Robinson, Serina L; Badalamenti, Jonathan P; Dodge, Anthony G; Tassoulas, Lambros J; Wackett, Lawrence P
2018-03-12
Biuret is a minor component of urea fertilizer and an intermediate in s-triazine herbicide biodegradation. The microbial metabolism of biuret has never been comprehensively studied. Here, we enriched and isolated bacteria from a potato field that grew on biuret as a sole nitrogen source. We sequenced the genome of the fastest-growing isolate, Herbaspirillum sp. BH-1 and identified genes encoding putative biuret hydrolases (BHs). We purified and characterized a functional BH enzyme from Herbaspirillum sp. BH-1 and two other bacteria from divergent phyla. The BH enzymes reacted exclusively with biuret in the range of 2-11 µmol min -1 mg -1 protein. We then constructed a global protein superfamily network to map structure-function relationships in the BH subfamily and used this to mine > 7000 genomes. High-confidence BH sequences were detected in Actinobacteria, Alpha- and Beta-proteobacteria, and some fungi, archaea and green algae, but not animals or land plants. Unexpectedly, no cyanuric acid hydrolase homologs were detected in > 90% of genomes with BH homologs, suggesting BHs may have arisen independently of s-triazine ring metabolism. This work links genotype to phenotype by enabling accurate genome-mining to predict microbial utilization of biuret. Importantly, it advances understanding of the microbial capacity for biuret biodegradation in agricultural systems. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.
Biuret, a NPN source for ruminants -- a review
Energy Technology Data Exchange (ETDEWEB)
Singhal, K K; Mudgal, V D [National Dairy Research Inst., Karnal (India)
1980-06-01
Biuret is a non toxic and palatable source of non protein nitrogen which is hydrolyzed slowly and has a slower solubility as compared to urea. It is hydrolyzed in rumen with the help of biuretase which is an induced enzyme, therefore animals require some time of adaptation before its proper utilization. Biuret is degraded into ammonia and urea which later on gets hydrolysed further into ammonia with the help of urease. The activity of urease might have been supressed in the rumen when the animals were fed on biuret supplemented diet. Biuret degradation into ammonia increases as the adaptation reaches. Biuret hydrolyzed slowly upto 24 hr of its feeding in adapted animals. For the best utilization of this NPN compound, the diet should contain low levels of natural protein and sufficient quantity of readily available source of energy and provide adequate essential minerals. Biuret can be successfully used for the maintenance and production ratio of the ruminants.
Biuret, a NPN source for ruminants -- a review
International Nuclear Information System (INIS)
Singhal, K.K.; Mudgal, V.D.
1980-01-01
Biuret is a non toxic and palatable source of non protein nitrogen which is hydrolyzed slowly and has a slower solubility as compared to urea. It is hydrolyzed in rumen with the help of biuretase which is an induced enzyme, therefore animals require some time of adaptation before its proper utilization. Biuret is degraded into ammonia and urea which later on gets hydrolysed further into ammonia with the help of urease. The activity of urease might have been supressed in the rumen when the animals were fed on biuret supplemented diet. Biuret degradation into ammonia increases as the adaptation reaches. Biuret hydrolyzed slowly upto 24 hr of its feeding in adapted animals. For the best utilization of this NPN compound, the diet should contain low levels of natural protein and sufficient quantity of readily available source of energy and provide adequate essential minerals. Biuret can be successfully used for the maintenance and production ratio of the ruminants. (author)
Katsoulos, Panagiotis D; Athanasiou, Labrini V; Karatzia, Maria A; Giadinis, Nektarios; Karatzias, Harilaos; Boscos, Constantin; Polizopoulou, Zoe S
2017-12-01
Determination of serum total protein concentration is commonly performed by the biuret method. Refractometric measurement is a faster and less expensive alternative but its accuracy has not been determined in ruminants. The purpose of the study was to compare the serum total protein concentrations in cattle, sheep, and goats measured by the biuret method with those obtained by refractometry. Serum total protein concentration was determined in 120 cattle, 67 sheep, and 58 goat blood samples refractometrically and with the biuret method. The data were analyzed with a paired samples t-test, and Passing and Bablok regression equations and Bland and Altman plots were generated. There was a strong linear relationship between the total protein values determined with the refractometer and the biuret method in cattle, sheep, and goats. The statistical accuracy, which represents a bias correction factor that measures the deviation of the best-fit line from the 45° line through the origin, was 90.63% for cattle, 93.05% for sheep, and 91.76% for goats. The mean protein values determined with the refractometer were significantly lower than those measured with the biuret method in cattle and goats (P .05). The evaluated refractometer was sufficiently accurate for the determination of serum total proteins in cattle, sheep, and goats, although it cannot be used interchangeably with the biuret method. The RIs should be corrected for negative bias based on the created equations. © 2017 American Society for Veterinary Clinical Pathology.
U.S. Department of Health & Human Services — Health Data Interactive (HDI) presents a broad range of important public health indicators through an interactive web-based application that provides access to...
Quantitative plasma biomarker analysis in HDI exposure assessment.
Flack, Sheila L; Fent, Kenneth W; Trelles Gaines, Linda G; Thomasen, Jennifer M; Whittaker, Steve; Ball, Louise M; Nylander-French, Leena A
2010-01-01
Quantification of amines in biological samples is important for evaluating occupational exposure to diisocyanates. In this study, we describe the quantification of 1,6-hexamethylene diamine (HDA) levels in hydrolyzed plasma of 46 spray painters applying 1,6-hexamethylene diisocyanate (HDI)-containing paint in vehicle repair shops collected during repeated visits to their workplace and their relationship with dermal and inhalation exposure to HDI monomer. HDA was detected in 76% of plasma samples, as heptafluorobutyryl derivatives, and the range of HDA concentrations was HDA levels and HDI inhalation exposure measured on the same workday was low (N = 108, r = 0.22, P = 0.026) compared with the correlation between plasma HDA levels and inhalation exposure occurring approximately 20 to 60 days before blood collection (N = 29, r = 0.57, P = 0.0014). The correlation between plasma HDA levels and HDI dermal exposure measured on the same workday, although statistically significant, was low (N = 108, r = 0.22, P = 0.040) while the correlation between HDA and dermal exposure occurring approximately 20 to 60 days before blood collection was slightly improved (N = 29, r = 0.36, P = 0.053). We evaluated various workplace factors and controls (i.e. location, personal protective equipment use and paint booth type) as modifiers of plasma HDA levels. Workers using a downdraft-ventilated booth had significantly lower plasma HDA levels relative to semi-downdraft and crossdraft booth types (P = 0.0108); this trend was comparable to HDI inhalation and dermal exposure levels stratified by booth type. These findings indicate that HDA concentration in hydrolyzed plasma may be used as a biomarker of cumulative inhalation and dermal exposure to HDI and for investigating the effectiveness of exposure controls in the workplace.
Rose, Alexandra; Funk, Deborah; Neiger, Reto
2016-04-01
To compare total protein (TP) concentrations in canine pleural and abdominal fluid specimens as measured by refractometry and biuret assay. Diagnostic test evaluation. Data regarding 92 pleural and 148 abdominal fluid specimens from dogs with various diseases. TP concentrations in fluid specimens as measured by refractometry and biuret assay were recorded. Strength of association between sets of measurements was assessed by Spearman rank correlations and Bland-Altman plots. Optimal concentration cutoff for diagnostic discrimination between exudate and nonexudate was identified by construction of receiver operating characteristic curves. Median TP concentration in pleural fluid specimens was 2.7 g/dL (range, 0.3 to 4.8 g/dL) for refractometry and 2.9 g/dL (range, 0.7 to 5.8 g/dL) for biuret assay. Median TP concentration in abdominal fluid specimens was 3.5 g/dL (range, 0.1 to 6.0 g/dL) for refractometry and 3.5 g/dL (range, 0.6 to 5.7 g/dL) for biuret assay. Correlation was significant between refractometric and biuret results for pleural (ρ = 0.921) and abdominal (ρ = 0.908) fluid. Bland-Altman plots revealed bias of -0.18 g/dL for pleural fluid and -0.03 g/dL for abdominal fluid for refractometry versus biuret assay. With a TP concentration of ≥ 3 g/dL used to distinguish exudate from nonexudate, sensitivity of refractometry was 77% for pleural fluid and 80% for abdominal fluid. Specificity was 100% and 94%, respectively. Refractometry yielded acceptable results for measurement of TP concentration in canine pleural and abdominal fluid specimens, providing a more rapid and convenient method than biuret assay.
Occupational exposure to HDI: progress and challenges in biomarker analysis.
Flack, Sheila L; Ball, Louise M; Nylander-French, Leena A
2010-10-01
1,6-Hexamethylene diisocyanate (HDI) is extensively used in the automotive repair industry and is a commonly reported cause of occupational asthma in industrialized populations. However, the exact pathological mechanism remains uncertain. Characterization and quantification of biomarkers resulting from HDI exposure can fill important knowledge gaps between exposure, susceptibility, and the rise of immunological reactions and sensitization leading to asthma. Here, we discuss existing challenges in HDI biomarker analysis including the quantification of N-acetyl-1,6-hexamethylene diamine (monoacetyl-HDA) and N,N'-diacetyl-1,6-hexamethylene diamine (diacetyl-HDA) in urine samples based on previously established methods for HDA analysis. In addition, we describe the optimization of reaction conditions for the synthesis of monoacetyl-HDA and diacetyl-HDA, and utilize these standards for the quantification of these metabolites in the urine of three occupationally exposed workers. Diacetyl-HDA was present in untreated urine at 0.015-0.060 μg/l. Using base hydrolysis, the concentration range of monoacetyl-HDA in urine was 0.19-2.2 μg/l, 60-fold higher than in the untreated samples on average. HDA was detected only in one sample after base hydrolysis (0.026 μg/l). In contrast, acid hydrolysis yielded HDA concentrations ranging from 0.36 to 10.1 μg/l in these three samples. These findings demonstrate HDI metabolism via N-acetylation metabolic pathway and protein adduct formation resulting from occupational exposure to HDI. Copyright © 2010 Elsevier B.V. All rights reserved.
The effect of employment, economic growth, and investment on HDI: In provinces in Indonesia
Directory of Open Access Journals (Sweden)
Nur Feriyanto
2016-07-01
Full Text Available This study aims to analyze the effect of Number of Working People (Employment, Economic Growth Rate (EGR, and Investment on Human Development Index (HDI in Indonesia, partially and simultaneously. This study used investments consisting of Domestic Investment (DI and Foreign Direct Investment (FDI. It used the method of analysis of panel data regression analysis with the data from thirty-three provinces in Indonesia from 2006 to 2013. The results indicate that the employment variables have positive and significant impact to HDI in Indonesia. It shows that EGR does not affect HDI in Indonesia. However, Domestic and foreign direct investments partially have positive and significant effect on HDI in Indonesia. Simultaneously, the variables employment, EGR, domestic and foreign direct investments have a significant effect on the HDI in Indonesia.
Occupational Exposure to HDI: Progress and Challenges in Biomarker Analysis
Flack, Sheila L.; Ball, Louise M.; Nylander-French, Leena A.
2010-01-01
1,6-hexamethylene diisocyanate (HDI) is extensively used in the automotive repair industry and is a commonly reported cause of occupational asthma in industrialized populations. However, the exact pathological mechanism remains uncertain. Characterization and quantification of biomarkers resulting from HDI exposure can fill important knowledge gaps between exposure, susceptibility, and the rise of immunological reactions and sensitization leading to asthma. Here, we discuss existing challenge...
Muckenhuber, Johanna; Burkert, Nathalie; Dorner, Thomas E; Großschädl, Franziska; Freidl, Wolfgang
2014-10-01
The purpose of this study was to determine whether psychosocial work demands have a different impact on sickness absence and presenteeism in countries with a high vs. countries with a low Human Development Index (HDI). This article is based on an analysis of the fifth European Working Conditions Survey. We investigated single items as well as complex constructs and indices. Sickness absence and presenteeism were measured as outcome variables. Following the model of Karasek and Theorell, we measured the HDI at the macro level and psychosocial job demands at the micro level as independent variables. The multivariate multilevel analysis reveals a significant association between the HDI and the number of days recorded for sickness absence. In countries with a higher HDI, people report a lower number of days with sickness absence. Higher psychosocial job demands are associated with poorer health. There are significant cross-level interaction effects between psychosocial job demands and the HDI for these associations. Psychosocial job demands are stronger associated with sickness absence and presenteeism in high-HDI than in low-HDI countries. We argue that Public Health Actions that are connected to work characteristics need to take into consideration the level of HDI of the countries. In low- and high-HDI countries, different actions could be necessary to reach the needs of the working population. © The Author 2013. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.
Gaines, Linda G. T.; Fent, Kenneth W.; Flack, Sheila L.; Thomasen, Jennifer M.; Ball, Louise M.; Richardson, David B.; Ding, Kai; Whittaker, Stephen G.; Nylander-french, Leena A.
2010-01-01
Urinary 1,6-hexamethylene diamine (HDA) may serve as a biomarker for systemic exposure to 1,6-hexamethylene diisocyanate (HDI) in occupationally exposed populations. However, the quantitative relationships between dermal and inhalation exposure to HDI and urine HDA levels have not been established. We measured acid-hydrolyzed urine HDA levels along with dermal and breathing-zone levels of HDI in 48 automotive spray painters. These measurements were conducted over the course of an entire workd...
A practical method for extending the biuret assay to protein determination of corn-based products.
Liu, Zelong; Pan, Junhui
2017-06-01
A modified biuret method suitable for protein determination of corn-based products was developed by introducing a combination of an alkaline reagent with sodium dodecyl sulfate (reagent A) and heat treatments. The method was tested on seven corn-based samples. The results showed mostly good agreement (P>0.05) as compared to the Kjeldahl values. The proposed method was found to enhance the accuracy of prediction on zein content using bovine serum albumin as standard. Reagent A and sample treatment were proved to effectively improve protein solubilization for the thermally-dried corn-based products, e.g. corn gluten meal. The absorbance was stable for at least 1-h. Moreover, the whole measurement of protein content only needs 15-20min more than the traditional biuret assay, and can be performed in batches. The findings suggest that the proposed method could be a timesaving alternative for routine protein analyses in corn processing factories. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gaines, Linda G T; Fent, Kenneth W; Flack, Sheila L; Thomasen, Jennifer M; Ball, Louise M; Richardson, David B; Ding, Kai; Whittaker, Stephen G; Nylander-French, Leena A
2010-08-01
Urinary 1,6-hexamethylene diamine (HDA) may serve as a biomarker for systemic exposure to 1,6-hexamethylene diisocyanate (HDI) in occupationally exposed populations. However, the quantitative relationships between dermal and inhalation exposure to HDI and urine HDA levels have not been established. We measured acid-hydrolyzed urine HDA levels along with dermal and breathing-zone levels of HDI in 48 automotive spray painters. These measurements were conducted over the course of an entire workday for up to three separate workdays that were spaced approximately 1 month apart. One urine sample was collected before the start of work with HDI-containing paints and subsequent samples were collected during the workday. HDA levels varied throughout the day and ranged from nondetectable to 65.9 microg l(-1) with a geometric mean and geometric standard deviation of 0.10 microg l(-1) +/- 6.68. Dermal exposure and inhalation exposure levels, adjusted for the type of respirator worn, were both significant predictors of urine HDA levels in the linear mixed models. Creatinine was a significant covariate when used as an independent variable along with dermal and respirator-adjusted inhalation exposure. Consequently, exposure assessment models must account for the water content of a urine sample. These findings indicate that HDA exhibits a biphasic elimination pattern, with a half-life of 2.9 h for the fast elimination phase. Our results also indicate that urine HDA level is significantly associated with systemic HDI exposure through both the skin and the lungs. We conclude that urinary HDA may be used as a biomarker of exposure to HDI, but biological monitoring should be tailored to reliably capture the intermittent exposure pattern typical in this industry.
Is the Human Development Index (HDI) of the United Nations ...
African Journals Online (AJOL)
Is the Human Development Index (HDI) of the United Nations Development Programme (UNDP) a relevant indicator? Jean Claude Saha. Abstract. No Abstract. African Journal of Economic Policy Vol. 12(1) 2005: 1-27. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.
Ghoncheh, Mahshid; Mirzaei, Maryam; Salehiniya, Hamid
2015-01-01
Breast cancer is the most common malignancy in women worldwide and its incidence is generally increasing. In 2012, it was the second most common cancer in the world. It is necessary to obtain information on incidence and mortality for health planning. This study aimed to investigate the relationship between the human development index (HDI), and the incidence and mortality rates of breast cancer in the world in 2012. This ecologic study concerns incidence rate and standardized mortality rates of the cancer from GLOBOCAN in 2012, and HDI and its components extracted from the global bank site. Data were analyzed using correlation tests and regression with SPSS software (version 15). Among the six regions of WHO, the highest breast cancer incidence rate (67.6) was observed in the PAHO, and the lowest incidence rate was 27.8 for SEARO. There was a direct, strong, and meaningful correlation between the standardized incidence rate and HDI (r=0.725, p≤0.001). Pearson correlation test showed that there was a significant correlation between age-specific incidence rate (ASIR) and components of the HDI (life expectancy at birth, mean years of schooling, and GNP). On the other, a non-significant relationship was observed between ASIR and HDI overall (r=0.091, p=0.241). In total, a significant relationship was not found between age-specific mortality rate (ASMR) and components of HDI. Significant positive correlations exist between ASIR and components of the HDI. Socioeconomic status is directly related to the stage of the cancer and patient's survival. With increasing the incidence rate of the cancer, mortality rate from the cancer does not necessariloy increase. This may be due to more early detection and treatment in developed that developing countries. It is necessary to increase awareness of risk factors and early detection in the latter.
Mirmohammadi, Mirtaghi; Hakimi Ibrahim, M; Ahmad, Anees; Kadir, Mohd Omar Abdul; Mohammadyan, M; Mirashrafi, S B
2010-06-01
Today, many raw materials used in factories may have a dangerous effect on the physiological system of workers. One of them which is widely used in the polyurethane factories is diisocyanates. These compounds are widely used in surface coatings, polyurethane foams, adhesives, resins, elastomers, binders, and sealants. Exposure to diisocyanates causes irritation to the skin, mucous membranes, eyes, and respiratory tract. Hexamethylene diamine (HDA) is metabolite of hexamethylene diisocyanate (HDI). It is an excretory material by worker's urine who is exposed to HDI. Around 100 air samples were collected from five defined factories by midget impinger which contained dimethyl sulfoxide absorbent as a solvent and tryptamine as reagent. Samples were analyzed by high-performance liquid chromatography with EC\\UV detector using NIOSH 5522 method of sampling. Also, 50 urine samples collected from workers were also analyzed using William's biological analysis method. The concentration of HDI into all air samples were more than 88 microg/m(3), and they have shown high concentration of pollutant in the workplaces in comparison with NIOSH standard, and all of the workers' urine were contaminated by HDA. The correlation and regression test were used to obtain statistical model for HDI and HDA, which is useful for the prediction of diisocyanates pollution situation in the polyurethane factories.
Gene expression profiling in mouse lung following polymeric hexamethylene diisocyanate exposure
International Nuclear Information System (INIS)
Lee, C.-T.; Ylostalo, Joni; Friedman, Mitchell; Hoyle, Gary W.
2005-01-01
Isocyanates are a common cause of occupational lung disease. Hexamethylene diisocyanate (HDI), a component of polyurethane spray paints, can induce respiratory symptoms, inflammation, lung function impairment, and isocyanate asthma. The predominant form of HDI in polyurethane paints is a nonvolatile polyisocyanate known as HDI biuret trimer (HDI-BT). Exposure of mice to aerosolized HDI-BT results in pathological effects, including pulmonary edema, lung inflammation, cellular proliferation, and fibrotic lesions, which occur with distinct time courses following exposure. To identify genes that mediate lung pathology in the distinct temporal phases after exposure, gene expression profiles in HDI-BT-exposed C57BL/6J mouse lungs were analyzed. RNase protection assay (RPA) of genes involved in apoptosis, cell survival, and inflammation revealed increased expression of IκBα, Fas, Bcl-X L , TNFα, KC, MIP-2, IL-6, and GM-CSF following HDI-BT exposure. Microarray analysis of approximately 10 000 genes was performed on lung RNA collected from mice 6, 18, and 90 h after HDI-BT exposure and from unexposed mice. Classes of genes whose expression was increased 6 h after exposure included those involved in stress responses (particularly oxidative stress and thiol redox balance), growth arrest, apoptosis, signal transduction, and inflammation. Types of genes whose expression was increased at 18 h included proteinases, anti-proteinases, cytoskeletal molecules, and inflammatory mediators. Transcripts increased at 90 h included extracellular matrix components, transcription factors, inflammatory mediators, and cell cycle regulators. This characterization of the gene expression profile in lungs exposed to HDI-BT will provide a basis for investigating injury and repair pathways that are operative during isocyanate-induced lung disease
Czech Academy of Sciences Publication Activity Database
Matulková, I.; Mathauserová, J.; Císařová, I.; Němec, I.; Fábry, Jan
2016-01-01
Roč. 231, č. 5 (2016), s. 291-300 ISSN 2194-4946 R&D Projects: GA ČR GA14-05506S Institutional support: RVO:68378271 Keywords : biuret * crystal structure analysis * hydrogen bonding * vibrational spectroscopy * X-ray diffraction Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.179, year: 2016
Xiong, Zhu; Zhang, Lisheng; Ma, Songqi; Yang, Yong; Zhang, Chuanzhi; Tang, Zhaobin; Zhu, Jin
2013-04-15
Blends of entirely bio-sourced polymers, namely polylactide (PLA) and starch, have been melt-compounded by lab-scale co-extruder with castor oil (CO) as a plasticizer. The enrichment of castor oil on starch had great effect on the properties of the blends. If the castor oil was mainly dispersed in PLA matrix, the properties of the blends were poor, but when the hexamethylenediisocyanate (HDI) was grafted on starch granules the ready reactions between the hydroxyl on CO and the isocyante on the HDI-grafted starch (HGSTs) brought CO molecules enriched on starch particles. DSC analysis shows that the CO layer on starch has a positive effect on the crystallization of PLA in the ternary blend. The accumulation of CO on starch greatly improves the toughness and impact strength of PLA/starch blends. The grafting content of HDI on the starch granules primarily determined the compatibility and properties of the resulted blends. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bergamini, L; Finelli, M E; Bendini, C; Ferrari, E; Veschi, M; Neviani, F; Manni, B; Pelosi, A; Rioli, G; Neri, M
2009-01-01
Hypertension is a risk factor for a long-lasting arterial wall-remodelling leading to stiffness. The rapid method measuring the pulse pressure (PP) by means of the tool of Hypertension Diagnostic Instruments (HDI) called PP-HDI, overcomes some of the problems arising with more-time consuming methods, like ambulatory blood pressure monitoring (ABPM), and give information about the elasticity of the arterial walls. We studied the relationship between the PP-HDI, the large artery compliance (LA-C) and small artery compliance (SA-C) and few well-established indices of arterial blood pressure (ABP) in a sample of 75 hypertensive subjects, aged 65 years and over. Significant correlations between LA-C and heart rate (HR), PP-ABPM and PP-HDI were found. SA-C relates with HR and systolic blood pressure (SBP) measured in lying and standing positions. Applying a stepwise regression analysis, we found that LA-C variance stems from PP-HDI and HR, while SA-C variance stems from SBP in lying position. Receiver operator characteristic (ROC) curves for thresholds of PP showed that PP-HDI reached levels of sensitivity/specificity similar to PP-ABPM. In conclusion, surveillance of ABP through hemo-dynamic indices, in particular of SBP, is essential, nevertheless the advantage of this control is not known in an elderly population where the organ damage is already evident. PP needs necessarily an instrumental measurement. The PP-HDI result is similar in reliability with respect to PPABPM, but is more rapid and well applicable in an elderly population.
Reliability of CGA/LGA/HDI Package Board/Assembly (Final Report)
Ghaffaroam. Reza
2014-01-01
Package manufacturers are now offering commercial-off-the-shelf column grid array (COTS CGA) packaging technologies in high-reliability versions. Understanding the process and quality assurance (QA) indicators for reliability are important for low-risk insertion of these advanced electronics packages. The previous reports, released in January of 2012 and January of 2013, presented package test data, assembly information, and reliability evaluation by thermal cycling for CGA packages with 1752, 1517, 1509, and 1272 inputs/outputs (I/Os) and 1-mm pitch. It presented the thermal cycling (-55C either 100C or 125C) test results for up to 200 cycles. This report presents up to 500 thermal cycles with quality assurance and failure analysis evaluation represented by optical photomicrographs, 2D real time X-ray images, dye-and-pry photomicrographs, and optical/scanning electron Microscopy (SEM) cross-sectional images. The report also presents assembly challenge using reflowing by either vapor phase or rework station of CGA and land grid array (LGA) versions of three high I/O packages both ceramic and plastic configuration. A new test vehicle was designed having high density interconnect (HDI) printed circuit board (PCB) with microvia-in-pad to accommodate both LGA packages as well as a large number of fine pitch ball grid arrays (BGAs). The LGAs either were assembled onto HDI PCB as an LGA or were solder paste print and reflow first to form solder dome on pads before assembly. Both plastic BGAs with 1156 I/O and ceramic LGAs were assembled. It also presented the X-ray inspection results as well as failures due to 200 thermal cycles. Lessons learned on assembly of ceramic LGAs are also presented.
Neuronal modulation of lung injury induced by polymeric hexamethylene diisocyanate in mice
International Nuclear Information System (INIS)
Lee, C.-T.; Poovey, Halet G.; Rando, Roy J.; Hoyle, Gary W.
2007-01-01
1,6-Hexamethylene diisocyanate biuret trimer (HDI-BT) is a nonvolatile isocyanate that is a component of polyurethane spray paints. HDI-BT is a potent irritant that when inhaled stimulates sensory nerves of the respiratory tract. The role of sensory nerves in modulating lung injury following inhalation of HDI-BT was assessed in genetically manipulated mice with altered innervation of the lung. Knockout mice with a mutation in the low-affinity nerve growth factor receptor (NGFR), which have decreased innervation by nociceptive nerve fibers, and transgenic mice expressing nerve growth factor (NGF) from the lung-specific Clara cell secretory protein (CCSP) promoter, which have increased innervation of the airways, were exposed to HDI-BT aerosol and evaluated at various times after exposure. NGFR knockout mice exhibited significantly more, and CCSP-NGF transgenic mice exhibited significantly less injury and inflammation compared with wild-type mice, indicative of a protective effect of nociceptive nerves on the lung following HDI-BT inhalation. Transgenic mice overexpressing the tachykinin 1 receptor (Tacr1) in lung epithelial cells also showed less severe injury and inflammation compared with wild-type mice after HDI-BT exposure, establishing a role for released tachykinins acting through Tacr1 in mediating at least part of the protective effect. Treatment of lung fragments from Tacr1 transgenic mice with the Tacr1 ligand substance P resulted in increased cAMP accumulation, suggesting this compound as a possible signaling mediator of protective effects on the lung following nociceptive nerve stimulation. The results indicate that sensory nerves acting through Tacr1 can exert protective or anti-inflammatory effects in the lung following isocyanate exposure
一种叠孔三阶HDI板制作技术研究%Study on the process technology of a stack-via 3 steps HDI board
Institute of Scientific and Technical Information of China (English)
陈世金; 罗旭; 覃新; 乔鹏程; 徐缓
2012-01-01
In recent years, because of popularity 3G mobile phone and intelligent mobile phone appearance, promote continuous development of PCB technology, HDI products demand growth accelerated, especially the 3 steps HDI products will become the mainstream of future 3G mobile phone, and intelligent mobile phones are the 3 steps,any-layer HDI design is given priority to, these demand drive HDI technology gradually to higher line density direction, line and space is reduced ceaselessly, panel structure from 1+N+1 to stagger-via, and then to stack-via, the production difficulty is increased ceaselessly. Therefore, for the first 3 steps HDI board production process technology waster of the 3 steps via and order HDI plate production technology will be the key to the market today race.% 近年来,由于3G手机的普及和智能手机的出现,推动PCB(Printed Circuit Board,印制电路板)技术不断向前发展,加快HDI类产品的增长需求,尤其是三阶HDI产品将成为3G手机未来的主流,而智能手机则以三阶、any-layer HDI设计为主。这些需求带动HDI技术逐渐向更高布线密度方向发展,线宽线距不断减小,板件结构从1+N+1到stagger-via(交错孔),再到stack-via(叠孔),其制作难度不断加大。因此,对三阶HDI板的制作工艺技术进行研究,掌握叠孔三阶及多阶HDI板制作技术将成为抢占当今市场的关键所在。
Reeb-Whitaker, Carolyn; Whittaker, Stephen G.; Ceballos, Diana M.; Weiland, Elisa C.; Flack, Sheila L.; Fent, Kenneth W.; Thomasen, Jennifer M.; Gaines, Linda G. Trelles; Nylander-French, Leena A.
2014-01-01
Isocyanate exposure was evaluated in 33 spray painters from 25 Washington State autobody shops. Personal breathing zone samples (n = 228) were analyzed for isophorone diisocyanate (IPDI) monomer, 1,6-hexamethylene diisocyanate (HDI) monomer, IPDI polyisocyanate, and three polyisocyanate forms of HDI. The objective was to describe exposures to isocyanates while spray painting, compare them with short-term exposure limits (STELs), and describe the isocyanate composition in the samples. The composition of polyisocyanates (IPDI and HDI) in the samples varied greatly, with maximum amounts ranging from up to 58% for HDI biuret to 96% for HDI isocyanurate. There was a significant inverse relationship between the percentage composition of HDI isocyanurate to IPDI and to HDI uretdione. Two 15-min STELs were compared: (1) Oregon's Occupational Safety and Health Administration (OR-OSHA) STEL of 1000 μg/m3 for HDI polyisocyanate, and (2) the United Kingdom's Health and Safety Executive (UK-HSE) STEL of 70 μg NCO/m3 for all isocyanates. Eighty percent of samples containing HDI polyisocyanate exceeded the OR-OSHA STEL while 98% of samples exceeded the UKHSE STEL. The majority of painters (67%) wore half-face air-purifying respirators while spray painting. Using the OROSHA and the UK-HSE STELs as benchmarks, 21% and 67% of painters, respectively, had at least one exposure that exceeded the respirator's OSHA-assigned protection factor. A critical review of the STELs revealed the following limitations: (1) the OR-OSHA STEL does not include all polyisocyanates, and (2) the UK-HSE STEL is derived from monomeric isocyanates, whereas the species present in typical spray coatings are polyisocyanates. In conclusion, the variable mixtures of isocyanates used by autobody painters suggest that an occupational exposure limit is required that includes all polyisocyanates. Despite the limitations of the STELs, we determined that a respirator with an assigned protection factor of 25 or
Reeb-Whitaker, Carolyn; Whittaker, Stephen G; Ceballos, Diana M; Weiland, Elisa C; Flack, Sheila L; Fent, Kenneth W; Thomasen, Jennifer M; Trelles Gaines, Linda G; Nylander-French, Leena A
2012-01-01
Isocyanate exposure was evaluated in 33 spray painters from 25 Washington State autobody shops. Personal breathing zone samples (n = 228) were analyzed for isophorone diisocyanate (IPDI) monomer, 1,6-hexamethylene diisocyanate (HDI) monomer, IPDI polyisocyanate, and three polyisocyanate forms of HDI. The objective was to describe exposures to isocyanates while spray painting, compare them with short-term exposure limits (STELs), and describe the isocyanate composition in the samples. The composition of polyisocyanates (IPDI and HDI) in the samples varied greatly, with maximum amounts ranging from up to 58% for HDI biuret to 96% for HDI isocyanurate. There was a significant inverse relationship between the percentage composition of HDI isocyanurate to IPDI and to HDI uretdione. Two 15-min STELs were compared: (1) Oregon's Occupational Safety and Health Administration (OR-OSHA) STEL of 1000 μg/m(3) for HDI polyisocyanate, and (2) the United Kingdom's Health and Safety Executive (UK-HSE) STEL of 70 μg NCO/m(3) for all isocyanates. Eighty percent of samples containing HDI polyisocyanate exceeded the OR-OSHA STEL while 98% of samples exceeded the UK-HSE STEL. The majority of painters (67%) wore half-face air-purifying respirators while spray painting. Using the OR-OSHA and the UK-HSE STELs as benchmarks, 21% and 67% of painters, respectively, had at least one exposure that exceeded the respirator's OSHA-assigned protection factor. A critical review of the STELs revealed the following limitations: (1) the OR-OSHA STEL does not include all polyisocyanates, and (2) the UK-HSE STEL is derived from monomeric isocyanates, whereas the species present in typical spray coatings are polyisocyanates. In conclusion, the variable mixtures of isocyanates used by autobody painters suggest that an occupational exposure limit is required that includes all polyisocyanates. Despite the limitations of the STELs, we determined that a respirator with an assigned protection factor of 25 or
Jin, Shuping; Yue, Guoren; Feng, Lei; Han, Yuqi; Yu, Xinghai; Zhang, Zenghu
2011-01-12
In this investigation, a novel water-insoluble slow-release fertilizer, biuret polyphosphoramide (BPAM), was formulated and synthesized from urea, phosphoric acid (H(3)PO(4)), and ferric oxide (Fe(2)O(3)). The structure of BPAM was characterized by Fourier transform infrared (FTIR) spectroscopy. Subsequently, a coated slow-release BPAM fertilizer with superabsorbent was prepared by ionic cross-linked carboxymethylchitosan (the core), acrylic acid, acrylamide, and active carbon (the coating). The variable influences on the water absorbency were investigated and optimized. Component analysis results showed that the coated slow-release BPAM contained 5.66% nitrogen and 11.7% phosphorus. The property of water retention, the behavior of slow release of phosphorus, and the capacity of adsorption of cations were evaluated, and the results revealed that the product not only had good slow-release property and excellent water retention capacity but also higher adsorption capacities of cations in saline soil.
Chelation Ion Exchange Properties of 2, 4-Dihydroxyacetophenone-Biuret-Formaldehyde Terpolymer Resin
Directory of Open Access Journals (Sweden)
Sanjiokumar S. Rahangdale
2009-01-01
Full Text Available The terpolymer resin 2, 4-HABF has been synthesized by the condensation of 2, 4-dihydroxyacetophenone (2, 4-HA and biuret (B with formaldehyde (F in 1:1:2 molar ratios in presence of 2 M hydrochloric acid as catalyst. UV-Visible, IR and proton NMR spectral studies have been carried out to elucidate the structure of the resin. A terpolymer (2, 4-HABF proved to be a selective chelating ion exchange polymer for certain metals. Chelating ion-exchange properties of this polymer were studied for Fe3+, Cu2+, Ni2+, Co2+, Zn2+, Cd2+ and Pb2+ ions. A batch equilibrium method was employed in the study of the selectivity of metal ion uptake involving the measurement of the distribution of a given metal ion between the polymer sample and a solution containing the metal ion. The study was carried out over a wide pH range and in media of various ionic strengths. The polymer showed highest selectivity for Fe3+, Cu2+ ions than for Ni2+, Co2+, Zn2+, Cd2+, and Pb2+ ions. Study of distribution ratio as a formation of pH indicates that the amount of metal ion taken by resin is increases with the increasing pH of the medium.
Pronk, A.; Yu, F.; Vlaanderen, J.; Tielemans, E.; Preller, L.; Bobeldijk, I.; Deddens, J.A.; Latza, U.; Baur, X.; Heederik, D.
2006-01-01
Objectives: To study inhalation and dermal exposure to hexamethylene diisocyanate (HDI) and its oligomers as well as personal protection equipment (PPE) use during task performance in conjunction with urinary hexamethylene diamine (HDA) in car body repair shop workers and industrial spray painters.
Disruptive Technologies in Workmanship: pH-neutral Flux, CDM ESD Events, HDI PCBs
Plante, Jeannette F.
2010-01-01
This slide presentation describes what it calls "disruptive technologies", i.e., "Low-end disruption" occurs when the rate at which products improve exceeds the rate at which customers can adopt the new performance. Therefore, at some point the performance of the product overshoots the needs of certain customer segments. At this point, a disruptive technology may enter the market and provide a product which has lower performance than the incumbent but which exceeds the requirements of certain segments, thereby gaining a foothold in the market. This concept is viewed in impacting incumbent technologies Rosin Flux, with a pH-neutral water soluble Flux; electrostatic discharge models being disrupted by the charge device model (CDM) concept; and High Density Interconnect Printed Circuit Boards (HDI PCB).
Pronk, A; Yu, F; Vlaanderen, J; Tielemans, E; Preller, L; Bobeldijk, I; Deddens, J A; Latza, U; Baur, X; Heederik, D
2006-09-01
To study inhalation and dermal exposure to hexamethylene diisocyanate (HDI) and its oligomers as well as personal protection equipment (PPE) use during task performance in conjunction with urinary hexamethylene diamine (HDA) in car body repair shop workers and industrial spray painters. Personal task based inhalation samples (n = 95) were collected from six car body repair shops and five industrial painting companies using impingers with di-n-butylamine (DBA) in toluene. In parallel, dermal exposure was assessed using nitril rubber gloves. Gloves were submerged into DBA in toluene after sampling. Analysis for HDI and its oligomers was performed by LC-MS/MS. Urine samples were collected from 55 workers (n = 291) and analysed for HDA by GC-MS. Inhalation exposure was strongly associated with tasks during which aerosolisation occurs. Dermal exposure occurred during tasks that involve direct handling of paint. In car body repair shops associations were found between detectable dermal exposure and glove use (odds ratio (OR) 0.22, 95% confidence interval (CI) 0.09 to 0.57) and inhalation exposure level (OR 1.34, 95% CI 0.97 to 1.84 for a 10-fold increase). HDA in urine could be demonstrated in 36% and 10% of car body repair shop workers and industrial painting company workers respectively. In car body repair shops, the frequency of detectable HDA was significantly elevated at the end of the working day (OR 2.13, 95% CI 1.07 to 4.22 for 3-6 pm v 0-8 am). In both branches HDA was detected in urine of approximately 25% of the spray painters. In addition HDA was detected in urine of a large proportion of non-spray painters in car body repair shops. Although (spray) painting with lacquers containing isocyanate hardeners results in the highest external exposures to HDI and oligomers, workers that do not perform paint related tasks may also receive a considerable internal dose.
Directory of Open Access Journals (Sweden)
Paolo Palazzi
2004-09-01
Full Text Available On the basis of the UNDP data used to calculate the Human Development Index (HDI, the paper applies a methodology to determine a different development index able to show disequilibria between the different aspects of development (in this case income, life expectancy and education. The basic idea is that the concept of total substitutability between the variables utilized to calculate the HDI must be abandoned, and it is therefore important to take into account the unbalance between the various aspects characterizing the development level when calculating the index. The author utilizes the concept of the social sustainability of development over time, assuming that it will show a higher value with a more even balance between the various aspects of development. The concave average methodology proposed in Casadio Tarabusi ePalazzi (2004 is able to "penalize" development levels proportionally to the disequilibrium of the variables utilized to measure it. In the paper the new indicator is calculated for 162 countries for the years 1997-2001. Comparison between HDI and the new index shows notable differences not only in the ranking of the countries, but also in the time dynamics of the two indicators, now of the opposite sign for many countries. Finally, utilizing multivariate statistical analysis the presence of disequilibria in the various countries is evidenced together with their dynamics over time.
Pronk, A; Yu, F; Vlaanderen, J; Tielemans, E; Preller, L; Bobeldijk, I; Deddens, J A; Latza, U; Baur, X; Heederik, D
2006-01-01
Objectives To study inhalation and dermal exposure to hexamethylene diisocyanate (HDI) and its oligomers as well as personal protection equipment (PPE) use during task performance in conjunction with urinary hexamethylene diamine (HDA) in car body repair shop workers and industrial spray painters. Methods Personal task based inhalation samples (n = 95) were collected from six car body repair shops and five industrial painting companies using impingers with di‐n‐butylamine (DBA) in toluene. In parallel, dermal exposure was assessed using nitril rubber gloves. Gloves were submerged into DBA in toluene after sampling. Analysis for HDI and its oligomers was performed by LC‐MS/MS. Urine samples were collected from 55 workers (n = 291) and analysed for HDA by GC‐MS. Results Inhalation exposure was strongly associated with tasks during which aerosolisation occurs. Dermal exposure occurred during tasks that involve direct handling of paint. In car body repair shops associations were found between detectable dermal exposure and glove use (odds ratio (OR) 0.22, 95% confidence interval (CI) 0.09 to 0.57) and inhalation exposure level (OR 1.34, 95% CI 0.97 to 1.84 for a 10‐fold increase). HDA in urine could be demonstrated in 36% and 10% of car body repair shop workers and industrial painting company workers respectively. In car body repair shops, the frequency of detectable HDA was significantly elevated at the end of the working day (OR 2.13, 95% CI 1.07 to 4.22 for 3–6 pm v 0–8 am). In both branches HDA was detected in urine of ∼25% of the spray painters. In addition HDA was detected in urine of a large proportion of non‐spray painters in car body repair shops. Conclusion Although (spray) painting with lacquers containing isocyanate hardeners results in the highest external exposures to HDI and oligomers, workers that do not perform paint related tasks may also receive a considerable internal dose. PMID:16728504
Directory of Open Access Journals (Sweden)
Paolo Palazzi
2012-04-01
Full Text Available On the basis of the UNDP data used to calculate the Human Development Index (HDI, the paper applies a methodology to determine a different development index able to show disequilibria between the different aspects of development (in this case income, life expectancy and education. The basic idea is that the concept of total substitutability between the variables utilized to calculate the HDI must be abandoned, and it is therefore important to take into account the unbalance between the various aspects characterizing the development level when calculating the index. The author utilizes the concept of the social sustainability of development over time, assuming that it will show a higher value with a more even balance between the various aspects of development. The concave average methodology proposed in Casadio Tarabusi ePalazzi (2004 is able to "penalize" development levels proportionally to the disequilibrium of the variables utilized to measure it. In the paper the new indicator is calculated for 162 countries for the years 1997-2001. Comparison between HDI and the new index shows notable differences not only in the ranking of the countries, but also in the time dynamics of the two indicators, now of the opposite sign for many countries. Finally, utilizing multivariate statistical analysis the presence of disequilibria in the various countries is evidenced together with their dynamics over time. JEL Codes: C43, O10, O15, Q01Keywords: Development, Education, Human Development, Indice
Sheffield, Catherine A; Kane, Michael P; Bakst, Gary; Busch, Robert S; Abelseth, Jill M; Hamilton, Robert A
2009-09-01
This study compared the accuracy and precision of four value-added glucose meters. Finger stick glucose measurements in diabetes patients were performed using the Abbott Diabetes Care (Alameda, CA) Optium, Diagnostic Devices, Inc. (Miami, FL) DDI Prodigy, Home Diagnostics, Inc. (Fort Lauderdale, FL) HDI True Track Smart System, and Arkray, USA (Minneapolis, MN) HypoGuard Assure Pro. Finger glucose measurements were compared with laboratory reference results. Accuracy was assessed by a Clarke error grid analysis (EGA), a Parkes EGA, and within 5%, 10%, 15%, and 20% of the laboratory value criteria (chi2 analysis). Meter precision was determined by calculating absolute mean differences in glucose values between duplicate samples (Kruskal-Wallis test). Finger sticks were obtained from 125 diabetes patients, of which 90.4% were Caucasian, 51.2% were female, 83.2% had type 2 diabetes, and average age of 59 years (SD 14 years). Mean venipuncture blood glucose was 151 mg/dL (SD +/-65 mg/dL; range, 58-474 mg/dL). Clinical accuracy by Clarke EGA was demonstrated in 94% of Optium, 82% of Prodigy, 61% of True Track, and 77% of the Assure Pro samples (P Abbott Optium was significantly more accurate than the other meter systems, whereas the HDI True Track was significantly less accurate and less precise compared to the other meter systems.
Contribution to Casein Determination by UV Spectrophotometry
Directory of Open Access Journals (Sweden)
Stefanescu Raluca
2017-12-01
Full Text Available In the present paper, the interaction between copper ions and proteins is presented, in order to elaborate a simple and rapid spectrophotometric assay of casein in milk. Under alkaline conditions, copper ions form the biuret complex with the proteins, which can be used in protein determination. Although very specific, the biuret method is less sensitive. Using insoluble copper phosphate, casein is able to extract copper ions, with which it forms the biuret complex, while either the complex or copper ions could be determined in the ultraviolet range. Indeed, an increased absorbance of biuret complex at 215 nm was found. Nevertheless, copper ions can be determined in UV as well, their concentration being proportional to that of casein. When used tetraglycine instead casein, mass spectrometric measurements at pH higher than 11 revealed the formation of complexes with many copper ions bound to each peptide bond-containing molecule. Nevertheless, on diluting the biuret solution the complex may dissociate leading to very complex UV spectra that should be further studied.
Neuroprotective effect of whole-plant extract of Torilis leptophylla in ...
African Journals Online (AJOL)
of oxidative stress in the brain indicate that the levels of superoxide .... determinations after 32 days. ... homogenates using Gornall's biuret technique, ..... serum proteins by means of the biuret reaction. J Biol. Chem. 1949; 177(2): 751–766. 11.
Directory of Open Access Journals (Sweden)
Joshua J.H. Hunsaker
2016-12-01
Full Text Available Objectives: Refractometric methods to measure total protein (TP in serum and plasma specimens have been replaced by automated biuret methods in virtually all routine clinical testing. A subset of laboratories, however, still report using refractometry to measure TP in conjunction with serum protein electrophoresis. The objective of this study was therefore to conduct a modern performance evaluation of a digital refractometer for TP measurement. Design and methods: Performance evaluation of a MISCO Palm Abbe⢠digital refractometer was conducted through device familiarization, carryover, precision, accuracy, linearity, analytical sensitivity, analytical specificity, and reference interval verification. Comparison assays included a manual refractometer and an automated biuret assay. Results: Carryover risk was eliminated using a demineralized distilled water (ddH2O wash step. Precision studies demonstrated overall imprecision of 2.2% CV (low TP pool and 0.5% CV (high TP pool. Accuracy studies demonstrated correlation to both manual refractometry and the biuret method. An overall positive bias (+5.0% was observed versus the biuret method. On average, outlier specimens had an increased triglyceride concentration. Linearity was verified using mixed dilutions of: a low and high concentration patient pools, or b albumin-spiked ddH2O and high concentration patient pool. Decreased recovery was observed using ddH2O dilutions at low TP concentrations. Significant interference was detected at high concentrations of glucose (>267 mg/dL and triglycerides (>580 mg/dL. Current laboratory reference intervals for TP were verified. Conclusions: Performance characteristics of this digital refractometer were validated in a clinical laboratory setting. Biuret method remains the preferred assay for TP measurement in routine clinical analyses. Keywords: Refractometry, Digital refractometry, Total protein, Biuret, Serum protein electrophoresis, Monoclonal
Hunsaker, Joshua J H; Wyness, Sara P; Snow, Taylor M; Genzen, Jonathan R
2016-12-01
Refractometric methods to measure total protein (TP) in serum and plasma specimens have been replaced by automated biuret methods in virtually all routine clinical testing. A subset of laboratories, however, still report using refractometry to measure TP in conjunction with serum protein electrophoresis. The objective of this study was therefore to conduct a modern performance evaluation of a digital refractometer for TP measurement. Performance evaluation of a MISCO Palm Abbe™ digital refractometer was conducted through device familiarization, carryover, precision, accuracy, linearity, analytical sensitivity, analytical specificity, and reference interval verification. Comparison assays included a manual refractometer and an automated biuret assay. Carryover risk was eliminated using a demineralized distilled water (ddH 2 O) wash step. Precision studies demonstrated overall imprecision of 2.2% CV (low TP pool) and 0.5% CV (high TP pool). Accuracy studies demonstrated correlation to both manual refractometry and the biuret method. An overall positive bias (+5.0%) was observed versus the biuret method. On average, outlier specimens had an increased triglyceride concentration. Linearity was verified using mixed dilutions of: a) low and high concentration patient pools, or b) albumin-spiked ddH 2 O and high concentration patient pool. Decreased recovery was observed using ddH 2 O dilutions at low TP concentrations. Significant interference was detected at high concentrations of glucose (>267 mg/dL) and triglycerides (>580 mg/dL). Current laboratory reference intervals for TP were verified. Performance characteristics of this digital refractometer were validated in a clinical laboratory setting. Biuret method remains the preferred assay for TP measurement in routine clinical analyses.
Razi, Saeid; Ghoncheh, Mahshid; Mohammadian-Hafshejani, Abdollah; Aziznejhad, Hojjat; Mohammadian, Mahdi; Salehiniya, Hamid
2016-01-01
The incidence and mortality estimates of ovarian cancer based on human development are essential for planning by policy makers. This study is aimed at investigating the standardised incidence rates (SIR) and standardised mortality rates (SMR) of ovarian cancer and their relationship with the Human Development Index (HDI) in Asian countries. This study was an ecologic study in Asia for assessment of the correlation between SIR, age standardised rates (ASR), and HDI and their details, including life expectancy at birth, mean years of schooling, and gross national income (GNI) per capita. We used the correlation bivariate method for assessment of the correlation between ASR and HDI, and its details. Statistical significance was assumed if P HDI and SIR (r = 0.143, p = 0.006). Correlation between SMR of ovarian cancer and HDI was not significant (r = 0.005, p = 052.0). According to the findings of this study, between the HDI and SIR, there was a positive correlation, but there was no correlation between the SMR and HDI.
2018-04-05
Appendicitis is the most common abdominal surgical emergency worldwide. Differences between high- and low-income settings in the availability of laparoscopic appendectomy, alternative management choices, and outcomes are poorly described. The aim was to identify variation in surgical management and outcomes of appendicitis within low-, middle-, and high-Human Development Index (HDI) countries worldwide. This is a multicenter, international prospective cohort study. Consecutive sampling of patients undergoing emergency appendectomy over 6 months was conducted. Follow-up lasted 30 days. 4546 patients from 52 countries underwent appendectomy (2499 high-, 1540 middle-, and 507 low-HDI groups). Surgical site infection (SSI) rates were higher in low-HDI (OR 2.57, 95% CI 1.33-4.99, p = 0.005) but not middle-HDI countries (OR 1.38, 95% CI 0.76-2.52, p = 0.291), compared with high-HDI countries after adjustment. A laparoscopic approach was common in high-HDI countries (1693/2499, 67.7%), but infrequent in low-HDI (41/507, 8.1%) and middle-HDI (132/1540, 8.6%) groups. After accounting for case-mix, laparoscopy was still associated with fewer overall complications (OR 0.55, 95% CI 0.42-0.71, p introduction, laparoscopy could significantly improve outcomes for patients in low-resource environments. NCT02179112.
Khazaei, Salman; Rezaeian, Shahab; Khazaei, Somayeh; Mansori, Kamyar; Sanjari Moghaddam, Ali; Ayubi, Erfan
2016-01-01
Geographic disparity for colorectal cancer (CRC) incidence and mortality according to the human development index (HDI) might be expected. This study aimed at quantifying the effect measure of association HDI and its components on the CRC incidence and mortality. In this ecological study, CRC incidence and mortality was obtained from GLOBOCAN, the global cancer project for 172 countries. Data were extracted about HDI 2013 for 169 countries from the World Bank report. Linear regression was constructed to measure effects of HDI and its components on CRC incidence and mortality. A positive trend between increasing HDI of countries and age-standardized rates per 100,000 of CRC incidence and mortality was observed. Among HDI components education was the strongest effect measure of association on CRC incidence and mortality, regression coefficients (95% confidence intervals) being 2.8 (2.4, 3.2) and 0.9 (0.8, 1), respectively. HDI and its components were positively related with CRC incidence and mortality and can be considered as targets for prevention and treatment intervention or tracking geographic disparities.
Bioethics and its gatekeepers: does institutional racism exist in leading bioethics journals?
Chattopadhyay, Subrata; Myser, Catherine; De Vries, Raymond
2013-03-01
Who are the gatekeepers in bioethics? Does editorial bias or institutional racism exist in leading bioethics journals? We analyzed the composition of the editorial boards of 14 leading bioethics journals by country. Categorizing these countries according to their Human Development Index (HDI), we discovered that approximately 95 percent of editorial board members are based in (very) high-HDI countries, less than 4 percent are from medium-HDI countries, and fewer than 1.5 percent are from low-HDI countries. Eight out of 14 leading bioethics journals have no editorial board members from a medium- or low-HDI country. Eleven bioethics journals have no board members from low-HDI countries. This severe underrepresentation of bioethics scholars from developing countries on editorial boards suggests that bioethics may be affected by institutional racism, raising significant questions about the ethics of bioethics in a global context.
Cole, J B; Stellpflug, S J; Ellsworth, H; Anderson, C P; Adams, A B; Engebretsen, K M; Holger, J S
2013-05-01
High dose insulin (HDI) has proven superior to glucagon and catecholamines in the treatment of poison-induced cardiogenic shock (PICS) in previous animal studies. Standard recommendations for dosing of insulin vary and the optimal dose of HDI in PICS has not been established. Our hypothesis was a dose of 10 U/kg/hr of HDI would be superior to 1 U/kg/hr with cardiac output (CO) as our primary outcome measure in pigs with propranolol-induced PICS. This was a blinded, prospective, randomized trial with 4 arms consisting of 4 pigs in each arm. The arms were as follows: placebo (P), 1 U/kg/hr (HDI-1), 5 U/kg/hr (HDI-5), and 10 U/kg/hr (HDI-10). Cardiogenic shock was induced with a bolus of 0.5 mg/kg of propranolol followed by an infusion of 0.25 mg/kg/min until the point of toxicity, defined as 0.75 x (HR x MAP) was reached. At this point the propranolol infusion was decreased to 0.125 mg/kg/min and a 20 mL/kg bolus of normal saline (NS) was administered. The protocol was continued for 6 hours or until the animals died. 2 pigs died in the P arm, 1 pig died each in the HDI-1 and HDI-5 arms, and all pigs lived in the HDI-10 arm. There was a statistically significant difference in dose by time interaction on CO of 1.13 L/min over the 6 hr study period (p = < 0.001). There was also a statistically significant difference in dose by time interaction on MAP, HR, and systemic vascular resistance (SVR). No statistically significant difference was found between any of the arms regarding glucose utilization. HDI was statistically and clinically significantly superior to placebo in this propranolol model of PICS. Furthermore a dose response over time was found where CO increased corresponding to increases in doses of HDI.
Van Hiel, Alain; Van Assche, Jasper; De Cremer, David; Onraet, Emma; Bostyn, Dries; Haesevoets, Tessa; Roets, Arne
2018-01-01
The present study investigated the relationship between level of education and liberalization values in large, representative samples administered in 96 countries around the world (total N = 139,991). These countries show meaningful variation in terms of the Human Development Index (HDI), ranging from very poor, developing countries to prosperous, developed countries. We found evidence of cross-level interactions, consistently showing that individuals' level of education was associated with an increase in their liberalization values in higher HDI societies, whereas this relationship was curbed in lower HDI countries. This enhanced liberalization mindset of individuals in high HDI countries, in turn, was related to better scores on national indices of innovation. We conclude that this 'education amplification effect' widens the gap between lower and higher HDI countries in terms of liberalized mentality and economic growth potential. Policy implications for how low HDI countries can counter this gap are discussed.
Incidence and Mortality of Breast Cancer and their Relationship to Development in Asia.
Ghoncheh, Mahshid; Mohammadian-Hafshejani, Abdollah; Salehiniya, Hamid
2015-01-01
This study aimed to investigate the incidence and mortality of breast cancer, and its relationship with human development index (HDI) and its components in Asia in 2012. This study was an ecologic study in Asia for assessment of the correlation between age-specific incidence rate (ASIR) and age-specific mortality rate (ASMR) with HDI and its details that include: life expectancy at birth, mean years of schooling and gross national income (GNI) per capita. Data about SIR and SMR for every Asian country for the year 2012 were obtained from the global cancer project. We used a bivariate method for assessment of the correlation between SIR and SMR and HDI and its individual components. Statistical significance was assumed if PASMR) was observed in Pakistan (25.2), Armenia (24.2), and Lebanon (24). There was a positive correlation between the ASIR of breast cancer and HDI (r = 0.556, p ASMR of breast cancer and HDI (r = -0.051). Breast cancer incidence in countries with higher development is greater, while mortality is greatest in countries with less development. There was a positive and significant relationship between the ASIR of breast cancer and HDI and its components. Also there was a negative but non significant relationship between the ASMR of breast cancer and HDI.
Human development and South East Asian countries: Special emphasis on India.
Sharma, Kalpa
2013-08-31
'Development' is to improve the quality of people's lives by creating an environment for them to engage in a wide range of activities, to be healthy and well nourished, to be knowledgeable and to be able to participate in the community life. The Human Development Index (HDI) is a multi-dimensional index of development as it is the combination of three development indices- health index, education index and income index. This article attempts to compare the HDI and its components between various South East Asian countries. Secondary data is used. India's position on the HDI scale is equivalent to the South East Asian average and rank 134 out of more than 190 countries. In South East Asia, India stood fifth in HDI, behind Sri Lanka, Thailand, Maldives and Indonesia. Country has launched several schemes and programs to improve the health indicators, to provide elementary education to every child and to alleviate poverty. India's HDI value has improved with time but still country has a long way to go in achieving an acceptable HDI. Need is to strengthen the existing schemes and programs.
Pourabedian, Siyamak; Barkhordari, Abdullah; Habibi, Ehsanallah; Rismanchiyan, Masoud; Zare, Mohsen
2010-06-01
The aim of this study was to investigate the effects of occupational exposure to 1,6-hexamethylene diisocyanate (HDI) on peak flowmetry in automobile body paint shop workers in Iran. We studied a population of 43 car painters exposed to HDI at their workplaces. Peak expiratory flow was tested for one working week, from the start to the end of each shift. Air was sampled and HDI analysed in parallel, according to the OSHA 42 method. Daily and weekly HDI exposure averages were (0.42+/-0.1) mg m(-3) and (0.13+/-0.05) mg m(-3), respectively. On painting days, 72 % of workers showed more than a 10 % variation in peak expiratory flow. Inhalation exposure exceeded the threshold limit value (TLV) ten times over. This strongly suggests that HDI affected the peak flowmetry in the studied workers.
Human Development Inequality Index and Cancer Pattern: a Global Distributive Study.
Rezaeian, Shahab; Khazaei, Salman; Khazaei, Somayeh; Mansori, Kamyar; Sanjari Moghaddam, Ali; Ayubi, Erfan
2016-01-01
This study aimed to quantify associations of the human development inequality (HDI) index with incidence, mortality, and mortality to incidence ratios for eight common cancers among different countries. In this ecological study, data about incidence and mortality rates of cancers was obtained from the Global Cancer Project for 169 countries. HDI indices for the same countries was obtained from the United Nations Development Program (UNDP) database. The concentration index was defined as the covariance between cumulative percentage of cancer indicators (incidence, mortality and mortality to incidence ratio) and the cumulative percentage of economic indicators (country economic rank). Results indicated that incidences of cancers of liver, cervix and esophagus were mainly concentrated in countries with a low HDI index while cancers of lung, breast, colorectum, prostate and stomach were concentrated mainly in countries with a high HDI index. The same pattern was observed for mortality from cancer except for prostate cancer that was more concentrated in countries with a low HDI index. Higher MIRs for all cancers were more concentrated in countries with a low HDI index. It was concluded that patterns of cancer occurrence correlate with care disparities at the country level.
Directory of Open Access Journals (Sweden)
Gabriel Porto Soares
Full Text Available Abstract Background: Diseases of the circulatory system (DCS are the major cause of death in Brazil and worldwide. Objective: To correlate the compensated and adjusted mortality rates due to DCS in the Rio de Janeiro State municipalities between 1979 and 2010 with the Human Development Index (HDI from 1970 onwards. Methods: Population and death data were obtained in DATASUS/MS database. Mortality rates due to ischemic heart diseases (IHD, cerebrovascular diseases (CBVD and DCS adjusted by using the direct method and compensated for ill-defined causes. The HDI data were obtained at the Brazilian Institute of Applied Research in Economics. The mortality rates and HDI values were correlated by estimating Pearson linear coefficients. The correlation coefficients between the mortality rates of census years 1991, 2000 and 2010 and HDI data of census years 1970, 1980 and 1991 were calculated with discrepancy of two demographic censuses. The linear regression coefficients were estimated with disease as the dependent variable and HDI as the independent variable. Results: In recent decades, there was a reduction in mortality due to DCS in all Rio de Janeiro State municipalities, mainly because of the decline in mortality due to CBVD, which was preceded by an elevation in HDI. There was a strong correlation between the socioeconomic indicator and mortality rates. Conclusion: The HDI progression showed a strong correlation with the decline in mortality due to DCS, signaling to the relevance of improvements in life conditions.
Soares, Gabriel Porto; Klein, Carlos Henrique; Silva, Nelson Albuquerque de Souza e; de Oliveira, Glaucia Maria Moraes
2016-01-01
Background Diseases of the circulatory system (DCS) are the major cause of death in Brazil and worldwide. Objective To correlate the compensated and adjusted mortality rates due to DCS in the Rio de Janeiro State municipalities between 1979 and 2010 with the Human Development Index (HDI) from 1970 onwards. Methods Population and death data were obtained in DATASUS/MS database. Mortality rates due to ischemic heart diseases (IHD), cerebrovascular diseases (CBVD) and DCS adjusted by using the direct method and compensated for ill-defined causes. The HDI data were obtained at the Brazilian Institute of Applied Research in Economics. The mortality rates and HDI values were correlated by estimating Pearson linear coefficients. The correlation coefficients between the mortality rates of census years 1991, 2000 and 2010 and HDI data of census years 1970, 1980 and 1991 were calculated with discrepancy of two demographic censuses. The linear regression coefficients were estimated with disease as the dependent variable and HDI as the independent variable. Results In recent decades, there was a reduction in mortality due to DCS in all Rio de Janeiro State municipalities, mainly because of the decline in mortality due to CBVD, which was preceded by an elevation in HDI. There was a strong correlation between the socioeconomic indicator and mortality rates. Conclusion The HDI progression showed a strong correlation with the decline in mortality due to DCS, signaling to the relevance of improvements in life conditions. PMID:27849263
Energy Technology Data Exchange (ETDEWEB)
Sun, Da-Lei [Department of Chemical Engineering and Light Industry, Guangdong University of Technology, Guangzhou 510006 (China); College of Chemistry and Chemical Engineering, State Key Laboratory of Chemo/Biosensing and Chemometrics, Hunan University, Changsha 410082 (China); Luo, Jun-Yin; Wen, Ru-Yu [Department of Chemical Engineering and Light Industry, Guangdong University of Technology, Guangzhou 510006 (China); Deng, Jian-Ru [College of Chemistry and Chemical Engineering, State Key Laboratory of Chemo/Biosensing and Chemometrics, Hunan University, Changsha 410082 (China); Chao, Zi-Sheng, E-mail: zschao@yahoo.com [College of Chemistry and Chemical Engineering, State Key Laboratory of Chemo/Biosensing and Chemometrics, Hunan University, Changsha 410082 (China)
2014-02-15
Highlights: • Synthesis of HDI via HDU decomposition over ZnAlPO{sub 4} heterogeneous catalyst. • Employment of self-designed reliable fixed bed reactor for HDU decomposition to HDI. • As high as 89.4% yield of HDI over ZnAlPO{sub 4} catalyst. • High stability and large ability for repeating usage of ZnAlPO{sub 4} catalyst. -- Abstract: The phosgene-free synthesis of hexamethylene-1,6-diisocyanate (HDI) by the decomposition of dimethylhexane-1,6-dicarbamate (HDU) was carried out on a self-designed fixed-bed catalytic reactor, using zinc-incorporated berlinite (ZnAlPO{sub 4}) as catalyst, dioctyl phthalate (DOP) as solvent and N{sub 2} as carrier gas. Factors influencing the yield of HDI, including the Zn/Al molar ratio, HDU concentration and liquid space velocity (LHSV), were investigated. Under the optimized reaction conditions, i.e., 4.8 wt.% concentration of HDU in DOP, 100 ml/min N{sub 2} flow rate, 0.09 MPa vacuum, 623 K reaction temperature, 1.2 h{sup −1} LHSV and catalyst usage 2.0 g, a 89.4% yield of HDI had been achieved over the ZnAlPO{sub 4} (molar ratio Zn/Al = 0.04) catalyst. The ZnAlPO{sub 4} catalyst was found to exhibit a considerable large on-stream stability and could be repeatedly used in the decomposition of HDU to HDI, after its regeneration.
Global Prostate Cancer Incidence and Mortality Rates According to the Human Development Index.
Khazaei, Salman; Rezaeian, Shahab; Ayubi, Erfan; Gholamaliee, Behzad; Pishkuhi, Mahin Ahmadi; Khazaei, Somayeh; Mansori, Kamyar; Nematollahi, Shahrzad; Sani, Mohadeseh; Hanis, Shiva Mansouri
2016-01-01
Prostate cancer (PC) is one of the leading causes of death, especially in developed countries. The human development index (HDI) and its dimensions seem correlated with incidence and mortality rates of PC. This study aimed to assess the association of the specific components of HDI (life expectancy at birth, education, gross national income per 1000 capita, health, and living standards) with burden indicators of PC worldwide. Information of the incidence and mortality rates of PC was obtained from the GLOBOCAN cancer project in year 2012 and data about the HDI 2013 were obtained from the World Bank database. The correlation between incidence, mortality rates, and the HDI parameters were assessed using STATA software. A significant inequality of PC incidence rates was observed according to concentration indexes=0.25 with 95% CI (0.22, 0.34) and a negative mortality concentration index of -0.04 with 95% CI (-0.09, 0.01) was observed. A positive significant correlation was detected between the incidence rates of PC and the HDI and its dimensions including life expectancy at birth, education, income, urbanization level and obesity. However, there was a negative significant correlation between the standardized mortality rates and the life expectancy, income and HDI.
Incidence and mortality of kidney cancers, and human development index in Asia; a matter of concern.
Arabsalmani, Masoumeh; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Hadadian, Fatemeh; Towhidi, Farhad; Vafaee, Kamran; Salehiniya, Hamid
2017-01-01
The incidence and mortality of kidney cancer have steadily increased by 2%- 3% per decade worldwide, and an increased risk of kidney cancer has been observed in many Asian countries. The information on the incidence and mortality of a disease and its distribution is essential for better planning for prevention and further studies. This study aimed to assess the incidence and mortality of kidney cancer and their correlation with the human development index (HDI) in Asia. This ecological study was based on GLOBOCAN data Asia for assessment the correlation between age-specific incidence rate (ASIR) and age-specific mortality rate (ASMR) with HDI and its details that include life expectancy at birth, mean years of schooling and gross national income (GNI) per capita. We use of correlation bivariate method for assessment the correlation between ASIR and ASMR with HDI and its components. A total of 121 099 kidney cancer cases were recorded in Asian countries in 2012.Overall, 80 080 cases (66.12%) were males. Sex ratio was 1.95. The three countries with the highest number of new patients were china (66 466 cases), Japan (16 830 cases), India(9658 cases), respectively. Positive correlation were seen between HDI and ASIR of kidney cancer 0.655 ( P = 0.001), and HDI and ASMR of kidney cancer 0.285 ( P = 0.055). A positive relationship between ASIR and the HDI was seen. The relationship is due to risk factors in countries with high development such as older age, smoking, hypertension, obesity, and diet. However, ASMR showed no significant relationship with HDI.
Shifting the Physical Inactivity Curve Worldwide by Closing the Gender Gap.
Mielke, Grégore I; da Silva, Inacio Crochemore M; Kolbe-Alexander, Tracy L; Brown, Wendy J
2018-02-01
The aims of this study were to (i) examine gender differences in physical inactivity in countries with different levels of Human Development Index (HDI); and (ii) assess whether small changes in the prevalence of inactivity in women could achieve the World Health Organization's (WHO) global inactivity target. Data on inactivity were extracted for 142 countries for the year 2010 from the WHO Data Repository. Data for HDI were obtained for the year 2010 from the United Nations Development Program. Absolute and relative gender differences were calculated for countries according to four HDI categories. The potential effects of increasing women's activity levels on achievement of the WHO physical inactivity target were computed. Overall inactivity prevalence was higher in women (27%) than in men (20%). Women were more inactive than men in all except eight countries. Absolute gender differences [median 7.5% (range -10.1 to 33.2)] did not vary by HDI category, but there was a small negative correlation between relative gender difference in inactivity and HDI (rho -0.19; p = 0.02), which was mostly influenced by three outlier countries with low HDI. A decrease in inactivity levels of 4.8% points among women across the world would achieve the WHO target of reducing global levels of inactivity by 10%. Gender differences in the prevalence of physical inactivity were highly variable, both within and across categories of HDI. Interventions which result in small changes in inactivity prevalence in women would achieve the 2025 WHO global target for inactivity, without any change to the prevalence in men.
Hemoglobin adducts in workers exposed to 1,6-hexamethylene diisocyanate.
Flack, Sheila L; Fent, Kenneth W; Gaines, Linda G T; Thomasen, Jennifer M; Whittaker, Stephen G; Ball, Louise M; Nylander-French, Leena A
2011-05-01
We investigated the utility of 1,6-hexamethylene diamine (HDA) hemoglobin adducts as biomarkers of exposure to 1,6-hexamethylene diisocyanate (HDI) monomer. Blood samples from 15 spray painters applying HDI-containing paint were analyzed for hemoglobin HDA (HDA-Hb) and N-acetyl-1,6-hexamethylene diamine (monoacetyl-HDA-Hb) by GC-MS. HDA-Hb was detected in the majority of workers (≤1.2-37 ng/g Hb), whereas monoacetyl-HDA-Hb was detected in one worker (0.06 ng/g Hb). The stronger, positive association between HDA-Hb and cumulative HDI exposure (r(2) = 0.3, p HDA-Hb adducts. This association demonstrates the suitability of HDA-Hb adducts for further validation as a biomarker of HDI exposure.
2014-03-27
ISO Guide 34:2009 and ISO / IEC 17025 :2005) for HDI oligomers. Per the manufacturer, a single ASSETTM sampler may be used for over 8 hours which leads...hexamethylene diisocyanate (HDI). During this study, the Supelco ASSETTM EZ4-NCO Dry Sampler was compared to the Omega Specialty Instrument Company ISO ...detection (HPLC-MS); 2) do ASSETTM and ISO -CHEK® samplers collect equivalent HDI monomer and oligomer concentrations; and 3) what is the relative cost of
Directory of Open Access Journals (Sweden)
Vicente Livacic
2018-01-01
Full Text Available To determine mortality rates for oropharyngeal cancer according to the Human Development Index (HDI per district in the Metropolitan Region (RM, Santiago, Chile, between 2002 and 2014. Materials and Methods: An ecological study was carried out. The sample corresponded to individuals over 45 years, from the Metropolitan Region, with oropharyngeal cancer as cause of death, as registered in the Chilean National Institute of Statistics (INE. The HDI was classified into three categories: “medium” (8 districts, “high” (18 districts and “very high” (25 districts. The crude and adjusted mortality rates were calculated for each year and period. Results: The oropharyngeal cancer adjusted mortality rate for the chosen period was 3.98 deaths per 100,000 inhabitants. The specific mortality rate from oropharyngeal cancer in the “medium” HDI category was 4.01; in the “high” DHI category, 4.42; and in the “very high” HDI category, 3.79. Conclusion: Mortality from oropharyngeal cancer was higher in the “medium” HDI category between 2002 and 2014.
Directory of Open Access Journals (Sweden)
Amir Almasi-Hashiani
2016-12-01
Full Text Available BackgroundSeveral studies have examined the relationship between Human Development Index (HDI and various health outcomes. The aim of this study was to investigate the relationship between HDI, and infant mortality rate, mortality rate of children under one year and under 5 years, maternal mortality rate, and total fertility rate.Materials and MethodsIn this ecologic study, data on HDI, total fertility rate (TFR, maternal mortality rate (MMR, neonatal mortality rate (NMR, infant mortality rate (IMR and mortality rate in children under 5 years of age (< 5MR, were extracted from 188 countries in 2014 in the world. The data required in this study was obtained from the World Bank. Data analysis was performed using Pearson correlation in Stata version 12.0 software. ResultsIn this study, a negative significant correlation was observed between HDI and IMR (r = -0.878, P = 0.001, NMR (r = -0.870, 95% CI: -0.902, -0.828, P = 0.001, ConclusionIMR, children under one year old and under 5 years, and MMR mostly occur in developing countries. There was a correlation between HDI and its components, and the neonatal, infants, children under 5 years, maternal mortality rate and total fertility. The average annual percentage change of HDI also had a correlation with neonatal, infants, children under 5- year mortality rate, total fertility and maternal deaths.
Dugas, Lara R; Harders, Regina; Merrill, Sarah; Ebersole, Kara; Shoham, David A; Rush, Elaine C; Assah, Felix K; Forrester, Terrence; Durazo-Arvizu, Ramon A; Luke, Amy
2011-02-01
There is an assumption that people in developing countries have a higher total energy expenditure (TEE) and physical activity level (PAL) than do people in developed nations, but few objective data for this assertion exist. We conducted a meta-analysis of TEE and PAL by using data from countries that have a low or middle human development index (HDI) compared with those with a high HDI to better understand how energy-expenditure variables are associated with development status and population differences in body size. We performed a literature search for studies in which energy expenditure was measured by using doubly labeled water. Mean data on age, weight, body mass index (BMI; in kg/m(2)), TEE, and PAL were extracted, and HDI status was assessed. Pooled estimates of the mean effect by sex were obtained, and the extent to which age, weight, HDI status, and year of publication explained heterogeneity was assessed. A total of 98 studies (14 studies from low- or middle-HDI countries) that represented 183 cohorts and 4972 individuals were included. Mean (±SE) BMI was lower in countries with a low or middle HDI than in those with a high HDI for both men and women (22.7 ± 1.0 compared with 26.0 ± 0.7, respectively, in men and 24.3 ± 0.7 compared with 26.6 ± 0.4, respectively, in women). In meta-regression models, there was an inverse association of age (P developing and industrialized countries, which calls into question the role of energy expenditure in the cause of obesity at the population level.
