bo; Xiong, Xin; Li, Rui; Cao, Du; Zhu, Dan; Wei, Xiao; Xie, Peng

    2017-11-01

    The aim of the study was to investigate the usefulness of the computed tomography (CT) island sign for predicting early hematoma growth and poor functional outcome. We included patients with spontaneous intracerebral hemorrhage (ICH) who had undergone baseline CT within 6 hours after ICH symptom onset in our hospital between July 2011 and September 2016. Two readers independently assessed the presence of the island sign on the admission noncontrast CT scan. Multivariable logistic regression analysis was used to analyze the association between the presence of the island sign on noncontrast admission CT and early hematoma growth and functional outcome. A total of 252 patients who met the inclusion criteria were analyzed. Among them, 41 (16.3%) patients had the island sign on baseline noncontrast CT scans. In addition, the island sign was observed in 38 of 85 patients (44.7%) with hematoma growth. Multivariate logistic regression analysis demonstrated that the time to baseline CT scan, initial hematoma volume, and the presence of the island sign on baseline CT scan independently predicted early hematoma growth. The sensitivity of the island sign for predicting hematoma expansion was 44.7%, specificity 98.2%, positive predictive value 92.7%, and negative predictive value 77.7%. After adjusting for the patients' age, baseline Glasgow Coma Scale score, presence of intraventricular hemorrhage, presence of subarachnoid hemorrhage, admission systolic blood pressure, baseline ICH volume, and infratentorial location, the presence of the island sign (odds ratio, 3.51; 95% confidence interval, 1.26-9.81; P=0.017) remained an independent predictor of poor outcome in patients with ICH. The island sign is a reliable CT imaging marker that independently predicts hematoma expansion and poor outcome in patients with ICH. The noncontrast CT island sign may serve as a potential marker for therapeutic intervention. © 2017 American Heart Association, Inc.

  11. Curative effect of minimally invasive puncture and drainage assisted with alteplase on treatment of acute intracerebral hemorrhage

    Directory of Open Access Journals (Sweden)

    Jun-Lin Hu

    2017-01-01

    Full Text Available Objective: To investigate the different effects on evacuation of hematoma, the severity of nerve injury, inflammatory reaction and oxidative stress response in the treatment of acute intracerebral hemorrhage by using minimally invasive puncture and drainage assisted with alteplase or urokinase. Methods: A total of 114 patients with acute intracerebral hemorrhage treated with minimally invasive puncture and drainage in our hospital from May 2012 to October 2015 were retrospectively analyzed and divided into alteplase group and urokinase group, which received adjuvant therapy with alteplase and urokinase, respectively. Before and after treatment, CT was used for scanning, and the volume of hematoma and edema and the distance of midline shift were examined. After treatment, serum was collected for detecting the contents of molecular markers of nerve injury, inflammatory reaction and oxidative stress response. Results: On the 3rd day after treatment, the volume of hematoma and edema and the distance of midline shift in minimally invasive group were significantly lower than those of craniotomy group, and incidence of intracranial infection was lower than that of craniotomy group. There was no significant difference of rebleeding incidence compared to craniotomy group. The serum contents of osteopontin, S100β, glial fibrillary acidic protein, neuron-specific enolase, myelin basic protein, neuropeptide Y, ischemia modified albumin, tumor necrosis factor alpha, interleukin-1β, interleukin-6, interleukin-8, soluble intercellular adhesion molecule-1, highmobility group protein 1, malonaldehyde, advanced oxidation protein products and 8-hydroxy- 2'-deoxyguanosine urine of patients from alteplase group were significantly lower than those of urokinase group. The content of total antioxidant capacity was obviously higher than that of urokinase group. Conclusions: As for the effect on evacuation of hematoma and also the ameliorative effect on nerve injury

  12. Clinical features and patient management of Lujo hemorrhagic fever.

    Directory of Open Access Journals (Sweden)

    Nivesh H Sewlall

    Full Text Available In 2008 a nosocomial outbreak of five cases of viral hemorrhagic fever due to a novel arenavirus, Lujo virus, occurred in Johannesburg, South Africa. Lujo virus is only the second pathogenic arenavirus, after Lassa virus, to be recognized in Africa and the first in over 40 years. Because of the remote, resource-poor, and often politically unstable regions where Lassa fever and other viral hemorrhagic fevers typically occur, there have been few opportunities to undertake in-depth study of their clinical manifestations, transmission dynamics, pathogenesis, or response to treatment options typically available in industrialized countries.We describe the clinical features of five cases of Lujo hemorrhagic fever and summarize their clinical management, as well as providing additional epidemiologic detail regarding the 2008 outbreak. Illness typically began with the abrupt onset of fever, malaise, headache, and myalgias followed successively by sore throat, chest pain, gastrointestinal symptoms, rash, minor hemorrhage, subconjunctival injection, and neck and facial swelling over the first week of illness. No major hemorrhage was noted. Neurological signs were sometimes seen in the late stages. Shock and multi-organ system failure, often with evidence of disseminated intravascular coagulopathy, ensued in the second week, with death in four of the five cases. Distinctive treatment components of the one surviving patient included rapid commencement of the antiviral drug ribavirin and administration of HMG-CoA reductase inhibitors (statins, N-acetylcysteine, and recombinant factor VIIa.Lujo virus causes a clinical syndrome remarkably similar to Lassa fever. Considering the high case-fatality and significant logistical impediments to controlled treatment efficacy trials for viral hemorrhagic fever, it is both logical and ethical to explore the use of the various compounds used in the treatment of the surviving case reported here in future outbreaks

  13. Endovascular Management of Intractable Postpartum Hemorrhage Caused by Vaginal Laceration

    Energy Technology Data Exchange (ETDEWEB)

    Koganemaru, Masamichi, E-mail: mkoganemaru@med.kurume-u.ac.jp; Nonoshita, Masaaki, E-mail: z2rs-1973@yahoo.co.jp; Iwamoto, Ryoji, E-mail: iwamoto-ryouji@kurume-u.ac.jp; Kuhara, Asako, E-mail: kuhara-asako@med.kurume-u.ac.jp; Nabeta, Masakazu, E-mail: nabeta-masakazu@med.kurume-u.ac.jp; Kusumoto, Masashi, E-mail: kusumoto-masashi@med.kurume-u.ac.jp; Kugiyama, Tomoko, E-mail: kugiyama-tomoko@med.kurume-u.ac.jp [Kurume University School of Medicine, Department of Radiology (Japan); Kozuma, Yutaka, E-mail: kouduma-yutaka@kurume-u.ac.jp [Kurume University School of Medicine, Department of Obstetrics and Gynecology (Japan); Nagata, Shuji, E-mail: sn4735@med.kurume-u.ac.jp; Abe, Toshi, E-mail: toshiabe@med.kurume-u.ac.jp [Kurume University School of Medicine, Department of Radiology (Japan)

