WorldWideScience

Sample records for hafnium 173

  1. Metallurgy of zirconium and hafnium

    International Nuclear Information System (INIS)

    Baryshnikov, N.V.; Geger, V.Eh.; Denisova, N.D.; Kazajn, A.A.; Kozhemyakin, V.A.; Nekhamkin, L.G.; Rodyakin, V.V.; Tsylov, Yu.A.

    1979-01-01

    Considered are those properties of zirconium and of hafnium, which are of practical interest for the manufacture of these elements. Systematized are the theoretical and the practical data on the procedures for thermal decomposition of zirconia and for obtaining zirconium dioxide and hafnium dioxide by a thermal decomposition of compounds and on the hydrometallurgical methods for extracting zirconium and hafnium. Zirconium and hafnium fluorides and chlorides production procedures are described. Considered are the iodide and the electrolytic methods of refining zirconium and hafnium

  2. SEPARATING HAFNIUM FROM ZIRCONIUM

    Science.gov (United States)

    Lister, B.A.J.; Duncan, J.F.

    1956-08-21

    A dilute aqueous solution of zirconyl chloride which is 1N to 2N in HCl is passed through a column of a cation exchange resin in acid form thereby absorbing both zirconium and associated hafnium impurity in the mesin. The cation exchange material with the absorbate is then eluted with aqueous sulfuric acid of a O.8N to 1.2N strength. The first portion of the eluate contains the zirconium substantially free of hafnium.

  3. Commercial production of metal hafnium and hafnium-based products

    International Nuclear Information System (INIS)

    Negodin, D.A.; Shtutsa, M.G.; Akhtonov, S.G.; Il'enko, E.V.; Kobyzev, A.M.

    2012-01-01

    Hafnium possesses a unique complex of physical and chemical properties which allow the application of products on its basis in various industries. Joint Stock Company 'Chepetsky Mechanical Plant' is the single enterprise which produces hafnium on the territory of Russia. The manufacture of metal hafnium with the total content of zirconium and hafnium, at least, 99,8 % of weights is developed at the present time at Joint Stock Company CHMZ. The weight of melted hafnium ingots is up to 1 ton. Manufacture of wide range of products from hafnium is implemented. The plates from a hafnium with thickness of 0.60 mm which are used for emergency control cartridges of VVER-440 reactors are the most critical product. It is shown that ingots and products obtained from metal hafnium correspond to the Russian and international standards for reactor materials in chemical composition, mechanical and corrosion properties.

  4. Zirconium and hafnium

    Science.gov (United States)

    Jones, James V.; Piatak, Nadine M.; Bedinger, George M.; Schulz, Klaus J.; DeYoung,, John H.; Seal, Robert R.; Bradley, Dwight C.

    2017-12-19

    Zirconium and hafnium are corrosion-resistant metals that are widely used in the chemical and nuclear industries. Most zirconium is consumed in the form of the main ore mineral zircon (ZrSiO4, or as zirconium oxide or other zirconium chemicals. Zirconium and hafnium are both refractory lithophile elements that have nearly identical charge, ionic radii, and ionic potentials. As a result, their geochemical behavior is generally similar. Both elements are classified as incompatible because they have physical and crystallochemical properties that exclude them from the crystal lattices of most rock-forming minerals. Zircon and another, less common, ore mineral, baddeleyite (ZrO2), form primarily as accessory minerals in igneous rocks. The presence and abundance of these ore minerals in igneous rocks are largely controlled by the element concentrations in the magma source and by the processes of melt generation and evolution. The world’s largest primary deposits of zirconium and hafnium are associated with alkaline igneous rocks, and, in one locality on the Kola Peninsula of Murmanskaya Oblast, Russia, baddeleyite is recovered as a byproduct of apatite and magnetite mining. Otherwise, there are few primary igneous deposits of zirconium- and hafnium-bearing minerals with economic value at present. The main ore deposits worldwide are heavy-mineral sands produced by the weathering and erosion of preexisting rocks and the concentration of zircon and other economically important heavy minerals, such as ilmenite and rutile (for titanium), chromite (for chromium), and monazite (for rare-earth elements) in sedimentary systems, particularly in coastal environments. In coastal deposits, heavy-mineral enrichment occurs where sediment is repeatedly reworked by wind, waves, currents, and tidal processes. The resulting heavy-mineral-sand deposits, called placers or paleoplacers, preferentially form at relatively low latitudes on passive continental margins and supply 100 percent of

  5. SEPARATION OF HAFNIUM FROM ZIRCONIUM

    Science.gov (United States)

    Overholser, L.B.; Barton, C.J. Sr.; Ramsey, J.W.

    1960-05-31

    The separation of hafnium impurities from zirconium can be accomplished by means of organic solvent extraction. The hafnium-containing zirconium feed material is dissolved in an aqueous chloride solution and the resulting solution is contacted with an organic hexone phase, with at least one of the phases containing thiocyanate. The hafnium is extracted into the organic phase while zirconium remains in the aqueous phase. Further recovery of zirconium is effected by stripping the onganic phase with a hydrochloric acid solution and commingling the resulting strip solution with the aqueous feed solution. Hexone is recovered and recycled by means of scrubbing the onganic phase with a sulfuric acid solution to remove the hafnium, and thiocyanate is recovered and recycled by means of neutralizing the effluent streams to obtain ammonium thiocyanate.

  6. Calorimetric measurements on hafnium titanate

    International Nuclear Information System (INIS)

    Kandan, R.; Prabhakara Reddy, B.; Panneerselvam, G.; Nagarajan, K.

    2012-01-01

    Owing to its desirable nuclear and mechanical properties such as good absorption cross-section for thermal neutrons (105 barns), hafnium titanate (HfTiO 4 ) finds application as control rods for nuclear reactors. An accurate knowledge of the thermo physical properties of this material is necessary for design of control rod and for modeling its performance. Heat capacity is an important thermodynamic property that determines the temperature dependent variation of all other thermodynamic properties. Hence enthalpy increments of hafnium titanate (HfTiO 4 ) were measured in the temperature range 803-1663 K by employing the method of inverse drop calorimetry using high temperature differential calorimeter

  7. Hafnium carbide formation in oxygen deficient hafnium oxide thin films

    Energy Technology Data Exchange (ETDEWEB)

    Rodenbücher, C. [Forschungszentrum Jülich GmbH, Peter Grünberg Institute (PGI-7), JARA-FIT, 52425 Jülich (Germany); Hildebrandt, E.; Sharath, S. U.; Kurian, J.; Komissinskiy, P.; Alff, L. [Technische Universität Darmstadt, Institute of Materials Science, 64287 Darmstadt (Germany); Szot, K. [Forschungszentrum Jülich GmbH, Peter Grünberg Institute (PGI-7), JARA-FIT, 52425 Jülich (Germany); University of Silesia, A. Chełkowski Institute of Physics, 40-007 Katowice (Poland); Breuer, U. [Forschungszentrum Jülich GmbH, Central Institute for Engineering, Electronics and Analytics (ZEA-3), 52425 Jülich (Germany); Waser, R. [Forschungszentrum Jülich GmbH, Peter Grünberg Institute (PGI-7), JARA-FIT, 52425 Jülich (Germany); RWTH Aachen, Institute of Electronic Materials (IWE 2), 52056 Aachen (Germany)

    2016-06-20

    On highly oxygen deficient thin films of hafnium oxide (hafnia, HfO{sub 2−x}) contaminated with adsorbates of carbon oxides, the formation of hafnium carbide (HfC{sub x}) at the surface during vacuum annealing at temperatures as low as 600 °C is reported. Using X-ray photoelectron spectroscopy the evolution of the HfC{sub x} surface layer related to a transformation from insulating into metallic state is monitored in situ. In contrast, for fully stoichiometric HfO{sub 2} thin films prepared and measured under identical conditions, the formation of HfC{sub x} was not detectable suggesting that the enhanced adsorption of carbon oxides on oxygen deficient films provides a carbon source for the carbide formation. This shows that a high concentration of oxygen vacancies in carbon contaminated hafnia lowers considerably the formation energy of hafnium carbide. Thus, the presence of a sufficient amount of residual carbon in resistive random access memory devices might lead to a similar carbide formation within the conducting filaments due to Joule heating.

  8. Hafnium isotope stratigraphy of ferromanganese crusts

    Science.gov (United States)

    Lee; Halliday; Hein; Burton; Christensen; Gunther

    1999-08-13

    A Cenozoic record of hafnium isotopic compositions of central Pacific deep water has been obtained from two ferromanganese crusts. The crusts are separated by more than 3000 kilometers but display similar secular variations. Significant fluctuations in hafnium isotopic composition occurred in the Eocene and Oligocene, possibly related to direct advection from the Indian and Atlantic oceans. Hafnium isotopic compositions have remained approximately uniform for the past 20 million years, probably reflecting increased isolation of the central Pacific. The mechanisms responsible for the increase in (87)Sr/(86)Sr in seawater through the Cenozoic apparently had no effect on central Pacific deep-water hafnium.

  9. Ferroelectricity in undoped hafnium oxide

    International Nuclear Information System (INIS)

    Polakowski, Patrick; Müller, Johannes

    2015-01-01

    We report the observation of ferroelectric characteristics in undoped hafnium oxide thin films in a thickness range of 4–20 nm. The undoped films were fabricated using atomic layer deposition (ALD) and embedded into titanium nitride based metal-insulator-metal (MIM) capacitors for electrical evaluation. Structural as well as electrical evidence for the appearance of a ferroelectric phase in pure hafnium oxide was collected with respect to film thickness and thermal budget applied during titanium nitride electrode formation. Using grazing incidence X-Ray diffraction (GIXRD) analysis, we observed an enhanced suppression of the monoclinic phase fraction in favor of an orthorhombic, potentially, ferroelectric phase with decreasing thickness/grain size and for a titanium nitride electrode formation below crystallization temperature. The electrical presence of ferroelectricity was confirmed using polarization measurements. A remanent polarization P r of up to 10 μC cm −2 as well as a read/write endurance of 1.6 × 10 5 cycles was measured for the pure oxide. The experimental results reported here strongly support the intrinsic nature of the ferroelectric phase in hafnium oxide and expand its applicability beyond the doped systems

  10. Study of fine structure of deformed hafnium

    International Nuclear Information System (INIS)

    Voskresenskaya, L.A.; Petukhova, A.S.; Kovalev, K.S.

    1978-01-01

    Variations in the hafnium fine structure following the cold plastic deformation have been studied. The fine structure condition has been studied through the harmonic analysis of the profile of the X-ray diffraction line, obtained at the DRON-I installation. Received has been the dependence of the crystal lattice microdistortions value on the deformation extent for hafnium. This dependence is compared with the corresponding one for zirconium. It is found out that at all the deformations the microdistortion distribution is uniform. The microdistortion value grows with the increase in the compression. During the mechanical impact higher microdistortions of the crystal lattice occur in the hafnium rather than in zirconium

  11. Hafnium - material for chemical apparatus engineering

    International Nuclear Information System (INIS)

    Jennert, D.

    1981-01-01

    This work describes - on the background of available literature - the properties of hafnium in technical quality (DIN-material No. 2.6400) as material for chemical apparatus engineering. The occurence, refining, physical and chemical properties will be described as well as the material behavior. In conclusion, it has been found that there is, at present, sufficient information for the engineering of hafnium which has to be completed by additional investigations for special applications. (orig.) [de

  12. Determination of hafnium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Yoshida, Isao; Kobayashi, Hiroshi; Ueno, Keihei.

    1977-01-01

    Optimum conditions for atomic absorption spectrophotometric determination of hafnium were investigated by use of a Jarrel-Ash AA-1 instrument which was equipped with a premixed gas burner slotted 50 mm in length and 0.4 mm in width. Absorption of hafnium, which was atomized in an nitrous oxide-acetylene flame, was measured on a resonance line at 307.29 nm. The absorption due to hafnium was enhanced in the presence of ammonium fluoride and iron(III) ion, as shown in Figs. 2 and 3, depending on their concentration. The highest absorption was attained by the addition of (0.15 -- 0.3)M ammonium fluoride, 0.07 M of iron(III) ion and 0.05 M of hydrochloric acid. An excess of the additives decreased the absorption. The presence of zirconium, which caused a significant interference in the ordinary analytical methods, did not affect the absorption due to hafnium, if the zirconium concentration is less than 0.2 M. A standard procedure was proposed; A sample containing a few mg of hafnium was dissolved in a 25-ml volumetric flask, and ammonium fluoride, ferric nitrate and hydrochloric acid were added so that the final concentrations were 0.3, 0.07 and 0.05 M, respectively. Atomic absorption was measured on the aqueous solution in a nitrous oxide-acetylene flame and the hafnium content was calculated from the absorbance. Sensitivity was as high as 12.5 μg of Hf/ml/l% absorption. The present method is especially recommendable to the direct determination of hafnium in samples containing zirconium. (auth.)

  13. Titanium(IV), zirconium, hafnium and thorium

    International Nuclear Information System (INIS)

    Brown, Paul L.; Ekberg, Christian

    2016-01-01

    Titanium can exist in solution in a number of oxidation states. The titanium(IV) exists in acidic solutions as the oxo-cation, TiO 2+ , rather than Ti 4+ . Zirconium is used in the ceramics industry and in nuclear industry as a cladding material in reactors where its reactivity towards hydrolysis reactions and precipitation of oxides may result in degradation of the cladding. In nature, hafnium is found together with zirconium and as a consequence of the contraction in ionic radii that occurs due to the 4f -electron shell, the ionic radius of hafnium is almost identical to that of zirconium. All isotopes of thorium are radioactive and, as a consequence of it being fertile, thorium is important in the nuclear fuel cycle. The polymeric hydrolysis species that have been reported for thorium are somewhat different to those identified for zirconium and hafnium, although thorium does form the Th 4 (OH) 8 8+ species.

  14. Gravimetric determination of hafnium through its arsenate in carbide and boride of hafnium

    International Nuclear Information System (INIS)

    Rasulbekova, R.A.; Mamedov, I.A.

    1976-01-01

    A gravimetric method of determining hafnium through hydroarsenate has been recommended. The method differs from the known ones by its simplicity and by the recalculation coefficient which is more than by 50% smaller than that used in preparing a weight form of HfO 2 . Upon development of gravimetric determination of hafnium through hydro-and pyroarsenate, an investigation has been conducted with the aim to find some physico-chemical constants of hafnium hydroarsenate. The weighed amount of hafnium hydroarsenate is dissolved in sulphuric acid (2:5). The precipitate of hafnium hydroarsenate has been studied for recording infrared absorption spectra. Thermographic analysis of the precipitate has been performed. Thermogram reveals endothermal effect at 105 deg C and exothermal at 840 deg C. Water solubility of hafnium has been determined equal to 1.75x10 6 g mol/l. The corresponding solubility product of the precipitate has been calculated which is 2.1x10 -17 . It is shown that the method possesses certain selectivity, sufficient accuracy, and is rather fast. It has been established that determination can be performed in the presence of excess amounts of ions

  15. Method of separating hafnium from zirconium

    International Nuclear Information System (INIS)

    Megy, J.A.