Use of refractometry for determination of psittacine plasma protein concentration.
Cray, Carolyn; Rodriguez, Marilyn; Arheart, Kristopher L
2008-12-01
Previous studies have demonstrated both poor and good correlation of total protein concentrations in various avian species using refractometry and biuret methodologies. The purpose of the current study was to compare these 2 techniques of total protein determination using plasma samples from several psittacine species and to determine the effect of cholesterol and other solutes on refractometry results. Total protein concentration in heparinized plasma samples without visible lipemia was analyzed by refractometry and an automated biuret method on a dry reagent analyzer (Ortho 250). Cholesterol, glucose, and uric acid concentrations were measured using the same analyzer. Results were compared using Deming regression analysis, Bland-Altman bias plots, and Spearman's rank correlation. Correlation coefficients (r) for total protein results by refractometry and biuret methods were 0.49 in African grey parrots (n=28), 0.77 in Amazon parrots (20), 0.57 in cockatiels (20), 0.73 in cockatoos (36), 0.86 in conures (20), and 0.93 in macaws (38) (Prefractometry in Amazon parrots, conures, and macaws (n=25 each, PRefractometry can be used to accurately measure total protein concentration in nonlipemic plasma samples from some psittacine species. Method and species-specific reference intervals should be used in the interpretation of total protein values.
Urbanization and Socioeconomic Development in Inner Mongolia in 2000 and 2010: A GIS Analysis
Directory of Open Access Journals (Sweden)
Ganlin Huang
2017-02-01
Full Text Available Economic indicators and other indices measuring overall development describe local development trajectories differently. In this paper, we illustrated this difference and explored how urbanization is related to development by a case study in Inner Mongolia, China. We calculated the human development index (HDI and compared the temporal and spatial dynamics of the overall development (represented by the HDI and economic growth (represented by the GDP in 2000 and 2010. We conducted partial correlation analysis between the HDI and urbanization rate whilst controlling for the effects of the GDP. Our results showed that the spatial pattern of the HDI was little in 2000 and became clearer in 2010 when the western part tended to have higher values and the northeastern part tended to have lower values. The spatial trend for the GDP was obvious in 2000 as the high values clustered in the northwest and the low values clustered in the southeast but became less obvious in 2010 when high values clustered in several counties in the southwest and low values took up almost the entire northeast and some counties in the middle. Furthermore, we found that the HDI of all the city districts were significantly higher than their surrounding rural counties in both 2000 and 2010. Urbanization rates are found to be positively correlated with the HDI even when we controlled the effects of the GDP (p < 0.001. This study illustrated that the HDI and GDP told different stories on local performance in development at the county level. Translating the fast economic growth into an improvement in education and health relies on many other factors and our results seem to suggest that urbanization is one of these factors.
Tran, T D; Luchters, S; Fisher, J
2017-05-01
This study was to describe and quantify the relationships among family poverty, parents' caregiving practices, access to education and the development of children living in low- and middle-income countries (LAMIC). We conducted a secondary analysis of data collected in UNICEF's Multiple Indicator Cluster Surveys (MICS). Early childhood development was assessed in four domains: language-cognitive, physical, socio-emotional and approaches to learning. Countries were classified into three groups on the basis of the Human Development Index (HDI). Overall, data from 97 731 children aged 36 to 59 months from 35 LAMIC were included in the after analyses. The mean child development scale score was 4.93 out of a maximum score of 10 (95%CI 4.90 to 4.97) in low-HDI countries and 7.08 (95%CI 7.05 to 7.12) in high-HDI countries. Family poverty was associated with lower child development scores in all countries. The total indirect effect of family poverty on child development score via attending early childhood education, care for the child at home and use of harsh punishments at home was -0.13 SD (77.8% of the total effect) in low-HDI countries, -0.09 SD (23.8% of the total effect) in medium-HDI countries and -0.02 SD (6.9% of the total effect) in high-HDI countries. Children in the most disadvantaged position in their societies and children living in low-HDI countries are at the greatest risk of failing to reach their developmental potential. Optimizing care for child development at home is essential to reduce the adverse effects of poverty on children's early development and subsequent life. © 2016 John Wiley & Sons Ltd.
The incidence and mortality of prostate cancer and its relationship with development in Asia.
Pakzad, Reza; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Pakzad, Iraj; Salehiniya, Hamid
2015-12-01
Prostate cancer is a common cancer in men in the world. It is rapidly increasing. This study investigated the incidence and mortality of prostate cancer and the relationship with the Human Development Index (HDI) and its dimensions in Asia in 2012. The study was conducted based on data from the world data of cancer and the World Bank (including the HDI and its components). The standardized incidence and mortality rates of prostate cancer were calculated for Asian countries. The correlation between incidence, mortality rates, and the HDI and its components were assessed with the use of the correlation test, using SPSS software. There was a total of 191,054 incidences and 81,229 death were recorded in Asian countries in 2012. Among the Asian countries, the five countries with the highest standardized incidence rates of prostate cancer were Israel, Turkey, Lebanon, Singapore, and Japan, and the five countries with the highest standardized mortality rates were Turkey, Lebanon, Timor-Leste, Armenia, and the Philippines. The correlation between standardized incidence rate of prostate cancer and the HDI was 0.604 (P ≤ 0.001), with life expectancy at birth 0.529 (P = 0.002), with mean years of schooling 0.427 (P = 0.001), and with level of income per each person of the population 0.349 (P = 0.013). Also, between the standardized mortality rate and the HDI, it was 0.228 (P = 0.127). A significant and positive correlation was observed between the standardized incidence rate of prostate cancer, and the HDI and its dimensions, such as life expectancy at birth, mean years of schooling, and income level of the population per each person of population. However, there was no significant correlation between the standardized mortality rate, and the HDI and its dimensions.
Directory of Open Access Journals (Sweden)
Minoru Tomizawa
Full Text Available Hepatocyte differentiation inducer (HDI lacks both glucose and arginine, but is supplemented with galactose and ornithine, and is added together with other reagents such as apoptosis inhibitor and oncostatin M. Although human induced pluripotent stem (iPS cells initiate hepatocyte differentiation, most die within 7 days. In this study, we investigated both HDI and conventional media for their potential to improve cell survival.201B7 iPS cells were cultured in conventional media. This consisted of three cycles of 5-day culture in William's E (WE medium, followed by a 2-day culture in HDI.Expression levels of α-feto protein (AFP were higher in cells cultured in WE and in Dulbecco's Modified Eagle's Medium/Nutrient F-12 Ham (DF12. 201B7 cells expressed the highest AFP and albumin (ALB when cultured in HDI for 2 days following 7-day culture in WE. After three cycles of 5-day culture in WE followed by 2 days in HDI, 201B7 cells expressed AFP and ALB 54 ± 2.3 (average ± standard deviation and 73 ± 15.1 times higher, respectively, than those cultured in ReproFF (feeder-free condition.201B7 cells survived culture in WE for 7 days followed HDI for 2 days. After three cycles of culture under these conditions, hepatocyte differentiation was enhanced, as evidenced by increased AFP and ALB expression.
Lou, Li-Xia; Chen, Yi; Yu, Chao-Hui; Li, You-Ming; Ye, Juan
2014-10-01
HIV/AIDS is a worldwide threat to human health with mortality, prevalence, and incidence rates varying widely. We evaluated the association between the global HIV/AIDS epidemic and national socioeconomic development. We obtained global age-standardized HIV/AIDS mortality, prevalence, and incidence rates from World Health Statistics Report of the World Health Organization. The human development indexes (HDIs) of 141 countries were obtained from a Human Development Report. Countries were divided into 4 groups according to the HDI distribution. We explored the association between HIV/AIDS epidemic and HDI information using Spearman correlation analysis, regression analysis, and the Kruskal-Wallis test. HIV/AIDS mortality, prevalence, and incidence rates were inversely correlated with national HDI (r = -0.675, -0.519, and -0.398, respectively; P birth, mean years of schooling, expected years of schooling, and gross national income per capita). Low HDI countries had higher HIV/AIDS mortality, prevalence, and incidence rates than that of medium, high, and very high HDI countries. Quantile regression results indicated that HDI had a greater negative effect on the HIV/AIDS epidemic in countries with more severe HIV/AIDS epidemic. Less-developed countries are likely to have more severe HIV/AIDS epidemic. There is a need to pay more attention to HIV/AIDS control in less-developed countries, where lower socioeconomic status might have accelerated the HIV/AIDS epidemic more rapidly. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Socioeconomic status is associated with global diabetes prevalence.
Xu, Zhiye; Yu, Dan; Yin, Xueyao; Zheng, Fenping; Li, Hong
2017-07-04
The incidence of diabetes is increasing globally. We investigated the relationship between diabetes prevalence and patient socioeconomic status across multiple countries. We searched PubMed to identify population-based surveys reporting diabetes prevalence between 1990 and May 2016. Search results were filtered, and Human Development Index (HDI) values from the United Nations Development Programme were used to assess socioeconomic status for a given nation. Our analysis included 45 national surveys from 32 countries. Diabetes prevalence was positively correlated with national HDI (r = 0.421 P = 0.041) in developing countries, and negatively correlated with HDI (r = -0.442 P = 0.045) in developed countries. Diabetes prevalence trends were the same in women and men, although men were associated with increased diabetes risk in developed countries (r = 0.459 P = 0.048). Thus, diabetes prevalence rises with increasing HDI in developing countries, and this is reversed in developed countries. Ours is the first study to investigate the relationship between diabetes and socioeconomic status at global level using HDI values. These results will aid in evaluating global diabetes prevalence and risk with respect to patient socioeconomic status, and will be useful in the development of policies that help reduce disease incidence.
Khazaei, Salman; Rezaeian, Shahab; Soheylizad, Mokhtar; Khazaei, Somayeh; Biderafsh, Azam
2016-01-01
Stomach cancer (SC) is the second leading cause of cancer death with the rate of 10.4% in the world. The correlation between the incidence and mortality rates of SC and human development index (HDI) has not been globally determined. Therefore, this study aimed to determine the association between the incidence and mortality rates of SC and HDI in various regions. In this global ecological study, we used the data about the incidence and mortality rate of SC and HDI from the global cancer project and the United Nations Development Programme database, respectively. In 2012, SCs were estimated to have affected a total of 951,594 individuals (crude rate: 13.5 per 100,000 individuals) with a male/female ratio of 1.97, and caused 723,073 deaths worldwide (crude rate: 10.2 per 100,000 individuals). There was a positive correlation between the HDI and both incidence (r=0.28, countries with high and very high HDI is remarkable which should be the top priority of interventions for global health policymakers. In addition, health programs should be provided to reduce the burden of this disease in the regions with high incidence and mortality rates of SC.
Prevalence of HBsAg Among Prospective Blood Donors and ...
African Journals Online (AJOL)
Keywords: Hepatitis B, Prevalence, Liver function test, Kebbi State. .... determine Total Protein (Weichselbaum, 1946), Albumin. (Doumas et al., 1971), ... and mechanical transfers are also possible means of ..... Biuret method of serum total.
Directory of Open Access Journals (Sweden)
Dwi Susilowati
2015-01-01
Full Text Available This study was conducted with the intention of examining the causal relationship between the following variables: Human Development Index (HDI, foreign debt, poverty, and economic growth. The data used in this investigation was secondary data from 1990 to 2013 which then analyzed by applying Granger causality tests performed six times that ultimately obtained the following results: (1 there was no causal relationship between Human Development Index (HDI and Foreign Debt (AD; (2 there was a one-way causal relationship between foreign debt (AD and poverty; (3 there was a one-way causal relationship between economic growth with Foreign Debt (AD; (4 there was no causal relationship between poverty with Human Development Index (HDI; (5 there was no causal relationship between Economic Growth and Human Development Index (HDI; and (6 there was a one-way causal relationship between economic growth and poverty.
Incidence and Mortality of Testicular Cancer and Relationships with Development in Asia.
Sadeghi, Mostafa; Ghoncheh, Mahshid; Mohammadian-Hafshejani, Abdollah; Gandomani, Hamidreza Sadeghi; Rafiemanesh, Hosein; Salehiniya, Hamid
2016-01-01
Testicular cancer is one of the most common cancers among young men between ages 20-34 in countries with high or very high levels of the Human Development Index (HDI). This study investigated the incidence and mortality of prostate cancer and the relationship with the HDI and its dimensions in Asia in 2012. The study was conducted based on data from the world data of cancer and the World Bank (including the HDI and its components). Standardized incidence and mortality rates of testicular cancer were calculated for Asian countries. Correlations between incidence and/ormortality rates, and the HDI and its components were assessed with the use of the correlation test, using SPSS software. There was a total of 14902 incidences and 5832 death were recorded in Asian countries in 2012. Among the Asian countries, the five countries with the highest standardized incidence rates of testicular cancer were Israel, Georgia, Turkey, Lebanon and Kazakhstan and the five countries with the highest standardized mortality rates were Turkey, Georgia, Jordan, Cambodia and the Syrian Arab Republic. A positive correlation of 0.382 was observed between the standardized incidence rates of testicular cancer and the HDI (p=0.009). Also a negative correlation of 0.298 between the standardized mortality rate of testicular cancer and the Human Development Index was noted although this relation was statistically non-significant (p=0.052). There is a positive correlation between HDI and the standardized incidence rate of testicular cancer and negative correlation with standardized mortality rate.
Gaines, Linda G T; Fent, Kenneth W; Flack, Sheila L; Thomasen, Jennifer M; Whittaker, Stephen G; Nylander-French, Leena A
2011-01-01
Although urinary 1,6-hexamethylene diamine (HDA) is a useful biomarker of exposure to 1,6-hexamethylene diisocyanate (HDI), a large degree of unexplained intra- and inter-individual variability exists between estimated HDI exposure and urine HDA levels. We investigated the effect of individual and workplace factors on urine HDA levels using quantitative dermal and inhalation exposure data derived from a survey of automotive spray painters exposed to HDI. Painters' dermal and breathing-zone HDI-exposures were monitored over an entire workday for up to three separate workdays, spaced approximately one month apart. One urine sample was collected before the start of work with HDI-containing paints, and multiple samples were collected throughout the workday. Using mixed effects multiple linear regression modeling, coverall use resulted in significantly lower HDA levels (p = 0.12), and weekday contributed to significant variability in HDA levels (p = 0.056). We also investigated differences in urine HDA levels stratified by dichotomous and classification covariates using analysis of variance. Use of coveralls (p = 0.05), respirator type worn (p = 0.06), smoker status (p = 0.12), paint-booth type (p = 0.02), and more than one painter at the shop (p = 0.10) were all found to significantly affect urine HDA levels adjusted for creatinine concentration. Coverall use remained significant (p = 0.10), even after adjusting for respirator type. These results indicate that the variation in urine HDA level is mainly due to workplace factors and that appropriate dermal and inhalation protection is required to prevent HDI exposure.
Fear and Loathing in the Housing Market
DEFF Research Database (Denmark)
Chauvet, Marcelle; Gabriel, Stuart; Lutz, Chandler
We use Google search data to develop a broad-based and real-time index of housing distress. Unlike established indicators, this new Housing Distress Index (HDI) directly reflects sentiment revealed through search queries. Research findings indicate that the HDI provides important new insights in ...
Duong, Vanessa; Licznar, Anne; Margueron, Raphaël; Boulle, Nathalie; Busson, Muriel; Lacroix, Matthieu; Katzenellenbogen, Benita S.; Cavaillès, Vincent; Lazennec, Gwendal
2006-01-01
The proliferative action of ERα largely accounts for the carcinogenic activity of estrogens. By contrast, recent data show that ERβ displays tumor-suppressor properties, thus supporting the interest to identify compounds which could increase its activity. Here, we show that histone deacetylase inhibitors (HDI) up-regulated ERβ protein levels, whereas it decreased ERα expression. Part of this regulation took place at the mRNA level through a mechanism independent of de novo protein synthesis. In addition, we found that, in various cancer cells, the treatment with different HDI enhanced the ligand-dependent activity of ERβ more strongly than that of ERα. On the other hand, in MDA-MB231 and HeLa cells, the expression of ERs modified the transcriptional response to HDI. The use of deletion mutants of both receptors demonstrated that AF1 domain of the receptors was required. Finally, we show that ERβ expression led to a dramatic increased in the antiproliferative activity of HDI, which correlated with a modification of the transcription of genes involved in cell cycle control by HDI. Altogether, these data demonstrate that the interference of ERβ and HDAC on the control of transcription and cell proliferation constitute a promising approach for cancer therapy. PMID:16158045
Treated Neem Kernel Cake. *1A. Aruwayo, 2S.A
African Journals Online (AJOL)
The mean values for per cell volume (PCV), haemoglobin concentration ... protein, albumin, globulin, SGPT, total bilirubin and conjugated bilirubin in the .... Total proteins were estimated by the Biuret ... determined by Jaffe reaction (Sarre and.
African Journals Online (AJOL)
show a well-defined breeding season (Fitch 1970; Van Wyk. 1983). Oocyte development in ... biuret reaction method described by Mattenheimer (1971) was used to determine the total plasma protein concentration. Plasma protein fractions ...
A human development framework for CO2 reductions.
Directory of Open Access Journals (Sweden)
Luís Costa
Full Text Available Although developing countries are called to participate in CO(2 emission reduction efforts to avoid dangerous climate change, the implications of proposed reduction schemes in human development standards of developing countries remain a matter of debate. We show the existence of a positive and time-dependent correlation between the Human Development Index (HDI and per capita CO(2 emissions from fossil fuel combustion. Employing this empirical relation, extrapolating the HDI, and using three population scenarios, the cumulative CO(2 emissions necessary for developing countries to achieve particular HDI thresholds are assessed following a Development As Usual approach (DAU. If current demographic and development trends are maintained, we estimate that by 2050 around 85% of the world's population will live in countries with high HDI (above 0.8. In particular, 300 Gt of cumulative CO(2 emissions between 2000 and 2050 are estimated to be necessary for the development of 104 developing countries in the year 2000. This value represents between 20 % to 30 % of previously calculated CO(2 budgets limiting global warming to 2 °C. These constraints and results are incorporated into a CO(2 reduction framework involving four domains of climate action for individual countries. The framework reserves a fair emission path for developing countries to proceed with their development by indexing country-dependent reduction rates proportional to the HDI in order to preserve the 2 °C target after a particular development threshold is reached. For example, in each time step of five years, countries with an HDI of 0.85 would need to reduce their per capita emissions by approx. 17% and countries with an HDI of 0.9 by 33 %. Under this approach, global cumulative emissions by 2050 are estimated to range from 850 up to 1100 Gt of CO(2. These values are within the uncertainty range of emissions to limit global temperatures to 2 °C.
A human development framework for CO2 reductions.
Costa, Luís; Rybski, Diego; Kropp, Jürgen P
2011-01-01
Although developing countries are called to participate in CO(2) emission reduction efforts to avoid dangerous climate change, the implications of proposed reduction schemes in human development standards of developing countries remain a matter of debate. We show the existence of a positive and time-dependent correlation between the Human Development Index (HDI) and per capita CO(2) emissions from fossil fuel combustion. Employing this empirical relation, extrapolating the HDI, and using three population scenarios, the cumulative CO(2) emissions necessary for developing countries to achieve particular HDI thresholds are assessed following a Development As Usual approach (DAU). If current demographic and development trends are maintained, we estimate that by 2050 around 85% of the world's population will live in countries with high HDI (above 0.8). In particular, 300 Gt of cumulative CO(2) emissions between 2000 and 2050 are estimated to be necessary for the development of 104 developing countries in the year 2000. This value represents between 20 % to 30 % of previously calculated CO(2) budgets limiting global warming to 2 °C. These constraints and results are incorporated into a CO(2) reduction framework involving four domains of climate action for individual countries. The framework reserves a fair emission path for developing countries to proceed with their development by indexing country-dependent reduction rates proportional to the HDI in order to preserve the 2 °C target after a particular development threshold is reached. For example, in each time step of five years, countries with an HDI of 0.85 would need to reduce their per capita emissions by approx. 17% and countries with an HDI of 0.9 by 33 %. Under this approach, global cumulative emissions by 2050 are estimated to range from 850 up to 1100 Gt of CO(2). These values are within the uncertainty range of emissions to limit global temperatures to 2 °C. © 2011 Costa et al.
A Human Development Index by Income Groups
M. Grimm (Michael); K. Harttgen (Kenneth); S. Klasen (Stephan); M. Misselhorn (Mark)
2006-01-01
textabstractAbstract One of the most frequent critiques of the HDI is that is does not take into account inequality within countries in its three dimensions. We suggest a relatively easy and intuitive approach which allows to compute the three components and the overall HDI for quintiles of the
Rafiemanesh, Hosein; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Sepehri, Zahra; Shamlou, Reza; Salehiniya, Hamid; Towhidi, Farhad; Makhsosi, Behnam Reza
2016-01-01
This study aimed to investigate the standardized incidence and mortality rate of colorectal cancer and its relationship with the human development index (HDI) across the world in 2012. This ecologic study was conducted for assessment of the correlation between age-specific incidence rate (ASIR) and age-specific mortality rate (ASMR) with HDI and its components. Data for SIR and SMR for every country for the year 2012 were obtained from the global cancer project. We used a bivariate method for assessment of the correlation between SIR and SMR and HDI. Statistical significance was assumed at <0.05. Statistical analyses were performed using SPSS (Version 22.0, SPSS Inc.). Countries with the highest SIR of colorectal cancer in the world in 2012, were Republic of Korea, Slovakia, Hungary and countries with the highest SMR were Hungary, Croatia and Slovakia. The correlation between SIR of colorectal cancer and the HDI was 0.712 (P≤0.001), with life expectancy at birth 0.513 (P≤0.001), with mean years of schooling 0.641 (P≤0.001) and with level of income per each person of the population 0.514 (P=0.013). In addition, the correlation between SMR of colorectal cancer and the HDI was 0.628 (P≤0.001), with life expectancy at birth 0.469 (P≤0.001), with mean years of schooling 0.592 (P≤0.001) and with level of income per each person of the population 0.378 (P=0.013). The highest SIR and SMR of colorectal cancer was in the WHO Europe region. There was a positive correlation between HDI and SIR and SMR of colorectal cancer.
African Journals Online (AJOL)
User
Prior to the multivitamin supplementation, the baseline mean serum vitamin. A, C, and E, selenium, zinc, .... Northam, 1978), serum total protein was determined by the commercially available Biuret method kit. (Gomall, 1949), while serum lipid ...
effect of hepatitis b virus co-infection on cd4 cell count and liver
African Journals Online (AJOL)
2015-03-01
Mar 1, 2015 ... total Protein, and liver enzymes were determined using standard ... The mean serum ALT, AST and ALP of mono ... HIV positivity was diagnosed by positive reactions to ..... the colorimetric Biuret method of protein determi.
UTILIZATION OF Prosopis afiicana PULP FOR RABBIT FEEDING: 2
African Journals Online (AJOL)
IBB
The formulated diets contained similar crude protein content of 18%. The apparent ... These results indicate that Prosopis africana pulp can completely replace maize in the diets of ... serum albumin were determined by Biuret reactions. (Bush ...
[Environmental health and inequalities: building indicators for sustainable development].
Carneiro, Fernando Ferreira; Franco Netto, Guilherme; Corvalan, Carlos; de Freitas, Carlos Machado; Sales, Luiz Belino Ferreira
2012-06-01
Despite its progress in terms of socio-economic indicators, Brazil is still unequal, which is due to an unequal and exclusionary historical process. In this paper we selected the Human Development Index - HDI and other social, economic, environmental and health indicators to exemplify this situation. We selected the municipalities that had the lowest HDI in the country in 2000 comparing their evolution over time between 2000 and 2010 by means of indicators linked to the economic, environmental and social pillars of sustainable development. These municipalities have an HDI classified as low (sustainable development with quality of life, the improvement of sanitation and education indicators should be a priority for Brazil.
Haematological Indices and Blood Urea Nitrogen of Yankasa Ram ...
African Journals Online (AJOL)
reaction (Tanis and Naylor, 1968), while total proteins were estimated by Biuret method as described by. Henry and Stobel (1957). Albumin was determined by. Bromo Cresol ... means observed in the values of packed cell volume. (PCV) ...
Lack of Any Relationship of Stomach Cancer Incidence and Mortality with Development in Asia.
RaFiei, Elahe; Mohammadian-Hafshejani, Abdollah; Towhidi, Farhad; Makhsosi, Behnam Reza; Salehiniya, Hamid
2016-01-01
The aim of this study was to evaluate the incidence and mortality of stomach cancer, and its relationship with the Human Development Index (HDI) and its components in Asia in 2012. This ecological study was conducted based on GLOBOCAN project of WHO for Asian countries. We assessed the correlations between standardized incidence rates (SIR) and standardized mortality rates (SMR) of stomach cancer with HDI and its components using SPSS18. A total of 696,231 cases (68.7% in males and 31.3% in females, ratio of 2.19:1) and 524,465 deaths (67.1% in men and 33.0% in women, ratio 2.03:1) were included in 2012. Five countries with the highest SIR of stomach cancer were Republic Korea, Mongolia, Japan, China and Tajikistan. Five countries with the highest SMR of stomach cancer were Mongolia, Tajikistan, Kyrgyzstan, Kazakhstan and China. Correlation between HDI and SIR was 0.241 (p = 0.106), in men 0.236 (p = 0.114) and in women -0.250 (p = 0.094). Also between HDI and SMR -0.250 (p = 0.871) in men -0.018 (p = 0.903) and in women -0.014 (p = 0.927). No significant correlation was observed between the SIR of stomach cancer, and the HDI and its dimensions, such as life expectancy at birth, mean years of schooling, and income level of the population.
[Migrations in Latin American countries. Characteristics of the pediatric population].
Vásquez-De Kartzow, Rodrigo; Castillo-Durán, Carlos; Lera M, Lydia
2015-01-01
Migration is a growing phenomenon among Latin American countries (LAC) as well as others; however, scarce information is available studying its impact on paediatric groups and its association with socioeconomic variables. To study the association among socioeconomic variables and the immigration rate of paediatric population in LAC. Official rates of migration of LAC were obtained from: International Organization for Migration, Pan American Health Organization, and United Nations Development Programme. Demographic and socioeconomic information was also obtained for: gross domestic product (GDP), human development index (HDI), Gini coefficient of inequality (GC), alphabetization rate for adults (AA), net migration rate (NMR), and immigration of childrenChile and Argentina. No association among NMR and GDP, HDI, GC, AA was found. A correlation of IM15 was found with: GC (r=0.668, P=.01), with GDP (r=-0.720; P=.01), AA (r=-0.755; P=.01) and with HDI (r=-0.799; P=.01). Rate of IM15 was lower in LA countries with advanced/medium development (GDP>median) vs those with low development (Fisher, P<.0001). There is a direct inverse association between GDP per capita, HDI, AA and GC and the proportion of each country IN15. We did not observe an association between NMR and HDI, AA, and GC. The health impact of these migrations should be analysed. Copyright © 2015. Publicado por Elsevier España, S.L.U.
Negative and Positive Partial Mobility: A Study of the Relative Changes in Human Development
Sengupta, Atanu; Ghosh, Abhijit
2010-01-01
In this paper, we have considered the issues concerning dynamic changes in HDI and its various components from a relative standpoint. The analysis of HDI mobility should entail directional movement introduced by Fields (in Distribution and development: a new look at the developing world. MIT Press, Cambridge, 2001). However, Fields' analysis was…
ideal hepatotoxicity model in rats using carbon tetrachloride (ccl4)
African Journals Online (AJOL)
DR. AMINU
various concentrations of CCl4 had mean serum activities/ levels of AST, ... biological degenerative reaction, and may be an ... determine the dose range of the concentration of CCl4 ... total protein and albumin assessed by Biuret and BCG.
Wu, Ruidong; Long, Yongcheng; Malanson, George P; Garber, Paul A; Zhang, Shuang; Li, Diqiang; Zhao, Peng; Wang, Longzhu; Duo, Hairui
2014-01-01
By addressing several key features overlooked in previous studies, i.e. human disturbance, integration of ecosystem- and species-level conservation features, and principles of complementarity and representativeness, we present the first national-scale systematic conservation planning for China to determine the optimized spatial priorities for biodiversity conservation. We compiled a spatial database on the distributions of ecosystem- and species-level conservation features, and modeled a human disturbance index (HDI) by aggregating information using several socioeconomic proxies. We ran Marxan with two scenarios (HDI-ignored and HDI-considered) to investigate the effects of human disturbance, and explored the geographic patterns of the optimized spatial conservation priorities. Compared to when HDI was ignored, the HDI-considered scenario resulted in (1) a marked reduction (∼9%) in the total HDI score and a slight increase (∼7%) in the total area of the portfolio of priority units, (2) a significant increase (∼43%) in the total irreplaceable area and (3) more irreplaceable units being identified in almost all environmental zones and highly-disturbed provinces. Thus the inclusion of human disturbance is essential for cost-effective priority-setting. Attention should be targeted to the areas that are characterized as moderately-disturbed, conservation. We delineated 23 primary large-scale priority areas that are significant for conserving China's biodiversity, but those isolated priority units in disturbed regions are in more urgent need of conservation actions so as to prevent immediate and severe biodiversity loss. This study presents a spatially optimized national-scale portfolio of conservation priorities--effectively representing the overall biodiversity of China while minimizing conflicts with economic development. Our results offer critical insights for current conservation and strategic land-use planning in China. The approach is transferable and easy
Incidence and Mortality of Bladder Cancer and their Relationship with Development in Asia.
Pakzad, Reza; Mohammadian-Hafshejani, Abdollah; Mohammadian, Mahdi; Pakzad, Iraj; Safiri, Saeid; Khazaei, Salman; Salehiniya, Hamid
2015-01-01
Over the past decade, bladder cancer was associated with a significant increase. Given the importance of the impact of socioeconomic status on the distribution of cancer incidence and mortality, and the need to information on these parameters for prevention planning, the aim of this study was to evaluate data for bladder cancer and their relationship with human development index (HDI) and its components in Asia in 2012. The study was conducted based on data from the world data of cancer and the World Bank (including the HDI and its components). The incidence and mortality rates were drawn for Asian countries. To analyze data, correlation tests between incidence and death rates, and HDI and its components were employed with a significance level of 0.05 using SPSS software. A total incidence of 696,231 cases (68.7% in males and 31.3% in females, sex ratio of 2.19:1) and 524,465 deaths (67.0% in men and 32.9% in women, sex ratio was 2.03:1) were recorded in Asian countries in 2012. Correlation between HDI and standardized incidence rate was 0.241 overall (p=0.106), 0.236 in men (p=0.114) and -0.250 in women (p=0.094). Also between HDI and standardized mortality rate 0.025 (p=0.871) in men 0.118 (p=0.903) and in women 0.014 (p=0.927). Bladder cancer incidence is higher in developed countries, but the rate is declining, and in less developed and developing countries it is growing. There was no statistically significant correlation between the standardized incidence rate of bladder cancer and the HDI and its dimensions in Asia, except for the level of education.
African Journals Online (AJOL)
olayemitoyin
The mean serum proteins of hepatitis patients were significantly lower (P < 0.05) than those of the control and malaria while there were ... regions; and to determine the relationship between .... Kingsley, G.R. (1942) The direct Biuret method for.
Abuelgassim and Al-Showayman Afr J Tradit Complement Altern ...
African Journals Online (AJOL)
AJTCAM
C reactive protein (CRP) levels in serum were determined by the sandwich ELISA ... of diluted samples was assayed by Biuret method (Gornall et al., 1949). ... The data presented in this investigation are expressed as means ± standard error ...
Multichip module technology development
International Nuclear Information System (INIS)
Kapustinsky, J.S.; Boissevain, J.G.; Muck, R.C.; Smith, G.D.; Wong-Swanson, B.G.; Ziock, H.J.
1997-01-01
This is the final report of a one-year, Laboratory Directed Research and Development (LDRD) project at Los Alamos National Laboratory (LANL). A Multichip Module (MCM) was designed and submitted for fabrication to the Lockheed Martin foundry using a licensed process called High Density Interconnect (HDI). The HDI process uses thin film techniques to create circuit interconnect patterns on multiple layers of dielectric film which are deposited directly on top of unpackaged electronic die. This results in an optimally small package that approaches the area of the bare die themselves. This project tested the capability of the Lockheed Martin foundry to produce, in an HDI process, a complex mixed-mode (analog and digital) circuit on a single MCM substrate
African Journals Online (AJOL)
Acute toxicity was determined by LD, while serum biochemical .... ing the method of Hare, (1950), total proteins by the , , ; pl. ... method of Nosslin, (1960) and glucose by the method y !t, a, ( diff r, , , 1 \\ccm means, The .... the biuret reaction.
Antihyperglycaemic effect of aqueous extract of Daniella oliveri and ...
African Journals Online (AJOL)
JTEkanem
results indicate that the decoction of the roots of S. latifolius and D. oliveri has .... Protein Determination. Protein content of the liver tissues was determined by the Biuret method as described by Gornal et al.14 using Bovine Serum. Albumin ...
Effect of soy protein on serum lipid profile and some lipid ...
African Journals Online (AJOL)
SERVER
2007-10-04
Oct 4, 2007 ... serum collected to determine the baseline level of the test para- meters studied. ... Biuret reaction described by Gornall et al. (1949) ... Change in mean body weights (g) of rats fed soy protein and cholesterol diet. Mean body ...
Gastroprotective Effects of DAS-77 (a Phytomedicine) in Ulcer ...
African Journals Online (AJOL)
determined using the Magistreni scoring scale [8]:. 0 = no lesion; 0.5 ..... Gornall AG, Bardawill CJ, David MM. Determination of serum proteins by means of the biuret reaction. J Biol Chem 1949; 177(2): 751-766. 17. Salim AS. Removing ...
Characterization of proteic content of gelatins
Directory of Open Access Journals (Sweden)
Eliane Bayle
1995-03-01
Otherwise, results obtained in Kjeldahl and Biuret methods are proportional. In fact, the authors suggest a limit proteic concentration expressed in mg BSA/g solid gelatin : 750 mg BSA /g corresponding to the standard decided by the Codex, 14 % nitrogen minimum.
Rafiemanesh, Hosein; Mehtarpour, Mojtaba; Khani, Farah; Hesami, Sayed Mohammadali; Shamlou, Reza; Towhidi, Farhad; Salehiniya, Hamid; Makhsosi, Behnam Reza; Moini, Ali
2016-06-01
The highest incidence of lung cancer is seen in North America and the lowest incidence in central Africa. Socioeconomic factors of inequality reflect regional disparities in human development. Due to the importance of awareness about incidence and mortality of lung cancer in health programming and the possible role of the human development index (HDI), this study was done with the aim to investigate the epidemiology of lung cancer in the world and its relationship with HDI. The study was conducted based on data from the world data of cancer and the World Bank (including the HDI and its components). Data about the age-specific incidence and mortality rate (ASR) for every country in 2012 were getting from the global cancer project. To analyze data, correlation tests between incidence and death rates, and HDI and its components were employed with a significance level of 0.05 using SPSS software. Lung cancer with standardized incidence rate (ASIR) and standardized mortality rate (ASMR), equal to 23.1 and 19.7 (in 100,000 people), respectively. The highest and lowest values of mortality incidence ratio (MIR) for lung cancer due to continents division were 0.93 and 0.71 for Eastern Africa and Australia/New Zealand, respectively. Univariate analysis showed significant relationship (PASMR with life expectancy at birth and mean years of schooling. The highest MIR for lung cancer was for medium human development countries. Linear regression analysis showed a reverse significant relationship between MIR and HDI.
Costs of a healthy diet: analysis from the UK Women's Cohort Study.
Cade, J; Upmeier, H; Calvert, C; Greenwood, D
1999-12-01
To investigate the direct and indirect cost differences associated with eating a 'healthy' or 'unhealthy' diet. Analysis of data from a baseline postal questionnaire for the UK Women's Cohort Study, including a detailed food frequency questionnaire (FFQ), supplemented by a telephone interview on a sub-sample. The first 15,191 women who responded to the questionnaire, aged 35-69 years with similar numbers of meat eaters, fish eaters and vegetarians. A healthy diet indicator (hdi), with values from 0 (lowest) to 8 (highest) was developed based on the WHO dietary recommendations. Direct monetary cost of the diet was calculated using prices from the 1995 National Food Survey and the Tesco home shopping catalogue. Women in the healthy diet group were almost four times as likely to be vegetarian and have a higher educational level. For direct costs, the difference between the most extreme hdi groups was 1.48 day-1 (equivalent to 540 year-1), with fruit and vegetable expenditure being the main items making a healthy diet more expensive. Forty-nine per cent of the food budget was spent on fruit and vegetables in hdi group 8 compared to 29% in hdi group 0. Interestingly, 52% of those questioned in both extreme hdi groups did not think that it was difficult to eat healthily. To achieve a particularly healthy diet independent predictive factors were spending more money, being a vegetarian, having a higher energy intake, having a lower body mass index (BMI) and being older.
Plasma Copper Status in Hypercholesterolemic Patients
African Journals Online (AJOL)
Dr Femi Olaleye
149mg/dl). The mean values of Cu in groups 1, 2, 3 were 103.39±8.58 µg/dl, .... Plasma total protein level was determined by the Biuret method (Reinhold, ... Simple Correlation matrix between cholesterol, copper, total protein and Albumin.
Inequality in Human Development: An Empirical Assessment of 32 Countries
Grimm, Michael; Harttgen, Kenneth; Klasen, Stephan; Misselhorn, Mark; Munzi, Teresa; Smeeding, Timothy
2010-01-01
One of the most frequent critiques of the HDI is that is does not take into account inequality within countries in its three dimensions. In this paper, we apply a simply approach to compute the three components and the overall HDI for quintiles of the income distribution. This allows a comparison of the level in human development of the poor with…
The incidence and mortality of prostate cancer and its relationship with development in Asia
Directory of Open Access Journals (Sweden)
Reza Pakzad
2015-12-01
Conclusions: A significant and positive correlation was observed between the standardized incidence rate of prostate cancer, and the HDI and its dimensions, such as life expectancy at birth, mean years of schooling, and income level of the population per each person of population. However, there was no significant correlation between the standardized mortality rate, and the HDI and its dimensions.
Czech Academy of Sciences Publication Activity Database
Marková, Silvia; Searle, J. B.; Kotlík, Petr
2014-01-01
Roč. 113, č. 1 (2014), s. 64-73 ISSN 0018-067X R&D Projects: GA AV ČR IAA600450901; GA ČR GAP506/11/1872 Institutional support: RVO:67985904 Keywords : adaptation * evolution * haemoglobin Subject RIV: EG - Zoology Impact factor: 3.805, year: 2014 http://www.nature.com/hdy/journal/v113/n1/abs/hdy201412a.html
Guidelines for standard and biuretic renogram in children
International Nuclear Information System (INIS)
Gordon, I.; Piepsz, A.; Colarinha, P.; Hahn, K.; Fischer, S.; Porn, U.; Sixt, R.; Velzen, J. van
2000-01-01
The guidelines are intended to help nuclear medical teams in their daily routine. The information given relates to aspects such as data acquisition, evaluation and interpretation, and indications for pediatric renal functional scintigraphy. The guidelines have been elaborated in response to a request of EANM and the American Society of Nuclear Medicine, who expressed the need for guidelines on recommended procedures for most of the standard nuclear medical examinations. The guidelines express the opinion of the Paediatric Committee of the EANM, and should be seen in the context of generally accepted basic principles in nuclear medicine, as well as local and national regulatory standards in radiation protection. (orig./CB) [de
Directory of Open Access Journals (Sweden)
Ni Putu Ari Aryawati
2018-01-01
Full Text Available The aim of this study was to analyzes whether the fiscal balance transfer, regional allocation budget and regional financial performance directly affects the human development index and economic growth in the Regency / City throughout West Nusa Tenggara Province and indirect effect of fiscal balance transfer and regional allocation budget on human development index and economic growth with the financial performance as a mediating variable. Analysis of the data in this research used Partial Least Square (PLS analysis. The results of the analysis show that there are positive affect between fiscal balance transfer and regional allocation budget on economic growth. Regional allocation budget has negative affect to HDI. Regional allocation budget influence partial mediation on human development index and economic growth with regional financial performance as a mediating variable.The result of this study, to maximize the HDI and economic growth of West Nusa Tenggara Province should consider the amount of fiscal balance transfer, regional allocation budget and regional financial performance because the variables are proven to affect HDI and economic growth of West Nusa Tenggara Province either directly or indirectly. Keywords: HDI, Economic Growth, Regional Financial Performance
Mortality in Digestive Cancers, 2012: International Data and Data from Romania.
Valean, Simona; Acalovschi, Monica; Diculescu, Mircea; Manuc, Mircea; Goldis, Adrian; Sfarti, Catalin; Trifan, Anca
2015-12-01
We aimed to compare the difference in case fatality rate between more developed and very high Human Development Index (HDI) regions, less developed and low HDI regions, and Romania. The incidence and mortality rates for digestive cancers were obtained from the IARC/WHO 2012 database. World mean mortality-to-incidence ratios registered the highest values in pancreatic cancer (0.97/0.94), and liver cancer (0.93/0.96) in males/females, respectively. The lowest values were recorded in colorectal cancer (0.48 in both sexes). Mortality-to-incidence ratios were generally higher in less developed areas, low HDI populations, and in Romania. The difference in case fatality rate between different areas showed higher variations for colorectal, gastric and gallbladder cancers, and smaller variations for esophageal, liver, and pancreatic cancers. In summary, mortality-to-incidence ratios of digestive cancers were high in 2012; higher values were registered in less developed and low HDI regions, and in Romania. Mortality-to-incidence ratios were similar in both sexes, even though the incidence was generally higher in men. Digestive cancer mortality variation suggests the necessity of finding better strategies for prevention, early diagnosis and treatment of digestive cancers.
Kinetic Studies of Alkaline Phosphatase from the Liver of Agama ...
African Journals Online (AJOL)
group of catalytic proteins (enzymes) that have the ability to ... was determined by the method of Biuret (Gornall et al.,. 1949) using ... The result indicate that the enzyme has an optimum. pH of 9.9. ... Total protein (mg) Total activity. (x10-4).
African Journals Online (AJOL)
testicular function indices and serum hormones of male Wistar rats. Twenty male ... ng/ml, 4.2 mlu/ml, 15.5 mlu/ml, 16.8 nM/min/mg protein, 3.39 mmol/ L, 13.58 .... Determination of some reproductive hormones ..... means of biuret reaction.
Population growth, human development, and deforestation in biodiversity hotspots.
Jha, S; Bawa, K S
2006-06-01
Human population and development activities affect the rate of deforestation in biodiversity hotspots. We quantified the effect of human population growth and development on rates of deforestation and analyzed the relationship between these causal factors in the 1980s and 1990s. We compared the averages of population growth, human development index (HDI, which measures income, health, and education), and deforestation rate and computed correlations among these variables for countries that contain biodiversity hotspots. When population growth was high and HDI was low there was a high rate of deforestation, but when HDI was high, rate of deforestation was low, despite high population growth. The correlation among variables was significant for the 1990s but not for the 1980s. The relationship between population growth and HDI had a regional pattern that reflected the historical process of development. Based on the changes in HDI and deforestation rate over time, we identified two drivers of deforestation: policy choice and human-development constraints. Policy choices that disregard conservation may cause the loss of forests even in countries that are relatively developed. Lack of development in other countries, on the other hand, may increase the pressure on forests to meet the basic needs of the human population. Deforestation resulting from policy choices may be easier to fix than deforestation arising from human development constraints. To prevent deforestation in the countries that have such constraints, transfer of material and intellectual resources from developed countries may be needed. Popular interest in sustainable development in developed countries can facilitate the transfer of these resources.
The incidence and mortality of esophageal cancer and their relationship to development in Asia.
Pakzad, Reza; Mohammadian-Hafshejani, Abdollah; Khosravi, Bahman; Soltani, Shahin; Pakzad, Iraj; Mohammadian, Mahdi; Salehiniya, Hamid; Momenimovahed, Zohre
2016-01-01
Esophageal cancer is the most common cancer in less developed countries. It is necessary to understand epidemiology of the cancer for planning. The aim of this study was to evaluate the incidence and mortality of esophageal cancer, and its relationship with Human Development Index (HDI) and its components in Asia in 2012. This study was an Ecological study, which conducted based on GLOBOCAN project of WHO for Asian counters. We assess the correlation between standardized incidence rates (SIR) and standardized mortality rates (SMR) of esophageal cancer with HDI and its components with using of SPSS18. A total of 337,698 incidence (70.33% were males and 29.87% females. Sex ratio was 2.37) and 296,734 death (69.45% in men and 30.54% in women. The sex ratio was 2.27) esophageal cancer was recorded in Asian countries in 2012. Five countries with the highest SIR and SMR of esophageal cancer were Turkmenistan, Mongolia and Tajikistan, Bangladesh and China respectively. Correlation between HDI and SIR was -0.211 (P=0.159), in men -0.175 (P=0.244) and in women -0.231 (P=0.123). Also between HDI and SMR -0.250 (P=0.094) in men -0.226 (P=0.131) and in women -0.251 (P=0.037). The incidence of esophageal cancer is more in less developed and developing countries. Statistically significant correlation was not found between standardized incidence and mortality rates of esophageal cancer, and HDI and its dimensions, except for life expectancy at birth.
Directory of Open Access Journals (Sweden)
Selay Giray
2014-12-01
Full Text Available Human Development Index (HDI is an index aiming to measure human development by taking into account a long and healthy life, access to knowledge and a decent standard of living. The 2013 Human Development Report presents HDI values and ranks, the Inequality-adjusted HDI the Gender Inequality Index (GII and the Multidimensional Poverty Index. The aim of this study is to evaluate countries according to their similarities and differences using the indicators contained in the 2013 human development report. A figure created in two dimensional space was used by evaluation. Locations of Turkey, OECD and Eurasian countries are analyzed and interpreted elaborately. Multidimensional scaling is a statistical technique provides visual representation of the objects using proximity patterns. The most recent data of countries were analyzed by Multidimensional Scaling analysis (MDS. Stress value obtained from metric multidimensional scaling application was found in desired range. Also it was determined that we can trust the interpretations made of the map. To begin with, comparison by country groups was made, then remarkable points were interpreted on the basis of country. As examination of the map obtained from MDS application with HDI and GII indexes, it was remarked that OECD countries were grouped on the left hand side and Eurasian countries were grouped on the right hand side. Turkey, a member of OECD, located far away from other OECD countries and located closer to Eurasian countries. According to HDI and GII indexes Mexico is closest country to Turkey. Also Mexico is the country, which is perceived similar to Turkey.
Human development, poverty, health & nutrition situation in India.
Antony, G M; Laxmaiah, A
2008-08-01
Human development index (HDI) is extensively used to measure the standard of living of a country. India made a study progress in the HDI value. Extreme poverty is concentrated in rural areas of northern States while income growth has been dynamic in southern States and urban areas. This study was undertaken to assess the trends in HDI, human poverty index (HPI) and incidence of poverty among Indian states, the socio-economic, health, and diet and nutritional indicators which determine the HDI, changes in protein and calorie adequacy status of rural population, and also trends in malnutrition among children in India. The variations in socio-economic, demographic and dietary indicators by grades of HDI were studied. The trends in poverty and nutrition were also studied. Univariate, bivariate and multivariate analysis were done to analyse data. While India's HDI value has improved over a time; our rank did not improve much compared to other developing countries. Human poverty has not reduced considerably as per the HPI values. The undernutrition among preschool children is still a major public health problem in India. The incidence of poverty at different levels of calorie requirement has not reduced in both rural and urban areas. The time trends in nutritional status of pre-school children showed that, even though, there is an improvement in stunting over the years, the trend in wasting and underweight has not improved much. Proper nutrition and health awareness are important to tackle the health hazards of developmental transition. Despite several national nutrition programmes in operation, we could not make a significant dent in the area of health and nutrition. The changing dietary practices of the urban population, especially the middle class, are of concern. Further studies are needed to measure the human development and poverty situation of different sections of the population in India using an index, which includes both income indicators and non income
MANAGEMENT AND OUTCOMES FROM APPENDECTOMY: AN INTERNATIONAL, PROSPECTIVE, MULTICENTRE STUDY.
Camilleri-Brennan, J; Drake, T; Spence, R; Bhangu, A; Harrison, E
2017-09-01
To identify variation in surgical management and outcomes of appendicitis across low, middle and high Human Development Index (HDI) country groups. Multi-centre, international prospective cohort study of consecutive patients undergoing emergency appendectomy over a 6-month period. Follow-up lasted 30 days. Primary outcome measure was overall complication rate. 4546 patients from 52 countries underwent appendectomy (2499 high, 1540 middle and 507 low HDI groups). Complications were more frequent in low-HDI (OR 3.81, 95% CI 2.78 to 5.19, p accounting for case-mix, laparoscopy was still associated with fewer complications (OR 0.55, 95% CI 0.42 to 0.71, pintroduction of laparoscopy that if overcome, could result in significantly improved outcomes for patients in low-resource environments, with potential for wider health-system benefits.
BKR 26(3) pp. 76-84 (Adeyanju)
African Journals Online (AJOL)
Femi Olorunniji
2014-09-30
Sep 30, 2014 ... protein source had been established by various researchers. [(Stafford & Tacon, 1988 ... rhodanese enzyme is defined as the amount of enzyme which produces an optical ... levels of purification were determined by Biuret method. (Gornall et al., 1949) using bovine serum albumin as standard. Enzyme ...
Resonance – Journal of Science Education | Indian Academy of ...
Indian Academy of Sciences (India)
https://www.ias.ac.in/article/fulltext/reso/009/11/0072-0085. Keywords. Six sigma; biuret. Lowry; protein estimation; runs test. Author Affiliations. V Sitaramam1 V Krishnabrahmam2. Department of Biotechnology University of Pune Pune 411007, India. Swatsam Softech Pvt. Ltd., Vanasthalipuram, Hyderabad 500 070, India.
ANALYSIS OF HUMAN DEVELOPMENT IN IRAN: EDUCATION, EMPLOYMENT AND GENDER IN A COMPARATIVE PERSPECTIVE
Vahdatian, Parisa
2018-01-01
This paper addresses existing gender parities and gapsin Iran, Turkey and Azerbaijan in terms of human development. Human developmentby enlarging people’s freedoms and potentials draws the attention to “ends” andinsists on intrinsic significance of development. The main components of humandevelopment are: capabilities, free agency and achievements. Health, educationand economic resources are essential indicators of Human Development Index(HDI) which share the same ratio in HDI value estimatio...
Allareddy, Veerasathpurush; Allareddy, Veeratrishul; Rampa, Sankeerth; Nalliah, Romesh P; Elangovan, Satheesh
2015-09-01
The objective of this study is to examine the associations between country level factors (such as human development, economic productivity, and political stability) and their dental research productivity. This study is a cross-sectional analysis of bibliometric data from Scopus search engine. Human Development Index (HDI), Gross National Income per capita (GNI), and Failed State Index measures were the independent variables. Outcomes were "Total number of publications (articles or articles in press) in the field of dentistry" and "Total number of publications in the field of dentistry per million population." Non-parametric tests were used to examine the association between the independent and outcome variables. During the year 2013, a total of 11,952 dental research articles were published across the world. The top 5 publishing countries were United States, Brazil, India, Japan, and United Kingdom. "Very High" HDI countries had significantly higher number of total dental research articles and dental research articles per million population when compared to the "High HDI," "Medium HDI," and "Low HDI" countries (p < 0.0001). There was a significant linear relationship between the GNI quartile income levels and outcome metrics (p ≤ 0.007). Countries which were highly politically stable were associated with significantly higher dental research productivity (p < 0.0001). There appears to be a regional concentration of articles with just five countries contributing to over 50% of all articles. The human development and economic development of a country are linearly correlated with dental research productivity. Dental research productivity also increases with increasing political stability of a country. Copyright © 2015 Elsevier Inc. All rights reserved.
Giebel, Sebastian; Labopin, Myriam; Ibatici, Adalberto; Browne, Paul; Czerw, Tomasz; Socie, Gerard; Unal, Ali; Kyrcz-Krzemien, Slawomira; Bacigalupo, Andrea; Goker, Hakan; Potter, Mike; Furness, Caroline L; McQuaker, Grant; Beelen, Dietrich; Milpied, Noel; Campos, Antonio; Craddock, Charles; Nagler, Arnon; Mohty, Mohamad
2016-03-01
From a global perspective, the rates of allogeneic hematopoietic cell transplantation (alloHCT) are closely related to the economic status of a country. However, a potential association with outcome has not yet been documented. The goal of this study was to evaluate effects of health care expenditure (HCE), Human Development Index (HDI), team density, and center experience on nonrelapse mortality (NRM) after HLA-matched sibling alloHCT for adults with acute lymphoblastic leukemia (ALL). A total of 983 patients treated with myeloablative alloHCT between 2004 and 2008 in 24 European countries were included. In a univariate analysis, the probability of day 100 NRM was increased for countries with lower current HCE (8% vs. 3%; p = .06), countries with lower HDI (8% vs. 3%; p = .02), and centers with less experience (8% vs. 5%; p = .04). In addition, the overall NRM was increased for countries with lower current HCE (21% vs. 17%; p = .09) and HDI (21% vs. 16%; p = .03) and for centers with lower activity (21% vs. 16%; p = .07). In a multivariate analysis, the strongest predictive model for day 100 NRM included current HCE greater than the median (hazard ratio [HR], 0.39; p = .002). The overall NRM was mostly predicted by HDI greater than the median (HR, 0.65; p = .01). Both lower current HCE and HDI were associated with decreased probability of overall survival. Both macroeconomic factors and the socioeconomic status of a country strongly influence NRM after alloHCT for adults with ALL. Our findings should be considered when clinical studies in the field of alloHCT are interpreted. ©AlphaMed Press.
Hearing Impairment and High Blood Pressure among Bus Drivers in Puducherry.
Balaji, Rajeshwar; Rajasegaran, Rajalakshmi; John, Nitin Ashok; Venkatappa, Umadevi Sajja
2016-02-01
Noise Induced Hearing Loss (NIHL), a major heath concern due to constant exposure to loud noise is on the rising trend in today's world. The bus drivers are more vulnerable to the auditory and non-auditory ill effects of noise pollution. The aim of this study was to assess and compare the hearing level, blood pressure and peak expiratory flow rate of bus drivers and individuals employed in office jobs. Fifty male bus drivers aged 30-50 years and fifty males of the same group employed in office jobs were recruited as the test and control groups respectively. The hearing level of the individuals in both the groups was assessed using the Hearing Deterioration Index (HDI). The lung function and cardiovascular status of the study participants were assessed by measuring their Peak Expiratory Flow Rate (PEFR) and Blood Pressure (BP) respectively. The mean HDI, PEFR and BP values of both the groups were compared using the unpaired t-test and the extent of correlation between HDI, service years, exposure level, systolic blood pressure (SBP) and diastolic blood pressure (DBP) was determined using Pearson correlation coefficient test. HDI, SBP and DBP were significantly higher among the bus drivers when compared to the controls. However, there was no significant difference in the PEFR values between the test and the control groups. There was a highly significant positive correlation between HDI and service years and exposure level. Similarly, there was a significant positive correlation between exposure level and systolic and diastolic blood pressure. Prolonged exposure to high intensity of sound results in deterioration of hearing capacity and increase in blood pressure among the bus drivers.
Trends of teenage pregnancy in Brazil, 2000-2011.
Vaz, Raquel Ferreira; Monteiro, Denise Leite Maia; Rodrigues, Nádia Cristina Pinheiro
2016-07-01
To evaluate the frequency of teenage pregnancy in Brazil, from 2000 to 2011, in all five Brazilian macroregions and age groups (10-14 and 15-19 years), correlating it with the human development index (HDI). Descriptive epidemiological study, with cross-sectional design, performed by searching the database of the National Health System (Datasus), using information from the Information System (Sinasc). There was a decrease in the percentage of live births (LB) from teenage mothers (10-19 years) in Brazil (23.5 % in 2000 to 19.2 % in 2011). This reduction was observed in all Brazilian macroregions in the group of mothers aged 15 to 19 years. The number of LB increased by 5.0% among mothers aged 10-14 years (increase in the North and Northeast and decline in the other macroregions). The proportion of LB shows an inversely proportional trend to HDI score, with the Southeast having the highest HDI and the lowest proportion of LB to teenage mothers in the country. Brazil shows a decline in the percentage of LB to adolescent mothers, tending to be inversely related to HDI score. It is important to empower strategies to address the problem, so that teenage pregnancy is seen as a personal decision rather than the result of a lack of policies targeting adolescent health.
Impact of human development on safety consciousness in construction.
Baradan, Selim; Dikmen, Seyyit Umit; Akboga Kale, Ozge
2018-05-03
The International Labour Organization (ILO) reports that the risk of fatal occupational injuries in developing countries is almost twice as high as in developed countries, indicating a potential relationship between the fatality rates and the development level. The human development index (HDI), based on life expectancy, knowledge level and purchasing power parity, endorsed by the United Nations Development Programme, is a widely accepted measure of the development level. This study investigates the relationship between the HDI and the fatality rates reported by the ILO. A 23-country data set is used to demonstrate the general trend of the relationship followed by country-specific analyses for Australia, Spain, Hungary and Turkey. The study conducted is limited to fatal occupational injuries in construction, where the accidents are notoriously high. The results demonstrate a statistically significant inverse relationship between the fatality rates and the HDI.
Razi, Saeid; Ghoncheh, Mahshid; Mohammadian-Hafshejani, Abdollah; Aziznejhad, Hojjat; Mohammadian, Mahdi; Salehiniya, Hamid
2016-01-01
Background The incidence and mortality estimates of ovarian cancer based on human development are essential for planning by policy makers. This study is aimed at investigating the standardised incidence rates (SIR) and standardised mortality rates (SMR) of ovarian cancer and their relationship with the Human Development Index (HDI) in Asian countries. Methods This study was an ecologic study in Asia for assessment of the correlation between SIR, age standardised rates (ASR), and HDI and their...
MorOgoro, Tanzania ! / ". . . "
African Journals Online (AJOL)
DPP perio.d suggesting probably an inflammatory reaction within the body 7he ... Success in' commercial dairy farming determine whether blood metabolite .... ~j milk~ng.feeding .and cleaning kinetic);· Total prot~in by Biuret: Albu~in bv ... between total protein and albumi~: ~d inorganic ..... in sm~lholder~arms,in Morogor~.
International Journal of Health Research
African Journals Online (AJOL)
Erah
2008-09-19
Sep 19, 2008 ... Methods: The levels of serum glutamate oxaloacetate transminase (SGOT) ... protein, total and direct bilirubin were evaluated in .... The estimation of SGOT and SGPT was based on the ... In this method, the serum was mixed with Biuret reagent and incubated ... (mean and sd) were used in presentation of.
Spectrophotometric determination of proteins associated with ...
African Journals Online (AJOL)
Twenty six Aeromonas isolates from fishes, poultry and humans in Zaria were quantified for total soluble proteins (enzymes) profiles in January, 2007 by spectrophotometric (Biuret) method. Isolates were grown on Brain Heart Infusion (BHI) broth, they were incubated at 370C and centrifuged at 1,000 g/dl using harous ...
Biosynthesis and Characterization of Glucose Syrup Derived from ...
African Journals Online (AJOL)
In order to characterize the prepared glucose syrups, Fehling test, Biuret test, glucose concentration (GC), dextrose equivalent (DE), relative density (RD), pH, viscosity and surface tension (ST) were determined. Granular size range of 7 – 15 μm and moisture content of 12 % were determined for the untreated starch sample.
Hassanipour-Azgomi, S.; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Towhidi, Farhad; Jamehshorani, Saeid; Salehiniya, Hamid
2016-01-01
Background: The aim of this study was to evaluate the incidence and mortality of prostate cancer and their relationship with the Human Development Index (HDI) and its components in Asia in 2012. Methods: This study was an ecological study conducted based on the GLOBOCAN project of the World Health Organization. The correlation between standardized incidence rate (SIR) and standardized mortality rate (SMR) of prostate cancer with HDI and its components was assessed using SPSS Inc Version 18...
Decker, Michele R; Kalamar, Amanda; Tunçalp, Özge; Hindin, Michelle J
2017-03-01
Reducing unwanted adolescent childbearing is a global priority. Little is known about how national-level economic and human development indicators relate to early adolescent childbearing. This ecological study evaluates associations of Gross Domestic Product (GDP), GINI index, Human Development Index (HDI) and Gender-related Development Index (GDI; i.e. the HDI adjusted for gender disparities) with early adolescent childbearing in 27 low- and middle-income countries (LMICs) across three time periods. Among women ages 18–24, prevalence estimates for early birth (development adjusted for gender disparities in educational and economic prospects, was more consistently related to early adolescent childbearing than the absolute development prospects as given by the HDI. While creating gender equality is an important goal in and of itself, the findings emphasize the potential for improved national-level gender equitable development as a means to improve adolescents’ sexual and reproductive health.
Directory of Open Access Journals (Sweden)
Guimond Eric
2007-12-01
Full Text Available Abstract Background Canada, the United States, Australia, and New Zealand consistently place near the top of the United Nations Development Programme's Human Development Index (HDI rankings, yet all have minority Indigenous populations with much poorer health and social conditions than non-Indigenous peoples. It is unclear just how the socioeconomic and health status of Indigenous peoples in these countries has changed in recent decades, and it remains generally unknown whether the overall conditions of Indigenous peoples are improving and whether the gaps between Indigenous peoples and other citizens have indeed narrowed. There is unsettling evidence that they may not have. It was the purpose of this study to determine how these gaps have narrowed or widened during the decade 1990 to 2000. Methods Census data and life expectancy estimates from government sources were used to adapt the Human Development Index (HDI to examine how the broad social, economic, and health status of Indigenous populations in these countries have changed since 1990. Three indices – life expectancy, educational attainment, and income – were combined into a single HDI measure. Results Between 1990 and 2000, the HDI scores of Indigenous peoples in North America and New Zealand improved at a faster rate than the general populations, closing the gap in human development. In Australia, the HDI scores of Indigenous peoples decreased while the general populations improved, widening the gap in human development. While these countries are considered to have high human development according to the UNDP, the Indigenous populations that reside within them have only medium levels of human development. Conclusion The inconsistent progress in the health and well-being of Indigenous populations over time, and relative to non-Indigenous populations, points to the need for further efforts to improve the social, economic, and physical health of Indigenous peoples.
Epidemiology and Inequality in the Incidence and Mortality of Nasopharynx Cancer in Asia.
Mahdavifar, Neda; Ghoncheh, Mahshid; Mohammadian-Hafshejani, Abdollah; Khosravi, Bahman; Salehiniya, Hamid
2016-12-01
One of the most common head and neck cancers is nasopharynx cancer. Knowledge about the incidence and mortality of this disease and its distribution in terms of geographical areas is necessary for further study and better planning. Therefore, this study was conducted with the aim of determining the incidence and mortality rates of nasopharynx cancer and its relationship with the Human Development Index (HDI) in Asia in 2012. The aim of this ecologic study was to assess the correlation between age-specific incidence rate (ASIR) and age-specific mortality rate (ASMR) with HDI and its components, which include the following: life expectancy at birth, mean years of schooling, and gross national income per capita. Data about SIR and SMR for every Asian country for 2012 were obtained from the global cancer project. We used the correlation bivariate method for the assessment. Statistical significance was assumed if p ASMR were Indonesia, Vietnam, Singapore, Malaysia, and Brunei. The correlation between HDI and ASIR was 0.097 ( p = 0.520) [0.105 in men ( p = 0.488) and 0.119 in women ( p = 0.901)]. The correlation between HDI and ASMR was -0.102 ( p = 0.502) [-0.072 in men ( p = 0.633) and -0.224 in women ( p = 0.134)]. Nasopharynx cancer is native to Southeast Asia. The highest incidence and mortality rates are found in Malaysia, Singapore, Indonesia, Vietnam, and Brunei. No significant relation was found between the standardized incidence and mortality rates of nasopharynx cancer and the HDI components. Further studies are recommended in Southeast Asian countries in order to find the etiology of cancer, as well as its diagnosis and treatment.
DETERMINAN KUALITAS PEMBANGUNAN MANUSIA DI KABUPATEN/KOTA PROVINSI JAWA TENGAH
Directory of Open Access Journals (Sweden)
Agung Yudhi Pramono
2017-06-01
Full Text Available Penelitian ini bertujuan untuk menganalisis seberapa besar pengaruh pengeluaran pemerintah daerah sektor pendidikan, pengeluaran pemerintah daerah sektor kesehatan, rasio ketergantungan penduduk dan pendapatan perkapita terhadap pembangunan manusia yang diukur dengan IPM. Populasi penelitian terdiri dari 35 Kabupaten/Kota di Provinsi Jawa Tengah, menggunakan data sekunder dari Badan Pusat Statistik Provinsi Jawa Tengah dan Biro Keuangan Sekretaris Daerah Provinsi Jawa Tengah dalam periode 2009 sampai 2013. Variabel penelitian ini indeks pembangunan manusia, pengeluran pemerintah daerah sektor pendidikan, pengeluaran pemerintah daerah sektor kesehatan, rasio ketergantungan penduduk, dan pendapatan perkapita. Dalam penelitian ini, digunakan metode penelitian kuantitatif dengan menggunakan analisis regresi data panel model efek tetap (FEM dengan metode Generalized Least Square (GLS. Hasil penelitian ini dapat diketahui bahwa pengeluaran pemerintah daerah sektor pendidikan berpengaruh positif dan signifikan terhadap IPM, pengeluaran pemerintah daerah sektor kesehatan berpengaruh positif dan signifikan terhadap IPM, rasio ketergantungan penduduk berpengaruh negatif dan signifikan terhadap IPM, sementara pendapatan perkapita tidak berpengaruh secara signifikan terhadap IPM. This research has purpose to analyze how much influence of the local government expenditure in educational sector, local government expenditure in health sector, dependency ratio, and per capita income of a human development measured by HDI. the population of this research consists of 35 regionals in Central Java and region bureau money secretary of Central Java province among 2009 and 2013 period. the variables used in this research are HDI, local government expenditure in educational sector, local government expenditure in health sector, dependency ratio, and per capita income. in this research, quantitative and regression analysis of Fixed Effect Model is used as well as
Cooke, Martin; Mitrou, Francis; Lawrence, David; Guimond, Eric; Beavon, Dan
2007-12-20
Canada, the United States, Australia, and New Zealand consistently place near the top of the United Nations Development Programme's Human Development Index (HDI) rankings, yet all have minority Indigenous populations with much poorer health and social conditions than non-Indigenous peoples. It is unclear just how the socioeconomic and health status of Indigenous peoples in these countries has changed in recent decades, and it remains generally unknown whether the overall conditions of Indigenous peoples are improving and whether the gaps between Indigenous peoples and other citizens have indeed narrowed. There is unsettling evidence that they may not have. It was the purpose of this study to determine how these gaps have narrowed or widened during the decade 1990 to 2000. Census data and life expectancy estimates from government sources were used to adapt the Human Development Index (HDI) to examine how the broad social, economic, and health status of Indigenous populations in these countries have changed since 1990. Three indices - life expectancy, educational attainment, and income - were combined into a single HDI measure. Between 1990 and 2000, the HDI scores of Indigenous peoples in North America and New Zealand improved at a faster rate than the general populations, closing the gap in human development. In Australia, the HDI scores of Indigenous peoples decreased while the general populations improved, widening the gap in human development. While these countries are considered to have high human development according to the UNDP, the Indigenous populations that reside within them have only medium levels of human development. The inconsistent progress in the health and well-being of Indigenous populations over time, and relative to non-Indigenous populations, points to the need for further efforts to improve the social, economic, and physical health of Indigenous peoples.
Spatiotemporal Analysis of AIDS Incidence Among Adults in Brazil.
da Silva Lizzi, Elisangela Aparecida; Nunes, Altacilio Aparecido; Martinez, Edson Zangiacomi
2016-01-01
AIDS is the fourth leading cause of death worldwide and, currently, the overall prevalence rate of HIV infection in Brazil is 0.5% among men and 0.3% among women. To evaluate the spatiotemporal trend of AIDS in Brazil from 2006 to 2012 and its relationship with human development index (HDI) and their components income, education and life expectancy. This ecological study evaluate the spatiotemporal trend of standardized incidence ratio of AIDS among adults in Brazil from 2006 to 2012 and its relationship with HDI by using a Bayesian analysis, considering the Brazilian Federal Units as units of analysis. The proposed statistical model allows obtaining a standardized incidence ratio (SIR, adjusted by gender and age). Among the men, our results show higher incidence rates in the States of the Southern regions as well as in the state of Amazonas (Northern Brazil). In females, we found other patterns for SIR, with higher incidence rates in the states of Rio de Janeiro (Southeast region), Rio Grande do Sul and Santa Catarina (both in Southern region). Among men it was observed as an expressive association between the SIR values and the overall HDI and income and education components, but it was observed to have an inverse association with the life expectancy component. Among women, it is noted that the SIR values are associated with the overall HDI and the education components only at the beginning of the studied period. AIDS remains a major public health problem in Brazil, mainly in the southern and southeastern regions of the country. Considering its association with HDI, it is noted that the disease still remains related to the pattern observed in the early years of the studied period, at least in the more developed regions of Brazil. This certainly happened because of the chronicity of the disease, thus affecting people with good socioeconomic status.
Inhalation exposure to isocyanates of car body repair shop workers and industrial spray painters.
Pronk, Anjoeka; Tielemans, Erik; Skarping, Gunnar; Bobeldijk, Ivana; VAN Hemmen, Joop; Heederik, Dick; Preller, Liesbeth
2006-01-01
As part of a large-scale epidemiological study, occupational isocyanate exposure was assessed in spray-painting environments. The aim was to assess which compounds contribute to isocyanate exposure in car body repair shops and industrial painting companies, and to identify tasks with high risk of isocyanate exposure. Mainly personal task-based samples (n = 566) were collected from 24 car body repair shops and five industrial painting companies using impingers with DBA in toluene. Samples were analysed by LC-MS for isocyanate monomers, oligomers and products of thermal degradation. From the 23 analysed compounds, 20 were detected. Exploratory factor analysis resulted in a HDI, TDI and MDI factor with the thermal degradation products divided over the TDI and MDI factors. The HDI factor mainly consisted of HDI oligomers and was dominant in frequency and exposure levels in both industries. Spray painting of PU lacquers resulted in the highest exposures for the HDI factor (car body repair shops than in industrial painting companies. Exposure levels were low (car body repair shops (
Directory of Open Access Journals (Sweden)
Gavin Walker
2012-10-01
Full Text Available In this study three chemical agents Amino-propyl-triethoxy-silane (APS, sorbitol ended PLA oligomer (SPLA and Hexamethylene diisocyanate (HDI were identified to be used as coupling agents to react with the phosphate glass fibre (PGF reinforcement and the polylactic acid (PLA polymer matrix of the composite. Composites were prepared with short chopped strand fibres (l = 20 mm, ϕ = 20 µm in a random arrangement within PLA matrix. Improved, initial composite flexural strength (~20 MPa was observed for APS treated fibres, which was suggested to be due to enhanced bonding between the fibres and polymer matrix. Both APS and HDI treated fibres were suggested to be covalently linked with the PLA matrix. The hydrophobicity induced by these coupling agents (HDI, APS helped to resist hydrolysis of the interface and thus retained their mechanical properties for an extended period of time as compared to non-treated control. Approximately 70% of initial strength and 65% of initial modulus was retained by HDI treated fibre composites in contrast to the control, where only ~50% of strength and modulus was retained after 28 days of immersion in PBS at 37 °C. All coupling agent treated and control composites demonstrated good cytocompatibility which was comparable to the tissue culture polystyrene (TCP control, supporting the use of these materials as coupling agent’s within medical implant devices.
Management of pegylated interferon alpha toxicity in adjuvant therapy of melanoma.
Daud, Adil; Soon, Christopher; Dummer, Reinhard; Eggermont, Alexander M M; Hwu, Wen-Jen; Grob, Jean Jacques; Garbe, Claus; Hauschild, Axel
2012-08-01
Both native IFNα2b and pegylated IFNα2b (PegIFNα2b) are approved for the adjuvant treatment of high-risk melanoma. This review compares the toxicity profiles of high-dose IFNα2b (HDI) and PegIFNα2b, and provides recommendations on the management of common PegIFNα2b-related toxicities, based on available clinical data and published literature. The toxicity profile of PegIFNα2b at the approved dose (6 μg/kg/week for 8 weeks then 3 μg/kg/week for up to 5 years) is qualitatively similar to HDI in melanoma. The most common adverse events (AEs) are fatigue, anorexia, hepatotoxicity, flu-like symptoms, injection site reactions and depression. However, fatigue and flu-like symptoms appear less severe with PegIFNα2b, and toxicity seems to occur earlier, whereas with HDI toxicity may increase with time. Most AEs can be managed effectively by dose modification and aggressive symptom control. Dosing to tolerance using a three-step dose reduction schedule to maintain an ECOG performance status of 0 - 1 may enable patients experiencing toxicity to remain on treatment; this can be applied readily in clinical practice. PegIFNα2b is therefore a valuable alternative option for adjuvant treatment in melanoma, with a toxicity profile similar to that of HDI overall but a more convenient administration schedule.
Human development and South East Asian countries: Special emphasis on India
Sharma, Kalpa
2013-01-01
?Development? is to improve the quality of people's lives by creating an environment for them to engage in a wide range of activities, to be healthy and well nourished, to be knowledgeable and to be able to participate in the community life. The Human Development Index (HDI) is a multi-dimensional index of development as it is the combination of three development indices- health index, education index and income index. This article attempts to compare the HDI and its components between variou...