    2016-08-15

    PurposeWe evaluated the management of transcatheter arterial embolization for postpartum hemorrhage caused by vaginal laceration.Materials and MethodsWe reviewed seven cases of patients (mean age 30.9 years; range 27–35) with intractable hemorrhages and pelvic hematomas caused by vaginal lacerations, who underwent superselective transcatheter arterial embolization from January 2008 to July 2014. Postpartum hemorrhage was evaluated by angiographic vascular mapping to determine the vaginal artery’s architecture, technical and clinical success rates, and complications.ResultsThe vaginal artery was confirmed as the source of bleeding in all cases. The artery was found to originate from the uterine artery in three cases, the uterine and obturator arteries in two, or the internal pudendal artery in two. After vaginal artery embolization, persistent contrast extravasation from the inferior mesenteric artery as an anastomotic branch was noted in one patient. Nontarget vessels (the inferior vesical artery and nonbleeding vaginal arterial branches) were embolized in one patient. Effective control of hemostasis and no post-procedural complications were confirmed for all cases.ConclusionPostpartum hemorrhages caused by vaginal lacerations involve the vaginal artery arising from the anterior trunk of the internal iliac artery with various branching patterns. Superselective vaginal artery embolization is clinically acceptable for the successful treatment of vaginal laceration hemorrhages, with no complications. After vaginal artery embolization, it is suggested to check for the presence of other possible bleeding vessels by pelvic aortography with a catheter tip at the L3 vertebral level, and to perform a follow-up assessment.

  14. Resveratrol Rescues Kidney Mitochondrial Function Following Hemorrhagic Shock.

    Science.gov (United States)

    Wang, Hao; Guan, Yuxia; Karamercan, Mehmet Akif; Ye, Lan; Bhatti, Tricia; Becker, Lance B; Baur, Joseph A; Sims, Carrie A

    2015-08-01

    Hemorrhagic shock may contribute to acute kidney injury (AKI) by profoundly altering renal mitochondrial function. Resveratrol (RSV), a naturally occurring sirtuin 1 (SIRT1) activator, has been shown to promote mitochondrial function and reduce oxidative damage in a variety of aging-related disease states. We hypothesized that RSV treatment during resuscitation would ameliorate kidney mitochondrial dysfunction and decrease oxidative damage following hemorrhagic shock. Using a decompensated hemorrhagic shock model, male Long-Evans rats (n = 6 per group) were killed prior to hemorrhage (sham), at severe shock, and following either lactated Ringer's (LR) resuscitation or LR + RSV resuscitation (RSV: 30 mg/kg). At each time point, blood samples were assayed for arterial blood gases, lactate, blood urea nitrogen, and serum creatinine. Mitochondria were also isolated from kidney samples in order to assess individual electron transport complexes (complexes I, II, and IV) using high-resolution respirometry. Total mitochondria reactive oxygen species were measured using fluorometry, and lipid peroxidation was assessed by measuring 4-hydroxynonenal by Western blot. Quantitative polymerase chain reaction was used quantify mRNA from peroxisome proliferator-activated receptor γ coactivator 1-α (PGC1-α) SIRT1, and proteins known to mitigate oxidative damage and promote mitochondrial biogenesis. Resveratrol supplementation during resuscitation restored mitochondrial respiratory capacity and decreased mitochondrial reactive oxygen species and lipid peroxidation. Compared with standard LR resuscitation, RSV treatment significantly increased SIRT1 and PGC1-α expression and significantly increased both superoxide dismutase 2 and catalase expression. Although RSV was associated with decreased lactate production, pH, blood urea nitrogen, and serum creatinine values did not differ between resuscitation strategies. Resuscitation with RSV significantly restored renal mitochondrial

  15. PATHOPHYSIOLOGY STROKE NON-HEMORRHAGIC ET CAUSA THROMBUS

    Directory of Open Access Journals (Sweden)

    Aji Kristianto Wijaya

    2013-10-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE Stroke is one of the most common cause of death worldwide and the third leading cause of death in the United States. Stroke composed 90,000 deaths of women and 60,000 men each year. In Indonesia, 8 of 1000 people suffered a stroke. Stroke is divided into two, non-hemorrhagic stroke and hemorrhagic stroke. Most of them (80% is non-hemorrhagic stroke. Non-hemorrhagic stroke can be caused by thrombi or emboli. Understanding the pathophysiology of non-hemorrhagic stroke caused by a thrombus is very important in regard with providing appropriate patient management. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  16. Updates in diagnosis and management of Ebola hemorrhagic fever

    Directory of Open Access Journals (Sweden)

    Salah Mohamed El Sayed

    2016-01-01

    Full Text Available Ebola hemorrhagic fever is a lethal viral disease transmitted by contact with infected people and animals. Ebola infection represents a worldwide health threat causing enormous mortality rates and fatal epidemics. Major concern is pilgrimage seasons with possible transmission to Middle East populations. In this review, we aim to shed light on Ebola hemorrhagic fever as regard: virology, transmission, biology, pathogenesis, clinical picture, and complications to get the best results for prevention and management. We also aim to guide future research to new therapeutic perspectives to precise targets. Our methodology was to review the literature extensively to make an overall view of the biology of Ebola virus infection, its serious health effects and possible therapeutic benefits using currently available remedies and future perspectives. Key findings in Ebola patients are fever, hepatic impairment, hepatocellular necrosis, lymphopenia (for T-lymphocyte and natural killer cells with lymphocyte apoptosis, hemorrhagic manifestations, and complications. Pathogenesis in Ebola infection includes oxidative stress, immune suppression of both cell-mediated and humoral immunities, hepatic and adrenal impairment and failure, hemorrhagic fever, activation of deleterious inflammatory pathways, for example, tumor necrosis factor-related apoptosis-inducing ligand, and factor of apoptotic signal death receptor pathways causing lymphocyte depletion. Several inflammatory mediators and cytokines are involved in pathogenesis, for example, interleukin-2, 6, 8, and 10 and others. In conclusion, Ebola hemorrhagic fever is a serious fatal viral infection that can be prevented using strict health measures and can be treated to some extent using some currently available remedies. Newer treatment lines, for example, prophetic medicine remedies as nigella sativa may be promising.