    1980-01-01

    English. A new anhydrous method was developed for separating zirconium and hafnium, which gives higher separation factors and is more economical than previous methods. A molten phase, comprising a solution of unseparated zirconium and hafnium and a solvent metal, is first prepared. The molten metal phase is contacted with a fused salt phase which includes a zirconium salt. Zirconium and hafnium separation is effected by mutual displacement with hafnium being transported from the molten metal phase to the fused salt phase, while zirconium is transported from the fused salt phase to the molten metal phase. The solvent metal is less electropositive than zirconium. Zinc was chosen as the solvent metal, from a group which also included cadmium, lead, bismuth, copper, and tin. The fused salt phase cations are more electropositive than zirconium and were selected from a group comprising the alkali elements, the alkaline earth elements, the rare earth elements, and aluminum. A portion of the zirconium in the molten metal phase was oxidized by injecting an oxidizing agent, chlorine, to form zirconium tetrachlorid

  16. Kinetic studies on the hafnium nad deuterium

    International Nuclear Information System (INIS)

    Bing Wenzeng; Long Xinggui; Zhu Zuliang

    2009-04-01

    Through the method of reaction rate analysis in a constant volume reactor, the time dependence of the pressure drop of the hafnium deuteride formation are studied over a temperature range 573-873 K on a metal hydride thermodynamic and kinetic parameters measuring apparatus. The rate constants of the hafnium deuteride formation, which are 0.0530 s -1 , 0.0452 s -1 , 0.0319 s -1 , 0.0261 s -1 , are calculated at a serial temperatures of 573 K, 673 K, 773 K, 873 K and the initial pressure of 13 kPa. The activation energy of the reaction is (-10.1±1.5) kJ·mol -1 . Comparing the above results with those of titanium deuteride formation on the same measuring apparatus, the kinetic mechanism of the deuteride formation of hafnium and titanium is considered different. It is concluded that the reaction rate of hafnium absorbing deuterium may be controlled by phase transformation and surface oxidation. (authors)

  17. Recovery of hafnium values from loaded extraction solvent

    International Nuclear Information System (INIS)

    Abodishish, H.A.

    1989-01-01

    This patent describes an improvement in a process for recovering high purity hafnium hydroxide from a methyl isobutyl ketone organic solvent that is substantially free of sulfate ions and contains hafnium thiocyanate and thiocyanic acid. The improvement comprising reacting the organic solvent with ammonia to produce a reaction product in the form of a methyl isobutyl ketone organic solvent that is substantially free of sulfate ions and contains ammonium thiocyanite solution and hafnium hydroxide; separating the constituents of the reaction product in accordance with their respective specific gravities to produce a hafnium hydroxide sludge as one of the separation products; and removing the liquid component of the sludge to yield a high purity hafnium hydroxide ready for calcination to hafnium oxide

  18. Flotation separation of hafnium(IV) from aqueous solutions

    International Nuclear Information System (INIS)

    Downey, D.M.; Narick, C.N.; Cohen, T.A.

    1985-01-01

    A simple, rapid method for the separation of hafnium from aqueous solutions was investigated using sup(175+181)Hf tracer. Cationic hafnium complex ions were floated from dilute acid solutions with sodium lauryl sulfate (SLS) and anionic hafnium complexes were floated from basic and oxalic acid solutions with hexadecyltrimethyl ammonium bromide (HTMAB). The conditions necessary for quantitative recovery of the metal and mechanisms of flotation are described. (author)

  19. Flotation separation of hafnium(IV) from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Downey, D.M.; Narick, C.N.; Cohen, T.A.

    1985-09-01

    A simple, rapid method for the separation of hafnium from aqueous solutions was investigated using sup(175 + 181)Hf tracer. Cationic hafnium complex ions were floated from dilute acid solutions with sodium lauryl sulfate (SLS) and anionic hafnium complexes were floated from basic and oxalic acid solutions with hexadecyltrimethyl ammonium bromide (HTMAB). The conditions necessary for quantitative recovery of the metal and mechanisms of flotation are described. (author). 21 refs.; 5 figs.

  20. Titanium zirconium and hafnium coordination compounds with vanillin thiosemicarbazone

    International Nuclear Information System (INIS)

    Konunova, Ts.B.; Kudritskaya, S.A.

    1987-01-01

    Coordination compounds of titanium zirconium and hafnium tetrachlorides with vanillin thiosemicarbazone of MCl 4 x nLig composition, where n=1.5, 4 for titanium and 1, 2, 4 for zirconium and hafnium, are synthesized. Molar conductivity of ethanol solutions is measured; IR spectroscopic and thermochemical investigation are carried out. The supposition about ligand coordination via sulfur and azomethine nitrogen atoms is made. In all cases hafnium forms stable compounds than zirconium

  1. Niobium and hafnium grown on porous membranes

    International Nuclear Information System (INIS)

    Morant, C.; Marquez, F.; Campo, T.; Sanz, J.M.; Elizalde, E.

    2010-01-01

    In this work we report on a method for fabricating highly ordered nanostructures of niobium and hafnium metals by physical vapour deposition using two different templates: anodized aluminum oxide membranes (AAO) and zirconium onto AAO membranes (Zr/AAO). The growth mechanism of these metal nanostructures is clearly different depending on the material used as a template. A different morphology was obtained by using AAO or Zr/AAO templates: when the metal is deposited onto AAO membranes, nanospheres with ordered hexagonal regularity are obtained; however, when the metal is deposited onto a Zr/AAO template, highly ordered nanocones are formed. The experimental approach described in this work is simple and suitable for synthesizing nanospheres or nanoholes of niobium and hafnium metals in a highly ordered structure.

  2. Joint titrimetric determination of zirconium and hafnium

    International Nuclear Information System (INIS)

    Vazquez, Cristina; Botbol, Moises; Bianco de Salas, G.N.; Cornell de Casas, M.I.

    1980-01-01

    A method for the joint titrimetric determination of zirconium and hafnium, which are elements of similar chemical behaviour, is described. The disodic salt of the ethylendiaminetetracetic acid (EDTA) is used for titration, while xilenol orange serves as final point indicator. Prior to titration it is important to evaporate with sulfuric acid, the solution resulting from the zirconium depolymerization process, to adjust the acidity and to eliminate any interferences. The method, that allows the quick and precise determination of zirconium and hafnium in quantities comprised between 0.01 and mg, was applied to the analysis of raw materials and of intermediate and final products in the fabrication of zirconium sponge and zircaloy. (M.E.L.) [es

  3. Molten salt scrubbing of zirconium or hafnium tetrachloride

    International Nuclear Information System (INIS)

    Lee, E.D.; McLaughlin, D.F.

    1990-01-01

    This patent describes a continuous process for removing impurities of iron or aluminum chloride or both from vaporous zirconium or hafnium chloride or both. It comprises: introducing impure zirconium or hafnium chloride vapor or both into a middle portion of an absorbing column containing a molten salt phase, the molten salt phase absorbing the impurities of iron or aluminum chloride or both to produce chloride vapor stripped of zirconium or hafnium chloride; introducing sodium or potassium chloride or both into a top portion of the column; controlling the top portion of the column to between 300--375 degrees C.; heating a bottom portion of the column to 450--550 degrees C. To vaporize zirconium chloride or hafnium chloride or hafnium and zirconium chloride from the molten salt; withdrawing molten salt substantially free of zirconium and hafnium chloride from the bottom portion of the column; and withdrawing zirconium chloride or hafnium chloride or hafnium and zirconium chloride vapor substantially free of impurities of iron and aluminum chloride from the top of the column

  4. Investigation of ferromagnetism in oxygen deficient hafnium oxide thin films

    Energy Technology Data Exchange (ETDEWEB)

    Hildebrandt, Erwin; Kurian, Jose; Krockenberger, Yoshiharu; Alff, Lambert [Institut fuer Materialwissenschaft, TU Darmstadt (Germany); Suter, Andreas [PSI, Villingen (Switzerland); Wilhelm, Fabrice; Rogalev, Andrei [ESRF, Grenoble (France)

    2008-07-01

    Oxygen deficient thin films of hafnium oxide were grown on single crystal r-cut and c-cut sapphire by reactive molecular beam epitaxy. RF-activated oxygen was used for the in situ oxidation of hafnium oxide thin films. Oxidation conditions were varied substantially in order to create oxygen deficiency in hafnium oxide films intentionally. The films were characterized by X-ray and magnetic measurements. X-ray diffraction studies show an increase in lattice parameter with increasing oxygen deficiency. Oxygen deficient hafnium oxide thin films also showed a decreasing bandgap with increase in oxygen deficiency. The magnetisation studies carried out with SQUID did not show any sign of ferromagnetism in the whole oxygen deficiency range. X-ray magnetic circular dichroism measurements also confirmed the absence of ferromagnetism in oxygen deficient hafnium oxide thin films.

  5. Preparation of hafnium carbide by chemical vapor deposition

    International Nuclear Information System (INIS)

    Hertz, Dominique.

    1974-01-01

    Hard, adhesive coatings of single-phase hafnium carbide were obtained by chemical vapor reaction in an atmosphere containing hafnium tetrachloride, methane and a large excess of hydrogen. By varying the gas phase composition and temperature the zones of formation of the different solid phases were studied and the growth of elementary hafnium and carbon deposits evaluated separately. The results show that the mechanism of hafnium carbide deposition does not hardly involve phenomene of homogeneous-phase methane decomposition or tetrachloride reduction by hydrogen unless the atmosphere is very rich or very poor in methane with respect to tetrachloride. However, hydrogen acting inversely on these two reactions, affects the stoichiometry of the substance deposited. The methane decomposition reaction is fairly slow, the reaction leading to hafnium carbide deposition is faster and that of tetrachloride reduction by hydrogen is quite fast [fr

  6. Assessing hafnium on hafnia as an oxygen getter

    International Nuclear Information System (INIS)

    O'Hara, Andrew; Demkov, Alexander A.; Bersuker, Gennadi

    2014-01-01

    Hafnium dioxide or hafnia is a wide band gap dielectric used in a range of electronic applications from field effect transistors to resistive memory. In many of these applications, it is important to maintain control over oxygen stoichiometry, which can be realized in practice by using a metal layer, specifically hafnium, to getter oxygen from the adjacent dielectric. In this paper, we employ density functional theory to study the thermodynamic stability of an interface between (100)-oriented monoclinic hafnia and hafnium metal. The nudged elastic band method is used to calculate the energy barrier for migration of oxygen from the oxide to the metal. Our investigation shows that the presence of hafnium lowers the formation energy of oxygen vacancies in hafnia, but more importantly the oxidation of hafnium through the migration of oxygen from hafnia is favored energetically

  7. Properties of filmogen solutions and films of hafnium compounds

    International Nuclear Information System (INIS)

    Sviridova, A.I.

    1986-01-01

    Study on hafnium hydrolizing compound solutions, used for hafnium oxide homogeneous layer formation, is conducted. In particular, electric conductivity, acidity and refractive index were investigated depending on the sal on ether concentration and the storage time. Oxyhafnium nitrate, hafnium chloride in ethanol, dichlorodiethoxyhafnium, hafnium oxychloride were used as initial compounds. Hydrolysis of hafnium compounds in solution occurs partially; further process occurs in the thin layer on the optical element surface; final decomposition is performed under heat treatment. It is ascertained, that alcoholic-aqueous solutions of inorganic salts can be filmogen only at definite acidity, density and viscosity (1.33-2.5 cp.). It is also ascertained that refractive index values and transmission spectral boundary of coatings, produced from alkoxy compound solutions and from chloride salt solutions, are practically the same. Transmittance boundary in ultraviolet region of spectrum of oxide films produced from nitrate and chloride solutions, varies with the heating temperature increase differently

  8. Analysis of hafnium in zirconium alloys

    International Nuclear Information System (INIS)

    Kondo, Isao; Sakai, Fumiaki; Ohuchi, Yoshifusa; Nakamura, Hisashi

    1977-01-01

    It is required to analyse alloying components and impurity elements in the acceptance analysis of zirconium alloys as the material for fuel cladding tubes and pressure tubes for advanced thermal reactors. Because of extreme similarity in chemical properties between zirconium and hafnium, about 100 ppm of hafnium is usually contained in zirconium alloys. Zircaloy-2 alloy and 2.5% Nb-zirconium with the addition of hafnium had been prepared as in-house standard samples for rapid analysis. Study was made on fluorescent X-ray analysis and emission spectral analysis to establish the analytical method. By using these in-house standard samples, acceptance analysis was successfully carried out for the fuel cladding tubes for advanced thermal reactors. Sulfuric acid solution was prepared from JAERI-Z 1, 2 and 3, the standard sample for zircaloy-2 prepared by the Analytical Committee on Nuclear Fuel and Reactor Materials, JAERI, and zirconium oxide (Hf 1 ppm/Zr). Standard Hf solution was added to the sulfuric acid solution step by step, to make up a series of the standard oxide samples by the precipitation process. By the use of these standard samples, the development of the analytical method and joint analysis were made by the three-member analytical technique research group including PNC. The analytical precision for the fluorescent X-ray analysis was improved by attaching a metallic yttrium filter to the window of an X-ray tube so as to suppress the effect due to zirconium matrix. The variation factor of the joint analysis was about 10% to show good agreement, and the indication value was determined. (Kobatake, H.)

  9. Primary hafnium metal sponge and other forms, approved standard 1973

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    A specification is presented covering virgin hafnium metal commonly designated as sponge because of its porous, sponge-like texture; it may also be in other forms such as chunklets. The specification does not cover crystal bar

  10. Investigation of colourless complexes of thorium, hafnium and zirconium

    International Nuclear Information System (INIS)

    Kiciak, S.; Stefanowicz, T.; Gontarz, H.; Swit, Z.

    1980-01-01

    The investigations conducted in the Institute of General Chemistry of Poznan Technical University in partial cooperation with Kharkhof Technical University related with thorium, hafnium and zirconium complexes are reviewed. (author)

  11. Molten salt extractive distillation process for zirconium-hafnium separation

    International Nuclear Information System (INIS)

    McLaughlin, D.F.; Stoltz, R.A.

    1989-01-01

    This patent describes an improvement in a process for zirconium-hafnium separation. It utilizes an extractive distillation column with a mixture of zirconium and hafnium tetrachlorides introduced into a distillation column having a top and bottom with hafnium enriched overheads taken from the top of the column and a molten salt solvent circulated through the column to provide a liquid phase, and with molten salt solvent containing zirconium chloride being taken from the bottom of the distillation column. The improvements comprising: utilizing a molten salt solvent consisting principally of lithium chloride and at least one of sodium, potassium, magnesium and calcium chlorides; stripping of the zirconium chloride taken from the bottom of the distillation column by electrochemically reducing zirconium from the molten salt solvent; and utilizing a pressurized reflux condenser on the top of the column to add the hafnium chloride enriched overheads to the molten salt solvent previously stripped of zirconium chloride

  12. Internal Dosimetry for Inhalation of Hafnium Tritide Aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Inkret, W.C.T.; Schillaci, M.E.; Boyce, M.K.; Cheng, Y.S.; Efurd, D.W.; Little, T.T.; Miller, G.; Musgrave, J.A.; Wermer, J.R

    2001-07-01

    Metal tritides with low dissolution rates may have residence times in the lungs which are considerably longer than the biological half-time normally associated with tritium in body water, resulting in long-term irradiation of the lungs by low energy {beta} particles and bremsstrahlung X rays. Samples of hafnium tritide were placed in a lung simulant fluid to determine approximate lung dissolution rates. Hafnium hydride samples were analysed for particle size distribution with a scanning electron microscope. Lung simulant data indicated a biological dissolution half-time for hafnium tritide on the order of 10{sup 5}d. Hafnium hydride particle sizes ranged between 2 and 10 {mu}m, corresponding to activity median aerodynamic diameters of 5 to 25 {mu}m. Review of in vitro dissolution data, development of a biokinetic model, and determination of secondary limits for 1 {mu}m AMAD particles are presented and discussed. (author)

  13. New solvent extraction process for zirconium and hafnium

    International Nuclear Information System (INIS)

    Takahashi, M.; Katoh, Y.; Miyazaki, H.