The incidence and mortality of prostate cancer and its relationship with development in Asia
Pakzad, Reza; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Pakzad, Iraj; Salehiniya, Hamid
2015-01-01
Purpose Prostate cancer is a common cancer in men in the world. It is rapidly increasing. This study investigated the incidence and mortality of prostate cancer and the relationship with the Human Development Index (HDI) and its dimensions in Asia in 2012. Methods The study was conducted based on data from the world data of cancer and the World Bank (including the HDI and its components). The standardized incidence and mortality rates of prostate cancer were calculated for Asian countries. Th...
International Nuclear Information System (INIS)
Kaul, A.K.; Niemann, E.G.
1975-01-01
Rapid screening methods for biuret nitrogen determination and fluorometric lysine estimation are described. While the biuret method has been found to be suitable for early generation screening for peptide nitrogen determination, fluorescence estimation of dansylated grain meal could be taken as a good index of available lysine in cereal and legume samples. The necessity of rapid and inexpensive tests for the determination of Relative Nutritive Value (RNV) in the advance generations of screening, is discussed. Preliminary data available on two such tests, utilizing protozoan Tetrahymena pyriformis W. and flour beetle Tribolium confusum Duval, indicated promise. Both techniques were tried on different cereal and legume samples. The relative lethality of beetle larvae and their nitrogen retention were taken as indices of RNV in legumes. Larval Nitrogen Retention Index (LNRI) of cereal samples was found to be dependent both on nitrogen content and on protein quality. It was concluded that both these organisms need to be further investigated for their potential as test animals for RNV determination in the advance segregating populations. (author)
Human Development Index: A Non-Compensatory Assessment
Directory of Open Access Journals (Sweden)
Gutiérrez Ester
2009-10-01
Full Text Available El Índice de Desarrollo Humano es un indicador sintético basado en tres dimensiones esenciales: longevidad,
educación y nivel de vida. En este trabajo se adopta una perspectiva no-compensatoria que considera que la
privación de cualquiera de estas dimensiones básicas no puede ser suplida por los logros en otra. Según este
punto de vista, se propone utilizar el mínimo de los componentes, en lugar de la media aritmética. En el
documento se presentan los resultados de esta nueva evaluación para los últimos cinco años del índice HDI.
Este nuevo indicador (NCHDI, a pesar de estar correlacionado con el HDI, proporciona una ordenación
diferente de los países, nuevos conocimientos sobre los desequilibrios presentes en el HDI, y puede ser
utilizado a nivel nacional y local.
Measuring socio-economic inequality: From dwellers' perspective within Bangalore urban agglomeration
Directory of Open Access Journals (Sweden)
Keya Chakraborty
2015-06-01
Full Text Available Planners and researchers have realized that larger regional framework of urban areas are significant in assessing various inequality aspects in a developing country like India. The framework consists of heterogeneity in spatial and demographic aspects and in quality of socio-economic development levels as well. Against this background, the present paper has proposed a methodological framework to assess socio-economic inequality within Bangalore Urban Agglomeration (BUA as governed by the composite set of Human Development Index (HDI based indicators. Assessments are based on local data of dwellers' preferences on the indicators. On the whole, this paper has tried to establish the significance of application of HDI based indicators in an assessment of socio-economic inequality within BUA. Consequently, the paper has arrived at the need for improvement of comprehensive HDI governed basic public services, amenities, and advanced facilities, across all trans-urban-area levels to ensure a holistic development within BUA.
Khazaei, Salman; Armanmehr, Vajihe; Nematollahi, Shahrzad; Rezaeian, Shahab; Khazaei, Somayeh
2017-06-01
There has been no worldwide ecological study on suicide as a global major public health problem. This study aimed to identify the variations in suicide specific rates using the Human Development Index (HDI) and some health related variables among countries around the world. In this ecological study, we obtained the data from the World Bank Report 2013. The analysis was restricted to 91 countries for which both the epidemiologic data from the suicide rates and HDI were available. Overall, the global prevalence of suicide rate was 10.5 (95% confidence intervals: 8.8, 12.2) per 100,000 individuals, which significantly varied according to gender (16.3 in males vs. 4.6 in females, pgender and HDI components are associated with an increased risk of suicide behaviors. Hence, detecting population subgroups with a high suicide risk and reducing the inequality of socioeconomic determinants are necessary to prevent this disorder around the world. Copyright © 2017 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.
dichlorophenoxyacetic acid by bacteria species isolated from ...
African Journals Online (AJOL)
SERVER
2007-06-18
Jun 18, 2007 ... released/mg protein)-1 h-1] in actively growing cell cultures ranged from 0.010 – 0.055 (SERU 2) and .... concentration of the extracts was estimated by the Biuret method. (Gornall et al., 1949) using bovine serum albumin as the standard ... free culture extract of the isolates against 2,4-D were determined by.
Evaluation of the protective efficacy of immunoglobulin Y (IgY ...
African Journals Online (AJOL)
user
2012-09-06
Sep 6, 2012 ... IgY, which is transferred from serum to the yolk for ... The lethal potencies of the venom (LD50) were determined by i.p. injection of Swiss outbreed mice ... The protein concentration was measured by Biuret method and the. IgY-preparation ... Mean log10 antibody titer of the IgY- extracted by. Ammonium.
African Journals Online (AJOL)
USER
2016-01-23
Jan 23, 2016 ... findings indicate high oxidant activity on the fish, explaining the enormity of the impact of cigarette butt leachates in ... 6.93cm ± 0.01, mean total length: 8.57 cm. ± 0.02) were used in ... Estimation of Protein concentration was determined using Biuret method. (Gornall, 1949), LPO an index of MDA levels was ...
Directory of Open Access Journals (Sweden)
Dimas A. M. Zaia
1998-11-01
Full Text Available Spectrophotometric determination of total protein is used in several areas such as clinical analysis, food science and technology, biochemistry, protein chemistry, physiology. Five spectrophotometric methods are mostly used: biuret, Lowry, Bradford, Smith and UV absorption. In this review a general overview of these methods is presented (interferences, applications; other methodologies are also discussed.
Keskklassi meistrivõistlused / Wolfgang König, Dirk Branke
König, Wolfgang
2012-01-01
Suur test. Mõõtu võtavad 15 pereautot: Audi A4 2.0 TDI, BMW 318d, Mercedes-Benz C 200 CDI, Škoda Superb 2.0 TDI, VW Passat 2.0 TDI, Citroën C5 HDi 140, Hyundai i40 1.7 CRDi, Ford Mondeo 2.0 TDCi, Kia Optima 1.7 CRDi, Mazda 6 2.2 MZR-CD, Opel Insignia 2.0 CDTI, Renault Laguna dCi 150, Peugeot 508 HDi 140, Volvo S60 D3, Seat Exeo 2.0 TDI
Provincial human development index, a guide for efficiency level analysis: the case of iran.
Sabermahani, Asma; Barouni, Mohsen; Seyedin, Hesam; Aryankhesal, Aidin
2013-01-01
Human Development Index (HDI) is a composite indicator that can show the impact of economic strategies on human life standards. The index is calculated by three main factors of income, education and health. This research studies the status of HDI across the Iranian provinces, its changes over time and the efficiency of provinces in using resources. The data for 2001 and 2009 was obtained from the Iranian Center of Statistics. Data envelopment analysis technique was used to analyze the data. To calculate the efficiency, Banker, Charnes and Cooper's model was used. The national mean for the HDI in 2001 was 0.717 while it grew to 0.747 in 2009. Except for one province, all others had an improved human development index. Low ranked provinces such as Sistan & Baluchistan and Kurdistan stayed at the bottom in 2009 as well. Some provinces such as Bushehr with developing oil industries, or those purposively benefited from national oil income showed good growth. In some provinces, such as Hormozgan, out-migration of manpower to its neighboring province, Bushehr, was associated with decrease of the provincial income level. The number of efficient provinces increased from 5 to 13 in 2009. Iran falls among countries with high human development index based on the 2009 data. However, the distribution of HDI status across provinces was highly varied and the difference between high- and low-developed provinces increased in 2009. The government needs to revise policies concerning distribution of resources among the provinces.
Human Development Index and Efficiency level of Social Security Hospitals
Directory of Open Access Journals (Sweden)
H. Sepehrdost
2012-04-01
Full Text Available Introduction & Objective: Hospitals as one of the main institutions providing health care services play an important role in the health system and allocate a high percentage of health sector's budget to them. This study aimed to answer whether social security hospitals efficiency levels are the same for all provinces in Iran? And whether any relationship exists between the human development indexes (HDI of the provinces and technical efficiency levels of the hospitals?Materials & Methods: Data envelopment analysis model has been used to measure technical efficiency of 65 social security hospitals, including small hospitals (working with lower than one hundred active beds and large hospitals (working with over one hundred active beds during the years 2007 to 2009. Further, the relationship between human development index and technical efficiency of hospitals in the provinces has been analyzed.Results: Results show that the average technical efficiency of small and large hospitals working in low and medium HDI provinces (0.912 and 0.937 are more than the average technical efficiency of hospitals in higher HDI provinces (0.870 and 0.887.Conclusion: It is recommended that social security organization concentrated distribute its hospital services in provinces with lower HDI and higher density of population living under the coverage of organization’s insurance. This will eventually puts its positive effects on per capita income of people, as well as more equitable distribution of income. (Sci J Hamadan Univ Med Sci 2012;19(1:32-38
. اﻟﺤﻤﺎم اﻷهﻠﻲ ؛ اﻟﻔﺘﺮة اﻟﻀﻮﺋﻴﺔ ؛ اﻟﺘﻴﺮوآﺴﻴﻦ ؛ ﺗﻜﺎﺛﺮ : ا
African Journals Online (AJOL)
Prélèvement sanguin par ponction de la veine brachiale. Pesée. Prélèvement sanguin par ponction de la veine brachiale. -Taille des gonades. -Poids des gonades ..... glucose in blood, using glucose oxydase with an alternative oxygen acceptor. Cli. Biochimy., Vol. 6, 1969, p.24. [23] N. Biuret, R.J. Henry, D.C. Cannon,.
Incidence of public expenditure on the human development index in Bogota, 1995-2010
Directory of Open Access Journals (Sweden)
Mónica Consuelo Rodríguez Torres
2012-01-01
Full Text Available This paper seeks to test the hypothesis that social public expenditure per capita invested in Bogota has had a significant influence on the improvement of the city’s human development. For this purpose, the Human Development Index (HDI for the capital between 1995-2010 is estimated, using the new methodology proposed by the UNDP in 2010. Thus, a retrospective estimation of the life expectancy, salaries, and educational achievement rates is carried out, the last as a combination between the average years of education and expected years of instruction. A qualitative analysis is then presented, between the HDI components and the social public expenditure invested through politics, programs, projects carried out in the city, according to the District Development Plan “Bogotá positiva, para vivir mejor (Positive Bogota, to Live Better”. Finally, a quantitative analysis of this relation is made and it is concluded that social public spending per capita is significant to explain the HDI, since there is a long-term and stable relation between the two variables.
Liu, Yan; Arai, Asuna; Kanda, Koji; Lee, Romeo B; Glasser, Jay; Tamashiro, Hiko
2013-08-01
Life expectancy (LE) is a major marker of individual survival. It also serves as a guide to highlight both the progress and the gaps in total social and societal health. Comparative LE in concert with measures of gender-specific experience, indices of empowerment and societal happiness and development offer a comparative tool to examine trends and similarities of societal progress as seen through the lens of cross-national experience. To determine the gender gaps in LE (GGLE) trends, we performed a longitudinal analysis, covering a period of 49 years (1960-2008). To examine the association of GGLE with development indices, we used the 2007 GGLE data, the newest happiness data mostly drawn from 2006; the 2006 Human Development Index (HDI) data and the 2006 Gender Empowerment Measure (GEM) data. It revealed that most of the Organization for Economic Co-operation and Development (OECD) countries had a GGLE trend that occurred in an inverted U-curve fashion. We divided them into three subgroups based on the peak years of respective GGLE. The earlier the peak year, the happier the countries, the higher the HDI and the smaller the current GGLE are. Association analysis indicates that Happiness, HDI and GEM are all negatively associated with GGLE. This pattern suggests that GGLE undergoes three phases of growth, peak and stability and decline. Japan will soon be seeing its GGLE gradually shrinking in the foreseeable future. The continuing increases in Happiness, HDI and GEM are associated with a decrease in GGLE, which should be carefully taken into consideration.
Energy Technology Data Exchange (ETDEWEB)
Meyer, M., E-mail: mathias.meyer@medma.uni-heidelberg.de [Institute of Clinical Radiology and Nuclear Medicine, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); Klein, S.A., E-mail: stefan.klein@umm.de [Department of Hematology and Oncology, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); Brix, G., E-mail: gbrix@bfs.de [Department of Medical and Occupational Radiation Protection, Federal Office for Radiation Protection, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Fink, C., E-mail: Christian.Fink@medma.uni-heidelberg.de [Institute of Clinical Radiology and Nuclear Medicine, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); Pilz, L., E-mail: lothar.pilz@medma.uni-heidelberg.de [Department of Biostatistics, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); Jafarov, H., E-mail: Hashim.Jafarov@umm.de [Institute of Clinical Radiology and Nuclear Medicine, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); Hofmann, W.K., E-mail: w.k.hofmann@umm.de [Department of Hematology and Oncology, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); Schoenberg, S.O., E-mail: Stefan.Schoenberg@umm.de [Institute of Clinical Radiology and Nuclear Medicine, University Medical Center Mannheim, Medical Faculty Mannheim, Heidelberg University, Theodor-Kutzer-Ufer 1-3, D-68167 Mannheim (Germany); and others
2014-02-15
Objectives: Patients with lymphoma are at higher-risk of secondary malignancies mainly due to effects of cancer therapy as well as frequent radiological surveillance. We thus aimed to investigate the objective and subjective image quality as well as radiation exposure and risk of full-dose standard (FDS), full-dose iterative (FDI), and half-dose iterative (HDI) image reconstruction in patients with lymphoma. Material and methods: In 100 lymphoma patients, contrast-enhanced whole-body staging was performed on a dual-source CT. To acquire full-dose and half-dose CT data simultaneously, the total current-time product was equally distributed on both tubes operating at 120 kV. HDI reconstructions were calculated by using only data from one tube. Quantitative image quality was assessed by measuring image noise in different tissues of the neck, thorax, and abdomen. Overall diagnostic image quality was assessed using a 5-point Likert scale. Radiation doses and risks were estimated for a male and female reference person. Results: For all anatomical regions apart from the lungs image noise was significantly lower and the overall subjective image quality significantly better when using FDI and HDI instead of FDS reconstruction (p < 0.05). For the half-dose protocol, the risk to develop a radiation-induced cancer was estimated to be less than 0.11/0.19% for an adult male/female. Conclusions: Image quality of FDI and more importantly of HDI is superior to FDS reconstruction, thus enabling to halve radiation dose and risk to lymphoma patients.
Boutry, Céline; Delplace, Brigitte; Clippe, André; Fontaine, Laetitia; Hols, Pascal
2013-02-01
Streptococcus includes species that either contain or lack the LexA-like repressor (HdiR) of the classical SOS response. In Streptococcus pneumoniae, a species which belongs to the latter group, SOS response inducers (e.g., mitomycin C [Mc] and fluoroquinolones) were shown to induce natural transformation, leading to the hypothesis that DNA damage-induced competence could contribute to genomic plasticity and stress resistance. Using reporter strains and microarray experiments, we investigated the impact of the SOS response inducers mitomycin C and norfloxacin and the role of HdiR on competence development in Streptococcus thermophilus. We show that both the addition of SOS response inducers and HdiR inactivation have a dual effect, i.e., induction of the expression of SOS genes and reduction of transformability. Reduction of transformability results from two different mechanisms, since HdiR inactivation has no major effect on the expression of competence (com) genes, while mitomycin C downregulates the expression of early and late com genes in a dose-dependent manner. The downregulation of com genes by mitomycin C was shown to take place at the level of the activation of the ComRS signaling system by an unknown mechanism. Conversely, we show that a ComX-deficient strain is more resistant to mitomycin C and norfloxacin in a viability plate assay, which indicates that competence development negatively affects the resistance of S. thermophilus to DNA-damaging agents. Altogether, our results strongly suggest that SOS response activation and competence development are antagonistic processes in S. thermophilus.
Analysis of Factors That Affects the Investors in Conducting Business in Indonesia
Directory of Open Access Journals (Sweden)
Rini Kurnia Sari
2015-10-01
Full Text Available Investment is needed in the development of the economy. With the decentralization of investment is expected to evolve as a whole in every province in Indonesia. Local governments need to improve the quality of economic (GDP / Capita, social (HDI and the infrastructure to attract domestic and foreign investors. Fromthe test results showed that factors affecting investors conducting business in Indonesia is still influenced by GDP/capita, HDI and Infrastructure instead of natural resources.This study uses descriptive analysis and correlation analysis methods to look at the correlation factors that affect investors doing business in Indonesia.
Mahdavifar, Neda; Ghoncheh, Mahshid; Pakzad, Reza; Momenimovahed, Zohre; Salehiniya, Hamid
2016-01-01
Bladder cancer is an international public health problem. It is the ninth most common cancer and the fourteenth leading cause of death due to cancer worldwide. Given aging populations, the incidence of this cancer is rising. Information on the incidence and mortality of the disease, and their relationship with level of economic development is essential for better planning. The aim of the study was to investigate bladder cancer incidence and mortality rates, and their relationship with the the Human Development Index (HDI) in the world. Data were obtained from incidence and mortality rates presented by GLOBOCAN in 2012. Data on HDI and its components were extracted from the global bank site. The number and standardized incidence and mortality rates were reported by regions and the distribution of the disease were drawn in the world. For data analysis, the relationship between incidence and death rates, and HDI and its components was measured using correlation coefficients and SPSS software. The level of significance was set at 0.05. In 2012, 429,793 bladder cancer cases and 165,084 bladder death cases occurred in the world. Five countries that had the highest age-standardized incidence were Belgium 17.5 per 100,000, Lebanon 16.6/100,000, Malta 15.8/100,000, Turkey 15.2/100,000, and Denmark 14.4/100,000. Five countries that had the highest age-standardized death rates were Turkey 6.6 per 100,000, Egypt 6.5/100,000, Iraq 6.3/100,000, Lebanon 6.3/100,000, and Mali 5.2/100,000. There was a positive linear relationship between the standardized incidence rate and HDI (r=0.653, Pincidence rate with life expectancy at birth, average years of schooling, and the level of income per person of population. A positive linear relationship was also noted between the standardized mortality rate and HDI (r=0.308, Pincidence of bladder cancer in developed countries and parts of Africa was higher, while the highest mortality rate was observed in the countries of North Africa and the
Jankovic, Nicole; Geelen, Anouk; Streppel, Martinette T; de Groot, Lisette C P G M; Orfanos, Philippos; van den Hooven, Edith H; Pikhart, Hynek; Boffetta, Paolo; Trichopoulou, Antonia; Bobak, Martin; Bueno-de-Mesquita, H B; Kee, Frank; Franco, Oscar H; Park, Yikyung; Hallmans, Göran; Tjønneland, Anne; May, Anne M; Pajak, Andrzej; Malyutina, Sofia; Kubinova, Růžena; Amiano, Pilar; Kampman, Ellen; Feskens, Edith J
2014-11-15
The World Health Organization (WHO) has formulated guidelines for a healthy diet to prevent chronic diseases and postpone death worldwide. Our objective was to investigate the association between the WHO guidelines, measured using the Healthy Diet Indicator (HDI), and all-cause mortality in elderly men and women from Europe and the United States. We analyzed data from 396,391 participants (42% women) in 11 prospective cohort studies who were 60 years of age or older at enrollment (in 1988-2005). HDI scores were based on 6 nutrients and 1 food group and ranged from 0 (least healthy diet) to 70 (healthiest diet). Adjusted cohort-specific hazard ratios were derived by using Cox proportional hazards regression and subsequently pooled using random-effects meta-analysis. During 4,497,957 person-years of follow-up, 84,978 deaths occurred. Median HDI scores ranged from 40 to 54 points across cohorts. For a 10-point increase in HDI score (representing adherence to an additional WHO guideline), the pooled adjusted hazard ratios were 0.90 (95% confidence interval (CI): 0.87, 0.93) for men and women combined, 0.89 (95% CI: 0.85, 0.92) for men, and 0.90 (95% CI: 0.85, 0.95) for women. These estimates translate to an increased life expectancy of 2 years at the age of 60 years. Greater adherence to the WHO guidelines is associated with greater longevity in elderly men and women in Europe and the United States. © The Author 2014. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Diet quality and adherence to a healthy diet in Japanese male workers with untreated hypertension.
Kanauchi, Masao; Kanauchi, Kimiko
2015-07-10
As Japanese societies rapidly undergo westernisation, the prevalence of hypertension is increasing. We investigated the association between dietary quality and the prevalence of untreated hypertension in Japanese male workers. We conducted a cross-sectional study of 433 male workers who completed a brief food frequency questionnaire. Adherence to the WHO-based Healthy Diet Indicator (HDI), the American Heart Association 2006 Diet and Lifestyle Recommendations, the Dietary Approaches to Stop Hypertension (DASH) diet, and Mediterranean-style diet was assessed using four adherence indexes (HDI score, AI-84 score, DASH score and MED score). Hypertension classes were classified into three categories: non-hypertension, untreated hypertension and treated hypertension (ie, taking antihypertensive medication). The prevalence of untreated hypertension and treated hypertension was 22.4% and 8.5%, respectively. Patients with untreated hypertension had significantly lower HDI and AI-84 scores compared with non-hypertension. DASH and MED scores across the three hypertension classes were comparable. After adjusting for age, energy intake, smoking habit, alcohol drinking, physical activity and salt intake, a low adherence to HDI and a lowest quartile of AI-84 score were associated with a significantly higher prevalence of untreated hypertension, with an OR of 3.33 (95% CI 1.39 to 7.94, p=0.007) and 2.23 (1.09 to 4.53, p=0.027), respectively. A lower dietary quality was associated with increased prevalence of untreated hypertension in Japanese male workers. Our findings support a potential beneficial impact of nutritional assessment using diet qualities. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Studies on the quality nutrition in women with polycystic ovary syndrome (PCOS)
Szczuko, Małgorzata; Sankowska, Patrycja; Zapałowska-Chwyć, Marta; Wysokiński, Paweł
Polycystic ovary syndrome (PCOS) manifests itself with various symptoms, therefore it interests representatives of many medical specializations: general practitioners, gynecologists, endocrinologists, dermatologists, cardiologists and those who deal with metabolic disorders, such as dieticians. The aim of this study was perform the qualitative assessment of components of diets of women with PCOS as one of the major factor contributing to the disease. The study was performed on 54 women of childbearing age with PCOS diagnosed according to on the Rotterdam criteria. Qualitative assessment of the diets on the basis of 216 menus was performed based on the analysis of 3-day food diaries and food records taken from the last 24-hour dietary interview. Diets quality assessment was made using three types of point tests: Szewczyński’s Diets’ classification (SDC), Bielińska’s Test with Kulesza’s modification (BTK), Healthy Diet Indicator (HDI). Average waist-hip ratio (WHR) and body mass index (BMI) was above the standard 0.91± 0.08 and 29.16 ± 5.8 kg/m2. Qualitative analysis performed with point tests SDC, BT-K and HDI revealed that the majority of the diets were composed inappropriately, containing many mistakes. Statistically significant correlations (Pearson’s) were determined between HDI test and the body weight and BMI. When analyzing the type of the meals also the correlations (Spearman’s) between BMI and BMI category in BT-K test. Mistakes in diets of women with PCOS are the cause of metabolic disorders related to improper function of ovaries. Native test BT-K seems to be a better method then test SDC and probably HDI of assessing diet in women with PCOS from Poland.
Directory of Open Access Journals (Sweden)
Diewertje Sluik
Full Text Available The differential associations of beer, wine, and spirit consumption on cardiovascular risk found in observational studies may be confounded by diet. We described and compared dietary intake and diet quality according to alcoholic beverage preference in European elderly.From the Consortium on Health and Ageing: Network of Cohorts in Europe and the United States (CHANCES, seven European cohorts were included, i.e. four sub-cohorts from EPIC-Elderly, the SENECA Study, the Zutphen Elderly Study, and the Rotterdam Study. Harmonized data of 29,423 elderly participants from 14 European countries were analyzed. Baseline data on consumption of beer, wine, and spirits, and dietary intake were collected with questionnaires. Diet quality was assessed using the Healthy Diet Indicator (HDI. Intakes and scores across categories of alcoholic beverage preference (beer, wine, spirit, no preference, non-consumers were adjusted for age, sex, socio-economic status, self-reported prevalent diseases, and lifestyle factors. Cohort-specific mean intakes and scores were calculated as well as weighted means combining all cohorts.In 5 of 7 cohorts, persons with a wine preference formed the largest group. After multivariate adjustment, persons with a wine preference tended to have a higher HDI score and intake of healthy foods in most cohorts, but differences were small. The weighted estimates of all cohorts combined revealed that non-consumers had the highest fruit and vegetable intake, followed by wine consumers. Non-consumers and persons with no specific preference had a higher HDI score, spirit consumers the lowest. However, overall diet quality as measured by HDI did not differ greatly across alcoholic beverage preference categories.This study using harmonized data from ~30,000 elderly from 14 European countries showed that, after multivariate adjustment, dietary habits and diet quality did not differ greatly according to alcoholic beverage preference.
Inequality in Maternal Mortality in Iran: An Ecologic Study
Tajik, Parvin; Nedjat, Saharnaz; Afshar, Nozhat Emami; Changizi, Nasrin; Yazdizadeh, Bahareh; Azemikhah, Arash; Aamrolalaei, Sima; Majdzadeh, Reza
2012-01-01
Background: Maternal mortality (MM) is an avoidable death and there is national, international and political commitment to reduce it. The objective of this study is to examine the relation of MM to socioeconomic factors and its inequality in Iran's provinces at an ecologic level. Methods: The overall MM from each province was considered for 3 years from 2004 to 2006. The five independent variables whose relations were studied included the literacy rate among men and women in each province, mean annual household income per capita, Gini coefficients in each province, and Human Development Index (HDI). The correlation of Maternal Mortality Ratio (MMR) to the above five variables was evaluated through Pearson's correlation coefficient (simple and weighted for each province's population) and linear regression – by considering MMR as the dependent variable and the Gini coefficient, HDI, and difference in literacy rate among men and women as the independent variables. Results: The mean MMR in the years 2004–2006 was 24.7 in 100,000 live births. The correlation coefficients between MMR and literacy rate among women, literacy rate among men, the mean annual household income per capita, Gini coefficient and HDI were 0.82, 0.90, –0.61, 0.52 and –0.77, respectively. Based on multivariate regression, MMR was significantly associated with HDI (standardized B=–0.93) and difference in literacy rate among men and women (standardized B=–0.47). However, MMR was not significantly associated with the Gini coefficient. Conclusion: This study shows the association between socioeconomic variables and their inequalities with MMR in Iran's provinces at an ecologic level. In addition to the other direct interventions performed to reduce MM, it seems essential to especially focus on more distal factors influencing MMR. PMID:22347608
Singh, Gopal K; Azuine, Romuladus E; Siahpush, Mohammad
2012-01-01
This study examined global inequalities in cervical cancer incidence and mortality rates as a function of cross-national variations in the Human Development Index (HDI), socioeconomic factors, Gender Inequality Index (GII), and healthcare expenditure. Age-adjusted incidence and mortality rates were calculated for women in 184 countries using the 2008 GLOBOCAN database, and incidence and mortality trends were analyzed using the WHO cancer mortality database. Log-linear regression was used to model annual trends, while OLS and Poisson regression models were used to estimate the impact of socioeconomic and human development factors on incidence and mortality rates. Cervical cancer incidence and mortality rates varied widely, with many African countries such as Guinea, Zambia, Comoros, Tanzania, and Malawi having at least 10-to-20-fold higher rates than several West Asian, Middle East, and European countries, including Iran, Saudi Arabia, Syria, Egypt, and Switzerland. HDI, GII, poverty rate, health expenditure per capita, urbanization, and literacy rate were all significantly related to cervical cancer incidence and mortality, with HDI and poverty rate each explaining >52% of the global variance in mortality. Both incidence and mortality rates increased in relation to lower human development and higher gender inequality levels. A 0.2 unit increase in HDI was associated with a 20% decrease in cervical cancer risk and a 33% decrease in cervical cancer mortality risk. The risk of a cervical cancer diagnosis increased by 24% and of cervical cancer death by 42% for a 0.2 unit increase in GII. Higher health expenditure levels were independently associated with decreased incidence and mortality risks. Global inequalities in cervical cancer are clearly linked to disparities in human development, social inequality, and living standards. Reductions in cervical cancer rates are achievable by reducing inequalities in socioeconomic conditions, availability of preventive health
The incidence and mortality of lung cancer and their relationship to development in Asia.
Pakzad, Reza; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Pakzad, Iraj; Salehiniya, Hamid
2015-12-01
Lung cancer is the deadliest cancer worldwide and the most common cancer in Asia. It is necessary to get information on epidemiology and inequalities related to incidence and mortality of the cancer to use for planning and further research. This study aimed to investigate epidemiology and inequality of incidence and mortality from lung cancer in Asia. The study was conducted based on data from the world data of cancer and the World Bank [including the Human Development Index (HDI) and its components]. The incidence and mortality rates, and cancer distribution maps were drawn for Asian countries. To analyze data, correlation test between incidence and death rates, and HDI and its components at significant was used in the significant level of 0.05 using SPSS software. A total of 1,033,881 incidence (71.13% were males and 28.87% were females. Sex ratio was 2.46) and 936,051 death (71.45% in men and 28.55% in women. The sex ratio was 2.50) recorded in Asian countries in 2012. Five countries with the highest standardized incidence and mortality rates of lung cancer were Democratic Republic of Korea, China, Armenia, Turkey, and Timor-Leste, respectively. Correlation between HDI and standardized incidence rate was 0.345 (P=0.019), in men 0.301 (P=0.042) and in women 0.3 (P=0.043); also between HDI and standardized mortality rate 0.289 (P=0.052), in men 0.265 (P=0.075) and in women 0.200 (P=0.182). The incidence of lung cancer has been increasing in Asia. It is high in men. Along with development, the incidence and mortality from lung cancer increases. It seems necessary to study reasons and factors of increasing the incidence and mortality of lung cancer in Asian countries.
Incidence and Mortality of Liver Cancer and Their Relationship with Development in Asia.
Mohammadian, Maryam; Soroush, Ali; Mohammadian-Hafshejani, Abdollah; Towhidi, Farhad; Hadadian, Fatemeh; Salehiniya, Hamid
2016-01-01
Liver cancer (LC) is the sixth world most common cancer and the second leading cause of cancer death. Due to the importance and necessity of awareness about the incidence and mortality of diseases to perform prevention programs, this study focused on data for LC and its relationship with the human development index (HDI) and its components in Asia in 2012. This ecological study was based on GLOBOCAN data for Asian countries. We assessed correlations between standardized incidence rates (SIR) and standardized mortality rates (SMR) of LC with HDI and its components using of SPSS18. A total of 582,420 incident cases and 557,097 deaths were recorded in Asian countries in 2012. The five with the highest SIR were Mongolia, Lao PDR, Vietnam, Republic of Korea and Thailand and those with the highest SMR were Mongolia, Lao PDR, Vietnam, Cambodia and Thailand. A negative relation was observed between HDI and LC for SIR of 0.049 (P=0.748) and for SMR of 0.07 (P=0.645), with life expectancy at birth a positive relation for SIR of 0.061 (P=0.687) and a negative relation for SMR of 0.079 (P=0.603), with the average years of education a negative relation fo SIR of 0.476 (p=0.952) and for SMR of 0.032 (P=0.832), and with the country income level per person a negative relation for SMI of 0.11 (p=0.465) and for SMR of 0.113 (P=0.455). The incidence of LC is more in less developed and developing countries but statistically significant correlations were not found between standardized incidence and mortality rates of LC, and HDI and its dimensions.
Vakis, Antonis I.; Polycarpou, Andreas A.
2010-06-01
In the effort to achieve Tbit/inch2 recording densities, thermal fly-height control (TFC) nanotechnology was developed to effectively reduce the clearance (which is of the order of a few nanometres) at the head-disk interface (HDI) of hard-disk drives. In this work, we present a model of the HDI that can predict the dynamic flying and nanotribological contacting behaviour, allowing for accurate predictions and characterization of the operating regime as a function of TFC actuation. A geometric model for TFC is presented and an improved definition of contact at the interface is developed in the presence of nanoscale topographical roughness and dynamic microwaviness. A new methodology is proposed for the calculation of the nominal area of contact, which affects both near- and at-contact behaviour, while the stiffening of the air bearing force with TFC actuation is also accounted for. Slider behaviour is analysed by quantifying the approach, jump-to-contact, lubricant and solid contact regimes of operation and identifying the critical and optimum TFC actuations. The feasibility of near-contact, light molecularly thin lubricant contact versus solid contact recording is explored under the effect of the interfacial forces and stresses present at the HDI. The clearance and the state of vibrations are analysed and design guidelines are proposed for improved performance.
International Nuclear Information System (INIS)
Vakis, Antonis I; Polycarpou, Andreas A
2010-01-01
In the effort to achieve Tbit/inch 2 recording densities, thermal fly-height control (TFC) nanotechnology was developed to effectively reduce the clearance (which is of the order of a few nanometres) at the head-disk interface (HDI) of hard-disk drives. In this work, we present a model of the HDI that can predict the dynamic flying and nanotribological contacting behaviour, allowing for accurate predictions and characterization of the operating regime as a function of TFC actuation. A geometric model for TFC is presented and an improved definition of contact at the interface is developed in the presence of nanoscale topographical roughness and dynamic microwaviness. A new methodology is proposed for the calculation of the nominal area of contact, which affects both near- and at-contact behaviour, while the stiffening of the air bearing force with TFC actuation is also accounted for. Slider behaviour is analysed by quantifying the approach, jump-to-contact, lubricant and solid contact regimes of operation and identifying the critical and optimum TFC actuations. The feasibility of near-contact, light molecularly thin lubricant contact versus solid contact recording is explored under the effect of the interfacial forces and stresses present at the HDI. The clearance and the state of vibrations are analysed and design guidelines are proposed for improved performance.
High-Density Infrared Surface Treatments of Refractories
Energy Technology Data Exchange (ETDEWEB)
Tiegs, T.N.
2005-03-31
Refractory materials play a crucial role in all energy-intensive industries and are truly a crosscutting technology for the Industries of the Future (IOF). One of the major mechanisms for the degradation of refractories and a general decrease in their performance has been the penetration and corrosion by molten metals or glass. Methods and materials that would reduce the penetration, wetting, and corrosive chemistry would significantly improve refractory performance and also maintain the quality of the processed liquid, be it metal or glass. This report presents the results of an R&D project aimed at investigating the use of high-density infrared (HDI) heating to surface treat refractories to improve their performance. The project was a joint effort between Oak Ridge National Laboratory (ORNL) and the University of Missouri-Rolla (UMR). HDI is capable of heating the near-surface region of materials to very high temperatures where sintering, diffusion, and melting can occur. The intended benefits of HDI processing of refractories were to (1) reduce surface porosity (by essentially sealing the surface to prevent liquid penetration), (2) allow surface chemistry changes to be performed by bonding an adherent coating onto the underlying refractory (in order to inhibit wetting and/or improve corrosion resistance), and (3) produce noncontact refractories with high-emissivity surface coatings.
Neglected tropical diseases in Brazil.
Lindoso, José Angelo L; Lindoso, Ana Angélica B P
2009-01-01
Poverty is intrinsically related to the incidence of Neglected Tropical Diseases (NTDs). The main countries that have the lowest human development indices (HDI) and the highest burdens of NTDs are located in tropical and subtropical regions of the world. Among these countries is Brazil, which is ranked 70th in HDI. Nine out of the ten NTDs established by the World Health Organization (WHO) are present in Brazil. Leishmaniasis, tuberculosis, dengue fever and leprosy are present over almost the entire Brazilian territory. More than 90% of malaria cases occur in the Northern region of the country, and lymphatic filariasis and onchocerciasis occur in outbreaks in a particular region. The North and Northeast regions of Brazil have the lowest HDIs and the highest rates of NTDs. These diseases are considered neglected because there is not important investment in projects for the development of new drugs and vaccines and existing programs to control these diseases are not sufficient. Another problem related to NTDs is co-infection with HIV, which favors the occurrence of severe clinical manifestations and therapeutic failure. In this article, we describe the status of the main NTDs currently occurring in Brazil and relate them to the HDI and poverty.
Directory of Open Access Journals (Sweden)
Avinash Mulky
2013-01-01
Full Text Available Corporate social responsibility has become an important concept in the business world in recent decades. CSR is important in all countries but is particularly relevant in emerging markets where the levels of human development are not high. The United Nations Development Programme has created the Human Development Index (HDI to measure the human development in countries. The present study analyzes the CSR communication on the websites of the 100 largest Indian companies. The objective was to examine the reported CSR activities and determine whether the activities address the dimensions and indicators of the HDI. The study uses content analysis to classify the CSR activities into categories corresponding to HDI parameters. The findings indicate that about two thirds of the companies are using their websites to communicate CSR. Of the companies which reported CSR, about eighty percent report support for primary education and about seventy percent undertake livelihood support activities. The level of corporate involvement in the health dimension of human development is quite low. Reduction of infant and maternal mortality does not get much corporate attention. This study will add to the literature on CSR in emerging markets and will be useful for firms in India and other emerging markets that are planning CSR activities aimed at human development parameters.
Directory of Open Access Journals (Sweden)
André Luís Dias Araujo MAZZARI
2014-12-01
Full Text Available O consumo de plantas medicinais e fitoterápicos está cada vez mais em expansão pelo mundo. Contudo, os fitoterápicos, como qualquer xenobiótico, podem causar alterações farmacocinéticas no organismo, ocasionando distúrbios nos metabolismos de fase 1 e fase 2, devido à inibição ou indução de enzimas metabólicas. Em caso de coadministração de plantas medicinais e/ou fitoterápicos com medicamentos convencionais, poderá haver interações que comprometem a eficácia do último, ocasionando uma falha terapêutica. Como ensaios pré-clínicos farmacocinéticos não são uma exigência regulatória para que um medicamento fitoterápico seja registrado, os casos de interações com fármacos convencionais (Herb-Drug Interactions - HDI acabam sendo revelados somente na fase de pós- -comercialização, ou seja, pelos sistemas de farmacovigilância. Inúmeros países já reportaram casos de HDI através de seus respectivos centros de farmacovigilância à Organização Mundial de Saúde (OMS, mas até o momento, o Brasil não reportou nenhum oficialmente. Além disso, durante os primeiros 10 anos de monitoramento, nenhum caso de HDI envolvendo plantas medicinais brasileiras foi apresentado. Sabe-se que aproximadamente 90% da população brasileira fazem uso de plantas medicinais e fitoterápicos, e que casos de HDI podem estar acontecendo sem serem percebidos e/ou notificados. Para que este cenário mude, é necessário que se adote medidas que visem ao estímulo do profissional de saúde à comunicação de suspeita de HDI para o centro de farmacovigilância, bem como a educação continuada destes profissionais, com a inclusão de especialistas em medicina tradicional no sistema de saúde, além de campanhas de prevenção à automedicação de plantas medicinais e fitoterápicos pela população, que atualmente não é praticado no Brasil.
Production of granules of urea, urea-ammonium sulphate and urea-potassium chloride enriched with 15N
International Nuclear Information System (INIS)
Bendassolli, J.A.
1991-01-01
Using a pearling tower it was possible to produce granulated urea, and granulated mixtures of ammonium sulphate and urea, potassium chloride and urea, Labelled in 15 N. Granulated urea with 1, 2, 3 and 4 mm of diameter was obtained using a system with a heating controller. A low concentration of biuret was observed in the granules produced ( 15 N-Labelled ( 15 NH 4' 15 NH 2 ) with variable proportion of ammonium sulphate and urea. (author)
Energy Technology Data Exchange (ETDEWEB)
Daniel Tao; Craig A. Blue
2004-08-01
Equipment wear is a major concern in the mineral processing industry, which dramatically increases the maintenance cost and adversely affects plant operation efficiency. In this research, wear problems of mineral processing equipment including screens, sieve bends, heavy media vessel, dewatering centrifuge, etc., were identified. A novel surface treatment technology, high density infrared (HDI) surface coating process was proposed for the surface enhancement of selected mineral processing equipment. Microstructural and mechanical properties of the coated samples were characterized. Laboratory-simulated wear tests were conducted to evaluate the tribological performance of the coated components. Test results indicate that the wear resistance of AISI 4140 and ASTM A36 steels can be increased 3 and 5 folds, respectively by the application of HDI coatings.
Copolímeros de poliuretano del tipo poli[(hexametilencarbamatobutanodiol- co-(carbonato-co-éster
Directory of Open Access Journals (Sweden)
Borja Fernández-d'Arlas
2016-12-01
Full Text Available Los poliuretanos segmentados termoplástico elastoméricos (PUSTE comprenden una familia de materiales muy versátiles debido a su potencial empleo en diversos campos tales como biomedicina. Entre los PUSTE los formados por policarbonatos dioles y diisocianatos alifáticos son especialmente atractivos debido a su bioestabilidad y biocompatibilidad. En este trabajo se presentan los resultados del análisis morfológico y conducta mecánica de una familia de PUSTEs formados por 1,6-hexametilen diisocianato (HDI, 1,4-butanodiol (BD y un copolímero cauchoso de policaprolactona y polihexametilen carbonato diol, PCL-b-PHMC-b-PCL, sintetizados con distinta relación entre bloques rígidos (HDI-BD y copolímero cauchoso.
Directory of Open Access Journals (Sweden)
Maryam Okhovati
2015-12-01
Results: IHD research publications were most likely produced by European and Western pacific countries. High-income countries produced the greatest share of about 81% of the global IHD research. However, no significant association observed between the countries’ GDP and number of research publications worldwide (OR=0.98, P=0.939. Global IHD research found to be strongly associated with the burden of disease (P<0.0001 and the countries’ HDI values worldwide (OR=16.8, P=0.016. Conclusion: Our study suggested that global research on IHD were geographically distributed and highly concentrated among the world’s richest countries. Estimated DALYs and HDI were found as important predictors of IHD research and the key drivers of health research disparities across the world.
International Nuclear Information System (INIS)
Hakkarainen, J.
1975-01-01
A scheme for the sequential quantitative separation and determination of protein, RNA, DNA, lipid, and glycogen from rat-liver homogenate is modified for application to frozen tissues of the piglet. The biochemical methods, including the biuret method, used in the present investigation are described and thoroughly checked. The effects of freezing and storage on the recovery of major tissue constituents are recorded. The modified scheme is applied to the determination of protein, RNA, DNA, lipid, and glycogen in the liver, skeletal muscle, and brain of the developing piglet. Developmental changes for these major tissue constituents, including the biuret protein, are described with special reference to protein synthesis and physiology of growth at the cellular level from 45 days of foetal age to 35-42 days of postnatal age for liver and skeletal muscle, and from birth to 31-40 days of postnatal age for the cerebrum and cerebellum. The uniformly labelled amino acid, 14 C-L-leucine, is used to study protein synthesis. Developmental patterns of labelling of protein and lipid in the liver, skeletal muscle, cerebrum, and cerebellum of the piglet from birth up to the age of two weeks are described. The results of the methodological, developmental, and experimental studies are thoroughly discussed in the light of the relevant literature and compared with those obtained in developmental and experimental studies on rats and other mammal species. (author)
Directory of Open Access Journals (Sweden)
Noor Sanbhal
2018-01-01
Full Text Available Polypropylene (PP light weight meshes are commonly used as hernioplasty implants. Nevertheless, the growth of bacteria within textile knitted mesh intersections can occur after surgical mesh implantation, causing infections. Thus, bacterial reproduction has to be stopped in the very early stage of mesh implantation. Herein, novel antimicrobial PP meshes grafted with β-CD and complexes with triclosan were prepared for mesh infection prevention. Initially, PP mesh surfaces were functionalized with suitable cold oxygen plasma. Then, hexamethylene diisocyanate (HDI was successfully grafted on the plasma-activated PP surfaces. Afterwards, β-CD was connected with the already HDI reacted PP meshes and triclosan, serving as a model antimicrobial agent, was loaded into the cyclodextrin (CD cavity for desired antibacterial functions. The hydrophobic interior and hydrophilic exterior of β-CD are well suited to form complexes with hydrophobic host guest molecules. Thus, the prepared PP mesh samples, CD-TCL-2 and CD-TCL-6 demonstrated excellent antibacterial properties against Staphylococcus aureus and Escherichia coli that were sustained up to 11 and 13 days, respectively. The surfaces of chemically modified PP meshes showed dramatically reduced water contact angles. Moreover, X-ray diffractometer (XRD, differential scanning calorimeter (DSC, and Thermogravimetric (TGA evidenced that there was no significant effect of grafted hexamethylene diisocyanate (HDI and CD on the structural and thermal properties of the PP meshes.
Sletner, Line; Jenum, Anne Karen; Mørkrid, Kjersti; Vangen, Siri; Holme, Ingar M; Birkeland, Kåre I; Nakstad, Britt
2014-09-01
Size and body composition at birth may affect long-term health. Mean birthweight and body composition differ between ethnic groups living in Europe. We wanted to explore if this relates to differences in socio-economic conditions in country of origin and over the maternal life course. This is a population-based cohort study of healthy pregnant women living in Oslo, Norway. Data on maternal early life and present socio-economic position (SEP) were collected in early gestation, and SEP scores were extracted through two separate principal components analyses. The associations between maternal present SEP and four different offspring anthropometric measures at birth were assessed separately, stratified by maternal early life SEP (dichotomised score) and Human Development Index (HDI, a country-level socio-economic indicator) in the country of origin [high HDI (Reference), n = 287 and low HDI, n = 250]. A strong positive association between maternal present SEP and offspring birthweight was observed if maternal early life SEP was high, but not if maternal early life SEP was low (P countries had smaller abdominal circumference, possibly indicating less fat-free mass, regardless of maternal life course SEP. Our results suggest that there are transgenerational effects of maternal past socio-economic conditions on offspring size and body composition at birth that modify the associations with present socio-economic factors. © 2014 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Salman Khazaei
2017-06-01
Full Text Available There has been no worldwide ecological study on suicide as a global major public health problem. This study aimed to identify the variations in suicide specific rates using the Human Development Index (HDI and some health related variables among countries around the world. In this ecological study, we obtained the data from the World Bank Report 2013. The analysis was restricted to 91 countries for which both the epidemiologic data from the suicide rates and HDI were available. Overall, the global prevalence of suicide rate was 10.5 (95% confidence intervals: 8.8, 12.2 per 100,000 individuals, which significantly varied according to gender (16.3 in males vs. 4.6 in females, p < 0.001 and different levels of human development (11.64/100,000 individuals in very high development countries, 7.93/100,000 individuals in medium development countries, and 13.94/100,000 individuals in high development countries, p = 0.004. In conclusion, the suicide rate varies greatly between countries with different development levels. Our findings also suggest that male gender and HDI components are associated with an increased risk of suicide behaviors. Hence, detecting population subgroups with a high suicide risk and reducing the inequality of socioeconomic determinants are necessary to prevent this disorder around the world.
Directory of Open Access Journals (Sweden)
Jorge Eduardo Scarpin
2007-10-01
Full Text Available Este artigo aponta uma modelagem matemática para determinar o valor futuro do IDH-M para os municípios do Paraná, com base em dados contábeis atuais e outras variáveis. O referencial teórico abrange, entre outros, aspectos de externalidades e bens públicos, analisando as razões pelas quais são necessários investimentos públicos e também contempla aspectos sobre o cálculo do IDH-M. O artigo é baseado em uma pesquisa explicativa, e o instrumental utilizado é a análise de regressão, com regressões múltiplas a partir de 87 variáveis independentes, sendo 10 variáveis não-contábeis e 77 contábeis. Fica evidente que o IDH-M possui relação com as variáveis de IDH-M passado, distância em relação à capital, altitude, nível de população rural, receita tributária, despesa com pessoal, despesa com saúde e saneamento, investimentos e gastos com indústria e comércio.This article presents a mathematical model for determining the future valueof local HDI of municipalities in the state of Paraná, Brazil, based on current accounting data and other variables. The theoretical framework considers externalities and public assets, analyzing the reasons why public investments are necessary, as well as how the HDI is calculated. This explanatory research uses regression analysis with multiple regressions of 87 independent variables, 10 of them non-accounting and 77 accounting variables. The tests showed that local HDI has relation with past local HDI variables, distance to the state capital, altitude, level of rural population, tax revenue, expenses with civil service personnel, public health and sanitation expenditure, investments and expenses with commerce and industry.
Ghoncheh, Mahshid; Mohammadian, Maryam; Mohammadian-Hafshejani, Abdollah; Salehiniya, Hamid
Colorectal cancer is the second most common cancer in women and the third most common cancer among men, and its incidence is increasing in Asia. Awareness about the status of this cancer incidence and mortality is necessary for a better plan. The present study was done with the aim to investigate the incidence and mortality of colorectal cancer and its relationship with the Human Development Index (HDI) in Asia in 2012. This study was an ecological study, which was conducted based on the GLOBOCAN project of the World Health Organization for Asian countries. We assessed the correlation between standardized incidence rates (SIR) and standardized mortality rates (SMR) of colorectal cancer with HDI and its components using SPSS software, version 18 (SPSS Inc., Chicago, IL). A total of 592,563 incidences of and 325,752 deaths from colorectal cancer were recorded in Asian countries in 2012. The 5 countries with the highest SIR were Republic of Korea (45 per 100,000), Israel (35.9 per 100,000), Singapore (33.7 per 100,000), Japan (32.2 per 100,000), and Jordan (25.6 per 100,000). The 5 countries with the highest SMR for colorectal cancer were Jordan (15.5 per 100,000), Kazakhstan (12.8 per 100,000), Democratic Republic of Korea (12 per 100,000), Brunei (12 per 100,000), and Japan (11.9 per 100,000). Correlation between HDI and SIR was 0.709 overall (P ≤ .001)- 0.667 in men (P ≤ .001) and 0.759 in women (P ≤ .001). Also, correlation between HDI and SMR overall was 0.517 (P ≤ .001)- 0.447 in men (P = .002) and 0.593 in women (P ≤ .001). Cancer incidence and mortality are higher in countries with more development. A positive and statistically significant correlation was found between standardized incidence and mortality rate of colorectal cancer and the Human Development Index and its components. Copyright © 2016. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Gopal K. Singh, PhD
2012-11-01
Full Text Available Objective: This study examined global inequalities in cervical cancer incidence and mortality rates as a function of cross-national variations in the Human Development Index (HDI, socioeconomic factors, Gender Inequality Index (GII, and healthcare expenditure.Methods: Age-adjusted incidence and mortality rates were calculated for women in 184 countries using the 2008 GLOBOCAN database, and incidence and mortality trends were analyzed using the WHO cancer mortality database. Log-linear regression was used to model annual trends, while OLS and Poisson regression models were used to estimate the impact of socioeconomic and human development factors on incidence and mortality rates.Results: Cervical cancer incidence and mortality rates varied widely, with many African countries such as Guinea, Zambia, Comoros, Tanzania, and Malawi having at least 10-to-20-fold higher rates than several West Asian, Middle East, and European countries, including Iran, Saudi Arabia, Syria, Egypt, and Switzerland. HDI, GII, poverty rate, health expenditure per capita, urbanization, and literacy rate were all significantly related to cervical cancer incidence and mortality, with HDI and poverty rate each explaining >52% of the global variance in mortality. Both incidence and mortality rates increased in relation to lower human development and higher gender inequality levels. A 0.2 unit increase in HDI was associated with a 20% decrease in cervical cancer risk and a 33% decrease in cervical cancer mortality risk. The risk of a cervical cancer diagnosis increased by 24% and of cervical cancer death by 42% for a 0.2 unit increase in GII. Higher health expenditure levels were independently associated with decreased incidence and mortality risks.Conclusions and Public Health Implications: Global inequalities in cervical cancer are clearly linked to disparities in human development, social inequality, and living standards. Reductions in cervical cancer rates are achievable by
Pandit, Subrata; Kanjilal, Satyajyoti; Awasthi, Anshumali; Chaudhary, Anika; Banerjee, Dipankar; Bhatt, B N; Narwaria, Avinash; Singh, Rahul; Dutta, Kakoli; Jaggi, Manu; Singh, Anu T; Sharma, Neena; Katiyar, Chandra Kant
2017-02-02
Arishtas are Ayurvedic formulation made with decoction of herbs. Arjunarishta formulation is being used in Ayurveda for cardio-protective activity. Ashwagandharishta formulation possesses antioxidant, anti-atherosclerotic and anti-stress properties. Ridayarishta, a novel empirical formulation was prepared using combination of selected ingredients from these two formulations to support healthy heart functions and to reduce stress. Aim of the Study was to investigate herb-drug interaction (HDI) of Ridayarishta formulation through human hepatic cytochrome P450 (CYP450) enzyme inhibition assay. Ridayarishta formulation was phyto-chemically standardized against arjunolic acid, arjunetin, berberine, piperine, resveratrol and withaferin-A using high performance thin layer chromatography (HPTLC) analysis. The formulation was standardized with respect to ethanol by gas chromatographic (GC) analysis. HDI was evaluated with Ridayarishta formulation and amlodipine besilate, atenolol, atorvastatin, metformin, glipizide glimepiride cocktail using high throughput CYP450 enzyme inhibition assay; against CYP1A2, 2C19, 2D6 and 3A4 isozymes. Contents of arjunolic acid, arjunetin, berberine, piperine, resveratrol and withaferin-A in Ridayarishta formulation were found to be 1.76±0.12, 1.51±0.09, 1.85±0.05, 3.2±0.12, 1.21±0.08, and 2.16±0.09ppm, respectively. Quantity of ethanol in Ridayarishta was found to be 7.95±0.023% (V/V). Ridayarishta showed significantly higher (Pdrugs showed significantly (P<0.001and P<0.01) less or negligible HDI. Ridayarishta formulation alone and cocktail with amlodipine besilate, atenolol, atorvastatin, metformin, glipizide, glimepiride had negligible or insignificant effect on CYP450 inhibition. It may be concluded that consumption of Ridayarishta along with selective cardio protective, antihypertensive and anti-diabetic conventional medicine is safe with negligible or without any significant CYP450 (CYP1A2, 2C19, 2D6 and 3A4) inhibition mediated
National Aeronautics and Space Administration — In Phase II of this SBIR, Harmonic Devices (HDI) proposes to develop miniaturized MEMS filters at UHF, S-band and Ka-band to address the requirements of NASA's...
Democracy and Development – A Disputed Pair1
African Journals Online (AJOL)
... rising incomes. (based on economic growth), but also longer lives, higher levels of literacy .... the integrated human development measure (HDI) as a valid or meaningful ... Just like the minimalist, the substantialist definition holds democracy.
Autod jõuluöös / Tapio Koisaari
Koisaari, Tapio
2011-01-01
Talveauto 2011: Alfa Romeo Giulietta 2,0 JTD 140 ; Audi A1 1,6 TDI 77 kW ; BMW 520dA Touring ; Chevrolet Cruze 2,0 DLT+ ; Citroën C3 HDi 90 ; Dacia Duster 1,5 dCi 110 Laureate ; Ford C-Max 1,6L TDCi Titanium ; Honda CR-Z 1,5 GT ; Hyundai ix35 1,7 CRDi ISG Comfort ; Kia Venga 1,4 CRDi Ex ; Mini Cooper D Countryman ; Mitsubishi ASX 1,8 DID 2WD Invite ; Nissan Juke 1,5 dCi Acenta ; Opel Meriva 1,7D DTC Enjoy ; Peugeot RCZ Sport 2,0 HDi ; Saab 9-5 Vector 2,0 TTiD ; Toyota Auris 1,8 HSD Linea Sol Plus ; Volkswagen Sharan Comfortline 2,0 TDI DSG ; Volvo S60 D3 Momentum
Boissonnet, Carlos; Schargrodsky, Herman; Pellegrini, Fabio; Macchia, Alejandro; Marcet Champagne, Beatriz; Wilson, Elinor; Tognoni, Gianni
2011-08-01
Earlier reviews have found that the proportion of inverse associations between socioeconomic status and obesity increased according to the level of development of the studied country. Based on this finding, it has been hypothesized that in low- to middle- income countries the burden of obesity shifts to disadvantaged groups as a country develops. CARMELA is a cross-sectional, population-based observational study that sampled 11,550 women and men age 25-64 from seven major Latin American cities. We analyzed by gender the association of educational attainments (as proxy of socioeconomic status) with body mass index, waist circumference and metabolic syndrome. Participating cities were divided by country Human Development Index (HDI). An inverse gradient between socioeconomic status and body mass index in women was uniformly present in High HDI cities (Buenos Aires, Santiago, Mexico) but not in Medium HDI group (Barquisimeto, Bogota, Lima, Quito), where two cities showed an inverse gradient and two cities did not. In men, no clear socioeconomic gradients were found. Findings regarding waist circumference and metabolic syndrome closely mirrored those about body mass index. In women but not men, these results give support to the hypothesis of obesity shifting to the poor and extend it to the related concepts of abdominal obesity and metabolic syndrome. Obesity should be considered as a socially-generated disease and an indicator of socioeconomic disadvantage, to be approached by comprehensive strategies that bear in mind this perspective.
Socioeconomic disadvantage and schizophrenia in migrants under mental health detention orders.
Bulla, Jan; Hoffmann, Klaus; Querengässer, Jan; Ross, Thomas
2017-09-01
Migrants with mental hospital orders according to section 63 of the German criminal code are overrepresented in relation to their numbers in the general population. Subgroups originating from certain world regions are diagnosed with schizophrenia at a much higher rate than others. In the present literature, there is a strong evidence for a substantial correlation between migration, social disadvantage and the prevalence of schizophrenia. This study investigates the relationship between countries of origin, the risk of becoming a forensic patient and the proportion of schizophrenia spectrum disorders. Data from a comprehensive evaluation tool of forensic inpatients in the German federal state of Baden-Württemberg (FoDoBa) were compared with population statistics and correlated with the Human Development Index (HDI) and Multidimensional Poverty Index (MPI). For residents with migration background, the risk ratio to receive a mental hospital order is 1.3 in comparison to non-migrants. There was a highly significant correlation between the HDI of the country of origin and the risk ratio for detention in a forensic psychiatric hospital. The proportion of schizophrenia diagnoses also correlated significantly with the HDI. In contrast, the MPI country rankings were not associated with schizophrenia diagnoses. Two lines of explanations are discussed: first, higher prevalence of schizophrenia in migrants originating from low-income countries, and second, a specific bias in court rulings with regard to involuntary forensic treatment orders for these migrant groups.
Wood, William A; Brazauskas, Ruta; Hu, Zhen-Huan; Abdel-Azim, Hisham; Ahmed, Ibrahim A; Aljurf, Mahmoud; Badawy, Sherif; Beitinjaneh, Amer; George, Biju; Buchbinder, David; Cerny, Jan; Dedeken, Laurence; Diaz, Miguel Angel; Freytes, Cesar O; Ganguly, Siddhartha; Gergis, Usama; Almaguer, David Gomez; Gupta, Ashish; Hale, Gregory; Hashmi, Shahrukh K; Inamoto, Yoshihiro; Kamble, Rammurti T; Adekola, Kehinde; Kindwall-Keller, Tamila; Knight, Jennifer; Kumar, Lalit; Kuwatsuka, Yachiyo; Law, Jason; Lazarus, Hillard M; LeMaistre, Charles; Olsson, Richard F; Pulsipher, Michael A; Savani, Bipin N; Schultz, Kirk R; Saad, Ayman A; Seftel, Matthew; Seo, Sachiko; Shea, Thomas C; Steinberg, Amir; Sullivan, Keith; Szwajcer, David; Wirk, Baldeep; Yared, Jean; Yong, Agnes; Dalal, Jignesh; Hahn, Theresa; Khera, Nandita; Bonfim, Carmem; Atsuta, Yoshiko; Saber, Wael
2018-03-19
For patients with acute lymphoblastic leukemia (ALL), allogeneic hematopoietic cell transplantation (alloHCT) offers a potential cure. Life-threatening complications can arise from alloHCT that require the application of sophisticated health care delivery. The impact of country-level economic conditions on post-transplantation outcomes is not known. Our objective was to assess whether these variables were associated with outcomes for patients transplanted for ALL. Using data from the Center for Blood and Marrow Transplant Research, we included 11,261 patients who received a first alloHCT for ALL from 303 centers across 38 countries between the years of 2005 and 2013. Cox regression models were constructed using the following macroeconomic indicators as main effects: Gross national income per capita, health expenditure per capita, and Human Development Index (HDI). The outcome was overall survival at 100 days following transplantation. In each model, transplants performed within lower resourced environments were associated with inferior overall survival. In the model with the HDI as the main effect, transplants performed in the lowest HDI quartile (n = 697) were associated with increased hazard for mortality (hazard ratio, 2.42; 95% confidence interval, 1.64 to 3.57; P macroeconomic indices were associated with lower survival at 100 days after alloHCT for ALL. The reasons for this disparity require further investigation. Copyright © 2018 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
Lazarus, Jeffrey V; Sperle, Ida; Safreed-Harmon, Kelly; Gore, Charles; Cebolla, Beatriz; Spina, Alexander
2017-07-26
As more countries worldwide develop national viral hepatitis strategies, it is important to ask whether context-specific factors affect their decision-making. This study aimed to determine whether country-level socioeconomic factors are associated with viral hepatitis programmes and policy responses across WHO Member States (MS). WHO MS focal points completed a questionnaire on national viral hepatitis policies. This secondary analysis of data reported in the 2013 Global Policy Report on the Prevention and Control of Viral Hepatitis in WHO Member States used logistic regression to examine associations between four survey questions and four socioeconomic factors: country income level, Human Development Index (HDI), health expenditure and physician density. This analysis included 119 MS. MS were more likely to have routine viral hepatitis surveillance and to have a national strategy and/or policy/guidelines for preventing infection in healthcare settings if they were in the higher binary categories for income level, HDI, health expenditure and physician density. In multivariable analyses, the only significant finding was a positive association between having routine surveillance and being in the higher binary HDI category (adjusted odds ratio 26; 95% confidence interval 2.0-340). Countries with differing socioeconomic status indicators did not appear to differ greatly regarding the existence of key national policies and programmes. A more nuanced understanding of the multifaceted interactions of socioeconomic factors, health policy, service delivery and health outcomes is needed to support country-level efforts to eliminate viral hepatitis.
Cade, J E; Taylor, E F; Burley, V J; Greenwood, D C
2011-08-01
To assess the risk of developing breast cancer associated with consumption of two common dietary patterns: a Mediterranean dietary pattern and a dietary pattern, which conforms to the World Health Organization Healthy Diet Index (WHO HDI). Dietary data from a 217-item food frequency questionnaire were used to generate two dietary patterns according to pre-defined criteria in women from the UK Women's Cohort Study. Survival analysis using Cox regression was used to estimate hazards ratios for risk of breast cancer adjusted for known confounders. This analysis included 828 incident cases of breast cancer in 33,731 women with a mean follow-up of 9 years. There were no statistically significant associations between either the Mediterranean dietary pattern or the WHO HDI and risk of breast cancer. In premenopausal women, there was a nonsignificant trend suggesting that increasing compliance with the Mediterranean diet was associated with lower risk of breast cancer. Maximal adherence to the Mediterranean diet was associated with hazards ratio=0.65 (95% confidence interval: 0.42-1.02, P trend=0.09) compared with minimal adherence. In postmenopausal women, no clear trends were observed. In this study, no strong association between the risk of breast cancer and the consumption of either a Mediterranean-type diet or one characterized by adherence to the WHO HDI was observed. In premenopausal, but not postmenopausal women, there was a nonsignificant inverse association with increasing adherence to the Mediterranean diet pattern.
International Nuclear Information System (INIS)
Henkens, Tom; Papeleu, Peggy; Elaut, Greetje; Vinken, Mathieu; Rogiers, Vera; Vanhaecke, Tamara
2007-01-01
Histone deacetylase inhibitors (HDI) have been shown to increase differentiation-related gene expression in several tumor-derived cell lines by hyperacetylating core histones. Effects of HDI on primary cultured cells, however, have hardly been investigated. In the present study, the ability of trichostatin A (TSA), a prototype hydroxamate HDI, to counteract the loss of liver-specific functions in primary rat hepatocyte cultures has been investigated. Upon exposure to TSA, it was found that the cell viability of the cultured hepatocytes and their albumin secretion as a function of culture time were increased. TSA-treated hepatocytes also better maintained cytochrome P450 (CYP)-mediated phase I biotransformation capacity, whereas the activity of phase II glutathione S-transferases (GST) was not affected. Western blot and qRT-PCR analysis of CYP1A1, CYP2B1 and CYP3A11 protein and mRNA levels, respectively, further revealed that TSA acts at the transcriptional level. In addition, protein expression levels of the liver-enriched transcription factors (LETFs) hepatic nuclear factor 4 alpha (HNF4α) and CCAAT/enhancer binding protein alpha (C/EBPα) were accordingly increased by TSA throughout culture time. In conclusion, these findings indicate that TSA plays a major role in the preservation of the differentiated hepatic phenotype in culture. It is suggested that the effects of TSA on CYP gene expression are mediated via controlling the expression of LETFs
Concept of an advanced hyperspectral remote sensing system for pipeline monitoring
Keskin, Göksu; Teutsch, Caroline D.; Lenz, Andreas; Middelmann, Wolfgang
2015-10-01
Areas occupied by oil pipelines and storage facilities are prone to severe contamination due to leaks caused by natural forces, poor maintenance or third parties. These threats have to be detected as quickly as possible in order to prevent serious environmental damage. Periodical and emergency monitoring activities need to be carried out for successful disaster management and pollution minimization. Airborne remote sensing stands out as an appropriate choice to operate either in an emergency or periodically. Hydrocarbon Index (HI) and Hydrocarbon Detection Index (HDI) utilize the unique absorption features of hydrocarbon based materials at SWIR spectral region. These band ratio based methods require no a priori knowledge of the reference spectrum and can be calculated in real time. This work introduces a flexible airborne pipeline monitoring system based on the online quasi-operational hyperspectral remote sensing system developed at Fraunhofer IOSB, utilizing HI and HDI for oil leak detection on the data acquired by an SWIR imaging sensor. Robustness of HI and HDI compared to state of the art detection algorithms is evaluated in an experimental setup using a synthetic dataset, which was prepared in a systematic way to simulate linear mixtures of selected background and oil spectra consisting of gradually decreasing percentages of oil content. Real airborne measurements in Ettlingen, Germany are used to gather background data while the crude oil spectrum was measured with a field spectrometer. The results indicate that the system can be utilized for online and offline monitoring activities.
Obesity in 7 - 10-year-old children in urban primary schools in Port ...
African Journals Online (AJOL)
affluence and obesity prevalence in developing countries. Methods .... Asian. 48. Home language. English. 547. Afrikaans. 54. isiXhosa. 108. Other. 4. Table 2. .... trend in SA. The HDI[20] categorises SA as a country in transition, similar to.
GLUCOSE AND TOTAL PROTEIN LEVEL IN LABORATORY RATS UNDER CONDITIONS OF SHORT-TERM FASTING
Directory of Open Access Journals (Sweden)
Damir Suljević
2013-09-01
Full Text Available Glucose level (UV enzymatic method and total protein level (Biuret method were measured in the blood samples of the rats exposed to short-term starvation. We found a statistically significant increase in the glucose level in experimental animals during starvation, which is also evident in males and females in the experimental group (p <0.05, while decrease in the total protein level was not statistically significant. During starvation, more significant weight loss was observed in females compared to males.Key words: glucose, total protein, serum, Rattus
Isocyanate exposure and respiratory symptoms in Dutch car spray painters
Heederik, D.; Pronk, A.; Doekes, G.; Bobbeldijk, I.; Preller, L.
2005-01-01
Isocyanate allergy and asthma is an important respiratory disease in most industrialized countries. Little information about its importance is available for the Netherlands. A baseline survey, part of a larger longitudinal epidemiological survey, shows that exposure to mainly HDI monomers and
Mortality differences between the foreign-born and locally-born population in France (2004-2007).
Boulogne, Roxane; Jougla, Eric; Breem, Yves; Kunst, Anton E; Rey, Grégoire
2012-04-01
In contrast to the situation in many European countries, the mortality of immigrants in France has been little studied. The main reasons for the lack of studies are based on ethical and ideological considerations. The objective of this study is to explore mortality by country of birth in Metropolitan (i.e. 'mainland') France. Complete mortality data were used to study the relative risks of mortality of the foreign- and locally-born populations by gender, age and cause of death for the period 2004-2007 in Metropolitan France. Analyses were conducted by countries of birth grouped into geographic areas and by the Human Development Index (HDI). The differentials in mortality between foreign-born and locally-born populations were not homogeneous. The figures varied by age (higher foreign-born mortality for the young; lower mortality for migrants aged 15-64 years), gender (female migrants more frequently had higher relative mortality than men migrants), country of birth (Eastern European-born migrants had higher mortality, while those born in Morocco, Central Asia, 'other Asian countries' and America had lower mortality) and cause of death (migrant mortality was higher overall for deaths caused by infectious diseases and diabetes, and lower for violent death and neoplasm). Moreover, mortality relative risks for male, violent deaths and cancer were positively associated with country-of-birth HDI, while female mortality and infectious disease mortality were negatively associated with country-of-birth HDI. Some important caveats have to be considered because the study did not control for individuals socioeconomic position in France, or length of residence in the host country. A strong healthy migrant effect was suggested and its intensity varies with age and gender (which may reflect different reasons for migration). For some specific causes of death, a lifestyle effect seems to explain mortality differentials. The associations between HDI and mortality show that mortality
Roncarolo, Federico; Boivin, Antoine; Denis, Jean-Louis; Hébert, Rejean; Lehoux, Pascale
2017-09-08
While there is an extensive literature on Health System (HS) strengthening and on the performance of specific HSs, there are few exhaustive syntheses of the challenges HSs are facing worldwide. This paper reports the findings of a scoping review aiming to classify the challenges of HSs investigated in the scientific literature. Specifically, it determines the kind of research conducted on HS challenges, where it was performed, in which health sectors and on which populations. It also identifies the types of challenge described the most and how they varied across countries. We searched 8 databases to identify scientific papers published in English, French and Italian between January 2000 and April 2016 that addressed HS needs and challenges. The challenges reported in the articles were classified using van Olmen et al.'s dynamic HS framework. Countries were classified using the Human Development Index (HDI). Our analyses relied on descriptive statistics and qualitative content analysis. 292 articles were included in our scoping review. 33.6% of these articles were empirical studies and 60.1% were specific to countries falling within the very high HDI category, in particular the United States. The most frequently researched sectors were mental health (41%), infectious diseases (12%) and primary care (11%). The most frequently studied target populations included elderly people (23%), people living in remote or poor areas (21%), visible or ethnic minorities (15%), and children and adolescents (15%). The most frequently reported challenges related to human resources (22%), leadership and governance (21%) and health service delivery (24%). While health service delivery challenges were more often examined in countries within the very high HDI category, human resources challenges attracted more attention within the low HDI category. This scoping review provides a quantitative description of the available evidence on HS challenges and a qualitative exploration of the
Directory of Open Access Journals (Sweden)
Ridolfi Ruggero
2006-02-01
Full Text Available Abstract Background High-dose interferon alfa-2b (IFNalfa-2b, according to the ECOG 1684 schedule, is the only approved adjuvant treatment for stage III melanoma patients by the FDA and EMEA. However, the risk/benefit profile has been questioned limiting its world-wide use. In the late nineties, the Italian Melanoma Inter-group started a spontaneous randomized clinical trial (RCT to verify if a more intense, but shorter than the ECOG 1684 regimen, could improve survival without increasing the toxicity profile. The safety analysis in the first 169 patients who completed the treatment is here described. Methods Stage III melanoma patients were randomized to receive IFNalfa-2b 20 MU/m2/d intravenously (IV 5 days/week × 4 weeks, repeated for three times on weeks 9 to 12, 17 to 20, 25 to 28 (Dose-Dense/Dose-Intense, DD/DI, arm, or IFNalfa-2b 20 MU/m2/d IV 5 days/week × 4 weeks followed by 10 MU/m2 subcutaneously (SC three times per week × 48 weeks (High Dose Interferon, HDI, arm. Toxicity was recorded and graded, according to the WHO criteria, as the worst grade that occurred during each cycle. Results The most common toxicities in both arms were flu-like and gastrointestinal symptoms, leukopenia, liver and neuro-psichiatric morbidities; with regard to severe toxicity, only leukopenia was statistically more frequent in DD/DI arm than in HDI arm (24% vs 9% (p = 0.0074, yet, this did not cause an increase in the infection risk. Discontinuation of treatment, due to toxicity, was observed in 13 and 17% of the patients in the DD/DI and HDI arm, respectively. The median actual dose intensity delivered in the DD/DI arm (36.4 MU/m2/week was statistically higher than that delivered in the HDI arm (30.7 MU/m2/week (p = 0.003. Conclusion Four cycles of intravenous high-dose IFNalfa-2b can be safely delivered with an increase in the median dose intensity. Efficacy results from this trial are eagerly awaited.
Adherence to a healthy diet in relation to cardiovascular incidence and risk markers
Mertens, Elly; Markey, Oonagh; Geleijnse, Marianne; Lovegrove, Julie A.; Givens, D.I.
2018-01-01
Purpose: Epidemiological findings indicate that higher adherence to a healthy diet may lower cardiovascular disease (CVD) risk. The present study aimed to investigate whether adherence to a healthy diet, assessed by the Healthy Diet Indicator (HDI), Dietary Approaches to Stop Hypertension (DASH)
DEFF Research Database (Denmark)
Li, Zibiao; Yang, Xiaodi; Wu, Linping
2009-01-01
Poly(ether-ester urethane)s (PUs) multiblock co-polymers were synthesized from telechelic hydroxylated poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx) and poly(ethylene glycol) (PEG) via a melting polymerization (MP) process using 1,6-hexamethylene diisocyanate (HDI) as a non-toxic couplin...