  17. Massive hemorrhage management-a best evidence topic report.

    Science.gov (United States)

    Vymazal, Tomas

    2015-01-01

    Massive hemorrhage remains a major cause of potentially preventable deaths. Better control of bleeding could improve survival rates by 10%-20%. Transfusion intervention concepts have been formulated in order to minimize acute traumatic coagulopathy. These interventions still have not been standardized and vary among medical centers. Based on a literature search using free term keywords and Medical Subject Heading (MeSH) index, we analyzed published articles addressing massive hemorrhage, component therapy, fresh whole blood, and fibrinogen from the year 2000 onward, in journals with impact factor >1.000, in Medline, PubMed, and Google Scholar. The evidence was grouped into topics including laboratory testing and transfusion interventions/viscoelastic assays vs standard laboratory tests, the effect of component therapy on patient outcome, the effect of warm fresh whole blood on patient outcome, and the effects of fibrinogen in severe bleeding. The obtained information was compared, evaluated, confronted, and was focused on to present an adequate and individual-based massive hemorrhage management approach. Viscoelastic whole-blood assays are superior to standard coagulation blood tests for the identification of coagulopathy and for guiding decisions on appropriate therapy in patients with severe bleeding. Replacement of plasma, red blood cells, platelets, and fibrinogen in a ratio of 1:1:1:1 has appeared to be the best substitution for lost whole blood. There is no evidence that cryoprecipitate improves the outcome of patients with severe hemorrhage. Current literature promotes the transfusion of warm fresh whole blood, which seems to be superior to the component therapy in certain clinical situations. Some authors recommend that fibrinogen and other coagulation factors be administered according to the viscoelastic attributes of the blood clot. This best-evidence topic report brings comprehensive information about massive hemorrhage management.

  18. Effect of hemorrhage rate on early hemodynamic responses in conscious sheep

    OpenAIRE

    Scully, Christopher G.; Daluwatte, Chathuri; Marques, Nicole R.; Khan, Muzna; Salter, Michael; Wolf, Jordan; Nelson, Christina; Salsbury, John; Enkhbaatar, Perenlei; Kinsky, Michael; Kramer, George C.; Strauss, David G.

    2016-01-01

    Abstract Physiological compensatory mechanisms can mask the extent of hemorrhage in conscious mammals, which can be further complicated by individual tolerance and variations in hemorrhage onset and duration. We assessed the effect of hemorrhage rate on tolerance and early physiologic responses to hemorrhage in conscious sheep. Eight Merino ewes (37.4???1.1?kg) were subjected to fast (1.25?mL/kg/min) and slow (0.25?mL/kg/min) hemorrhages separated by at least 3?days. Blood was withdrawn until...

  19. Analysis of Glial Fibrillary Acidic Protein (GFAP Serum Levels on Spontaneous Intracerebral Hemorrhage Non-Lesion Patients

    Directory of Open Access Journals (Sweden)

    Suzy Indharty

    2016-04-01

    Full Text Available Background: Stroke is one of the root causes of brain disorders at the height of the productive age and ranks second cause of death after heart disease in most countries in the world. Fairly large-scale study conducted by ASNA (ASEAN Neurological Association in 28 Hospitals in Indonesia. This study was conducted in patients with acute stroke who were treated in hospital (hospital-based study and conducted a survey of factors - risk factors, treatment duration and mortality and morbidity. Method: This is a cross sectional study, with intracerebral hemorrhage Head CT scan examination then examined serum levels of plasma GFAP her at the time of patient entry from RSUP. H. Adam Malik Medan from March 2014 -May 2014. Results: In this research, we found the frequency of male patients as many (62.5%, while as many women (37.5%. Predominant age range in patients encountered in this study were 46-51 years old and are the dominant ethnic Batak tribe (43.8%. Conclusion: There were no significant differences between groups in serum GFAP levels with bleeding volume ≥ 30 cc compared to those with bleeding volume <30 cc (p = 0.599. GFAP is a biomarker to distinguish whether stroke patients including intracerebral hemorrhage or ischemic stroke Further longitudinal study would be needed to confirm the role.

  20. Obstetric hemorrhage and coagulation: an update. Thromboelastography, thromboelastometry, and conventional coagulation tests in the diagnosis and prediction of postpartum hemorrhage.

    NARCIS (Netherlands)

    Lange, N.M. de; Lance, M.D.; Groot, R. de; Beckers, E.A.; Henskens, Y.M.; Scheepers, H.C.J.

    2012-01-01

    Globally, postpartum hemorrhage (PPH) is the leading cause of maternal morbidity and mortality. In the current treatment of severe PPH, first-line therapy includes transfusion of packed cells and fresh-frozen plasma in addition to uterotonic medical management and surgical interventions. In

  1. [Development of Intracerebral Hemorrhage and Subarachnoid Hemorrhage Shortly after Cerebral Infarction Onset in an Adult Patient with Moyamoya Disease].

    Science.gov (United States)

    Yoshida, Jun; Kubo, Yoshitaka; Yoshida, Kenji; Chida, Kohei; Kobayashi, Masakazu; Ogasawara, Kuniaki

    2017-02-01

    Here we describe the case of a patient with moyamoya disease who developed cerebral infarction followed shortly by subarachnoid hemorrhage and intracerebral hemorrhage. A 50-year-old woman presenting with sudden and transient weakness of the left lower limb was transferred to a local hospital. Magnetic resonance imaging(MRI)revealed cerebral infarction in the corpus callosum and in the bilateral frontal lobes induced by moyamoya disease. Pyramidal tract was not affected. The patient was treated with an anti-platelet agent(ozagrel sodium 160mg/day)and did not undergo intentional antihypertensive therapy. The patient's averaged blood pressure was 150/90mmHg. Six days after symptom onset, the patient's orientation deteriorated. Head computed tomography scans revealed a subarachnoid hemorrhage in the right sylvian fissure and in the bilateral frontal lobes and an intracerebral hemorrhage adjacent to the left corona radiata. In addition, MRI revealed a significant expansion of the cerebral infarction in the bilateral frontal lobes. Angiography with arterial catheterization confirmed that the patient's symptoms met diagnostic criteria of stage III moyamoya disease. Positron emission tomography revealed hemodynamic compromise in the left cerebral hemisphere. The patient underwent a superficial temporal artery-middle cerebral artery anastomosis with encephalo-duro-myo-synangiosis. The patient's postoperative course was uneventful. Postoperative T2*-weighted MRI revealed multiple microbleeds in both cerebral hemispheres.