    1984-01-01

    The authors' company developed a new solvent extraction process for zirconium and hafnium separation, and started production of zirconium sponge by this new process in September 1979. The process utilizes selective extraction of zirconium oxysulfate using high-molecular alkyl amine, and has the following advantages: 1. This extraction system has a separation factor as high as 10 to 20 for zirconium and hafnium in the range of suitable acid concentration. 2. In the scrubbing section, removal of all the hafnium that coexists with zirconium in the organic solvent can be effectively accomplished by using scrubbing solution containing hafnium-free zirconium sulfate. Consequently, hafnium in the zirconium sponge obtained is reduced to less than 50 ppm. 3. The extractant undergoes no chemical changes but is very stable for a long period. In particular, its solubility in water is small, about 20 ppm maximum, posing no environmental pollution problems such as are often caused by other process raffinates. At the present time, the zirconium and hafnium separation operation is very stable, and zirconium sponge made by this process can be applied satisfactorily to nuclear reactors

  14. Separation process of zirconium and hafnium

    International Nuclear Information System (INIS)

    Hure, J.; Saint-James, R.

    1955-01-01

    About the separation different processes of zirconium-hafnium, the extraction by solvent in cross-current is the most easily the process usable on an industrial scale. It uses tributyl phosphate as solvent, diluted with white spirit to facilitate the decanting. Some exploratory tests showed that nitric environment seemed the most favorable for extraction; but a lot of other factors intervene in the separation process. We studied the influence of the acidity successively, the NO 3 - ions concentration, the role of the cation coming with NO 3 - , as well as the influence of the concentration of zirconium in the solution on the separation coefficient β = α Zr / α Hf . (M.B.) [fr

  15. The interaction of fast neutrons with hafnium

    International Nuclear Information System (INIS)

    Smith, A.B.

    2002-01-01

    Elemental hafnium neutron total cross sections are measured from ∼0.75 to 4.5 MeV in steps of ∼40 keV. Differential neutron elastic-scattering cross sections are measured from ∼4.5 to 10.0 MeV in ∼0.5 MeV steps and at 40 scattering angles distributed between ∼17 and 160 deg. These data are combined with those found in the literature to construct a comprehensive experimental data base which is interpreted in terms of coupled-channels models. Physical characteristics of the resulting potentials are discussed. Comparisons are made with ENDF/B-6 (MAT 7200). A detailed report of this work is given by Smith (Smith, A., 2001. Argonne National Laboratory Report ANL/NDM-153)

  16. High temperature diffusion of hafnium in tungsten and a tungsten-hafnium carbide alloy

    International Nuclear Information System (INIS)

    Ozaki, Y.; Zee, R.H.

    1994-01-01

    Refractory metals and ceramics are used extensively in energy systems due to their high temperature properties. This is particularly important in direct conversion systems where thermal to electric conversion efficiency is a direct function of temperature. Tungsten, which has the highest melting temperature among elemental metals, does not possess sufficient creep resistance at temperature above 1,600 K. Different dispersion strengthened tungsten alloys have been developed to extend the usefulness of tungsten to higher temperatures. One of these alloys, tungsten with 0.4 mole percent of finely dispersed HfC particles (W-HfC), has the optimum properties for high temperature applications. Hafnium carbide is used as the strengthening agent due to its high chemical stability and its compatibility with tungsten. The presence of HfC particles retards the rate of grain growth as well as restricting dislocation motion. Both of which are beneficial for creep resistance. The long term behavior of this alloy depends largely on the evolution of its microstructure which is governed by the diffusion of its constituents. Data on the diffusion of carbon in tungsten and tungsten self-diffusion are available, but no direct measurements have been made on the diffusion of hafnium in tungsten. The only diffusion data available are estimated from a coarsening study and these data are highly unreliable. In this study, the diffusion behavior of hafnium in pure tungsten and in a W-HfC alloy was directly measured by means of Secondary Ion Mass Spectroscopy (SIMS). The selection of the W-HfC alloy is due to its importance in high temperature engineering applications, and its higher recrystallization temperature. The presence of HfC particles in tungsten restricts grain growth resulting in better high temperature creep resistance. The higher recrystallization temperature allows measurements to be made over a wider range of temperatures at a relatively constant grain size

  17. 40 CFR 471.90 - Applicability; description of the zirconium-hafnium forming subcategory.

    Science.gov (United States)

    2010-07-01

    ... zirconium-hafnium forming subcategory. 471.90 Section 471.90 Protection of Environment ENVIRONMENTAL... POINT SOURCE CATEGORY Zirconium-Hafnium Forming Subcategory § 471.90 Applicability; description of the zirconium-hafnium forming subcategory. This subpart applies to discharges of pollutants to waters of the...

  18. 40 CFR 421.330 - Applicability: Description of the primary zirconium and hafnium subcategory.

    Science.gov (United States)

    2010-07-01

    ... primary zirconium and hafnium subcategory. 421.330 Section 421.330 Protection of Environment ENVIRONMENTAL... CATEGORY Primary Zirconium and Hafnium Subcategory § 421.330 Applicability: Description of the primary zirconium and hafnium subcategory. The provisions of this subpart are applicable to discharges resulting...

  19. Ground-state structures of Hafnium clusters

    Energy Technology Data Exchange (ETDEWEB)

    Ng, Wei Chun; Yoon, Tiem Leong [School of Physics, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Lim, Thong Leng [Faculty of Engineering and Technoloty, Multimedia University, Melaca Campus, 75450 Melaka (Malaysia)

    2015-04-24

    Hafnium (Hf) is a very large tetra-valence d-block element which is able to form relatively long covalent bond. Researchers are interested to search for substitution to silicon in the semi-conductor industry. We attempt to obtain the ground-state structures of small Hf clusters at both empirical and density-functional theory (DFT) levels. For calculations at the empirical level, charge-optimized many-body functional potential (COMB) is used. The lowest-energy structures are obtained via a novel global-minimum search algorithm known as parallel tempering Monte-Carlo Basin-Hopping and Genetic Algorithm (PTMBHGA). The virtue of using COMB potential for Hf cluster calculation lies in the fact that by including the charge optimization at the valence shells, we can encourage the formation of proper bond hybridization, and thus getting the correct bond order. The obtained structures are further optimized using DFT to ensure a close proximity to the ground-state.

  20. Hafnium carbide nanocrystal chains for field emitters

    International Nuclear Information System (INIS)

    Tian, Song; Li, Hejun; Zhang, Yulei; Ren, Jincui; Qiang, Xinfa; Zhang, Shouyang

    2014-01-01

    A hafnium carbide (HfC) nanostructure, i.e., HfC nanocrystal chain, was synthesized by a chemical vapor deposition (CVD) method. X-ray diffractometer, field-emission scanning electron microscope, transmission electron microscope, and energy-dispersive X-ray spectrometer were employed to characterize the product. The synthesized one-dimensional (1D) nanostructures with many faceted octahedral nanocrystals possess diameters of tens of nanometers to 500 nm and lengths of a few microns. The chain-like structures possess a single crystalline structure and preferential growth direction along the [1 0 0] crystal orientation. The growth of the chains occurred through the vapor–liquid–solid process along with a negative-feedback mechanism. The field emission (FE) properties of the HfC nanocrystal chains as the cold cathode emitters were examined. The HfC nanocrystal chains display good FE properties with a low turn-on field of about 3.9 V μm −1 and a high field enhancement factor of 2157, implying potential applications in vacuum microelectronics.

  1. Use of hafnium in control bars of nuclear reactors

    International Nuclear Information System (INIS)

    Ramirez S, J.R.; Alonso V, G.

    2003-01-01

    Recently the use of hafnium as neutron absorber material in nuclear reactors has been reason of investigation by virtue of that this material has nuclear properties as to the neutrons absorption and structural that can prolong the useful life of the control mechanisms of the nuclear reactors. In this work some of those more significant hafnium properties are presented like nuclear material. Also there are presented calculations carried out with the HELIOS code for fuel cells of uranium oxide and of uranium and plutonium mixed oxides under controlled conditions with conventional bars of boron carbide and also with similar bars to which are substituted the absorbent material by metallic hafnium, the results are presented in this work. (Author)

  2. Analytical study of zirconium and hafnium α-hydroxy carboxylates

    International Nuclear Information System (INIS)

    Terra, V.R.

    1991-01-01

    The analytical study of zirconium and hafnium α-hydroxy carboxylates was described. For this purpose dl-mandelic, dl-p-bromo mandelic, dl-2-naphthyl glycolic, and benzilic acids were prepared. These were used in conjunction with glycolic, dl-lactic, dl-2-hydroxy isovaleric, dl-2-hydroxy hexanoic, and dl-2-hydroxy dodecanoic acids in order to synthesize the zirconium(IV) and hafnium(IV) tetrakis(α-hydroxy carboxylates). The compounds were characterized by melting point determination, infrared spectroscopy, thermogravimetric analysis, calcination to oxides and X-ray diffractometry by the powder method. (C.G.C)

  3. High temperature evaporation of titanium, zirconium and hafnium carbides

    International Nuclear Information System (INIS)

    Gusev, A.I.; Rempel', A.A.

    1991-01-01

    Evaporation of cubic nonstoichiometric carbides of titanium, zirconium and hafnium in a comparatively low-temperature interval (1800-2700) with detailed crystallochemical sample certification is studied. Titanium carbide is characterized by the maximum evaporation rate: at T>2300 K it loses 3% of sample mass during an hour and at T>2400 K titanium carbide evaporation becomes extremely rapid. Zirconium and hafnium carbide evaporation rates are several times lower than titanium carbide evaporation rates at similar temperatures. Partial pressures of metals and carbon over the carbides studied are calculated on the base of evaporation rates

  4. Preparation of complexes of zirconium and hafnium tetrachlorides with phosphorus oxychloride

    International Nuclear Information System (INIS)

    McLaughlin, D.F.

    1989-01-01

    This patent describes an improvement in a method for separating hafnium tetrachloride from zirconium tetrachloride where a complex of zirconium-hafnium tetrachlorides and phosphorus oxychloride is prepared from zirconium-hafnium tetrachlorides and the complex of zirconium-hafnium tetrachlorides and phosphorus oxychloride is introduced into a distillation column, which distillation column has a reboiler connected at the bottom and a reflux condenser connected at the top and where a hafnium tetrachloride enriched stream is taken from the top of the column and a zirconium enriched tetrachloride stream is taken from the bottom of the column. The improvement comprising: prepurifying the zirconium-hafnium tetrachlorides, prior to preparation of the complex and introduction of the complex into a distillation column, to substantially eliminate iron chloride from the zirconium hafnium tetrachlorides, whereby buildup or iron chloride in the distillation column and in the reboiler is substantially eliminated and the column can be operated in a continuous, stable and efficient manner

  5. Separation process of zirconium and hafnium; Procede de separation du zirconium et du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Hure, J; Saint-James, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1955-07-01

    About the separation different processes of zirconium-hafnium, the extraction by solvent in cross-current is the most easily the process usable on an industrial scale. It uses tributyl phosphate as solvent, diluted with white spirit to facilitate the decanting. Some exploratory tests showed that nitric environment seemed the most favorable for extraction; but a lot of other factors intervene in the separation process. We studied the influence of the acidity successively, the NO{sub 3}{sup -} ions concentration, the role of the cation coming with NO{sub 3}{sup -}, as well as the influence of the concentration of zirconium in the solution on the separation coefficient {beta} = {alpha}{sub Zr} / {alpha}{sub Hf}. (M.B.) [French] Des differents procedes de separation zirconium-hafnium, l'extraction par solvant en contre-courant est le procede le plus facilement utilisable a l'echelle industrielle. On utilise comme solvant le phosphate de tributyle, dilue avec du white spirit pour faciliter les decantations. Des essais preliminaires ont montre que le milieu nitrique semblait le plus favorable a l'extraction; mais beaucoup d'autres facteurs interviennent dans le processus de separation. Nous avons etudie successivement l'influence de l'acidite, celle de la concentration en ions NO{sub 3}{sup -}, le role du cation accompagnant NO{sub 3}{sup -}, ainsi que l'influence de la concentration en zirconium de la solution sur le coefficient de separation {beta} = {alpha}{sub Zr} / {alpha}{sub Hf}. (MB)

  6. Separation of zirconium and hafnium using paper distribution chromatography

    International Nuclear Information System (INIS)

    Lebedeva, G.G.; Viktorova, M.E.

    1981-01-01

    A method is suggested of chromatographic separation of zirconium and hafnium in a CCl 4 -tributyl phosphate system (1:9) containing KCl as a salting-out agent in 5 M HNO 3 at 28-30 deg C. Zr and Hf are deterfmined in articiial mixtures under optimal chromatography conditions using visual colorimetry [ru

  7. X-Ray Photoemission Study of the Oxidation of Hafnium

    International Nuclear Information System (INIS)

    Chourasia, R.; Hickman, J.L.; Miller, R.L.; Nixon, G.A.; Seabolt, M.A.

    2011-01-01

    About 20 angstrom of hafnium were deposited on silicon substrates using the electron beam evaporation technique. Two types of samples were investigated. In one type, the substrate was kept at the ambient temperature. After the deposition, the substrate temperature was increased to 100, 200, and 300 degree C. In the other type, the substrate temperature was held fixed at some value during the deposition. For this type, the substrate temperatures used were 100, 200, 300, 400, 500, 550, and 600 degree C. The samples were characterized in situ by the technique of X-ray photoelectron spectroscopy. No trace of elemental hafnium is observed in the deposited overlayer. Also, there is no evidence of any chemical reactivity between the overlayer and the silicon substrate over the temperature range used. The hafnium overlayer shows a mixture of the dioxide and the suboxide. The ratio of the suboxide to dioxide is observed to be more in the first type of samples. The spectral data indicate that hafnium has a strong affinity for oxygen. The overlayer gets completely oxidized to form HfO 2 at substrate temperature around 300 degree C for the first type of samples and at substrate temperature greater than 550 degree C for the second type

  8. X-Ray Photoemission Study of the Oxidation of Hafnium

    Directory of Open Access Journals (Sweden)

    A. R. Chourasia

    2009-01-01

    Full Text Available About 20 Å of hafnium were deposited on silicon substrates using the electron beam evaporation technique. Two types of samples were investigated. In one type, the substrate was kept at the ambient temperature. After the deposition, the substrate temperature was increased to 100, 200, and 300∘C. In the other type, the substrate temperature was held fixed at some value during the deposition. For this type, the substrate temperatures used were 100, 200, 300, 400, 500, 550, and 600∘C. The samples were characterized in situ by the technique of X-ray photoelectron spectroscopy. No trace of elemental hafnium is observed in the deposited overlayer. Also, there is no evidence of any chemical reactivity between the overlayer and the silicon substrate over the temperature range used. The hafnium overlayer shows a mixture of the dioxide and the suboxide. The ratio of the suboxide to dioxide is observed to be more in the first type of samples. The spectral data indicate that hafnium has a strong affinity for oxygen. The overlayer gets completely oxidized to form HfO2 at substrate temperature around 300∘C for the first type of samples and at substrate temperature greater than 550∘C for the second type.