Tourism and Economic Development in ASEAN 1998-2013
Directory of Open Access Journals (Sweden)
Berly Martawardaya
2018-03-01
Full Text Available Many countries support government policies to encourage tourism sector, including ASEAN countries, due to an assumption that tourism contributes positively to GDP and poverty reduction. This study investigates that assumption, as well as the correlation between tourism and HDI, by applying panel data regression to eight ASEAN countries (Brunei Darussalam, Indonesia, Laos Singapore, Malaysia, Thailand, the Philippines, and Vietnam, during 1998--2013. We found that the number of international tourist arrivals as a proxy variable for tourism have a significant and positive correlation with poverty reduction. Tourism is also proven to increase GDP per capita (albeit in a smaller magnitude and increase HDI (in an even smaller scale. These findings confirmed our hypothesis on the positive effects of tourism. It is recommended that the tourist promotion is continued while studying the best practices to strategically develop the tourism sector in order to strengthen the positive correlation.
Shear thinning behavior of monolayer liquid lubricant films measured by fiber wobbling method
International Nuclear Information System (INIS)
Hamamoto, Y; Itoh, S; Fukuzawa, K; Zhang, H
2010-01-01
It is essential to clarify mechanical properties of monolayer lubricant films coated on magnetic disks under shearing motion for designing future hard disk drives with ultra-low flying height. Many of previous researchers reported that strong shear rate dependence of viscoelasticity was one of the typical phenomena observed with molecularly thin liquid films. However, it has not been clarified whether or not perfluoropolyether (PFPE) lubricant films, which are used for the head-disk interface (HDI) lubrication, show shear thinning behavior under actual HDI conditions. In this study, we used the fiber wobbling method that can achieve both highly-sensitive shear force measurement and precise gap control and measured shear rate dependence of viscoelastic properties of monolayer PFPE films coated on the magnetic disk. Our experimental results showed that shear thinning does occur at high shear rate ranged from 10 2 to 10 6 s -1 .
Directory of Open Access Journals (Sweden)
Delhaye B.
2006-12-01
Full Text Available The purpose of this paper is to present an overview of Computational Fluid Dynamics (CFD and combustion simulation applications to automotive power train development, and the methodologies we developed at PSA to integrate numerical simulation into the development process. We illustrate these methodologies with some applications concerning the development of PSA HDI engines. Dans cet article, on présente un panorama des applications de la mécanique des fluides numérique et de la simulation de la combustion pour le développement des groupes motopropulseurs, ainsi que les méthodologies que nous avons conçues au sein du groupe PSA pour intégrer la simulation numérique dans ce processus de développement. Nous illustrons cette démarche par des exemples d'applications issues du développement des moteurs HDI injection directe common rail de PSA.
Directory of Open Access Journals (Sweden)
Roshny Unnikrishnan
2015-04-01
Full Text Available This study is a result of the author’s inquisition to unearth the current values of Global Financial Inclusion and its relationship with economic growth measured by Gross Domestic product(GDP and human development measured by United Nations Human Development Index (HDI. The Financial Inclusion (FI levels are measured using Index for Financial Inclusion .The relationship between GDP and HDI with FI as mediator, using multiple regression, is validated on a global level based on data of 162 countries for the year 2011. An overall global mediation analysis is undertaken to establish Financial Inclusion as a mediating factor and partial mediation on human development is validated. The study is valid and unique in the global context of income inequality prevailing in developed, developing and underdeveloped countries as it validates the argument that an impressive GDP performance does not ensure equity in economic growth.
Vettore, Mario Vianna; Aqeeli, Amal
2016-04-01
This study investigated the relationship between contextual and individual social determinants of oral health-related quality of life (OHRQoL) in Brazilian adults. Data of 4594 Brazilian adults aged 35-44 years from the 2010 Brazilian Oral Health Survey were analysed. OHRQoL was measured using the Oral Impacts on Daily Performance (OIDP). Contextual socio-economic characteristics at city level assessed in 1991 and 2000 included social deprivation measured by Human Development Index (HDI) and income inequality (Gini index). Individual socio-economic characteristics included family income, schooling and number of goods. Covariates were age, sex, ethnicity and clinical oral measures. Multilevel multivariable Poisson regression analysis was carried to investigate the association of contextual and individual social characteristics with OIDP extent and with each OIDP item. Eating and cleaning teeth were the most reported daily activities influenced by oral conditions. In the adjusted analysis, low HDI 1991 and individual social characteristics (lower family income and lower schooling) were associated with OIDP extent. Sex (females) and all clinical oral measures were also associated with OIDP. Adults living in the cities with low HDI 1991 were more likely to have impact on eating and sleeping, whereas living in cities with high Gini index 1991 increased the prevalence of impact on emotional status, work and social contact. Low income was associated with all OIDP items. Poor contextual social determinants and lower individual socio-economic position are associated with worse OHRQoL among Brazilian adults, even after adjusting for individual socio-demographic and clinical oral health variables.
International Comparison of Water Resources Utilization Efficiency in the Silk Road Economic Belt
Yan, Long; Ma, Jing; Deng, Wei; Wang, Yong
2018-03-01
In order to get knowledge of the standard of water utilization of the Silk Road Economic Belt from international point of view, the paper analyzes the annual variation of water resources utilization in the Silk Road Economic Belt, and compares with other typical countries. The study shows that Water resources utilization efficiency has been greatly improved in recent 20 years and the water consumption per USD 10000 of GDP has been declined 87.97%. the improvement of industrial water consumption efficiency is the key driving factors for substantial decrease in water consumption.The comparison of water utilization and human development shows that the higher HDI the country is, the more efficient water utilization the country has. water consumption per USD 10000 of GDP in country with HDI>0.9 is 194m³, being 8.5% of that in country with HDI from 0.5 to 0.6. On the premise of maintaining the stable economic and social development of the Silk Road Economic Belt, the realization of the control target of total water consumption must depend on the strict control over the disorderly expansion of irrigated area, the change in the mode of economic growth, the implementation of the development strategy for new industrialization and urbanization, vigorous development of the processing industry with low water consumption as well as the high-tech and high value-added industry. Only in this way, the control target of total water consumption can be realized in the process of completing the industrialization task.
Directory of Open Access Journals (Sweden)
Jeffrey V Lazarus
2017-07-01
Full Text Available Abstract Background As more countries worldwide develop national viral hepatitis strategies, it is important to ask whether context-specific factors affect their decision-making. This study aimed to determine whether country-level socioeconomic factors are associated with viral hepatitis programmes and policy responses across WHO Member States (MS. Methods WHO MS focal points completed a questionnaire on national viral hepatitis policies. This secondary analysis of data reported in the 2013 Global Policy Report on the Prevention and Control of Viral Hepatitis in WHO Member States used logistic regression to examine associations between four survey questions and four socioeconomic factors: country income level, Human Development Index (HDI, health expenditure and physician density. Results This analysis included 119 MS. MS were more likely to have routine viral hepatitis surveillance and to have a national strategy and/or policy/guidelines for preventing infection in healthcare settings if they were in the higher binary categories for income level, HDI, health expenditure and physician density. In multivariable analyses, the only significant finding was a positive association between having routine surveillance and being in the higher binary HDI category (adjusted odds ratio 26; 95% confidence interval 2.0–340. Conclusion Countries with differing socioeconomic status indicators did not appear to differ greatly regarding the existence of key national policies and programmes. A more nuanced understanding of the multifaceted interactions of socioeconomic factors, health policy, service delivery and health outcomes is needed to support country-level efforts to eliminate viral hepatitis.
As Escalas Geográficas da Certificação ISO 14001: um panorama da gestão ambiental empresarial
Directory of Open Access Journals (Sweden)
Henrique Elias Pessoa Gutierres
2013-06-01
Full Text Available Environmental certification, especially ISO 14001, demonstrates the existence of internal and external factors for improving the environmental performance of companies. Thus, this article aims to present a current overview of ISO 14001 certification at different scales of analysis (global, national, regional and state, seeking its territoriality by considering factors of location, extent and connection. The following procedures were adopted: a survey of the theoretical reference, the acquisition of data from the ISO (International Organization for Standardization and INMETRO (National Institute of Metrology, Standardization and Industrial Quality on the quantity of companies certified by ISO 14001. After organizing the data, there was systematization through tables via spreadsheet, presentation and finalization of graphs and data analysis relating to the Human Development Index (HDI and Gross Domestic Product (GDP. It is understood that most of these certificates is concentrated in developed countries, where the headquarters of large companies are located. Considering the Brazilian reality, the ratio (number of certifications, GDP and HDI by state was not so obvious, since there are states with lower GDP and HDI, but with higher certificates compared to some states that are better positioned socio-economically. This feature has to do with economic aspects of the companies that have a strong influence on the occurrence of these certificates. Therefore, we present a spatially uneven reality where the environmental certification is not always related to the local reality, being a requirement of external factors, such as a continuing relation with customers and suppliers who hold environmental certification. Therefore, it is something external acting in local reality.
Sixpack diisleid / Hannu Ahonen, Pekka Aromaa, Jari Pitkäjärvi, Isak Kullman
2008-01-01
Diiselmootoriga mahukad pereautod: Citroën C5 2,0 Hdi Aut.; Ford Mondeo 2,0 TDCi Trend; Mazda 6 Sedan 2,0 TD Elegance; Renault Laguna 2,0 dCi Dynamique; Toyota Avensis 2,0 dt Linea Sol; Volkswagen Passat Sedan 2,0 TDI
Merit Goods, Education Public Policy--India at Cross Roads
Misra, Satya Narayan; Ghadai, Sanjaya Ku.
2015-01-01
Merit Goods have always received handsome attention and allocation from countries which have witnessed a congruence between high significant economic growth and Human Development Index (HDI). The Emerging Market Economies (EMEs) have become significant manufacturing hubs by universalizing education and improving their Incremental Capital Output…
Lifescience Database Archive (English)
Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT
Adherence to dietary guidelines and cardiovascular disease risk in the EPIC-NL cohort
Struijk, E.A.; May, A.M.; Wezenbeek, N.L.W.J.; Fransen, H.; Soedamah-Muthu, S.S.; Geelen, A.; Boer, J.; Schouw, van der Y.T.; Bueno de Mesquita, H.B.; Beulens, J.W.J.
2014-01-01
Background Global and national dietary guidelines have been created to lower chronic disease risk. The aim of this study was to assess whether greater adherence to the WHO guidelines (Healthy Diet Indicator (HDI)); the Dutch guidelines for a healthy diet (Dutch Healthy Diet-index (DHD-index)); and
Borges da Silveira Bezerra, Paula; Ludovique Callegari, Camila; Ribas, Aline; Lucena, André F. P.; Portugal-Pereira, Joana; Koberle, Alexandre; Szklo, Alexandre; Schaeffer, Roberto
2017-09-01
Universal access to electricity is deemed critical for improving living standards and indispensable for eradicating poverty and achieving sustainable development. In 2003, the ‘Luz para Todos’ (LpT—Light for All) program was launched aiming to universalize access to electricity in Brazil. The program focused on rural and isolated areas, also targeting to bring development to those regions along with electrification. This paper evaluates the results of the LpT program in improving socio-economic development in the poorest regions of Brazil. After an initial qualitative analysis, an empirical quantitative assessment of the influence of increased electrification rates on the components of the Human Development Index (HDI) is performed. The empirical results of this study showed that electrification had a positive influence on all dimensions of the HDI, with the education component having the strongest effect. Although complementary policies were needed to achieve this, results show that electricity access is a major requirement to improve quality of life.
NATIONAL CULTURAL DIMENSIONS AND WELL-BEING IN SOME COUNTRIES OF THE WORLD, IN 2013
Directory of Open Access Journals (Sweden)
Liliana DUGULEANĂ
2014-12-01
Full Text Available Cultural dimensions of Hofstede’s model were developed in different models of cultural influences in business. Erin Meyer, the author of the Culture Map, uses eight scales for defining a national cultural profile. The database of cultural profiles for some states of the World was built in time, by business leaders and it can be dynamically updated by adding the answers of new respondents to the online questionnaire. The performances of economic and social organizations influence the well-being of their nations. The paper uses the estimations of the national cultural profiles from Erin Meyer’s database and some indicators which characterize the well-being, like: human development index (HDI, the corruption perceptions index, the unemployment rate and inequality-adjusted HDI, in order to define how the culture influences the well-being. Using the Analysis of Principal Components in SPSS, there can be found the position of the analyzed countries about well-being in relation with their national cultural profile in businesses, in 2013.
Koelmel, Jeremy; Prasad, M N V; Pershell, Karoline
2015-01-01
Phytoremediation is often a low cost alternative to conventional remediation. To assess trends, a bibliometric approach using data from SciVerse Scopus, SciVerseHub, and GoogleTM Trends was used. Globally there is a linear increase in publications containing the word phytoremediation as a percent of all published papers in SciVerse Hub, with China, India, and the Philippines concentrating relatively more research in phytoremediation. Furthermore there was an inverse correlation between a country's Human Development Index (HDI) and a country's phytoremediation research output as a percent of total research. Results show a focus on phytoremediation in countries with low HDI values. This suggests that academic experts are available for advancing phytoremediation applications in countries where the majority of the effected population do not have the education, finances, and political leverage to obtain expensive conventional remediation efforts on their land. Phytoremediation can combine expert advice with affected parties commitment and labor to help mitigate the harms of polluted landscapes.
Directory of Open Access Journals (Sweden)
Cláudia Maria Martins
2001-10-01
Full Text Available OBJETIVO: Avaliar possíveis divergências no padrão reprodutivo de mulheres residentes em áreas de diferentes níveis de desenvolvimento humano, pela análise de suas taxas de fecundidade total e taxas específicas de fecundidade por idade. MÉTODOS: Foram estudados os 96 distritos do Município de São Paulo, agrupados em cinco áreas segundo ordem crescente dos valores assumidos pelo Indicador de Desenvolvimento Humano. O estudo compreendeu a população feminina de 15 a 49 anos e os nascimentos vivos ocorridos durante o ano de 1997. As fontes de obtenção dos dados foram as declarações de nascidos vivos e a contagem da população 1996. Foram trabalhadas as seguintes variáveis: IDH, distrito de residência e idade da mulher. RESULTADOS: As mulheres residentes na área de menor desenvolvimento humano apresentaram taxa de fecundidade total de 2,62, sendo que a cúspide (151/1.000 filhos por mulheres situou-se no grupo etário de 20 a 24 anos. Na área de maior indicador de desenvolvimento humano, observou-se menor número médio de filhos por mulher (1,67, e a cúspide (93/1.000 filhos por mulheres se situou no grupo etário de 25 a 29 anos. CONCLUSÕES: As mulheres residentes nas áreas de maior desenvolvimento humano apresentaram menor número médio de filhos e tendência a tê-los em idades mais avançadas, o que sugere a coexistência de distintos padrões reprodutivos no Município de São Paulo.OBJECTIVE: To assess potential discrepancies in reproductive patterns of women living in areas at different levels of human development by analyzing their total fertility rates and age-specific rates. METHODS: Ninety-six districts of the city of São Paulo (Brazil were grouped in 5 areas according to their human development index (HDI. Women aged 15 to 49 years were included in the study and data was obtained from live birth certificates during the year of 1997. Data was collected from live birth certificates and population census for the
Bradley, Robert H.; Putnick, Diane L.
2012-01-01
This study examined home environment conditions (housing quality, material resources, formal and informal learning materials) and their relations with the Human Development Index (HDI) in 28 developing countries. Home environment conditions in these countries varied widely. The quality of housing and availability of material resources at home were…
Dietary patterns and health in the elderly : a north - south comparison in Europe
Huijbregts, P.P.C.W.
1997-01-01
The aim of this thesis was to gain more insight into the role of dietary intake as a determinant of different aspects of health, e.g. cognitive function, functional status, self-rated health and mortality. Dietary patterns, obtained from cluster analysis or a healthy diet indicator (HDI),
Thorvaldsson, Valgeir; Skoog, Ingmar; Johansson, Boo
2017-03-01
Terminal decline (TD) refers to acceleration in within-person cognitive decline prior to death. The cognitive reserve hypothesis postulates that individuals with higher IQ are able to better tolerate age-related increase in brain pathologies. On average, they will exhibit a later onset of TD, but once they start to decline, their trajectory is steeper relative to those with lower IQ. We tested these predictions using data from initially nondemented individuals (n = 179) in the H70-study repeatedly measured at ages 70, 75, 79, 81, 85, 88, 90, 92, 95, 97, 99, and 100, or until death, on cognitive tests of perceptual-and-motor-speed and spatial and verbal ability. We quantified IQ using the Raven's Coloured Progressive Matrices (RCPM) test administrated at age 70. We fitted random change point TD models to the data, within a Bayesian framework, conditioned on IQ, age of death, education, and sex. In line with predictions, we found that 1 additional standard deviation on the IQ scale was associated with a delay in onset of TD by 1.87 (95% highest density interval [HDI; 0.20, 4.08]) years on speed, 1.96 (95% HDI [0.15, 3.54]) years on verbal ability, but only 0.88 (95% HDI [-0.93, 3.49]) year on spatial ability. Higher IQ was associated with steeper rate of decline within the TD phase on measures of speed and verbal ability, whereas results on spatial ability were nonconclusive. Our findings provide partial support for the cognitive reserve hypothesis and demonstrate that IQ can be a significant moderator of cognitive change trajectories in old age. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Isocyanate exposure and asthma in the UK vehicle repair industry.
Stocks, S J; Jones, K; Piney, M; Agius, R M
2015-12-01
Organic diisocyanates are a common cause of occupational asthma, particularly in motor vehicle repair (MVR) workers. The UK Health & Safety Laboratory provides screening for urinary hexamethylenediamine (UHDA), a biomarker of exposure to 1,6-hexamethylene diisocyanate (HDI). The UK Surveillance of Work-related and Occupational Respiratory Disease scheme (SWORD) has collected reports of occupational asthma since 1996. To compare trends in HDI exposure with trends in the incidence of work-related asthma attributed to isocyanates or paint spraying in MVR workers reported to SWORD. Two-level regression models were used to estimate trends in UHDA levels and work-related asthma in MVR workers reported to SWORD. The direction and magnitude of the trends were compared descriptively. From 2006 to 2014, there was a significant decline in the number of urine samples with detectable levels of UHDA (odds ratio = 0.96; 95% confidence intervals 0.94-0.98) and minimal change in those over the guidance value (1.03; 1.00-1.06). Over the same period, there was a significant decline in all asthma cases attributed to isocyanates or paint spraying reported to SWORD (0.90; 0.86-0.94) and a non-significant decline among MVR workers (0.94; 0.86-1.02). The simultaneous decrease in HDI exposure and incident cases of asthma reported to SWORD is temporally consistent with a reduction in exposure to airborne isocyanate leading to a reduction in asthma. Although this is not direct evidence of a causal relationship between the two trends, it is suggestive. © The Author 2015. Published by Oxford University Press on behalf of the Society of Occupational Medicine.
Work disability benefits due to musculoskeletal disorders among Brazilian private sector workers.
Vieira, E R; Albuquerque-Oliveira, P R; Barbosa-Branco, A
2011-05-14
To evaluate the prevalence and characteristics of disability benefits due to musculoskeletal disorders (MSD) granted to Brazilian private sector workers. This was a population-based epidemiological study of MSD-related benefits among registered private sector workers (n=32 959 329). The prevalence (benefits/10 000 workers/year) of work disability benefits was calculated by gender, age, state, Human Development Index (HDI), economic activity, MSD type and work-relatedness. The prevalence of MSD-related benefits in Brazil among registered private sector workers in 2008 was 93.6/10 000 workers. The prevalence increased with age, and was higher for women (112.2) than for men (88.1), although the former had shorter benefit duration. The gender-adjusted prevalence by state varied from 16.6 to 90.3 for non-work-related, and from 7.8 to 59.6 for work-related benefits. The Brazilian states with a high-very high HDI had the highest prevalence. The top four most common types of MSD-related benefits were due to back pain, intervertebral disc disorders, sinovitis/tenosynovitis and shoulder disorders. MSD is a frequent cause of work disability in Brazil. There were differences in prevalence among economic activities and between states grouped by HDI. This study demonstrates that further evaluation of the contributing factors associated with MSD-related disability benefits is required. Factors that should be considered include production processes, political organisation, socioeconomic and educational characteristics, the compensation and recording systems, and employee-employer power relationships. These factors may play an important role in the prevalence of MSD-related disability benefits, especially in countries with large socioeconomic iniquities such as Brazil.
Bello, Dhimiter; Redlich, Carrie A; Stowe, Meredith H; Sparer, Judy; Woskie, Susan R; Streicher, Robert P; Hosgood, H Dean; Liu, Youcheng
2008-03-01
Skin exposure to isocyanates, in addition to respiratory exposures, may contribute to sensitization and asthma. Quantitative skin exposure data are scarce and quantitative methods limited. As part of the Survey of Painters and Repairers of Autobodies by Yale study, a method to sample and quantify human isocyanate skin exposure was developed (based on NIOSH 5525 method) and used to evaluate aliphatic isocyanate skin exposure in 81 auto body shop painters and body technicians. Wipe samples were collected from unprotected skin and from under PPE (gloves, clothing and respirator) using a polypropylene glycol-impregnated wipe. Hexamethylene diisocyanate (HDI), its polyisocyanates [HDI-derived polyisocyanates (pHDI)], isophorone diisocyanate (IPDI) and its polyisocyanates and IPDI-derived polyisocyanates (pIPDI) were quantified separately and also expressed as the total free isocyanate groups (total NCO). For unprotected skin areas, 49 samples were collected for spray painting, 13 for mixing, 27 for paint-related tasks (e.g. sanding and compounding) and 53 for non-paint-related tasks. Forty-three samples were also collected under PPE. The geometric mean (GM) [geometric standard deviation (GSD)] total NCO concentrations (ng NCO cm(-2)) for unprotected skin (hands, face and forearms) was 1.9 (10.9) and range 0.0-64.4. pHDI species were the major contributor to the total NCO content. Levels were very variable, with the highest concentrations measured for clear coating and paint mixing tasks. Isocyanate skin exposure was also commonly detected under PPE, with 92% of samples above the limit of detection. Levels were very variable with the overall GM (GSD) total NCO (ng NCO cm(-2)) under PPE 1.0 (5.2) and range (0.0-47.0) and similar under the different PPE (glove, respirator and clothing). The highest concentrations were detected for mixing and spraying tasks, 6.9 (5.3) and 1.0 (5.2), respectively. Levels under PPE were generally lower than unpaired samples obtained with no
Kodanlikud "kaubikud" / Aimo Niemi
Niemi, Aimo
2013-01-01
TM võrdleb premium-klassi väiksemaid universaale: Audi A4 Avant 2,0 TDI Quattro Stronic ; BMW 320d A Touring ; Citroën DS5 HDi 163 So Chic AT ; Mercedes-Benz C 250 CDI Blue Efficiency 4Matic T ; Volvo V60 D4 A R-Design
Implications of rural irrigation schemes on household economy. A ...
African Journals Online (AJOL)
... and quality of life as measured through the use of standardised HDI. In light of the above, there is a need to fund and develop more rural irrigation schemes so as to ensure livelihood security and rural development in Zimbabwe. Keywords: Rural livelihood, Poverty, Climate change, Irrigation, Lower Gweru, Extension.
Luksust ja ruumi / Aimo Niemi, Jyri Ajomaa, Pekka Aromaa, Jari Pitkäjärvi
2010-01-01
TM võrdleb diiselmootoriga universaale: Citroën C5 1,6 Hdi Tourer; Ford Mondeo 2,0 TDCi DPF Wagon; Opel Insignia 2,0 CDTi Sports Tourer Cosmo; Renault Laguna Sport Tourer 1,5 dCi; Toyota Avensis D-4D DPF Linea Sol Wagon; Volkswagen Passat Variant 2,0 TDI
Preparation of eugenol-based polyurethane
Li, Yupeng; Luo, Fang; Cheng, Chuanjie
2018-03-01
The regenerative eugenol was used as the starting material to prepare diol species by two steps, with a total yield of 28%. Furthermore, the prepared diol reacts with 1,6-hexadiisocyanate(HDI) to afford the corresponding polyurethane (PU). The structure of intermediates and PU are characterized by 1H-NMR or IR.
Attracting Attention for the Cause. The Reporting of Three Indices in the UK National Press
Morse, Stephen
2011-01-01
Indicators and indices (a collection of indicators into a single value) have been promoted for some time as convenient devices for the presentation of complex datasets to a more general audience. Examples of indices are the corruption perception index (CPI), human development index (HDI) and ecological footprint (EF). The research reported in this…
The effect of oxidation on the enzyme-catalyzed hydrolytic biodegradation of poly(urethane)s.
Labow, Rosalind S; Tang, Yiwen; McCloskey, Christopher B; Santerre, J Paul
2002-01-01
Although the biodegradation of polyurethanes (PU) by oxidative and hydrolytic agents has been studied extensively, few investigations have reported on the combination of their effects. Since neutrophils (PMN) arrive at an implanted device first and release HOCl, followed by monocyte-derived macrophages (MDM) which have potent esterase activities and oxidants of their own, the combined effect of oxidative and hydrolytic degradation on radiolabeled polycarbonate-polyurethanes (PCNU)s was investigated and compared to that of a polyester-PU (PESU) and a polyether-PU (PEU). The PCNUs were synthesized with PCN (MW = 1,000), and butanediol (14C-BD) and one of two diisocyanates, hexane-1,6-diisocyanate (14C-HDI) or methylene bis-p-phenyl diisocyanate (MDI). The PESU and PEU were synthesized using toluene-diisocyanate (14C-TDI), with polycaprolactone and polytetramethylene oxide as soft segments respectively, and ethylene diamine as the chain extender. The effect of pre-treatment with 0.1 mM HOC1 for 1 week on the HDI-based PCNUs and both TDI-based PUs resulted in a significant inhibition of radiolabel release (RR) elicited by cholesterol esterase (CE), when compared to buffer alone, whereas the MDI-based PCNU showed a small but significant increase. When PMN were activated on the HDI-based PCNU surface with phorbol myristate acetate (PMA), HOCl was released for 3 h, and was almost completely abolished by sodium azide (AZ). Simultaneously, the PMN-elicited RR, shown previously to be due to the esterolytic cleavage by serine proteases, was inhibited approximately 75% by PMA-activation of the cells, but significantly increased relative to the latter when AZ was added. Both in vitro oxidation by HOCl and the release of HOCI by PMN were associated with the inhibition of RR and suggest perturbations between oxidative and hydrolytic mechanisms of biodegradation.
Carlson, Matthew L; Tveiten, Øystein Vesterli; Driscoll, Colin L; Boes, Christopher J; Sullan, Molly J; Goplen, Frederik K; Lund-Johansen, Morten; Link, Michael J
2015-11-01
The primary goals of this study were: 1) to examine the influence of disease and treatment on headache in patients with sporadic vestibular schwannoma (VS); and 2) to identify clinical predictors of long-term headache disability. This was a cross-sectional observational study with international multicenter enrollment. Patients included those with primary sporadic Headache Disability Inventory (HDI), the Hospital Anxiety and Depression Scale, and a VS symptom questionnaire. The main outcome measures were univariate and multivariable associations with HDI total score. The overall survey response rate was 79%. Data from 538 patients with VS were analyzed. The mean age at time of survey was 64 years, 56% of patients were female, and the average duration between treatment and survey was 7.7 years. Twenty-seven percent of patients received microsurgery, 46% stereotactic radiosurgery, and 28% observation. Patients with VS who were managed with observation were more than twice as likely to have severe headache disability compared with 103 control subjects without VS. When accounting for baseline differences, there was no statistically significant difference in HDI outcome between treatment modalities at time of survey. Similarly, among the microsurgery cohort, the long-term risk of severe headache disability was not different between surgical approaches. Multivariable regression demonstrated that younger age, greater anxiety and depression, and a preexisting diagnosis of headache were the primary predictors of severe long-term headache disability, while tumor size and treatment modality had little influence. At a mean of almost 8 years following treatment, approximately half of patients with VS experience headaches of varying frequency and severity. Patient-driven factors including age, sex, mental health, and preexisting headache syndrome are the strongest predictors of long-term severe headache disability. Tumor size and treatment modality have less impact. These data
Directory of Open Access Journals (Sweden)
Fernando Ferreira Carneiro
2012-06-01
Full Text Available O Brasil, mesmo com os avanços nos indicadores socioeconômicos ainda se apresenta desigual, situação fruto de um desenvolvimento historicamente excludente. Foi escolhido o Índice de Desenvolvimento Humano (IDH e indicadores sociais, econômicos, ambientais e de saúde para exemplificar essa problemática. Foram selecionados os municípios que apresentavam mais baixos IDHs no ano de 2000 e comparada sua evolução temporal entre 2000 e 2010 por meio de indicadores relacionados aos pilares econômico, ambiental e social do desenvolvimento sustentável. Estes possuem um IDH classificado como baixo (Despite its progress in terms of socio-economic indicators, Brazil is still unequal, which is due to an unequal and exclusionary historical process. In this paper we selected the Human Development Index - HDI and other social, economic, environmental and health indicators to exemplify this situation. We selected the municipalities that had the lowest HDI in the country in 2000 comparing their evolution over time between 2000 and 2010 by means of indicators linked to the economic, environmental and social pillars of sustainable development. These municipalities have an HDI classified as low (<0.500, and correspond to countries such as Laos, Yemen, Haiti and Madagascar. At national level, data for the decade show a significant improvement in economic indicators (decrease from 23% to 8.9% of people living on less than a quarter of the minimum wage; social indicators (increase from 86.5% to 90.2% of literacy in women, and the environmental indicator associated with access to the water grid, which also improved to a lesser extent (increase from 81% to 85%. It was concluded that in order to achieve sustainable development with quality of life, the improvement of sanitation and education indicators should be a priority for Brazil.
Kornhuber, Kai; Rybski, Diego; Costa, Luis; Reusser, Dominik E.; Kropp, Jürgen P.
2014-05-01
The Environmental Kuznets Curves (EKC) postulates that pollution increases with the income per capita up to a maximum, above which it decreases with the further increase in income per capita, i.e. following an inverse U-shape in the pollution vs. income per capita. It is commonly believed that EKC occurs for "local" pollutants such as nitrogen oxide and sulfur dioxide, but does not hold for CO2 emissions. This is attributed to the fact that while "local" pollutants cause a visible environmental damage on the local/regional scale (which authorities/governments seek to avoid), the consequences of CO2 emission have no immediate attributable local/regional consequences. We review EKC for CO2 exploring its relation between CO2 per capita and the Human Development Index (HDI) between 1990 and 2010 obtained from the World Bank database. We find evidence for a reduction in CO2 emissions per capita in highly developed countries. We propose a model according to which the emissions per capita of a country are composed of a component related to the actual state of development and a component related to the change of development. The model leads to four distinct cases of which two have EKC shape and two imply saturation. This outcome is in line with previously suggested qualitative relations. Our analysis indicates that the EKC shaped cases better describes the empirical values. We explore the less extreme version corresponding to the so-called conventional EKC and study the maximum of the fitted curve, providing a threshold-value for the HDI and a typical maximum value for the emissions per capita. We find that approx. 5 countries have crossed the CO2-HDI maximum, corresponding to approx. 1.5% of the world population.
The inhibitory activity of the extracts of popular medicinal herbs on ...
African Journals Online (AJOL)
One of the major clinical risks of such concomitant herb-drug use is pharmacokinetic herb-drug interaction (HDI). ... (HLM) to monitor the phenacetin O-deethylation, diclofenac 4'-hydroxylation, S-mephenytoin 4'-hydroxylation and testosterone 6 β-hydroxylation as respective probe reactions for CYP1A2, CYP2C9, CYP2C19 ...
The efficacy of oral habit modification on headache.
Agha-Hosseini, Farzaneh; Sheykhbahaei, Nafiseh; Mirzaii-Dizgah, Iraj; Fatehi, Farzad
2017-12-01
Headache is the most common complaint of patients suffering from temporomandibular joint disorders (TMDs). Thus, temporomandibular joint (TMJ) examinations maybe necessary in patients with headache. Considering the high prevalence of bruxism and TMDs in patients with headache the effects of conservative TMD treatment on headache should be assessed. Patients were questioned about headaches in the past three months. Those responding affirmatively to this question were examined for TMD and bruxism. After the examinations, 219 patients remained in the study and received self-management instructions. Patients were requested to modify oral habits except when eating or sleeping. The degree of pain (visual analogue scale), headache disability index (HDI), frequency of headaches (FH) per month and TMD intensity were evaluated. The median levels of pain, HDI, FH, and TMD intensity were 8, 44, 8, and 7, respectively, before modifying oral habits and decreased to 4, 24, 2, and 3, respectively, after intervention. These decreases were statistically significant. Having patients maintain free space between the teeth and relax muscles can be an efficient method to treat headache and TMD, especially when repeated frequently.
DEFF Research Database (Denmark)
Jacobsen, M. W.; Smedegaard, L.; Sørensen, Sune Riis
2017-01-01
Elucidating barriers to gene flow is important for understanding the dynamics of speciation. Here we investigate pre- and post-zygotic mechanisms acting between the two hybridizing species of Atlantic eels: Anguilla anguilla and A. rostrata. Temporally varying hybridization was examined by analyz...... in natural hybrids.Heredity advance online publication, 9 November 2016; doi:10.1038/hdy.2016.96....
The Republic of the Philippines: Background and U.S. Relations
2009-01-15
Central Intelligence Agency, World Factbook; United Nations Development Programme. The HDI ranks countries according to human development indicators of...economic assistance in Mindanao. The Philippines faces terrorist threats from several groups, including Jemaah Islamiyah (JI), the main Southeast Asian ...people contacts. Filipino-Americans number approximately three million, making them the second- largest Asian -American group in the United States
Determinants of Poverty in Sub-Saharan Africa
African Journals Online (AJOL)
Nekky Umera
sub-region one of the poorest in the world with 46.4 percent of its people living on ... variables on the level of poverty as observed in Sub-Saharan Africa, using a ... Studies by UNDP also advocate the use of Human Development Index (HDI) and .... Gdisi = gender discrimination proxy by low women status relative to men.
N-halamine-based rechargeable antimicrobial and biofilm-controlling polyurethane
Sun, Xinbo; Cao, Zhengbing; Porteous, Nuala; Sun, Yuyu
2012-01-01
An N-halamine precursor, 5, 5-dimethyl hydantoin (DMH), was covalently linked to the surface of polyurethane (PU) with 1,6-hexamethylene diisocyanate (HDI) as a coupling agent. The reaction pathways were investigated using propyl isocyanate (PI) as a model compound, and the results suggested that the imide and amide groups of DMH had very similar reactivity toward the isocyanate groups on PU surfaces activated with HDI. After bleach treatment, the covalently bound DMH moieties were transformed into N-halamines. The new N-halmaine-based PU provided potent antimicrobial effects against Staphylococcus aureus (S. aureus, Gram-positive), Escherichia coli (E. coli, Gram-negative), methicillin-resistant staphylococcus aureus (MRSA, drug resistant Gram-positive bacteria), vancomycin-resistant enterococcus (VRE, drug resistant Gram-positive bacteria), and Candida albicans (C. ablicans, fungi), and successfully prevented bacterial and fungal biofilm formation. The antimicrobial and biofilm-controlling effects were stable for longer than 6 months under normal storage in open air. Furthermore, if the functions were lost due to prolonged use, they could be recharged by another chlorination treatment. The recharging could be repeated as needed to achieve long-term protection against microbial contamination and biofilm-formation. PMID:22244984
Espí-López, Gemma V; Zurriaga-Llorens, Rosario; Monzani, Lucas; Falla, Deborah
2016-10-01
Manipulative techniques have shown promising results for relief of tension-type headache (TTH), however prior studies either lacked a control group, or suffered from poor methodological quality. The aim of this study was to compare the effect of spinal manipulation combined with massage versus massage alone on range of motion of the cervical spine, headache frequency, intensity and disability in patients with TTH. Randomized, single-blinded, controlled clinical trial. University clinic. We enrolled 105 subjects with TTH. Participants were divided into two groups: 1) manipulation and massage; 2) massage only (control). Four treatment sessions were applied over four weeks. The Headache Disability Inventory (HDI) and range of upper cervical and cervical motion were evaluated at baseline, immediately after the intervention and at a follow-up, 8 weeks after completing the intervention. Both groups demonstrated a large (ƒ=1.22) improvement on their HDI scores. Those that received manipulation reported a medium-sized reduction (ƒ=0.33) in headache frequency across all data points (Pheadache. Although massage provided relief of headache in TTH sufferers, when combined with cervical manipulation, there was a stronger effect on range of upper cervical spine motion.
The dynamics of democracy, development and cultural values.
Spaiser, Viktoria; Ranganathan, Shyam; Mann, Richard P; Sumpter, David J T
2014-01-01
Over the past decades many countries have experienced rapid changes in their economies, their democratic institutions and the values of their citizens. Comprehensive data measuring these changes across very different countries has recently become openly available. Between country similarities suggest common underlying dynamics in how countries develop in terms of economy, democracy and cultural values. We apply a novel Bayesian dynamical systems approach to identify the model which best captures the complex, mainly non-linear dynamics that underlie these changes. We show that the level of Human Development Index (HDI) in a country drives first democracy and then higher emancipation of citizens. This change occurs once the countries pass a certain threshold in HDI. The data also suggests that there is a limit to the growth of wealth, set by higher emancipation. Having reached a high level of democracy and emancipation, societies tend towards equilibrium that does not support further economic growth. Our findings give strong empirical evidence against a popular political science theory, known as the Human Development Sequence. Contrary to this theory, we find that implementation of human-rights and democratisation precede increases in emancipative values.
Effects on well-being of investing in cleaner air in India.
Sanderson, Warren; Striessnig, Erich; Schöpp, Wolfgang; Amann, Markus
2013-01-01
Over the past decade, India has experienced rapid economic growth along with increases in levels of air pollution. Our goal is to examine how alternative policies for air pollution abatement affect well-being there. In particular, we estimate the effects of policies to reduce the levels of ambient fine particulates (PM2.5), which are especially harmful to human health, on well-being, quantified using the United Nations' human development index (HDI). Two of the three dimensions of this index are based on gross domestic product (GDP) per capita and life expectancy. Our approach allows reductions in PM2.5 to affect both of them. In particular, economic growth is affected negatively through the costs of the additional pollution control measures and positively through the increased productivity of the population. We consider three scenarios of PM2.5 abatement, corresponding to no further control, current Indian legislation, and current European legislation. The overall effect in both control scenarios is that growth in GDP is virtually unaffected relative to the case of no further controls, life expectancy is higher, and well-being, as measured by the HDI, is improved. In India, air pollution abatement investments clearly improve well-being.
Variables associated with the performance of Centers for Dental Specialties in Brazil.
Cortellazzi, Karine Laura; Balbino, Edna Cesar; Guerra, Luciane Miranda; Vazquez, Fabiana de Lima; Bulgareli, Jaqueline Vilela; Ambrosano, Glaucia Maria Bovi; Pereira, Antonio Carlos; Mialhe, Fábio Luiz
2014-12-01
The aim of this study was to evaluate the performance of the Centers for Dental Specialties (CDS) in the country and associations with sociodemographic indicators of the municipalities, structural variables of services and primary health care organization in the years 2004-2009. The study used secondary data from procedures performed in the CDS to the specialties of periodontics, endodontics, surgery and primary care. Bivariate analysis by χ2 test was used to test the association between the dependent variable (performance of the CDS) with the independents. Then, Poisson regression analysis was performed. With regard to the overall achievement of targets, it was observed that the majority of CDS (69.25%) performance was considered poor/regular. The independent factors associated with poor/regular performance of CDS were: municipalities belonging to the Northeast, South and Southeast regions, with lower Human Development Index (HDI), lower population density, and reduced time to deployment. HDI and population density are important for the performance of the CDS in Brazil. Similarly, the peculiarities related to less populated areas as well as regional location and time of service implementation CDS should be taken into account in the planning of these services.
Obesity and socioeconomic status in developing countries: a systematic review.
Dinsa, G D; Goryakin, Y; Fumagalli, E; Suhrcke, M
2012-11-01
We undertook a systematic review of studies assessing the association between socioeconomic status (SES) and measured obesity in low- and middle-income countries (defined by the World Bank as countries with per capita income up to US$12,275) among children, men and women. The evidence on the subject has grown significantly since an earlier influential review was published in 2004. We find that in low-income countries or in countries with low human development index (HDI), the association between SES and obesity appears to be positive for both men and women: the more affluent and/or those with higher educational attainment tend to be more likely to be obese. However, in middle-income countries or in countries with medium HDI, the association becomes largely mixed for men and mainly negative for women. This particular shift appears to occur at an even lower level of per capita income than suggested by an influential earlier review. By contrast, obesity in children appears to be predominantly a problem of the rich in low- and middle-income countries. © 2012 The Authors. obesity reviews © 2012 International Association for the Study of Obesity.
Air Pollution and Human Development in Europe: A New Index Using Principal Component Analysis
Directory of Open Access Journals (Sweden)
Ana-Maria Săndică
2018-01-01
Full Text Available EU countries to measure human development incorporating the ambient PM2.5 concentration effect. Using a principal component analysis, we extract the information for 2010 and 2015 using the Real GDP/capita, the life expectancy at birth, tertiary educational attainment, ambient PM2.5 concentration, and the death rate due to exposure to ambient PM2.5 concentration for 29 European countries. This paper has two main results: it gives an overview about the relationship between human development and ambient PM2.5 concentration, and second, it provides a new quantitative measure, PHDI, which reshapes the concept of human development and the exposure to ambient PM2.5 concentration. Using rating classes, we defined thresholds for both HDI and PHDI values to group the countries in four categories. When comparing the migration matrix from 2010 to 2015 for HDI values, some countries improved the development indicator (Romania, Poland, Malta, Estonia, Cyprus, while no downgrades were observed. When comparing the transition matrix using the newly developed indicator, PHDI, the upgrades observed were for Denmark and Estonia, while some countries like Spain and Italy moved to a lower rating class due to ambient PM2.5 concentration.
Healthcare Waste Generation Worldwide and Its Dependence on Socio-Economic and Environmental Factors
Directory of Open Access Journals (Sweden)
Minas Minoglou
2017-02-01
Full Text Available This paper examines the dependence of the healthcare waste (HCW generation rate on several social-economic and environmental parameters. Correlations were calculated between the quantities of healthcare waste generated (expressed in kg/bed/day versus economic indices (GDP, healthcare expenditure per capita, social indices (HDI, IHDI, MPI, life expectancy, mean years of schooling, HIV prevalence, deaths due to tuberculosis and malaria, and under five mortality rate, and an environmental sustainability index (total CO2 emissions from 42 countries worldwide. The statistical analysis included the examination of the normality of the data and the formation of linear multiple regression models to further investigate the correlation between those indices and HCW generation rates. Pearson and Spearman correlation coefficients were also calculated for all pairwise comparisons. Results showed that the life expectancy, the HDI, the mean years of schooling and the CO2 emissions positively affect the HCW generation rates and can be used as statistical predictors of those rates. The resulting best reduced regression model included the life expectancy and the CO2 emissions and explained 85% of the variability of the response.
Breast Cancer Mortality In Brazil: Correlation With Human Development Index
Directory of Open Access Journals (Sweden)
Mara Rejane Barroso Barcelos
2017-01-01
Full Text Available Background: Mortality from breast cancer decreased in high-income countries, while countries with middle and low incomes as Brazil still has upward trend. However, large geographical variations among the federal units are observed in the country. The aim of the study was to evaluate the trend of specific mortality from breast cancer in women over 20 years old years among different states of Brazil from 1996 to 2012. Methods and Findings: Ecological study, using linear regression model for temporal analysis of specific mortality coefficient from malignant neoplasm of breast. We also checked the degree of its correlation with the HDI for the states of Brazil during the stated period. There was an increase in the specific mortality rate for malignant neoplasm of the breast in order of 33%, with range from 23.2 to 30.8 / 100,000 inhabitants. The states with the highest human development HDI in 2010, showed the largest specific mortality rates of breast cancer. Conclusion: Taking the trends of mortality from cancer an important role, this study confirms the need for improvements in mammography coverage, following radiological lesions suspected and access to appropriate therapy.
Carboxylated Polyurethanes Containing Hyperbranched Polyester Soft Segments
Directory of Open Access Journals (Sweden)
Žigon, M.
2006-09-01
Full Text Available hyperbranched polyester soft segments (HB PU with functional carboxylic groups in order to enable the preparation of stable HB PU dispersions. Carboxylated hyperbranched polyurethanes were synthesized using a hyperbranched polyester based on 2,2-bis(methylolpropionic acid of the fourth pseudo-generation (Boltorn H40 and hexamethylene (HDI or isophorone diisocyanate (IPDI. The reactivity of hyperbranched polyester with HDI was lower than expected, possibly due to the presence of less reactive hydroxyl groups in the linear repeat units. A gel was formed at mole ratios rNCO/OH = 1:2 or 1:4. The synthesis of HB PU was performed with partly esterified hyperbranched polyester with lowered hydroxyl functionality. The carboxyl groups were incorporated in the HB PU backbone by reaction of residual hydroxyl groups with cis-1,2-cyclohexanedicarboxylic anhydride. HB PU aqueous dispersions were stable at least for two months, although their films were brittle. The tensile strength and Young's modulus of blends of linear and HB PU decreased with increasing content of HB PU whereas elongation at break remained nearly constant, which was explained in terms of looser chain packing due to more open tree-like hyperbranched structures.
Rural electrification of the Brazilian Amazon - Achievements and lessons
International Nuclear Information System (INIS)
Gomez, Maria F.; Silveira, Semida
2010-01-01
The Brazilian government has the ambition to provide complete electricity coverage for all citizens as a means to promote development and reduce inequalities. Full coverage implies the provision of electricity to 15 million people in the country by the end of 2010 through the program Luz para Todos (LPT - light for all) launched in 2003. So far, 11 million people have benefited, 2 million of which live in the Amazon. In this paper, we analyze the linkages between development and rural electrification through the Human Development Index (HDI) and within the context of the Amazon. We examine the suitability of the HDI as a planning and monitoring tool for improving energy access and development. We show that the recognition of electricity access as a driver for development has led to concrete goals for electrification, actual action and welfare improvement. Our study serves to highlight the role of LPT in the development of the Amazon region, and the specific features and achievements of the Brazilian policy for universal electrification. We conclude that some challenges related to the electrification of isolated areas still lie ahead. We finalize with a discussion on the relevance of the Brazilian experience to other developing countries.
DESENVOLVIMENTO ECONÔMICO E SOCIAL POR MEIO DE INVESTIMENTOS EM INFRAESTRUTURA: O CASO DA BR-163
Directory of Open Access Journals (Sweden)
Fernando Vinícius da Rocha
2018-01-01
Full Text Available The logistics infrastructure are deep related to the economic development. Several studies has shown the existing infrastructure problems in Brazil, due to the low level of investment by the state and the private sector, which generates inefficiencies for many sectors of the economy. In this subject this paper analyzes the economic and social development as consequences of investment in transport infrastructure. The article analyzes the effects of the BR-163 highway in the Brazilian human development index (HDI of the municipalities in the states of Mato Grosso (MT and Pará (PA. Methodologically, the Propensity Score Matching (PSM was the statistical method used, which, by comparison between the municipalities, estimates the average effect of the presence of the highway BR-163. The findings show a positive effect in social and economics indicators as a result of investments in logistics infrastructure. In the Mato Grosso (MT and Pará (PA states, municipalities located around this highway has higher HDI in relation to other comparable municipalities. The findings highlight the importance of improvements of public policies that aims to promote economic development through infrastructure investments in Brazil.
Poly(Lactic Acid) Based Flexible Films
Fathilah binti Ali; Jamarosliza Jamaluddin; Arun Kumar Upadhyay
2014-01-01
Poly(lactic acid) (PLA) is a biodegradable polymer which has good mechanical properties, however, its brittleness limits its usage especially in packaging materials. Therefore, in this work, PLA based polyurethane films were prepared by synthesizing with different types of isocyanates; methylene diisocyanate (MDI) and hexamethylene diisocyanates (HDI). For this purpose, PLA based polyurethane must have good strength and flexibility. Therefore, polycaprolactone which has b...
Directory of Open Access Journals (Sweden)
Israel Teoldo da Costa
2013-03-01
Full Text Available O presente trabalho objetiva identificar a possível influência do Índice de Desenvolvimento Humano (IDH e da data de nascimento (DN na ascensão de jogadores ao alto nível de rendimento. A amostra integra os 643 jogadores que disputaram o Campeonato Brasileiro Série A de 2010. Foram coletados dados referentes à data e ao local de nascimento juntamente com seu IDH. Foi utilizada a estatística descritiva e os testes Kolmogorov-Smirnov, Qui-quadrado, Kruskall-Wallis e coeficiente de corelação de Pearson. O nível de significância adotado foi de α=0,05. Os resultados sugerem que jogadores nascidos em cidades com valores populacionais inferiores a 100 mil habitantes, com IDH médio (entre 0,501-0,800 e, nascidos nos primeiros meses do ano, apresentam maiores chances de atingir a elite. Afigura-se plausível concluir que a DN e o IDH são fatores que associados podem determinar a ascensão de jogadores ao alto rendimento.The present study verifies the possible influence of the human development index (HDI and the birth-date (BD on the climb up to higher performance in sports, considering Brazilian football context. The sample comprised all 643 players from 20 teams of the Premier Football League in Brazil. The data were collected from official website of Brazilian National Federation, United Nations Development Programme and Brazilian Institute of Geography and Statistics. Descriptive analysis, Kolmogorov-Smirnov test, chi-square test (c ², Pearson correlation and Kruskall-Wallis H test were carried out. The level of significance was set at α=0.05. The results suggested that contextual factors associated with size and HDI of birth-place and birth-date contribute to the achievement of the Premier Football League. Thus, players were born in the first months of the year and in cities with medium or higher HDI had more conditions to climb up the elite level of Brazilian Football.
Isolation of thymus gland fractions and the determination of their biological activity
Directory of Open Access Journals (Sweden)
MILENA RADETA
2007-03-01
Full Text Available A calf thymus extract was prepared and fractionated into lipid and non-lipid fractions. The non-lipid fraction was isolated from the calf thymus extract using the Folch method. The components isolated from the non-lipid fraction were characterized by IR, NMR, biuret and HPLC method. The results of the analyses indicated the presence of peptides. The lipid fraction contained phospholipids, glycolipids and neutral lipids. The biological activity of both the isolated lipid and peptide fractions was determined by the in vivo hemolytic plaques method in Wistar rats with an involuted thymus. The peptide and phospholipid fractions of the thymus extract showed a significant increase of hemolytic plaques. The glycolipid and neutral lipid fraction failed to express a significant immunological response.
Spectrophotometric and Refractometric Determination of Total Protein in Avian Plasma
Directory of Open Access Journals (Sweden)
Rodica Căpriță
2013-10-01
Full Text Available The aim of this study was to compare the total protein values obtained in heparin plasma of chickens by a spectrophotometric technique (biuret method, and the values obtained on the same day in the same samples by refractometry. The results obtained by refractometry (average value 2.638±0.153g% were higher than those obtained by the spectrophotometric method (average value 2.441±0.181g%. There was a low correlation (r = 0.6709 between the total protein values, determined with both methods. Protein is the major determinant of plasma refractive index, but glucose contributes too. The refractometric method is not recommended in chickens for the determination of total protein, because avian blood glucose concentration averages about twice than in mammalian blood.
2011-01-01
TM võrdleb mahtuniversaale: Chevrolet Orlando LTZ M/T 2,0 D; Ford Grand C-Max Titanium 2,0 TDCi; Mazda5 1,6 TD Dynamic 6MT 5d; Nissan Qashqai+2 2WD 6MT 2,0 dCi DPF Acenta; Peugeot 5008 Hdi FAP; Renault Grand Scenic 1,9 dCi FAP; Toyota Verso 2,0 D-4D DPF; Volkswagen Touran Comfortline 1,6 TDI
The Southwest Pacific: U.S. Interests and China’s Growing Influence
2007-07-06
Pacific Island countries plus Australia and New Zealand. 22 Asian Development Bank, A Pacific Strategy for the New Millennium, September 2000. 23...Glance Region, Country and Date of Independence Former Colonial Ruler or Administrator Land Area (sq. kilo) Population GDP per capita (PPP) HDI Major...Order Code RL34086 The Southwest Pacific: U.S. Interests and China’s Growing Influence July 6, 2007 Thomas Lum Specialist in Asian Affairs Foreign
Gopal K. Singh, PhD; Romuladus E. Azuine, DrPH, RN; Mohammad Siahpush, PhD
2012-01-01
Objectives This study examined global inequalities in cervical cancer incidence and mortality rates as a function of cross-national variations in the Human Development Index (HDI), socioeconomic factors, Gender Inequality Index (GII), and healthcare expenditure. Methods Age-adjusted incidence and mortality rates were calculated for women in 184 countries using the 2008 GLOBOCAN database, and incidence and mortality trends were analyzed using the WHO cancer mortality database. Log-linear regre...
Aromaa, Juha
2009-01-01
Kaubikute võrdlustest: Citroën Jumper 30L2H1 2,2Hdi; Ford Transit 300M Van Base 2,2 TDCi; Mercedes-Benz Vito 109 CDI; Toyota Hiace 2,5 td D-4D 117; Fiat Scudo 2,0 JTD 12 PL/6; Hyundai H-1 2,5 CRDi; Opel Vivaro Van 2,0 CDTI L2H1; Volkswagen Transporter 1,9 TDI PD
Production chain of CMS pixel modules
2006-01-01
The pictures show the production chain of pixel modules for the CMS detector. Fig.1: overview of the assembly procedure. Fig.2: bump bonding with ReadOut Chip (ROC) connected to the sensor. Fig.3: glueing a raw module onto the baseplate strips. Fig.4: glueing of the High Density Interconnect (HDI) onto a raw module. Fig.5: pull test after heat reflow. Fig.6: wafer sensor processing, Indium evaporation.
A multicriterial analysis of national competitiveness: Evidences for a resilient economy
Directory of Open Access Journals (Sweden)
Sima Violeta
2017-01-01
Full Text Available This article is structured in three parts, as follows: In the first part, we summarized the different approaches of national competitiveness in the literature on the economic performance assessment, using specific indexes: Global Competitiveness Index (GCI, Ecological Performance Index (EPI, and Human Development Index (HDI, highlighting their advantages and limitations. These variables were analyzed ante-crisis and ex-crisis, assuming that the economic recession could generate some effects. Data sources are presented at the beginning of the 'Results and discussion' paragraph. Considering the diversity of the issues and the inhomogeneity of data describing those issues, GDP was used along with the four composite indicators: GCI, EPI, HDI, and Economic Resilience Index (ERI. The third part presents the main findings and their implications. Thus, a downward trend of the evolution of Romania's economic resilience index during 2008-2014 was observed. This decline appears to be due largely to the decrease in Social development sub-index and in Governance sub-index. The low level of the Romanian economy resilience is mainly explained by the low level of competitiveness and productivity of production factors. The obtained outcomes suggest that in addition to national competitiveness assessing, ERI evaluation is important because it can reveal the hidden sources of vulnerability of the economy to external shocks.
PENGARUH KEMISKINAN, PERTUMBUHAN EKONOMI, DAN BELANJA MODAL TERHADAP IPM JAWA TENGAH
Directory of Open Access Journals (Sweden)
Denni Sulistio Mirza
2015-12-01
Full Text Available The purpose of this study is to know the influences of poverty, economic growth and capital expenditures to the Human Development Index (HDI in Central Java. The result of Panel data regression indicates that poverty significantly and negative related to IPM. The economic growth has positive and significant impact on IPM. Next, the capital expenditures have a positive and significant effect on the HDI. It is recommended that the planning policy of government does not only view the achievement of economic growth but also the target of human development. It is because economic growth has not been able enough to improve the quality of human resources, especially in the aspects of education, health and income.Tujuan dari penelitian ini adalah mengetahui seberapa besar pengaruh kemiskinan, pertumbuhan ekonomi dan belanja modal terhadap Indeks Pembangunan Manusia (IPM di Jawa Tengah. Hasil regresi data panel menunjukkan bahwa kemiskinan berpengaruh negatif dan signifikan terhadap IPM. Pertumbuhan ekonomi berpengaruh positif dan signifikan terhadap IPM dan belanja modal berpengaruh positif dan signifikan terhadap IPM. Disarankan agar dalam merencanakan kebijakan pemerintah tidak hanya melihat dari pencapaian target peningkatan pertumbuhan ekonomi saja namun juga target peningkatan pembangunan manusia karena pertumbuhan ekonomi sendiri belum memadai untuk meningkatkan kualitas sumber daya manusia terutama pada aspek pendidikan, kesehatan dan pendapatan masyarakat.
Directory of Open Access Journals (Sweden)
Shyh-Yuan Lee
2018-01-01
Full Text Available The aim of this research is to synthesize polycaprolactone-based polyurethanes (PCL-based PUs that can be further used for the fabrication of guided bone regeneration (GBR membranes with higher tensile strength and elongation at break than collagen and PTFE membranes. The PCL-based PUs were prepared by the polymerization of polycaprolactone (PCL diol with 1,6-hexamethylene diisocyanate (HDI at different ratios using either polyethylene glycol (PEG or ethylenediamine (EDA as chain extenders. The chemical, mechanical, and thermal properties of the synthesized polymers were determined using NMR, FTIR, GPC, DSC, and tensile tester. The PCL and polyurethanes were fabricated as nanofiber membranes by electrospinning, and their mechanical properties and SEM morphology were also investigated. In vitro tests, including WST-1 assay, SEM of cells, and phalloidin cytoskeleton staining, were also performed. It was shown that electrospun membranes made of PCL and PCL-HDI-PEG (2 : 3 : 1 possessed tensile strength of 19.84 MPa and 11.72 MPa and elongation at break of 627% and 362%, respectively. These numbers are equivalent or higher than most of the commercially available collagen and PTFE membrane. As a result, these membranes may have potential for future GBR applications.
Perspectives on climate change and adaptation funding in developing countries
Directory of Open Access Journals (Sweden)
P Lalthapersad-Pillay
2011-12-01
Full Text Available Most studies concur that climate change could seriously affect the sustainability and well-being of developing countries as they depend directly on climate-sensitive natural resources for their livelihood endeavours. This could primarily occur through reduced agricultural productivity, a higher incidence of diseases, the displacement of people, loss of livelihood and food price increases, all of which could contribute to food insecurity, malnourishment and escalating poverty. Although developing countries have contributed the least to Green house Gas (GHG emissions, they stand to lose the most and it is likely that many of the development gains that have been made thus far will be reversed. To ensure that poverty reduction and economic growth do not become elusive goals for developing countries, it will be necessary to provide funds for potential adaptation measures to prevent these countries slipping further down the Human Development Index (HDI ranking. In this paper, we will use Africa as a reference and look at the funds required for adaptation, the possible sources of funds and the conflict that may occur in prioritizing development objectives. Keywords: Climate change, sustainability, Greenhouse Gas (GHG emissions, poverty reduction, Human Development Index (HDI Disciplines: Economics, Environmental Studies, Sustainabiilty Studies, African Studies
Global energy futures and human development: a framework for analysis
International Nuclear Information System (INIS)
Pasternak, A.D.
2001-01-01
This paper explores the relationship between measures of human well-being and consumption of energy and electricity. A correlation is shown between the United Nations Human Development Index (HDI) and annual per- capita electricity consumption for 60 populous countries comprising 90% of the world population. In this correlation, HDI reaches a maximum value when electricity consumption is about 4,000 kWh per person per year, well below consumption levels for most developed countries but also well above the level for developing countries. The correlation with electricity use is better than with total primary energy use. Global electricity consumption associated with a ''Human Development Scenario'' is estimated by adding to U.S. Department of Energy projections for the year 2020 increments of additional electricity consumption sufficient to reach 4,000 kWh per capita on a country-by-country basis. A roughly constant ratio of primary energy consumption to electric energy consumption is observed for countries with high levels of electricity use, and this ratio is used to estimate global primary energy consumption in the Human Development Scenario. The Human Development Scenario implies significantly greater global consumption of electricity and primary energy than do projections for 2020 by the DOE and others. (author)
L-Carnitine for the treatment of a calcium channel blocker and metformin poisoning.
St-Onge, Maude; Ajmo, Ian; Poirier, Diane; Laliberté, Martin
2013-09-01
The object of the current communication is to discuss the theory and the evidence for the use of L-carnitine in calcium channel blocker and metformin poisonings. A 68-year-old male known for hypertension and type II diabetes was admitted to the critical care unit of a community hospital following an overdose of amlodipine and metformin. The patient was intubated, ventilated, and hemodynamically supported with vasopressors. Despite calcium, glucagon, high-dose insulin (HDI), and lipid emulsion for calcium channel blocker and bicarbonate for metabolic acidosis, the patient remained hemodynamically unstable. The patient was considered too unstable to initiate continuous renal replacement therapy; and without access to extracorporeal life support, the administration of L-carnitine was administered as a last resort. One hour after L-carnitine, the norepinephrine requirements started to decrease, the patient began to improve and was subsequently extubated successfully without apparent sequelae in less than 4 days. L-Carnitine combined with HDI may have helped with the calcium channel blocker (CCB) poisoning by decreasing insulin resistance, promoting intracellular glucose transport, facilitating the metabolism of free fatty acids, and increasing calcium channel sensitivity. It may have also stimulated oxidative utilization of glucose instead of converting pyruvate into lactate and contributed to decrease lactate production with metformin poisoning.
Global energy futures and human development: a framework for analysis
Energy Technology Data Exchange (ETDEWEB)
Pasternak, A.D. [Lawrence Livermore National Lab., CA (United States)
2001-07-01
This paper explores the relationship between measures of human well-being and consumption of energy and electricity. A correlation is shown between the United Nations Human Development Index (HDI) and annual per- capita electricity consumption for 60 populous countries comprising 90% of the world population. In this correlation, HDI reaches a maximum value when electricity consumption is about 4,000 kWh per person per year, well below consumption levels for most developed countries but also well above the level for developing countries. The correlation with electricity use is better than with total primary energy use. Global electricity consumption associated with a ''Human Development Scenario'' is estimated by adding to U.S. Department of Energy projections for the year 2020 increments of additional electricity consumption sufficient to reach 4,000 kWh per capita on a country-by-country basis. A roughly constant ratio of primary energy consumption to electric energy consumption is observed for countries with high levels of electricity use, and this ratio is used to estimate global primary energy consumption in the Human Development Scenario. The Human Development Scenario implies significantly greater global consumption of electricity and primary energy than do projections for 2020 by the DOE and others. (author)
Un indice per lo sviluppo sostenibile (An Index for Sustainable Development
Directory of Open Access Journals (Sweden)
Enrico Casadio Tarabusi
2012-04-01
Full Text Available As a possible improvement to the United Nations' Human Development Index (HDI, we propose including in the set of individual variables some of an environmental or social nature. Thus, by rescaling all the variables non-linearly it is possible to mitigate the effect of outliers and synthesize by principal components, or alternatively by a different averaging method that takes sustainability into account and penalizes unbalances among different aspects of development. Both methods are easy to implement and calibrate. The ensuing effect on the ranking of world countries is compared to the HDI ranking. Come possibile miglioramento dell'Indice di Sviluppo Umano (ISU elaborato dall'Organizzazione delle Nazioni Unite proponiamo di includere nell'insieme di variabili individuali alcune di natura ambientale o sociale, di riscalare opportunamente tutte le variabili non linearmente in modo da mitigare l'effetto deglioutliers, e di sintetizzare mediante le componenti principali, oppure attraverso un diverso metodo di media che, tenendo conto della sostenibilità, penalizza gli squilibri tra diversi aspetti dello sviluppo. Entrambi i metodi sono facili da implementare e da calibrare. Il loro effetto sulla graduatoria dei paesi mondiali viene raffrontata con quella dell'ISU. JEL Codes: I31, O47Keywords: Development, Human Development, Indice
Coatings and Biodegradable and Bioabsorbable Films
2006-09-01
K.A., "Novel Method for Characterization of Poly(D,L-lactide) Degradation Based on Dielectric Spectroscopy ," Polymers for Biomedical Applications ...consumption of Temperature (°C) hydroxyl groups upon cross-linking with HDI. The Figl2. Positron annihilation assessment hydroxyl groups are known to form...higher Tg, the larger none-equilibrium 0 1.26 A 0 volume is accumulated upon cooling. Probing free- A volume with positron life time spectroscopy 1.25
Coatings and Biodegradable and Bioasorbable Films
2006-12-28
Dielectric Spectroscopy ," Polymers for Biomedical Applications Symposium, ACS Fall 2006 Meeting, San Francisco, CA. 25 Novel Biodegradable Films Based on...groups upon cross-linking with HDI. The Figl2. Positron annihilation assessment hydroxyl groups are known to form fairly strong of free volume behavior of...1.26 e volume is accumulated upon cooling. Probing free- "A volume with positron life time spectroscopy 1.25 (PALS) showed that indeed, cross-linked
Neciosup Obando, Jorge Eduardo
2014-01-01
This research aims to explain how the administrative regions in Peru are classified according to the components that determine the Human Development Index (HDI); also determine how regions are classified according to the transitional phase they are going through. The scientific problem solving can be explained as the differential of Human Development in the administrative regions in Peru, for their transitional phases. Have been constructed indicators as conceptual aspects of Landry and Notes...
Energy Technology Data Exchange (ETDEWEB)
Martinez M, V
1993-12-31
Dysprosium bis (tetraphenylporphyrinate) and bis (dysprosium) Tris (tetraphenylporphyrinate) were synthesized from dysprosium tetraphenylporphyrinate prepared in situ, and characterized by IR, UV-vis, TGA, DTA, EPR and magnetic susceptibility measurements. The double decker compound was obtained by direct oxidation of the HDy(TPP){sub 2} intermediate. The existence of the radical anion, (TPP){sup -} , in the double decker product was conformed by EPR spectrometry. Dysprosium monoporphyrinate was isolated and characterized by the same techniques. (Author).
Multidimensional indices of achievements and poverty: What do we gain and what do we lose?
Nora Lustig
2011-01-01
Poverty and wellbeing are multi-dimensional. Nobody questions that deprivations and achievements go beyond income. There is, however, sharp disagreement on whether the various dimensions of poverty and wellbeing can be aggregated into a single, multi-dimensional index in a meaningful way. Is aggregating dimensions of poverty and wellbeing useful? Is it sensible? Here I summarize and contrast three key papers that respond these questions in strikingly different ways. The papers are: The HDI 20...
Multidimensional Indices of Achievements and Poverty: What Do We Gain and What Do We
Nora Lustig
2011-01-01
Poverty and wellbeing are multi-dimensional. Nobody questions that deprivations and achievements go beyond income. There is, however, sharp disagreement on whether the various dimensions of poverty and wellbeing can be aggregated into a single, multi-dimensional index in a meaningful way. Is aggregating dimensions of poverty and wellbeing useful? Is it sensible? Here I summarize and contrast three key papers that respond these questions in strikingly different ways. The papers are: The HDI 20...
International Nuclear Information System (INIS)
Martinez M, V.
1992-01-01
Dysprosium bis (tetraphenylporphyrinate) and bis (dysprosium) Tris (tetraphenylporphyrinate) were synthesized from dysprosium tetraphenylporphyrinate prepared in situ, and characterized by IR, UV-vis, TGA, DTA, EPR and magnetic susceptibility measurements. The double decker compound was obtained by direct oxidation of the HDy(TPP) 2 intermediate. The existence of the radical anion, (TPP) - , in the double decker product was conformed by EPR spectrometry. Dysprosium monoporphyrinate was isolated and characterized by the same techniques. (Author)
Electron irradiation effect of polyurethane using coincidence doppler-broadening spectroscopy
International Nuclear Information System (INIS)
Yang, D.J.; Zhang, J.D.; Leung, J.K.C.; Beling, C.D.; Liu, L.B.
2006-01-01
Full text: To understand the electron irradiation effects on polymer, polyether-urethane (ETPU) samples of 2m m in thickness and 1 0 m m in diameter were irradiated by a 1.8M eV electron beam with beam current of 3 ma at room temperature. The irradiated doses are 5 kGy, 10 kGy, 15 kGy, 30 kGy, 100 kGy and 150 kGy. ETPU was manufactured by mixing PTMG-100, TDI-100 and MOCA. The momentum density distributions (MMDs) of electrons taking part in the annihilation processes of positron-electron pairs in ETPU have been measured by coincidence Doppler-broadening spectroscopy (CDBS). By presenting the ratio of the counts in every channel of the measured CDB spectrum to the corresponding counts from a reference spectrum (pristine ETPU), we observed that the change in MMDs is not significant for doses lower than 10 kGy. However, high momentum part of MMDs exhibit an obvious decrease for dose exceeding 15 kGy and then slowly down to steady with doses until 150 kGy. This valley occurs at around 15 x1 0 3m οc and is well known as oxygen-specific, indicative of a less positron trapping by oxygen atoms in some samples of higher dose radiation. It is postulated that the radiation will break the crosslinkings, allowing the trace water and oxygen molecules to be released from the sample surface. Excess NCO groups in ETPU would crosslink with urethane and urea groups to produce allophanate and biuret groups. After receiving a certain amount of electron irradiation, crosslinked allophanate and biuret groups would produce degradation. Thus, residual water and oxygen trapped in ETPU by the crosslinking would diffuse out. However, the irradiation doses up to 150 kGy in this experiment are still not large enough to induce strong degradation of urethane and urea groups
Macrocyclic ligands for uranium complexation
International Nuclear Information System (INIS)
Potts, K.T.
1991-04-01
A highly preorganized 24-macrocycle containing biuret, thiobiuret and pyridine subunits has been prepared by high dilution ring-closure procedures. Intermediate products to this macrocycle have been utilized to extend this synthetic route to include further representatives where solubility and stability will be influenced by substituent variation. A 1:1 complex has been formed from uranyl acetate and a quinquepyridine derivative, this representing a new type of ligand for the uranyl ion. A very convenient synthetic procedure that will allow the incorporation of these macrocycles into polymeric systems has been developed for the introduction of a vinyl substituent into the 4-position of the pyridine ring. Using triflate, vinyltributyltin and Pd 0 chemistry, this procedure should make a variety of substituted 4-vinylpyridines available for the first time. 3 refs
Directory of Open Access Journals (Sweden)
Maria Meimei Brevidelli
2012-09-01
Full Text Available Avaliar o nível de saúde das Unidades da Federação (UF do Brasil, por meio de um indicador sintético - Índice de Desenvolvimento da Saúde (IDS. O IDS foi composto pelas dimensões: (1 Recursos de saúde: disponibilidade e qualidade dos recursos de saúde; (2 Cobertura por atenção básica e saneamento; (3 Eficácia das políticas de saúde. Cada dimensão englobou um conjunto de indicadores obtidos em bases de dados nacionais. Em 2005, o Brasil apresentava nível intermediário de desenvolvimento da saúde, tendo progredido de patamares inferiores, desde 1999. A maioria das UF apresentava déficits em "recursos" e "cobertura". A dimensão da "eficácia" mostrou-se altamente desenvolvida em todo Brasil. Conclusões: A construção do indicador sintético IDS possibilitou constatar deficiências e disparidades significativas na disponibilidade e qualidade dos recursos de saúde, em grande parte do território nacional. Esses resultados podem auxiliar gestores de saúde no desafio de tornar a saúde pública universal.The scope of this paper was to assess the health level in Brazilian states using the Health Development Index (HDI. The HDI consisted of the following dimensions: (1 Health resources: Availability and quality of health resources; (2 Primary Healthcare coverage and sanitation; (3 Effectiveness of health policies. Each dimension was composed of a set of indicators obtained from national databases. In 2005, Brazil had an intermediate level of development of health, having progressed from a low level in 1999. Most states had medium and low development, with deficits in resources and coverage. The dimension of effectiveness was highly developed nationwide. With the construction of a synthetic indicator (HDI it was possible to detect that in most of the country there are severe deficiencies in the availability and quality of health resources. These results can help health managers to tackle the challenge of making public health
International Nuclear Information System (INIS)
De Jong, Wim H.; Arts, Josje H.E.; De Klerk, Arja; Schijf, Marcel A.; Ezendam, Janine; Kuper, C. Frieke; Van Loveren, Henk
2009-01-01
There are currently no validated animal models that can identify low molecular weight (LMW) respiratory sensitizers. The Local Lymph Node Assay (LLNA) is a validated animal model developed to detect contact sensitizers using skin exposure, but all LMW respiratory sensitizers tested so far were also positive in this assay. Discrimination between contact and respiratory sensitizers can be achieved by the assessment of cytokine profiles. In a LLNA using the inhalation route, both contact and respiratory sensitizers enhanced proliferation in the draining lymph nodes. The question was if their cytokine profiles were affected by the route of exposure. Male BALB/c mice were exposed head/nose-only during 3 consecutive days to the respiratory sensitizers trimellitic anhydride, phthalic anhydride, toluene diisocyanate, hexamethylene diisocyanate (HDI), and isophorone diisocyanate; the contact sensitizers dinitrochlorobenzene (DNCB), oxazolone (OXA) and formaldehyde (FA), and the irritant methyl salicylate (MS). Three days after the last exposure the draining lymph nodes were excised and cytokine production was measured after ex vivo stimulation with Concanavalin A. Skin application was used as a positive control. After inhalation exposure the respiratory sensitizers induced more interleukin-4 (IL-4) and interleukin (IL-10) compared to the contact sensitizers, whereas the contact sensitizers, except formaldehyde, induced relatively more interferon-γ (IFN-γ) production. When IL-4 and IFN-γ were plotted as a function of the proliferative response, it was shown that IL-4 could be used to identify respiratory sensitizers, except HDI, at concentration levels inducing intermediate stimulation indices. HDI could be distinguished from DNCB and OXA at high SI values. In contrast, contact sensitizers could only be identified when IFN-γ was measured at high stimulation indices. The skin positive control, tested at high concentrations, showed comparable results for IL-4 and IL-10
Pokhrel, R.; Ortiz, L. E.; González, J. E.; Ramírez-Beltran, N. D.