  2. Pre-hemorrhage statin use and the risk of vasospasm following aneurysmal subarachnoid hemorrhage

    Science.gov (United States)

    Moskowitz, Shaye I.; Ahrens, Christine; Provencio, J Javier; Chow, Michael; Rasmussen, Peter A

    2010-01-01

    Background and Purpose Aneurysmal subarachnoid hemorrhage (SAH) is often followed by delayed ischemic deficits attributable to cerebral vasospasm. Recent studies suggest a positive impact of statin therapy on the incidence of vasospasm. This study was designed to assess whether a history of prior use of statin therapy was associated with a lower risk of vasospasm in patients with SAH. Methods We performed a comprehensive retrospective review of patients with aneurysmal SAH between 1997 and 2004. Clinical demographics and imaging data for all patients were reviewed and a logistic regression analysis was performed to identify the predictors of cerebral vasospasm, defined as a combination of clinical signs with radiographic confirmation. Results 308 patients were included. Mean age was higher in the group receiving statins (64 +/- 12 versus 54+/- 12 years). Hunt and Hess scores and treatment modality were not significantly different between the groups. Vasospasm was observed in 31% of patients not taking a statin (n=282) versus 23% taking a statin (n=26), without achieving statistical significance. Discontinuation of the statin did not affect risk of vasospasm. Conclusions Use of a statin prior to an aneurysmal SAH trended to reduce the incidence of subsequent vasospasm, without achieving statistical significance. PMID:18423529

  3. Efficacy and survival associated with cystoscopy and clot evacuation for radiation or cyclophosphamide induced hemorrhagic cystitis.

    Science.gov (United States)

    Kaplan, Joshua R; Wolf, J Stuart

    2009-02-01

    We assessed the outcome of patients with hemorrhagic cystitis severe enough to require cystoscopy and clot evacuation. We retrospectively evaluated the records of 33 patients with cyclophosphamide or radiation induced hemorrhagic cystitis treated with cystoscopy. Mean followup of living patients was 76 months. Of 33 patients 20 (61%) had resolution of hematuria after single cystoscopy unrelated to hemorrhagic cystitis etiology. Only 4 of 11 patients (36%) had resolution after 2 or more cystoscopies, and all were in the radiation induced hemorrhagic cystitis group (4 of 6, 67%) with none in the cyclophosphamide induced hemorrhagic cystitis group (0 of 5, p = 0.02). Hematuria was refractory to cystoscopy in 9 patients and ileal conduits were created in 4. Kaplan-Meier overall survival at 1, 2 and 5 years was 58%, 51% and 43%, respectively, with survival tending to be worse in patients who received cyclophosphamide for bone marrow transplantation induction. Of the 18 deaths 3 were due to complications of hemorrhagic cystitis, 13 were due to the disease underlying the hemorrhagic cystitis and 2 were unrelated. The response of hemorrhagic cystitis to single cystoscopy and clot evacuation is reasonable but response to subsequent cystoscopy (unless the hemorrhagic cystitis is radiation induced) is less likely, so alternate interventions should be considered if hematuria does not resolve after initial cystoscopy. Patients with hemorrhagic cystitis requiring cystoscopy have a poor prognosis even if hematuria resolves, although most deaths are related to the disease underlying the hemorrhagic cystitis rather than its direct result.

  4. Intracranial hemorrhage of the mature newborn infant. Centering around the CT picture

    Energy Technology Data Exchange (ETDEWEB)

    Takemine, Hisao

    1983-08-01

    The labour course, treatment, and prognoses were discussed concerning four mature newborn infants with intracranial hemorrhage diagnosed by CT. Of intracranial hemorrhage, 70.7% was small hemorrhage along the cerebellar tentorium and the falx cerebri, 12.2% subdural hemorrhage in the posterior cranial fossa, and 9.8% subdural hemorrhage in the fornex. Intraventricular or extradural hemorrhage was rarely found. The prognosis is determined by the severity of neurotic symptoms due to cerebral hypoxia. Subdural hemorrhage of the posterior cranial fossa resulted in cerebral palsy in one fifth of the cases, and in slight enlargement of the ventricle in three fifths. Subdural hematoma left porencephaly in one fourth of the patients, but the remaining recovered to normal.

  5. BK virus-associated hemorrhagic cystitis after pediatric stem cell transplantation.

    Science.gov (United States)

    Han, Seung Beom; Cho, Bin; Kang, Jin Han

    2014-12-01

    Hemorrhagic cystitis is a common stem cell transplantation-related complication. The incidence of early-onset hemorrhagic cystitis, which is related to the pretransplant conditioning regimen, has decreased with the concomitant use of mesna and hyperhydration. However, late-onset hemorrhagic cystitis, which is usually caused by the BK virus, continues to develop. Although the BK virus is the most common pathogenic microorganism of poststem cell transplantation late-onset hemorrhagic cystitis, pediatricians outside the hemato-oncology and nephrology specialties tend to be unfamiliar with hemorrhagic cystitis and the BK virus. Moreover, no standard guidelines for the early diagnosis and treatment of BK virus-associated hemorrhagic cystitis after stem cell transplantation have been established. Here, we briefly introduce poststem cell transplantation BK virus-associated hemorrhagic cystitis.

  6. Defense Small Business Innovation Research Program (SBIR). Volume 1. Army Abstracts of Phase 1 Awards 1991

    Science.gov (United States)

    1991-01-01

    TECHNIQUES, THE IDENTIFICATION AND SELECTION OF CONDUCTIVE POLYMERS, CONDUCTIVE FILLERS, AND NONWOVEN AND FIBER MATERIALS WHICH CAN BE MADE COMPATIBLE WITH...COMPACT PORTABLE SYSTEM FOR RAPID INFUSION AND WARMING OF CRYSTALLOID FLUID OR BLOOD SUBSTITUTE FOR VOLUME REPLACEMENT IN HEMORRHAGIC SHOCK. THE SYSTEM...SOPHISTICATED FLOW AND TEMPERATURE CONTROL, USER INTERFACE, FILTRATION , AIR DETECTION, AND INTEGRAL POWER SOURCE. IN ADDITION TO ITS MILITARY

  7. Polyphenols of Camellia sinenesis decrease mortality, hepatic injury and generation of cytokines and reactive oxygen and nitrogen species after hemorrhage/resuscitation in rats

    Directory of Open Access Journals (Sweden)

    Lehnert Mark

    2010-08-01

    Full Text Available Abstract Background Reactive oxygen species (ROS and reactive nitrogen species (RNS are produced during hemorrhagic shock and resuscitation (H/R, which may contribute to multiple organ failure. The Aim of this study was to test the hypothesis that green tea (Camellia sinenesis extract containing 85% polyphenols decreases injury after H/R in rats by scavenging ROS and RNS. Methods Female Sprague Dawley rats were given 100 mg polyphenol extract/kg body weight or vehicle 2 h prior to hemorrhagic shock. H/R was induced by two protocols: 1 withdrawal of blood to a mean arterial pressure of 40 mm Hg followed by further withdrawals to decrease blood pressure progressively to 28 mm Hg over 1 h (severe, and 2 withdrawal of blood to a sustained hypotension of 40 mm Hg for 1 h (moderate. Rats were then resuscitated over 1 h with 60% of the shed blood volume plus twice the shed blood volume of lactated Ringer's solution. Serum samples were collected at 10 min and 2 h after resuscitation. At 2 or 18 h, livers were harvested for cytokine and 3-nitrotyrosine quantification, immunohistochemical detection of 4-hydroxynonenol (4-HNE and inducible nitric oxide synthase (iNOS protein expression. Results After severe H/R, 18-h survival increased from 20% after vehicle to 70% after polyphenols (p Conclusion Polyphenols decrease ROS/RNS formation and are beneficial after hemorrhagic shock and resuscitation.