  9. Modelling of Zirconium and Hafnium separation using continuous annular chromatography

    International Nuclear Information System (INIS)

    Moch-Setyadji; Endang Susiantini

    2014-01-01

    Nuclear degrees of zirconium in the form of a metal alloy is the main material for fuel cladding of NPP. Zirconium is also used as sheathing UO 2 kernel in the form of ZrC as a substitute of SiC in the fuel elements of High Temperature Reactor (HTR). Difficulty separating hafnium from zirconium because it has a lot of similarities in the chemical properties of Zr and Hf. Annular chromatography is a device that can be used for separating of zirconium and hafnium to obtain zirconium nuclear grade. Therefore, it is necessary to construct the mathematical modelling that can describe the separation of zirconium and hafnium in the annular chromatography containing anion resin dowex-1X8. The aim of research is to perform separation simulation by using the equilibrium model and mass transfer coefficient resulted from research. Zr and Hf feed used in this research were 26 and 1 g/l, respectively. Height of resin (L), angular velocity (ω) and the superficial flow rate (uz) was varied to determine the effect of each parameter on the separation of Zr and Hf. By using Kd and Dv values resulted previous research. Simulation results showed that zirconium and hafnium can be separated using a continuous annular chromatography with high resin (long bed) 50 cm, superficial flow rate of 0.001 cm/s, the rotation speed of 0.006 rad/min and 20 cm diameter annular. In these conditions the results obtained zirconium concentration of 10,303.226 g/m 3 and hafnium concentration of 12.324 g/m 3 (ppm). (author)

  10. Hafnium Resonance Parameter Analysis Using Neutron Capture and Transmission Experiments

    International Nuclear Information System (INIS)

    MJ Trbovich; DP Barry; RE Slovacck; Y Danon; RC Block; JA Burke; NJ Drindak; G Leinweber; RV Ballad

    2004-01-01

    The focus of this work is to determine resonance parameters for stable hafnium isotopes in the 0.005-200 eV region, with special emphasis on the overlapping 176 Hf and 178 Hf resonances near 8 eV. The large neutron cross section of hafnium, combined with its corrosion resistance and excellent mechanical properties, make it a useful material for controlling nuclear reactions. Experiments measuring neutron capture and transmission were performed at the Rensselaer Polytechnic Institute (RPI) electron linear accelerator (LINAC) using the time of flight method. 6 Li glass scintillation detectors were used for transmission experiments at flight path lengths of 15 and 25 m. Capture experiments were done using a sixteen section NaI(Tl) multiplicity detector at a flight path length of 25 m. These experiments utilized various thicknesses of metallic and isotopically-enriched liquid samples. The liquid samples were designed to provide information on the 176 Hf and 178 Hf contributions to the 8 eV doublet without saturation. Data analysis was done using the R-matrix Bayesian code SAMMY version M6 beta. SAMMY is able to account for experimental resolution effects for each of the experimental setups at the RPI LINAC, and also can correct for multiple scattering effects in neutron capture yield data. The combined capture and transmission data analysis yielded resonance parameters for all hafnium isotopes from 0.005-200 eV. Resonance integrals were calculated along with errors for each hafnium isotope using the NJOY [1] and INTER [2] codes. The isotopic resonance integrals calculated were significantly different than previously published values; however the calculated elemental hafnium resonance integral changed very little

  11. Electronic properties of hafnium oxide: A contribution from defects and traps

    Energy Technology Data Exchange (ETDEWEB)

    Gritsenko, Vladimir A., E-mail: grits@isp.nsc.ru; Perevalov, Timofey V.; Islamov, Damir R., E-mail: damir@isp.nsc.ru

    2016-02-15

    In the present article, we give a review of modern data and latest achievements pertaining to the study of electronic properties of oxygen vacancies in hafnium oxide. Hafnium oxide is a key dielectric for use in many advanced silicon devices. Oxygen vacancies in hafnium oxide largely determine the electronic properties of the material. We show that the electronic transitions between the states due to oxygen vacancies largely determine the optical absorption and luminescent properties of hafnium oxide. We discuss the role of oxygen vacancies as traps that facilitate charge transport in hafnium oxide films. Also, we demonstrate the fact that the electrical conductivity in hafnium oxide is controlled by the phonon-assisted tunnelling of charge carriers between traps that were identified as oxygen vacancies.

  12. Method of purifying zirconium tetrachloride and hafnium tetrachloride in a vapor stream

    International Nuclear Information System (INIS)

    Snyder, T.S.; Stolz, R.A.

    1992-01-01

    This patent describes a method of purifying zirconium tetrachloride and hafnium tetrachloride in a vapor stream from a sand chlorinator in which the silicon and metals present in sand fed to the chlorinator are converted to chlorides at temperatures over about 800 degrees C. It comprises cooling a vapor stream from a sand chlorinator, the vapor stream containing principally silicon tetrachloride, zirconium tetrachloride, and hafnium tetrachloride contaminated with ferric chloride, to a temperature of from about 335 degrees C to about 600 degrees C; flowing the vapor stream through a gaseous diffusion separative barrier to produce a silicon tetrachloride-containing vapor stream concentrated in zirconium tetrachloride and hafnium tetrachloride and a silicon tetrachloride-containing vapor stream depleted in zirconium tetrachloride and hafnium tetrachloride; adsorbing the ferric chloride in the separative barrier; and recovering the silicon tetrachloride stream concentrated in zirconium tetrachloride and hafnium tetrachloride separately from the silicon tetrachloride stream depleted in zirconium tetrachloride and hafnium tetrachloride

  13. Synthesis of Hafnium-Based Ceramic Materials for Ultra-High Temperature Aerospace Applications

    Science.gov (United States)

    Johnson, Sylvia; Feldman, Jay

    2004-01-01

    This project involved the synthesis of hafnium (Hf)-based ceramic powders and Hf-based precursor solutions that were suitable for preparation of Hf-based ceramics. The Hf-based ceramic materials of interest in this project were hafnium carbide (with nominal composition HE) and hafnium dioxide (HfO2). The materials were prepared at Georgia Institute of Technology and then supplied to research collaborators Dr. Sylvia Johnson and Dr. Jay Feldman) at NASA Ames Research Center.

  14. Elaboration and characterisation of yttrium oxide and hafnium oxide powders by the sol-gel process

    International Nuclear Information System (INIS)

    Hours, T.

    1988-01-01

    The two classical sol-gel processes, colloidal and polymeric are studied for the preparation of yttrium oxide and hafnium oxide high performance powders. In the colloidal process, controlled and reproducible conditions for the preparation of yttrium oxide and hafnium oxide sols from salts or alkoxides are developed and the hydrothermal synthesis monodisperse hafnium oxide colloids is studied. The polymeric process is studied with hafnium ethyl-hexylate, hydrolysis kinetics for controlled preparation of sols and gels is investigated. Each step of preparation is detailed and powders obtained are characterized [fr

  15. Design and fabrication of hafnium tube to control the power of the irradiation test fuel in HANARO

    Energy Technology Data Exchange (ETDEWEB)

    Kim, D. H.; Lee, C. B.; Kim, Y. M.; Yang, Y. S.; Jung, Y. H

    2003-05-01

    For the irradiation test at HANARO, non-instrumentation capsule was manufactured and hafnium tube was used to control LHGR of HANARO. Hafnium tube can control the irradiation condition of HANARO similar to that of commercial reactor. Hafnium tube thickness was determined by the LHGR calculated at OR-4 irradiation hole to be installed the non-instrumented capsule. To fabricate the hafnium tube with hafnium plate, the fabrication method was determined by using the hafnium mechanical properties. And the tensile strength of hafnium was confirmed by tensile test. This report is confirmed the LHGR control at the OR-4 and the Hafnium fabrication for in used which the AFPCAP non-instrumented irradiation capsule.

  16. Pentamethylcyclopentadienyl Zirconium and Hafnium Polyhydride Complexes : Synthesis, Structure, and Reactivity

    NARCIS (Netherlands)

    Visser, Cindy; Hende, Johannes R. van den; Meetsma, Auke; Hessen, Bart; Teuben, Jan H.

    2001-01-01

    The half-sandwich zirconium and hafnium N,N-dimethylaminopropyl complexes Cp*M[(CH2)3NMe2]Cl2 (Cp* = η5-C5Me5, M = Zr, 1; Hf, 2) and Cp*M[(CH2)3NMe2]2Cl (M = Zr, 3; Hf, 4) were synthesized by mono- or dialkylation of Cp*MCl3 with the corresponding alkyllithium and Grignard reagents. Hydrogenolysis

  17. Separation of zirconium from hafnium by ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Felipe, Elaine C.B.; Palhares, Hugo G.; Ladeira, Ana Claudia Q., E-mail: elainecfelipe@yahoo.com.br, E-mail: hugopalhares@gmail.com, E-mail: ana.ladeira@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Zirconium and hafnium are two of the most important metals for the nuclear industry. Hafnium occurs in all zirconium ores usually in the range 2 - 3%. However, for the most nuclear industry applications, it is necessary to use a zirconium of extremely pure level. The current work consists in the separation of zirconium and hafnium by the ion exchange method in order to obtain a zirconium concentrate of high purity. The zirconium and hafnium liquors were produced from the leaching of the Zr(OH){sub 4} and Hf(OH){sub 4} with nitric acid for 24 hours. From these two liquors it was prepared one solution containing 7.5 x 10{sup -2} mol L{sup -1} of Zr and 5.8 x 10{sup -3} mol L{sup -1} of Hf with acidity of 1 M. Ion exchange experiments were carried out in batch with the resins Dowex 50WX4, Dowex 50WX8 100, Dowex 50WX8 50, Amberlite IR-120 and Marathon C at constant temperature 28 deg C. Other variables such as, acidity and agitation were kept constant. The data were adjusted to Langmuir equation in order to calculate the maximum loading capacity (q{sub max}) of the resins, the distribution coefficient (K{sub d}) for Zr and Hf and the separation factor (α{sub Hf}{sup Zr} ). The results of maximum loading capacity (q{sub max}) for Zr and Hf, in mmol g{sup -}1, showed that the most suitable resins for columns experiments are: Dowex 50WX4 50 (q{sub max} Z{sub r} = 2.21, Hf = 0.18), Dowex 50WX8 50 (q{sub max} Zr = 1.89, Hf = 0.13) and Amberlite (q{sub max} Zr = 1.64, Hf = 0.12). However, separations factors, α{sub Hf}{sup Zr}, showed that the resins are not selective. (author)

  18. Evolution of the hafnium isotopic composition in the RBMK reactor

    International Nuclear Information System (INIS)

    Jurkevicius, A.; Remeikis, V.

    2002-01-01

    The isotopic composition of hafnium in the radial neutron flux sensor of the RBMK-1500 reactor, the rates of the neutron absorption on Hf isotopes and the neutron spectrum in the sensor were numerically modeled. The sequence SAS2 (Shielding Analysis Sequence) program from the package SCALE 4.4A and the HELIOS code system were used for calculations. It has been obtained that the overall neutron absorption rates in hafnium for the sensors located in the 2.4 % and 2.6 % enrichment uranium-erbium nuclear fuel assemblies are by 16 % and 19 % lower than in the 2.0 % enrichment uranium nuclear fuel assemblies. The overall neutron absorption rate in hafnium decreases 2.70-2.75 times due to the sensor burnup to 5800 MW d. The sensitivity of the Hf sensors to the thermal neutron flux increases twice due to the nuclear fuel assembly burnup to 3000 MW d. The corrective factors ξ d (I) at the different integral current I of the sensors and ξ td (E) at the different burnup E of the nuclear fuel assemblies were calculated. The obtained dependence ξ d (I) calculated numerically was compared to the experimental one determined by comparing signals of the fresh sensor and the sensor with the integral current I and by processing repeated calibration results of Hf sensors in RBMK-1500 reactors. The relative relationship coefficients K T (T FA ) were found for all RBMK-1500 nuclear fuel types. (author)

  19. Recovery of hafnium radioisotopes from a proton irradiated tantalum target

    International Nuclear Information System (INIS)

    Taylor, W.A.; Garcia, J.G.; Hamilton, V.T.; Heaton, R.C.; Jamriska, D.J.; Ott, M.A.; Philips, D.R.; Radzinski, S.D.

    1998-01-01

    The 178m2 Hf nucleus, with its long half-life (31 y) and high-spin isomeric state (16 + ) is desired for new and exotic nuclear physics studies. The Los Alamos Radioisotope Program irradiated a kilogram of natural tantalum at the Los Alamos Meson Physics Facility in early 1981. After fifteen years of decay, this target was ideal for the recovery of 178m2 Hf. There was more than a millicurie of 178m2 Hf produced during this irradiation and there has been a sufficient period of time for most of the other hafnium radioisotopes to decayed away. Traditionally, separation techniques for recovering hafnium isotopes from tantalum targets employ solvent extractions with reagents that are considered hazardous. These techniques are no longer condoned because they generate a mixed-waste (radioactive and hazardous components) that can not be treated for disposal. In this paper we describe a new and unique procedure for the recovery of hafnium radioisotopes from a highly radioactive, proton irradiated, tantalum target using reagents that do not contribute a hazardous waste component. (author)

  20. Zirconium and hafnium in the southeastern Atlantic States

    Science.gov (United States)

    Mertie, J.B.

    1958-01-01

    The principal source of zirconium and hafnium is zircon, though a minor source is baddeleyite, mined only in Brazil. Zircon is an accessory mineral in igneous, metamorphic, and sedimentary rocks, but rarely occurs in hardrock in minable quantities. The principal sources of zircon are therefore alluvial deposits, which are mined in many countries of five continents. The principal commercial deposits in the United States are in Florida, though others exist elsewhere in the southeastern Coastal Plain. The evidence indicates that conditions for the accumulation of workable deposits of heavy minerals were more favorable during the interglacial stages of the Pleistocene epoch than during Recent time. Therefore detrital ores of large volume and high tenor are more likely to be found in the terrace deposits than along the present beaches. Other concentrations of heavy minerals, however, are possible at favored sites close to the Fall Line where the Tuscaloosa formation rests upon the crystalline rocks of the Piedmont province. A score of heavy and semiheavy minerals occur in the detrital deposits of Florida, but the principal salable minerals are ilmenite, leucoxene, rutile, and zircon, though monazite and staurolite are saved at some mining plants. Commercial deposits of heavy minerals are generally required to have a tenor of 4 percent, though ores with a lower tenor can be mined at a profit if the content of monazite is notably high. The percentages of zircon in the concentrates ranges from 10 to 16 percent, and in eastern Florida from 13 to 15 percent. Thus the tenor in zircon of the ore-bearing sands ranges from 0.4 to 0.6 percent. The content of hafnium in zircon is immaterial for many uses, but for some purposes very high or very low tenors in hafnium are required. Alluvial zircon cannot be separated into such varieties, which, if needed, must be obtained from sources in bedrock. It thus becomes necessary to determine the Hf : Zr ratios in zircon from many kinds of

  1. On the stabilization of niobium(V) solutions by zirconium(IV) and hafnium(IV)

    DEFF Research Database (Denmark)

    Sørensen, E.; Bjerre, A.B.

    1992-01-01

    Niobium cannot be separated from zirconium or hafnium when these elements occur together in solution with common anions such as chloride and sulphate. This is ascribed to the co-polymerization of niobium(V) and the hydrolysed ionic species of zirconium(IV) and hafnium(IV) to form colloidal...

  2. Use of X-ray fluorescence analysis for the determination of hafnium in zircalloys

    International Nuclear Information System (INIS)

    Sato, I.M.; Salvador, V.L.R.; Lordello, A.R.

    1985-01-01

    The determination of hafnium at trace levels (ppm) in the presence of zirconium by X-ray fluorescence technique is presented. The samples were prepared in the form of double-layer pellets, with boric acid as the binding material. The most sensitive first order line of hafnium HfLα (0.157 nm), which is used analyticaly, has approximately 67% overlapping with second order line of zirconium ZrKα 1 , (0.079 nm). As the excitation potencial of zirconium is larger than hafnium, the best condition was selected, so that the interference of zirconium intensity would not be significant in hafnium analytical line. The method allowed the determination of hafnium above 5.0 ppm (LLd = 1.5 ppm) with an accuracy of less than 10%. (Author) [pt

  3. Preparation of complexes of zirconium and hafnium tetrachlorides with phosphorus oxychloride

    International Nuclear Information System (INIS)

    Snyder, T.S.; Stoltz, R.A.