2017-12-01
The main objective of this study is to identify how climate variability influences human comfort levels in tropical urban environments. San Juan Metropolitan Area (SJMA) of the island of Puerto Rico was chosen as a reference point. A new human discomfort index (HDI) based on environmental enthalpy is defined. This index is expanded to determine the energy required to maintain indoor human comfort levels and was compared to Total Electricity consumption for the Island of Puerto Rico. Regression analysis shows that both Temperature and HDI are good indictor to predict total electrical energy consumption. Results showed that over the past 35 years the average enthalpy have increased and have mostly been above thresholds for human comfort for SJMA. The weather stations data further shows a clear indication of urbanization biases ramping up the index considered. From the trend analysis local scale (weather station) data shows a decreasing rate of maximum cooling at -11.41 kW-h/years, and minimum is increasing at 10.64 kW-h/years. To compare human comfort levels under extreme heat wave events conditions, an event of 2014 in the San Juan area was identified. The analysis for this extreme heat event is complemented by data from the National Center for environmental Prediction (NCEP) at 250km spatial resolution, North American Re-Analysis (NARR) at 32 km spatial resolution, by simulations of the Weather Forecasting System (WRF) at a resolution of 2 km, and by weather station data for San Juan. WRF simulation's results showed an improvement for both temperature and relative humidity from the input NCEP data. It also shows that difference in Energy per Capita (EPC) in urban area during a heat wave event can increase to 16% over a non-urban area. Sensitivity analysis was done by modifying the urban land cover to the most common rural references of evergreen broadleaf forest and cropland to investigate the Urban Heat Island (UHI) effect on HDI. UHI is seen to be maximum during
Identifying biomarkers of dietary patterns by using metabolomics123
Derkach, Andriy; Reedy, Jill; Subar, Amy F; Sampson, Joshua N; Albanes, Demetrius; Gu, Fangyi; Kontto, Jukka; Lassale, Camille; Liao, Linda M; Männistö, Satu; Mondul, Alison M; Weinstein, Stephanie J; Irwin, Melinda L; Mayne, Susan T; Stolzenberg-Solomon, Rachael
2017-01-01
Background: Healthy dietary patterns that conform to national dietary guidelines are related to lower chronic disease incidence and longer life span. However, the precise mechanisms involved are unclear. Identifying biomarkers of dietary patterns may provide tools to validate diet quality measurement and determine underlying metabolic pathways influenced by diet quality. Objective: The objective of this study was to examine the correlation of 4 diet quality indexes [the Healthy Eating Index (HEI) 2010, the Alternate Mediterranean Diet Score (aMED), the WHO Healthy Diet Indicator (HDI), and the Baltic Sea Diet (BSD)] with serum metabolites. Design: We evaluated dietary patterns and metabolites in male Finnish smokers (n = 1336) from 5 nested case-control studies within the Alpha-Tocopherol, Beta-Carotene Cancer Prevention Study cohort. Participants completed a validated food-frequency questionnaire and provided a fasting serum sample before study randomization (1985–1988). Metabolites were measured with the use of mass spectrometry. We analyzed cross-sectional partial correlations of 1316 metabolites with 4 diet quality indexes, adjusting for age, body mass index, smoking, energy intake, education, and physical activity. We pooled estimates across studies with the use of fixed-effects meta-analysis with Bonferroni correction for multiple comparisons, and conducted metabolic pathway analyses. Results: The HEI-2010, aMED, HDI, and BSD were associated with 23, 46, 23, and 33 metabolites, respectively (17, 21, 11, and 10 metabolites, respectively, were chemically identified; r-range: −0.30 to 0.20; P = 6 × 10−15 to 8 × 10−6). Food-based diet indexes (HEI-2010, aMED, and BSD) were associated with metabolites correlated with most components used to score adherence (e.g., fruit, vegetables, whole grains, fish, and unsaturated fat). HDI correlated with metabolites related to polyunsaturated fat and fiber components, but not other macro- or micronutrients (e
Assessing opportunities and constraints for biofuel development in sub-Saharan Africa
CSIR Research Space (South Africa)
Von Maltitz, Graham P
2011-01-01
Full Text Available , the development of sustainability principles, criteria and indicators for biofuel development, and constraints to imports in the EU, have been some key responses to reduce unsustainable practices (Harrison et al. 2010a, Vis et al. 2008). �ough the adoption... FSC Forest Stewardship Council GAIA Movement Trust Living Earth Green World Action GAP Good Agricultural Practices GHG Greenhouse gas GIZ Gesellscha� f?r Internationale Zusammenarbeit Ha Hectare HCV High Conservation Value HDI Human Development...
Sudarlan
2015-01-01
Abstract The development of a country usually determined by the human development index HDI. Per capita income education and health are the three most important components of human development index. The purpose of this research is to understand the relationship among human development index to income per capita growth and poverty alleviation in Indonesia with cross-section data from 30 provinces period 2002 2011 year. The result of this research were a income per capita growth was not sign...
Determinants of economic freedom of the Association of Southeast Asian Nation economic community
Karen Debbie C. Magallon
2016-01-01
One of the determinants of the well-being of people across the world is economic freedom. It is the freedom to choose the ways to produce, sell, and use your private resources, while respecting rights of the other to practice the same. The primordial intention of the study was to investigate the factors affecting economic freedom in the Association of Southeast Asian Nations (ASEAN) Economic Community. Human Development Index (HDI), Corruption Perceptions Index (CPI) and GDP per capita are...
Amir Tiyuri; Abdollah Mohammadian-Hafshejani; Elham Iziy; Hamidreza Sadeghi Gandomani; Hamid Salehiniya
2017-01-01
Introduction: Lip and oral cavity cancer is one of the most prevalent cancers in Asia and considered to be a major public health problem due to the low survival rate. Because of the importance of access to information about this cancer (including incidence, mortality rate and relation to socioeconomic indicators), this study aims at investigating the incidence and mortality of lip and oral cavity cancer and its relationship with the Human Development Index (HDI) of Asia (from 2012). Meth...
Incidence and mortality of kidney cancers, and human development index in Asia; a matter of concern
Arabsalmani, Masoumeh; Mohammadian-Hafshejani, Abdollah; Ghoncheh, Mahshid; Hadadian, Fatemeh; Towhidi, Farhad; Vafaee, Kamran; Salehiniya, Hamid
2016-01-01
Background The incidence and mortality of kidney cancer have steadily increased by 2%- 3% per decade worldwide, and an increased risk of kidney cancer has been observed in many Asian countries. The information on the incidence and mortality of a disease and its distribution is essential for better planning for prevention and further studies. Objectives This study aimed to assess the incidence and mortality of kidney cancer and their correlation with the human development index (HDI) in Asia. ...
Hypervelocity Dust Injection for Plasma Diagnostic Applications
Ticos, Catalin
2005-10-01
Hypervelocity micron-size dust grain injection was proposed for high-temperature magnetized plasma diagnosis. Multiple dust grains are launched simultaneously into high temperature plasmas at several km/s or more. The hypervelocity dust grains are ablated by the electron and ion fluxes. Fast imaging of the resulting luminous plumes attached to each grain is expected to yield local magnetic field vectors. Combination of multiple local magnetic field vectors reproduces 2D or even 3D maps of the internal magnetic field topology. Key features of HDI are: (1) a high spatial resolution, due to a relatively small transverse size of the elongated tail, and (2) a small perturbation level, as the dust grains introduce negligible number of particles compared to the plasma particle inventory. The latter advantage, however, could be seriously compromised if the gas load from the accelerator has an unobstructed access to the diagnosed plasma. Construction of a HDI diagnostic for National Spherical Torus Experiment (NSTX), which includes a coaxial plasma gun for dust grain acceleration, is underway. Hydrogen and deuterium gas discharges inside accelerator are created by a ˜ 1 mF capacitor bank pre-charged up to 10 kV. The diagnostic apparatus also comprises a dust dispenser for pre-loading the accelerator with dust grains, and an imaging system that has a high spatial and temporal resolution.
Incidence and mortality of lung cancer: global trends and association with socioeconomic status.
Wong, Martin C S; Lao, Xiang Qian; Ho, Kin-Fai; Goggins, William B; Tse, Shelly L A
2017-10-30
We examined the correlation between lung cancer incidence/mortality and country-specific socioeconomic development, and evaluated its most recent global trends. We retrieved its age-standardized incidence rates from the GLOBOCAN database, and temporal patterns were assessed from global databases. We employed simple linear regression analysis to evaluate their correlations with Human Development Index (HDI) and Gross Domestic Product (GDP) per capita. The average annual percent changes (AAPC) of the trends were evaluated from join-point regression analysis. Country-specific HDI was strongly correlated with age-standardized incidence (r = 0.70) and mortality (r = 0.67), and to a lesser extent GDP (r = 0.24 to 0.55). Among men, 22 and 30 (out of 38 and 36) countries showed declining incidence and mortality trends, respectively; whilst among women, 19 and 16 countries showed increasing incidence and mortality trends, respectively. Among men, the AAPCs ranged from -2.8 to -0.6 (incidence) and -3.6 to -1.1 (mortality) in countries with declining trend, whereas among women the AAPC range was 0.4 to 8.9 (incidence) and 1 to 4.4 (mortality) in countries with increasing trend. Among women, Brazil, Spain and Cyprus had the greatest incidence increase, and all countries in Western, Southern and Eastern Europe reported increasing mortality. These findings highlighted the need for targeted preventive measures.
Soy Expansion and Socioeconomic Development in Municipalities of Brazil
Directory of Open Access Journals (Sweden)
Luiz Antonio Martinelli
2017-09-01
Full Text Available Soy occupies the largest area of agricultural land in Brazil, spreading from southern states to the Amazon region. Soy is also the most important agricultural commodity among Brazilian exports affecting food security and land use nationally and internationally. Here we pose the question of whether soy expansion affects only economic growth or whether it also boosts socioeconomic development, fostering education and health improvements in Brazilian municipalities where it is planted. To achieve this objective, we divided more than 5000 municipalities into two groups: those with >300 ha of soy (soy municipalities and those with <300 ha of soy (non-soy municipalities. We compared the Human Development Index (HDI and the Gini coefficient for income for these two groups of municipalities in 1991, 2000, and 2010. We made such comparison at the municipality level for the whole country, but we also grouped the municipalities by major geographical regions and states. We found that the HDI was higher in soy municipalities, especially in the agricultural frontier. That effect was not so clear in more consolidated agricultural regions of the country. Soy municipalities also had a higher Gini coefficient for income than non-soy municipalities. We concluded that soy could be considered a precursor of socioeconomic development under certain conditions; however, it also tends to be associated with an increase in income inequality, especially in the agricultural frontier.
Thermal modeling of head disk interface system in heat assisted magnetic recording
Energy Technology Data Exchange (ETDEWEB)
Vemuri, Sesha Hari; Seung Chung, Pil; Jhon, Myung S., E-mail: mj3a@andrew.cmu.edu [Department of Chemical Engineering and Data Storage Systems Center, Carnegie Mellon University, 5000 Forbes Ave., Pittsburgh, Pennsylvania 15213 (United States); Min Kim, Hyung [Department of Mechanical System Engineering, Kyonggi University, Suwon, Gyeonggi-do 440-746 (Korea, Republic of)
2014-05-07
A thorough understanding of the temperature profiles introduced by the heat assisted magnetic recording is required to maintain the hotspot at the desired location on the disk with minimal heat damage to other components. Here, we implement a transient mesoscale modeling methodology termed lattice Boltzmann method (LBM) for phonons (which are primary carriers of energy) in the thermal modeling of the head disk interface (HDI) components, namely, carbon overcoat (COC). The LBM can provide more accurate results compared to conventional Fourier methodology by capturing the nanoscale phenomena due to ballistic heat transfer. We examine the in-plane and out-of-plane heat transfer in the COC via analyzing the temperature profiles with a continuously focused and pulsed laser beam on a moving disk. Larger in-plane hotspot widening is observed in continuously focused laser beam compared to a pulsed laser. A pulsed laser surface develops steeper temperature gradients compared to continuous hotspot. Furthermore, out-of-plane heat transfer from the COC to the media is enhanced with a continuous laser beam then a pulsed laser, while the temperature takes around 140 fs to reach the bottom surface of the COC. Our study can lead to a realistic thermal model describing novel HDI material design criteria for the next generation of hard disk drives with ultra high recording densities.
Atkinson, Kaitlin; Lowe, Samantha; Moore, Spencer
2016-06-01
This study aimed to (a) assess the relationship between a person's occupational category and their physical inactivity, and (b) analyze the association among country-level variables and physical inactivity. The World Health Survey (WHS) was administered in 2002-2003 among 47 low- and middle-income countries (n = 196,742). The International Physical Activity Questionnaire (IPAQ) was used to collect verbal reports of physical activity and convert responses into measures of physical inactivity. Economic development (GDP/c), degree of urbanization, and the Human Development Index (HDI) were used to measure country-level variables and physical inactivity. Multilevel logistic regression analysis was used to examine the association among country-level factors, individual occupational status, and physical inactivity. Overall, the worldwide prevalence of physical inactivity in 2002-2003 was 23.7%. Individuals working in the white-collar industry compared to agriculture were 84% more likely to be physically inactive (OR: 1.84, CI: 1.73-1.95). Among low- and middle-income countries increased HDI values were associated with decreased levels of physical inactivity (OR: 0.98, CI: 0.97-0.99). This study is one of the first to adjust for within-country differences, specifically occupation while analyzing physical inactivity. As countries experience economic development, changes are also seen in their occupational structure, which result in increased countrywide physical inactivity levels.
Individual- and contextual-level factors associated with client-initiated HIV testing
Directory of Open Access Journals (Sweden)
Claudia Renata dos Santos Barros
Full Text Available ABSTRACT: Background: Knowing the reasons for seeking HIV testing is central for HIV prevention. Despite the availability of free HIV counseling and testing in Brazil, coverage remains lacking. Methods: Survey of 4,760 respondents from urban areas was analyzed. Individual-level variables included sociodemographic characteristics; sexual and reproductive health; HIV/AIDS treatment knowledge and beliefs; being personally acquainted with a person with HIV/AIDS; and holding discriminatory ideas about people living with HIV. Contextual-level variables included the Human Development Index (HDI of the municipality; prevalence of HIV/AIDS; and availability of local HIV counseling and testing (CT services. The dependent variable was client-initiated testing. Multilevel Poisson regression models with random intercepts were used to assess associated factors. Results: Common individual-level variables among men and women included being personally acquainted with a person with HIV/AIDS and age; whereas discordant variables included those related to sexual and reproductive health and experiencing sexual violence. Among contextual-level factors, availability of CT services was variable associated with client-initiated testing among women only. The contextual-level variable “HDI of the municipality” was associated with client-initiated testing among women. Conclusion: Thus, marked gender differences in HIV testing were found, with a lack of HIV testing among married women and heterosexual men, groups that do not spontaneously seek testing.
Obesity and socioeconomic status in developing countries: a systematic review
Dinsa, GD; Goryakin, Y; Fumagalli, E; Suhrcke, M
2012-01-01
Summary We undertook a systematic review of studies assessing the association between socioeconomic status (SES) and measured obesity in low- and middle-income countries (defined by the World Bank as countries with per capita income up to US$12,275) among children, men and women. The evidence on the subject has grown significantly since an earlier influential review was published in 2004. We find that in low-income countries or in countries with low human development index (HDI), the associat...
Epidemiology and Inequality in the Incidence and Mortality of Nasopharynx Cancer in Asia
Mahdavifar, Neda; Ghoncheh, Mahshid; Mohammadian-Hafshejani, Abdollah; Khosravi, Bahman; Salehiniya, Hamid
2016-01-01
Objectives One of the most common head and neck cancers is nasopharynx cancer. Knowledge about the incidence and mortality of this disease and its distribution in terms of geographical areas is necessary for further study and better planning. Therefore, this study was conducted with the aim of determining the incidence and mortality rates of nasopharynx cancer and its relationship with the Human Development Index (HDI) in Asia in 2012. Methods The aim of this ecologic study was to assess the ...
Fariba Ramezani Siakholak; Mahshid Ghoncheh; Reza Pakzad; Hamidreza Sadeghi Gandomani; Fereshteh Ghorat; Hamid Salehiniya
2016-01-01
Introduction: According to the importance of knowledge about incidence and mortality of oral cavity and lip cancer in health planning, this study was performed with the aim of investigating the incidence and mortality rate of oral cavity and lip cancer and its relation with the Human Development Index in the world in 2012. Methods: The study was conducted based on data from the world data of cancer and the World Bank (including the HDI and its components). Data about the age-specific inc...
Guadalupe Soto-Estrada; Laura Moreno Altamirano; Juan José García-García; Iván Ochoa Moreno; Martín Silberman
2018-01-01
Objective: To analyse the evolution of the frequency of type 2 diabetes (T2D) and its relationship to eating patterns in Mexico from 1961 to 2013, and the Gini coefficient, Human Development Index (HDI) and Gross Domestic Product (GDP). Mexico ranked sixth in world prevalence of diabetes in 2015 with an estimated 11.4 million Mexicans affected. Method: Using data from the Balance Sheets Food published by the Food and Agriculture Organization of the United Nations (FAO), the means of apparent ...
Jin, Xing; Willeke, Matthias; Lucchesi, Ralph; Daniliuc, Constantin-Gabriel; Fröhlich, Roland; Wibbeling, Birgit; Uhl, Werner; Würthwein, Ernst-Ulrich
2015-06-19
The series of differently substituted ketenimines 1 was hydroluminated using di-iso-butyl aluminum hydride. For the sterically congested ketenimine 1a, preferred hydroalumination of the C═N-bond was proven by X-ray crystallography (compound 5a). In situ treatment of the hydroaluminated ketenimines 5 with various heterocumulenes like carbodiimides, isocycanates, isothiocyanates and ketenimines as electrophiles and subsequent hydrolytic workup resulted in novel enamine derived amide species in case of N-attack (sterically less hindered ketenimines) under formation of a new C-N-bond or in 1,3-diimines by C-C-bond-formation in case of bulky substituents at the ketenimine-nitrogen atom. Furthermore, domino reactions with more than 1 equiv of the electrophile or by subsequent addition of two different electrophiles are possible and lead to polyfunctional amide derivatives of the biuret type which are otherwise not easily accessible.
International Nuclear Information System (INIS)
Abdullah-Al-Mahin; Alamgir Z. Chowdhury; Rehana Begum
2006-01-01
The amount of protein in the surface grown mycelia of three strains of Aspergillus niger (CA16,79/20 and 318) was found to decrease with the increase of citric acid production in sucrose based fermentation medium. Throughout the study period of 6 to 10 days of fermentation, highest amount of citric acid was produced by Aspergillus niger 318 although the amount of protein in mycelia was lowest for this strain. On the other hand, lowest amount of citric acid was produced by the strain CA 16 which in tern produced highest amount of mycelial protein. Aspergillus niger 79/20 produced both intermediate level of protein and citric acid. The Protein was estimated by three commonly used methods namely: Kjeldahl, Biuret and Lowry methods. Kjeldahl and Lowry method gave the highest and lowest results respectively for protein determination in all cases.(authors)
A Biology Laboratory Exercise Using Macromolecule Assays to Distinguish Four Types of Milk
Directory of Open Access Journals (Sweden)
Charlotte W. Pratt
2011-03-01
Full Text Available One of the drawbacks of cookbook-style laboratory exercises for General Biology courses is that students are not challenged to develop skills in scientific reasoning, such as formulating hypotheses and designing and carrying out experiments. Several traditional laboratory curricula include exercises involving semi-quantitative colorimetric assays to detect proteins (biuret test, reducing sugars (Benedict’s test, starch (Lugol’s test, and lipids (Sudan red test in a variety of easily prepared solutions (glucose, albumin, glycine, etc. and familiar food items (lemon juice, cornstarch, egg white, etc.. An extension of this lab exercise was developed to allow students to use their knowledge of the macromolecule assays to design an experiment to distinguish four types of “milk”: whole milk, skim milk, cream, and soy milk (rice milk or almond milk could also be included.
International Nuclear Information System (INIS)
Raininko, R.; Laivola, J.; Irjala, K.; Turku Univ. Central Hospital
1988-01-01
Sodium meglumine ioxaglate (320 or 306 mg I/ml) and meglumine diatrizoate (306 mg I/ml) in an intravenous dose of 2 ml/kg were compared in a randomized double-blind test on the brain CT of 209 patients. Side effects were noted in 56% of the ioxaglate group and 90% of the diatrizoate group. Diatrizoate caused a sensation of heat significantly more often and more intensely, but the frequencies of other side effects did not differ significantly. No severe reactions occurred. The quality of the CT scans was equal. Neither ioxaglate nor diatrizoate impaired renal function. False-positive strip tests and falsely elevated protein values measured by the biuretic method were found in particular in the ioxaglate group. The results of urine protein measurements and strip tests are misleading on the day of the examination with both ioxaglate and diatrizoate. (orig.)
Component Analysis of Deposits in Selective Catalytic Reduction System for Automotive Diesel Engine
Directory of Open Access Journals (Sweden)
Zhu Neng
2016-01-01
Full Text Available In this paper, deposits in exhaust pipes for automotive diesel engines were studied by various chemical analysis methods and a kind of analysis process to determine the compositions of organic matter was proposed. Firstly, the elements of the deposits were determined through the element analysis method. Then using characteristic absorption properties of organic functional groups to the infrared spectrum, the functional groups in the deposits were determined. Finally, by GC-MS (gas chromatography - mass spectrometry test, the content of each main component was determined quantitatively. Element analysis results indicated that the deposits adsorbed metal impurities from fuel oil, lubricating oil, mechanical wear and urea water solution. The result of GC-MS test showed that the area percentage of cyanuric acid was the biggest (about 85%, the second was urea (about 4%, and the content of biuret and biurea was scarce.
Energy Technology Data Exchange (ETDEWEB)
Gordon, I. [Great Ormond Street Hospital for Children, London (United Kingdom); Piepsz, A. [CHU St. Pierre, Brussels (Belgium); Colarinha, P. [Instituto Portugues de Oncologia, Lisbon (Portugal); Hahn, K.; Fischer, S.; Porn, U. [LMU Muenchen (Germany). Klinik fuer Nuklearmedizin; Olivier, P. [CHU Brabois, Nancy (France); Sixt, R. [The Queen Silvia Children' s Hospital, Goeteborg (Sweden); Velzen, J. van
2000-11-01
The guidelines are intended to help nuclear medical teams in their daily routine. The information given relates to aspects such as data acquisition, evaluation and interpretation, and indications for pediatric renal functional scintigraphy. The guidelines have been elaborated in response to a request of EANM and the American Society of Nuclear Medicine, who expressed the need for guidelines on recommended procedures for most of the standard nuclear medical examinations. The guidelines express the opinion of the Paediatric Committee of the EANM, and should be seen in the context of generally accepted basic principles in nuclear medicine, as well as local and national regulatory standards in radiation protection. (orig./CB) [German] Zweck dieser Leitlinie ist es, dem nuklearmedizinischen Team Hilfestellung fuer die taegliche Routinepraxis zu geben. Diese Leitlinie enthaelt Informationen ueber die Datenakquisition, Auswertung, Interpretation sowie die Indikationen der Nierenfunktionsszintigraphie bei Kindern. Das vorliegende Dokument wurde durch den Wunsch der EANM und der American Society of Nuclear Medicine nach Leitlinien fuer die meisten nuklearmedizinischen Untersuchungsverfahren initiiert. Die Leitlinie gibt die Ansicht des Paediatric Committee der EANM wieder. Sie sollte immer in Verbindung gesehen werden mit den allgemeingueltigen Grundlagen der Nuklearmedizin sowie den lokalen und nationalen Regelungen des Strahlenschutzes. (orig./MG)
Inhibition of HIF-2.alpha. heterodimerization with HIF1.beta. (ARNT)
Bruick, Richard K.; Caldwell, Charles G.; Frantz, Doug E.; Gardner, Kevin H.; MacMillan, John B.; Scheuermann, Thomas H.; Tambar, Uttam K.
2017-09-12
Provided is a method of inhibiting heterodimerization of HIF-2.alpha. to HIF1.beta. (ARNT) comprising binding certain small molecules to the HIF-2.alpha. PAS-B domain cavity but not to HIF1.alpha. and inhibiting HIF-2.alpha. heterodimerization to HIF1.beta. (ARNT) but not inhibiting HIF1.alpha. heterodimerization to HIF1.beta. (ARNT). Those certain small molecules are also referenced synonymously as HIF2-HDI and HIF2.alpha. heterodimerization inhibitors and also simply as certain small molecules.
Bauersachs, T.; Rochelmeier, J.; Schwark, L.
2015-06-01
It has been demonstrated that the relative distribution of heterocyst glycolipids (HGs) in cultures of N2-fixing heterocystous cyanobacteria is largely controlled by growth temperature, suggesting a potential use of these components in paleoenvironmental studies. Here, we investigated the effect of environmental parameters (e.g., surface water temperatures, oxygen concentrations and pH) on the distribution of HGs in a natural system using water column filtrates collected from Lake Schreventeich (Kiel, Germany) from late July to the end of October 2013. HPLC-ESI/MS (high-performance liquid chromatography coupled to electrospray ionization-mass spectrometry) analysis revealed a dominance of 1-(O-hexose)-3,25-hexacosanediols (HG26 diols) and 1-(O-hexose)-3-keto-25-hexacosanol (HG26 keto-ol) in the solvent-extracted water column filtrates, which were accompanied by minor abundances of 1-(O-hexose)-3,27-octacosanediol (HG28 diol) and 1-(O-hexose)-3-keto-27-octacosanol (HG28 keto-ol) as well as 1-(O-hexose)-3,25,27-octacosanetriol (HG28 triol) and 1-(O-hexose)-3-keto-25,27-octacosanediol (HG28 keto-diol). Fractional abundances of alcoholic and ketonic HGs generally showed strong linear correlations with surface water temperatures and no or only weak linear correlations with both oxygen concentrations and pH. Changes in the distribution of the most abundant diol and keto-ol (e.g., HG26 diol and HG26 keto-ol) were quantitatively expressed as the HDI26 (heterocyst diol index of 26 carbon atoms) with values of this index ranging from 0.89 in mid-August to 0.66 in mid-October. An average HDI26 value of 0.79, which translates into a calculated surface water temperature of 15.8 ± 0.3 °C, was obtained from surface sediments collected from Lake Schreventeich. This temperature - and temperatures obtained from other HG indices (e.g., HDI28 and HTI28) - is similar to the one measured during maximum cyanobacterial productivity in early to mid-September and suggests that HGs
Prevalence and correlates of hypertension in Maharashtra, India: A multilevel analysis.
Directory of Open Access Journals (Sweden)
Mahadev D Bhise
Full Text Available In the last few decades, the prevalence of hypertension has been drastically increased in India. The present study estimates the current prevalence of hypertension and its correlates in the state of Maharashtra. The variation in the prevalence of hypertension associated with individual-level characteristics is explained at the community and district level.Data is used from the recent round of District Level Household & Facility Survey (DLHS-4, 2012-13. The DLHS-4 has used the nationally representative sample, collected through multistage stratified sampling procedure. A similar sampling frame, used in NSSO-2007-08, has been followed. The chi-square test is used to show the significance level of the association between the estimated prevalence of hypertension and its correlates. Multilevel regression analysis is carried out to investigate the effects of individual and community level factors on the prevalence of hypertension.The overall prevalence of hypertension is 25% in Maharashtra, and a huge variation in the prevalence of hypertension is found across the districts. Dhule, Gadchiroli (with a low HDI rank, Mumbai and Satara (with higher HDI rank are the districts with the higher (above 30% prevalence of high blood pressure. The prevalence also significantly varies according to different correlates. The prevalence of high blood pressure is higher among elderly population (40%, among males (28%, in the urban areas (27% and in the richest wealth quintile (28%. The prevalence is also higher among cigarette smokers (31%, alcohol consumers (30% and people with obesity (38% as compared to their counterparts. The results of the multilevel analysis show that the older and obese persons are at four-time higher risk of hypertension. Again, age, sex, marital status, place of residence, wealth status, unhealthy habits (i.e. smoking and alcohol consumption and BMI are significantly associated with hypertension. The results of VPC statistics show that 14% of
Simple vs. Complex Carbohydrate Dietary Patterns and the Global Overweight and Obesity Pandemic.
Ferretti, Fabrizio; Mariani, Michele
2017-10-04
Nowadays, obesity and being overweight are among the major global health concerns. Many, diet-related diseases impose high tangible and intangible costs, and threaten the sustainability of health-care systems worldwide. In this study, we model, at the macroeconomic level, the impact of energy intake from different types of carbohydrates on the population's BMI (body mass index). We proceed in three steps. First, we develop a framework to analyse both the consumption choices between simple and complex carbohydrates and the effects of these choices on people health conditions. Second, we collect figures for 185 countries (over the period 2012-2014) regarding the shares of simple (sugar and sweetener) and complex (cereal) carbohydrates in each country's total dietary energy supply. Third, we use regression techniques to: (1) estimate the impact of these shares on the country's prevalence of obesity and being overweight; (2) compute for each country an indicator of dietary pattern based on the ratio between simple and complex carbohydrates, weighted by their estimated effects on the prevalence of obesity and being overweight; and (3) measure the elasticity of the prevalence of obesity and being overweight with respect to changes in both carbohydrate dietary pattern and income per capita. We find that unhealthy eating habits and the associated prevalence of excessive body fat accumulation tend to behave as a 'normal good' in low, medium- and high-HDI (Human Development Index) countries, but as an 'inferior good' in very high-HDI countries.
Espí-López, G V; Rodríguez-Blanco, C; Oliva-Pascual-Vaca, A; Benítez-Martínez, J C; Lluch, E; Falla, D
2014-12-01
Tension-type headache (TTH) is the most common type of primary headache however there is no clear evidence as to which specific treatment is most effective or whether combined treatment is more effective than individual treatments. To assess the effectiveness of manual therapy techniques, applied to the suboccipital region, on aspects of disability in a sample of patients with tension-type headache. Randomized Controlled Trial. Specialized centre for headache treatment. Seventy-six (62 women) patients (age: 39.9 ± 10.9 years) with episodic chronic TTH. Patients were randomly divided into four treatment groups: 1) suboccipital soft tissue inhibition; 2) occiput-atlas-axis manipulation; 3) combined treatment of both techniques; 4) control. Four sessions were applied over 4 weeks and disability was assessed before and after treatment using the Headache Disability Inventory (HDI). Headache frequency, severity and the functional and emotional subscales of the questionnaire were assessed. Photophobia, phonophobia and pericranial tenderness were also monitored. Headache frequency was significantly reduced with the manipulative and combined treatment (Ptreatment groups (Ptreatment also reduced the score on the emotional subscale of the HDI (Ptreatments were combined, effectiveness was noted for all aspects of disability and other symptoms including photophobia, phonophobia and pericranial tenderness. Although individual manual therapy treatments showed a positive change in headache features, measures of photophobia, photophobia and pericranial tenderness only improved in the group that received the combined treatment suggesting that combined treatment is the most appropriate for symptomatic relief of TTH.
Petrov, Megan E; Emert, Sarah E; Lichstein, Kenneth L
2018-06-05
To compare therapeutic response to behavioral therapy for insomnia (BT-I) among hypnotic-dependent insomnia (HDI) patients with and without Cluster C personality disorders. Twenty-three adults with HDI (17 females), aged between 33 and 68 (M = 53; SD = 9.9) were included in the study. Participants completed a personality disorder assessment (baseline), as well as sleep diaries, polysomnography (PSG), and an insomnia severity assessment (baseline, posttreatment, and one-year follow-up). Treatment consisted of eight weeks of individual BT-I and gradual hypnotic medication withdrawal. Multilevel mixed-effects linear regression models examined the interaction between study visit and Cluster C personality disorders status on treatment response to BT-I. Obsessive-compulsive personality disorder (OCPD) was the most prevalent of the Cluster C personality disorders with 38% (n = 8) of participants meeting criteria. There were no significant treatment differences by OCPD status across time as measured by sleep diaries and insomnia severity status. However, there were significant treatment differences by OCPD status by one-year follow-up on PSG outcomes, indicating that patients with OCPD status had shorter and more disrupted sleep than patients without OCPD status. Based on self-reported sleep measures, patients with insomnia and features of OCPD responded equivalently to BT-I at one-year follow-up compared to patients without features of OCPD. However, polysomnography outcomes indicated objective sleep deteriorated in these patients, which may suggest greater vulnerability to relapse.
Acetylation Increases EWS-FLI1 DNA Binding and Transcriptional Activity
International Nuclear Information System (INIS)
Schlottmann, Silke; Erkizan, Hayriye V.; Barber-Rotenberg, Julie S.; Knights, Chad; Cheema, Amrita; Üren, Aykut; Avantaggiati, Maria L.; Toretsky, Jeffrey A.
2012-01-01
Ewing Sarcoma (ES) is associated with a balanced chromosomal translocation that in most cases leads to the expression of the oncogenic fusion protein and transcription factor EWS-FLI1. EWS-FLI1 has been shown to be crucial for ES cell survival and tumor growth. However, its regulation is still enigmatic. To date, no functionally significant post-translational modifications of EWS-FLI1 have been shown. Since ES are sensitive to histone deacetylase inhibitors (HDI), and these inhibitors are advancing in clinical trials, we sought to identify if EWS-FLI1 is directly acetylated. We convincingly show acetylation of the C-terminal FLI1 (FLI1-CTD) domain, which is the DNA binding domain of EWS-FLI1. In vitro acetylation studies showed that acetylated FLI1-CTD has higher DNA binding activity than the non-acetylated protein. Over-expression of PCAF or treatment with HDI increased the transcriptional activity of EWS-FLI1, when co-expressed in Cos7 cells. However, our data that evaluates the acetylation of full-length EWS-FLI1 in ES cells remains unclear, despite creating acetylation specific antibodies to four potential acetylation sites. We conclude that EWS-FLI1 may either gain access to chromatin as a result of histone acetylation or undergo regulation by direct acetylation. These data should be considered when patients are treated with HDAC inhibitors. Further investigation of this phenomenon will reveal if this potential acetylation has an impact on tumor response.
Local Government Units in Indonesia: Demographic Attributes and Differences in Financial Condition
Directory of Open Access Journals (Sweden)
Rusmin Rusmin
2014-06-01
Full Text Available This study examines the outcome of decentralisation reforms in Indonesia, focusing on the association between demographic characteristics and differences in the financial condition of local governments units. It investigates cross-sectional data pertaining to demographic characteristics and financial statements audited by the Supreme Audit Body of 419 Indonesian local government units for the fiscal year 2007. It utilises demographic attributes including scope of entity, location, tenure (date of entry, gender, human development index (HDI and size of local governments to explain differences in the financial condition of Indonesia’s local government. Local government financial condition is proxied by quick ratio, debt ratio, services ratio, and ratio of local to total revenues. The results suggest that scope and location of local government units help explain all of the financial condition variables. The findings further infer that local government units domiciled in Java tend to report better financial conditions relative to those domiciled in other islands. Our results also show that local government units with greater female populations and higher HDI are more likely to have a local authority that (1 has better ability to finance their general services from their unrestricted net assets, and (2 has greater ability to earn more revenues from local sources. Finally, this study documents that the larger the population of a local government unit, the higher its liquidity position, the stronger its ability to funding general services, and the greater its possibility earning revenues from its local sources.
Carbon Intensities of Economies from the Perspective of Learning Curves
Directory of Open Access Journals (Sweden)
Henrique Pacini
2014-03-01
Full Text Available While some countries have achieved considerable development, many others still lack accessto the goods and services considered standard in the modern society. As CO2 emissions and development are often correlated, this paper employs the theoretical background of the Environmental Kuznets Curve (EKC and the learning curves toolkit to analyze how carbon intensities have changed as countries move towards higher development (and cumulative wealth levels. The EKC concept is then tested with the methodology of learning curves for the period between 1971 and 2010, so as to capture a dynamic picture of emissions trends and development. Results of both analyses reveal that empirical data fails to provide direct evidence of an EKC for emissions and development. The data does show, however, an interesting pattern in the dispersion of emissions levels for countries within the same HDI categories. While data does not show that countries grow more polluting during intermediary development stages, it does provide evidence that countries become more heterogeneous in their emission intensities as they develop, later re-converging to lower emission intensities at higher HDI levels. Learning rates also indicate heterogeneity among developing countries and relative convergence among developed countries. Given the heterogeneity of development paths among countries, the experiences of those which are managing to develop at low carbon intensities can prove valuable examples for ongoing efforts in climate change mitigation, especially in the developing world.
PENGARUH FERMENTASI TERHADAP KANDUNGAN PROTEIN DAN KOMPOSISI ASAM AMINO DALAM SINGKONG
Directory of Open Access Journals (Sweden)
Almasyhuri Almasyhuri
2012-11-01
Full Text Available Effects of Solid Fermentation on Protein Content and Amino Acid Composition of Cassava.This study was carried out to assess the protein and amino acid quantity of solid fermentation of cassava (Manihot esculenta using pure culture of the Rhizopus oligosporus and traditional inoculum (laru. The protein content of the fermented product was analyzed by Biuret method, and the animo acid composition by HPLC (high performance liquid chromatography method. The results showed that solid fermentation of cassava increased the protein content from 2.1% to 4.0% and 4.7%. The animo acid contents of the fermented product increased 2.5 folds of that of cassava. Higher increase was seen in substrates fermented with traditional inoculum. This is due to the addition of coconut oil and ammonium to the cassava substrate which improved the growth of mold.Key words: cassava (Manihot esculenta, food fermentation, protein content, amino acid composition
Külmavõitu vastane : [talveauto 2014
2014-01-01
TM võrdleb: BMW 318d GT A, Citroën C4 Picasso e-HDi 115, Dacia Logan MCV TCe 90, Honda CR-V 1,6 i-DTEC, Kia Carens 1,6 GDI, Lexus IS 300h, Mazda3 Sedan 2,0 Skyactiv-G, Mercedes-Benz CLA 200 BE A, Nissan Note 1,5 dCi, Opel Adam 1,4, Peugeot 308 1,6 THP, Renault Captur TCe 120 EDC, Suzuki SX4 S-Cross 1,6, VVT CVT, Škoda Octavia 1,4 TSI, Toyota Corolla 1,6 Valvematic
Directory of Open Access Journals (Sweden)
C. L. Almeida
1999-06-01
Full Text Available Um novo método de síntese de poliuretanos segmentados foi desenvolvido, no qual segmentos de características bem definidas foram preparados separadamente e acoplados em uma etapa seguinte. O segmento flexível (SS foi preparado a partir da reação entre glicol polipropilênico comercial de peso molecular 3800 e diisocianato de 1,6 hexametileno (HDI. O peso molecular destes blocos variou de acordo com a razão NCO/OH usada nas sínteses, que foi sempre maior do que a unidade, fornecendo blocos com terminação NCO. O HDI não reagido foi removido à vácuo (10-6-10-8mbar. O peso molecular dos produtos SS foi determinado por GPC. O segmento rígido (HS foi preparado a partir da reação de HDI e 1,4 butanodiol (BDO usando-se razão NCO/OH igual à unidade. Ao término desta reação os produtos foram funcionalizados pela adição de um excesso de BDO, fornecendo segmentos com terminação -OH. O BDO não reagido foi removido por extração com solvente. O peso molecular dos produtos correspondentes aos segmentos HS foi determinado através da técnica de dessorção à laser (MALDI - Matrix Assisted Laser Desorption. O acoplamento dos segmentos flexíveis com os rígidos fornecendo os produtos SPU foi feito em solução de DMF. Um poliuretano convencional foi preparado pela técnica em duas etapas (produto PU para comparação de efeitos estrutura-propriedades. A espectroscopia no infravermelho foi usada com o intuito de se observar diferenças em interações intermoleculares referentes aos produtos PU e SPU, mas estas diferenças só foram acessíveis através de estudos morfológicos que serão publicados em continuação a este estudo.A new method for segmented polyurethanes synthesis (SPU was developed, in which segments of well-defined characteristics were prepared separately and coupled together in a further step. The soft segment was prepared from the reaction of commercially available anionic polyol-polyether, with an average
Nanoscale modeling for ultrathin liquid films: Spreading and coupled layering
Phillips, David Michael
The hard disk drive (HDD) industry is currently experiencing a compound annual growth rate of 100% for the areal density. Current production drives have an areal density of 80 Gbit in-2, and drives with an areal density of 100 Gbit in-2 have been recently demonstrated. While much of this growth has been fueled by the development of new read/write heads, some of this gain was achieved by reducing the spacing between the heads and the magnetic media. This in turn reduces the spacing at the head-disk interface (HDI). The HDI in a HDD system consists of a slider, which contains the read/write heads, flying over the disk surface on an air bearing. The current designed separation distance, or fly height, is less than 10 nm. This spacing is expected to reduce to a mere 5 nm within the next few years. With the reduced fly height, intermittent contacts at the HDI become more probable. Only a thin lubricant film of perfluoropolyether (PFPE) and a sputtered carbon overcoat on the disk surface protect the slider and the stored data from mechanical and thermal damage. The PFPE film is quite thin, with a thickness of less than 2 nm or about a monolayer of molecules. During an HDI contact, the PFPE film is considered sacrificial and is often depleted in the contact area. In order to maintain adequate protection for the disk surface, PFPE molecules from the surrounding film must replenish the depleted area. This replenishment ability directly opposes the requirement that the PFPE film must not spin-off of the disk surface due to the disk rotation rate, which is as high as 10,000 RPM in current drives. To balance the PFPE films to sufficiently meet both requirements, HDD manufacturers functionalized the endgroups of the PFPE molecules to allow some portion of the lubricant film to reversibly bond with the disk overcoat. The result is a lubricant film that has a slower replenishment but does not spin-off. The work presented here focuses on the replenishment ability of thin films of
Directory of Open Access Journals (Sweden)
Smit Sibinga CT
2017-07-01
Full Text Available Cees Th Smit Sibinga,1 Maruff A Oladejo,2 Olamide Hakeem Adejumo,3 Quentin Eichbaum,4 Midori Kumagawa,5 Shuichi Kino,5 Sima Zolfaghari,6 Silvano Wendel,7 Gordana Rasovic,8 Namjil Erdenebayar,9 Maya Makhmudova,10 Loyiso Mpuntsha,11 Charlotte Ingram,11 Bakyt B Kharabaev,12 Isaac Kajja,13 Zainab Mukhtar Hussain Sanji,14 Maria M M Satti15 1IQM Consulting for International Development of Quality Management in Transfusion Medicine, University of Groningen, Groningen, the Netherlands; 2Department of Educational Management, University of Lagos, Lagos, 3Olabisi Onabanjo University Teaching Hospital, Sagamu, Nigeria; 4Department of Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, TN, USA; 5Japanese Red Cross Hokkaido Block Blood Center, Japan; 6IBTO, Tehran, Iran; 7Blood Bank, Hospital Sirio Libanês, Sao Paulo, Brazil; 8Montenegro National Blood Transfusion Center, Podgorica, Montenegro; 9National Center for Transfusion Medicine, Ulaanbaatar, Mongolia; 10Consultant IQM Consulting, Tashkent, Uzbekistan; 11South Africa National Blood Transfusion Service, Johannesburg, South Africa; 12National Blood Transfusion Service, Bishkek, Kyrgyzstan; 13Department of Orthopedics, Mulago Hospital, Makerere University, Uganda; 14Consultant, Dow University of Health Sciences, Karachi, Pakistan; 15National Blood Transfusion Service, Khartoum, Sudan Introduction: Clinical use of blood has shown the least developed part in the vein-to-vein transfusion chain. This global study was carried out in order to investigate the level of awareness, accessibility and utilization of continuous e-learning and education, and quality of blood use among blood prescribing clinicians and nurses.Approach: Descriptive ex post facto survey design.Methods: A total of 264 purposively selected blood prescribing clinicians and nurses from the four Human Development Index (HDI groups of countries (low, medium, high, and very high participated in this study
Simple vs. Complex Carbohydrate Dietary Patterns and the Global Overweight and Obesity Pandemic
Directory of Open Access Journals (Sweden)
Fabrizio Ferretti
2017-10-01
Full Text Available Nowadays, obesity and being overweight are among the major global health concerns. Many, diet-related diseases impose high tangible and intangible costs, and threaten the sustainability of health-care systems worldwide. In this study, we model, at the macroeconomic level, the impact of energy intake from different types of carbohydrates on the population’s BMI (body mass index. We proceed in three steps. First, we develop a framework to analyse both the consumption choices between simple and complex carbohydrates and the effects of these choices on people health conditions. Second, we collect figures for 185 countries (over the period 2012–2014 regarding the shares of simple (sugar and sweetener and complex (cereal carbohydrates in each country’s total dietary energy supply. Third, we use regression techniques to: (1 estimate the impact of these shares on the country’s prevalence of obesity and being overweight; (2 compute for each country an indicator of dietary pattern based on the ratio between simple and complex carbohydrates, weighted by their estimated effects on the prevalence of obesity and being overweight; and (3 measure the elasticity of the prevalence of obesity and being overweight with respect to changes in both carbohydrate dietary pattern and income per capita. We find that unhealthy eating habits and the associated prevalence of excessive body fat accumulation tend to behave as a ‘normal good’ in low, medium- and high-HDI (Human Development Index countries, but as an ‘inferior good’ in very high-HDI countries.
Airborne thermal degradation products of polyurethene coatings in car repair shops.
Karlsson, D; Spanne, M; Dalene, M; Skarping, G
2000-10-01
A methodology for workplace air monitoring of aromatic and aliphatic, mono- and polyisocyanates by derivatisation with di-n-butylamine (DBA) is presented. Air sampling was performed using midget impinger flasks containing 10 ml of 0.01 mol l(-1) DBA in toluene and a glass-fibre filter in series after the impinger flask, thereby providing the possibility of collecting and derivatising isocyanates in both the gas and particle phases. Quantification was made by LC-MS, monitoring the molecular ions [MH]+. Air samples taken with this method in car repair shops showed that many different isocyanates are formed during thermal decomposition of polyurethane (PUR) coatings. In addition to isocyanates such as hexamethylene (HDI), isophorone (IPDI), toluene (TDI) and methylenediphenyl diisocyanate (MDI), monoisocyanates such as methyl (MIC), ethyl (EIC), propyl (PIC), butyl (BIC) and phenyl isocyanate (PhI) were found. In many air samples the aliphatic monoisocyanates dominated. During cutting and welding operations, the highest levels of isocyanates were observed. In a single air sample from a welding operation in a car repair shop, the highest concentrations found were: MIC, 290; EIC, 60; PIC, 20; BIC, 9; PhI, 27; HDI, 105; IPDI, 39; MDI, 4; and 2,4-TDI and 2,6-TDI 140 microg m(-3). Monitoring the particle size distribution and concentration during grinding, welding and cutting operations showed that ultrafine particles (< 0.1 microm) were formed at high concentrations. Isocyanates with low volatility were mainly found in the particle phase, but isocyanates with a relatively high volatility such as TDI, were found in both the particle and gas phases.
Mertens, Elly; Markey, Oonagh; Geleijnse, Johanna M; Lovegrove, Julie A; Givens, D Ian
2018-04-01
Epidemiological findings indicate that higher adherence to a healthy diet may lower cardiovascular disease (CVD) risk. The present study aimed to investigate whether adherence to a healthy diet, assessed by the Healthy Diet Indicator (HDI), Dietary Approaches to Stop Hypertension (DASH) score, and Alternative Healthy Eating Index 2010 (AHEI-2010), was associated with CVD incidence and risk markers. Included in the present analyses were data from 1867 middle-aged men, aged 56.7 ± 4.5 years at baseline, recruited into the Caerphilly Prospective Study. Adherence to a healthy diet was examined in relation to CVD, coronary heart disease (CHD), and stroke incidence (Cox regression), and risk markers (linear regression) with adjustment for relevant confounders. The DASH score was inversely associated with CVD [hazard ratio (HR) 0.81; 95% confidence interval (CI) 0.66, 0.99], and stroke (HR 0.61; 95% CI 0.42, 0.88) incidence, but not with CHD after an average of 16.6 year follow-up, and with diastolic blood pressure, after 12 year follow-up. The AHEI-2010 was inversely associated with stroke (HR 0.66; 95% CI 0.42, 0.88) incidence, aortic pulse wave velocity, and C-reactive protein. The HDI was not associated with any single outcome. Higher DASH and AHEI-2010 scores were associated with lower CVD and stroke risk, and favourable cardiovascular health outcomes, suggesting that encouraging middle-aged men to comply with the dietary recommendations for a healthy diet may have important implications for future vascular disease and population health.
Greiman, Alyssa K; Rosoff, James S; Prasad, Sandip M
2017-12-01
To describe contemporary worldwide age-standardized incidence and mortality rates for bladder, kidney, prostate and testis cancer and their association with development. We obtained gender-specific, age-standardized incidence and mortality rates for 184 countries and 16 major world regions from the GLOBOCAN 2012 database. We compared the mortality-to-incidence ratios (MIRs) at national and regional levels in males and females, and assessed the association with socio-economic development using the 2014 United Nations Human Development Index (HDI). Age-standardized incidence rates were 2.9 (bladder) to 7.4 (testis) times higher for genitourinary malignancies in more developed countries compared with less developed countries. Age-standardized mortality rates were 1.5-2.2 times higher in more vs less developed countries for prostate, bladder and kidney cancer, with no variation in mortality rates observed in testis cancer. There was a strong inverse relationship between HDI and MIR in testis (regression coefficient 1.65, R 2 = 0.78), prostate (regression coefficient -1.56, R 2 = 0.85), kidney (regression coefficient -1.34, R 2 = 0.74), and bladder cancer (regression coefficient -1.01, R 2 = 0.80). While incidence and mortality rates for genitourinary cancers vary widely throughout the world, the MIR is highest in less developed countries for all four major genitourinary malignancies. Further research is needed to understand whether differences in comorbidities, exposures, time to diagnosis, access to healthcare, diagnostic techniques or treatment options explain the observed inequalities in genitourinary cancer outcomes. © 2017 The Authors BJU International © 2017 BJU International Published by John Wiley & Sons Ltd.
Water-energy-food nexus for adopting sustainable development goals in Asia
Taniguchi, M.
2016-12-01
Water, energy, and food are the most essential and fundamental resources for human well-beings, a sustainable society, and global sustainability. These are inextricably linked, and there are complex synergies and tradeoffs among the three resources. More issues arise and attention must be paid when it comes to the Water-Energy-Food (WEF) Nexus. Lack of integrated research between a nexus and policy implementation is the most concerning. The United Nations Sustainable Development Goals (SDGs) aim to end poverty, protect the planet, and ensure prosperity for all, and are scheduled to be achieved by 2030. Of the 17 SDGs, Goal 2, 6 and 7 are directly related to food, water, and energy sectors. However, there are no integrated SDGs related to the Water-Energy-Food Nexus. Two different directions of nexus research exist in developing and industrialized worlds, and synthesis of both are needed. Developing countries are striving to increase their Human Development Index (HDI) while keeping Ecological Footprints, including Nexus Footprint, low. On the other hand, industrialized countries are targeting to maintain their high HDI and reduce their Ecological Footprints. Both are challenging tasks under the restrictions of planetary boundaries (limited nature) and doughnut economy (limited society). In this study, WEF Nexus research in Asian countries, including developing and industrialized countries, demonstrates the different types of nexus approaches to achieve SDGs through renewable energy, agriculture and aquaculture as food, and water management in Monsoon and semi-arid Asia. Mutual learning between the two types of nexus approaches can be made in the Asian area.
Under-reporting of dietary energy intake in five populations of the African diaspora.
Orcholski, Lindsay; Luke, Amy; Plange-Rhule, Jacob; Bovet, Pascal; Forrester, Terrence E; Lambert, Estelle V; Dugas, Lara R; Kettmann, Elizabeth; Durazo-Arvizu, Ramon A; Cooper, Richard S; Schoeller, Dale A
2015-02-14
Studies on the role of diet in the development of chronic diseases often rely on self-report surveys of dietary intake. Unfortunately, many validity studies have demonstrated that self-reported dietary intake is subject to systematic under-reporting, although the vast majority of such studies have been conducted in industrialised countries. The aim of the present study was to investigate whether or not systematic reporting error exists among the individuals of African ancestry (n 324) in five countries distributed across the Human Development Index (HDI) scale, a UN statistic devised to rank countries on non-income factors plus economic indicators. Using two 24 h dietary recalls to assess energy intake and the doubly labelled water method to assess total energy expenditure, we calculated the difference between these two values ((self-report - expenditure/expenditure) × 100) to identify under-reporting of habitual energy intake in selected communities in Ghana, South Africa, Seychelles, Jamaica and the USA. Under-reporting of habitual energy intake was observed in all the five countries. The South African cohort exhibited the highest mean under-reporting ( - 52·1% of energy) compared with the cohorts of Ghana ( - 22·5%), Jamaica ( - 17·9%), Seychelles ( - 25·0%) and the USA ( - 18·5%). BMI was the most consistent predictor of under-reporting compared with other predictors. In conclusion, there is substantial under-reporting of dietary energy intake in populations across the whole range of the HDI, and this systematic reporting error increases according to the BMI of an individual.
Directory of Open Access Journals (Sweden)
Gudlavalleti VS Murthy
2012-01-01
Full Text Available Background: In the final push toward the elimination of avoidable blindness, cataract occupies a position of eminence for the success of the Right to Sight initiative. Aims: Review existing situation and assess what monitoring indicators may be useful to chart progress towards attaining the goals of Vision 2020. Settings and Design: Review of published papers from low and middle income countries since 2000. Materials and Methods: Published population-based data on prevalence of cataract blindness/visual impairment were accessed and prevalence of cataract blindness/visual impairment computed, where not reported. Data on prevalence of cataract blindness, cataract surgical coverage at different visual acuity cut offs, surgical outcomes, and prevalence of cataract surgery were analyzed. Scatter plots were used to look at relationships of some variables, with Human Development Index (HDI rank. Available data on Cataract Surgical Rate (CSR was plotted against prevalence of cataract surgery reported from surveys. Results: Worse HDI Ranks were associated with higher prevalence of cataract blindness. Most studies showed that a significant proportion of the blind were covered by surgery, while a fifth showed that a significant proportion, were operated before they went blind. A good visual outcome after surgery was positively correlated with higher surgical coverage. CSR was positively correlated with cataract surgical coverage. Conclusions: Cataract surgical coverage is increasing in most countries at vision <3/60 and visual outcomes after cataract surgery are improving. Establishing population-based surveillance of cataract surgical need and performance is a strong monitoring tool and will help program planners immensely.
Klećkowska-Nawrot, Joanna; Nowaczyk, Renata; Goździewska-Harłajczuk, Karolina; Barszcz, Karolina; Kowalczyk, Artur; Łukaszewicz, Ewa
2016-01-01
Normal structure of the accessory organs of the eye is essential for normal eye physiology. Among the most important accessory organs of the eye are the eyelids, the conjunctiva-associated lymphoid tissue (CALT) and the lacrimal gland (LG). The aim of this study was to demonstrate the histological structure of the eyelids and LG by histochemical and ultrastructural analysis. The study was performed on 13 adult female Bilgorajska geese. Eyelid samples were stained with the Alcian blue (AB pH 2.5) and periodic acid-Schiff (PAS) methods. Staining methods used for LG were AB pH 2.5, aldehyde fuchsin (AF), PAS and Hale's dialysed iron (HDI). Within the connective tissue of the eyelids, well-developed, diffuse, CALT follicles were observed, mostly under the conjunctival epithelium. Numerous lymphocytes were present within loose connective tissue. Staining of the eyelids with the PAS method demonstrated the presence of goblet cells of a mucous nature, and AB pH 2.5 staining indicated the presence of sulfated acid mucopolysaccharides. PAS staining of LG revealed the presence of secretory cells containing weakly PAS-positive granules. All epithelial cells of the corpus glandulae and the duct systems reacted positively to AB pH 2.5. HDI staining detected the presence of carboxylated acid mucopolysaccharides. Transmission electron microscopy investigations revealed two types of secretory epithelial cells in LG. Both types of LG cells contained drop-like secretory vesicles of different sizes with low or high electron density in cytoplasm, as well as small and large lipid vacuoles, and numerous small primary lysosomes.
DEFF Research Database (Denmark)
Christensen, Jesper Bjerg; Dionisio, Giuseppe; Poulsen, Hanne Damgaard
2014-01-01
.3. Solubilized and degraded proteins evaluated by biuret, SDS-PAGE, and differential proteomics revealed that pH 4.3 had the greatest impact on both solubilization and degradation. In order to boost proteolysis, the recombinant barley endoprotease B2 (rec-HvEP-B2) was included after 8 h using the pH 4.3 regime......Nonfermented soaking of barley feedstuff has been established as an in vitro procedure prior to the feeding of pigs as it can increase protein digestibility. In the current study, two feed cultivars of barley (Finlissa and Zephyr) were soaked in vitro either nonbuffered or buffered at pH 3.6 and 4....... Proteolysis evaluated by SDS-PAGE and differential proteomics confirmed a powerful effect of adding rec-HvEP-B2 to the soaked barley, regardless of the genotype. Our study addresses the use of rec-HvEP-B2 as an effective feed enzyme protease. HvEP-B2 has the potential to increase the digestibility of protein...
Degradation mechanism and thermal stability of urea nitrate below the melting point
International Nuclear Information System (INIS)
Desilets, Sylvain; Brousseau, Patrick; Chamberland, Daniel; Singh, Shanti; Feng, Hongtu; Turcotte, Richard; Anderson, John
2011-01-01
Highlights: → Decomposition mechanism of urea nitrate. → Spectral characterization of the decomposition mechanism. → Thermal stability of urea nitrate at 50, 70 and 100 o C. → Chemical balance of decomposed products released. - Abstract: Aging and degradation of urea nitrate below the melting point, at 100 o C, was studied by using thermal analysis and spectroscopic methods including IR, Raman, 1 H and 13 C NMR techniques. It was found that urea nitrate was completely degraded after 72 h at 100 o C into a mixture of solids (69%) and released gaseous species (31%). The degradation mechanism below the melting point was clearly identified. The remaining solid mixture was composed of ammonium nitrate, urea and biuret while unreacted residual nitric and isocyanic acids as well as traces of ammonia were released as gaseous species at 100 o C. The thermal stability of urea nitrate, under extreme storage conditions (50 o C), was also examined by isothermal nano-calorimetry.
A new antibiotic produced by the cyanobacterium-symbiotic fungus Simplicillium lanosoniveum.
Dong, Qinglin; Dong, Rongzhen; Xing, Xiangying; Li, Yukuan
2018-06-01
The culture broth of the cyanobacterium-symbiotic fungus Simplicillium lanosoniveum var. Tianjinienss Q. L. Dong exhibited unanticipated antibacterial activities against the Gram-positive bacteria, particularly the pathogenic bacterium Staphylococcus aureus, indicating the secretion of antibiotic-like metabolite, for which the modified Sabouraud medium was the suitable medium. The antibiotic-like metabolite was separated with macroporous resins CT-12 (absorption) and 95% ethanol (desorption), purified by ion-exchange resins D301T and displayed a characteristic absorption peak at 228 nm, suggesting the presence of nitrogen. The negative biuret and ninhydrin tests confirmed the absence of -NH 2 and -COOH groups. Further, HPLC and mass spectrometry analyses showed that the retention time and molecular weight of the antibiotic-like metabolite were 4.1031 min and 163.0182 (Δ ± 2.3 ppm), respectively. Taking together, we speculated that the antibiotic-like metabolite was a new antibiotic structurally similar to alkaloid, which was the first one isolated from the species of Simplicillium genus.
Kovacs, Mark Istvan; Gadek, Tomasz; Honma, Alan; Vasey, Francois
2017-01-01
The CMS Tracker Phase-2 Upgrade for HL-LHC requires High Density Interconnect (HDI) flexible hybrid circuits to build modules with low mass and high granularity. The hybrids are carbon fibre reinforced flexible circuits with flip-chips and passives. Three different manufacturers produced prototype hybrids for the Pixel-Strip type modules. The first part of the presentation will focus on the design challenges of this state of the art circuit. Afterwards, the difficulties and experience related to the circuit manufacturing and assembly are presented. The description of quality inspection methods with comprehensive test results will lead to the conclusion.
El Rostro Andino del Arco Iris La diversidad cultural, el desarrollo y el sumak kawsay ecuatoriano
Directory of Open Access Journals (Sweden)
Merchán, Andrés Abad
2011-12-01
Full Text Available The article reflects on the concept of human development and its cultural dimensions. It analyzes the Human Development Index (HDI, the legal framework for development in the Ecuador and the concept of sumak kawsay (known as "living well", as well as the intrinsic relationship between biological and cultural diversity. In addition, it analyzes the proposal of UNESCO, which provides a series of indicators linked to welfare and the promotion of cultural and creative diversity. Finally, the National Plan for Living Well 2009-2013 drawn up by the National Secretariat of Planning and Development (SENPLADES is reviewed.
Neglected tropical diseases in Brazil Doenças tropicais negligenciadas no Brasil
Directory of Open Access Journals (Sweden)
José Angelo L. Lindoso
2009-10-01
Full Text Available Poverty is intrinsically related to the incidence of Neglected Tropical Diseases (NTDs. The main countries that have the lowest human development indices (HDI and the highest burdens of NTDs are located in tropical and subtropical regions of the world. Among these countries is Brazil, which is ranked 70th in HDI. Nine out of the ten NTDs established by the World Health Organization (WHO are present in Brazil. Leishmaniasis, tuberculosis, dengue fever and leprosy are present over almost the entire Brazilian territory. More than 90% of malaria cases occur in the Northern region of the country, and lymphatic filariasis and onchocerciasis occur in outbreaks in a particular region. The North and Northeast regions of Brazil have the lowest HDIs and the highest rates of NTDs. These diseases are considered neglected because there is not important investment in projects for the development of new drugs and vaccines and existing programs to control these diseases are not sufficient. Another problem related to NTDs is co-infection with HIV, which favors the occurrence of severe clinical manifestations and therapeutic failure. In this article, we describe the status of the main NTDs currently occurring in Brazil and relate them to the HDI and poverty.A pobreza está intrinsicamente relacionada com a ocorrência de doenças tropicais negligenciadas (DTNs. Os principais países com os menores índices de desenvolvimento humano (IDH e a maior carga de DTNs estão nas regiões tropicais e subtropicais do globo terrestre. O Brasil é o 70º país no ranking do IDH e concentra nove das 10 principais doenças tropicais consideradas negligenciadas pela OMS. Leishmanioses, tuberculose, dengue e hanseníase ocorrem em quase todo o território do Brasil. Mais de 90% dos casos de malária ocorrem na região norte e há surtos de filariose linfática e oncocercose. As regiões norte e nordeste apresentam o menor IDH e concentram o maior número das DTNs. Essas doen
Langebeek, Nienke; Gisolf, Elizabeth H; Reiss, Peter; Vervoort, Sigrid C; Hafsteinsdóttir, Thóra B; Richter, Clemens; Sprangers, Mirjam A G; Nieuwkerk, Pythia T
2014-08-21
Adherence to combination antiretroviral therapy (ART) is a key predictor of the success of human immunodeficiency virus (HIV) treatment, and is potentially amenable to intervention. Insight into predictors or correlates of non-adherence to ART may help guide targets for the development of adherence-enhancing interventions. Our objective was to review evidence on predictors/correlates of adherence to ART, and to aggregate findings into quantitative estimates of their impact on adherence. We searched PubMed for original English-language papers, published between 1996 and June 2014, and the reference lists of all relevant articles found. Studies reporting on predictors/correlates of adherence of adults prescribed ART for chronic HIV infection were included without restriction to adherence assessment method, study design or geographical location. Two researchers independently extracted the data from the same papers. Random effects models with inverse variance weights were used to aggregate findings into pooled effects estimates with 95% confidence intervals. The standardized mean difference (SMD) was used as the common effect size. The impact of study design features (adherence assessment method, study design, and the United Nations Human Development Index (HDI) of the country in which the study was set) was investigated using categorical mixed effects meta-regression. In total, 207 studies were included. The following predictors/correlates were most strongly associated with adherence: adherence self-efficacy (SMD = 0.603, P = 0.001), current substance use (SMD = -0.395, P = 0.001), concerns about ART (SMD = -0.388, P = 0.001), beliefs about the necessity/utility of ART (SMD = 0.357, P = 0.001), trust/satisfaction with the HIV care provider (SMD = 0.377, P = 0.001), depressive symptoms (SMD = -0.305, P = 0.001), stigma about HIV (SMD = -0.282, P = 0.001), and social support (SMD = 0.237, P = 0.001). Smaller but significant associations were observed for the
Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus
2011-01-01
A majority of recipients benefited from the intra-operative single high-dose induction (HDI) with ATG-Fresenius (ATG-F) still leaving a group of recipients who did not profit from this kind of induction. Therefore the aim of this retrospective analysis was 1st to identify the risk factors impacting short and long-term graft survival, and 2nd to assess the efficacy of this type of induction in kidney graft recipients with or without these risk factors. A total of 606 recipients receiving two different immunosuppressive treatment regimens (1st: Triple drug therapy [TDT, n=196] consisting mainly of steroids, azathioprine and cyclosporine; 2nd: TDT + 9 mg/kg ATG-F intra-operatively [HDI, n=410]) were included in this analysis and grouped according to their kidney graft survival time (short GST: ≤1 yr, n=100 and long GST: >5 yrs, n=506). The main risk factors associated with a shortened graft survival were pre-transplant sensitization, re-transplantation, rejections (in particular vascular or mixed ones) and the necessity of a long-term anti-rejection therapy. Adding ATG-F single high dose induction to TDT was more efficient in prolonging kidney graft survival than TDT alone not only in recipients without any risk factors (p<0.005) but also in recipients with at least one risk factor (p<0.021). Only in 4.6% of recipients having two or more risk factors this effect could not be demonstrated. The intra-operative single high-dose induction with ATG-F significantly improves the kidney graft survival in recipients with or without risk factors and can therefore be recommended.
Assessing Patient Participation in Health Policy Decision-Making in Cyprus
Directory of Open Access Journals (Sweden)
Kyriakos Souliotis
2016-08-01
Full Text Available Although the importance of patient participation in the design and evaluation of health programs and services is well-documented, there is scarcity of research with regard to patient association (PA participation in health policy decision-making processes. To this end, the present study aimed to validate further a previously developed instrument as well as to investigate the degree of PA participation in health policy decision-making in Cyprus. A convenient sample of 114 patients-members of patients associations took part in the study. Participants were recruited from an umbrella organization, the Pancyprian Federation of Patient Associations and Friends (PFPA. PA participation in health policy decision-making was assessed with the Health Democracy Index (HDI, an original 8-item tool. To explore its psychometric properties, Cronbach α was computed as regards to its internal consistency, while its convergent validity was tested against a self-rated question enquiring about the degree of PA participation in health policy decision-making. The findings revealed that the HDI has good internal consistency and convergent validity. Furthermore, PAs were found to participate more in consultations in health-related organizations and the Ministry of Health (MoH as well as in reforms or crucial decisions in health policy. Lower levels were documented with regard to participation in hospital boards, ethics committees in clinical trials and health technology assessment (HTA procedures. Overall, PA participation levels were found to be lower than the mid-point of the scale. Targeted interventions aiming to facilitate patients’ involvement in health policy decision-making processes and to increase its impact are greatly needed in Cyprus.
International Nuclear Information System (INIS)
Kaw, P.K.; Bandyopadhyay, I.
2012-01-01
Humans do not live by bread alone. Physically we are puny creatures with limited prowess, but with unlimited dreams. We see a mountain and want to move it to carve out a path for ourselves. We see a river and want to tame it so that it irrigates our fields. We see a star and want to fly to its planets to secure a future for our progeny. For all this, we need a genie who will do our bidding at a flip of our fingers. Energy is such a genie. Modern humans need energy and lots of it to live a life of comfort. In fact, the quality of life in different regions of the world can be directly correlated with the per capita use of energy. In this regard, the human development index (HDI) of various countries based on various reports by the United Nations Development Programme (UNDP), which is a parameter measuring the quality of life in a given part of the world, is directly determined by the amount of per capita electricity consumption. Most of the developing world (∼5 billion people) is crawling up the UN curve of HDI versus per capita electricity consumption, from abysmally low values of today towards the average of the whole world and eventually towards the average of the developed world. This translates into a massive energy hunger for the globe as a whole. It has been estimated that by the year 2050, the global electricity demand will go up by a factor of up to 3 in a high growth scenario. The requirements beyond 2050 go up even higher. (author)
Impact of Health Research Systems on Under-5 Mortality Rate: A Trend Analysis
Directory of Open Access Journals (Sweden)
Bahareh Yazdizadeh
2017-07-01
Full Text Available Background Between 1990 and 2015, under-5 mortality rate (U5MR declined by 53%, from an estimated rate of 91 deaths per 1000 live births to 43, globally. The aim of this study was to determine the share of health research systems in this decrease alongside other influential factors. Methods We used random effect regression models including the ‘random intercept’ and ‘random intercept and random slope’ models to analyze the panel data from 1990 to 2010. We selected the countries with U5MRs falling between the first and third quartiles in 1990. We used both the total articles (TA and the number of child-specific articles (CSA as a proxy of the health research system. In order to account for the impact of other factors, measles vaccination coverage (MVC (as a proxy of health system performance, gross domestic product (GDP, human development index (HDI, and corruption perception index (CPI (as proxies of development, were embedded in the model. Results Among all the models, ‘the random intercept and random slope models’ had lower residuals. The same variables of CSA, HDI, and time were significant and the coefficient of CSA was estimated at -0.17; meaning, with the addition of every 100 CSA, the rate of U5MR decreased by 17 per 1000 live births. Conclusion Although the number of CSA has contributed to the reduction of U5MR, the amount of its contribution is negligible compared to the countries’ development. We recommend entering different types of researches into the model separately in future research andincluding the variable of ‘exchange between knowledge generator and user.’
Assessing Patient Participation in Health Policy Decision-Making in Cyprus.
Souliotis, Kyriakos; Agapidaki, Eirini; Peppou, Lily Evangelia; Tzavara, Chara; Samoutis, George; Theodorou, Mamas
2016-06-20
Although the importance of patient participation in the design and evaluation of health programs and services is well-documented, there is scarcity of research with regard to patient association (PA) participation in health policy decision-making processes. To this end, the present study aimed to validate further a previously developed instrument as well as to investigate the degree of PA participation in health policy decision-making in Cyprus. A convenient sample of 114 patients-members of patients associations took part in the study. Participants were recruited from an umbrella organization, the Pancyprian Federation of Patient Associations and Friends (PFPA). PA participation in health policy decision-making was assessed with the Health Democracy Index (HDI), an original 8-item tool. To explore its psychometric properties, Cronbach α was computed as regards to its internal consistency, while its convergent validity was tested against a self-rated question enquiring about the degree of PA participation in health policy decision-making. The findings revealed that the HDI has good internal consistency and convergent validity. Furthermore, PAs were found to participate more in consultations in health-related organizations and the Ministry of Health (MoH) as well as in reforms or crucial decisions in health policy. Lower levels were documented with regard to participation in hospital boards, ethics committees in clinical trials and health technology assessment (HTA) procedures. Overall, PA participation levels were found to be lower than the mid-point of the scale. Targeted interventions aiming to facilitate patients' involvement in health policy decision-making processes and to increase its impact are greatly needed in Cyprus. © 2016 by Kerman University of Medical Sciences.
[Gender development inequalities epidemiology in Spain (1990-2000)].
Carrasco-Portiño, Mercedes; Ruiz-Cantero, María Teresa; Gil-González, Diana; Díaz, Carlos Alvarez-Dardet; Torrubiano-Domínguez, Jordi
2008-01-01
Gender is an important health determinant for public health policies. This study describes the changes in gender development inequalities in Spain and its autonomous regions from 1990 to 2000. An ecological study using the Human Development Index (HDI) and the Gender Development Index (GDI) was done. IDG both men and women was analysed according to indexes of education, income and life expectancy at birth. Although the GDI has had an increase of 5,05% in the 90 s, 51,5% of the population was located above the global GDI of Spain in 1990, moreover this number decreased to 46,3% in 2000. Gender inequalities have been reduced both at national and regional levels. The regions with the lowest increase were Asturias (3.37%), Cantabria (3.68%) and Baleares Islands (3.71%). The regions with the highest increase were Madrid (6,46%) and Extremadura (6,75%). All the autonomous regions showed a number of GDI lower than the value of HDI. Both sexes achieved similar increase in life expectancy (Men: 5% and Women: 4%). An unequal variation was detected according to the autonomous region (Basque Country; Men: 7% and Women: 3%; Madrid; Men:8% and Women:5%). Women have improved their educational level in comparison to men (Men: 3% and Women: 6%). In the 90 s, men obtained more income than women, but women improved their situation three times more than men. Inequalities in Human Development analysed by gender have been reduced in the 90 s in Spain. However, the improvement of education, income and life expectancy occurred only in some autonomous regions. This situation shows the differences among Spanish autonomous regions.