  8. Acute, transient hemorrhagic hypotension does not aggravate structural damage or neurologic motor deficits but delays the long-term cognitive recovery following mild to moderate traumatic brain injury

    Science.gov (United States)

    Schütz, Christian; Stover, John F.; Thompson, Hilaire J.; Hoover, Rachel C.; Morales, Diego M.; Schouten, Joost W.; McMillan, Asenia; Soltesz, Kristie; Motta, Melissa; Spangler, Zachery; Neugebauer, Edmund; McIntosh, Tracy K.

    2008-01-01

    Objectives Posttraumatic hypotension is believed to increase morbidity and mortality in traumatically brain-injured patients. Using a clinically relevant model of combined traumatic brain injury with superimposed hemorrhagic hypotension in rats, the present study evaluated whether a reduction in mean arterial blood pressure aggravates regional brain edema formation, regional cell death, and neurologic motor/cognitive deficits associated with traumatic brain injury. Design Experimental prospective, randomized study in rodents. Setting Experimental laboratory at a university hospital. Subjects One hundred nineteen male Sprague-Dawley rats weighing 350-385 g. Interventions Experimental traumatic brain injury of mild to moderate severity was induced using the lateral fluid percussion brain injury model in anesthetized rats (n = 89). Following traumatic brain injury, in surviving animals one group of animals was subjected to pressure-controlled hemorrhagic hypotension, maintaining the mean arterial blood pressure at 50-60 mm Hg for 30 mins (n = 47). The animals were subsequently either resuscitated with lactated Ringer’s solution (three times shed blood volume, n = 18) or left uncompensated (n = 29). Other groups of animals included those with isolated traumatic brain injury (n = 34), those with isolated hemorrhagic hypotension (n = 8), and sham-injured control animals receiving anesthesia and surgery alone (n = 22). Measurements and Main Results The withdrawal of 6-7 mL of arterial blood significantly reduced mean arterial blood pressure by 50% without decreasing arterial oxygen saturation or Pao2. Brain injury induced significant cerebral edema (p hypotension. Brain injury-induced neurologic deficits persisted up to 20 wks after injury and were also not aggravated by the hemorrhagic hypotension. Cognitive dysfunction persisted for up to 16 wks postinjury. The superimposition of hemorrhagic hypotension significantly delayed the time course of cognitive recovery

  9. Development and Validation of an Automatic Segmentation Algorithm for Quantification of Intracerebral Hemorrhage.

    Science.gov (United States)

    Scherer, Moritz; Cordes, Jonas; Younsi, Alexander; Sahin, Yasemin-Aylin; Götz, Michael; Möhlenbruch, Markus; Stock, Christian; Bösel, Julian; Unterberg, Andreas; Maier-Hein, Klaus; Orakcioglu, Berk

    2016-11-01

    ABC/2 is still widely accepted for volume estimations in spontaneous intracerebral hemorrhage (ICH) despite known limitations, which potentially accounts for controversial outcome-study results. The aim of this study was to establish and validate an automatic segmentation algorithm, allowing for quick and accurate quantification of ICH. A segmentation algorithm implementing first- and second-order statistics, texture, and threshold features was trained on manual segmentations with a random-forest methodology. Quantitative data of the algorithm, manual segmentations, and ABC/2 were evaluated for agreement in a study sample (n=28) and validated in an independent sample not used for algorithm training (n=30). ABC/2 volumes were significantly larger compared with either manual or algorithm values, whereas no significant differences were found between the latter (P<0.0001; Friedman+Dunn's multiple comparison). Algorithm agreement with the manual reference was strong (concordance correlation coefficient 0.95 [lower 95% confidence interval 0.91]) and superior to ABC/2 (concordance correlation coefficient 0.77 [95% confidence interval 0.64]). Validation confirmed agreement in an independent sample (algorithm concordance correlation coefficient 0.99 [95% confidence interval 0.98], ABC/2 concordance correlation coefficient 0.82 [95% confidence interval 0.72]). The algorithm was closer to respective manual segmentations than ABC/2 in 52/58 cases (89.7%). An automatic segmentation algorithm for volumetric analysis of spontaneous ICH was developed and validated in this study. Algorithm measurements showed strong agreement with manual segmentations, whereas ABC/2 exhibited its limitations, yielding inaccurate overestimations of ICH volume. The refined, yet time-efficient, quantification of ICH by the algorithm may facilitate evaluation of clot volume as an outcome predictor and trigger for surgical interventions in the clinical setting. © 2016 American Heart Association, Inc.

  10. Systemic administration of urocortin after intracerebral hemorrhage reduces neurological deficits and neuroinflammation in rats

    Directory of Open Access Journals (Sweden)

    Liew Hock-Kean

    2012-01-01

    Full Text Available Abstract Background Intracerebral hemorrhage (ICH remains a serious clinical problem lacking effective treatment. Urocortin (UCN, a novel anti-inflammatory neuropeptide, protects injured cardiomyocytes and dopaminergic neurons. Our preliminary studies indicate UCN alleviates ICH-induced brain injury when administered intracerebroventricularly (ICV. The present study examines the therapeutic effect of UCN on ICH-induced neurological deficits and neuroinflammation when administered by the more convenient intraperitoneal (i.p. route. Methods ICH was induced in male Sprague-Dawley rats by intrastriatal infusion of bacterial collagenase VII-S or autologous blood. UCN (2.5 or 25 μg/kg was administered i.p. at 60 minutes post-ICH. Penetration of i.p. administered fluorescently labeled UCN into the striatum was examined by fluorescence microscopy. Neurological deficits were evaluated by modified neurological severity score (mNSS. Brain edema was assessed using the dry/wet method. Blood-brain barrier (BBB disruption was assessed using the Evans blue assay. Hemorrhagic volume and lesion volume were assessed by Drabkin's method and morphometric assay, respectively. Pro-inflammatory cytokine (TNF-α, IL-1β, and IL-6 expression was evaluated by enzyme-linked immunosorbent assay (ELISA. Microglial activation and neuronal loss were evaluated by immunohistochemistry. Results Administration of UCN reduced neurological deficits from 1 to 7 days post-ICH. Surprisingly, although a higher dose (25 μg/kg, i.p. also reduced the functional deficits associated with ICH, it is significantly less effective than the lower dose (2.5 μg/kg, i.p.. Beneficial results with the low dose of UCN included a reduction in neurological deficits from 1 to 7 days post-ICH, as well as a reduction in brain edema, BBB disruption, lesion volume, microglial activation and neuronal loss 3 days post-ICH, and suppression of TNF-α, IL-1β, and IL-6 production 1, 3 and 7 days post

  11. Satellite Detection of Ebola River Hemorrhagic Fever Epidemics Trigger Events

    Science.gov (United States)

    Tucker, Compton J.; Pinzon, Jorge E.