    1989-01-01

    This patent describes an improvement in a method for separating hafnium chloride from zirconium chloride using a distillation column, with a hafnium chloride enriched vapor stream taken from the top of the column and a zirconium enriched chloride stream taken from the bottom of the column. The improvement comprising: purifying the zirconium-hafnium chloride in a molten salt purification vessel prior to or after introduction into the distillation column to substantially eliminate iron chloride from the zirconium-hafnium chloride by at least periodically removing iron chloride from the molten salt purification vessel by electrochemically plating iron onto an electrode in the molten salt purification vessel. The molten salt in the molten salt purification vessel consisting essentially of a mixture of chlorides selected from the group consisting of alkali metals, alkaline earth metals, zirconium, hafnium, aluminum, manganese, and zinc

  4. Properties of neutron-rich hafnium high-spin isomers

    CERN Multimedia

    Tungate, G; Walker, P M; Neyens, G; Billowes, J; Flanagan, K; Koester, U H; Litvinov, Y

    It is proposed to study highly-excited multi-quasiparticle isomers in neutron-rich hafnium (Z=72) isotopes. Long half-lives have already been measured for such isomers in the storage ring at GSI, ensuring their accessibility with ISOL production. The present proposal focuses on:\\\\ (i) an on-line experiment to measure isomer properties in $^{183}$Hf and $^{184}$Hf, and\\\\ (ii) an off-line molecular breakup test using REXTRAP, to provide Hf$^{+}$ beams for future laser spectroscopy and greater sensitivity for the future study of more neutron-rich isotopes.

  5. Studies on Optical and Electrical Properties of Hafnium Oxide Nanoparticles

    Science.gov (United States)

    Jayaraman, Venkatachalam; Sagadevan, Suresh; Sudhakar, Rajesh

    2017-07-01

    In this paper, the synthesis and physico-chemical properties of hafnium oxide nanoparticles (HfO2 NPs) are analyzed and reported. The synthesis was carried out by the precipitation route by using hafnium tetrachloride (HfCl4) as precursor material with potassium hydroxide (KOH) dissolved in Millipore water. In the precipitation technique, the chemical reaction is comparatively simple, low-cost and non-toxic compared to other synthetic methods. The synthesized HfO2 NPs were characterized by using powder x-ray diffraction (PXRD), ultraviolet-visible (UV-Vis) spectroscopy, Raman analysis, and high-resolution transmission electron microscopy (HRTEM). The monoclinic structure of the HfO2 NPs was resolved utilizing x-ray diffraction (XRD). The optical properties were studied from the UV-Vis absorption spectrum. The optical band gap of the HfO2NPs was observed to be 5.1 eV. The Raman spectrum shows the presence of HfO2 NPs. The HRTEM image showed that the HfO2 NPs were of spherical shape with an average particle size of around 28 nm. The energy-dispersive x-ray spectroscopy (EDS) spectrum obviously demonstrated the presence of HfO2 NPs. Analysis and studies on the dielectric properties of the HfO2 NPs such as the dielectric constant, the dielectric loss, and alternating current (AC) conductivity were carried out at varying frequencies and temperatures.

  6. Corrosion potentials of hafnium in molten alkaline-earth metal chlorides

    International Nuclear Information System (INIS)

    Kovalik, O.Yu.; Tkhaj, V.D.

    2000-01-01

    Corrosion potentials of hafnium in molten calcium, strontium and barium chlorides are measured and their temperature dependences are determined. It is stated that the corrosion potential of hafnium becomes more electropositive with an increase of the environment temperature. If the temperature is the same the potential shifts to the interval of more electronegative values in the row of CaCl 2 , SrCl 2 , BaCl 2 which corresponds to a lesser corrosion rate in environments positioned from left to right. the comparison of hafnium corrosion potentials with previously measured values for titanium and zirconium shows that a metal activity decrease results in a more electronegative corrosion potential [ru

  7. Hafnium-Based Contrast Agents for X-ray Computed Tomography.

    Science.gov (United States)

    Berger, Markus; Bauser, Marcus; Frenzel, Thomas; Hilger, Christoph Stephan; Jost, Gregor; Lauria, Silvia; Morgenstern, Bernd; Neis, Christian; Pietsch, Hubertus; Sülzle, Detlev; Hegetschweiler, Kaspar

    2017-05-15

    Heavy-metal-based contrast agents (CAs) offer enhanced X-ray absorption for X-ray computed tomography (CT) compared to the currently used iodinated CAs. We report the discovery of new lanthanide and hafnium azainositol complexes and their optimization with respect to high water solubility and stability. Our efforts culminated in the synthesis of BAY-576, an uncharged hafnium complex with 3:2 stoichiometry and broken complex symmetry. The superior properties of this asymmetrically substituted hafnium CA were demonstrated by a CT angiography study in rabbits that revealed excellent signal contrast enhancement.

  8. Solvent extraction of zirconium and hafnium using MIBK-HSCN-HCL process

    International Nuclear Information System (INIS)

    Borges, J.A.L.; Cunha, O.G.C. da

    1985-01-01

    The separation process of zirconium and hafnium, using MIBK as extractant in a set of mixer-settler is described. The chemical analysis was done by X-ray fluorescence and emission spectrography. (Author) [pt

  9. Hafnium as a prospective absorber for VVER-1000 reactors of Ukraine

    International Nuclear Information System (INIS)

    Afanas'ev, A.A.; Konotop, Yu.F.; Odejchuk, N.L.

    2000-01-01

    Nuclear-physical parameters of hafnium having in mind its use as an absorber, are considered. Technical aspects of Hf production are exposed. Use of B 4 C/Hf absorber is twice cheaper than a standard one

  10. Spectrofluorimetric determination of hafnium and zirconium with 3,7-dihydroxyflavone

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Takushi; Suzuki, Osamu; Seuzuki, Tetsuo; Murata, Akira

    1986-04-01

    The absorptive and fluorescent characteristics of the hafnium and zirconium complexes of 3-hydroxyflavone and its 12 hydroxy and methoxy derivatives have been studied. The fluorescence of the 1:1 hafnium - 3,7-dihydroxyflavone complex (lambdasub(ex.)397 nm,lambdasub(em.) 465 nm) in 3 M hydrochloric acid has been used to determine 2-40 ng ml/sup -1/ of hafnium. The fluorescence of the 1:1 zirconium - 3,7-dihydroxyflavone complex (lambdasub(ex.) 395 nm, lambda sub(em.) 465 nm) at pH 2.0 in 0.02 M sulphate solution has been used to determine 2-40 ng ml/sup -1/ of zirconium. These methods are very sensitive and can be used for the simultaneous determination of hafnium and zirconium with an error of about 5%.

  11. Electronic structure of pentacene on hafnium studied by ultraviolet photoelectron spectroscopy

    International Nuclear Information System (INIS)

    Kang, Seong Jun; Yi, Yeon Jin; Kim, Chung Yi; Whang, Chung Nam

    2005-01-01

    The electronic structure of pentacene on hafnium, which is a low work function metal, was analyzed by using ultraviolet photoelectron spectroscopy. The energy level alignment was studied by using the onset of the highest occupied molecular orbital level and the shift of the vacuum level of the pentacene layer, which was deposited on a clean hafnium surface in a stepwise manner. The measured onset of the highest occupied molecular orbital energy level was 1.52 eV from the Fermi level of hafnium. The vacuum level was shifted 0.28 eV toward higher binding energy with additional pentacene layers, which means an interfacial dipole exists at the interface between pentacene and hafnium. We confirm that a small electron injection barrier can be achieved by inserting a low work function metal in a pentacene thin-film transistor.

  12. Compositional characterization of hafnium alloy used as control rod material in nuclear reactor

    International Nuclear Information System (INIS)

    Sharma, P.K.; Bassan, M.K.T.; Avhad, D.K.; Singhal, R.K.

    2014-01-01

    Hafnium (Hf) is a heavy, steel-gray metal in the reactive metals group that is very closely related to zirconium (Zr) and forms a continuous solid-solution at all concentrations of zirconium and hafnium. Hafnium occurs naturally with zirconium at a ratio of approximately 1:50 and is produced exclusively as a co-product of nuclear-grade zirconium. It is used in a variety of applications where few substitutes are available. Thus with its relatively high thermal neutron absorption cross-section, hafnium's biggest application is as control rod material in nuclear reactors. During this work, major (Zirconium (Zr), Cobalt (Co) and Molybdenum (Mo)) and trace ((Iron (Fe), Nickel (Ni) and Titanium (Ti)) elements were measured in the bulk matrices of Hf. These materials are also associated with other impurities such as O, N, H etc.

  13. Evaluation of thermodynamic data on zirconium and hafnium halides and oxyhalides by means of transport experiments

    International Nuclear Information System (INIS)

    Dittmer, G.; Niemann, U.

    1987-01-01

    A consistent set of thermodynamic data for zirconium and hafnium halides, oxides and oxyhalides was achieved. It was found that formation enthalpies of gaseous compounds could be derived from solubility measurements together with theoretical estimations and a revision of literature data. Free energy functions were calculated employing statistical mechanics. Data for liquid and solid compounds were obtained via sublimation and vaporization data. Chemical equilibria of zirconium and hafnium with halogens are discussed. 51 refs.; 16 figs.; 14 tabs

  14. Investigation of chlorination of zirconium and hafnium and their compounds in discharge from hollow cathode

    International Nuclear Information System (INIS)

    Ioffe, R.B.; Korovin, Yu.I.

    1978-01-01

    The possibility is investigated of chlorinating various zirconium and hafnium compounds (metal, oxide, carbide) in a hot discharge from a hollow cathode with various chlorinating reagents: copper monochloride, nickel chloride, magnesium chloride, for the purpose of accelerating their entrance into the excitation zone. It has been shown thermodynamically and experimentally that chlorination of metal zirconium and hafnium and their carbides with copper monochloride in hot hollow cathode conditions provides a sharp increase in the intensity of the lines of these elements

  15. Knight shift in scandium and its alloys with hafnium and titanium

    International Nuclear Information System (INIS)

    Chachkhiani, Z.B.; Chechernikov, V.I.; Martynova, L.F.; Nidel'ko, V.I.; Chachkhiani, L.G.; Georgadze, G.S.

    1981-01-01

    Results of the investigation of NMR on 45 Sc nuclei and magnetic susceptibility of scandium and its solid solutions with titanium and hafnium are presented. It is shown that the existing hybridization of S and d zones in pure scandium and its alloys with titanium and hafnium affects the Knight shift reducing the value of the contact contribution. The temperature behaviour of the Knight shift from the temperature dependence and spin susceptibility of collectivized d electrons [ru

  16. Application of hafnium hydride control rod to large sodium cooled fast breeder reactor

    Energy Technology Data Exchange (ETDEWEB)

    Ikeda, Kazumi, E-mail: kazumi_ikeda@mfbr.mhi.co.jp [Mitsubishi FBR Systems, Inc., 34-17, Jingumae 2-Chome, Shibuya-ku, Tokyo 150-0001 (Japan); Moriwaki, Hiroyuki, E-mail: hiroyuki_moriwaki@mfbr.mhi.co.jp [Mitsubishi FBR Systems, Inc., 34-17, Jingumae 2-Chome, Shibuya-ku, Tokyo 150-0001 (Japan); Ohkubo, Yoshiyuki, E-mail: yoshiyuki_okubo@mfbr.mhi.co.jp [Mitsubishi FBR Systems, Inc., 34-17, Jingumae 2-Chome, Shibuya-ku, Tokyo 150-0001 (Japan); Iwasaki, Tomohiko, E-mail: tomohiko.iwasaki@qse.tohoku.ac.jp [Department of Quantum Science and Energy Engineering, Tohoku University, Aoba, Aramaki, Aoba-ku, Sendai-shi, Miyagi-ken 980-8579 (Japan); Konashi, Kenji, E-mail: konashi@imr.tohoku.ac.jp [Institute for Materials Research, Tohoku University, Narita-cho, Oarai-machi, Higashi-Ibaraki-gun, Ibaraki-ken 311-1313 (Japan)

    2014-10-15

    Highlights: • Application of hafnium hydride control rod to large sodium cooled fast breeder reactor. • This paper treats application of an innovative hafnium hydride control rod to a large sodium cooled fast breeder reactor. • Hydrogen absorption triples the reactivity worth by neutron spectrum shift at H/Hf ratio of 1.3. • Lifetime of the control rod quadruples because produced daughters of hafnium isotopes are absorbers. • Nuclear and thermal hydraulic characteristics of the reactor are as good as or better than B-10 enriched boron carbide. - Abstract: This study treats the feasibility of long-lived hafnium hydride control rod in a large sodium-cooled fast breeder reactor by nuclear and thermal analyses. According to the nuclear calculations, it is found that hydrogen absorption of hafnium triples the reactivity by the neutron spectrum shift at the H/Hf ratio of 1.3, and a hafnium transmutation mechanism that produced daughters are absorbers quadruples the lifetime due to a low incineration rate of absorbing nuclides under irradiation. That is to say, the control rod can function well for a long time because an irradiation of 2400 EFPD reduces the reactivity by only 4%. The calculation also reveals that the hafnium hydride control rod can apply to the reactor in that nuclear and thermal characteristics become as good as or better than 80% B-10 enriched boron carbide. For example, the maximum linear heat rate becomes 3% lower. Owing to the better power distribution, the required flow rate decreases approximately by 1%. Consequently, it is concluded on desk analyses that the long lived hafnium hydride control rod is feasible in the large sodium-cooled fast breeder reactor.

  17. Dielectric response and ac conductivity analysis of hafnium oxide nanopowder

    International Nuclear Information System (INIS)

    Karahaliou, P K; Xanthopoulos, N; Krontiras, C A; Georga, S N

    2012-01-01

    The dielectric response of hafnium oxide nanopowder was studied in the frequency range of 10 -2 -10 6 MHz and in the temperature range of 20-180 °C. Broadband dielectric spectroscopy was applied and the experimental results were analyzed and discussed using the electric modulus (M*) and alternating current (ac) conductivity formalisms. The analyses of the dc conductivity and electric modulus data revealed the presence of mechanisms which are thermally activated, both with almost the same activation energy of 1.01 eV. A fitting procedure involving the superposition of the thermally activated dc conductivity, the universal dielectric responce and the near constant loss terms has been used to describe the frequency evolution of the real part of the specific electrical conductivity. The conductivity master curve was obtained, suggesting that the time-temperature superposition principle applies for the studied system, thus implying that the conductivity mechanisms are temperature independent.

  18. Amorphous Hafnium-Indium-Zinc Oxide Semiconductor Thin Film Transistors

    Directory of Open Access Journals (Sweden)

    Sheng-Po Chang

    2012-01-01

    Full Text Available We reported on the performance and electrical properties of co-sputtering-processed amorphous hafnium-indium-zinc oxide (α-HfIZO thin film transistors (TFTs. Co-sputtering-processed α-HfIZO thin films have shown an amorphous phase in nature. We could modulate the In, Hf, and Zn components by changing the co-sputtering power. Additionally, the chemical composition of α-HfIZO had a significant effect on reliability, hysteresis, field-effect mobility (μFE, carrier concentration, and subthreshold swing (S of the device. Our results indicated that we could successfully and easily fabricate α-HfIZO TFTs with excellent performance by the co-sputtering process. Co-sputtering-processed α-HfIZO TFTs were fabricated with an on/off current ratio of ~106, higher mobility, and a subthreshold slope as steep as 0.55 V/dec.

  19. Determination of hafnium with the inductively coupled plasma (ICP)

    International Nuclear Information System (INIS)

    Wuensch, G.; Pose, K.