Energy Technology Data Exchange (ETDEWEB)
Kaw, P K; Bandyopadhyay, I [Institute for Plasma Research, Bhat, Gandhinagar, Gujarat (India)
2012-09-15
Humans do not live by bread alone. Physically we are puny creatures with limited prowess, but with unlimited dreams. We see a mountain and want to move it to carve out a path for ourselves. We see a river and want to tame it so that it irrigates our fields. We see a star and want to fly to its planets to secure a future for our progeny. For all this, we need a genie who will do our bidding at a flip of our fingers. Energy is such a genie. Modern humans need energy and lots of it to live a life of comfort. In fact, the quality of life in different regions of the world can be directly correlated with the per capita use of energy. In this regard, the human development index (HDI) of various countries based on various reports by the United Nations Development Programme (UNDP), which is a parameter measuring the quality of life in a given part of the world, is directly determined by the amount of per capita electricity consumption. Most of the developing world ({approx}5 billion people) is crawling up the UN curve of HDI versus per capita electricity consumption, from abysmally low values of today towards the average of the whole world and eventually towards the average of the developed world. This translates into a massive energy hunger for the globe as a whole. It has been estimated that by the year 2050, the global electricity demand will go up by a factor of up to 3 in a high growth scenario. The requirements beyond 2050 go up even higher. (author)
Laboratory Characterization Tests for Antimisting Fuel.
1987-03-01
Por hdi cal lv, clean wtith chromic acid to reTove traces r! rt c ,t r al e t 1t,’ t t I irt ft tf,(- viscomter C t! tC. ’o( +( .fl50( ,r,, .. , i:t...bath to bel ow 3.9o C. Bubbl e gaseous sul1fur dioxid’e (SO-) through rocetatdsul furic acid (S( 4 ,sp gr 1 .84-) into th, coo led mixture . (’out :oue...qeyce. .t d ’ŕ X oku.4 ict t ,Avenue., NW 3034 W! I. Mr. ,. Thris Meldrum Mr. James H. O’Mara Texdao Company Rohm and Haas P.O. Box 430 727
2008-01-01
TM võrdleb diiselmootoriga pereautosid: Audi A4 2,0 TDI, BMW 123d Coupé, Chrysler Sebring 2,0 CRD Touring, Fiat Bravo 1,9 JTD Dynamic, Ford Mondeo 1,8 TDCi Trend, Hyundai i30 1,6 CRDi Comfort, Kia Cee’d 1,6 CRDi EX, Mercedes-Benz C 200 CDI, Mitsubishi Lancer 2,0 DID Intense, Nissan Qashqai 4x2 1,5 dCi Acenta, Peugeot 308 Premium HDI 110 FAP, Renault Laguna Expression 1,5 dCi Eco2, Škoda Fabia 1,9 TDI Sport, Toyota Auris 1,4 D-4D Linea Sol, Volvo V70 2,0D Momentum
Comment faire la part des choses ? Une sociologie des dispositifs d’aide aux choix
Directory of Open Access Journals (Sweden)
Samuel Lézé
2011-03-01
Full Text Available Les consommateurs contemporains doivent faire face à une offre de plus en plus complexe constituée de produits a priori équivalents en termes d’utilité, de qualité ou de prix comme, par exemple, une automobile : Peugeot Partner 2.0 HDI ou Renault Kangoo 4X4 1.9 dCi. Cette situation s’apparente au fameux paradoxe philosophique de l’âne de Buridan : soit un âne affamé placé à égale distance de deux quantités semblables de nourriture, deux bottes de foin identiques. Incapable de choisir, il fin...
Fidler, Miranda M; Gupta, Sumit; Soerjomataram, Isabelle; Ferlay, Jacques; Steliarova-Foucher, Eva; Bray, Freddie
2017-12-01
To date, the burden of cancer among young adults has rarely been studied in depth. Our aim was to describe the scale and profile of cancer incidence and mortality worldwide among 20-39 year-olds, highlighting major patterns by age, sex, development level, and geographical region. We did a population-based study to quantify the burden of young adult cancers worldwide. We defined young adult cancers as those occurring between the ages of 20 and 39 years because these individuals will have passed puberty and adolescence, but not yet experienced the effects of hormonal decline, immune response deterioration, or organ dysfunction associated with chronic health conditions. Global, regional, and country-specific (n=184) data estimates of the number of new cancer cases and cancer-associated deaths that occurred in 2012 among young adults were extracted in four 5-year bands from the International Agency for Research on Cancer's GLOBOCAN 2012 for all cancers combined and for 27 major types as defined by the International Classification of Disease, tenth revision. We report the number of new cancer cases and cancer-associated deaths overall and by sex alongside corresponding age-standardised rates (ASR) per 100 000 people per year. We also present results using four levels of the Human Development Index (HDI; low [least developed], medium, high, and very high [most developed]), which is a composite indicator for socioeconomic development comprising life expectancy, education, and gross national income. 975 396 new cancer cases and 358 392 cancer-associated deaths occurred among young adults worldwide in 2012, which equated to an ASR of 43·3 new cancer cases per 100 000 people per year and 15·9 cancer-associated deaths per 100 000 people per year. The burden was disproportionally greater among women and the most common cancer types overall in terms of new cases were female breast cancer, cervical cancer, thyroid cancer, leukaemia, and colorectal cancer; in terms of
FEATURES OF EVALUATION OF THE COMPETITIVE STATUS OF TOURIST ENTERPRISES
Directory of Open Access Journals (Sweden)
Kyrylo Mykolaychuk
2017-09-01
Full Text Available The purpose of the paper is to provide methodological approaches to assessing the competitive status of the tourism business at different levels of management and to determine the characteristics of models for tourism enterprises. The construction of models will allow identifying the factors, influencing the competitive position; will contribute to increasing the competitiveness of tourism business in the regions and countries. Methodology. The research is based on a comparison of the methods of assessing the competitiveness of countries and their achievements in sustainable development. Indicators of competitiveness characterize the preconditions of development, and achievements in the implementation of competitiveness can be estimated on the basis of competitive status. The main achievement of each country is to ensure sustainable development. A generalized assessment, positioning of states is based on the Human Development Index (HDI. It can be considered the main method of assessing the competitive status of the country. To assess the achievements of the regions in ensuring sustainable development, the regions of the HDI are determined, and appropriate indicators for enterprises can be developed. Such a system of assessment is also required for tourism business. Competitiveness of tourism activity of countries is assessed internationally by the index of competitiveness of travel and tourism (ICTT. Based on the comparison of the HDI and ICTT, it is advisable to develop an indicator of the competitive status of tourism business in the country, regions, and enterprises. Results. Among the components of HDI, the most important is economic and social development. The impact of the tourism business on the economic component reflects the direct contribution to GDP of the country, as well as the indirect contribution by the cost of tourists in the territory of stay and investment in the development of tourism activities. One of the main social
RESEARCH METHODOLOGY OF SUS SCROFA TISSUE EXTRACTS PROTEIN-PEPTIDE COMPONENTS
Directory of Open Access Journals (Sweden)
Ekaterina R.. Vasilevskaya
2017-01-01
Full Text Available The article presents a comparative analysis of four methods for quantifying the protein-peptide complexes content in extracts obtained from animal raw materials, as well as the low- and highmolecular weight extract fractions: the direct spectrophotometric determination at wavelengths of 260 and 280 nm with subsequent calculation by the Kalckar formula; the biuret reaction by the Kingsley-Weichselbaum method; the method with Bradford reagent and the standard Lowry method. Experimental data analysis demonstrates that in case of the extract that contains protein-peptidic complexes in different molecular weights range, the Kingsley-Weichselbaum method shows the highest quality of protein concentration determination; while studying highmolecular weight fraction (more than 30 kDa, it is possible to obtain more information by combining the spectrophotometric method and the Kingsley-Weichselbaum method. Low-molecular weight fractions (less than 30 kD should be investigated by complex methods including the spectrophotometric method, Lowry and Bradford methods. These methods make it possible to presumably estimate protein molecules size ranges (by amount of peptide bonds, and also to determine hydrophobic and aromatic amino acids presence.
Assessment of the usefulness of the PIGE method to determine nitrogen in human blood serum
International Nuclear Information System (INIS)
Kupila-Rantala, T.; Hyvoenen-Dabek, M.; Raiasanen, J.; Dabek, J.T.
1995-01-01
Proton-induced gamma-ray emission (PIGE) analysis has been applied to the determination of total nitrogen concentration of blood sera from hospital patients. Both the reaction 14 N(p,p'γ) 14 N, E γ =2313 keV, and the reaction 15 N(p,αγ) 12 C,E γ =4439keV, have been used. From 37 patients, the range of the nitrogen concentrations obtained was 9.54-16.3 g/l with a mean of 12.0 g/l. The corresponding total protein concentrations varied between 59 and 96 g/l, measured in a clinical laboratory auto analyser using the biuret method. The range of the albumin concentrations was 29-46 g/l. The nitrogen concentrations correlated well with the total protein concentrations (r=0.802). The multiple correlation of nitrogen versus (albumin+ (total protein- albumin)) gives a coefficient of 0.175 for albumin and 0.161 for total protein- albumin. The results agree with expectations and support the potential usefulness of the rapid PIGE method for medical studies. (author). 17 refs., 3 figs
Directory of Open Access Journals (Sweden)
Paula Alessandra Di Filippppo
2010-12-01
Full Text Available Aiming at evaluating the electrophoresis profile of serum and peritoneal protein in horses submitted to an experimental model of intestinal obstruction, 24 animals were divided into four groups: instrumented control (GI, duodenum obstruction (GII, ileum obstruction (GIII and large colon obstruction (GIV. Blood and peritoneal fluid samples were collected before the surgical procedures (T0, 3h after the obstruction (Ti and 1, 3, 12, 24, 72, 120 and 168h after reperfusion (Tr. After sample centrifuging and fractioning, total protein were determined by biuret method, and the proteic fractions were separated by electrophoresis in agarose gel. Alterations were observed in serum and peritoneal concentrations of α, β and γ globulins on the studied animals. The changes occurred due to the intestinal inflammatory process caused by the obstruction model and the surgical trauma, associated to laparotomy. Animals submitted to duodenum and ileum obstruction showed higher serum and peritoneal concentrations of acute phase proteins. The electrophoretic separation of proteins included in the peritoneal liquid is more sensible when compared to the serum concentration to the diagnosis of abdominal inflammatory process.
Refractometric total protein concentrations in icteric serum from dogs.
Gupta, Aradhana; Stockham, Steven L
2014-01-01
To determine whether high serum bilirubin concentrations interfere with the measurement of serum total protein concentration by refractometry and to assess potential biases among refractometer measurements. Evaluation study. Sera from 2 healthy Greyhounds. Bilirubin was dissolved in 0.1M NaOH, and the resulting solution was mixed with sera from 2 dogs from which food had been withheld to achieve various bilirubin concentrations up to 40 mg/dL. Refractometric total protein concentrations were estimated with 3 clinical refractometers. A biochemical analyzer was used to measure biuret assay-based total protein and bilirubin concentrations with spectrophotometric assays. No interference with refractometric measurement of total protein concentrations was detected with bilirubin concentrations up to 41.5 mg/dL. Biases in refractometric total protein concentrations were detected and were related to the conversion of refractive index values to total protein concentrations. Hyperbilirubinemia did not interfere with the refractometric estimation of serum total protein concentration. The agreement among total protein concentrations estimated by 3 refractometers was dependent on the method of conversion of refractive index to total protein concentration and was independent of hyperbilirubinemia.
Global temporal patterns of pancreatic cancer and association with socioeconomic development.
Wong, Martin C S; Jiang, Johnny Y; Liang, Miaoyin; Fang, Yuan; Yeung, Ming Sze; Sung, Joseph J Y
2017-06-09
Pancreatic cancer induces a substantial global burden. We examined its global incidence/mortality rates and their correlation with socioeconomic development (Human Development Index [HDI] and Gross Domestic Product [GDP] in 2000 as proxy measures). Data on age-standardized incidence/mortality rates in 2012 were retrieved from the GLOBOCAN database. Temporal patterns in 1998-2007 were assessed for 39 countries according to gender. The Average Annual Percent Change (AAPC) of the incidence/mortality trends was evaluated using joinpoint regression analysis. The age-standardized incidence ranged between 0.8-8.9/100,000. When compared among countries, Brazil (AAPC = 10.4, 95%C.I. = 0.8,21) and France (AAPC = 4.7, 95%C.I. = 3.6,5.9) reported the highest incidence rise in men. The greatest increase in women was reported in Thailand (AAPC = 7, 95%C.I. = 2.1,12.1) and Ecuador (AAPC = 4.3, 95%C.I. = 1.3,7.3). For mortality, the Philippines (APCC = 4.3, 95%C.I. = 2,6.6) and Croatia (AAPC = 2, 95% C.I. = 0,3.9) reported the biggest increase among men. The Philippines (AAPC = 5.8, 95% C.I. 4.5,7.2) and Slovakia (AAPC = 3.1, 95% C.I. 0.9,5.3) showed the most prominent rise among women. Its incidence was positively correlated with HDI (men: r = 0.66; women: r = 0.70) and GDP (men: r = 0.29; women: r = 0.28, all p GDP]). In summary, the incidence and mortality of pancreatic cancer were rising in many countries, requiring regular surveillance.
Unhealthy Behaviours: An International Comparison.
Ferretti, Fabrizio
2015-01-01
In the current global economy, chronic non-communicable diseases (NCDs) have become the leading cause of death and a major health concern for both developed and developing countries. Among other factors, the worldwide spread of NCDs is driven by the globalisation of unhealthy habits. The purpose of this paper is to develop a simple statistic to measure, at the national level, the average population's exposure to the main NCDs modifiable risk factors. The approach and methodology followed by the United Nations Development Programme to compute the Human Development Index (HDI) is applied to four basic indicators of NCD-related preventable risk factors (alcohol consumption, excess caloric intake, non-balanced diet and tobacco use) in 112 countries worldwide in 2012-14. We obtain a summary composite index, which we call the Unhealthy Behaviour Index (UBI), which ranks countries by the average level of the unhealthy habits (drinking, eating and smoking) of their populations. We find that Belarus and Russian federation are the two countries with the unhealthiest NCD-related lifestyle. With the exception of Canada, the first twenty populations more exposed to the main NCDs preventable risk factors all live in European countries, and mainly in countries of Eastern Europe. Overall, the UBI tends to increase along with the level of human development. In medium, high and very high HDI countries, however, the same level of human development may be associated with very different kinds of NCD-related lifestyles. Finally, economic growth may push populations toward either more unhealthy or healthy habits, depending on the countries' level of development; the elasticity of unhealthy habits with respect to income per capita is positive (but less than one: on average 0.6) until $30,000, decreases as income rises, and becomes negative (around -0.3) in very high income countries.
Unhealthy Behaviours: An International Comparison.
Directory of Open Access Journals (Sweden)
Fabrizio Ferretti
Full Text Available In the current global economy, chronic non-communicable diseases (NCDs have become the leading cause of death and a major health concern for both developed and developing countries. Among other factors, the worldwide spread of NCDs is driven by the globalisation of unhealthy habits. The purpose of this paper is to develop a simple statistic to measure, at the national level, the average population's exposure to the main NCDs modifiable risk factors. The approach and methodology followed by the United Nations Development Programme to compute the Human Development Index (HDI is applied to four basic indicators of NCD-related preventable risk factors (alcohol consumption, excess caloric intake, non-balanced diet and tobacco use in 112 countries worldwide in 2012-14. We obtain a summary composite index, which we call the Unhealthy Behaviour Index (UBI, which ranks countries by the average level of the unhealthy habits (drinking, eating and smoking of their populations. We find that Belarus and Russian federation are the two countries with the unhealthiest NCD-related lifestyle. With the exception of Canada, the first twenty populations more exposed to the main NCDs preventable risk factors all live in European countries, and mainly in countries of Eastern Europe. Overall, the UBI tends to increase along with the level of human development. In medium, high and very high HDI countries, however, the same level of human development may be associated with very different kinds of NCD-related lifestyles. Finally, economic growth may push populations toward either more unhealthy or healthy habits, depending on the countries' level of development; the elasticity of unhealthy habits with respect to income per capita is positive (but less than one: on average 0.6 until $30,000, decreases as income rises, and becomes negative (around -0.3 in very high income countries.
Inflammation drives dysbiosis and bacterial invasion in murine models of ileal Crohn's disease.
Directory of Open Access Journals (Sweden)
Melanie Craven
Full Text Available Understanding the interplay between genetic susceptibility, the microbiome, the environment and the immune system in Crohn's Disease (CD is essential for developing optimal therapeutic strategies. We sought to examine the dynamics of the relationship between inflammation, the ileal microbiome, and host genetics in murine models of ileitis.We induced ileal inflammation of graded severity in C57BL6 mice by gavage with Toxoplasma gondii, Giardia muris, low dose indomethacin (LDI; 0.1 mg/mouse, or high dose indomethacin (HDI; 1 mg/mouse. The composition and spatial distribution of the mucosal microbiome was evaluated by 16S rDNA pyrosequencing and fluorescence in situ hybridization. Mucosal E. coli were enumerated by quantitative PCR, and characterized by phylogroup, genotype and pathotype.Moderate to severe ileitis induced by T. gondii (day 8 and HDI caused a consistent shift from >95% gram + Firmicutes to >95% gram - Proteobacteria. This was accompanied by reduced microbial diversity and mucosal invasion by adherent and invasive E. coli, mirroring the dysbiosis of ileal CD. In contrast, dysbiosis and bacterial invasion did not develop in mice with mild ileitis induced by Giardia muris. Superimposition of genetic susceptibility and T. Gondii infection revealed greatest dysbiosis and bacterial invasion in the CD-susceptible genotype, NOD2(-/-, and reduced dysbiosis in ileitis-resistant CCR2(-/- mice. Abrogating inflammation with the CD therapeutic anti-TNF-α-mAb tempered dysbiosis and bacterial invasion.Acute ileitis induces dysbiosis and proliferation of mucosally invasive E. coli, irrespective of trigger and genotype. The identification of CCR2 as a target for therapeutic intervention, and discovery that host genotype and therapeutic blockade of inflammation impact the threshold and extent of ileal dysbiosis are of high relevance to developing effective therapies for CD.
Inflammation drives dysbiosis and bacterial invasion in murine models of ileal Crohn's disease.
Craven, Melanie; Egan, Charlotte E; Dowd, Scot E; McDonough, Sean P; Dogan, Belgin; Denkers, Eric Y; Bowman, Dwight; Scherl, Ellen J; Simpson, Kenneth W
2012-01-01
Understanding the interplay between genetic susceptibility, the microbiome, the environment and the immune system in Crohn's Disease (CD) is essential for developing optimal therapeutic strategies. We sought to examine the dynamics of the relationship between inflammation, the ileal microbiome, and host genetics in murine models of ileitis. We induced ileal inflammation of graded severity in C57BL6 mice by gavage with Toxoplasma gondii, Giardia muris, low dose indomethacin (LDI; 0.1 mg/mouse), or high dose indomethacin (HDI; 1 mg/mouse). The composition and spatial distribution of the mucosal microbiome was evaluated by 16S rDNA pyrosequencing and fluorescence in situ hybridization. Mucosal E. coli were enumerated by quantitative PCR, and characterized by phylogroup, genotype and pathotype. Moderate to severe ileitis induced by T. gondii (day 8) and HDI caused a consistent shift from >95% gram + Firmicutes to >95% gram - Proteobacteria. This was accompanied by reduced microbial diversity and mucosal invasion by adherent and invasive E. coli, mirroring the dysbiosis of ileal CD. In contrast, dysbiosis and bacterial invasion did not develop in mice with mild ileitis induced by Giardia muris. Superimposition of genetic susceptibility and T. Gondii infection revealed greatest dysbiosis and bacterial invasion in the CD-susceptible genotype, NOD2(-/-), and reduced dysbiosis in ileitis-resistant CCR2(-/-) mice. Abrogating inflammation with the CD therapeutic anti-TNF-α-mAb tempered dysbiosis and bacterial invasion. Acute ileitis induces dysbiosis and proliferation of mucosally invasive E. coli, irrespective of trigger and genotype. The identification of CCR2 as a target for therapeutic intervention, and discovery that host genotype and therapeutic blockade of inflammation impact the threshold and extent of ileal dysbiosis are of high relevance to developing effective therapies for CD.
Inflammation Drives Dysbiosis and Bacterial Invasion in Murine Models of Ileal Crohn’s Disease
Craven, Melanie; Egan, Charlotte E.; Dowd, Scot E.; McDonough, Sean P.; Dogan, Belgin; Denkers, Eric Y.; Bowman, Dwight; Scherl, Ellen J.; Simpson, Kenneth W.
2012-01-01
Background and Aims Understanding the interplay between genetic susceptibility, the microbiome, the environment and the immune system in Crohn’s Disease (CD) is essential for developing optimal therapeutic strategies. We sought to examine the dynamics of the relationship between inflammation, the ileal microbiome, and host genetics in murine models of ileitis. Methods We induced ileal inflammation of graded severity in C57BL6 mice by gavage with Toxoplasma gondii, Giardia muris, low dose indomethacin (LDI;0.1 mg/mouse), or high dose indomethacin (HDI;1 mg/mouse). The composition and spatial distribution of the mucosal microbiome was evaluated by 16S rDNA pyrosequencing and fluorescence in situ hybridization. Mucosal E. coli were enumerated by quantitative PCR, and characterized by phylogroup, genotype and pathotype. Results Moderate to severe ileitis induced by T. gondii (day 8) and HDI caused a consistent shift from >95% Gram + Firmicutes to >95% Gram - Proteobacteria. This was accompanied by reduced microbial diversity and mucosal invasion by adherent and invasive E. coli, mirroring the dysbiosis of ileal CD. In contrast, dysbiosis and bacterial invasion did not develop in mice with mild ileitis induced by Giardia muris. Superimposition of genetic susceptibility and T. Gondii infection revealed greatest dysbiosis and bacterial invasion in the CD-susceptible genotype, NOD2−/−, and reduced dysbiosis in ileitis-resistant CCR2−/− mice. Abrogating inflammation with the CD therapeutic anti-TNF-α-mAb tempered dysbiosis and bacterial invasion. Conclusions Acute ileitis induces dysbiosis and proliferation of mucosally invasive E. coli, irrespective of trigger and genotype. The identification of CCR2 as a target for therapeutic intervention, and discovery that host genotype and therapeutic blockade of inflammation impact the threshold and extent of ileal dysbiosis are of high relevance to developing effective therapies for CD. PMID:22848538
Vulnerability to poverty in Brazilian municipalities in 2000 and 2010: A multidimensional approach
Directory of Open Access Journals (Sweden)
Guilherme Ottoni Teixeira Costa
2018-01-01
Full Text Available The introduction of the temporal component into poverty analysis takes us to the study of the poverty dynamic, which focuses on investigating events of entering, remaining in and getting out of deprivation. As an effort to consider the diverse aspects unrelated to income in the study of vulnerability to poverty, the monetary approach is put aside and the multidimensional approach is used to elaborate the well-being index. The Multidimensional Poverty Index (MPI is constructed with data from Brazil’s 2000 and 2010 Demographic Census. First, this article intends to quantify and describe the results of the MPI in Brazilian territory, using municipalities as unit of analysis. Second, it intends to analyze the factors associated to the poverty dynamics, which can be understood through the transition probability from a non-vulnerable state to a vulnerable state, in a distribution of the MPI in deciles. Finally, it intends to identify the municipalities that went through this transition in a regional level during the intercensal period. Results show that, despite the improvement observed in its whole national territory, Brazil’s North and Northeast remain with deeper deprivations while the Southern and Southeastern regions present the lowest incidence of multidimensional poverty. Dropout Rate of Grades 3–4 of High School, HDI-M Education, HDI-M Longevity, Logarithm of the Population, Gross Value Added per capita of Industry, Service Concentration Index and Entrepreneur Rate contribute positively to the reduction of municipal vulnerability to poverty. Compared to Northern municipalities, Southeastern Brazil has reduced more significantly the likelihood of position loss and has had a greater effect of increasing the probability of its upward movement. JEL classifications: I32, R13, Keywords: Multidimensional poverty, Vulnerability, Brazil
Long, Rose G; Rotman, Stijn G; Hom, Warren W; Assael, Dylan J; Illien-Jünger, Svenja; Grijpma, Dirk W; Iatridis, James C
2018-02-01
Herniated intervertebral discs (IVDs) are a common cause of back and neck pain. There is an unmet clinical need to seal annulus fibrosus (AF) defects, as discectomy surgeries address acute pain but are complicated by reherniation and recurrent pain. Copolymers of polyethylene glycol with trimethylene carbonate (TMC) and hexamethylene diisocyanate (HDI) end-groups were formulated as AF sealants as the HDI form covalent bonds with native AF tissue. TMC adhesives were evaluated and optimized using the design criteria: stable size, strong adherence to AF tissue, high cytocompatibility, restoration of IVD biomechanics to intact levels following in situ repair, and low extrusion risk. TMC adhesives had high adhesion strength as assessed with a pushout test (150 kPa), and low degradation rates over 3 weeks in vitro. Both TMC adhesives had shear moduli (220 and 490 kPa) similar to, but somewhat higher than, AF tissue. The adhesive with three TMC moieties per branch (TMC3) was selected for additional in situ testing because it best matched AF shear properties. TMC3 restored torsional stiffness, torsional hysteresis area and axial range of motion to intact states. However, in a failure test of compressive deformation under fixed 5 ° flexion, some herniation risk was observed with failure strength of 5.9 MPa compared with 13.5 MPa for intact samples; TMC3 herniated under cyclic organ culture testing. These TMC adhesives performed well during in vitro and in situ testing, but additional optimization to enhance failure strength is required to further this material to advanced screening tests, such as long-term degradation. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Unhealthy Behaviours: An International Comparison
Ferretti, Fabrizio
2015-01-01
In the current global economy, chronic non-communicable diseases (NCDs) have become the leading cause of death and a major health concern for both developed and developing countries. Among other factors, the worldwide spread of NCDs is driven by the globalisation of unhealthy habits. The purpose of this paper is to develop a simple statistic to measure, at the national level, the average population’s exposure to the main NCDs modifiable risk factors. The approach and methodology followed by the United Nations Development Programme to compute the Human Development Index (HDI) is applied to four basic indicators of NCD-related preventable risk factors (alcohol consumption, excess caloric intake, non-balanced diet and tobacco use) in 112 countries worldwide in 2012–14. We obtain a summary composite index, which we call the Unhealthy Behaviour Index (UBI), which ranks countries by the average level of the unhealthy habits (drinking, eating and smoking) of their populations. We find that Belarus and Russian federation are the two countries with the unhealthiest NCD-related lifestyle. With the exception of Canada, the first twenty populations more exposed to the main NCDs preventable risk factors all live in European countries, and mainly in countries of Eastern Europe. Overall, the UBI tends to increase along with the level of human development. In medium, high and very high HDI countries, however, the same level of human development may be associated with very different kinds of NCD-related lifestyles. Finally, economic growth may push populations toward either more unhealthy or healthy habits, depending on the countries’ level of development; the elasticity of unhealthy habits with respect to income per capita is positive (but less than one: on average 0.6) until $30,000, decreases as income rises, and becomes negative (around -0.3) in very high income countries. PMID:26512717
Directory of Open Access Journals (Sweden)
WAYAN YOGI SWARA
2012-11-01
Full Text Available Millennium development goals (MDGs has become an importantreference for the development in Indonesia. In reducing poverty requires asustainable and equitable economic growth sustainable. The size of the successfulachievement of national development, one of them can be seen from the HumanDevelopment Index (HDI. HDI can be described by three indicators of the LifeExpectancy Index, Knowledge Index and Income Index. Through research on thevalue Gross Dosmestic Product (GDP, life expectancy, and the HumanDevelopment Index will be a portrait of the poverty level in a region/country. Thisstudy was conducted to see the extent of poverty in the province of Bali seen fromthe review of the value GDP, life expectancy, and the Human Development Indexduring the period 2005 to 2009.Through this research can be seen how far the realization of millenniumdevelopment goals (MDGs can be accomplished. This study uses secondary data,using descriptive analysis techniques. From the results of the analysis is knownthat the Human Development Index of Bali Province of 69.10 in 2004, whereas in2009, a 71.52 this puts the Province of Bali is ranked sixteenth for IPM inIndonesia. Judging from the life expectancy indicate that the province of Bali wasin fourth position in Indonesia. Overall economic performance of Bali Province inthe year 2009 has been changed into positive from per capita GDP. In 2009 thenumber of poor people in Bali both rural and urban areas only 181.7 thousandinhabitants or 5.13 percent. The number of poor families in the province of Bali,in 2009 as many as 134,804 families are scattered in nine districts/cities.Suggestion put forward is the development policy should be adapted to localconditions, and design development between top down-bottom up should beconducted in stages. In addition, implementation of development programs shouldfocus on programs involving many people's lives especially those that canalleviate poverty.
Bozorgmehr, Kayvan; San Sebastian, Miguel
2014-05-01
Trade liberalization is promoted by the World Trade Organization (WTO) through a complex architecture of binding trade agreements. This type of trade, however, has the potential to modify the upstream and proximate determinants of tuberculosis (TB) infection. We aimed to analyse the association between trade liberalization and TB incidence in 22 high-burden TB countries between 1990 and 2010. and findings A longitudinal multi-level linear regression analysis was performed using five different measures of trade liberalization as exposure [WTO membership, duration of membership, trade as % of gross domestic product, and components of both the Economic Freedom of the World Index (EFI4) and the KOF Index of Globalization (KOF1)]. We adjusted for a wide range of factors, including differences in human development index (HDI), income inequality, debts, polity patterns, conflict, overcrowding, population stage transition, health system financing, case detection rates and HIV prevalence. None of the five trade indicators was significantly associated with TB incidence in the crude analysis. Any positive effect of EFI4 on (Log-) TB incidence over time was confounded by differences in socio-economic development (HDI), HIV prevalence and health financing indicators. The adjusted TB incidence rate ratio of WTO member countries was significantly higher [RR: 1.60; 95% confidence interval (CI): 1.12-2.29] when compared with non-member countries. We found no association between specific aggregate indicators of trade liberalization and TB incidence. Our analyses provide evidence of a significant association between WTO membership and higher TB incidence, which suggests a possible conflict between the architecture of WTO agreements and TB-related Millennium Development Goals. Further research is needed, particularly on the relation between the aggregate trade indices used in this study and the hypothesized mediators and also on sector-specific indices, specific trade agreements and
Understanding the importance of an energy crisis
Mechtenberg, Abigail Reid
Human development and energy, in general, and electrical energy, specifically, co-exist seamlessly in high HDI countries where reliability and availability is greater than 99%. In numerous low HDI countries, there is 2-50% electric grid availability with reliability at or below 50% due to load shedding and faults. In Africa, solar, wind, biomass and hydroelectric energy production are cited to meet growing demand and increase reliability and availability; however, the capital costs are greater than the ability-to-pay for wide scale implementation. Since the 1970s, the United States has continued to argue over the new sustainable energy infrastructure solution(s); thus resulting in no new infrastructure being built for wide scale implementation. Together the world is facing the daunting task of averting an energy crisis in developed countries and facing energy crises in developing countries. This thesis explores the importance of energy crises: from the past, current, and future. The first part entails arguing that the United States is not on a pathway to prevent an energy crisis based on an analysis of 1986 and 2004 niche and status-quo manufacturing of light-duty vehicles. The second part answers the question of what an energy crisis looks like by exploring and investigating current electrical energy crises in Fort Portal, Uganda. This part used both anthropological and physics education empowerment research to co-design and build for various energy crisis situations in hospitals, schools, and businesses all from locally available materials and expertise. Finally, looking into the US light-duty vehicle's future, I design a new hybrid vehicle powertrain (called transition mode hybrid). This third part describes my new patent as a way to avert an energy crisis in the light-duty transportation sector.
A REVIEW OF THE EFFECT OF SOCIAL CAPITAL ON HUMAN DEVELOPMENT IN IRAN
Directory of Open Access Journals (Sweden)
Mohammad Javad Razmi
2012-01-01
Full Text Available The present study aims to investigate the effect of social capital on human development in Iran. For this purpose, Iran society in the period 1984 to 2009 by using time series data and Autoregressive Distributed Lags (ARDL technique has been studied. Due to the quality of social capital variable two variables i.e. the number of judicial cases related to nonsufficient fund checks and embezzlement, bribery and forgery, and elections' participation rate have been used to measure the effect of social capital. The results suggest that there is a negative and significant effect of judicial cases on human development index (HDI level and elections' participation index statistically has not significant effect on Iran's human development index.
Global burden of human papillomavirus and related diseases.
Forman, David; de Martel, Catherine; Lacey, Charles J; Soerjomataram, Isabelle; Lortet-Tieulent, Joannie; Bruni, Laia; Vignat, Jerome; Ferlay, Jacques; Bray, Freddie; Plummer, Martyn; Franceschi, Silvia
2012-11-20
The worldwide prevalence of infection with human papillomavirus (HPV) in women without cervical abnormalities is 11-12% with higher rates in sub-Saharan Africa (24%), Eastern Europe (21%) and Latin America (16%). The two most prevalent types are HPV16 (3.2%) and HPV18 (1.4%). Prevalence increases in women with cervical pathology in proportion to the severity of the lesion reaching around 90% in women with grade 3 cervical intraepithelial neoplasia and invasive cancer. HPV infection has been identified as a definite human carcinogen for six types of cancer: cervix, penis, vulva, vagina, anus and oropharynx (including the base of the tongue and tonsils). Estimates of the incidence of these cancers for 2008 due to HPV infection have been calculated globally. Of the estimated 12.7 million cancers occurring in 2008, 610,000 (Population Attributable Fraction [PAF]=4.8%) could be attributed to HPV infection. The PAF varies substantially by geographic region and level of development, increasing to 6.9% in less developed regions of the world, 14.2% in sub-Saharan Africa and 15.5% in India, compared with 2.1% in more developed regions, 1.6% in Northern America and 1.2% in Australia/New Zealand. Cervical cancer, for which the PAF is estimated to be 100%, accounted for 530,000 (86.9%) of the HPV attributable cases with the other five cancer types accounting for the residual 80,000 cancers. Cervical cancer is the third most common female malignancy and shows a strong association with level of development, rates being at least four-fold higher in countries defined within the low ranking of the Human Development Index (HDI) compared with those in the very high category. Similar disparities are evident for 5-year survival-less than 20% in low HDI countries and more than 65% in very high countries. There are five-fold or greater differences in incidence between world regions. In those countries for which reliable temporal data are available, incidence rates appear to be
Directory of Open Access Journals (Sweden)
Alfonso J. Rodríguez-Morales
2010-03-01
Full Text Available Objetivos. Evaluar las posibles asociaciones entre el índice de desarrollo humano (IDH y sus componentes, y la incidencia de Leishmaniosis cutánea (LC en cuatro estados endémicos de Venezuela (Mérida, Trujillo, Lara y Sucre en el período 1994 al 2003. Materiales y métodos. La data socioeconómica (clasificada de acuerdo al Banco Mundial se obtuvo del Instituto Nacional de Estadística y la epidemiológica del Ministerio de Salud, ambos de Venezuela. Para este estudio ecológico se evaluó la variación anual de las variables y se realizó modelos de regresión. Resultados. El IDH varió en el período, de 0,6746 en 1994 a 0,8144 en 2003 (p=0,90, asimismo, se observó un aumento de la incidencia acumulada de Leishmaniosis, en especial del año 1998 (7,3 casos/100 000 hab a 1999 (11,3 casos/100 000 hab. Al analizar con los modelos de regresión lineal, se observó que la relación entre las variables epidemiológicas y sociales era diferente a nivel de los Estados evaluados. Para Mérida y Trujillo se observó un descenso significativo de la incidencia de LC con relación al aumento del porcentaje de alfabetización (pObjectives. Assess potential relationships between the Human Development Index (HDI and its components and the incidence of cutaneous leishmaniasis (CL in four endemic States of Venezuela (Mérida, Trujillo, Lara and Sucre in the period 1994-2003. Material and methods. Socioeconomical data (classified according the World Bank was obtained from the National Institute of Statistics, and the epidemiological data from the Ministry of Health, both from Venezuela. For this ecological study the annual variation of the variables was assessed and also regression models were done. Results. The HDI varied in the period from 0.6746 in 1994 to 0.8144 in 2003 (p=0.90. During this time an increase in the cumulative incidence of Leishmaniasis was observed, particularly from 1998 (7.3 cases/100,000 pop to 1999 (11.3 cases/100,000 pop. Analyzing
He, Meilin; Zhang, Jie
2011-06-01
In China, the traceability of clinical chemistry methods is still immature. Therefore, it is necessary to establish a reference measurement procedure and evaluate commercial reagent kits using such established procedures. We reproduced the reference measurement procedure for serum total protein, as recommended by the American Association for Clinical Chemistry (AACC). We evaluated the performance by Clinical Laboratory Standard Institute (CLSI) guidelines EP15-A and EP6-A. Subsequently, four commercial reagent kits were evaluated by the reproduced reference procedure following CLSI guideline EP9-A2. The performance of the reproduced reference procedure was as follows: CVs ranged from 0.47% to 0.85% at medical decision levels (X(c)) of 45 g/L, 60 g/L and 80 g/L. Linearity was Y=1.0022X-0.2121 (r=0.9999), and recovery ranged from 100.2% to 102.4%. The External Quality Assessment Scheme for Reference Laboratories in Laboratory Medicine (RELA) was applied, and the result was within the limit of equivalence. The linear relationships of four commercial reagent kits, Merit Choice, KHB, Leadman, and Olympus, were, respectively: Y=0.9922X+0.5776 (r=0.9961); Y=0.9936X+0.4316 (r=0.9992); Y=0.9949X+0.9129 (r=0.9987) and Y=0.9923X+0.8876 (r=0.9989). KHB showed slight negative bias, and the mean±SD was -0.03±0.60 g/L. Merit Choice, Leadman, and Olympus all showed positive bias, and the mean±SDs were 0.02±0.63 g/L, 0.55±0.77 g/L and 0.34±0.71 g/L, respectively. The correlation and bias of four commercial reagent kits for serum total protein were found to be acceptable. Thus, these reagent kits can be used reliably in China.
Wives, Husbands and Sharing of Household Works in Indian Villages
Directory of Open Access Journals (Sweden)
K Rajendran
2011-04-01
Full Text Available There is a general belief that nowadays men share household works and there is a change from the tradition. The main objective of the paper is to analyse whether husbands shares the household works in rural areas and the study was conducted with 450 respondents in 26 villages in India. The study reports that the findings are not encouraging as projected or anticipated and suggests NGOs NGOs and SHGs should take role in sensitising men to assist in the household works since sharing of household works by men is considered as an indicator of women empowerment. Keywords: Households-sharing; SHGs; NGOs; HDI; GDI DOI: 10.3126/dsaj.v4i0.4521 Dhaulagiri Journal of Sociology and Anthropology Vol.4 2010 pp.211-222
TRANSPORTASI DAN KETIMPANGAN WILAYAH DI PROVINSI JAWA TIMUR
Directory of Open Access Journals (Sweden)
Jose Rizal Joesoef
2016-03-01
Full Text Available It is well understood that transportation improves the accessibility and transportation is needed in production and consumption activities. This study is aimed to describe the pattern of the movement of people and goods among districts/cities within the Province of East Java, to estimate the density of people and goods, and to measure the inequality of transport density. This study is also to test whether transport affects welfare. It is found that the Malang District and Surabaya City are the most destination of goods transport. Regression analysis shows that the density of transport only affects the welfare (as measured by the HDI when together with other variables, namely poverty and GDP/capita. However, partial density of transport has no effect on the welfare.
Extraction of flocculants from a strain of Bacillus thuringiensis and analysis of their properties
Directory of Open Access Journals (Sweden)
Jingrong Wu
2017-07-01
Full Text Available In a preliminary screening study, our laboratory isolated from the biofloc in aquaculture waters a strain of Bacillus thuringiensis, which produced highly efficient bio-flocculants. In the present study, we extracted the crude flocculants from this strain and analyzed their properties. Distribution analysis indicated that the flocculants were mainly distributed in the supernatant of the fermentation liquid. The flocculants were extracted using an ethanol extraction method, and the chemical compositions and morphology of the crude flocculants were analyzed using the Molish reaction, Fehling reaction, ninhydrin reaction, biuret reaction, phenol-sulfuric acid assay, Coomassie brilliant blue staining, ultraviolet scanning, infrared scanning and scanning electron microscopy. The carbohydrate composition of the polysaccharides in the flocculants was analyzed with thin layer chromatography. The results indicated that flocculants were solid substances with an ivory white color and their texture was loose and soft. Visualization under scanning electron microscopy revealed that their ultra-morphology consisted of small, long and fiber-like shapes. Chemical and physical analyses indicated that polysaccharides accounted for 34.5% of the components in the crude flocculants. The monosaccharides present in crude flocculants included mainly glucose, galactose and mannitose.
Synthesis of 15N-enriched urea (CO(15NH22 from 15NH3, CO, and S in a discontinuous process
Directory of Open Access Journals (Sweden)
C. R. Sant Ana Filho
2012-12-01
Full Text Available CO(15NH22 enriched with the stable isotope 15N was synthesized based on a reaction involving CO, 15NH3, and S in the presence of CH3OH. The method differs from the industrial method; a stainless steel reactor internally lined with polytetrafluoroethylene (PTFE was used in a discontinuous process under low pressure and temperature. The yield of the synthesis was evaluated as a function of the parameters: the amount of reagents, reaction time, addition of H2S, liquid solution and reaction temperature. The results showed that under optimum conditions (1.36, 4.01, and 4.48 g of 15NH3, CO, and S, respectively, 40 ml CH3OH, 40 mg H2S, 100 ºC and 120 min of reaction 1.82 g (yield 76.5% of the compound was obtained per batch. The synthesized CO(15NH22 contained 46.2% N, 0.55% biuret, melting point of 132.55 ºC and did not exhibit isotopic fractionation. The production cost of CO(15NH22 with 90.0 at. % 15N was US$ 238.60 per gram.
Restoration of radiation injury by ginseng, 2. Some properties of the radioprotective substances
Energy Technology Data Exchange (ETDEWEB)
Yonezawa, M.; Katoh, N.; Takeda, A. (Radiation Center of Osaka Prefecture, Sakai (Japan))
1981-09-01
Some properties of the radioprotective substances in a ginseng extract that increased the 30-day survival ratio in irradiated mice were studied. Methanol-soluble fraction of the extract did not protect the irradiated animals. Acid or alkali (0.12 N) inactivated the extract at 60/sup 0/C. But the radioprotective activity was stable after heating the ginseng extract in physiological saline at pH 7 in a boiling-water bath for 15 min. The ginseng extract was separated into two fractions by CM-cellulose column chromatography. One of them (CM-A) was significantly efficacious at 5% level, and the other (CM-B) at 0.1% level with the doses proportional to their yields. CM-B, not containing saponin, was subjected to further purification, UV spectrum and a biuret test suggested the presence of protein in this fraction. The supernatant obtained after heating CM-B solution at pH 7 was separated into three fractions, namely G-I, G-II and G-III, by gel-chromatography with a Sephadex G-75 column. Both G-I (0.44 mg per animal) and G-III (0.84 mg, calculated dose) were significantly efficacious, but G-II (0.47 mg) was not.
Restoration of radiation injury by ginseng, 2
International Nuclear Information System (INIS)
Yonezawa, Morio; Katoh, Norio; Takeda, Atsuhiko
1981-01-01
Some properties of the radioprotective substances in a ginseng extract that increased the 30-day survival ratio in irradiated mice were studied. Methanol-soluble fraction of the extract did not protect the irradiated animals. Acid or alkali (0.12 N) inactivated the extract at 60 0 C. But the radioprotective activity was stable after heating the ginseng extract in physiological saline at pH 7 in a boiling-water bath for 15 min. The ginseng extract was separated into two fractions by CM-cellulose column chromatography. One of them (CM-A) was significantly efficacious at 5% level, and the other (CM-B) at 0.1% level with the doses proportional to their yields. CM-B, not containing saponin, was subjected to further purification, UV spectrum and a biuret test suggested the presence of protein in this fraction. The supernatant obtained after heating CM-B solution at pH 7 was separated into three fractions, namely G-I, G-II and G-III, by gel-chromatography with a Sephadex G-75 column. Both G-I (0.44 mg per animal) and G-III (0.84 mg, calculated dose) were significantly efficacious, but G-II (0.47 mg) was not. (author)
Structure of the Cyanuric Acid Hydrolase TrzD Reveals Product Exit Channel.
Bera, Asim K; Aukema, Kelly G; Elias, Mikael; Wackett, Lawrence P
2017-03-27
Cyanuric acid hydrolases are of industrial importance because of their use in aquatic recreational facilities to remove cyanuric acid, a stabilizer for the chlorine. Degradation of excess cyanuric acid is necessary to maintain chlorine disinfection in the waters. Cyanuric acid hydrolase opens the cyanuric acid ring hydrolytically and subsequent decarboxylation produces carbon dioxide and biuret. In the present study, we report the X-ray structure of TrzD, a cyanuric acid hydrolase from Acidovorax citrulli. The crystal structure at 2.19 Å resolution shows a large displacement of the catalytic lysine (Lys163) in domain 2 away from the active site core, whereas the two other active site lysines from the two other domains are not able to move. The lysine displacement is proposed here to open up a channel for product release. Consistent with that, the structure also showed two molecules of the co-product, carbon dioxide, one in the active site and another trapped in the proposed exit channel. Previous data indicated that the domain 2 lysine residue plays a role in activating an adjacent serine residue carrying out nucleophilic attack, opening the cyanuric acid ring, and the mobile lysine guides products through the exit channel.
Where does the money go? A peregrination of government spending in South Africa
Directory of Open Access Journals (Sweden)
Raphael T Mpofu
2013-12-01
Full Text Available The study looked at the relationship between GDP per capita and health expenditure per capita as well as that of GDP per capita and education expenditure per capita in South Africa between 1994 and 2012. Adolph Wagner’s “Law” proposes that a state will increase its government expenditure relatively to the national income (Henrekson, 1993. Any change in the amount of health expenditure will influence the per capita health expenditure in a country. In this study, using the Human Development Index (HDI as the yardstick for Quality of Life (QoL, the concepts of Standard of Living (SoL and per capita income were examined closely in relation to the role of government in its public expenditure programmes and how these programmes in turn influenced QoL. In particular, the role of government expenditure on health and education seems to signify the commitment of a government in improving the HDI or QoL. Using data on government expenditure in South, the relationships amongst these variables were examined. Since Quality of Life is related to health expenditure per capita, then QoL too should change as government health expenditure increases. The same is expected of an increase in education expenditure. From the study results, it is clear that total tax revenue has increased sharply since 2000 and at a much faster rate than its contribution to GDP but the government deficit has also burgeoned in tandem with government revenue collection as if in tango. The reality is that government expenditure has increased sharply since 1993 but has this been directed at QoL? Public service protests tell a different story. The departments of Cooperative Governance and Traditional Affairs and the Police seem to be receiving the largest revenue votes, raising the question of whether there is real value added and whether this expenditure is warrantied in terms of SoL.
Boutin, Michel; Dufresne, André; Ostiguy, Claude; Lesage, Jacques
2006-06-01
Polyurethanes are widely used in car paint formulations. During thermal degradation, such polymeric systems can generate powerful asthmatic sensitizing agents named isocyanates. In body repair shops, the thermal degradation of car paint can occur during abrasive processes that generate enough heat to involve release of isocyanates in air. An environmental monitoring study was performed in two body repair training schools and in a body repair shop to evaluate the workers' exposure to isocyanates during cutting, grinding and orbital sanding operations. For sampling, cassettes containing two 1-(2-methoxyphenyl)piperazine (MOPIP)-coated glass fiber filters (MFs) ( approximately 5 mg of MOPIP per filter) and bubblers containing 15 ml of MOPIP solution in toluene (1.0 mg ml(-1)) backed at the outlet with cassettes containing two MFs were used. Tandem mass spectrometry was used to analyze the MOPIP derivatives of isocyanic acid (HNCO), all the linear aliphatic isocyanates ranging from methyl isocyanate (Me-i) to hexyl isocyanate, all the alkenyl isocyanates ranging from propylene isocyanate to hexylene isocyanate, 1,6-hexamethylene diisocyanate (HDI), trans- and cis-isophorone diisocyanate (IPDI), 2,4- and 2,6-toluene diisocyanate (TDI), 2,4'-; 2,2'- and 4,4'-methylenediphenyl diisocyanate (MDI), phenyl isocyanate (Ph-i) and p-toluene isocyanate (p-Tol-i). The instrumental detection limits (LOD) were in the 0.13-0.75 microg of NCO per m(3) range for 15 l air samples converted into 3 ml liquid samples. The isocyanate concentrations detected in the workers' breathing zone were in the 1.07-9.80 microg of NCO per m(3) range for cutting, 0.63-3.62 microg of NCO per m(3) range for grinding and 0-1.29 microg of NCO per m(3) range for sanding. However, a rapid decrease of the isocyanate concentration was observed while moving away from the emission source. Among the isocyanates detected the most abundant were the monomers (MDI, HDI, TDI and IPDI) and Me-i.
Chronic widespread pain prevalence in the general population: A systematic review.
Andrews, P; Steultjens, M; Riskowski, J
2018-01-01
Chronic widespread pain (CWP) is a significant burden in communities. Understanding the impact of population-dependent (e.g., age, gender) and contextual-dependent (e.g. survey method, region, inequality level) factors have on CWP prevalence may provide a foundation for population-based strategies to address CWP. Therefore, the purpose of this study was to estimate the global prevalence of CWP and evaluate the population and contextual factors associated with CWP. A systematic review of CWP prevalence studies (1990-2017) in the general population was undertaken. Meta-analyses were conducted to determine CWP prevalence, and study population data and contextual factors were evaluated using a meta-regression. Thirty-nine manuscripts met the inclusion criteria. Study CWP prevalence ranged from 1.4% to 24.0%, with CWP prevalence in men ranging from 0.8% to 15.3% and 1.7% to 22.1% in women. Estimated overall CWP prevalence was 9.6% (8.0-11.2%). Meta-regression analyses showed gender, United Nations country development status, and human development index (HDI) influenced CWP prevalence, while survey method, region, methodological and reporting quality, and inequality showed no significant effect on the CWP estimate. Globally CWP affects one in ten individuals within the general population, with women more likely to experience CWP than men. HDI was noted to be the socioeconomic factor related to CWP prevalence, with those in more developed countries having a lower CWP prevalence than those in less developed countries. Most CWP estimates were from developed countries, and CWP estimates from countries with a lower socioeconomic position is needed to further refine the global estimate of CWP. This systematic review and meta-analysis updates the current global CWP prevalence by examining the population-level (e.g. age, gender) and contextual (e.g. country development status; survey style; reporting and methodologic quality) factors associated with CWP prevalence. This analyses
Reda, Seif Magdy; Krois, Joachim; Reda, Sophie Franziska; Thomson, William Murray; Schwendicke, Falk
2018-04-16
Regular and/or preventive dental services utilization is an indicator of healthcare access and associated with improved health outcomes. We assessed the proportion of individuals regularly/preventively utilizing dental services, and how this was affected by demographic, health-related and social factors. Three electronic databases (Medline, Embase, Central) were searched (2005-2017). We included observational studies investigating the association between preventive/regular dental service utilization and age, oral and general health, edentulism, family structure and health literacy. The proportion of individuals with regular/preventive utilization overall and in different sub-groups were extracted. Random-effects meta-analyses, with subgroup analyses by region, were performed. Meta-regression was used to assess whether and how associations changed with time and countries' human developmental status (HDI). 103 studies on 7,395,697 participants from 28 countries were included. The global mean (95% CI) proportion of individuals regularly/preventively utilizing dental services was 54% (50-59%). In countries with higher HDI, more individuals regularly/preventively utilized services (p Age did not have a significant impact on utilization in adults (OR = 1.00; 0.89-1.12). Utilization was significantly lower in younger than older children (OR = 0.52; 0.46-0.59), individuals with poorer general health (OR = 0.73; 0.65-0.80) and poorer oral health (OR = 0.64; 0.52-0.75), edentulous individuals (OR = 0.32; 0.23-0.41), and individuals with less supportive family structures (OR = 0.81; 0.73-0.89) or poor health literacy (OR = 0.41; 0.01-0.81). The observed differences within populations did not significantly change with time and were universally present. Regular/preventive utilization varied widely between and within countries. Understanding and tackling the reasons underlying this may help to consistently improve utilization. Higher developmental
Ye, J; Zhang, J; Mikolajczyk, R; Torloni, M R; Gülmezoglu, A M; Betran, A P
2016-04-01
Caesarean section was initially performed to save the lives of the mother and/or her baby. Caesarean section rates have risen substantially worldwide over the past decades. In this study, we set out to compile all available caesarean section rates worldwide at the country level, and to identify the appropriate caesarean section rate at the population level associated with the minimal maternal and neonatal mortality. Ecological study using longitudinal data. Worldwide country-level data. A total of 159 countries were included in the analyses, representing 98.0% of global live births (2005). Nationally representative caesarean section rates from 2000 to 2012 were compiled. We assessed the relationship between caesarean section rates and mortality outcomes, adjusting for socio-economic development by means of human development index (HDI) using fractional polynomial regression models. Maternal mortality ratio and neonatal mortality rate. Most countries have experienced increases in caesarean section rate during the study period. In the unadjusted analysis, there was a negative association between caesarean section rates and mortality outcomes for low caesarean section rates, especially among the least developed countries. After adjusting for HDI, this effect was much smaller and was only observed below a caesarean section rate of 5-10%. No important association between the caesarean section rate and maternal and neonatal mortality was observed when the caesarean section rate exceeded 10%. Although caesarean section is an effective intervention to save maternal and infant lives, based on the available ecological evidence, caesarean section rates higher than around 10% at the population level are not associated with decreases in maternal and neonatal mortality rates, and thus may not be necessary to achieve the lowest maternal and neonatal mortality. The caesarean section rate of around 10% may be the optimal rate to achieve the lowest mortality. © 2015 The Authors
Directory of Open Access Journals (Sweden)
Nina Iris Verslype
2016-04-01
Full Text Available Partindo da ideia que a agricultura está amplamente ligada aos fatores climáticos como temperatura e umidade relativa do ar, e que ela pode contribuir para o aumento de renda, geração de emprego, inclusive de verificar novas fronteiras agrícolas e consequentemente o aumento do PIB e IDH, que é considerado baixo na microrregião. Nesse estudo, foi feita a modelagem digital do terreno da microrregião Vale do Ipanema e de seus municípios, para os parâmetros de precipitação, temperatura, PIB, IDH e população. Os municípios analisados foram: Águas Belas, Buíque, Itaíba, Pedra, Tupanatinga e Venturosa.Com as análises climáticas foi possível perceber que a microrregião apresenta uma baixa capacidade hídrica, devido aos períodos longos de estiagem e as chuvas irregulares, mas mesmo assim a economia local se destaca com a maior produção leiteira pernambucana e como um grande contribuinte à agricultura familiar. Starting from the idea that agriculture is largely linked to climatic factors such as temperature and relative humidity, and it can contribute to increased income, employment generation, including checking new agricultural frontiers and hence the increase in GDP and HDI, which is considered low in the micro. In this study, was made the digital terrain modeling of the micro region of Ipanema Valley, and its municipalities for the precipitation parameters, temperature, GDP, HDI and population, in order to view the development of the region studied. Municipalities analyzed were: Águas Belas, Buíque, Itaíba, Pedra, Tupanatinga and Venturosa. With climate analysis was possible to realize that the micro-region has a low water capacity due to long periods of drought and erratic rainfall, yet the economy site stands out with the highest milk production Pernambuco and as a major contributor to family farming.
Biesbroek, Sander; Verschuren, W M Monique; Boer, Jolanda M A; van de Kamp, Mirjam E; van der Schouw, Yvonne T; Geelen, Anouk; Looman, Moniek; Temme, Elisabeth H M
2017-07-01
Guidelines for a healthy diet aim to decrease the risk of chronic diseases. It is unclear as to what extent a healthy diet is also an environmentally friendly diet. In the Dutch sub-cohort of the European Prospective Investigation into Cancer and Nutrition, the diet was assessed with a 178-item FFQ of 40 011 participants aged 20-70 years between 1993 and 1997. The WHO's Healthy Diet Indicator (HDI), the Dietary Approaches to Stop Hypertension (DASH) score and the Dutch Healthy Diet index 2015 (DHD15-index) were investigated in relation to greenhouse gas (GHG) emissions, land use and all-cause mortality risk. GHG emissions were associated with HDI scores (-3·7 % per sd increase (95 % CI -3·4, -4·0) for men and -1·9 % (95 % CI -0·4, -3·4) for women), with DASH scores in women only (1·1 % per sd increase, 95 % CI 0·9, 1·3) and with DHD15-index scores (-2·5 % per sd increase (95 % CI -2·2, -2·8) for men and -2·0 % (95 % CI -1·9, -2·2) for women). For all indices, higher scores were associated with less land use (ranging from -1·3 to -3·1 %). Mortality risk decreased with increasing scores for all indices. Per sd increase of the indices, hazard ratios for mortality ranged from 0·88 (95 % CI 0·82, 0·95) to 0·96 (95 % CI 0·92, 0·99). Our results showed that adhering to the WHO and Dutch dietary guidelines will lower the risk of all-cause mortality and moderately lower the environmental impact. The DASH diet was associated with lower mortality and land use, but because of high dairy product consumption in the Netherlands it was also associated with higher GHG emissions.
Wong, Martin C S; Goggins, William B; Wang, Harry H X; Fung, Franklin D H; Leung, Colette; Wong, Samuel Y S; Ng, Chi Fai; Sung, Joseph J Y
2016-11-01
Prostate cancer (PCa) is a leading cause of mortality and morbidity globally, but its specific geographic patterns and temporal trends are under-researched. To test the hypotheses that PCa incidence is higher and PCa mortality is lower in countries with higher socioeconomic development, and that temporal trends for PCa incidence have increased while mortality has decreased over time. Data on age-standardized incidence and mortality rates in 2012 were retrieved from the GLOBOCAN database. Temporal patterns were assessed for 36 countries using data obtained from Cancer incidence in five continents volumes I-X and the World Health Organization mortality database. Correlations between incidence or mortality rates and socioeconomic indicators (human development index [HDI] and gross domestic product [GDP]) were evaluated. The average annual percent change in PCa incidence and mortality in the most recent 10 yr according to join-point regression. Reported PCa incidence rates varied more than 25-fold worldwide in 2012, with the highest incidence rates observed in Micronesia/Polynesia, the USA, and European countries. Mortality rates paralleled the incidence rates except for Africa, where PCa mortality rates were the highest. Countries with higher HDI (r=0.58) and per capita GDP (r=0.62) reported greater incidence rates. According to the most recent 10-yr temporal data available, most countries experienced increases in incidence, with sharp rises in incidence rates in Asia and Northern and Western Europe. A substantial reduction in mortality rates was reported in most countries, except in some Asian countries and Eastern Europe, where mortality increased. Data in regional registries could be underestimated. PCa incidence has increased while PCa mortality has decreased in most countries. The reported incidence was higher in countries with higher socioeconomic development. The incidence of prostate cancer has shown high variations geographically and over time, with smaller
Work participation in spondyloarthritis across countries: analysis from the ASAS-COMOSPA study.
Rodrigues Manica, Santiago; Sepriano, Alexandre; Ramiro, Sofia; Pimentel Santos, Fernando; Putrik, Polina; Nikiphorou, Elena; Norton, Sam; Molto, Anna; Dougados, Maxime; van der Heijde, Désirée; Landewé, Robert B M; van den Bosch, Filip E; Boonen, Annelies
2018-06-02
To explore the role of individual and country level socioeconomic (SE) factors on employment, absenteeism and presenteeism in patients with spondyloarthritis (SpA) across 22 countries worldwide. Patients with a clinical diagnosis of SpA fulfilling the ASAS classification criteria and in working age (≤65 years) from COMOSPA were included. Outcomes of interest were employment status, absenteeism and presenteeism, assessed by the Work Productivity and Activity Impairment Specific General Health questionnaire. Three multivariable models were built (one per outcome) using mixed-effects binomial (for work status) or ordinal regressions (for absenteeism and presenteeism), with country as random effect. The contribution of SE factors at the individual-level (eg, gender, education, marital status) and country-level (healthcare expenditure (HCE) per capita, Human Development Index (HDI) and gross domestic product per capita) SE factors, independent of clinical factors, was assessed. In total, 3114 patients with SpA were included of which 1943 (62%) were employed. Physical function and comorbidities were related to all work outcomes in expected directions and disease activity also with absenteeism and presenteeism. Higher education (OR 4.2 (95% CI 3.1 to 5.6)) or living in a country with higher HCE (OR 2.3 (1.5 to 3.6)) or HDI (OR 1.9 (1.2 to 3.3)) was positively associated with being employed. Higher disease activity was associated with higher odds for absenteeism (OR 1.5 (1.3 to 1.7)) and presenteeism (OR 2.1 (1.8 to 2.4)). No significant association between individual-level and country-level SE factors and absenteeism or presenteeism was found. Higher education level and higher country SE welfare are associated with a higher likelihood of keeping patients with SpA employed. Absenteeism and presenteeism are only associated with clinical but not with individual-level or country-level SE factors. © Article author(s) (or their employer(s) unless otherwise stated in the text
Directory of Open Access Journals (Sweden)
Jeadran Nevardo Malagón Rojas
2011-01-01
Full Text Available Resumen El presente estudio ilustrará la relación existente entre desigualdad social, VIH/SIDA y conflicto armado en Colombia 2002 - 2008. Métodos: Las variables del estudio fueron determinadas de acuerdo al Índice de Riesgo de Situación Humanitaria. Los datos proporcionados fueron cruzados y estudiados mediante análisis bivariado. Resultados: El análisis de los resultados mostró dos tendencias. Un grupo de departamentos con índices de Desarrollo Humano mayores a la media nacional, que presentaron altas tasas de violencia armada y de incidencia de VIH/SIDA. Otro grupo con bajos niveles de desarrollo y pobreza, altas cifras de violencia armada, pero bajas tasas de incidencia de VIH/SIDA. Conclusiones: En el caso colombiano existe una relación demostrable entre conflicto armado, desigualdad social y VIH/SIDA, aunque el nexo de causalidad no es plenamente identificable en el caso de poblaciones donde el conflicto armado ha afectado la operativización de los servicios de Vigilancia en Salud. Abstract This study will illustrate the relationship between social inequality, HIV/AIDS and armed conflict in Colombia 2002 - 2008. Methods: The study variables were determined according to the Risk Index of Humanitarian Situation. The data provided were crossed and studied by means of bivariate analysis. Results: The analysis of the results showed two trends. A group of departments with higher than the national average Human Development Index (HDI, which showed high rates of armed violence and incidence of HIV/AIDS. Another group, with low HDI, high rates of armed violence, but low rates of incidence of HIV/AIDS. Conclusions: In the case of Colombia a relationship has shown between armed conflict, social inequality and HIV/AIDS. Although there is a causal link is fully identifiable for populations where the armed conflict has affected the implementation of the health surveillance services.
Directory of Open Access Journals (Sweden)
Shehata HS
2016-10-01
Full Text Available Hatem S Shehata, Eman H Esmail, Ahmad Abdelalim, Shaimaa El-Jaafary, Alaa Elmazny, Asmaa Sabbah, Nevin M Shalaby Neurology Department, Faculty of Medicine, Cairo University, Cairo, Egypt Background: Chronic migraine is a prevalent disabling disease, with major health-related burden and poor quality of life. Long-term use of preventive medications carries risk of side effects. Objectives: The aim of this study was to compare repetitive transcranial magnetic stimulation (rTMS to botulinum toxin-A (BTX-A injection as preventive therapies for chronic migraine. Methods: A pilot, randomized study was conducted on a small-scale sample of 29 Egyptian patients with chronic migraine, recruited from Kasr Al-Aini teaching hospital outpatient clinic and diagnosed according to ICHD-III (beta version. Patients were randomly assigned into two groups; 15 patients received BTX-A injection following the Phase III Research Evaluating Migraine Prophylaxis Therapy injection paradigm and 14 patients were subjected to 12 rTMS sessions delivered at high frequency (10 Hz over the left motor cortex (MC, M1. All the patients were requested to have their 1-month headache calendar, and they were subjected to a baseline 25-item (beta version Henry Ford Hospital Headache Disability Inventory (HDI, Headache Impact Test (HIT-6, and visual analogue scale assessment of headache intensity. The primary efficacy measures were headache frequency and severity; secondary measures were 25-item HDI, HIT-6, and number of acute medications. Follow-up visits were scheduled at weeks 4, 6, 8, 10, and 12 after baseline visit. Results: A reduction in all outcome measures was achieved in both the groups. However, this improvement was more sustained in the BTX-A group, and both the therapies were well tolerated. Conclusion: BTX-A injection and rTMS have favorable efficacy and safety profiles in chronic migraineurs. rTMS is of comparable efficacy to BTX-A injection in chronic migraine
Directory of Open Access Journals (Sweden)
Kaito Sugane
2017-11-01
Full Text Available It is important to develop tailor-made biodegradable/biocompatible polymer networks usable for biomaterials whose thermal and mechanical properties are easily controlled by changing the composition. We synthesized sugar-alcohol-based polymer networks (SPN-mscLAO/3CLO, m = 4, 5 or 6 by the crosslinking reactions of erythritol, xylitol or sorbitol-based m-armed star-shaped l-lactide and d-lactide oligomers (HmSLLAO and HmSDLAO, a glycerol-based 3-armed star-shaped ε-caprolactone oligomer (H3SCLO and hexamethylene diisocyanate (HDI at the weight ratios of HmSLLAO/HmSDLAO = 1/1 and (HmSLLAO + HmSDLAO/H3CLO = 100/0, 75/25, 50/50, 25/75 or 0/100. The influence of the arm number on the crystallization behavior, thermal and mechanical properties of SPN-mscLAO/3CLOs were systematically investigated by comparing with those of sugar-alcohol-based homochiral polymer network (SPN-mLLAO, m = 4, 5 or 6 prepared by the reaction of HmSLLAO and HDI. Stereocomplex (sc crystallites are dominantly formed for SPN-mscLAO/3CLOs 100/0–25/75, whereas SPN-mLLAOs were amorphous. The higher order of melting temperature of sc-crystals for SPN-mscLAO/3CLOs 100/0–25/75 was m = 5 > m = 6 > m = 4. The sc-crystallinities of SPN-4scLAO/3CLOs 100/0–50/50 were significantly lower than those of SPN-mscLAO/3CLOs 100/0–50/50 (m = 5 and 6. The larger order of the sc-spherulite size at crystallization temperature of 110 °C was m = 5 > m = 6 > m = 4 for SPN-mscLAO/3CLO 100/0. The size and number of sc-spherulites decreased with increasing crystallization temperature over the range of 110–140 °C and with increasing CLO fraction. Among all the networks, SPN-5scLAO/3CLOs 75/25 and 50/50 exhibited the highest and second highest tensile toughnesses (21.4 and 20.3 MJ·m−3, respectively.
Soldevila, Berta; Alonso, Núria; Martínez-Arconada, Maria J; Granada, Maria L; Boada, Aram; Vallejos, Virginia; Fraile, Manuel; Fernández-Sanmartín, Marco A; Pujol-Borrell, Ricardo; Puig-Domingo, Manel; Sanmartí, Anna; Martínez-Cáceres, Eva M
2013-04-01
One of the side effects of interferon-alpha therapy is interferon-induced thyroiditis (IIT). The role of lymphocyte subpopulations in IIT melanoma patients remains to be defined. Our objective was to assess different peripheral blood lymphocyte subpopulations, mainly regulatory T cells (Tregs), in melanoma patients who developed IIT. From 30 melanoma patients receiving high-dose interferon (HDI)-alpha 2b (IFN-α2b) treatment, those who developed IIT (IIT patients) were selected and compared with patients who did not develop IIT (Co-MM) and healthy controls (Co-H). Peripheral blood mononuclear cells were obtained before treatment (BT), mid-treatment (MT), end of treatment (ET), 24 weeks post-treatment and at appearance of IIT (TT). Nine patients developed IIT (30%): four Hashimoto's thyroiditis and five destructive thyroiditis. An increase in Tregs was observed in both melanoma groups during HDI treatment. A decrease in CD3(+) , NKT lymphocyte subpopulations and Bcl2 expression on B cells was also observed in both groups. However, no changes were observed in the percentage of CD4(+) , CD8(+) , CD3(+) γδ(+) , CD19(+) , transitional B cells (CD24(high) CD38(high) CD19(+) CD27(-) ), natural killer (NK), invariant NKT (iNKT) lymphocytes and Th1/Th2 balance when BT was compared with ET. At TT, IIT patients had a higher Tregs percentage than Co-MM (P = 0·012) and Co-H (P = 0·004), a higher iNKT percentage than Co-MM (P = 0·011), a higher transitional B cells percentage than Co-H (P = 0·015), a lower CD3(+) percentage than Co-H (P = 0·001) and a lower Bcl2 expression on B cells than Co-H (P < 0·001). Our results point to the immunomodulatory effects of IFN-α on different lymphocyte subpopulations and a possible role of Tregs in melanoma patients who developed IIT. © 2012 Blackwell Publishing Ltd.
POTENSI HIDROLISAT TEMPE SEBAGAI PENYEDAP RASA MELALUI PEMANFAATAN EKSTRAK BUAH NANAS
Directory of Open Access Journals (Sweden)
Achmad Machin
2012-09-01
Full Text Available Penelitian bertujuan untuk mendeskripsikan perlunya pengembangan penyedap rasa alternatif berbahan hidrolisat tempe dan proses pembuatannya, menguji jenis asam amino, kadar protein dan uji organoleptik. Metode eksperimen digunakan pada penelitian ini. Pengujian jenis asam amino melalui teknik kromatografi, kadar protein terlarut melalui metode Biuret dan uji organoleptik produk dibandingkan penyedap rasa sintetis. Hasil yang didapatkan adalah pengembangan penyedap rasa hidrolisat tempe perlu dilakukan karena alasan dampak mengkonsumsi penyedap rasa sintetis, pengembangan teknologi, sumber penghasilan dan potensi penelitian. Proses pembuatannya melalui penambahan sari nanas pada tempe yang telah dikukus dan diblender dengan perbandingan tempe:air:sari nanas 1: 0,5:0,5. Pengovenan selama 2 jam pada suhu 55ºC, penambahan dektrin + NaCl (masing-masing sebanyak 0,5 gr/100 gr tempe, pengovenan kembali selama 2 jam pada suhu 55ºC. Perlakuan B2 (pengovenan pada suhu 55ºC selama 2 jam menghasilkan asam glutamat. Produk ini berpotensi membentuk monosodium glutamat dengan penambahan NaCl. Jumlah protein terlarut dipengaruhi oleh lama pengovenan dan suhu. Produk hidrolisat tempe sebagai penyedap rasa menghasilkan rerata kesukaan warna (3,3 = menarik, aroma (3,9 = sangat suka dan menghasilkan cita rasa sama jika ditambahakan sebanyak 2 kali dibandingkan penyedap rasa sintetis.This research was aimed to describe the need for the development of alternative flavor made from hydrolyzated tempe and its manufacturing process, to test the types of amino acid, to measure the protein levels and to test the favor organoleptically. This was an experimental study. The types of amino acid was tested using chromatographic technique, the level of soluble protein was tested using Biuret method and the products were compared organoleptically. The study showed that the development of hydrolyzated tempe flavoring needs to be performed by the reason of the impact of
Directory of Open Access Journals (Sweden)
Marco Salucci
2018-04-01
Full Text Available The elementary radiator of a planar array for next generation millimeter-wave (mm-wave 5G base stations is described. The antenna is designed for high density interconnect (HDI manufacturing for yielding a compact, densely-interconnected, and highly-integrable stacked structure. The layout of the single element is determined by directly optimizing key radiation features of the whole planar arrangement according to specific application-driven requirements. In addition, thanks to the exploitation of a spline-shaped modelling of the radiator, suitable performance in terms of impedance matching, realized gain, half-power beamwidth (HPBW, polarization purity, and inter-element isolation are achieved within the 28-GHz pass-band. Moreover, integrated out-of-band filtering capabilities are obtained in selected and wide non-contiguous stop-bands without additional circuitry.
Controlled Release of 5-Aminosalicylic Acid (5-ASA from New Biodegradable Polyurethanes
Directory of Open Access Journals (Sweden)
El-Refaie Kenawy
2010-03-01
Full Text Available Segmented polyurethanes containing azo aromatic groups in the main chain were synthesized by reaction of 3,3'-azobis(6-hydroxybenzoic acid (ABHB, 5-[4-(hydroxyphenylazo] salicylic acid (HPAS, and 5-[1-hydroxynaphthylazo] salicylic acid (HNAS with hexamethylenediisocyanate (HDI. All synthesized monomers and polymers were characterized by elemental analysis, FTIR, 1H-NMR spectra, TGA and DSC analysis. All the synthesized azo polymers showed good thermal stability and the onset decomposition temperature of all these polymers was found to be above 195 ºC under nitrogen atmosphere.The release of 5-ASA under physiological conditions (pH = 7.8 and pH = 1.5 was investigated at body temperature (37 ºC. The release rate of 5-ASA increased with increasing pH (i.e., 7.8 > 1.5.
Martinez, Edson Zangiacomi; Roza, Daiane Leite da; Caccia-Bava, Maria do Carmo Gullaci Guimarães; Achcar, Jorge Alberto; Dal-Fabbro, Amaury Lelis
2011-05-01
Teenage pregnancy is a common public health problem worldwide. The objective of this ecological study was to investigate the spatial association between teenage pregnancy rates and socioeconomic characteristics of municipalities in São Paulo State, Southeast Brazil. We used a Bayesian model with a spatial distribution following a conditional autoregressive (CAR) form based on Markov Chain Monte Carlo algorithm. We used data from the Live Birth Information System (SINASC) and the Brazilian Institute of Geography and Statistics (IBGE). Early pregnancy was more frequent in municipalities with lower per capital gross domestic product (GDP), higher poverty rate, smaller population, lower human development index (HDI), and a higher percentage of individuals with State social vulnerability index of 5 or 6 (more vulnerable). The study demonstrates a significant association between teenage pregnancy and socioeconomic indicators.