    2006-01-01

    Ebola hemorrhagic fever, named after the Ebola River in Central Africa, first appeared in June 1976, during an outbreak in Nzara and Maridi, Sudan. In September 1976, a separate outbreak was recognized in Yambuku, Democratic Republic of the Congo (DRC). One fatal case was identified in Tandala, DRC, in June 1977, followed by another outbreak in Nzara, Sudan, in July 1979. Ebola hemorrhagic fever outbreaks results in a very high mortality of patients who contract the disease: from 50 to 80% of infected people perish from this highly virulent disease. Death is gruesome, with those afflicted bleeding to death from massive hemorrhaging of organs and capillaries. The disease was not identified again until the end of 1994, when three outbreaks occurred almost simultaneously in Africa. In October, an outbreak was identified in a chimpanzee community studied by primatologists in Tal, Cote d'lvoire, with one human infection. The following month, multiple cases were reported in northeast Gabon in the gold panning camps of Mekouka, Andock, and Minkebe. Later that same month, the putative index case of the 1995 Kikwit, DRC, outbreak was exposed through an unknown mechanism while working in a charcoal pit. In Gabon, two additional outbreaks were reported in February and JuIy,1996, respectively, in Mayibout II, a village 40 km south of the original outbreak in the gold panning camps, and a logging camp between Ovan and Koumameyong, near Booue. The largest Ebola hemorrhagic fever epidemic occurred in Gulu District, Uganda from August 2000 to January 2001. In December 2001, Ebola reappeared in the Ogooue-lvindo Province, Gabon with extension into Mbomo District, The Republic of the Congo lasting until July 2002. Since 2002 there have been several outbreaks of Ebola hemorrhagic fever in Gabon and adjacent areas of Congo. Of interest is the seasonal context and occasional temporal clustering of Ebola hemorrhagic fever outbreaks. Near simultaneous appearances of Ebola epidemics in

  12. Adult hemorrhagic moyamoya disease: The paradoxical role of combined revascularization

    Directory of Open Access Journals (Sweden)

    Vikas C Jha

    2012-01-01

    Full Text Available Background: Moyamoya disease (MMD in adults often manifests with hemorrhage. Combined revascularization in hemorrhagic MMD is controversial as improvement in hemodynamics may be offset by hypervascularity-induced rebleeding. Aim: Long-term outcome assessment of adult patients from non-endemic region with hemorrhagic MMD undergoing combined revascularization. Setting: Tertiary care, academic setting. Materials and Methods: Both Suzuki′s internal carotid artery (ICA grade (1-6 and Mugikura′s posterior cerebral artery (PCA grade (1-4 were applied to 11 patients with hemorrhagic MMD (mean symptom duration 6.11±6.46 months undergoing direct [superficial temporal artery-middle cerebral artery (STA-MCA bypass] and indirect encephalomyosynangiosis (EMSA revascularization. They were clinically graded at follow-up (F/U as: excellent, preoperative symptoms resolved; good, preoperative symptoms resolved, neurological deficits remained; fair, symptom frequency decreased; and poor, symptoms unchanged/worsened. Digital subtraction angiogram/magnetic resonance angiography (DSA/MRA assessed the patency of anastomosis and cerebral hemodynamics as: 0 = non-patent; 1 = patent bypass, STA perfused recipient artery, moyamoya vessels unchanged; and, 2 = patent bypass, STA widely perfused MCA territory, moyamoya vessels diminished. An acetazolamide stimulated single photon emission computed tomography (SPECT study evaluated regional cerebral vascular reserve (RCVR. Results: Angiographic ICA grades were 5 (n=2, 4 (n=2, 3 (n=4, and 2 (n=3, and PCA grades were 1 (n=8 and 3 (n=3. At F/U (mean: 36.55±21.6 months, clinical recovery was excellent in eight and fair in one. Two patients developed delayed re-hemorrhage (in one at a site remote from previous bleed. F/U DSA/MRA (n=6 showed a good caliber, patent anastomosis with collaterals in five patients, and a narrow caliber anastomotic vessel in one patient. SPECT (n=6 revealed improved perfusion in two and normal

  13. Black Hole Sign Predicts Poor Outcome in Patients with Intracerebral Hemorrhage.

    Science.gov (United States)

    Li, Qi; Yang, Wen-Song; Chen, Sheng-Li; Lv, Fu-Rong; Lv, Fa-Jin; Hu, Xi; Zhu, Dan; Cao, Du; Wang, Xing-Chen; Li, Rui; Yuan, Liang; Qin, Xin-Yue; Xie, Peng

    2018-01-10

    In spontaneous intracerebral hemorrhage (ICH), black hole sign has been proposed as a promising imaging marker that predicts hematoma expansion in patients with ICH. The aim of our study was to investigate whether admission CT black hole sign predicts hematoma growth in patients with ICH. From July 2011 till February 2016, patients with spontaneous ICH who underwent baseline CT scan within 6 h of symptoms onset and follow-up CT scan were recruited into the study. The presence of black hole sign on admission non-enhanced CT was independently assessed by 2 readers. The functional outcome was assessed using the modified Rankin Scale (mRS) at 90 days. Univariate and multivariable logistic regression analyses were performed to assess the association between the presence of the black hole sign and functional outcome. A total of 225 patients (67.6% male, mean age 60.3 years) were included in our study. Black hole sign was identified in 32 of 225 (14.2%) patients on admission CT scan. The multivariate logistic regression analysis demonstrated that age, intraventricular hemorrhage, baseline ICH volume, admission Glasgow Coma Scale score, and presence of black hole sign on baseline CT independently predict poor functional outcome at 90 days. There are significantly more patients with a poor functional outcome (defined as mRS ≥4) among patients with black hole sign than those without (84.4 vs. 32.1%, p black hole sign independently predicts poor outcome in patients with ICH. Early identification of black hole sign is useful in prognostic stratification and may serve as a potential therapeutic target for anti-expansion clinical trials. © 2018 S. Karger AG, Basel.