    1985-01-01

    The relative intensities of 198 hafnium lines in the Ar-ICP are listed. Spectral interference tables are given for the 9 analytically best lines, covering the range of +-60 pm around the Hf-lines. They include measured (not calculated) data of the interferent equivalent concentrations (IEC) and the critical concentration ratios (CCR) for 115 lines of all 34 possibly interfering elements. In many cases, these IEC- or CCR-data differ by 1 or 2 orders of magnitude from those calculated from intensities observed in the NBS-copper arc. Since no intense Hf-line is free from spectral interferences, examples are given for the calculation of the most suitable line for a known matrix. (orig.) [de

  20. Separation of zirconium--hafnium by nitride precipitation

    International Nuclear Information System (INIS)

    Anderson, R.N.; Parlee, N.A.

    1977-01-01

    A method is described for the separation of a light reactive metal (e.g., zirconium) from a heavy reactive metal (e.g., hafnium) by forming insoluble nitrides of the metals in a molten metal solvent (e.g., copper) inert to nitrogen and having a suitable density for the light metal nitride to form a separate phase in the upper portion of the solvent and for the heavy metal nitride to form a separate phase in the lower portion of the solvent. Nitriding is performed by maintaining a nitrogen-containing atmosphere over the bath. The light and heavy metals may be an oxide mixture and carbothermically reduced to metal form in the same bath used for nitriding. The nitrides are then separately removed and decomposed to form the desired separate metals. 16 claims, 1 figure

  1. Systematic investigation of electromagnetic properties of all stable hafnium isotopes

    International Nuclear Information System (INIS)

    Napiorkowski, T.J.; Choinski, J.; Czosnyka, T.; Iwanicki, J.; Kownacki, J.; Zemlo, L.; Srebrny, J.; Starosta, K.; Boer, J. de.; Gollwitzer, A.; Loewe, M.; Wuerkner, M.; Guenther, C.; Weber, T.; Hagemann, G.; Sletten, G.

    1996-01-01

    In a systematic investigation of the electromagnetic structure of hafnium stable isotopes enriched targets of 176, 177, 178, 179, 180 Hf were Coulomb exciting using: 67 MeV 19 F beam from NBITAL FN Tandem, 125 MeV 32 S beam from MP Tandem in Accelerator Laboratory LMU and TU Munich, 225 MeV 58 Ni beam from NBITAL FN Tandem plus 2 Liniac Boosters complex. Scattered particle-gamma as well as p-γ-γ coincidence were registered. A further simultaneous analysis of Coulomb excitation cross section as a function of scattering angle of 19 F, 32 S, 58 Ni projectiles should be sufficient to deduce reduced probabilities of E2 transitions in ground state band

  2. 12 CFR 308.173 - Prevailing party.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Prevailing party. 308.173 Section 308.173 Banks....173 Prevailing party. (a) General rule. An eligible applicant who, following an adversary adjudication has gained victory on the merits in the proceeding is a “prevailing party”. An eligible applicant may...

  3. 49 CFR 173.323 - Ethylene oxide.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Ethylene oxide. 173.323 Section 173.323... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.323 Ethylene oxide. (a) For packaging ethylene oxide in non-bulk packagings, silver mercury or any of its alloys or copper may not be used in any...

  4. 21 CFR 173.230 - Ethylene dichloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Ethylene dichloride. 173.230 Section 173.230 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.230 Ethylene dichloride. A tolerance of 30 parts per million is established for ethylene dichloride in spice oleoresins when present therein...

  5. 49 CFR 173.443 - Contamination control.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Contamination control. 173.443 Section 173.443... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.443 Contamination control. (a) The level of non-fixed (removable) radioactive contamination on the external surfaces of each package offered for...

  6. 21 CFR 173.290 - Trichloroethylene.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Trichloroethylene. 173.290 Section 173.290 Food and..., Lubricants, Release Agents and Related Substances § 173.290 Trichloroethylene. Tolerances are established for residues of trichloroethylene resulting from its use as a solvent in the manufacture of foods as follows...

  7. 21 CFR 173.160 - Candida guilliermondii.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Candida guilliermondii. 173.160 Section 173.160... CONSUMPTION Enzyme Preparations and Microorganisms § 173.160 Candida guilliermondii. The food additive Candida... the following conditions: (a) The food additive is the enzyme system of the viable organism Candida...

  8. 21 CFR 173.255 - Methylene chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methylene chloride. 173.255 Section 173.255 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.255 Methylene chloride. Methylene chloride may be present in food under the following conditions: (a) In spice oleoresins as a residue from...

  9. 21 CFR 173.375 - Cetylpyridinium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Cetylpyridinium chloride. 173.375 Section 173.375... CONSUMPTION Specific Usage Additives § 173.375 Cetylpyridinium chloride. Cetylpyridinium chloride (CAS Reg. No....1666 of this chapter, at a concentration of 1.5 times that of cetylpyridinium chloride. (c) The...

  10. 49 CFR 173.322 - Ethyl chloride.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Ethyl chloride. 173.322 Section 173.322 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.322 Ethyl chloride. Ethyl chloride must be...

  11. 21 CFR 173.210 - Acetone.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetone. 173.210 Section 173.210 Food and Drugs..., Lubricants, Release Agents and Related Substances § 173.210 Acetone. A tolerance of 30 parts per million is established for acetone in spice oleoresins when present therein as a residue from the extraction of spice. ...

  12. 19 CFR 173.0 - Scope.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Scope. 173.0 Section 173.0 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.0 Scope. This part deals with the general authority of review, the...

  13. 22 CFR 17.3 - Fault.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fault. 17.3 Section 17.3 Foreign Relations...) § 17.3 Fault. A recipient of an overpayment is without fault if he or she performed no act of... agency may have been at fault in initiating an overpayment will not necessarily relieve the individual...

  14. 33 CFR 173.17 - Reciprocity.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Reciprocity. 173.17 Section 173.17 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Numbering § 173.17 Reciprocity. (a) Section...

  15. Synthesis and characterization of hafnium oxide for luminescent applications

    International Nuclear Information System (INIS)

    Guzman Mendoza, J.; Aguilar Frutis, M.A.; Flores, G. Alarcon; Garcia Hipolito, M.; Azorin Nieto, J.; Rivera Montalvo, T.; Falcony, C.

    2008-01-01

    Full text: Hafnium oxide (HfO 2 ) is a material with a wide range of possible technological applications because it's chemical and physical properties such as high melting point, high chemical stability, high refraction index, high dielectric constant and hardness near to diamond in the tetragonal phase. The large energy gap and low phonon frequencies of the HfO 2 makes it appropriate as a host matrix for been doped with rare earth activators. Efficient luminescent materials find wide application in electroluminescent flat panel displays; color plasma displays panels, scintillators, cathode ray tubes, fluorescent lamps, lasers, etc. In recent years the study of luminescent materials based on HfO 2 has been intensified. Some groups have studied the optical properties of doped and undoped HfO 2 . In this contribution, Hafnium Oxide (HfO 2 ) films were prepared using the spray pyrolysis deposition technique. The material was synthesized using chlorides as raw materials in deionised water as solvent and deposited on Corning glass substrates at temperatures from 300 deg C to 600 deg C. For substrate temperatures lower than 400 deg C, the deposited films are amorphous, while for substrate temperatures higher than 450 deg C, the monoclinic phase of HfO 2 appears. Scanning electron microscopy with microprobe analysis was use to observe the microstructure and obtain the chemical composition of the films; rough surfaces with spherical particles were appreciated. UV and low energy X Ray radiations were used in order to achieve the thermoluminescent characterization of the films as a function of the deposition temperature

  16. Pyroelectricity of silicon-doped hafnium oxide thin films

    Science.gov (United States)

    Jachalke, Sven; Schenk, Tony; Park, Min Hyuk; Schroeder, Uwe; Mikolajick, Thomas; Stöcker, Hartmut; Mehner, Erik; Meyer, Dirk C.

    2018-04-01

    Ferroelectricity in hafnium oxide thin films is known to be induced by various doping elements and in solid-solution with zirconia. While a wealth of studies is focused on their basic ferroelectric properties and memory applications, thorough studies of the related pyroelectric properties and their application potential are only rarely found. This work investigates the impact of Si doping on the phase composition and ferro- as well as pyroelectric properties of thin film capacitors. Dynamic hysteresis measurements and the field-free Sharp-Garn method were used to correlate the reported orthorhombic phase fractions with the remanent polarization and pyroelectric coefficient. Maximum values of 8.21 µC cm-2 and -46.2 µC K-1 m-2 for remanent polarization and pyroelectric coefficient were found for a Si content of 2.0 at%, respectively. Moreover, temperature-dependent measurements reveal nearly constant values for the pyroelectric coefficient and remanent polarization over the temperature range of 0 ° C to 170 ° C , which make the material a promising candidate for IR sensor and energy conversion applications beyond the commonly discussed use in memory applications.

  17. Hafnium oxide nanoparticles: toward an in vitro predictive biological effect?

    International Nuclear Information System (INIS)

    Marill, Julie; Anesary, Naeemunnisa Mohamed; Zhang, Ping; Vivet, Sonia; Borghi, Elsa; Levy, Laurent; Pottier, Agnes

    2014-01-01

    Hafnium oxide, NBTXR3 nanoparticles were designed for high dose energy deposition within cancer cells when exposed to ionizing radiation. The purpose of this study was to assess the possibility of predicting in vitro the biological effect of NBTXR3 nanoparticles when exposed to ionizing radiation. Cellular uptake of NBTXR3 nanoparticles was assessed in a panel of human cancer cell lines (radioresistant and radiosensitive) by transmission electron microscopy. The radioenhancement of NBTXR3 nanoparticles was measured by the clonogenic survival assay. NBTXR3 nanoparticles were taken up by cells in a concentration dependent manner, forming clusters in the cytoplasm. Differential nanoparticle uptake was observed between epithelial and mesenchymal or glioblastoma cell lines. The dose enhancement factor increased with increase NBTXR3 nanoparticle concentration and radiation dose. Beyond a minimum number of clusters per cell, the radioenhancement of NBTXR3 nanoparticles could be estimated from the radiation dose delivered and the radiosensitivity of the cancer cell lines. Our preliminary results suggest a predictable in vitro biological effect of NBTXR3 nanoparticles exposed to ionizing radiation

  18. Studies of high-K isomers in hafnium nuclei

    International Nuclear Information System (INIS)

    Sletten, G.; Gjoerup, N.L.

    1991-01-01

    K-isomeric states built on high-Ω Nilsson orbitals from deformation-aligned high-j levels near the Fermi surface are found to cluster in the neutron rich Hf, W and Os nuclei. It has been shown that some of the high seniority states of this type have decay properties that indicate strong mixing of configurations and that in Osmium nuclei γ-softness cause strong deviations from the well established K-selection rule. Also in the Hafnium nuclei is the expected forbiddenness in isomeric decays an order of magnitude smaller than expected from the K-selection rule. A new 9 quasiparticle isomer has been discovered in 175 Hf at I=57/2. This isomer has the anomalous decay as the dominant mode. Other lower seniority states are also identified. At spin 35/2 and 45/2 the deformation aligned states become yrast, but the structure of the yrast line to even higher spins is not yet understood. (author)

  19. Luminescent determination of zirconium and hafnium with myricetin

    International Nuclear Information System (INIS)

    Talipov, Sh.T.; Zel'tser, L.E.; Morozova, L.A.; Tashkhodzhaev, A.T.

    1978-01-01

    Reaction of formation of 3, 5, 7, 3', 4', 5' - hexaoxiflavone - myricetin complexes with zirconium and hafnium ions has been the basis for development of luminescent method of determining these elements. Optimum conditions for complexing have been determined. For Hf they are : 8-9 HCl concentration, maximum fluorescence wave length (lambda fl.)of 520 nm, wave length of exciting light (lambda el) of 436 nm, for Zr lambda fl = 536nm, lambda el = 436 nm. Stable fluorescence establishes after 25 min. for Zr and after 15 min for Hf in the presence of 40% ethanol. Usage of various camouflage agents has permitted to attain high selectivity of the method. Possibility for determination of Zr with myricetin in the presence of a 10-time excess of Hf, Cr, Cu, 50-time excess of Mo and Ti is shown. Sensitivity of Zr determination is 2.0x10 μg -2 /ml, for Hf it is 9.0x10 μg -3 and mineral waters

  20. Composition and microstructure of zirconium and hafnium germanates obtained by different chemical routes

    International Nuclear Information System (INIS)

    Utkin, A.V.; Prokip, V.E.; Baklanova, N.I.

    2014-01-01

    The phase composition and morphology of zirconium and hafnium germanates synthesized by ceramic and co-precipitation routes were studied. The products were characterized using high-temperature X-ray diffraction analysis (XRD), Raman spectroscopy, scanning electron microscopy (SEM) and thermal (TG/DTA) analysis. To investigate the phase composition and stoichiometry of compounds the unit cell parameters were refined by full-profile Rietveld XRD analysis. The morphology of products and its evolution during high-temperature treatment was examined by SEM analysis. It was stated that there is the strong dependence of the phase composition and morphology of products on the preparation route. The ceramic route requires a multi-stage high-temperature treatment to obtain zirconium and hafnium germanates of 95% purity or more. Also, there are strong diffusion limitations to obtain hafnium germanate Hf 3 GeO 8 by ceramic route. On the contrary, the co-precipitation route leads to the formation of nanocrystalline single phase germanates of stoichiometric composition at a relatively low temperatures (less than 1000 °C). The results of quantitative XRD analysis showed the hafnium germanates are stoichiometric compounds in contrast to zirconium germanates that form a set of solid solutions. This distinction may be related to the difference in the ion radii of Zr and Hf. - Graphical abstract: The phase composition and morphology of zirconium and hafnium germanates synthesized by ceramic and co-precipitation routes were studied. It was stated that there is the strong dependence of the phase composition and morphology of products on the preparation route. Display Omitted - Highlights: • Zr and Hf germanates were synthesized by ceramic and co-precipitation routes. • The morphology of products depends on the synthesis parameters. • Zirconium germanates forms a set of solid solutions. • Hafnium germanates are stoichiometric compounds

  1. 21 CFR 211.173 - Laboratory animals.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Laboratory animals. 211.173 Section 211.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS... Laboratory animals. Animals used in testing components, in-process materials, or drug products for compliance...

  2. 46 CFR 173.010 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... VESSEL USE Lifting § 173.010 Definitions. As used in this part— (a) Hook load means the weight of the object lifted by the crane. (b) Crane radius means the distance illustrated in Figure 173.010. EC01MR91...

  3. 21 CFR 173.240 - Isopropyl alcohol.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Isopropyl alcohol. 173.240 Section 173.240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Solvents...

  4. 40 CFR 173.9 - Judicial review.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Judicial review. 173.9 Section 173.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES GOVERNING... Judicial review. The State may appeal an order rescinding, in whole or in part, its primary enforcement...

  5. 21 CFR 173.355 - Dichlorodifluoromethane.

    Science.gov (United States)

    2010-04-01

    ... with good manufacturing practice, as a direct-contact freezing agent for foods. (c) To assure safe use... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dichlorodifluoromethane. 173.355 Section 173.355 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD...

  6. 7 CFR 1150.173 - Confidential treatment.

    Science.gov (United States)

    2010-01-01

    ... reports of the number of persons subject to this subpart or statistical data collected therefrom, which... 7 Agriculture 9 2010-01-01 2009-01-01 true Confidential treatment. 1150.173 Section 1150.173 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing...

  7. 49 CFR 173.174 - Refrigerating machines.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Refrigerating machines. 173.174 Section 173.174 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Refrigerating machines. A refrigerating machine assembled for shipment and containing 7 kg (15 pounds) or less...

  8. 49 CFR 173.159 - Batteries, wet.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries, wet. 173.159 Section 173.159... Batteries, wet. (a) Electric storage batteries, containing electrolyte acid or alkaline corrosive battery fluid (wet batteries), may not be packed with other materials except as provided in paragraphs (g) and...