DEFF Research Database (Denmark)
Lazarus, Jeffrey V; Sperle, Ida; Safreed-Harmon, Kelly
2017-01-01
BACKGROUND: As more countries worldwide develop national viral hepatitis strategies, it is important to ask whether context-specific factors affect their decision-making. This study aimed to determine whether country-level socioeconomic factors are associated with viral hepatitis programmes...... and policy responses across WHO Member States (MS). METHODS: WHO MS focal points completed a questionnaire on national viral hepatitis policies. This secondary analysis of data reported in the 2013 Global Policy Report on the Prevention and Control of Viral Hepatitis in WHO Member States used logistic...... regression to examine associations between four survey questions and four socioeconomic factors: country income level, Human Development Index (HDI), health expenditure and physician density. RESULTS: This analysis included 119 MS. MS were more likely to have routine viral hepatitis surveillance and to have...
Directory of Open Access Journals (Sweden)
Danila Merino
2016-03-01
Full Text Available PLA-Chitosan films compatibilized with hexamethylenediisocyanate (HDI were obtained by casting and subsequent hot pressing. The films were prepared with different contents of chitosan (CS and then its physicochemical properties were studied by Fourier Transform infrared spectroscopy (FTIR, thermogravimetric analysis (TGA, differential scanning calorimetry (DSC, optical microscopy (OM and X-ray diffraction (XRD. It was found that the compatibilizing agent reacts completely and that chitosan affects the thermal properties of the films decreasing their decomposition temperatures, glass transition temperature (Tg and melting (Tm and increase its crystallinity. From the functional standpoint, antimicrobial properties of each blend were tested against Pseudomonas syringae pv tomato DC-3000. The increase in chitosan content was proportional to the antimicrobial effect allowing project its potential application in the agronomic field.
Daniell, James; Wenzel, Friedemann
2014-05-01
A review of over 200 fatality models over the past 50 years for earthquake loss estimation from various authors has identified key parameters that influence fatality estimation in each of these models. These are often very specific and cannot be readily adapted globally. In the doctoral dissertation of the author, a new method is used for regression of fatalities to intensity using loss functions based not only on fatalities, but also using population models and other socioeconomic parameters created through time for every country worldwide for the period 1900-2013. A calibration of functions was undertaken from 1900-2008, and each individual quake analysed from 2009-2013 in real-time, in conjunction with www.earthquake-report.com. Using the CATDAT Damaging Earthquakes Database containing socioeconomic loss information for 7208 damaging earthquake events from 1900-2013 including disaggregation of secondary effects, fatality estimates for over 2035 events have been re-examined from 1900-2013. In addition, 99 of these events have detailed data for the individual cities and towns or have been reconstructed to create a death rate as a percentage of population. Many historical isoseismal maps and macroseismic intensity datapoint surveys collected globally, have been digitised and modelled covering around 1353 of these 2035 fatal events, to include an estimate of population, occupancy and socioeconomic climate at the time of the event at each intensity bracket. In addition, 1651 events without fatalities but causing damage have also been examined in this way. The production of socioeconomic and engineering indices such as HDI and building vulnerability has been undertaken on a country-level and state/province-level leading to a dataset allowing regressions not only using a static view of risk, but also allowing for the change in the socioeconomic climate between the earthquake events to be undertaken. This means that a year 1920 event in a country, will not simply be
Hybrid process for nitrogen oxides reduction
Energy Technology Data Exchange (ETDEWEB)
Epperly, W.R.; Sprague, B.N.
1991-09-10
This patent describes a process for reducing the nitrogen oxide concentration in the effluent from the combustion of a carbonaceous fuel. It comprises introducing into the effluent a first treatment agent comprising a nitrogenous composition selected from the group consisting of urea, ammonia, hexamethylenetetramine, ammonium salts of organic acids, 5- or 6-membered heterocyclic hydrocarbons having at least one cyclic nitrogen, hydroxy amino hydrocarbons, NH{sub 4}-lignosulfonate, fur-furylamine, tetrahydrofurylamine, hexamethylenediamine, barbituric acid, guanidine, guanidine carbonate, biguanidine, guanylurea sulfate, melamine, dicyandiamide, biuret, 1.1{prime}-azobisformamide, methylol urea, methylol urea-urea condensation product, dimethylol urea, methyl urea, dimethyl urea, calcium cyanamide, and mixtures thereof under conditions effective to reduce the nitrogen oxides concentration and ensure the presence of ammonia in the effluent; introducing into the effluent a second treatment agent comprising an oxygenated hydrocarbon at an effluent temperature of about 500{degrees} F. to about 1600{degrees} F. under conditions effective to oxidize nitric oxide in the effluent to nitrogen dioxide and ensure the presence of ammonia at a weight ratio of ammonia to nitrogen dioxide of about 1:5 to about 5:1; and contacting the effluent with an aqueous scrubbing solution having a pH of 12 or lower under conditions effective to cause nitrogen dioxide to be absorbed therein.
Sun, Yang; Liu, Zhen; Liang, Xuhua; Fan, Jun; Han, Quan
2013-05-01
A novel water-soluble 1,8-naphthalimide derivative 1, bearing two acetic carboxylic groups, exhibited fluorescent turn-on recognition for casein based on the aggregation induced emission (AIE) character. The photophysical properties of 1 consisting of donor and acceptor units were investigated in different solutions. The fluorescence intensity decreased through taking advantage of twisted intramolecular charge transfer (TICT) and self-association emission with increasing solvent polarity. Moreover, the spectral red-shift and intensity quench in protic solvents were caused by the excited-state hydrogen bond strengthening effect. Density Functional Theory (DFT) calculations revealed that 1 exhibited a strong TICT character. The AIE mechanism of 1 with casein was due to 1 docked in the hydrophobic cavity between sub-micelles and bound with Tyr and Trp residues, resulting in the aggregation of 1 on the casein surface and emission enhancement. Based on this, a novel casein assay method was developed. The proposed exhibited a good linear range from 0.1 to 22 μg mL-1, with the detection limit of 2.8 ng mL-1. Satisfactory reproducibility, reversibility and a short response time were realized. This method was applied to the determination of casein in milk powder samples and the results were in good agreement with the result of Biuret method.
Protein content in gallstone patients can be a contributing factor in cholelithiasis
International Nuclear Information System (INIS)
Channa, N.A.; Memon, A.H.; Awan, A.Y.; Noorani, L.
2017-01-01
To find out the protein contents as contributing factor in the cholelithiasis patients. Methodology: The study was conducted during January 2016 to December 2016 at Institute of Biochemistry, University of Sindh, Jamshoro, Pakistan. A total number of 109 cholelithiasis patients admitted at Liaquat University Hospital, Jamshoro, Wali Bhai Rajputana Hospital, Hyderabad and Memon Charitable Hospital, Hyderabad, Pakistan and 294 age and gender matched control subjects were selected for the study. The serum samples of gallstone patients and control subjects were analyzed for the total protein contents by biuret kit method, gallstones recovered from the patients were also analyzed for the protein contents by Bradford method. Results: Cholelithiasis patients showed that gallstone protein contents increased with increasing age. We found increased amount of protein contents in mixed composition of gallstones as compared to pure cholesterol gallstones. Serum protein contents were increased in patients with age group 31-45 years, followed by age group 16-30 years. Female cholelithiasis patients were found with increased serum protein contents (but within normal limits) as compared to male cholelithiasis patients. Increased protein contents were also observed in serum as well as in gallstone samples recovered from multiparous female patients in comparison to triparous female patients. Conclusion: Protein may play a role in the pathogenesis of cholelithiasis. (author)
DEFF Research Database (Denmark)
Warren, Joshua L.; Shioda, Kayoko; Kürüm, Esra
2017-01-01
Background Pneumococcal conjugate vaccines (PCVs) are being used worldwide. A key question is whether the impact of PCVs on pneumonia is similar in low- and high-income populations. However, most low-income countries, where the burden of disease is greatest, lack reliable data that can be used...... to evaluate the impact. Data from middle-income countries that have both low- and high-income subpopulations can provide a proxy measure for the impact of the vaccine in low-income countries. Methods We evaluated the impact of PCV10 on hospitalizations for all-cause pneumonia in Brazil, a middle......-income country with localities that span a broad range of human development index (HDI) levels. We used complementary time series and spatiotemporal methods (synthetic controls and hierarchical Bayesian spatial regression) to test whether the decline in pneumonia hospitalizations associated with vaccine...
Paesaggio naturale e politiche di sviluppo territoriale in Islanda
Directory of Open Access Journals (Sweden)
Emanuela Finocchietti
2007-03-01
Full Text Available The stereotype of Iceland is a land of ice and fire, constantly subject to the devasting power of nature, an image that evokes the idea of a radically inhospitable environment, where is almost impossible to survive. Nevertheless Iceland, since independence, has developed so quickly to rank nowadays in the first positions in the world in terms of GDP pro-capita and HDI. Under this development there is a peculiar relation man-nature, that have been influencing the settlement and the economy so far, and that is so deeply rooted in the history of this territory to become a cultural and identitary factor. The aim of this paper is to analyse the relation environment-development in Iceland and the role of the natural landscape in the cultural sphere and in the development policies of this country.
Monopole Element at the Center of a Circular Groundplane of Arbitrary Radius. Volume 2. Appendices
1986-03-31
ocM’T-o — o-iMin-o M*riiM/)«rNn« fMD -OO^O^MD<iino*nJ-JJO’*niMI)IDo(HDi>«.flriiot>o^rijNiD<r«i’-H zoo — JJSMI- rM»n-oomr)»o — m — — N — CM — i>ini>nj...o-o-orj-iNrxOO-o-oa) fta )CMOOft•o->rv«0-inn(0>fODnwoinin-.^)Oftino-ininj)o--o K<rry-<^ODoa)**mrtN«^naiooor)*(D^,NO’^inr>«^orvor)-H’OrvinN...C SUBROUTINE QMM * SUBROUTINE QMM<AK,DKD,DKW,CDKD,SDKD,CDK,SDK,TK. IWZ,NPH. Zll> IMPLICIT REAL*8 <A-H>,(P-Z) C0MPLEX*16 FDM, FMD
Xiong, Shaomin; Wu, Haoyu; Bogy, David
2014-09-01
Heat assisted magnetic recording (HAMR) is expected to increase the storage areal density to more than 1 Tb/in2 in hard disk drives (HDDs). In this technology, a laser is used to heat the magnetic media to the Curie point (~400-600 °C) during the writing process. The lubricant on the top of a magnetic disk could evaporate and be depleted under the laser heating. The change of the lubricant can lead to instability of the flying slider and failure of the head-disk interface (HDI). In this study, a HAMR test stage is developed to study the lubricant thermal behavior. Various heating conditions are controlled for the study of the lubricant thermal depletion. The effects of laser heating repetitions and power levels on the lubricant depletion are investigated experimentally. The lubricant reflow behavior is discussed as well.
The effect of education on climate change risks
O'Neill, B. C.; KC, S.; Jiang, L.; Fuchs, R.; Pachauri, S.; Ren, X.; Zhang, T.; Laidlaw, E.
2017-12-01
Changes in the demographic and socio-economic compositions of populations are relevant to the climate change issue because these characteristics can be important determinants both of the capacity to adapt to climate change impacts as well as of energy use and greenhouse gas emissions, and therefore climate change. However, the incorporation of major trends such as aging, urbanization, and changes in household size into projections of future energy use and emissions is rare. Here we build on our previous work in this area by exploring the implications of future changes in educational attainment for the climate issue. Changes in the educational composition of the population may reduce the vulnerability of the population to climate change impacts, reducing risks. However they may also have effects on energy use and land use, and the resulting greenhouse gas emissions that drive climate change and increase risks. The direction of the effect of education on emissions is itself ambiguous. On the one hand, improvements in education can be expected to lead to faster fertility decline and slower population growth which, all else equal, would be expected to reduce emissions. On the other hand, education can also be expected to lead to faster economic growth, which would tend to increase emissions, and also to changes in consumption patterns. We employ iPETS, an integrated assessment model that includes a multi-region model of the world economy, driven with a new set of country-specific projections of future educational composition, to test the net effect of education on energy use and emissions on four world regions (China, India, Latin America, and Rest of Asia + Middle East) and therefore on climate. We also calculate the Human Development Index (HDI) for each region resulting from these scenarios, as an indicator of vulnerability to climate impacts. We find that the net effect of improved education is to increase emissions in the medium term driven primarily by increased
Directory of Open Access Journals (Sweden)
Paula Mazo
2010-06-01
Full Text Available El presente trabajo se centró en la producción de dispersiones acuosas de poliuretano empleando el método de emulsificación por inversión de fases. Para la síntesis fueron empleados dos polioles: uno comercial tipo poliéster y el otro es aceite de castor maleinizado (MACO; dos diisocianatos, uno aromático Toluen diisocianato (TDI y otro alifático Hexametilen diisocianato (HDI, siendo poco comunes para esta aplicación. Como emulsificante interno se empleó ácido cítrico el cual es muy económico y de fácil adquisición. Como factores se evaluaron la cantidad de ácido cítrico y la relación molar de grupos isocianato a hidroxilos (NCO/OH, generando un diseño de experimentos factorial 3² y minimizando el contenido de sólidos sedimentados. Mediante la metodología de superficie de respuesta, se obtuvo una ecuación polinomial cuadrática por un análisis de regresión múltiple. Los poliuretanos formados fueron evaluados en cuanto a sus propiedades adhesivas y mecánicas (pegajosidad tack, pegajosidad en cinta loop tack, cohesión hold, pelado peel, lo que permitió clasificar el adhesivo como reposicionable, para emplearlo en etiquetas.This work focused on the production of aqueous dispersions of polyurethane using the emulsification method by phase inversion. For the synthesis two polyols were employed, viz. a commercial polyester and Maleinizated Castor Oil (MACO, with two diisocyanates: one aromatic, toluene diisocyanate (TDI and another aliphatic, hexamethylene diisocyanate (HDI, which are not common for this application. Citric acid was used as internal emulsifier which is inexpensive and readily available. The parameters were the amount of citric acid and the mole ratio of isocyanate groups to hydroxyl (NCO/OH, generating a 3² factorial design, with minimization of the sedimented solids. The surface methodology was used to obtain a quadratic polynomial equation by multiple regression analysis. Polyurethanes synthesized were
Structure–inhibition relationship of ginsenosides towards UDP-glucuronosyltransferases (UGTs)
International Nuclear Information System (INIS)
Fang, Zhong-Ze; Cao, Yun-Feng; Hu, Cui-Min; Hong, Mo; Sun, Xiao-Yu; Ge, Guang-Bo; Liu, Yong; Zhang, Yan-Yan; Yang, Ling; Sun, Hong-Zhi
2013-01-01
The wide utilization of ginseng provides the high risk of herb–drug interaction (HDI) with many clinical drugs. The inhibition of ginsenosides towards drug-metabolizing enzymes (DMEs) has been regarded as an important reason for herb–drug interaction (HDI). Compared with the deep studies on the ginsenosides' inhibition towards cytochrome P450 (CYP), the inhibition of ginsenosides towards the important phase II enzymes UDP-glucuronosyltransferases (UGTs) remains to be unclear. The present study aims to evaluate the inhibition behavior of ginsenosides towards important UGT isoforms located in the liver and intestine using in vitro methods. The recombinant UGT isoform-catalyzed 4-methylumbelliferone (4-MU) glucuronidation reaction was employed as in vitro probe reaction. The results showed that structure-dependent inhibition existed for the inhibition of ginsenosides towards UGT isoforms. To clarify the possibility of in vivo herb–drug interaction induced by this kind of inhibition, the ginsenoside Rg 3 was selected as an example, and the inhibition kinetic type and parameters (K i ) were determined. Rg 3 competitively inhibited UGT1A7, 2B7 and 2B15-catalyzed 4-MU glucuronidation reaction, and exerted noncompetitive inhibition towards UGT1A8-catalyzed 4-MU glucuronidation. The inhibition parameters (K i values) were calculated to be 22.6, 7.9, 1.9, and 2.0 μM for UGT1A7, 1A8, 2B7 and 2B15. Using human maximum plasma concentration of Rg 3 (400 ng/ml (0.5 μM)) after intramuscular injection of 60 mg Rg 3 , the area under the plasma concentration-time curve (AUC) was extrapolated to increase by 2.2%, 6.3%, 26.3%, and 25% for the co-administered drugs completely undergoing the metabolism catalyzed by UGT1A7, 1A8, 2B7 and 2B15, respectively. All these results indicated that the ginsenosides' inhibition towards UGT isoforms might be an important reason for ginseng–drug interaction. - Highlights: ► Structure-dependent inhibition of ginsenoside towards UDP
Directory of Open Access Journals (Sweden)
Augusto Afonso Guerra Jr
2004-03-01
Full Text Available OBJETIVO: Avaliar a disponibilidade de medicamentos essenciais em localidades com índice de desenvolvimento humano OBJECTIVE: To investigate the availability of essential drugs in municipalities with a human development index < 0.699. METHODS: We surveyed 69 institutions, including municipal pharmacies, public clinics, private and philanthropic health units, and commercial pharmacies, in 19 municipalities of the state of Minas Gerais, Brazil. The municipalities were chosen according to the following selection criteria: (1 a human development index (HDI < 0.699 (the HDI for the entire state of Minas Gerais in 1991 in the microregion where the municipality was located; (2 the municipality had to be the seat of government for the microregion where it was located; (3 there had to be at least two eligible institutions (belonging to the public, private, or philanthropic sectors in full functioning in the municipality during the survey period. Health professionals who were directly responsible for stock control and drug dispensation at the institutions surveyed were interviewed. Institutional documents and records were also reviewed. A list of 21 tracer essential drugs, which were selected among the drugs most widely employed in the State of Minas Gerais’ Basic Pharmacy Program, was used to measure availability. The availability of each tracer drug was calculated at the time of the site visit and for the 12-month period immediately before the survey. In addition, the availability of tracer drugs was calculated for each type of institution surveyed. RESULTS: The availability of essential drugs in municipal pharmacies was 52.0%; in public health clinics, 46.9%; and in philanthropic and private health units, 41.0% and 38.1%, respectively. In commercial pharmacies, the availability of essential drugs reached 81.2%. CONCLUSION: The availability of essential drugs in public facilities is low and varies widely, with the result that persons who need such
Structure–inhibition relationship of ginsenosides towards UDP-glucuronosyltransferases (UGTs)
Energy Technology Data Exchange (ETDEWEB)
Fang, Zhong-Ze [The First Affiliated Hospital of Liaoning Medical University, Jinzhou 121001 (China); Joint Center for Translational Medicine, Dalian Institute of Chemical Physics Chinese Academy of Sciences and The first Affiliated Hospital of Liaoning Medical University, No.457, Zhongshan Road, Dalian 116023 (China); Laboratory of Metabolism, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892 (United States); Cao, Yun-Feng [Key Laboratory of Contraceptives and Devices Research(NPFPC),Shanghai Engineer and Technology Research Center of Reproductive Health Drug and Devices, Shanghai Institute of Planned Parenthood Research, Shanghai 200032 (China); Joint Center for Translational Medicine, Dalian Institute of Chemical Physics Chinese Academy of Sciences and The first Affiliated Hospital of Liaoning Medical University, No.457, Zhongshan Road, Dalian 116023 (China); Hu, Cui-Min [Laboratory of Metabolism, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892 (United States); Hong, Mo; Sun, Xiao-Yu [Joint Center for Translational Medicine, Dalian Institute of Chemical Physics Chinese Academy of Sciences and The first Affiliated Hospital of Liaoning Medical University, No.457, Zhongshan Road, Dalian 116023 (China); Ge, Guang-Bo; Liu, Yong; Zhang, Yan-Yan; Yang, Ling [Laboratory of Pharmaceutical Resource Discovery, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, 116023 Dalian (China); Sun, Hong-Zhi, E-mail: zzfang228@gmail.com [The First Affiliated Hospital of Liaoning Medical University, Jinzhou 121001 (China)
2013-03-01
The wide utilization of ginseng provides the high risk of herb–drug interaction (HDI) with many clinical drugs. The inhibition of ginsenosides towards drug-metabolizing enzymes (DMEs) has been regarded as an important reason for herb–drug interaction (HDI). Compared with the deep studies on the ginsenosides' inhibition towards cytochrome P450 (CYP), the inhibition of ginsenosides towards the important phase II enzymes UDP-glucuronosyltransferases (UGTs) remains to be unclear. The present study aims to evaluate the inhibition behavior of ginsenosides towards important UGT isoforms located in the liver and intestine using in vitro methods. The recombinant UGT isoform-catalyzed 4-methylumbelliferone (4-MU) glucuronidation reaction was employed as in vitro probe reaction. The results showed that structure-dependent inhibition existed for the inhibition of ginsenosides towards UGT isoforms. To clarify the possibility of in vivo herb–drug interaction induced by this kind of inhibition, the ginsenoside Rg{sub 3} was selected as an example, and the inhibition kinetic type and parameters (K{sub i}) were determined. Rg{sub 3} competitively inhibited UGT1A7, 2B7 and 2B15-catalyzed 4-MU glucuronidation reaction, and exerted noncompetitive inhibition towards UGT1A8-catalyzed 4-MU glucuronidation. The inhibition parameters (K{sub i} values) were calculated to be 22.6, 7.9, 1.9, and 2.0 μM for UGT1A7, 1A8, 2B7 and 2B15. Using human maximum plasma concentration of Rg{sub 3} (400 ng/ml (0.5 μM)) after intramuscular injection of 60 mg Rg{sub 3}, the area under the plasma concentration-time curve (AUC) was extrapolated to increase by 2.2%, 6.3%, 26.3%, and 25% for the co-administered drugs completely undergoing the metabolism catalyzed by UGT1A7, 1A8, 2B7 and 2B15, respectively. All these results indicated that the ginsenosides' inhibition towards UGT isoforms might be an important reason for ginseng–drug interaction. - Highlights: ► Structure
Shi, Shuo; Gu, Lin; Yang, Yihu; Yu, Haibin; Chen, Rui; Xiao, Xianglian; Qiu, Jun
2016-06-25
A series of bio-based thermosetting polyurethanes (Bio-PUs) were synthesized by the crosslinking reaction of polylactide and its copolymers diols with hexamethylene diisocyanate (HDI) trimer. The obtained Bio-PUs were characterized by Fourier Transform Infrared Spectroscopy (FTIR), Differential Scanning Calorimetry (DSC), Thermal Gravimetric Analysis (TGA), universal tensile testing machine and cytotoxicity test. Results indicate that the PLA copolymer (P(LA-co-CL)) diols reduced the glass transition temperature (Tg) of Bio-PUs and improved their thermal stability, compared with PLA diols. The Bio-PUs synthesized from P (LA-co-CL) diols exhibit better mechanical performance and shape memory properties. Especially, Young modulus and elongation at break of the obtained Bio-PUs were 277.7 MPa and 230% respectively; the shape recovery time of the obtained Bio-PUs at body temperature was only 93 s. Furthermore, alamar blue assay results showed that the obtained Bio-PUs had no cell toxicity.
Updating peasant competencies to mitigate poverty in the Chorti community, Copan (Honduras
Directory of Open Access Journals (Sweden)
Álvaro Rivas
2010-12-01
Full Text Available The Copan department of Honduras has a low Human Development Index (HDI 0.56 but it is very rich in hydric resources, all ranges in temperature, ecosystems, agricultural and livestock biodiversity, and rural knowledge because its original Mayan ethnic groups (Chorti and Lencas, and mixed race peasants. This article analyzes and evaluates the strategies used in the components of rural production and management of the basin of the Project 'Local Self-managed Development for Poverty Reduction in North Copán, Honduras' (NCP that worked with the Multifunctional Agriculture (MFA approach between 2003 and 2007. The main results were: To promote agro-ecological management innovations, creation of two funds to improve the farmers production, environmental protection of the basins, to consider the hydric and eco-systemic services in the management of the territory, to reassess social learning systems as the extension methodology “farmer to farmer”
Dawlee, S; Jayabalan, Muthu
2011-10-01
Biofunctionally active and inherently radiopaque polymers are the emerging need for biomedical applications. Novel segmented polyurethane elastomer with inherent radiopacity was prepared using aliphatic chain extender 2,3-diiodo-2-butene-1,4-diol, polyol polytetramethylene glycol and 4,4'-methylenebis(phenyl isocyanate) (MDI) for blood compatible applications. Aliphatic polyurethane was also prepared using hexamethylene diisocyanate for comparison. X-ray analysis of the polyurethanes revealed good radiopacity even at a relatively low concentration of 3% iodine in aromatic polyurethane and 10% in aliphatic polyurethane. The polyurethanes also possessed excellent thermal stability. MDI-based polyurethane showed considerably higher tensile strength than the analogous HDI-based polyurethane. MDI-based aromatic polyurethane exhibited a dynamic surface morphology in aqueous medium, resulting in the segregation of hydrophilic domains which was more conducive to anti-thrombogenic properties. The polyurethane was cytocompatible with L929 fibroblast cells, non-hemolytic, and possessed good blood compatibility.
International Nuclear Information System (INIS)
Dawlee, S; Jayabalan, Muthu
2011-01-01
Biofunctionally active and inherently radiopaque polymers are the emerging need for biomedical applications. Novel segmented polyurethane elastomer with inherent radiopacity was prepared using aliphatic chain extender 2,3-diiodo-2-butene-1,4-diol, polyol polytetramethylene glycol and 4,4'-methylenebis(phenyl isocyanate) (MDI) for blood compatible applications. Aliphatic polyurethane was also prepared using hexamethylene diisocyanate for comparison. X-ray analysis of the polyurethanes revealed good radiopacity even at a relatively low concentration of 3% iodine in aromatic polyurethane and 10% in aliphatic polyurethane. The polyurethanes also possessed excellent thermal stability. MDI-based polyurethane showed considerably higher tensile strength than the analogous HDI-based polyurethane. MDI-based aromatic polyurethane exhibited a dynamic surface morphology in aqueous medium, resulting in the segregation of hydrophilic domains which was more conducive to anti-thrombogenic properties. The polyurethane was cytocompatible with L929 fibroblast cells, non-hemolytic, and possessed good blood compatibility.
DEFF Research Database (Denmark)
Duda, Stephany N; Farr, Amanda M; Lindegren, Mary Lou
2014-01-01
in the International epidemiologic Databases to Evaluate AIDS completed a site survey from 2009 to 2010, including sites in the Asia-Pacific region (n=20), Latin America and the Caribbean (n=7), North America (n=7), Central Africa (n=12), East Africa (n=51), Southern Africa (n=16) and West Africa (n=15). We computed...... a measure of the comprehensiveness of care based on seven World Health Organization-recommended essential HIV services. RESULTS: Most sites reported serving urban (61%; region range (rr): 33-100%) and both adult and paediatric populations (77%; rr: 29-96%). Only 45% of HIV clinics that reported treating...... services. Newer sites and sites in settings with low rankings on the UN Human Development Index (HDI), especially those in the President's Emergency Plan for AIDS Relief focus countries, tended to offer a more comprehensive array of essential services. HIV care programme characteristics...
Crime Modeling using Spatial Regression Approach
Saleh Ahmar, Ansari; Adiatma; Kasim Aidid, M.
2018-01-01
Act of criminality in Indonesia increased both variety and quantity every year. As murder, rape, assault, vandalism, theft, fraud, fencing, and other cases that make people feel unsafe. Risk of society exposed to crime is the number of reported cases in the police institution. The higher of the number of reporter to the police institution then the number of crime in the region is increasing. In this research, modeling criminality in South Sulawesi, Indonesia with the dependent variable used is the society exposed to the risk of crime. Modelling done by area approach is the using Spatial Autoregressive (SAR) and Spatial Error Model (SEM) methods. The independent variable used is the population density, the number of poor population, GDP per capita, unemployment and the human development index (HDI). Based on the analysis using spatial regression can be shown that there are no dependencies spatial both lag or errors in South Sulawesi.
ANALISIS RISIKO BENCANA GEMPABUMI DI WILAYAH NUSA TENGGARA BARAT
Directory of Open Access Journals (Sweden)
Melki Adi Kurniawan
2017-02-01
Full Text Available An investigation of risk identification earthquake disaster in Nusa Tenggara Barat by three factors: the danger factor of earthquakes is Peak Ground Acceleration(PGA, vulnerability factor is population density by district, as well as the capasity factors are HDI (Human Development Index by district in the province of West Nusa Tenggara has be done. PGA value calculation was performed using the attenuation function Fukushima and Tanaka with earthquake parameter data from 1970 - 2014 with the criteria of magnitude ? 4.5mB, depth ? 60 km and the epicenter in the range of 7.5o - 12o and 115o-120o BT and for disaster risk index calculation earthquake using AHP (Analytical Hierarchy Process. From the calculation of the obtained regions with earthquake disaster risk levels are highest are southern Dompu, Mataram, Bima, northern Bima Regency while the lowest West Sumbawa regency and southern Sumbawa regency.
Energy Technology Data Exchange (ETDEWEB)
Dawlee, S; Jayabalan, Muthu, E-mail: muthujayabalan@rediffmail.com [Polymer Science Division, Biomedical Technology Wing, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram, Kerala 695 012 (India)
2011-10-15
Biofunctionally active and inherently radiopaque polymers are the emerging need for biomedical applications. Novel segmented polyurethane elastomer with inherent radiopacity was prepared using aliphatic chain extender 2,3-diiodo-2-butene-1,4-diol, polyol polytetramethylene glycol and 4,4'-methylenebis(phenyl isocyanate) (MDI) for blood compatible applications. Aliphatic polyurethane was also prepared using hexamethylene diisocyanate for comparison. X-ray analysis of the polyurethanes revealed good radiopacity even at a relatively low concentration of 3% iodine in aromatic polyurethane and 10% in aliphatic polyurethane. The polyurethanes also possessed excellent thermal stability. MDI-based polyurethane showed considerably higher tensile strength than the analogous HDI-based polyurethane. MDI-based aromatic polyurethane exhibited a dynamic surface morphology in aqueous medium, resulting in the segregation of hydrophilic domains which was more conducive to anti-thrombogenic properties. The polyurethane was cytocompatible with L929 fibroblast cells, non-hemolytic, and possessed good blood compatibility.
Brady, Pamlea N; Macnaughtan, Megan A
2015-12-15
Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins' molar extinction coefficients at 280 nm. For the Bradford assay, the responses (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar, with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines compared with the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.
Basit, Madiha; Rasool, Muhammad Hidayat; Naqvi, Syed Ali Raza; Waseem, Muhammad; Aslam, Bilal
2018-01-01
Present study was designed to evaluate the biosurfactant production potential by native strains of Bacillus cereus as well as determine their antimicrobial and antioxidant activities. The strains isolated from garden soil were characterized as B. cereus MMIC 1, MMIC 2 and MMIC 3. Biosurfactants were extracted as grey white precipitates. Optimum conditions for biosurfactant production were 37°C, the 7th day of incubation, 0.5% NaCl, pH 7.0. Moreover, corn steep liquor was the best carbon source. Biuret test, Thin Layer Chromatography (TLC), agar double diffusion and Fourier Transform Infrared Spectroscopy (FTIR) characterized the biosurfactants as cationic lipopeptides. Biosurfactants exhibited significant antibacterial and antifungal activity against S. aureus, E. coli, P. aeruginosa, K. pneumoniae, A. niger and C. albicans at 30 mg/ml. Moreover, they also possessed antiviral activity against NDV at 10 mg/ml. Cytotoxicity assay in BHK-21 cell lines revealed 63% cell survival at 10 mg/ml of biosurfactants and thus considered as safe. They also showed very good antioxidant activity by ferric-reducing activity and DPPH scavenging activity at 2 mg/ml. Consequently, the study offers an insight for the exploration of new bioactive molecules from the soil. It was concluded that lipopeptide biosurfactants produced from native strains of B. cereus may be recommended as safe antimicrobial, emulsifier and antioxidant agent.
Shaila, Mulki; Pai, G Prakash; Shetty, Pushparaj
2013-01-01
To evaluate the salivary protein concentration in gingivitis and periodontitis patients and compare the parameters like salivary total protein, salivary albumin, salivary flow rate, pH, buffer capacity and flow rate in both young and elderly patients with simple methods. One hundred and twenty subjects were grouped based on their age as young and elderly. Each group was subgrouped (20 subjects) as controls, gingivitis and periodontitis. Unstimulated whole saliva was collected from patients and flow rate was noted down during collection of the sample. Salivary protein estimation was done using the Biuret method and salivary albumin was assessed using the Bromocresol green method. pH was estimated with a pHmeter and buffering capacity was analyzed with the titration method. Student's t-test, Fisher's test (ANOVA) and Tukey HSD (ANOVA) tests were used for statistical analysis. A very highly significant rise in the salivary total protein and albumin concentration was noted in gingivitis and periodontitis subjects of both young and elderly. An overall decrease in salivary flow rate was observed among the elderly, and also the salivary flow rate of women was significantly lower than that of men. Significant associations between salivary total protein and albumin in gingivitis and periodontitis were found with simple biochemical tests. A decrease in salivary flow rate among elderly and among women was noted.
Ardhi, Muh. Waskito; Sulistyarsi, Ani; Pujiati
2017-06-01
Aspergillus sp is a microorganism which has a high ability to produce cellulase enzymes. In producing Cellulase enzymes requires appropriate concentration and incubation time to obtain optimum enzyme activity. This study aimed to determine the effect of inoculum concentration and incubation time towards production and activity of cellulases from Aspergillus sp substrate bagasse. This research used experiments method; completely randomized design with 2 factorial repeated 2 times. The treatment study include differences inoculum (K) 5% (K1), 15% (K2) 25%, (K3) and incubation time (F) that is 3 days (F1), 6 days (F2), 9 days (F3), 12 days (F4). The data taken from the treatment are glucose reduction and protein levels of crude cellulase enzyme activity that use Nelson Somogyi and Biuret methods. Analysis of variance ANOVA data used two paths with significance level of 5% then continued with LSD test. The results showed that: Fhit>Ftab. Thus, there is effect of inoculum concentrations and incubation time toward activity of crude cellulases of Aspergillus sp. The highest glucose reduction of treatment is K3F4 (concentration of inoculum is 25% with 12 days incubation time) amount 12.834 g / ml and the highest protein content is K3F4 (concentration of inoculum is 25% with with 12 days incubation time) amount 0.740 g / ml.
Baltaci, A K; Mogulkoc, R; Salbacak, A; Celik, I; Sivrikaya, A
2012-01-01
The objective of the present study was to examine the effects of zinc supplementation on the oxidant damage in lung and liver tissues in rats exposed to a 50-Hz frequency magnetic field for 5 minutes every other day over a period of 6 months. The study included 24 adult male Sprague-Dawley rats, which were divided into the three groups in equal numbers: Group 1, the control group (G1); Group 2, the group exposed to an electromagnetic field (G2); and Group 3, the group, which was exposed to an EMF and supplemented with zinc (G3). At the end of the 6-month procedures, the animals were decapitated to collect lung and liver tissue samples, in which MDA was analyzed using the "TBARS method (nmol/g/protein)", GSH by the "biuret method (mg/g/protein)" and zinc levels by atomic emission (µg/dl). MDA levels in lung and liver tissues in G2 were higher than those in G1 and G3, and the levels in G3 were higher than those in G1 (pelectromagnetic field caused cellular damage in lung and liver tissues and zinc supplementation inhibited the inflicted cellular damage. Another important result of this study that needs emphasis was that exposure to an electromagnetic field led to a significant decrease in zinc levels in lung and liver tissues (Tab. 3, Ref. 23).
Protein-Nanocellulose Interactions in Paper Filters for Advanced Separation Applications.
Gustafsson, Simon; Manukyan, Levon; Mihranyan, Albert
2017-05-16
Protein-based pharmaceutics are widely explored for healthcare applications, and 6 out of 10 best-selling drugs today are biologicals. The goal of this work was to evaluate the protein nanocellulose interactions in paper filter for advanced separation applications such as virus removal filtration and bioprocessing. The protein recovery was measured for bovine serum albumin (BSA), γ-globulin, and lysozyme using biuret total protein reagent and polyacrylamide gel electrophoresis (PAGE), and the throughput was characterized in terms of flux values from fixed volume filtrations at various protein concentrations and under worst-case experimental conditions. The affinity of cellulose to bind various proteins, such as BSA, lysozyme, γ-globulin, and human IgG was quantified using a quartz crystal microbalance (QCMB) by developing a new method of fixing the cellulose fibers to the electrode surface without cellulose dissolution-precipitation. It was shown that the mille-feuille filter exhibits high protein recovery, that is, ∼99% for both BSA and lysozyme. However, γ-globulin does not pass through the membrane due to its large size (i.e., >180 kDa). The PAGE data show no substantial change in the amount of dimers and trimers before and after filtration. QCMB analysis suggests a low affinity between the nanocellulose surface and proteins. The nanocellulose-based filter exhibits desirable inertness as a filtering material intended for protein purification.
Excreción de promastigotos de Leishmania pifanoi por Lutzomyia youngi experimentalmente infectada
Directory of Open Access Journals (Sweden)
Elina Rojas
1995-12-01
Full Text Available Se describe el desarrollo poblacional promastigótico de Leishmania pifanoi en Lutzomyia youngi experimentalmente infectada y mantenida con sacarosa al 50% bajo condiciones constantes de temperatura y humedad. Se reconocen dos etapas para la diferenciación y el crecimiento de los parásitos entre las dos y ciento veinte horas postprandiales. Hasta 48 horas tiene lugar la diferenciación pleomórfica de amastigotos en promastigotos cortos, que se multiplican por división binaria hasta las 60 horas, cuando ocurre la ruptura de la membrana peritrófica. La segunda etapa tiene lugar entre las 72 y 96 horas cuando algunos parásitos migran hacia la válvula esofágica y los demás parásitos libres son excretados en gotitas fecales como promastigotos grandes y activos. Las primeras gotitas excretadas dan reacción positiva a glucosa o contienen cristales de urato. El exceso de promastigotos de la segunda fase de desarrollo es eliminado en las últimas excretas que dan reacción positiva con las pruebas Hemoscreen y Biuret para proteínas totales y también para glucosa, y constituyen el 82% del total de gotas excretadas. La excreción de parásitos por Lu. youngi es fase normal del desarrollo de L. pifanoi en un vector.
Excreción de promastigotos de Leishmania pifanoi por Lutzomyia youngi experimentalmente infectada
Directory of Open Access Journals (Sweden)
Rojas Elina
1995-01-01
Full Text Available Se describe el desarrollo poblacional promastigótico de Leishmania pifanoi en Lutzomyia youngi experimentalmente infectada y mantenida con sacarosa al 50% bajo condiciones constantes de temperatura y humedad. Se reconocen dos etapas para la diferenciación y el crecimiento de los parásitos entre las dos y ciento veinte horas postprandiales. Hasta 48 horas tiene lugar la diferenciación pleomórfica de amastigotos en promastigotos cortos, que se multiplican por división binaria hasta las 60 horas, cuando ocurre la ruptura de la membrana peritrófica. La segunda etapa tiene lugar entre las 72 y 96 horas cuando algunos parásitos migran hacia la válvula esofágica y los demás parásitos libres son excretados en gotitas fecales como promastigotos grandes y activos. Las primeras gotitas excretadas dan reacción positiva a glucosa o contienen cristales de urato. El exceso de promastigotos de la segunda fase de desarrollo es eliminado en las últimas excretas que dan reacción positiva con las pruebas Hemoscreen y Biuret para proteínas totales y también para glucosa, y constituyen el 82% del total de gotas excretadas. La excreción de parásitos por Lu. youngi es fase normal del desarrollo de L. pifanoi en un vector.
Zhu, Rong; Wang, Yiyu; Zhang, Zongrui; Ma, Daiwei; Wang, Xinyu
2016-06-01
In this study, to obtain biomedical polyurethane elastomers with good mechanical properties and biocompatibility, a series of polycarbonate urethanes were synthesized via a two-step solution of polymerization method using the poly(1,6-hexanediol)carbonate diols (PCDL) as the soft segment, 4,4'-methylenebis(cyclohexyl isocyanate) (H12MDI), 1,6-hexamethylene diisocyanate (HDI) and 1,4-butanediol (BDO) as the hard segment with dibutyltin dilaurate as the catalyst. In this article, we illustrated the physical behaviors were obviously influenced by synthetic routes. And their chemical and physical structures were investigated by gel permeation chromatograph (GPC), differential scanning calorimeter (DSC), fourier transform infrared spectrography (FT-IR) and mechanical properties tests. The surface wettability were studied by contact angle measurement (CA). As a kind of short-term implant biomaterial, the results of the hemolysis and platelet adhesive tests were recorded by spectrophotometer and scanning electron microscopy (SEM), indicating the materials have a great potential for developments and applications in biomedical field.
Directory of Open Access Journals (Sweden)
Rong Zhu
2016-06-01
Full Text Available In this study, to obtain biomedical polyurethane elastomers with good mechanical properties and biocompatibility, a series of polycarbonate urethanes were synthesized via a two-step solution of polymerization method using the poly(1,6-hexanediolcarbonate diols (PCDL as the soft segment, 4,4′-methylenebis(cyclohexyl isocyanate (H12MDI, 1,6-hexamethylene diisocyanate (HDI and 1,4-butanediol (BDO as the hard segment with dibutyltin dilaurate as the catalyst. In this article, we illustrated the physical behaviors were obviously influenced by synthetic routes. And their chemical and physical structures were investigated by gel permeation chromatograph (GPC, differential scanning calorimeter (DSC, fourier transform infrared spectrography (FT-IR and mechanical properties tests. The surface wettability were studied by contact angle measurement (CA. As a kind of short-term implant biomaterial, the results of the hemolysis and platelet adhesive tests were recorded by spectrophotometer and scanning electron microscopy (SEM, indicating the materials have a great potential for developments and applications in biomedical field.
Murakami, Kentaro; Livingstone, M Barbara E
2016-06-01
To examine how different definitions of meals and snacks can affect the associations of meal frequency (MF) and snack frequency (SF) with dietary intake and adiposity measures. Based on 7 d weighed dietary record data, all eating occasions providing ≥210 kJ of energy were divided into meals or snacks based on contribution to energy intake (≥15 % or snacks, SF was associated with higher intakes of confectionery and alcohol, lower intakes of cereals, protein, fat and dietary fibre, and lower HDI (except for SF based on energy contribution in women) and MDS. After adjustment for potential confounders, MF based on time, but not MF based on energy contribution, was positively associated with BMI and waist circumference in men only. SF was positively associated with BMI and waist circumference, irrespective of the definition of snacks. Higher SF was consistently associated with lower diet quality and higher adiposity measures, while associations with MF varied depending on the definition of meals and sex.
The Changes of the Human Development on Micro-Regional and Settlement Levels
Directory of Open Access Journals (Sweden)
Katalin Lipták
2015-10-01
Full Text Available The purpose of this paper is to define and estimate the human potential of the settlements in South-Cserehát,, Hungary. The human development index in the classical view can be estimated atmicroregional level with only hard distortions, to which the list of starting indicators differ from the usual indicators, such as GDP and GNI, the life expectancy at birth and the portion of taking part in education. However, the estimating calculations made for defining the human potential in a settlement level should be handled with hard restrictions , at the same time it perfectly shows the formation of the human factor in the region. As a research question the following was defined: In what range has the human potential changed on the basis of the census data and what kind of configuration changes have happened in the South-Cserehát? The aim of the study to attempt to estimate the HDI on settlement level.
Yang, Cheng; Yuen, Matthew M. F.; Gao, Bo; Ma, Yuhui; Wong, C. P.
2011-01-01
As a candidate dispersant for silver-based isotropically conductive adhesives (ICAs), polyurethane (PU) is an environmentally benign material that can withstand a high deformation rate and that exhibits excellent reliability. In this work we investigated methyl ethyl ketoxime (MEKO) blocked isophorone diisocyanate (IPDI) and MEKO blocked hexamethylene diisocyanate (HDI) as dispersant materials, and we characterize the electrical conductivity, mechanical properties, and reliability of these PU-based ICAs with silver-flake filler content ranging from 30 wt.% to 75 wt.%. Results of temperature-humidity testing (THT) at 85°C and 85% relative humidity (RH) and thermal cycling testing (TCT) at -40°C to 125°C show that these ICAs have excellent reliability. Our experimental results suggest that the MEKO blocked PU dispersants are suitable for preparing ultralow-cost, flexible, high-performance ICAs for printing antennas for ultrahigh-frequency radiofrequency identification (RFID) tags. These tags can potentially be used for identifying washable items and food packaging.
Energy Technology Data Exchange (ETDEWEB)
Mumtaz, Fatima; Zuber, Mohammad; Zia, Khalid Mahmood [Government College University, Faisalabad (Pakistan); Jamil, Tahir [University of the Punjab, Lahore (Pakistan); Hussain, Rizwan [National Engineering and Scientific Commission (NESCOM), Islamabad (Pakistan)
2013-12-15
Aqueous polyurethane dispersions (PUDs) have recently emerged as important alternatives to their solvent-based counterparts for various applications due to increasing health and environmental awareness. A series of aqueous polyurethane dispersions containing carboxylate anion as hydrophilic pendant groups were synthesized through step growth polymerization reaction using hexamethylene diisocyanate (HDI), 1,4-butanediol (1,4-BDO), dimethylol propionic acid (DMPA) and polyethylene glycol (PEG) of different molecular weight. Effect of PEG molecular weight was investigated on molecular structure, contact angle measurement, and physical and adhesive properties of PU emulsions. Fourier transform infrared spectroscopy (FT-IR) was used to check the completion of polymerization reaction. Contact angle measurement indicated that the hydrophilicity of polymer increases by increasing molecular weight of PEG with a corresponding decrease in contact angle. Results of T-peel test showed a decrease in peel strength by increasing molecular weight of PEG. Moreover, solid contents%, drying time and storage stability suggested fast drying properties and greater stability of aqueous PU dispersions.
Da Silva, Vitor; Watts, David; Van der Bij, Erik; Banhidi, Z; Berbiers, Julien; Lampl, W; Marchesotti, M; Rangod, Stephane; Sbrissa, E; Schuh, S; Voss, Rüdiger; Zhuravlov, V
2004-01-01
The ChemicalVia process, patented by CERN, provides a new method of making microvias in high-density multilayer printed circuit boards of different types, such as sequential build-up (SBU), high density interconnected (HDI), or laminated multi-chip modules (MCM-L). The process uses chemical etching instead of laser, plasma or other etching techniques and can be implemented in a chain production line. This results in an overall reduced operation and maintenance cost and a much shorter hole production time as compared with other microvia processes. copy Emerald Group Publishing Limited. 4 Refs.4 An essential part of the Muon Spectrometer of the ATLAS experiment is based on the Monitored Drift Tube (MDT) technology. About 1200 muon drift chambers are being built at 13 institutes all over the world. The MDT chambers require an exceptional mechanical construction accuracy of better than 20 mu m. A dedicated X-ray tomograph has been developed at CERN since 1996 to control the mechanical quality of the chambers. The...
Directory of Open Access Journals (Sweden)
Jadson Freire da Silva
2016-04-01
dimensional representation of the terrain and can be used in the topography, noting that most conventional forms of representation are one-dimensional and two-dimensional. In addition to the relevant aspects MDT can be used on parameters such as agriculture, HDI, population, precipitation and temperature differentiating and deepening the studies and analyzes. The aim of this study was the analysis of average annual temperature parameters, average annual rainfall, human development index and gross domestic product of municipalities resulting from the Microregion Vale of Ipojuca evaluating the agricultural skills of the area to improve the quality of life and local income. Climate analyzes showed that the micro-region holds natural agricultural potential medium to low, with highlights in the industrial and services sectors, however, through appropriate agricultural management municipalities can generate quantitative employment through greater agricultural practices. Biodiversity conservation of forests, reforestation activities and sustainable management of riparian forests along the adventure tourism are alternative employment for the people who already benefit from other types of tourism, religious.
KALKINMA GELİR EŞİTSİZLİĞİ İLİŞKİSİ: TÜRKİYE ÖRNEĞİ
ÖZTÜRK, Eray; OKTAR, Suat
2018-01-01
Ülkeler kalkındıkça yaratılan refahınnasıl paylaşılacağı da iktisadi bir sorun olarak gündeme gelmektedir. Bu makaleTürkiye için 1990 sonrası dönemde kalkınma ve gelir eşitsizliği ilişkisiniincelemektedir. Bugüne kadar yapılan çalışmalar kişi başına gelir ile gelireşitsizliğini ilişkilendirirken,bu makalede kişi başına gelir yerine Birleşmiş milletlerin kalkınma ölçütü olanİnsani Gelişmişlik Endeksi (HDI) kullanılmıştır. İnsani Gelişme Endeksibireylerin refahını ölçtüğü için kişi başına gelir...
Directory of Open Access Journals (Sweden)
Seda BAĞDATLI KALKAN
2018-01-01
Full Text Available Consumer confidence index is a national indicator that suggest about current and future expectations of the economic conditions. With consumer confidence index, it is aimed to determine the trends and expectations of consumers according to their general economic situation, employment opportunities, their financial situations and developments in the markets. Another parameter is also the Human Development Index (HDI. This index is an indicator that examines the development of countries both economically and socially. Countries are sorted by these two indices and are considered as basic parameters in international platforms. The purpose of this study is to group the selected countries according to the consumer confidence index and reveal the features of the groups and then determine the position of the grouped countries with the Human Development Index. According to the results of cluster analysis, it is shown that India, China, Sweden and USA have the highest total consumer confidence index, employment, expectation and investment index
Mark, Quentin J
2014-01-01
Human height is a heritable trait that is known to be influenced by environmental factors and general standard of living. Individual and population stature is correlated with health, education and economic achievement. Strong sexual selection pressures for stature have been observed in multiple diverse populations, however; there is significant global variance in gender equality and prohibitions on female mate selection. This paper explores the contribution of general standard of living and gender inequality to the variance in global female population heights. Female population heights of 96 nations were culled from previously published sources and public access databases. Factor analysis with United Nations international data on education rates, life expectancy, incomes, maternal and childhood mortality rates, ratios of gender participation in education and politics, the Human Development Index (HDI) and the Gender Inequality Index (GII) was run. Results indicate that population heights vary more closely with gender inequality than with population health, income or education.
ANALISA TINGKAT RISIKO BENCANA GEMPA BUMI DI WILAYAH BALI
Directory of Open Access Journals (Sweden)
Rudy Darsono
2016-02-01
Full Text Available Bali region is prone to earthquake disasters because it lies between the two zones that cause earthquake (back arc trust at the north and subduction zones at the south and also vulnerable to earthquake disasters because of high population density. These conditions threaten the safety of lives and property of the population, so it needs to be research to analyze the risk of earthquake disaster in Bali. For identification of earthquake disaster risk, in this study using 3 factor: earthquake danger factor is Peak Ground Acceleration in Bali, vulnerability factor is population density every district in Bali, and resilience factors is HDI (Human Development Index every district in Bali. PGA value calculation using the atenuation function of Fukushima and Tanaka, for disaster risk index calculation using AHP (Analytical Hierarchy Process. The conclusion, regions that obtained the highest level of earthquake disaster risk are Karangasem and northern Buleleng, while the lowest are southern part of Badung, northern part of Gianyar and Nusa Penida.
Car-borne multichannel gamma-ray spectrometric system model CZD-6
International Nuclear Information System (INIS)
Lu Shili; Zhai Yugui; Ma Yanfang; Jiao Cangwen; Zhang Biao
1998-01-01
The car-borne multichannel gamma-ray spectrometric system Mode CZD-6 is composed of a HDY-256 of portable multichannel gamma-ray spectrometer developed by the Beijing Research Institute of Uranium Geology and a large volume scintillation detector. the position for each measurement point is determined by the GPS instrument. Its latitude and longitude, as well as measured 256 channels of γ-spectrometric data are collected by a notebook computer, which can show the 256 channels of spectra for each point during measuring processes. The complete system can be loaded in a field car. This system has been used to environmental radioactive monitoring after calibration by airborne radiometric models in Shijiazhuang, Hebei province. A lot of data confirm that the system works stably and reliably, and is a fast and advanced approach for environmental γ-spectrometric monitoring. It can be used not only to determination of contents of natural radioactive elements in environments, but also to monitoring nuclear pollution and emergency treatment in nuclear accidents significantly
A methodology to measure cervical vertebral bone maturation in a sample from low-income children.
Aguiar, Luciana Barreto Vieira; Caldas, Maria de Paula; Haiter Neto, Francisco; Ambrosano, Glaucia Maria Bovi
2013-01-01
This study evaluated the applicability of the regression method for determining vertebral age developed by Caldas et al. (2007) by testing this method in children from low-income families of the rural zone. The sample comprised cephalometric and hand-wrist radiographs of 76 boys and 64 girls aged 7.0 to 14.9 years living in a medium-sized city in the desert region of the northeastern region of Brazil, with an HDI of 0.678. C3 and C4 vertebrae were traced and measured on cephalometric radiographs to estimate the bone age. The average age, average hand-wrist age and average error estimated for girls and boys were, respectively, 10.62 and 10.44 years, 11.28 and 10.57 years, and 1.42 and 1.18 years. Based on these results, the formula proposed by Caldas et al. (2007) was not applicable to the studied population, and new multiple regression models were developed to obtain the children's vertebral bone age accurately.
Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors
Directory of Open Access Journals (Sweden)
Lamblin Anne-Francoise
2007-10-01
might promote osteoblast maturation following HDI exposure. One gene whose upregulation following HDI treatment is consistent with this notion is Slc9a3r1. Also known as NHERF1, Slc9a3r1 is required for optimal bone density. Similarly, the regulation of Wnt receptor genes indicates that this crucial pathway in osteoblast development is also affected by HDIs. These data support the hypothesis that HDIs regulate the expression of genes that promote osteoblast differentiation and maturation.
Anticorrosive organic/inorganic hybrid coatings
Gao, Tongzhai
Organic/inorganic hybrid coating system was developed for anticorrosion applications using polyurea, polyurethane or epoxide as the organic phase and polysiloxane, formed by sol-gel process, as the inorganic phase. Polyurea/polysiloxane hybrid coatings were formulated and moisture cured using HDI isocyanurate, alkoxysilane-functionalized HDI isocyanurate, and tetraethyl orthosilicate (TEOS) oligomers. Two urethanes were prepared using the same components as abovementioned in addition to the oligoesters derived from either cyclohexane diacids (CHDA) and 2-butyl-2-ethyl-1,3-propanediol (BEPD) or adipic acid (AA), isophthalic acid (IPA), 1,6-hexanediol (HD), and trimethylol propane (TMP). Accelerated weathering and outdoor exposure were performed to study the weatherability of the polyurethane/polysiloxane hybrid coating system. FTIR and solid-state 13C NMR revealed that the degradation of the hybrid coatings occurred at the urethane and ester functionalities of the organic phase. DMA and DSC analyses showed the glass transition temperature increased and broadened after weathering. SEM was employed to observe the change of morphology of the hybrid coatings and correlated with the gloss variation after weathering. Rutile TiO2 was formulated into polyurethane/polysiloxane hybrid coatings in order to investigate the effect of pigmentation on the coating properties and the sol-gel precursor. Chemical interaction between the TiO2 and the sol-gel precursor was investigated using solid-state 29Si NMR and XPS. The morphology, mechanical, viscoelastic, thermal properties of the pigmented coatings were evaluated as a function of pigmentation volume concentration (PVC). Using AFM and SEM, the pigment were observed to be well dispersed in the polymer matrix. The thermal stability, the tensile modulus and strength of the coatings were enhanced with increasing PVC, whereas the pull-off adhesion and flexibility were reduced with increasing PVC. Finally, the pigmented coatings were
Directory of Open Access Journals (Sweden)
Guadalupe Soto-Estrada
2018-05-01
Full Text Available Objective: To analyse the evolution of the frequency of type 2 diabetes (T2D and its relationship to eating patterns in Mexico from 1961 to 2013, and the Gini coefficient, Human Development Index (HDI and Gross Domestic Product (GDP. Mexico ranked sixth in world prevalence of diabetes in 2015 with an estimated 11.4 million Mexicans affected. Method: Using data from the Balance Sheets Food published by the Food and Agriculture Organization of the United Nations (FAO, the means of apparent food consumption (kcal/person/day were grouped by decades. Data for mortality rate for diabetes were obtained from 1990 until 2015. Spearman's correlation coefficient was calculated between the diabetes mellitus mortality rate and all food groups. Pearson's correlation explored the relationship between socio economic indicators and the prevalence of T2D diabetes. Results: The mortality rate for T2D has increased over the last decades. An increase of 647.9 kcal/person/day in apparent food consumption was observed. Cereal and legume consumption decreased, while apparent sugar, animal food and animal fat and vegetable oil consumption increased substantially. HDI and GDP showed a directly proportional relationship to diabetes. Spearman's correlation coefficient was statistically significant only for sugar. The Gini coefficient suggests that in lower inequalities there is an increased frequency of diabetes. Conclusions: The increase in the mortality rate of type 2 diabetes was constant during the study period, which coincides with the increase in energy density of Mexican eating patterns from 1961 to 2013. The higher the Gini coefficient, HDI and GDP, the higher the mortality observed for diabetes. Resumen: Objetivo: Analizar la evolución de la frecuencia de la diabetes tipo 2 y su relación con los patrones alimentarios en México de 1961 a 2013, así como el coeficiente de Gini, el índice de desarrollo humano (IDH y el producto interno bruto (PIB. México ocup
Directory of Open Access Journals (Sweden)
Muhammad Saqib Shahzad
2016-05-01
Full Text Available Background: Patterns of volatile metabolites in urine are important to detect abnormalities associated with diabetes. Present study was conducted to find out the excretion patterns of endogenously produced alcohols in urine for type 2 (Non-Insulin Dependent diabetes mellitus. A cross sectional analytical study was conducted with duration extended from Jan to Mar 2015. Methods: The current study included 40 patients with chronic type 2 diabetes mellitus. In total, 10 sex and age matched subjects with no history of any disease were considered as controls. Blood sugar was estimated by autoanalyzer using standard kit of Merck following manufacturer`s instructions. Urine sugar was quantitatively detected by biuret reagent using titration technique. Urinary alcohol was identified and estimated by gas chromatography. Urinary ketone bodies were estimated by urinary strip. Results: It was observed that level of fasting blood sugar was significantly increased (P<0.001 in patients as compared to their controls. The blood sugar and urinary alcohol in patients were 3.0% and 6.0% respectively. Urinary ketone bodies were found to be 2+. On the other hand urine sugar, alcohol and ketone bodies were not detected in the negative control subjects. Conclusions: It is concluded that urinary alcohol is endogenously produced in patients with type 2 diabetes due to uncontrolled hyperglycemia. However further work is needed to find out the ratio of urinary and blood alcohol which may confirm the present findings.
Food for the Future: A Study of Insects as a Protein Source
Riggs, S.
2017-12-01
This study is designed to gain a sustainable, organic food source containing the proper amino acids, minerals, and protein to sustain the needs of human life on Earth as the current economy and environment will not be able to equip the needs for the future. The hypotheses are if available protein is increased in an insect's diet then their nutritional value will increase to fulfill a human's daily protein requirements in one serving size or less for each species tested and if there is a higher content of protein in the insects, then food created with it will receive higher ratings. Protein supplements were added to an insect's natural diet to increase nutritional value. Protein value in the insects increased to fulfill a human's daily dietary protein requirement in a third of a serving size. Biuret and absorption spectrometry testing demonstrates this correlation. Insects increased protein in their body showing a positive correlation to the hypothesis. Week one, protein values doubled and tripled in some species, unexpectedly. After three weeks, protein still continued increasing. There was high success in increasing the protein value in the different species of insects chosen. Is there a taste difference benefit with a higher content of protein in the insects? Over 55% of participants rated the brownies with more protein higher than the control groups, and overall 88% preferred brownies with insects opposed to without, supporting the second hypothesis.
Antioxidant status of dog aqueous humor after extracapsular lens extraction
Directory of Open Access Journals (Sweden)
Barros P.S.M.
2003-01-01
Full Text Available We determined the antioxidant status of the aqueous humor after extracapsular lens extraction in 14 mongrel dogs weighing about 10 kg. The animals were examined by slit lamp biomicroscopy, applanation tonometry and indirect ophthalmoscopy. One eye was submitted to conventional extracapsular lens extraction and the other was used as control. Samples of aqueous humor were obtained by anterior chamber paracentesis before and at days 1, 2, 3, 7 and 15 after surgery. Total antioxidant status was determined as the capacity of aqueous humor to inhibit free radical generation by 2,2-azobis(2-amidopropane chlorine. Ascorbic acid concentration was measured by HPLC with UV detection. Protein content was determined with the biuret reagent. Statistical analysis was performed by ANOVA followed by the Tukey-Kramer test. Protein concentration increased from 0.61 to 22 mg/ml 24 h after surgery. These levels were maintained and returned to normal at day 7. Total antioxidant capacity was reduced from 50 to about 30 min until day 3 and at day 7 it was equal to control. Ascorbic acid levels were reduced from 252 to about 110 µM and then returned to control values at day 15. Considering the importance of ascorbic acid concentration in aqueous humor for the maintenance of the antioxidant status of the anterior segment of the eye, the decrease of antioxidant defenses suggests that the surgical procedures promote an oxidative stress condition in the eye.
Directory of Open Access Journals (Sweden)
B. Amarjagal
2007-01-01
Full Text Available Aim. To study change of rate and duration indicators of longitudinal movement of a fibrous ring of mitral valve (MFR during isovolumic contraction (IVC and relaxation (IVR in hypertensive patients with various degree of a left ventricular hypertrophy (LVH.Material and methods. 80 hypertensive patients with moderate LVH (n=40 and severe LVH (n=40 are examined. The control group was presented by 30 healthy volunteers. Transthoracic echocardiography and Tissue Doppler imaging has been performed with ultrasonic tomograph “HDI 5000” (Philips.Results. Increase in LVH (Smm and Е/Еmm associates with reduction in systolic velocity of movement of medial MFR (Smm. There is direct relation with duration of IVC-negative and IVR-positive components and myocardium mass index. Maximal velocity of IVC-positive component increases and maximal velocity of IVR-negative component decreases when LVH is growing.Conclusion. Velocities curves of IVC and IVR were bi-phase both in healthy persons and in hypertensive patients with LVH. Velocity and duration of positive and negative components of IVC and IVR depended on LVH degree.
Directory of Open Access Journals (Sweden)
B. Amarjagal
2015-12-01
Full Text Available Aim. To study change of rate and duration indicators of longitudinal movement of a fibrous ring of mitral valve (MFR during isovolumic contraction (IVC and relaxation (IVR in hypertensive patients with various degree of a left ventricular hypertrophy (LVH.Material and methods. 80 hypertensive patients with moderate LVH (n=40 and severe LVH (n=40 are examined. The control group was presented by 30 healthy volunteers. Transthoracic echocardiography and Tissue Doppler imaging has been performed with ultrasonic tomograph “HDI 5000” (Philips.Results. Increase in LVH (Smm and Е/Еmm associates with reduction in systolic velocity of movement of medial MFR (Smm. There is direct relation with duration of IVC-negative and IVR-positive components and myocardium mass index. Maximal velocity of IVC-positive component increases and maximal velocity of IVR-negative component decreases when LVH is growing.Conclusion. Velocities curves of IVC and IVR were bi-phase both in healthy persons and in hypertensive patients with LVH. Velocity and duration of positive and negative components of IVC and IVR depended on LVH degree.
Shape memory polymers based on uniform aliphatic urethane networks
Energy Technology Data Exchange (ETDEWEB)
Wilson, T S; Bearinger, J P; Herberg, J L; Marion III, J E; Wright, W J; Evans, C L; Maitland, D J
2007-01-19
Aliphatic urethane polymers have been synthesized and characterized, using monomers with high molecular symmetry, in order to form amorphous networks with very uniform supermolecular structures which can be used as photo-thermally actuable shape memory polymers (SMPs). The monomers used include hexamethylene diisocyanate (HDI), trimethylhexamethylenediamine (TMHDI), N,N,N{prime},N{prime}-tetrakis(hydroxypropyl)ethylenediamine (HPED), triethanolamine (TEA), and 1,3-butanediol (BD). The new polymers were characterized by solvent extraction, NMR, XPS, UV/VIS, DSC, DMTA, and tensile testing. The resulting polymers were found to be single phase amorphous networks with very high gel fraction, excellent optical clarity, and extremely sharp single glass transitions in the range of 34 to 153 C. Thermomechanical testing of these materials confirms their excellent shape memory behavior, high recovery force, and low mechanical hysteresis (especially on multiple cycles), effectively behaving as ideal elastomers above T{sub g}. We believe these materials represent a new and potentially important class of SMPs, and should be especially useful in applications such as biomedical microdevices.
Faktor-Faktor Mempengaruhi Ketimpangan Wilayah di Provinsi Jawa Timur, Indonesia
Directory of Open Access Journals (Sweden)
Fitrah Sari Islami
2018-01-01
Abstract Regional inequalities are one of the most common issues in developing countries including in Indonesia. East Java is the pro vince with the quiet high inequalities value compared to the other provinces in Java Island. This study aims to: 1 to calculate the inequality value in East Java Province, 2 to classify the regions in East Java Province using Klassen Typology, 3 to determine factors that affect inequalities value in East Java Province. The methods used in this study were 1 Williamson Index to calculate the inequalities values, 2 Multiple linear regression analysis (Ordinary Least Square during 2001 – 2015 using Eviews 9 software. The result of the study showed that the level of regional inequalities in East Java Province tends to increase with the Williamson index value more than 1. The result of multiple linear regression analysis, the variable of investment, labor forced and HDI were resulted to significant and it affect to the regional inequalities, meanwhile the variable of economic growth, and government expenditure were insignificant. Keyword: inequalities, Williamson Index, Klassen Typology, East Java
PROFILE SOCIAL CLASS OF INDIVIDUALS ASSISTED IN A SOCIAL ORGANIZATION IN THE CAMAÇARI-BA CITY
Directory of Open Access Journals (Sweden)
Milene de Andrade Carvalho
2012-04-01
Full Text Available The city of Camaçari-Ba in the Bahia is considered the biggest territory of the region metropolitan area of Salvador-B. This population has presented considerable growth in the Human Development Index (HDI, with magnifying of the life expectancy and industrial cycle. The biggest social organization situated in the city and considered satate reference of social inclusion are develops entailed diverse actions to the participation of the city departments, except on actions to the healt secretariat. This study one is about a research of transverse whose objective was to identify the profile of 227 individuals assisted by social organization Prof. Raimundo Pinheiro, located in the mentioned city. The results had indicated the presence of a predominant age range next to 60 years, the relation between income and scholarity, the high frequency of chronic pain and relation enters the chronic use of drugs, activities of daily life and occupational activities. It is necessary that the activities of the social organization contemplate the logic of the intersectoral and include secretariat of health in its organizational politics.
International Nuclear Information System (INIS)
Magarelli, N.; Guglielmi, G.; Savastano, M.; Toro, V.; Sborgia, M.; Fioritoni, G.; Mattei, P.A.; Steinbach, L.; Bonomo, L.
2004-01-01
Objective: To evaluate the sensitivity, specificity and diagnostic accuracy of a cut-off of the resistive index of 0.5 for the differentiation between inflammatory and neoplastic primary lymphadenopathies. Subjects and methods: We measured the resistive index of superficial enlarged lymph nodes in a total of 50 patients (29 males and 21 females; age range 12-72 years, mean age 41.6 year) using an ATL 5000 HDI. A resistive index greater than or equal to 0.5 indicated an inflammatory lymph node and a resistive index <0.5 was consistent with neoplastic primary lymphadenopathies. The gold standard was either surgical biopsy or lymph-node reduction seen with ultrasound examination after antibiotic therapy. Results: The sensitivity of the resistive index for distinguishing inflammatory from neoplastic lymphadenopathy was 84.6%, the specificity 100% and the diagnostic accuracy 95.7% (P<0.001, statistically significant). Conclusion: The results of this study indicate that power-Doppler using a resistive index cut-off of 0.5 was a valid technique for distinguising between inflammatory and primary neoplastic lymph nodes in patients with superficial lymphadenopathies
Li, Wei-Dong; Huang, Min; Lü, Wen-Gang; Chen, Xiao; Shen, Ming-Hui; Li, Xiang-Min; Wang, Rong-Xia; Ke, Cai-Huan
2015-01-01
The small abalone Haliotis diversicolor is an economically important mollusk that is widely cultivated in Southern China. Gonad precocity may affect the aquaculture of small abalone. Polyamines, which are small cationic molecules essential for cellular proliferation, may affect gonadal development. Ornithine decarboxylase (ODC) and antizyme (AZ) are essential elements of a feedback circuit that regulates cellular polyamines. This paper presents the molecular cloning and characterization of AZ from small abalone. Sequence analysis showed that the cDNA sequence of H. diversicolor AZ (HdiODCAZ) consisted of two overlapping open reading frames (ORFs) and conformed to the +1 frameshift property of the frame. Thin Layer chromatography (TLC) analysis suggested that the expressed protein encoded by +1 ORF2 was the functional AZ that targets ODC to 26S proteasome degradation. The result demonstrated that the expression level of AZ was higher than that of ODC in the ovary of small abalone. In addition, the expression profiles of ODC and AZ at the different development stages of the ovary indicated that these two genes might be involved in the gonadal development of small abalone.
Directory of Open Access Journals (Sweden)
Miguel Ángel González-Block
2008-12-01
Full Text Available OBJETIVO: Adaptar y evaluar una herramienta de autodiagnóstico de la capacidad de los equipos de gestión de salud para utilizar la investigación, con énfasis en su adquisición, análisis, adaptación y aplicación. MATERIAL Y MÉTODOS: La herramienta se tradujo al español y se elaboró un manual sometido a la autorización de la Comisión de Ética del Instituto Nacional de Salud Pública, antes de su aplicación durante el periodo de abril a noviembre del 2007 en 122 unidades (tasa de respuesta de 84.4% para cubrir una amplia gama de instituciones en seis entidades contrastantes de México, según el índice de desarrollo humano (IDH. Se validó la herramienta de manera interna y externa con métodos estadísticos. RESULTADOS: Se observaron diferencias en la capacidad de los equipos para cada fase de utilización, sin importar cuáles fueran su composición por género, experiencia o estudios, pero sí la participación en la atención a los pacientes, de acuerdo con el IDH de los estados. CONCLUSIONES: La herramienta se validó de modo interno y externo para su aplicación en diversas condiciones de México. Puede aplicarse en cualquier país de habla hispana.OBJECTIVE: A tool was adapted and evaluated for the self-assessment by health management teams of their capacity to utilize research, distinguishing between its acquisition, analysis, adaptation and application. MATERIAL AND METHODS: The tool was translated into Spanish and a manual was created. The manual was submitted for authorization to the Ethics Committee of the National Public Health Institute of Mexico. The kit was sent to 122 units (response rate of 84.4%, covering a wide range of institutions in six contrasting states of Mexico according to the Human Development Index (HDI. The tool was validated internally and externally using statistical methods. RESULTS: Differences were observed in the teams' research utilization capacity within each phase, regardless of their
Zaikos, Thomas D; Painter, Mark M; Sebastian Kettinger, Nadia T; Terry, Valeri H; Collins, Kathleen L
2018-03-15
Combinations of drugs that affect distinct mechanisms of HIV latency aim to induce robust latency reversal leading to cytopathicity and elimination of the persistent HIV reservoir. Thus far, attempts have focused on combinations of protein kinase C (PKC) agonists and pan-histone deacetylase inhibitors (HDIs) despite the knowledge that HIV gene expression is regulated by class 1 histone deacetylases. We hypothesized that class 1-selective HDIs would promote more robust HIV latency reversal in combination with a PKC agonist than pan-HDIs because they preserve the activity of proviral factors regulated by non-class 1 histone deacetylases. Here, we show that class 1-selective agents used alone or with the PKC agonist bryostatin-1 induced more HIV protein expression per infected cell. In addition, the combination of entinostat and bryostatin-1 induced viral outgrowth, whereas bryostatin-1 combinations with pan-HDIs did not. When class 1-selective HDIs were used in combination with pan-HDIs, the amount of viral protein expression and virus outgrowth resembled that of pan-HDIs alone, suggesting that pan-HDIs inhibit robust gene expression induced by class 1-selective HDIs. Consistent with this, pan-HDI-containing combinations reduced the activity of NF-κB and Hsp90, two cellular factors necessary for potent HIV protein expression, but did not significantly reduce overall cell viability. An assessment of viral clearance from in vitro cultures indicated that maximal protein expression induced by class 1-selective HDI treatment was crucial for reservoir clearance. These findings elucidate the limitations of current approaches and provide a path toward more effective strategies to eliminate the HIV reservoir. IMPORTANCE Despite effective antiretroviral therapy, HIV evades eradication in a latent form that is not affected by currently available drug regimens. Pharmacologic latency reversal that leads to death of cellular reservoirs has been proposed as a strategy for
Desigualdade de renda e eficiência técnica na geração de bem-estar entre os estados brasileiros
Directory of Open Access Journals (Sweden)
Emerson Marinho
2004-12-01
Full Text Available Este artigo estima as medidas de eficiência técnica dos estados brasileiros na geração de bem-estar, entre os anos de 1986 e 1998, utilizando o método não-paramétrico Data Envelopment Analisys (DEA. São utilizadas como medidas de bem-estar a medida de Sen e, alternativamente, o PIB per capita e o Índice de Desenvolvimento Humano (IDH. Adicionalmente, são calculadas as medidas de desigualdade de renda inter/intra-regional de Theil para se analisar a trajetória da desigualdade no Brasil como uma determinante do bem-estar. Comparando as medidas de desigualdade no início e no final do período, nota-se que apenas nas regiões nordeste e sudeste ocorreram reduções significativas da desigualdade e que as medidas de desigualdade totais não sofreram qualquer modificação significativa durante o período analisado. Quanto às medidas de eficiência na geração de bem-estar, o modelo utilizando a medida de bem-estar de Sen aponta os estados de São Paulo, Rio Grande do Sul, Amazonas, Roraima e Amapá como sendo os mais eficientes na geração de bem-estar. O modelo com PIB per capita, replica basicamente os resultados anteriores. Finalmente, utilizando o IDH, os estados acima citados, mantém-se ainda como os mais eficientes com exceção do estado de São PauloIn this paper we utilize the Data Envelopment Analysis (DEA, a non-parametric method, to estimate measures of technical efficiency of the Brazilian states in the generation of welfare between 1986 and 1998. The basic welfare measures considered include the measure developed by Sen and, alternatively, GDP per capita and the Human Development Index (HDI. Additionally, Theil's inter and intra-regional income inequality measures are calculated so that the path of income inequality as a determinant of welfare could also be analyzed for Brazil. Comparing these inequality measures in the beginning and in the end of the period in analysis, we note that only in the Northeast and in the
Plasma protein electrophoresis of Trachemys scripta and Iguana iguana.