  14. A Comparison of Acute Hemorrhagic Stroke Outcomes in two Populations: The Crete-Boston Study

    Science.gov (United States)

    Zaganas, Ioannis; Halpin, Amy P; Oleinik, Alexandra; Alegakis, Athanasios; Kotzamani, Dimitra; Zafiris, Spiros; Chlapoutaki, Chryssanthi; Tsimoulis, Dimitris; Giannakoudakis, Emmanouil; Chochlidakis, Nikolaos; Ntailiani, Aikaterini; Valatsou, Christina; Papadaki, Efrosini; Vakis, Antonios; Furie, Karen L; Greenberg, Steven M; Plaitakis, Andreas

    2011-01-01

    Background While corticosteroid use in Acute Hemorrhagic Stroke (AHS) is not widely adopted, management with intravenous dexamethasone (IVDxM) has been standard of care at the University Hospital of Heraklion, Crete (UH-Crete) with observed outcomes superior to those reported in literature. To explore this further, we conducted a retrospective, multivariable-adjusted two-center study. Methods We studied 391 AHS cases admitted to UH-Crete between 1/1997 and 7/2010 and compared them with 510 AHS cases admitted to Massachusetts General Hospital, Boston from 1/2003 to 9/2009. Of the Cretan cases, 340 received a tapering scheme of IVDxM, starting with 16–32 mg/day, while the Boston patients were managed without steroids. Results The two cohorts had comparable demographics and stroke severity on admission, although anticoagulation was more frequent in Boston. The in-hospital mortality was significantly lower on Crete (23.8%, n=340) than in Boston (38.0 %, n=510; p<0.001) as was the 30-day mortality (Crete: 25.4%, n=307; Boston: 39.4%, n=510; p<0.001). Exclusion of patients on anticoagulants showed even greater differences (30-day mortality: Crete 20.8%; n=259; Boston 37.0%; n=359; p<0.001). The improved survival on Crete was observed three days after initiation of IVDxM and was pronounced for deep-seated hemorrhages. After adjusting for AHS volume/location, GCS, hypertension, diabetes mellitus, smoking, coronary artery disease and statin, antiplatelet and anticoagulant use, IVDxM treatment was associated with better functional outcomes and significantly lower risk of death at 30-days (odds ratio 0.357; 95% C.I. 0.174–0.732). Conclusions This study suggests that IVDxM improves outcome in AHS and supports a randomized clinical trial using this approach. PMID:22020030

  15. Observation on the effect of carbetocin in preventing postpartum hemorrhage caused by uterine inertia

    Directory of Open Access Journals (Sweden)

    Hong-Li Zhang

    2017-01-01

    Full Text Available Objective: To explore the effect of carbetocin in preventing postpartum hemorrhage caused by uterine inertia. Methods: A total of 256 puerpera with single full-term delivery who were admitted in our hospital from May, 2015 to May, 2016 were included in the study and divided into the vaginal delivery group and cesarean section group with 128 cases in each group according to the delivery ways. According to the medication, each group was divided into the carbetocin group and oxytocin group with 64 cases in each group. After fetus delivery, the puerpera in the carbetocin group were given intravenous injection of carbetocin (100 μg, while the puerpera in the oxytocin group were given intravenous injection of oxytocin (10 U+0.9% NaCl (500 mL for 2 h. The amount of bleeding at delivery, 2 h and 24 h after delivery in each group was observed. A volume of 5 mL elbow venous blood before delivery and 24 h after delivery was extracted. The automatic blood cell analyzer was used to detect the decreased value of 24 h hemoglobin in each group. The coagulation detector was used to detect PT, APTT, and FIB before delivery and 24 h after delivery. The blood pressure and heart rate before and after medication in each group were observed. Results: The amount of bleeding at delivery, 2 h and 24 h after delivery in the carbetocin group was significantly less than that in the oxytocin group (P0.05. The heart rate and blood pressure after medication in each group were not significantly changed when compared with before medication (P>0.05. Conclusions: Carbetocin can effectively prevent the postpartum hemorrhage caused by uterine inertia, and is safe and effective in application of vaginal delivery and cesarean section; therefore, it deserves to be widely recommended in the clinic.

  16. 3D MR ventricle segmentation in pre-term infants with post-hemorrhagic ventricle dilation

    Science.gov (United States)

    Qiu, Wu; Yuan, Jing; Kishimoto, Jessica; Chen, Yimin; de Ribaupierre, Sandrine; Chiu, Bernard; Fenster, Aaron

    2015-03-01

    Intraventricular hemorrhage (IVH) or bleed within the brain is a common condition among pre-term infants that occurs in very low birth weight preterm neonates. The prognosis is further worsened by the development of progressive ventricular dilatation, i.e., post-hemorrhagic ventricle dilation (PHVD), which occurs in 10-30% of IVH patients. In practice, predicting PHVD accurately and determining if that specific patient with ventricular dilatation requires the ability to measure accurately ventricular volume. While monitoring of PHVD in infants is typically done by repeated US and not MRI, once the patient has been treated, the follow-up over the lifetime of the patient is done by MRI. While manual segmentation is still seen as a gold standard, it is extremely time consuming, and therefore not feasible in a clinical context, and it also has a large inter- and intra-observer variability. This paper proposes a segmentation algorithm to extract the cerebral ventricles from 3D T1- weighted MR images of pre-term infants with PHVD. The proposed segmentation algorithm makes use of the convex optimization technique combined with the learned priors of image intensities and label probabilistic map, which is built from a multi-atlas registration scheme. The leave-one-out cross validation using 7 PHVD patient T1 weighted MR images showed that the proposed method yielded a mean DSC of 89.7% +/- 4.2%, a MAD of 2.6 +/- 1.1 mm, a MAXD of 17.8 +/- 6.2 mm, and a VD of 11.6% +/- 5.9%, suggesting a good agreement with manual segmentations.