  9. 49 CFR 173.163 - Hydrogen fluoride.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen fluoride. 173.163 Section 173.163... Hydrogen fluoride. (a) Hydrogen fluoride (hydrofluoric acid, anhydrous) must be packaged as follows: (1) In... filling ratio of 0.84. (b) A cylinder removed from hydrogen fluoride service must be condemned in...

  10. 21 CFR 173.400 - Dimethyldialkylammonium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dimethyldialkylammonium chloride. 173.400 Section... HUMAN CONSUMPTION Specific Usage Additives § 173.400 Dimethyldialkylammonium chloride. Dimethyldialkylammonium chloride may be safely used in food in accordance with the following prescribed conditions: (a...

  11. 21 CFR 173.55 - Polyvinylpyrrolidone.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Polyvinylpyrrolidone. 173.55 Section 173.55 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... a residual level not to exceed 40 parts per million. Wine As a clarifying agent, at a residual level...

  12. Bond formation in hafnium atom implantation into SiC induced by high-energy electron irradiation

    International Nuclear Information System (INIS)

    Yasuda, H.; Mori, H.; Sakata, T.; Naka, M.; Fujita, H.

    1992-01-01

    Bilayer films of Hf (target atoms)/α-SiC (substrate) were irradiated with 2 MeV electrons in an ultra-high voltage electron microscope (UHVEM), with the electron beam incident on the hafnium layer. As a result of the irradiation, hafnium atoms were implanted into the SiC substrate. Changes in the microstructure and valence electronic states associated with the implantation were studied by a combination of UHVEM and Auger valence electron spectroscopy. The implantation process is summarized as follows. (1) Irradiation with 2 MeV electrons first induces a crystalline-to-amorphous transition in α-SiC. (2) Hafnium atoms which have been knocked-off from the hafnium layer by collision with the 2 MeV electrons are implanted into the resultant amorphous SiC. (3) The implanted hafnium atoms make preferential bonding to carbon atoms. (4) With continued irradiation, the hafnium atoms repeat the displacement along the beam direction and the subsequent bonding with the dangling hybrids of carbon and silicon. The repetition of the displacement and subsequent bonding lead to the deep implantation of hafnium atoms into the SiC substrate. It is concluded that implantation successfully occurs when the bond strength between a constituent atom of a substrate and an injected atom is stronger than that between constituent atoms of a substrate. (Author)

  13. Determination of hafnium, molybdenum, and vanadium in niobium and niobium-based alloys by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Ide, Kunikazu; Kobayashi, Takeshi; Sudo, Emiko.

    1985-01-01

    The analytical procedure is as follows: Weigh 1 g of a sample and put it into a 100 cm 3 PTFE beaker. Add 5 ml of distilled water and 5 ml of hydrofluoric acid, and then heat the solution on a hot plate, adding 3 ml of nitric acid dropwise. Dilute the solution to 100 cm 3 with distilled water. When hafnium is determined, add 2 g of diammonium titanium hexafluoride ((NH 4 ) 2 TiF 6 )) before dilution. Working standard solutions are prepared by adding the stock standard solutions of hafnium, molybdenum, and vanadium into niobium solutions. When hafnium is determined, add 2 g of (NH 4 ) 2 TiF 6 and the alloying elements in amounts corresponding to those in sample solutions into the working standard solutions. The tolerable amounts of hydrofluoric acid were 2.9 M, 2.1 M, and 3.1 M and those of nitric acid were 1.0 M, 1.6 M, and 1.6 M for hafnium, molybdenum, and vanadium, respectively. It was found that (NH 4 ) 2 TiF 6 greatly increased the sensitivity for hafnium determination. Niobium showed minus effect for hafnium and plus effect for molybdenum and vanadium. The atomic absorption of molybdenum and vanadium were not influenced by the presence of 20 % of each alloying element, while the atomic absorption of hafnium was given plus effect by 20 % of zirconium, iron, cobalt, nickel, manganese, chromium or vanadium and minus effect by 20 % tungsten. The analytical values of hafnium, molybdenum, and vanadium in niobium-based alloys by this method showed a good agreement with those by X-ray fluorescence analysis. The lower limits of determination (S/N=2) were 0.05, 0.001, and 0.002 % and the relative standard deviation were 3, 1, and 1.5 % for hafnium, molybdenum, and vanadium, respectively. (author)

  14. Separation of zirconium and hafnium from acompanying elements by paper chromatography in the systems of alcohol-acid

    International Nuclear Information System (INIS)

    Lebedeva, G.G.; Viktorova, M.E.

    1980-01-01

    Solvents have been chosen and investigated which provide expressed separation of zirconium and hafnium at the analysis of mineral raw materials by paper chromatography. The systems with HNO 3 and HCl containing methyl, ethyl, propyl and butyl alcohols have been studied as mobile phases for separation of zirconium and hafnium. It has been shown that alcohol contents and solvent acidity affect the Rsub(f) value of these elements. The C 2 H 5 OH-5MHCl and C 2 H 5 OH-5MHNO 3 systems are most optimal for pre-concentration of zirconium and hafnium

  15. ENTIRELY AQUEOUS SOLUTION-GEL ROUTE FOR THE PREPARATION OF ZIRCONIUM CARBIDE, HAFNIUM CARBIDE AND THEIR TERNARY CARBIDE POWDERS

    Directory of Open Access Journals (Sweden)

    Zhang Changrui

    2016-07-01

    Full Text Available An entirely aqueous solution-gel route has been developed for the synthesis of zirconium carbide, hafnium carbide and their ternary carbide powders. Zirconium oxychloride (ZrOCl₂.8H₂O, malic acid (MA and ethylene glycol (EG were dissolved in water to form the aqueous zirconium carbide precursor. Afterwards, this aqueous precursor was gelled and transformed into zirconium carbide at a relatively low temperature (1200 °C for achieving an intimate mixing of the intermediate products. Hafnium and the ternary carbide powders were also synthesized via the same aqueous route. All the zirconium, hafnium and ternary carbide powders exhibited a particle size of ∼100 nm.

  16. Plasma spraying of zirconium carbide – hafnium carbide – tungsten cermets

    Czech Academy of Sciences Publication Activity Database

    Brožek, Vlastimil; Ctibor, Pavel; Cheong, D.-I.; Yang, S.-H.

    2009-01-01

    Roč. 9, č. 1 (2009), s. 49-64 ISSN 1335-8987 Institutional research plan: CEZ:AV0Z20430508 Keywords : Plasma spraying * cermet coatings * microhardness * zirconium carbide * hafnium carbide * tungsten * water stabilized plasma Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass

  17. Titanium, zirconium- and hafnium containing initiators in the polymerization of acrylic monomers to ''living'' polymers

    International Nuclear Information System (INIS)

    Farnham, W.B.; Hertler, W.R.

    1988-01-01

    This patent describes a process for preparing ''living'' polymer. The process comprises contacting one or more acrylic monomers under polymerizing conditions with a polymerization-initiating amount of a tetra-coordinate organotitanium, organozirconium or organo-hafnium polymerization initiator, and ''living'' polymers produced thereby

  18. Vapor pressure, heat capacities, and phase transitions of tetrakis(tert-butoxy)hafnium

    Czech Academy of Sciences Publication Activity Database

    Fulem, Michal; Růžička, K.

    2011-01-01

    Roč. 311, Dec. (2011), s. 25-29 ISSN 0378-3812 Institutional research plan: CEZ:AV0Z10100521 Keywords : tetrakis(tert-butoxy)hafnium * MO precursor * vapor pressure * heat capacity * vaporization enthalpy * enthalpy of fusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.139, year: 2011

  19. Separation of hafnium from zirconium in sulfuric acid solutions using pressurized ion exchange

    International Nuclear Information System (INIS)

    Hurst, F.J.

    1981-01-01

    High-resolution pressurized ion exchange has been used successfully to study and separate hafnium and zirconium sulfate complexes by chromatographic elution from Dowex 50W-X8 (15 to 25 μm) resin with sulfuric acid solutions. Techniques were developed to continuously monitor the column effluents for zirconium and hafnium by reaction with fluorometric and colorimetric reagents. Since neither reagent was specific for either metal ion, peak patterns were initially identified by using the stable isotopes 90 Zr and 180 Hf as fingerprints of their elution position. Distribution ratios for both zirconium and hafnium decrease as the inverse fourth power of the sulfuric acid concentration below 2N and as the inverse second power at higher acid concentration. The hafnium-to-zirconium separation factor is approximately constant (approx. 8) over the 0.5 to 3N range. Under certain conditions, an unseparated fraction was observed that was not retained by the resin. The amount of this fraction which is thought to be a polymeric hydrolysis product appears to be a function of metal and sulfuric acid concentrations. Conditions are being sought to give the highest zirconium concentration and the lowest acid concentration that can be used as a feed material for commercial scale-up in the continuous annular chromatographic (CAC) unit without formation of the polymer

  20. The corrosion behavior of hafnium in high-temperature-water environments

    Energy Technology Data Exchange (ETDEWEB)

    Rishel, D.M.; Smee, J.D.; Kammenzind, B.F.

    1999-10-01

    The high-temperature-water corrosion performance of hafnium is evaluated. Corrosion kinetic data are used to develop correlations that are a function of time and temperature. The evaluation is based on corrosion tests conducted in out-of-pile autoclaves and in out-of-flux locations of the Advanced Test Reactor (ATR) at temperatures ranging from 288 to 360 C. Similar to the corrosion behavior of unalloyed zirconium, the high-temperature-water corrosion response of hafnium exhibits three corrosion regimes: pretransition, posttransition, and spalling. In the pretransition regime, cubic corrosion kinetics are exhibited, whereas in the posttransition regime, linear corrosion kinetics are exhibited. Because of the scatter in the spalling regime data, it is not reasonable to use a best fit of the data to describe spalling regime corrosion. Data also show that neutron irradiation does not alter the corrosion performance of hafnium. Finally, the data illustrate that the corrosion rate of hafnium is significantly less than that of Zircaloy-2 and Zircaloy-4.

  1. 49 CFR 173.173 - Paint, paint-related material, adhesives, ink and resins.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Paint, paint-related material, adhesives, ink and... Than Class 1 and Class 7 § 173.173 Paint, paint-related material, adhesives, ink and resins. (a) When..., paint-related material, adhesives, ink and resins must be packaged as follows: (1) As prescribed in...

  2. Reinforcement against crack propagation of PWR absorbers by development of boron-carbon-hafnium composites

    International Nuclear Information System (INIS)

    Provot, B.; Herter, P.

    2000-01-01

    In order to improve the mechanical behaviour of materials used as neutron absorbers in nuclear reactors, we have developed CERCER or CERMET composites with boron and hafnium. Thus a new composite B 4 C/HfB 2 has been especially studied. We have identified three kinds of degradation under irradiation (thermal gradient, swelling due to fission products and accidental corrosion) that induce imposed deformations cracking phenomena. Mechanical behaviour and crack propagation resistance have been studied by ball-on-three-balls and double torsion tests. A special device was developed to enable crack propagation and associated stress intensity factor measurements. Effects of structure and of a second phase are underline. First results show that these materials present crack initiation and propagation resistance much higher than pure boron carbide or hafnium diboride. We observe R-Curves effects, crack bridging or branching, crack arrests, and toughness increases that we can relate respectively to the composite structures. (author)

  3. Synthesis and characterization of hafnium oxide films for thermo and photoluminescence applications

    International Nuclear Information System (INIS)

    Guzman Mendoza, J.; Aguilar Frutis, M.A.; Flores, G. Alarcon; Garcia Hipolito, M.; Maciel Cerda, A.; Azorin Nieto, J.; Rivera Montalvo, T.; Falcony, C.

    2010-01-01

    Hafnium oxide (HfO 2 ) films were deposited by the ultrasonic spray pyrolysis process. The films were synthesized from hafnium chloride as raw material in deionized water as solvent and were deposited on corning glass substrates at temperatures from 300 to 600 deg. C. For substrate temperatures lower than 400 deg. C the deposited films were amorphous, while for substrate temperatures higher than 450 deg. C, the monoclinic phase of HfO 2 appeared. Scanning electron microscopy showed that the film's surface resulted rough with semi-spherical promontories. The films showed a chemical composition close to HfO 2 , with an Hf/O ratio of about 0.5. UV radiation was used in order to achieve the thermoluminescent characterization of the films; the 240 nm wavelength induced the best response. In addition, preliminary photoluminescence spectra, as a function of the deposition temperatures, are shown.

  4. Synthesis and characterization of Ho3+ doped hafnium oxide TLD for radiation dosimeter

    International Nuclear Information System (INIS)

    Sekar, Nandakumar; Ganesan, Bharanidharan; Sahib, Hajee Reyaz Ali; Aruna, Prakasarao; Ganesan, Singaravelu; Thamilkumar, P.; Rai, R.R.

    2017-01-01

    Cancer is a dreaded disease which is treated by Radiotherapy, Chemotherapy and Surgery. Radiotherapy plays a vital role in treatment of cancer and recently measurements of invivo radiation dosimetric in patient is of great interest due to high dose gradients in advanced technology like IMRT, IGRT etc. Hence, for the last few decades, a great degree of interest has been shown for the hafnium oxide for radiation dosimetric applications, due to its high dielectric constant, wide band gap and better interface properties such as chemical stability, conduction band offset and thermodynamic stability. In the present study, Synthesis and characterization of Ho 3+ doped Hafnium oxide were carried out and its applications towards radiation dosimeter were investigated

  5. Self-cleaning and surface chemical reactions during hafnium dioxide atomic layer deposition on indium arsenide.

    Science.gov (United States)

    Timm, Rainer; Head, Ashley R; Yngman, Sofie; Knutsson, Johan V; Hjort, Martin; McKibbin, Sarah R; Troian, Andrea; Persson, Olof; Urpelainen, Samuli; Knudsen, Jan; Schnadt, Joachim; Mikkelsen, Anders

    2018-04-12

    Atomic layer deposition (ALD) enables the ultrathin high-quality oxide layers that are central to all modern metal-oxide-semiconductor circuits. Crucial to achieving superior device performance are the chemical reactions during the first deposition cycle, which could ultimately result in atomic-scale perfection of the semiconductor-oxide interface. Here, we directly observe the chemical reactions at the surface during the first cycle of hafnium dioxide deposition on indium arsenide under realistic synthesis conditions using photoelectron spectroscopy. We find that the widely used ligand exchange model of the ALD process for the removal of native oxide on the semiconductor and the simultaneous formation of the first hafnium dioxide layer must be significantly revised. Our study provides substantial evidence that the efficiency of the self-cleaning process and the quality of the resulting semiconductor-oxide interface can be controlled by the molecular adsorption process of the ALD precursors, rather than the subsequent oxide formation.

  6. Zirconium and hafnium tetrachloride separation by extractive distillation with molten zinc chloride lead chloride solvent

    International Nuclear Information System (INIS)

    McLaughlin, D.F.; Stoltz, R.A.

    1988-01-01

    In an extractive distillation method for separating hafniuim tetrachloride from zirconium tetrachloride of the type wherein a mixture of zirconium and hafnium tetrachlorides is introduced into an extractive distillation column, which extractive distillation column has a reboiler connected at the bottom and a reflux condenser connected at the top and wherein a molten salt solvent is circulated into the reflux condenser and through the column to provide a liquid phase, and wherein molten salt solvent containing zirconium tetrachloride is taken from the reboiler and run through a stripper to remove zirconium tetrachloride product from the molten salt solvent and the stripped molten salt solvent is returned to the reflux condenser and hafnium tetrachloride enriched vapor is taken as product from the reflux condenser, the improvement is described comprising: the molten salt having a composition of at least 30 mole percent zinc chloride and at least 10 mole percent of lead chloride

  7. Preparation of hafnium metal by calciothermic reduction of HfO2

    International Nuclear Information System (INIS)

    Sharma, I.G.; Vijay, P.L.; Sehra, J.C.; Sundaram, C.V.