Giménez, Mercè; Saco, Yolanda; Pato, Raquel; Busquets, Alex; Martorell, Jaime M; Bassols, Anna
2010-06-01
Protein electrophoresis is widely applied in veterinary medicine, but is not used often in reptiles, in part because of lack of reference values. The goals of this study were to compare plasma protein profiles obtained by cellulose acetate electrophoresis (CAE) and agarose gel electrophoresis (AGE), measure precision and examine interference by sample hemolysis, and establish preliminary reference intervals for 2 reptile species. Heparinized plasma samples from healthy and diseased adult female Iguana iguana (n=40) and Trachemys scripta (n=60) were analyzed by CAE and AGE. Total protein concentration was measured by the biuret method. Electrophoresis results were compared using Bland-Altman plots and Passing-Bablok regression analysis. Precision and the effects of sample hemolysis were determined. Results from clinically healthy animals were used to determine reference intervals. Five protein fractions were identified in both species, with bisalbuminemia observed in 23/40 iguanas. High correlation was observed between the 2 methods for all fractions, with few proportional and systematic errors. Coefficients of variation were lower using AGE vs CAE and for I. iguana vs T. scripta. Two additional bands were observed in hemolyzed samples from T. scripta; 1 additional band was observed for I. iguana. Minimum and maximum values were reported for healthy I. iguana (n=14) and T. scripta (n=22). Although both methods are acceptable, the performance of AGE was slightly better than that of CAE for analysis of plasma from reptiles. Furthermore, reptile electrophoretic patterns should be interpreted based on the method used, the species analyzed, and the quality of the plasma sample.
Macrocyclic ligands for uranium complexation. Final report, August 1, 1986--March 31, 1993
International Nuclear Information System (INIS)
Potts, K.T.
1993-01-01
Macrocycles, designed for complexation of the uranyl ion by computer modeling studies and utilizing six ligating atoms in the equatorial plane of the uranyl ions, have been prepared and their complexation of the uranyl ions evaluated. The ligating atoms, either oxygen or sulfur, were part of acylurea, biuret or thiobiuret subunits with alkane chains or pyridine units completing the macrocyclic periphery. These macrocycles with only partial preorganization formed uranyl complexes in solution but no crystalline complexes were isolated. Refinement of the cavity diameter by variation of the peripheral functional groups is currently studied to achieve an optimized cavity diameter of 4.7--5.2 angstrom. Acyclic ligands containing the same ligating atoms in equivalent functional entities were found to form a crystalline 1:1 uranyl-ligand complex (stability constant log K = 10.7) whose structure was established by X-ray data. This complex underwent a facile, DMSO-induced rearrangement to a 2:1 uranyl-ligand complex whose structure was also established by X-ray data. The intermediates to the macrocycles all behaved as excellent ligands for the complexation of transition metals. Acylthiourea complexes of copper and nickel as well as intermolecular, binuclear copper and nickel complexes of bidentate carbonyl thioureas formed readily and their structures were established in several representative instances by X-ray structural determinations. Tetradentate bis(carbonylthioureas) were found to be very efficient selective reagents for the complexation of copper in the presence of nickel ions. Several preorganized macrocycles were also prepared but in most instances these macrocycles underwent ring-opening under complexation conditions
Induction of mutants with higher protein content in soy bean
International Nuclear Information System (INIS)
Hiraiwa, S.; Tanaka, S.; Nakamura, S.
1976-01-01
Two experiments were carried out to examine the effects of ionizing radiation on protein content of soy beans and to estimate the potential value of ionizing radiation in soy bean breeding. In the first experiment seeds of three cultivars were acutely irradiated by gamma ray doses of 8 krad and 16 krad. Seeds of M 3 plants were analysed for protein content by the Biuret method. Selection within each variety was made to isolate plants having about 2% higher protein content than the control populations. In the second experiment growing plants of a soy bean cultivar were irradiated with 2.9 krad and 6.1 krad, from germination to maturation, in a 60 Co gamma field. Seeds on individual lines in M 5 , M 6 and M 7 plants were determined for their protein contents by the Kjeldahl method and the upper 10% of the treated lines were selected for progeny testing. From the results of the analysis of variance for each trait, significant differences were observed between the control variety and selected lines for all the traits. Six out of 19 lines showed significant increases in both 100 seed weight and protein content, and four lines promising. The mean protein content of selected lines increased 0.68% compared with the control variety. Genetic gain expected from selection for high protein content was therefore considered at about 1%; however, the likelihood of a large increase in protein content would greatly increase if large populations derived from irradiated seeds were observed
Influence of Handheld Mobiles on Parotid: A Cohort Study
Directory of Open Access Journals (Sweden)
Gracelin E Ranjitha
2017-01-01
Full Text Available Introduction: Mobile phones generate heat and radiofrequency radiation. The parotid gland is one potential target, because mobile phones are pressed against the side of the face where the gland is located. Aims and Objectives: To compare the effect of mobile phone radiation on parotid gland volume, systolic velocity, salivary flow rate, and protein concentration between the dominant and the nondominant side of mobile phone usage among heavy mobile phone users. Materials and Methods: Ultrasonography of the superior lobe of parotid was performed bilaterally to measure gland volume. Systolic velocity of the external carotid artery in gland was calculated bilaterally using color Doppler imaging. Saliva flow rate was measured bilaterally with modified Schrimer strip. Carlson-Crittenden device was used to collect 0.5 ml saliva sample from the duct and biuret assay was done to determine the protein concentration. Settings and Design: A cohort study was conducted with 50 undergraduate students of a dental college based on the inclusion and exclusion criteria. Statistical Analysis Used: Pearson correlation test was used to correlate and compare changes in the parameters of parotid gland and analyzed to a significant level of 0.05. Results: The volume, systolic velocity of blood flow of the external carotid artery, the salivary flow rate, and protein concentration of the parotid gland were significantly more by 11.9, 18, 23, and 8%, respectively, on the dominant side than the nondominant side of mobile phone usage. Conclusion: The study emphasized that prolonged mobile phone usage causes biological changes in parotid gland.
Protein profile of Chlamydophila abortus isolates from Kerala, India
Directory of Open Access Journals (Sweden)
Binu K Mani
Full Text Available Chlamydiae are of microbiological interest because of their mode of interaction with eukaryotic host cells and their specialized life cycle with unique features of parasitism. Reports regarding prevalence of infections of Chlamydophila abortus, the causative organism for chlamydial abortions in livestock, was the basis of the study. Two isolates, one each from cattle and goat abortion along with a reference isolate, were used for characterization with Sodium Dodecyl Sulphate-Poly Acrylamide Gel Electrophoresis (SDS-PAGE. Elementary bodies infected Mc Coy cells, harvested from bottle cultures were disrupted by Teflon coated magnetic pellet. Urografin-76 diluted with Tris-Potassium hydrochloride was used for purification of Elementary bodies of Chlamydophila abortus organism. On protein estimation of Elementary bodies by Biuret method, all the three isolates revealed protein concentration between 500-1000 mg/100ml, which were sufficient for electrophoresis. Ten percent of resolving gel and five percent of stacking gel of polyacrylamide in which 10g of processed isolate samples along with standard protein marker and Mc Coy cell protein (control were electrophoresed. Using Alpha Imager Gel Documentation System, the protein bands were analyzed. Twelve bands each for local bovine isolate and reference isolate were noticed while only 10 bands were there in the caprine isolate. Additional bands of 148 kDa and 135 kDa were present in bovine isolate, compared to the reference isolate, while 152 kDa and 137 kDa bands were unique for caprine isolate. [Vet. World 2011; 4(10.000: 470-472
Ultrasonic brain therapy: First trans-skull in vivo experiments on sheep using adaptive focusing
Pernot, Mathieu; Aubry, Jean-Francois; Tanter, Michael; Fink, Mathias; Boch, Anne-Laure; Kujas, Michèle
2004-05-01
A high-power prototype dedicated to trans-skull therapy has been tested in vivo on 20 sheep. The array is made of 200 high-power transducers working at 1-MHz central and is able to reach 260 bars at focus in water. An echographic array connected to a Philips HDI 1000 system has been inserted in the therapeutic array in order to perform real-time monitoring of the treatment. A complete craniotomy has been performed on half of the treated animal models in order to get a reference model. On the other animals, a minimally invasive surgery has been performed thanks to a time-reversal experiment: a hydrophone was inserted at the target inside the brain thanks to a 1-mm2 craniotomy. A time-reversal experiment was then conducted through the skull bone with the therapeutic array to treat the targeted point. For all the animals a specified region around the target was treated thanks to electronic beam steering. Animals were finally divided into three groups and sacrificed, respectively, 0, 1, and 2 weeks after treatment. Finally, histological examination confirmed tissue damage. These in vivo experiments highlight the strong potential of high-power time-reversal technology.
Refractive index modulation in the polyurethane films containing diazo sulfonamide chromophores
Energy Technology Data Exchange (ETDEWEB)
Ortyl, E. [Insitute of Organic and Polymer Technology, WrocIaw University of Technology, 50-384 WrocIaw (Poland); Kucharski, S. [Insitute of Organic and Polymer Technology, WrocIaw University of Technology, 50-384 WrocIaw (Poland)]. E-mail: stanislaw.kucharski@pwr.wroc.pl; Gotszalk, T. [Faculty of Microsystem Electronics and Photonics, WrocIaw University of Technology, 50-384 WrocIaw (Poland)
2005-05-23
The series of photochromic polyurethanes was obtained by modification of precursor polymers prepared from 4,4'-diphenylmethane diisocyanate (MDI), hexamethylene 1,6-diisocyanate (HDI) or toluene 2,4-diisocyanate (TDI) and N,N'-di-(2-hydroxyethyl) aniline. The precursor polymers were functionalized by an azo-coupling reaction to form the polymers with different degrees of functionalization and various heterocyclic sulfonamide groups. Ellipsometric measurements showed a decrease of the refractive index during illumination of thin polymer films with white light. The change of real part of the refractive index was in the range of 0.0033-0.0296 depending on the polymer kind and chromophore content. It was found that photocurrent was generated in the polymer films deposited onto indium tin oxide (ITO) glass plates. For the polyurethanes containing sulfathiazole groups in side chains the current density was up to 180 nA/cm{sup 2}. The formation of diffraction grating in the polymer films was easily achieved using linearly polarized laser light (532 nm) in a standard two beam coupling (TBC) system. The diffraction efficiency of the first diffraction beam was dependent on the chromophore content reaching ca. 12% for the derivatives of sulfamethoxazole.
Directory of Open Access Journals (Sweden)
Rong Zhu
2017-03-01
Full Text Available Abstract: In this study, we have fabricated a series of polycarbonate polyurethanes using a two-step bulk reaction by the melting pre-polymer solution-casting method in order to synthesize biomedical polyurethane elastomers with good mechanical behavior and biostability. The polyurethanes were prepared using dibutyltin dilaurate as the catalyst, poly(1,6-hexanediolcarbonate microdiols (PCDL as the soft segment, and the chain extender 1,4-butanediol (BDO and aliphatic 1,6-hexamethylene diisocyanate (HDI as the hard segments. The chemical structures and physical properties of the obtained films were characterized by attenuated total reflectance Fourier transform infrared (ATR-FTIR spectroscopy, gel permeation chromatography (GPC, differential scanning calorimeter (DSC, and mechanical property tests. The surface properties and degrees of microphase separation were further analyzed by water droplet contact angle measurements (CA and atomic force microscopy (AFM. The materials exhibited a moderate toxic effect on the tetrazolium (MTT assay and good hemocompatibility through hemolytic tests, indicating a good biocompatibility of the fabricated membranes. The materials could be considered as potential and beneficial suitable materials for tissue engineering, especially in the fields of artificial blood-contacting implants or other biomedical applications.
The Head-Disk Interface Roadmap to an Areal Density of Tbit/in2
Directory of Open Access Journals (Sweden)
Bruno Marchon
2013-01-01
Full Text Available This paper reviews the state of the head-disk interface (HDI technology, and more particularly the head-medium spacing (HMS, for today’s and future hard-disk drives. Current storage areal density on a disk surface is fast approaching the one terabit per square inch mark, although the compound annual growth rate has reduced considerably from ~100%/annum in the late 1990s to 20–30% today. This rate is now lower than the historical, Moore’s law equivalent of ~40%/annum. A necessary enabler to a high areal density is the HMS, or the distance from the bottom of the read sensor on the flying head to the top of the magnetic medium on the rotating disk. This paper describes the various components of the HMS and various scenarios and challenges on how to achieve a goal of 4.0–4.5 nm for the 4 Tbit/in2 density point. Special considerations will also be given to the implication of disruptive technologies such as sealing the drive in an inert atmosphere and novel recording schemes such as bit patterned media and heat assisted magnetic recording.
An analysis of corruption: the American continent versus Romania
Directory of Open Access Journals (Sweden)
Ileana NIȘULESCU-ASHRAFZADEH
2016-04-01
Full Text Available Corruption has become one of the most vicious mass phenomena, affecting, in most cases, the general wealth of the population. The paper closely surveys a set of measurable variables which have a very high impact over the dimensions of corruption as a phenomenon. Two of the aforementioned variables are part of a bureaucratic component, specific to the public system – the number of taxes, duties and contributions that an economic entity has to pay for the right to conduct business on the territory of a state, and the amount of time assigned for the payment of the duties for a year’s interval. The variable, generally called the taxation level, assumes an economic perspective over the phenomenon of corruption, which may be encouraged or, on the contrary, inhibited by the government’s fiscal strategy. The last component, called Human Development Index (HDI, assumes a social perspective over corruption, surveying the people’s behavior, which is also able to amplify or decrease the dimensions of corruption as a phenomenon. The whole scientific attempt is synthesized in the form of a corruption map, based on the estimated spread of the phenomenon for each surveyed country.
The limits of human development and the use of energy and natural resources
International Nuclear Information System (INIS)
Dias, Rubens A.; Mattos, Cristiano R.; Balestieri, Jose A.P.
2006-01-01
The development of nations is an unquestionable requirement. A lot of challenges concerning health, education and economy are present. A discussion on these development models has occupied the minds of decision makers in recent years. When energy supply and demand is considered, the situation becomes critical and the crucial question is: how to improve the quality of life of developing countries based on available models of development that are related to the life style of developed countries, for which the necessary use and waste of energy are present? How much energy is essential to humanity for not so as to endangering the survival conditions of future generations? The human development index (HDI) establishes the relationship among energy use, economic growth and social growth. Here it can be seen that 75% of the world population has a significant energy consumption potential. This is a strong reason to consider that the sustainable development concepts on energy policies are strategic to the future of the planet. This paper deals with the importance of seeking alternative development models for human development balance, natural resources conservation and environment through rational energy use concepts
Limited resources of genome sequencing in developing countries: Challenges and solutions
Directory of Open Access Journals (Sweden)
Mohamed Helmy
2016-06-01
Full Text Available The differences between countries in national income, growth, human development and many other factors are used to classify countries into developed and developing countries. There are several classification systems that use different sets of measures and criteria. The most common classifications are the United Nations (UN and the World Bank (WB systems. The UN classification system uses the UN Human Development Index (HDI, an indicator that uses statistic of life expectancy, education, and income per capita for countries' classification. While the WB system uses gross national income (GNI per capita that is calculated using the World Bank Atlas method. According to the UN and WB classification systems, there are 151 and 134 developing countries, respectively, with 89% overlap between the two systems. Developing countries have limited human development, and limited expenditure in education and research, among several other limitations. The biggest challenge facing genomic researchers and clinicians is limited resources. As a result, genomic tools, specifically genome sequencing technologies, which are rapidly becoming indispensable, are not widely available. In this report, we explore the current status of sequencing technologies in developing countries, describe the associated challenges and emphasize potential solutions.
Determinants of economic freedom of the Association of Southeast Asian Nation economic community
Directory of Open Access Journals (Sweden)
Karen Debbie C. Magallon
2016-01-01
Full Text Available One of the determinants of the well-being of people across the world is economic freedom. It is the freedom to choose the ways to produce, sell, and use your private resources, while respecting rights of the other to practice the same. The primordial intention of the study was to investigate the factors affecting economic freedom in the Association of Southeast Asian Nations (ASEAN Economic Community. Human Development Index (HDI, Corruption Perceptions Index (CPI and GDP per capita are dimensions considered to characterize the level of a country’s economic freedom. Trend performance of AEC in these indexes was also determined. The empirical estimate was based on a panel dataset covering 6 member-countries of the ASEAN Economic Community from 2001 to 2010. The model was estimated through Ordinary Least Squares (OLS multiple linear regression analysis. For the trend performance of the indexes, Singapore found to have a remarkable performance. The empirical result strongly suggests that CPI and GDP per capita foster economic freedom. For every 1% decrease in CPI would lead to an increase in economic freedom index by.121 % and for every 1% increase in GDP per capita, EFI will increase by .019%.
International Nuclear Information System (INIS)
Raff, L.M.; Suzukawa, H.H. Jr.; Thompson, D.L.
1975-01-01
Unadjusted quasiclassical trajectory computations have been carried out to simulate the molecular beam scattering of thermal D atom beams at 2800 degreeK crossed with beams of HCl and HI at 250 degreeK. Total reaction cross sections, energy partitioning distributions, and differential scattering cross sections have been computed for the exchange reactions D+HCl → DCl+H and D+HI → DI+H while total reaction cross sections are reported for the corresponding abstractions, i.e., D+HCl → HD+Cl and D+HI → HD+I. For the exchange reactions, the computed reaction cross sections are within the range estimated from the crossed beam experiments. The calculated average energy partitioned into relative translational motion of products is in near quantitative agreement with the beam results, and the predicted differential scattering cross sections appear to be in qualitative accord with the beam experiments. The over-all agreement between theory and experiment indicates that previously computed values for the thermal rate coefficients for the exchange reactions are of the right order and that a systematic error exists in the interpretation of photolysis data in the hydrogen--hydrogen halide systems
Directory of Open Access Journals (Sweden)
Danila Merino
2016-01-01
Full Text Available Se obtuvieron films PLA - Quitosano compatibilizados con diisocianato de hexametileno (HDI por el método de casting y posterior prensado. Los films fueron preparados con diferentes contenidos de quitosano (CS y a continuación se estudiaron sus propiedades fisicoquímicas, mediante espectroscopia infrarroja de Transformada de Fourier (FTIR, análisis termogravimétrico (TGA, calorimetría diferencial de barrido (DSC, microscopia óptica (MO y difracción de rayos X (DRX. Se encontró que el agente compatibilizante reacciona completamente y que el quitosano afecta las propiedades térmicas de los films disminuyendo sus temperaturas de descomposición, transición vítrea (T g y de fusión (T f e incrementando su cristalinidad. Desde el punt o de vista funcional, se estudiaron las propiedades antimicrobianas de cada uno de los films frente a la bacteria patógena Pseudomonas syringae pv tomato DC - 3000. E l aumento en el contenido de quitosano fue proporcional al efecto antimicrobiano permitiendo proyectar su potencial de aplicación en el campo agronómico.
Directory of Open Access Journals (Sweden)
Wei-Dong Li
Full Text Available The small abalone Haliotis diversicolor is an economically important mollusk that is widely cultivated in Southern China. Gonad precocity may affect the aquaculture of small abalone. Polyamines, which are small cationic molecules essential for cellular proliferation, may affect gonadal development. Ornithine decarboxylase (ODC and antizyme (AZ are essential elements of a feedback circuit that regulates cellular polyamines. This paper presents the molecular cloning and characterization of AZ from small abalone. Sequence analysis showed that the cDNA sequence of H. diversicolor AZ (HdiODCAZ consisted of two overlapping open reading frames (ORFs and conformed to the +1 frameshift property of the frame. Thin Layer chromatography (TLC analysis suggested that the expressed protein encoded by +1 ORF2 was the functional AZ that targets ODC to 26S proteasome degradation. The result demonstrated that the expression level of AZ was higher than that of ODC in the ovary of small abalone. In addition, the expression profiles of ODC and AZ at the different development stages of the ovary indicated that these two genes might be involved in the gonadal development of small abalone.
Directory of Open Access Journals (Sweden)
José Luis Mata-Mata
2008-06-01
Full Text Available Se sintetizaron y se evaluaron como agentes curtientes de pieles vacunas dos tipos de agentes de reticulación base poliuretano bloqueado. Se presentan los resultados de la síntesis de dispersiones acuosas de poliuretano bloqueado (DPU’s, basadas en prepolímeros a partir de la reacción de los diisocianatos alifáticos H12MDI (4,4’ metilenbis-ciclohexilisocianato y HDI (hexametilendiisocianato con polioles base poliéter óxido de etileno de peso molecular 1 y 2 KDa, en una relación molar isocianato/oxhidrilo (NCO/OH de 4:1 y 6:1 a 100 °C por 2 y 4 horas. En una segunda reacción, los grupos isocianato (NCO libres del prepolímero se bloquearon con una solución acuosa de NaHSO3 ó Na2S2O5 al 40%p/p. Los prepolímeros se caracterizaron mediante espectroscopia IR y RMN de ¹H. El tanto por ciento de isocianato libre en el prepolímero, así como el bloqueo de dichos grupos, se determinaron por espectroscopía IR. La evaluación de la capacidad curtiente de las DPU’s se determinó de acuerdo a la estabilidad térmica de la piel (temperatura de desnaturalización, mediante Calorimetría Diferencial de Barrido (DSC y a la determinación del índice de reticulación de las DPU’s con la colágena de la piel mediante un ensayo con ninhidrina.Two types of crosslinking agents blocked polyurethanes were synthesized and evaluated as tanning agents of bovine skins. The results of the synthesis of aqueous dispersions of blocked polyurethane (DPU’s are presented. They were based on prepolymers from the reaction of the aliphatic diisocyanates H12MDI 4,4’-methylenebis(cyclohexyl isocyanate and HDI (hexamethylene diisocyanate with HO-polyols such as polyethylene oxide of molecular weight 1 and 2 kDa. The molar NCO/OH ratio was fixed in 4:1 or 6:1, at 100 °C and 2 or 4 hours for the reaction time. In a second reaction, the prepolymer containing terminal NCO groups were blocked by reaction with an aqueous NaHSO3 or Na2S2O5 solution to 40% w/w. The
McCoy, Dana Charles; Peet, Evan D; Ezzati, Majid; Danaei, Goodarz; Black, Maureen M; Sudfeld, Christopher R; Fawzi, Wafaie; Fink, Günther
2016-06-01
The development of cognitive and socioemotional skills early in life influences later health and well-being. Existing estimates of unmet developmental potential in low- and middle-income countries (LMICs) are based on either measures of physical growth or proxy measures such as poverty. In this paper we aim to directly estimate the number of children in LMICs who would be reported by their caregivers to show low cognitive and/or socioemotional development. The present paper uses Early Childhood Development Index (ECDI) data collected between 2005 and 2015 from 99,222 3- and 4-y-old children living in 35 LMICs as part of the Multiple Indicator Cluster Survey (MICS) and Demographic and Health Surveys (DHS) programs. First, we estimate the prevalence of low cognitive and/or socioemotional ECDI scores within our MICS/DHS sample. Next, we test a series of ordinary least squares regression models predicting low ECDI scores across our MICS/DHS sample countries based on country-level data from the Human Development Index (HDI) and the Nutrition Impact Model Study. We use cross-validation to select the model with the best predictive validity. We then apply this model to all LMICs to generate country-level estimates of the prevalence of low ECDI scores globally, as well as confidence intervals around these estimates. In the pooled MICS and DHS sample, 14.6% of children had low ECDI scores in the cognitive domain, 26.2% had low socioemotional scores, and 36.8% performed poorly in either or both domains. Country-level prevalence of low cognitive and/or socioemotional scores on the ECDI was best represented by a model using the HDI as a predictor. Applying this model to all LMICs, we estimate that 80.8 million children ages 3 and 4 y (95% CI 48.1 million, 113.6 million) in LMICs experienced low cognitive and/or socioemotional development in 2010, with the largest number of affected children in sub-Saharan Africa (29.4.1 million; 43.8% of children ages 3 and 4 y), followed by
Directory of Open Access Journals (Sweden)
Dana Charles McCoy
2016-06-01
Full Text Available The development of cognitive and socioemotional skills early in life influences later health and well-being. Existing estimates of unmet developmental potential in low- and middle-income countries (LMICs are based on either measures of physical growth or proxy measures such as poverty. In this paper we aim to directly estimate the number of children in LMICs who would be reported by their caregivers to show low cognitive and/or socioemotional development.The present paper uses Early Childhood Development Index (ECDI data collected between 2005 and 2015 from 99,222 3- and 4-y-old children living in 35 LMICs as part of the Multiple Indicator Cluster Survey (MICS and Demographic and Health Surveys (DHS programs. First, we estimate the prevalence of low cognitive and/or socioemotional ECDI scores within our MICS/DHS sample. Next, we test a series of ordinary least squares regression models predicting low ECDI scores across our MICS/DHS sample countries based on country-level data from the Human Development Index (HDI and the Nutrition Impact Model Study. We use cross-validation to select the model with the best predictive validity. We then apply this model to all LMICs to generate country-level estimates of the prevalence of low ECDI scores globally, as well as confidence intervals around these estimates. In the pooled MICS and DHS sample, 14.6% of children had low ECDI scores in the cognitive domain, 26.2% had low socioemotional scores, and 36.8% performed poorly in either or both domains. Country-level prevalence of low cognitive and/or socioemotional scores on the ECDI was best represented by a model using the HDI as a predictor. Applying this model to all LMICs, we estimate that 80.8 million children ages 3 and 4 y (95% CI 48.1 million, 113.6 million in LMICs experienced low cognitive and/or socioemotional development in 2010, with the largest number of affected children in sub-Saharan Africa (29.4.1 million; 43.8% of children ages 3 and 4 y
Landslide risk reduction strategies: an inventory for the Global South
Maes, Jan; Kervyn, Matthieu; Vranken, Liesbet; Dewitte, Olivier; Vanmaercke, Matthias; Mertens, Kewan; Jacobs, Liesbet; Poesen, Jean
2015-04-01
Landslides constitute a serious problem globally. Moreover, landslide impact remains underestimated especially in the Global South. It is precisely there where the largest impact is experienced. An overview of measures taken to reduce risk of landslides in the Global South is however still lacking. Because in many countries of the Global South disaster risk reduction (DRR) is at an emerging stage, it is crucial to monitor the ongoing efforts (e.g. discussions on the Post-2015 Framework for DRR). The first objective of this study is to make an inventory of techniques and strategies that are applied to reduce risk from landslides in tropical countries. The second objective is to investigate what are the main bottlenecks for implementation of DRR strategies. In order to achieve these objectives, a review of both scientific and grey literature was conducted, supplemented with expert knowledge. The compilation of recommended and implemented DRR measures from landslide-prone tropical countries is based on an adapted classification proposed by the SafeLand project. According to Vaciago (2013), landslide risk can be reduced by either reducing the hazard, the vulnerability, the number or value of elements at risk or by sharing the residual risk. In addition, these measures can be combined with education and/or awareness raising and are influenced by governance structures and cultural beliefs. Global landslide datasets have been used to identify landslide-prone countries, augmented with region-specific datasets. Countries located in the tropics were selected in order to include landslide-prone countries with a different Human Development Index (HDI) but with a similar climate. Preliminary results support the statement made by Anderson (2013) that although the importance of shifting from post-disaster emergency actions to pre-disaster mitigation is acknowledged, in practice this paradigm shift seems rather limited. It is expected that this is especially the case in countries
Directory of Open Access Journals (Sweden)
I. Parreira
2008-05-01
Full Text Available New teaching methodologies have been developed to facilitate the learning of biochemistry concepts. A new approach to Biochemistry teaching has become more frequent, one that does not require reagents but use photos, videos, softwares etc. Experimental Biochemistry classes, i.e. covering characterization of amino acids and proteins, might be more productive with the use of complementary didactic material. Furthermore, if experiments cannot be implemented, classes may be well illustrated with complementary didactic material covering from the simplest to the most complex experiments. In order to aid Biochemistry classes without practical experiments, some tests and reactions were documented in our laboratory through digital photos, for instance: (1 the biuret reaction wherein the blue reagent turns violet in the presence of proteins and changes to pink when combined with short-chain polypeptides; (2 the ninhydrin test used in amino acid analysis of proteins: most of the amino acids are hydrolyzed and react with ninhydrin; when reacting with these free amines, a deep blue or purple color appears; (3 methods for detecting proteins wherein spectrophotometry is used, that deals with the relationship between absorbance, concentration and path length, which constitute the Beer-Lambert Law. A didactic material constituted by texts, schemes and illustrated by photos has been created for each class topic. This material can be used either as a teacher script or in a presentation form to illustrate classes without experimental activities. Financial Support: Pro-Reitoria Graduação-USP, CNPq.
Mesospheric gravity wave momentum flux estimation using hybrid Doppler interferometry
Directory of Open Access Journals (Sweden)
A. J. Spargo
2017-06-01
Full Text Available Mesospheric gravity wave (GW momentum flux estimates using data from multibeam Buckland Park MF radar (34.6° S, 138.5° E experiments (conducted from July 1997 to June 1998 are presented. On transmission, five Doppler beams were symmetrically steered about the zenith (one zenith beam and four off-zenith beams in the cardinal directions. The received beams were analysed with hybrid Doppler interferometry (HDI (Holdsworth and Reid, 1998, principally to determine the radial velocities of the effective scattering centres illuminated by the radar. The methodology of Thorsen et al. (1997, later re-introduced by Hocking (2005 and since extensively applied to meteor radar returns, was used to estimate components of Reynolds stress due to propagating GWs and/or turbulence in the radar resolution volume. Physically reasonable momentum flux estimates are derived from the Reynolds stress components, which are also verified using a simple radar model incorporating GW-induced wind perturbations. On the basis of these results, we recommend the intercomparison of momentum flux estimates between co-located meteor radars and vertical-beam interferometric MF radars. It is envisaged that such intercomparisons will assist with the clarification of recent concerns (e.g. Vincent et al., 2010 of the accuracy of the meteor radar technique.
Nature's role in sustaining economic development.
Dasgupta, Partha
2010-01-12
In this paper, I formalize the idea of sustainable development in terms of intergenerational well-being. I then sketch an argument that has recently been put forward formally to demonstrate that intergenerational well-being increases over time if and only if a comprehensive measure of wealth per capita increases. The measure of wealth includes not only manufactured capital, knowledge and human capital (education and health), but also natural capital (e.g. ecosystems). I show that a country's comprehensive wealth per capita can decline even while gross domestic product (GDP) per capita increases and the UN Human Development Index records an improvement. I then use some rough and ready data from the world's poorest countries and regions to show that during the period 1970-2000 wealth per capita declined in South Asia and sub-Saharan Africa, even though the Human Development Index (HDI) showed an improvement everywhere and GDP per capita increased in all places (except in sub-Saharan Africa, where there was a slight decline). I conclude that, as none of the development indicators currently in use is able to reveal whether development has been, or is expected to be, sustainable, national statistical offices and international organizations should now routinely estimate the (comprehensive) wealth of nations.
Directory of Open Access Journals (Sweden)
Josip Vincelj
2015-08-01
Full Text Available Aim To evaluate the usefulness of echocardiography in the diagnosis of complete rupture of papillary muscle. Methods Transthoracic (TTE and transesophageal echocardiography (TEE was performed with the ATL 3000 HDI Ultrasound Inc (Bothell, WA, USA with a 2.5 MHz transducer and 5-7 MHz multiplane phased array transducer. We are reporting about two patients (a 45 and a 51-year old male with complete ruptures of papillary muscle following acute myocardial infarction (AMI. Results Both patients were previously treated with fibrinolysis in their local hospitals, 400 and 300 km, respectively, away from our hospital. Massive mitral regurgitation developed in both followed by rapid deterioration of hemodynamic state and severe heart failure, because of which both were transferred by helicopter to the Coronary Care Unit of our clinic. The diagnosis of complete papillary muscle rupture was confirmed in both patients by TTE and TEE. Due to the significant deterioration in their hemodynamic state, vasoactive drugs and intra-aortic balloon pump support were applied. Both patients then underwent mitral valve replacement, accompanied by concomitant coronary artery bypass grafting in one case. Conclusion Transesophageal echocardiography is a more accurate and rapid diagnostic method in patients with mechanical complications of AMI than TTE.
Sustainability and strategic competitive advantage: an exploratory and bibliometric study
Directory of Open Access Journals (Sweden)
Pedrita Dantas Gabriele
2012-08-01
Full Text Available This study aims to conduct a bibliometric analysis to understand the state of the art of academic research that relates to sustainability strategy and competitive advantage. For this, the article seeks to identify what is produced, released and knowledge generated by the scientific community related to the subject, and analyzing key trends, through a quantitative analysis of the evolution of scientific literature on the themes, vehicles publishing, centers research, leading researchers and research networks. Initially we constructed a tree of keywords in order to quest the search engines and publications on the subject and later, do the processing and analysis software with the support of EndNote ®, RefViz ® and Excel ®.Through research, we found that there was a recent increase of publications on the subject of this article, especially since 2000, and the areas of science that most published on the subject are represented by the Triple Bottom Line (environmental, social and economic, pointing out that sustainability is currently having a bias much more proactive instead of reactive. Furthermore, it was also possible to identify countries that have the highest rate of development, like the HDI and GINI index, are the pioneers in publishing this issue.
Polyurethane coating from prepolymers and Crambe oil polyesters in oxygenates and green solvents
International Nuclear Information System (INIS)
Pinto, Elaine R.P.; Messaddeq, Younes; Polito, Wagner Luiz; Matinelli, Marcia
2015-01-01
The PU coatings are extremely used in areas that require high-performance. For several applications PU resin, the solvent base is commonly used, the problem is the solvents with high content of volatile organic compounds (VCO) like: toluene, xylene, benzene, etc.. In this work, we were synthesized and characterized four kinds of prepolymers with low-VCO from renewable sources such as castor oil and crambe oil with oxygenate and green solvents. The PU prepolymers had been synthesized in the proportions NCO/OH 2:1 and 3:1. The curing process was carried out with atmospheric moisture in the films. Characterization was made from prepolymers, oligomers and polyesters and PU films by FTIR, TGA / DTA, NMR, GPC and GC-FID, besides this the coatings were applied on aluminum and glass plates and, subjected to analysis chamber saline, hardness and adhesion. The results indicated that the reaction occurred between the prepolymers with oligomers or polyesters, because disappearance of the NCO band at 2270 cm"-"1. The PU films showed good thermal stability (> 270 °C), high tensile strength and deformation. Surround the formulations, the PU films with HDI prepolymers showed the best results with polyesters from crambe oil (PEC 02 and PEC 03). (author)
Use of Poisson spatiotemporal regression models for the Brazilian Amazon Forest: malaria count data
Directory of Open Access Journals (Sweden)
Jorge Alberto Achcar
2011-12-01
Full Text Available INTRODUCTION: Malaria is a serious problem in the Brazilian Amazon region, and the detection of possible risk factors could be of great interest for public health authorities. The objective of this article was to investigate the association between environmental variables and the yearly registers of malaria in the Amazon region using Bayesian spatiotemporal methods. METHODS: We used Poisson spatiotemporal regression models to analyze the Brazilian Amazon forest malaria count for the period from 1999 to 2008. In this study, we included some covariates that could be important in the yearly prediction of malaria, such as deforestation rate. We obtained the inferences using a Bayesian approach and Markov Chain Monte Carlo (MCMC methods to simulate samples for the joint posterior distribution of interest. The discrimination of different models was also discussed. RESULTS: The model proposed here suggests that deforestation rate, the number of inhabitants per km², and the human development index (HDI are important in the prediction of malaria cases. CONCLUSIONS: It is possible to conclude that human development, population growth, deforestation, and their associated ecological alterations are conducive to increasing malaria risk. We conclude that the use of Poisson regression models that capture the spatial and temporal effects under the Bayesian paradigm is a good strategy for modeling malaria counts.
Use of Poisson spatiotemporal regression models for the Brazilian Amazon Forest: malaria count data.
Achcar, Jorge Alberto; Martinez, Edson Zangiacomi; Souza, Aparecida Doniseti Pires de; Tachibana, Vilma Mayumi; Flores, Edilson Ferreira
2011-01-01
Malaria is a serious problem in the Brazilian Amazon region, and the detection of possible risk factors could be of great interest for public health authorities. The objective of this article was to investigate the association between environmental variables and the yearly registers of malaria in the Amazon region using bayesian spatiotemporal methods. We used Poisson spatiotemporal regression models to analyze the Brazilian Amazon forest malaria count for the period from 1999 to 2008. In this study, we included some covariates that could be important in the yearly prediction of malaria, such as deforestation rate. We obtained the inferences using a bayesian approach and Markov Chain Monte Carlo (MCMC) methods to simulate samples for the joint posterior distribution of interest. The discrimination of different models was also discussed. The model proposed here suggests that deforestation rate, the number of inhabitants per km², and the human development index (HDI) are important in the prediction of malaria cases. It is possible to conclude that human development, population growth, deforestation, and their associated ecological alterations are conducive to increasing malaria risk. We conclude that the use of Poisson regression models that capture the spatial and temporal effects under the bayesian paradigm is a good strategy for modeling malaria counts.
SOCIO-TERRITORIAL CAPITAL AND DEVELOPMENT INDICATORS: A COMPARATIVE STUDY IN BRAZIL
Directory of Open Access Journals (Sweden)
Sylvio Bandeira de Mello e Silva
2017-07-01
Full Text Available This paper analyzes, based on data from 2010, the social organization in Brazil, measured by the distribution of Private Foundations and Non-Profit Associations (FASFIL, comparing them with the main socioeconomic indicators. The concept of socio-territorial capital is adopted, based on the notion of social capital (PUTNAM, 1996. This concept values the territorial networking, the bonds of cohesion and cooperation and the territorial rooting, that is, the interaction in different sectors and scales. An analysis is made for the relation between by FASFIL and GDP per capita for the Major Regions and for the Federation Units. The results confirm regional imbalances and interstate imbalances, that is, where there is more FASFIL income is higher. The analysis is also done for the main metropolitan regions and for the metropolises, now involving, in addition to GDP per capita, seven socioeconomic indicators (HDI, Gini index, Life expectancy at birth, Infant mortality, Persons with complete upper level, Percentage of vulnerable to poverty and Formalization of the employed. The results are more expressive than in the scale of the Federation Units, especially at the level of the metropolises, that is, they express more prominently the relation between FASFIL and socio territorial capital.
Mesospheric gravity wave momentum flux estimation using hybrid Doppler interferometry
Spargo, Andrew J.; Reid, Iain M.; MacKinnon, Andrew D.; Holdsworth, David A.
2017-06-01
Mesospheric gravity wave (GW) momentum flux estimates using data from multibeam Buckland Park MF radar (34.6° S, 138.5° E) experiments (conducted from July 1997 to June 1998) are presented. On transmission, five Doppler beams were symmetrically steered about the zenith (one zenith beam and four off-zenith beams in the cardinal directions). The received beams were analysed with hybrid Doppler interferometry (HDI) (Holdsworth and Reid, 1998), principally to determine the radial velocities of the effective scattering centres illuminated by the radar. The methodology of Thorsen et al. (1997), later re-introduced by Hocking (2005) and since extensively applied to meteor radar returns, was used to estimate components of Reynolds stress due to propagating GWs and/or turbulence in the radar resolution volume. Physically reasonable momentum flux estimates are derived from the Reynolds stress components, which are also verified using a simple radar model incorporating GW-induced wind perturbations. On the basis of these results, we recommend the intercomparison of momentum flux estimates between co-located meteor radars and vertical-beam interferometric MF radars. It is envisaged that such intercomparisons will assist with the clarification of recent concerns (e.g. Vincent et al., 2010) of the accuracy of the meteor radar technique.
Energy Technology Data Exchange (ETDEWEB)
NONE
1999-03-01
The effort aims to prepare the base of a next-generation ultrahigh density HDD (hard disk drive) industry in the Tohoku district. The contact head was modeled as a cantilever beam and a head disk linkage impact model for analysis was built for the elucidation of the effects of various factors. A microactuator using a PZT (piezoelectric transducer) thin film was evaluated concerning the constitution of its elements, and durability. Materials design guidelines were indicated concerning the moderation and suppression of thermomagnetism in the ultrahigh density magnetic recording medium. A grain diameter of less than 10nm was found necessary for a decrease in the interaction between magnetic crystal grains for the achievement of a reduction in noise, and a material was produced that met the condition. An appropriate abrasive was chosen for superfine surface processing. Attention was paid to the chemical loss of lubricating oil to cause lethal destruction of HDI (hard disk interface) and , after evaluating hard film and frictional conditions, it was found that a hard layer and soft layer were required to complete an effective lubricant film. A ferroelectric body and a shape memory alloy were combined into a composite lamination and crystal orientation therein was controlled, and the lamination showed its feasibility as a thin film actuator. (NEDO)
Electricity privatizations in Sahel: A U-turn?
International Nuclear Information System (INIS)
Gualberti, Giorgio; Alves, Luis; Micangeli, Andrea; Graca Carvalho, Maria da
2009-01-01
This paper examines the process of privatization of electrical utilities for the country members of CILLS (Burkina Faso, Cape Verde, The Gambia, Guinea-Bissau, Mali, Mauritania, Niger, Chad and Senegal). These Sahelian countries, the majority of whom rank at the bottom positions of the HDI and present extremely low access rates to modern energy services, together started a process of energy sector reform and energy utility privatization in the 1990s. The reforms, endorsed by the International Financial Institutions, focused on the privatization of the electrical utilities, and encountered many difficulties. The objective of this article is to analyze what happened in each of these nine countries and to understand the reasons that led to a general halt or reversal of the process. The analysis is first introduced by a brief examination of regional energy situations and of the international context in which the reforms took place; this includes the policy guidelines introduced by the IFIs and the investment decisions of energy corporations. We analyze management processes and ownership changes for each country. Finally, the article identifies the problems encountered as a result of reform design and the interaction of behaviors between the governments, the International Corporations and the IFIs; lastly, we draw conclusions.
Kornhuber, Kai; Reusser, Dominik E.; Costa, Luis; Kropp, Jürgen P.; Rybski, Diego
2015-04-01
Pollution may increase with the income per capita up to a maximum, above which it decreases with the further increase in income per capita, i.e. following an inverse U-shape in the pollution vs. income per capita. Such a behaviour is called the Environmental Kuznets Curves (EKC). In a previous presentation, we reviewed EKC for CO2 exploring its relation between CO2 per capita and the Human Development Index (HDI) between 1990 and 2013. We find evidence for a reduction in CO2 emissions per capita in highly developed countries. We present an updated model according to which the emissions per capita of a country are composed of a component related to the actual state of development and a component related to the change of development. The model leads to four distinct cases of which two have EKC shape and two imply saturation. This outcome is in line with previously suggested qualitative relations. Based on the past trend in parameters of the less extreme version of the EKC curve, we formulate a scenario for the future and contrast it against the RCP scenarios. We find that the mechanisms behind the EKC are unlikely to be sufficient to limit global warming below the 2°C target.
Energy Technology Data Exchange (ETDEWEB)
Pinto, Elaine R.P.; Messaddeq, Younes, E-mail: elainerpp@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (IQ/UNESP), Araraquara, SP (Brazil). Instituto de Quimica; Polito, Wagner Luiz [Universidade de Sao Paulo (IQ/USP), Sao Carlos, SP (Brazil). Instituto de Quimica; Matinelli, Marcia [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Instituto de Quimica
2015-07-01
The PU coatings are extremely used in areas that require high-performance. For several applications PU resin, the solvent base is commonly used, the problem is the solvents with high content of volatile organic compounds (VCO) like: toluene, xylene, benzene, etc.. In this work, we were synthesized and characterized four kinds of prepolymers with low-VCO from renewable sources such as castor oil and crambe oil with oxygenate and green solvents. The PU prepolymers had been synthesized in the proportions NCO/OH 2:1 and 3:1. The curing process was carried out with atmospheric moisture in the films. Characterization was made from prepolymers, oligomers and polyesters and PU films by FTIR, TGA / DTA, NMR, GPC and GC-FID, besides this the coatings were applied on aluminum and glass plates and, subjected to analysis chamber saline, hardness and adhesion. The results indicated that the reaction occurred between the prepolymers with oligomers or polyesters, because disappearance of the NCO band at 2270 cm{sup -1}. The PU films showed good thermal stability (> 270 °C), high tensile strength and deformation. Surround the formulations, the PU films with HDI prepolymers showed the best results with polyesters from crambe oil (PEC 02 and PEC 03). (author)
Xiong, Shaomin
The magnetic storage areal density keeps increasing every year, and magnetic recording-based hard disk drives provide a very cheap and effective solution to the ever increasing demand for data storage. Heat assisted magnetic recording (HAMR) and bit patterned media have been proposed to increase the magnetic storage density beyond 1 Tb/in2. In HAMR systems, high magnetic anisotropy materials are recommended to break the superparamagnetic limit for further scaling down the size of magnetic bits. However, the current magnetic transducers are not able to generate strong enough field to switch the magnetic orientations of the high magnetic anisotropy material so the data writing is not able to be achieved. So thermal heating has to be applied to reduce the coercivity for the magnetic writing. To provide the heating, a laser is focused using a near field transducer (NFT) to locally heat a ~(25 nm)2 spot on the magnetic disk to the Curie temperature, which is ~ 400 C-600°C, to assist in the data writing process. But this high temperature working condition is a great challenge for the traditional head-disk interface (HDI). The disk lubricant can be depleted by evaporation or decomposition. The protective carbon overcoat can be graphitized or oxidized. The surface quality, such as its roughness, can be changed as well. The NFT structure is also vulnerable to degradation under the large number of thermal load cycles. The changes of the HDI under the thermal conditions could significantly reduce the robustness and reliability of the HAMR products. In bit patterned media systems, instead of using the continuous magnetic granular material, physically isolated magnetic islands are used to store data. The size of the magnetic islands should be about or less than 25 nm in order to achieve the storage areal density beyond 1 Tb/in2. However, the manufacture of the patterned media disks is a great challenge for the current optical lithography technology. Alternative lithography
Sankar Boxi, Siddhartha; Mukherjee, Khushi; Paria, Santanu
2016-02-01
Chemical-based pesticides are widely used in agriculture to protect crops from insect infestation and diseases. However, the excessive use of highly toxic pesticides causes several human health (neurological, tumor, cancer) and environmental problems. Therefore nanoparticle-based green pesticides have become of special importance in recent years. The antifungal activities of pure and Ag doped (solid and hollow) TiO2 nanoparticles are studied against two potent phytopathogens, Fusarium solani (which causes Fusarium wilt disease in potato, tomato, etc) and Venturia inaequalis (which causes apple scab disease) and it is found that hollow nanoparticles are more effective than the other two. The antifungal activities of the nanoparticles were further enhanced against these two phytopathogens under visible light exposure. The fungicidal effect of the nanoparticles depends on different parameters, such as particle concentration and the intensity of visible light. The minimum inhibitory dose of the nanoparticles for V. inaequalis and F. solani are 0.75 and 0.43 mg/plate. The presence of Ag as a dopant helps in the formation of stable Ag-S and disulfide bonds (R-S-S-R) in cellular protein, which leads to cell damage. During photocatalysis generated •OH radicals loosen the cell wall structure and this finally leads to cell death. The mechanisms of the fungicidal effect of nanoparticles against these two phytopathogens are supported by biuret and triphenyl tetrazolium chloride analyses and field emission electron microscopy. Apart from the fungicidal effect, at a very low dose (0.015 mg/plate) the nanoparticles are successful in arresting production of toxic napthoquinone pigment for F. solani which is related to the fungal pathogenecity. The nanoparticles are found to be effective in protecting potatoes affected by F. solani or other fungi from spoiling.
Directory of Open Access Journals (Sweden)
R.C.A. Mesquita
1997-07-01
Full Text Available Cirrhotic patients (23 with alcoholic cirrhosis, 5 with posthepatitic cirrhosis and 2 with cryptogenic cirrhosis with ascites and portal hypertension were studied and divided into two groups corresponding to high or low risk to develop spontaneous bacterial peritonitis (SBP related to the concentration of total protein in the ascitic fluid (A-TP: group I (high risk: A-TP£1.5 g/dl and group II (low risk: A-TP>1.5 g/dl. Fibronectin (FN, C3 and C4 concentrations were measured by radial immunodiffusion while total protein was measured by the biuret method. The mean values (group I vs group II of C3 (12.59 ± 4.72 vs 24.53 ± 15.58 mg/dl, C4 (4.26 ± 3.87 vs 7.26 ± 4.14 mg/dl and FN (50.47 ± 12.49 vs 75.89 ± 24.70 mg/dl in the ascitic fluid were significantly lower (P<0.05 in the group considered to be at high risk for SBP. No significant difference was observed in the plasma/ascites fibronectin ratio (3.91 ± 1.21 vs 3.80 ± 1.26 or gradient (131.46 ± 64.01 vs 196.96 ± 57.38 between groups. Fibronectin in ascites was significantly correlated to C3 (r = 0.76, C4 (r = 0.58, total protein (r = 0.73 and plasma FN (r = 0.58 (P<0.05. The data suggest that the FN concentration in ascites is related to the opsonic capacity of this fluid, and that its concentration in the ascitic fluid may be a biochemical risk factor indicator for the development of spontaneous bacterial peritonitis
The Influence of Tobacco Smoke on Protein and Metal Levels in the Serum of Women during Pregnancy.
Directory of Open Access Journals (Sweden)
Marta Wrześniak
Full Text Available Tobacco smoking by pregnant women has a negative effect on fetal development and increases pregnancy risk by changing the oxidative balance and microelements level. Smoking affects the concentration, structure and function of proteins, potentially leading to various negative effects on pregnancy outcomes.The influence of tobacco smoke on key protein fractions in smoking and non-smoking healthy pregnant women was determined by capillary electrophoresis (CE. Concentrations of the proteins α1-antitrypsin, α1-acid glycoprotein, α2-macroglobulin and transferrin were determined by ELISA tests. Total protein concentration was measured by the Biuret method. Smoking status was established by cotinine levels. Cadmium (Cd and Zinc (Zn concentrations were determined by flame atomic absorption spectrometry and the Zn/Cd ratio was calculated based on these numbers. Smoking women had a 3.7 times higher level of Cd than non-smoking women. Zn levels decreased during pregnancy for all women. The Zn/Cd ratio was three times lower in smoking women. The differences between the changes in the protein profile for smoking and non-smoking women were noted. Regarding proteins, α1-antitrypsin and α2-macroglobulin levels were lower in the non-smoking group than in the smoking group and correlated with Cd levels (r = -0.968, p = 0.032 for non-smokers; r = -0.835, p = 0.019 for smokers. Zn/Cd ratios correlated negatively with α1-, α2- and β-globulins.Exposure to tobacco smoke increases the concentration of Cd in the blood of pregnant women and may lead to an elevated risk of pregnancy disorders. During pregnancy alter concentrations of some proteins. The correlation of Cd with proteins suggests that it is one of the causes of protein aberrations.
Directory of Open Access Journals (Sweden)
Adriana Cristina Poli Miwa
2008-06-01
Full Text Available Esta pesquisa teve como objetivo principal comparar cinco métodos espectrofotométricos para determinação de proteínas em amostras provenientes de estações de tratamento de efluentes sanitários. O intuito foi definir uma metodologia de aplicação rápida, fácil e confiável para este tipo de amostra. As lagoas de estabilização, como sistemas de tratamento biológico, têm como principais constituintes proteínas, carboidratos e lipídeos, mas também apresentam muitos compostos interferentes, como por exemplo, uréia, detergentes e compostos fenólicos, que podem prejudicar a quantificação de tais parâmetros. Os métodos analisados foram Lowry, Biureto, Bradford e Ácido bicinconínico. O método de Lowry mostrou-se mais adequado às características da amostra, com boa reprodutibilidade, reagente específico, custo moderado e ausência de substancias interferentes.This research had as main objective to compare five spectrophotometric methods for protein determination in samples proceeding from sanitary effluent of treatment plant. Intention was to define a methodology that is of fast and easy and reliable application for this type of sample. The stabilization ponds, as systems of biological treatment, have as main constituent proteins, carbohydrates and lipids, but also they present many interfering composites, for example, phenolic urea, detergents and composites, that can harm the quantification of such parameters. The analyzed methods had been Lowry, Biuret, Bradford and Acid bicinconinic. The method of Lowry revealed more adequate to the characteristics of the sample, with good reproducibility, specific reagent, moderate cost and absence of interfering substance.
Abernethy, Grant A
2015-01-01
This paper proposes a mechanism to explain the trace levels of natural semicarbazide occasionally observed in foods. The analytical derivative of semicarbazide, 2-nitrobenzaldehyde semicarbazone, is often measured as a metabolite marker to detect the widely banned antibiotic nitrofurazone. However, this marker is not specific as semicarbazide may be present in foods for several reasons other than exposure to nitrofurazone. In some cases, an entirely natural origin of semicarbazide is suspected, although up until now there was no explanation about how semicarbazide could occur naturally. In this work, semicarbazide is proposed as being generated from natural food compounds via an azine intermediate. Hydrazine, in the form of azines or hydrazones, may be generated in dilute aqueous solution from the natural food compounds ammonia, hydrogen peroxide and acetone, following known oxidation chemistry. When this mixture was prepared in the presence of ureas such as allantoin, urea, biuret or hydroxyurea, and then analysed by the standard method for the determination of semicarbazide, 2-nitrobenzaldehyde semicarbazone was detected. 2-Nitrobenzaldehyde aldazine was also found, and it may be a general marker for azines in foods. This proposal, that azine formation is central to semicarbazide development, provides a convergence of the published mechanisms for semicarbazide. The reaction starts with hydrogen peroxide, peracetic acid, atmospheric oxygen or hypochlorite; generates hydrazine either by an oxaziridine intermediate or via the chlorination of ammonia; and then either route may converge on azine formation, followed by reaction with a urea compound. Additionally, carbamate ion may speculatively generate semicarbazide by reaction with hydrazine, which might be a significant route in the case of the hypochlorite treatment of foods or food contact surfaces. Significantly, detection of 2-nitrobenzaldehyde semicarbazone may be somewhat artefactual because semicarbazide can
International Nuclear Information System (INIS)
Yeon, K.H.; Song, J.H.; Moon, S.H.
2002-01-01
CEDI is a hybrid separation system of electrodialysis and ion exchange processes. This system does not require chemicals to regenerate the ion exchange resin and to concentrate the wastewater. In a CEDI system, the ion exchange resin bed plays a major role in the reduction of the high electrical resistance in the dilute compartment, while the ion exchange membranes lead to depletion and concentration of the solutions in the dilute compartment and concentrate compartment, respectively. The production of high purity water in the primary coolant of a nuclear power plant was investigated using a CEDI process along with various ion-conducting spacers, such as an ion exchange resin (IX), polyurethane-coated ion exchange beads (IEPU), and an ion exchange textile (IET). The ion exchange resin was introduced into the ion-depleting compartments of an electrodialysis (ED) stack, and has been used to reduce the electrical resistance of the stack since ED cannot be applied economically to the treatment of dilute solutions due to their high electrical resistances and the development of the polarization phenomena. However, packing the resin beads in the compartment and assembling the stack is laborious work, while attaining a free flowing solution is difficult because the resin beads are driven downward by gravity in the diluted compartment. Nevertheless, a resin-packed ED stack has recently been developed by Millipore, and is now commercially available from U.S. Filter as industrial units. We set out to prepare improved ion-conducting materials suitable for use in CEDI stacks. To this end, IEPU was prepared using a blending method that produces mixtures of resin beads and powder by allophanate/biuret cross-linking. IET was prepared by the radiation grafting of styrene-fulfonic acid or trimethyl-ammonium chloride onto polypropylene non-woven fabric. (authors)
Directory of Open Access Journals (Sweden)
M Kandasamy
2016-01-01
Full Text Available Aim and Objective: The objective of this study is to estimate and compare the serum and salivary immunoglobulin G and A (IgG, IgA levels in various stages of oral submucous fibrosis (OSMF patients and relate it to total serum protein (TSP and hemoglobin (Hb levels. Materials and Methods: The sample for the present study comprised a total of 20 healthy controls, 20 OSMF patients. About 5 ml of blood and 2 ml of saliva were collected. Quantitative analysis of serum and salivary IgG, IgA was done by turbidometric immunoassay. TSP and Hb were estimated by Biuret and cyanmethemoglobin methods, respectively. Results: Serum and salivary IgA and IgG levels were statistically significantly increased (P < 0.001 in OSMF patients when compared to controls. Also serum and salivary IgG and IgA levels showed significantly increased (P < 0.01 in all the three staging of OSMF when compared to control group. Hb levels and TSP levels were significantly decreased (P < 0.001 in OSMF patients when compared to controls. One-way ANOVA, Pearson's correlation, and unpaired t -test were used for statistical analysis. Conclusion: The elevated levels of IgG and IgA are also in favor of polygammapathy, which are nonspecific and nondiagnostic objective reflections of an underlying disease. Decreased TSP is a result of host response and Hb, acts as an indicator of nutritional status plays an important role. It is also observed from the present study that the severity of OSMF was directly proportional to the estimated elevated levels of the major IgG and IgA. A need is also felt for the knowledge of immunoprofile estimation in etiology and pathogenesis that would prove a great asset in the proper assessment of this condition.
Kandasamy, M; Jaisanghar, N; Austin, Ravi David; Srivastava, Kumar Chandan; Anusuya, G Sai; Anisa, N
2016-10-01
The objective of this study is to estimate and compare the serum and salivary immunoglobulin G and A (IgG, IgA) levels in various stages of oral submucous fibrosis (OSMF) patients and relate it to total serum protein (TSP) and hemoglobin (Hb) levels. The sample for the present study comprised a total of 20 healthy controls, 20 OSMF patients. About 5 ml of blood and 2 ml of saliva were collected. Quantitative analysis of serum and salivary IgG, IgA was done by turbidometric immunoassay. TSP and Hb were estimated by Biuret and cyanmethemoglobin methods, respectively. Serum and salivary IgA and IgG levels were statistically significantly increased ( P < 0.001) in OSMF patients when compared to controls. Also serum and salivary IgG and IgA levels showed significantly increased ( P < 0.01) in all the three staging of OSMF when compared to control group. Hb levels and TSP levels were significantly decreased ( P < 0.001) in OSMF patients when compared to controls. One-way ANOVA, Pearson's correlation, and unpaired t -test were used for statistical analysis. The elevated levels of IgG and IgA are also in favor of polygammapathy, which are nonspecific and nondiagnostic objective reflections of an underlying disease. Decreased TSP is a result of host response and Hb, acts as an indicator of nutritional status plays an important role. It is also observed from the present study that the severity of OSMF was directly proportional to the estimated elevated levels of the major IgG and IgA. A need is also felt for the knowledge of immunoprofile estimation in etiology and pathogenesis that would prove a great asset in the proper assessment of this condition.
Directory of Open Access Journals (Sweden)
Diniyah Kholidah
2013-10-01
Full Text Available Background: Much effort has been made to counter the weaknesses of F100 through the development of milk powder substituted with ingredients that have a high content of protein and energy, high bioavailability and relatively low cost. Objective: To analyze an effect of F100 supplementation using substitute tempeh flour on protein status (total protein serum and serum albumin among undernourished pediatric patients. Method: Experimental research with randomized clinical control trial among 30 undernourished children consisting of open clinical trial in two experiment groups, supplemented with F100 or substitute F100 (isoenergetic and isoprotein diet within 14 days. The study was undertaken in April-August 2010 at pediatric inpatient room of Dr. Saiful Anwar Hospital Malang. Data of food intake were obtained through visual Comstock and 24-hour food recall; data of total serum protein through biuret method; serum albumin (Alb through cellulose acetate electrophoresis method. Data analysis was using Pearson Chi-Square test and unpaired t-test. Results: The result of unpaired t-test on the average intake of energy, protein, fat and carbohydrate showed there was no significant difference in each experimental groups (p>0.05. The test result of total serum protein level and serum Alb level showed there was no significant difference in each experiment (p=0.240 and p=0.774. The result of correlation coefficient test showed there was no significant association between intake of energy and nutrient and total serum level and serum Alb level (p>0.05 and degree of association showed a weak association (r>0.25. Conclusion: Formula of F100 substitute as complementary food could be used as an alternative food in diet therapy of malnourished children on rehabilitation phase.
Perrault, Justin R.; Wyneken, Jeanette; Page-Karjian, Annie; Merrill, Anita; Miller, Debra L.
2014-01-01
Serum protein concentrations provide insight into the nutritional and immune status of organisms. It has been suggested that some marine turtles are capital breeders that fast during the nesting season. In this study, we documented serum proteins in neophyte and remigrant nesting leatherback sea turtles (Dermochelys coriacea). This allowed us to establish trends across the nesting season to determine whether these physiological parameters indicate if leatherbacks forage or fast while on nesting grounds. Using the biuret method and agarose gel electrophoresis, total serum protein (median = 5.0 g/dl) and protein fractions were quantified and include pre-albumin (median = 0.0 g/dl), albumin (median = 1.81 g/dl), α1-globulin (median = 0.90 g/dl), α2-globulin (median = 0.74 g/dl), total α-globulin (median = 1.64 g/dl), β-globulin (median = 0.56 g/dl), γ-globulin (median = 0.81 g/dl) and total globulin (median = 3.12 g/dl). The albumin:globulin ratio (median = 0.59) was also calculated. Confidence intervals (90%) were used to establish reference intervals. Total protein, albumin and total globulin concentrations declined in successive nesting events. Protein fractions declined at less significant rates or remained relatively constant during the nesting season. Here, we show that leatherbacks are most likely fasting during the nesting season. A minimal threshold of total serum protein concentrations of around 3.5–4.5 g/dl may physiologically signal the end of the season's nesting for individual leatherbacks. The results presented here lend further insight into the interaction between reproduction, fasting and energy reserves and will potentially improve the conservation and management of this imperiled species. PMID:27293623
International Nuclear Information System (INIS)
Boxi, Siddhartha Sankar; Mukherjee, Khushi; Paria, Santanu
2016-01-01
Chemical-based pesticides are widely used in agriculture to protect crops from insect infestation and diseases. However, the excessive use of highly toxic pesticides causes several human health (neurological, tumor, cancer) and environmental problems. Therefore nanoparticle-based green pesticides have become of special importance in recent years. The antifungal activities of pure and Ag doped (solid and hollow) TiO 2 nanoparticles are studied against two potent phytopathogens, Fusarium solani (which causes Fusarium wilt disease in potato, tomato, etc) and Venturia inaequalis (which causes apple scab disease) and it is found that hollow nanoparticles are more effective than the other two. The antifungal activities of the nanoparticles were further enhanced against these two phytopathogens under visible light exposure. The fungicidal effect of the nanoparticles depends on different parameters, such as particle concentration and the intensity of visible light. The minimum inhibitory dose of the nanoparticles for V. inaequalis and F. solani are 0.75 and 0.43 mg/plate. The presence of Ag as a dopant helps in the formation of stable Ag–S and disulfide bonds (R–S–S–R) in cellular protein, which leads to cell damage. During photocatalysis generated • OH radicals loosen the cell wall structure and this finally leads to cell death. The mechanisms of the fungicidal effect of nanoparticles against these two phytopathogens are supported by biuret and triphenyl tetrazolium chloride analyses and field emission electron microscopy. Apart from the fungicidal effect, at a very low dose (0.015 mg/plate) the nanoparticles are successful in arresting production of toxic napthoquinone pigment for F. solani which is related to the fungal pathogenecity. The nanoparticles are found to be effective in protecting potatoes affected by F. solani or other fungi from spoiling. (paper)
Riond, Barbara; Wenger-Riggenbach, Bettina; Hofmann-Lehmann, Regina; Lutz, Hans
2009-03-01
Serum protein electrophoresis is a useful screening test in equine laboratory medicine. The method can provide valuable information about changes in the concentrations of albumin and alpha-, beta-, and gamma-globulins and thereby help characterize dysproteinemias in equine patients. Reference values for horses using agarose gel as a support medium have not been reported. The purpose of this study was to establish reference intervals for serum protein concentrations in adult horses using agarose gel electrophoresis and to assess differences between warm-blooded and heavy draught horses. In addition, the precision of electrophoresis for determining fraction percentages and the detection limit were determined. Blood samples were obtained from 126 clinically healthy horses, including 105 Thoroughbreds and 21 heavy draught horses of both sexes and ranging from 2 to 20 years of age. The total protein concentration was determined by an automated biuret method. Serum protein electrophoresis was performed using a semi-automated agarose gel electrophoresis system. Coefficients of variation (CVs) were calculated for within-run and within-assay precision. Data from warm-blooded and draught horses were compared using the Mann-Whitney U test. Within-run and within-assay CVs were draught horses and so combined reference intervals (2.5-97.5%) were calculated for total protein (51.0-72.0 g/L), albumin (29.6-38.5 g/L), alpha(1)-globulin (1.9-3.1 g/L), alpha(2)-globulin (5.3-8.7 g/L), beta(1)-globulin (2.8-7.3g/L), beta(2)-globulin (2.2-6.0 g/L), and gamma-globulin (5.8-12.7 g/L) concentrations, and albumin/globulin ratio (0.93-1.65). Using agarose gel as the supporting matrix for serum protein electrophoresis in horses resulted in excellent resolution and accurate results that facilitated standardization into 6 protein fractions.
Directory of Open Access Journals (Sweden)
Diana Comin
2016-11-01
Full Text Available O objetivo deste trabalho foi identificar a relação existente entre o índice de atendimento à Lei de Acesso à Informação dos municípios catarinenses e os seus indicadores socioeconômicos (população total, receita arrecadada, PIB e IDH-M. Trata-se de uma pesquisa descritiva, com abordagem quantitativa, cujo procedimento de coleta de dados é documental. Para a construção do índice de atendimento à Lei de Acesso à Informação, foi realizada busca e avaliação nos sítios eletrônicos dos 121 municípios de Santa Catarina que possuem população superior a dez mil habitantes, mediante a aplicação de um Check-list formulado com base nos artigos 5°, 8°, 9º, e 45 da lei. O nível de atendimento foi identificado como um conjunto de 19 indicadores. Para cada indicador atribuiu-se o valor de um ponto quando atendido, meio ponto quando atendido de forma parcial e nenhum ponto quando não atendido. Posteriormente ao cálculo dos percentuais de atendimento, observou-se que, até então, nenhum dos municípios atende a todas as exigências da Lei de Acesso à Informação, ficando a média geral de conformidade em 69,43%. Verificou-se também a existência de relação positiva do índice de atendimento apenas com a variável IDH-M. Demonstram os demais fatores socioeconômicos que os municípios menores têm divulgado maior número de informações voluntariamente. The objective of this study was to identify the relationship between the rate of compliance to the Access to Information Law of the municipalities of Santa Catarina and its socio-economic indicators (total population, revenue, GDP and HDI. It is a descriptive research with a quantitative approach, whose data collection procedure is documentary. In order to create the the rating level according to the requirements of the Information Access Law, it was necessary to search and evaluate the websites of 121 municipalities of Santa Catarina which a population of ten thousand
Directory of Open Access Journals (Sweden)
Régis Rathmann
2008-06-01
utilization of the regional agricultural vocation as well as the insertion of differentiated chains in local agribusiness. One of these experiences is the Program for the Development of Irrigated Fruit Culture in the Southern Half/RS. Within this context, this article has the objective of presenting the results observed in the GDP and HDI of two municipalities located in the Campanha Region of Rio Grande do Sul, and also to present the effects observed on the life quality of the producers after the implementation of fruit culture in their properties. Based on the data collected and the methodology chosen, it can be said that the productive diversification of rural properties contributes in the improvement of the producers' life quality, having positive effects on the per capita GDP and HDI of the municipalities studied.
Spatial exploration of the literacy intensity of Sundarban
Directory of Open Access Journals (Sweden)
Mondal Biraj Kanti
2015-01-01
Full Text Available The spatial variations of the literacy intensity of any regions reflect its educational standard and its diverse dimensions of development and Sundarban region of West Bengal is no exception. Education is probably the most important amongst the three elements of human development to quantify the Human Development Index (HDI for any region. Thus education holds the prime priority for development of all the region and Sundarban is no exception. The literacy level of Sundarban is not far ahead than other backward areas of West Bengal. In the present era of globalization, ‘Education for all’ has become the matter of human rights. Various developmental schemes of the Central and State Government, like Mid Day Meal (MDM, Sarva Sikhsha Aviyan (SSA etc. are able to make some positive loop and make a paradigm shift in the educational sector after crossing the first decades of the 21st century. The Sundarban region might be more developed than the present if its literacy echelon and educational sector improves much more. Proper education can make the inhabitants of the region more conscious and aware to do their betterment themselves as well as to save the biodiversity of the mangrove forest area of Sundarban. Thus an attempt has been made to portrait the spatial explorations and developmental scenario along with the regional disparities of the literacy status of Sundarban in the present paper.
Geometric Summary of the 9 Chip Ladder for the D0 Silicon Tracker
International Nuclear Information System (INIS)
Ratzmann, P.; Cooper, W.; Goloskie, D.; Kowalski, J.; Lipton, R.; Rapidis, P.; Serritella, C.
1997-01-01
Two hybrids types are required to accomodate the flipping of ladders within each bulkhead layer, in order to account for the pigtail routing. Left and right versions are shown below, following the definitions laid out by Mike Matulik. These drawings are not to proper scale in the sketches below. The dimensionally correct versions of the 9 chip hybrids are stored in DCS under drawing number 3823.112-MD-317803 for the lefthanded version, and 3823.112-MD-317804 for the right handed version. Handedness of the hybrids are designated as shown in the figures and table below. There are long and short versions of both the left and the right, for four total 9 chip hdi designs. The pigtail lengths of the long and short are shown in a table in the hybrid drawings which reside in DCS. The chamfer in the hybrid corners (N side) is placed in order to enable the hybrid to be glued to the beryllium substrate, whereas the rectangular cuttout on the same side is to allow direct gluing of a temperature sensor to the substrate metal. The oblong shape on the N side of both hybrids is a 'stay-clear' region (defined in the final drawings) where pressure will be applied to the hybrid during the second stage of ladder construction.
Ultrasonographic analysis in vitro of parietal thickness of lower limb varicose veins.
Bruschi, E; Como, G; Zuiani, C; Segatto, E; Rocco, M; Biasi, G; Bazzocchi, M
2006-09-01
The aim of this study was to evaluate the ability of ultrasound (US) to measure the parietal thickness of varicose veins. In a blind in vitro analysis, 28 great saphenous veins, obtained after stripping surgery from 28 patients with chronic venous insufficiency, were examined with a digital US scanner ATL-HDI5000, linear 5-1 to 2-MHz broadband probe, compound imaging technique and analogic-digital zooming. We obtained one to three progressive measurements for each vein wall (total 67 parietal thicknesses). The samples, fixed in formalin, were sent to the pathology laboratory: sections were obtained at the same level of the sonographic planes, and images were obtained by digital camera mounted on an optical microscope. Measurements obtained at histology were considered as the gold standard. K-statistic was applied to compare sonographic and histologic measurements. Considering only the hypoechoic wall portion, 29/29 (100%) diagnoses of hypotrophy (K=0.91), 19/22 (86%) diagnoses of normotrophy (K=0,47) and 12/16 (75%) diagnoses of hypertrophy (K=0.7) were obtained by sonography. In our preliminary experience, the in vitro study of varicose veins allows precise, at least morphological, detection of hypotrophic walls. If these preliminary data are confirmed in vivo, sonography could be used to discriminate patients eligible for conservative treatment instead of surgery.
Genome-Enabled Prediction of Breeding Values for Feedlot Average Daily Weight Gain in Nelore Cattle
Directory of Open Access Journals (Sweden)
Adriana L. Somavilla
2017-06-01
Full Text Available Nelore is the most economically important cattle breed in Brazil, and the use of genetically improved animals has contributed to increased beef production efficiency. The Brazilian beef feedlot industry has grown considerably in the last decade, so the selection of animals with higher growth rates on feedlot has become quite important. Genomic selection (GS could be used to reduce generation intervals and improve the rate of genetic gains. The aim of this study was to evaluate the prediction of genomic-estimated breeding values (GEBV for average daily weight gain (ADG in 718 feedlot-finished Nelore steers. Analyses of three Bayesian model specifications [Bayesian GBLUP (BGBLUP, BayesA, and BayesCπ] were performed with four genotype panels [Illumina BovineHD BeadChip, TagSNPs, and GeneSeek High- and Low-density indicus (HDi and LDi, respectively]. Estimates of Pearson correlations, regression coefficients, and mean squared errors were used to assess accuracy and bias of predictions. Overall, the BayesCπ model resulted in less biased predictions. Accuracies ranged from 0.18 to 0.27, which are reasonable values given the heritability estimates (from 0.40 to 0.44 and sample size (568 animals in the training population. Furthermore, results from Bos taurus indicus panels were as informative as those from Illumina BovineHD, indicating that they could be used to implement GS at lower costs.