  17. Minocycline Decreases Liver Injury after Hemorrhagic Shock and Resuscitation in Mice

    Directory of Open Access Journals (Sweden)

    Christoph Czerny

    2012-01-01

    Full Text Available Patients that survive hemorrhage and resuscitation (H/R may develop a systemic inflammatory response syndrome (SIRS that leads to dysfunction of vital organs (multiple organ dysfunction syndrome, MODS. SIRS and MODS may involve mitochondrial dysfunction. Under pentobarbital anesthesia, C57BL6 mice were hemorrhaged to 30 mm Hg for 3 h and then resuscitated with shed blood plus half the volume of lactated Ringer’s solution containing minocycline, tetracycline (both 10 mg/kg body weight or vehicle. Serum alanine aminotransferase (ALT, necrosis, apoptosis and oxidative stress were assessed 6 h after resuscitation. Mitochondrial polarization was assessed by intravital microscopy. After H/R with vehicle or tetracycline, ALT increased to 4538 U/L and 3999 U/L, respectively, which minocycline decreased to 1763 U/L (P<0.01. Necrosis and TUNEL also decreased from 24.5% and 17.7 cells/field, respectively, after vehicle to 8.3% and 8.7 cells/field after minocycline. Tetracycline failed to decrease necrosis (23.3% but decreased apoptosis to 9 cells/field (P<0.05. Minocycline and tetracycline also decreased caspase-3 activity in liver homogenates. Minocycline but not tetracycline decreased lipid peroxidation after resuscitation by 70% (P<0.05. Intravital microscopy showed that minocycline preserved mitochondrial polarization after H/R (P<0.05. In conclusion, minocycline decreases liver injury and oxidative stress after H/R by preventing mitochondrial dysfunction.

  18. A hemorrhagic transformation model of mechanical stroke therapy with acute hyperglycemia in mice.

    Science.gov (United States)

    Couret, David; Bourane, Steeve; Catan, Aurélie; Nativel, Brice; Planesse, Cynthia; Dorsemans, Anne-Claire; Ait-Arsa, Imade; Cournot, Maxime; Rondeau, Philippe; Patche, Jessica; Tran-Dinh, Alexy; Lambert, Gilles; Diotel, Nicolas; Meilhac, Olivier

    2017-12-26

    Clinical benefit for mechanical thrombectomy (MT) in stroke was recently demonstrated in multiple large prospective studies. Acute hyperglycemia (HG) is an important risk factor of poor outcome in stroke patients, including those that underwent MT. The aim of this therapy is to achieve a complete reperfusion in a short time, given that reperfusion damage is dependent on the duration of ischemia. Here, we investigated the effects of acute HG in a mouse model of ischemic stroke induced by middle cerebral artery occlusion (MCAO). Hyperglycemic (intraperitoneal [ip] injection of glucose) and control (ip saline injection) 10-week male C57BL6 mice were subjected to MCAO (30, 90, and 180 min) followed by reperfusion obtained by withdrawal of the monofilament. Infarct volume, hemorrhagic transformation (HT), neutrophil infiltration, and neurological scores were assessed at 24 hr by performing vital staining, ELISA immunofluorescence, and behavioral test, respectively. Glucose injection led to transient HG (blood glucose = 250-390 mg/dL) that significantly increased infarct volume, HT, and worsened neurological outcome. In addition, we report that HG promoted blood-brain barrier disruption as shown by hemoglobin accumulation in the brain parenchyma and tended to increase neutrophil extravasation within the infarcted area. Acute HG increased neurovascular damage for all MCAO durations tested. HTs were observed as early as 90 min after ischemia under hyperglycemic conditions. This model mimics MT ischemia/reperfusion and allows the exploration of brain injury in hyperglycemic conditions. © 2017 Wiley Periodicals, Inc.

  19. Lack of evidence for an association between hemodynamic variables and hematoma growth in spontaneous intracerebral hemorrhage.

    Science.gov (United States)

    Jauch, Edward C; Lindsell, Christopher J; Adeoye, Opeolu; Khoury, Jane; Barsan, William; Broderick, Joseph; Pancioli, Arthur; Brott, Thomas

    2006-08-01

    Early hematoma expansion in spontaneous intracerebral hemorrhage (ICH) is associated with worse clinical outcome. We hypothesized that hemodynamic parameters are associated with the increase in hematoma volume owing to their relationship to blood vessel wall stresses. We performed a post hoc analysis of clinical and computed tomography (CT) data from patients enrolled in a prospective observational study of ICH patients presenting within 3 hours from symptom onset. Hematoma volumes were measured at hospital arrival and at 1 and 20 hours from presentation. Blood pressure and heart rate, recorded at 19 time points between presentation and 20 hours, were used to derive hemodynamic variables. Multivariable logistic-regression models were constructed to assess the relation between hemodynamic parameters and hematoma growth, adjusted for clinical covariates. From the original study, 98 patients underwent baseline and 1-hour CT scans; of these, 65 had 20-hour CT scans. Substantial hematoma growth was observed in 28% within the first hour. Of the 65 patients not undergoing surgery within 20 hours, 37% experienced hematoma growth by 20 hours. Neither baseline or peak hemodynamic parameters nor changes in hemodynamic parameters were significantly associated with hematoma growth at either 1 or 20 hours. We found no blood pressure or heart rate parameters, individually or in combination, that were associated with hematoma growth. Our data suggest the influence of hemodynamic parameters on vessel wall stress to be an unlikely target for intervention in reducing the risk of early hematoma growth in ICH.

  20. Poststroke epilepsy in long-term survivors of primary intracerebral hemorrhage.

    Science.gov (United States)

    Lahti, Anna-Maija; Saloheimo, Pertti; Huhtakangas, Juha; Salminen, Henrik; Juvela, Seppo; Bode, Michaela K; Hillbom, Matti; Tetri, Sami

    2017-06-06

    To identify the incidence and predisposing factors for development of poststroke epilepsy (PSE) after primary intracerebral hemorrhage (PICH) during a long-term follow-up. We performed a retrospective study of patients who had had their first-ever PICH between January 1993 and January 2008 in Northern Ostrobothnia, Finland, and who survived for at least 3 months. These patients were followed up for PSE. The associations between PSE occurrence and sex, age, Glasgow Coma Scale (GCS) score on admission, hematoma location and volume, early seizures, and other possible risk factors for PSE were assessed using the Cox proportional hazards regression model. Of the 615 PICH patients who survived for longer than 3 months, 83 (13.5%) developed PSE. The risk of new-onset PSE was highest during the first year after PICH with cumulative incidence of 6.8%. In univariable analysis, the risk factors for PSE were early seizures, subcortical hematoma location, larger hematoma volume, hematoma evacuation, and a lower GCS score on admission, whereas patients with infratentorial hematoma location or hypertension were less likely to develop PSE (all variables p seizures (HR 3.63, 95% CI 1.99-6.64, p hypertension had a lower risk of PSE (HR 0.54, 0.35-0.84, p seizures increased the risk of PSE after PICH in long-term survivors, while hypertension seemed to reduce the risk. © 2017 American Academy of Neurology.