    1975-01-01

    Hafnium metal powder has been produced by the calciothermic reduction of hafnium oxide. The influence of various experimental parameters - such as amount of calcium in excess of stoichiometric requirement, temperature, and time of reduction - on the yield and purity of the metal has been studied. The metal powder obtained by reduction at 960 0 C (two hours) with a calcium excess of 70% analysed 600 ppm of oxygen and 147 ppm of nitrogen. A reduction efficiency of 96% has been achieved under these conditions. The refining of the powder by electron beam melting, fused salt electrolysis, and iodide process has been studied. The oxygen content in the metal could be brought down from 6900 to 148 ppm by electron beam melt-refining. (author)

  8. On-line separation of refractory hafnium and tantalum isotopes at the ISOCELE separator

    CERN Document Server

    Liang, C F; Obert, J; Paris, P; Putaux, J C

    1981-01-01

    By chemical evaporation technique, neutron deficient hafnium nuclei have been on-line separated at the ISOCELE facility, from the isobar rare-earth elements, in the metal-fluoride HfF/sub 3//sup +/ ion form. Half-lives of /sup 162-165/Hf have been measured. Similarly, tantalum has been selectively separated on the TaF/sub 4//sup +/ form. (4 refs) .

  9. Complexonometric determination of hafnium (4) in the presence of europium(3) or tantalum(5)

    International Nuclear Information System (INIS)

    Oziashvili, E.D.; Ehsakiya, K.E.; Sirakanyan, N.M.

    1986-01-01

    Complexonometric determination of hafnium in the presence of Ta or Eu in samples which can be decomposed by acids, i.e. in double borides has been investigated. Initial solutions are prepared by fusing with K 2 S 2 O 8 excess, the fusion was leached by hot water, H 2 SO L 4 was added and Hf was titrated by complexone 3 in the presence of xylenol orange

  10. Simplified method for gravimetric determination of zirconium or hafnium with α-hydroxy carboxylic acids

    International Nuclear Information System (INIS)

    Barbieri, R.S.; Rocha, J.C.; Terra, V.R.; Marques Netto, A.

    1989-01-01

    The conditions for gravimetric determination of zirconium or hafnium by glicoloc acids derivatives were studied by thermogravimetric analysis. The method utilized shownd that after precipitation, washing and drying of precipitates at 150 o C, the resulting solid was weighed in the form of [M (RCH(OH)COO) 4 ] (M = Zr, Hf; R + C 6 H 5 , β-C 10 H 7 , p-BrC 6 H 4 ). (author)

  11. Modified method for zirconium or hafnium gravimetric determination with glycolic acid derivatives

    International Nuclear Information System (INIS)

    Barbieri, R.S.; Rocha, J.C.; Terra, V.R.; Marques Neto, A.

    1989-01-01

    The conditions for gravimetric determination of zirconium or hafnium by glicolic acid derivatives were studied by thermogravimetric analysis. The method utilized shown that after precipitation, washing and drying of precipitates at 150 0 C, the resulting solid was weighed in the form of [M{RCH(OH)COO} 4 ] (M = Zr,Hf;R = C 6 H 5 , β-C 10 H 7 ,p-BrC 6 H 4 ). (author) [pt

  12. Electrodeposition in molten salts of metals used in nuclear industry: hafnium and uranium

    International Nuclear Information System (INIS)

    Serrano, K.

    1998-01-01

    The aim of this work is to study the electrodeposition in molten salts of metals used in nuclear industry: hafnium and uranium. The experiment is carried out in a molten alkaline halogenide medium in a temperature range between 670 and 750 degrees Celsius. The first part of this work concerns more particularly the electrochemical behaviour of the hafnium and uranium ions in the electrolytic solution. The reduction mechanisms of these ions have been studied by the use of three methods: cyclic voltametry, chrono-potentiometry and square wave voltametry. Results have shown that the process of metal deposition is difficult to explain because secondary reactions (as for instance: adsorption phenomena or cathodic deposit dissolution) occur. The uranium germination has then been studied by modelling of chrono-amperograms. The experiments have shown that the deposition is the result of the initial uranium crystal growth and depends on the electrolyte diffusion. The second part of this work deals with the implementation of hafnium and uranium deposition taking into account the preceding mechanistic studies. Depositions have all been observed by physical methods as for instance scanning electron microscopy. Particular experimental solutions (soluble anode, addition of fluoride ions to the electrolyte) have been used. The obtained deposition of hafnium is smooth and adheres very well to the substrate. The uranium depositions have been implemented with the use of a soluble anode. Uranium is deposited in a dendritic shape to the cathode. It has also been shown that the electro-kinetic parameters (temperature, uranium ions concentration, current density) have not an important influence on the dendritic morphology of the deposition. This morphology could be the consequence of particular convection movements to the surface of the cathode. (O.M.)

  13. Rhodium and Hafnium Influence on the Microstructure, Phase Composition, and Oxidation Resistance of Aluminide Coatings

    OpenAIRE

    Maryana Zagula-Yavorska; Małgorzata Wierzbińska; Jan Sieniawski

    2017-01-01

    A 0.5 μm thick layer of rhodium was deposited on the CMSX 4 superalloy by the electroplating method. The rhodium-coated superalloy was hafnized and aluminized or only aluminized using the Chemical vapour deposition method. A comparison was made of the microstructure, phase composition, and oxidation resistance of three aluminide coatings: nonmodified (a), rhodium-modified (b), and rhodium- and hafnium-modified (c). All three coatings consisted of two layers: the additive layer and the interdi...

  14. Radiation effects on the electrical properties of hafnium oxide based MOS capacitors.

    Energy Technology Data Exchange (ETDEWEB)

    Petrosky, J. C. (Air Force Institute of Technology, Wright-Patterson Air Force Base, OH); McClory, J. W. (Air Force Institute of Technology, Wright-Patterson Air Force Base, OH); Bielejec, Edward Salvador; Foster, J. C. (Air Force Institute of Technology, Wright-Patterson Air Force Base, OH)

    2010-10-01

    Hafnium oxide-based MOS capacitors were investigated to determine electrical property response to radiation environments. In situ capacitance versus voltage measurements were analyzed to identify voltage shifting as a result of changes to trapped charge with increasing dose of gamma, neutron, and ion radiation. In situ measurements required investigation and optimization of capacitor fabrication to include dicing, cleaning, metalization, packaging, and wire bonding. A top metal contact of 200 angstroms of titanium followed by 2800 angstroms of gold allowed for repeatable wire bonding and proper electrical response. Gamma and ion irradiations of atomic layer deposited hafnium oxide on silicon devices both resulted in a midgap voltage shift of no more than 0.2 V toward less positive voltages. This shift indicates recombination of radiation induced positive charge with negative trapped charge in the bulk oxide. Silicon ion irradiation caused interface effects in addition to oxide trap effects that resulted in a flatband voltage shift of approximately 0.6 V also toward less positive voltages. Additionally, no bias dependent voltage shifts with gamma irradiation and strong oxide capacitance room temperature annealing after ion irradiation was observed. These characteristics, in addition to the small voltage shifts observed, demonstrate the radiation hardness of hafnium oxide and its applicability for use in space systems.

  15. On the phase formation of sputtered hafnium oxide and oxynitride films

    International Nuclear Information System (INIS)

    Sarakinos, K.; Music, D.; Mraz, S.; Baben, M. to; Jiang, K.; Nahif, F.; Braun, A.; Zilkens, C.; Schneider, J. M.; Konstantinidis, S.; Renaux, F.; Cossement, D.; Munnik, F.

    2010-01-01

    Hafnium oxynitride films are deposited from a Hf target employing direct current magnetron sputtering in an Ar-O 2 -N 2 atmosphere. It is shown that the presence of N 2 allows for the stabilization of the transition zone between the metallic and the compound sputtering mode enabling deposition of films at well defined conditions of target coverage by varying the O 2 partial pressure. Plasma analysis reveals that this experimental strategy facilitates control over the flux of the O - ions which are generated on the oxidized target surface and accelerated by the negative target potential toward the growing film. An arrangement that enables film growth without O - ion bombardment is also implemented. Moreover, stabilization of the transition sputtering zone and control of the O - ion flux without N 2 addition is achieved employing high power pulsed magnetron sputtering. Structural characterization of the deposited films unambiguously proves that the phase formation of hafnium oxide and hafnium oxynitride films with the crystal structure of HfO 2 is independent from the O - bombardment conditions. Experimental and theoretical data indicate that the presence of vacancies and/or the substitution of O by N atoms in the nonmetal sublattice favor the formation of the cubic and/or the tetragonal HfO 2 crystal structure at the expense of the monoclinic HfO 2 one.

  16. Correlations between nuclear data and integral slab experiments: the case of hafnium; Correlations entre donnees nucleaires et experiences integrales a plaques: le cas du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Palau, J.M

    1999-07-01

    The aim of this work was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor.In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods together with Monte Carlo- type simulations enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope {sup 177}Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  17. Correlations between nuclear data and integral slab experiments: the case of hafnium; Correlations entre donnees nucleaires et experiences integrales a plaques: le cas du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Palau, J M

    1999-07-01

    The aim of this work was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor.In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods together with Monte Carlo- type simulations enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope {sup 177}Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  18. Correlations between nuclear data and results of integral slab experiments. Case of hafnium; Correlations entre donnees nucleaires et experiences integrales a plaques: le cas du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Palau, J M

    1997-10-22

    The aim of this thesis was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular `mock-up` reactor. In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods (APOLLO2 code) together with Monte Carlo- type simulations (TRIPOLI4 code) enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope {sup 177}Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent`s efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author) 128 refs.

  19. Development and characterization of ultrathin hafnium titanates as high permittivity gate insulators

    Science.gov (United States)

    Li, Min

    High permittivity or high-kappa materials are being developed for use as gate insulators for future ultrascaled metal oxide semiconductor field effect transistors (MOSFETs). Hafnium containing compounds are the leading candidates. Due to its moderate permittivity, however, it is difficult to achieve HfO2 gate structures with an EOT well below 1.0 nm. One approach to increase HfO2 permittivity is combining it with a very high-kappa material, such as TiO2. In this thesis, we systematically studied the electrical and physical characteristics of high-kappa hafnium titanates films as gate insulators. A series of HfxTi1-xO2 films with well-controlled composition were deposited using an MOCVD system. The physical properties of the films were analyzed using a variety of characterization techniques. X-ray micro diffraction indicates that the Ti-rich thin film is more immune to crystallization. TEM analysis showed that the thick stoichiometric HfTiO 4 film has an orthorhombic structure and large anisotropic grains. The C-V curves from the devices with the hafnium titanates films displayed relatively low hysteresis. In a certain composition range, the interfacial layer (IL) EOT and permittivity of HfxTi1-x O2 increases linearly with increasing Ti. The charge is negative for HfxTi1-xO2/IL and positive for Si/IL interface, and the magnitude increases as Hf increases. For ultra-thin films (less than 2 nm EOT), the leakage current increases with increasing HE Moreover, the Hf-rich sample has weaker temperature dependence of the current. In the MOSFET devices with the hafnium titanates films, normal transistor characteristics were observed, also electron mobility degradation. Next, we investigated the effects that different pre-deposition surface treatments, including HF dipping, NH3 surface nitridation, and HfO2 deposition, have on the electrical properties of hafnium titanates. Surface nitridation shows stronger effect than the thin HfO2 layer. The nitrided samples displayed a

  20. 40 CFR 141.173 - Filtration.

    Science.gov (United States)

    2010-07-01

    ... PRIMARY DRINKING WATER REGULATIONS Enhanced Filtration and Disinfection-Systems Serving 10,000 or More People § 141.173 Filtration. A public water system subject to the requirements of this subpart that does... treatment, direct filtration, slow sand filtration, or diatomaceous earth filtration. A public water system...

  1. 21 CFR 173.368 - Ozone.

    Science.gov (United States)

    2010-04-01

    ... CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.368 Ozone. Ozone (CAS Reg. No. 10028-15-6) may be safely used in the treatment, storage, and processing of foods, including meat and poultry (unless such use is precluded by standards of identity in 9...

  2. 49 CFR 173.403 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... emitters and low toxicity alpha emitters or 0.04 Bq/cm2 for all other alpha emitters. Contamination exists... containers.” Graphite means, for the purposes of § 173.453, graphite with a boron equivalent content less... A2/g. Low toxicity alpha emitters means natural uranium; depleted uranium; natural thorium; uranium...

  3. Low-voltage bendable pentacene thin-film transistor with stainless steel substrate and polystyrene-coated hafnium silicate dielectric.

    Science.gov (United States)

    Yun, Dong-Jin; Lee, Seunghyup; Yong, Kijung; Rhee, Shi-Woo

    2012-04-01

    The hafnium silicate and aluminum oxide high-k dielectrics were deposited on stainless steel substrate using atomic layer deposition process and octadecyltrichlorosilane (OTS) and polystyrene (PS) were treated improve crystallinity of pentacene grown on them. Besides, the effects of the pentacene deposition condition on the morphologies, crystallinities and electrical properties of pentacene were characterized. Therefore, the surface treatment condition on dielectric and pentacene deposition conditions were optimized. The pentacene grown on polystyrene coated high-k dielectric at low deposition rate and temperature (0.2-0.3 Å/s and R.T.) showed the largest grain size (0.8-1.0 μm) and highest crystallinity among pentacenes deposited various deposition conditions, and the pentacene TFT with polystyrene coated high-k dielectric showed excellent device-performance. To decrease threshold voltage of pentacene TFT, the polystyrene-thickness on high-k dielectric was controlled using different concentration of polystyrene solution. As the polystyrene-thickness on hafnium silicate decreases, the dielectric constant of polystyrene/hafnium silicate increases, while the crystallinity of pentacene grown on polystyrene/hafnium silicate did not change. Using low-thickness polystyrene coated hafnium silicate dielectric, the high-performance and low voltage operating (pentacene thin film transistor (μ: ~2 cm(2)/(V s), on/off ratio, >1 × 10(4)) and complementary inverter (DC gains, ~20) could be fabricated.

  4. Extraction of zirconium and hafnium thiocyanates by CH3COCH2CH.(CH3)2-HSCN solvent from chloride medium

    International Nuclear Information System (INIS)

    Okada, A.T.

    1982-01-01

    A zirconium-hafnium separation process for application in nuclear industry is presented. The extraction of zirconium and hafnium thiocyanates in chloride medium by hexone-HSCN solvent was studied. The extraction process was developed, varying the parameters, such as, concentrations of the metals, the thiocyanate ion, the sulphate ion and free acidity in aqueous phase. (Author) [pt

  5. Solvent extraction of titanium(IV), zirconium(IV) and hafnium(IV) salicylates using liquid ion exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Sundaramurthi, N M; Shinde, V M

    1989-02-01

    A solvent extraction method is proposed for the extraction of quadrivalent titanium, zirconium an hafnium from salicylate media using liquid ion exchangers such as Aliquat 336 and trioctylamine dissolved in xylene. The optimum conditions were evaluated from a critical study of the following: pH, salicylate concentration, amine concentration, diluent and period of equilibration. The method allows the separation of titanium, zirconium and hafnium from binary mixtures containing commonly associated metal ions and is applicable to the analysis of real samples such as BCS-CRM 387 nimonic 901, BCS-CRM 243/4 ferro-titanium, BCS-CRM 307 magnesium alloy and BCS-CRM 388 zircon. Titanium is determined either with hydrogen peroxide or by atomic absorption spectrometry whereas zirconium and hafnium are determined spectrophotometrically with Alizarin Red S and Zylenol Orange, respectively. The results of both separation and analysis are reported. The method is precise, accurate and fast.

  6. Use of hafnium in control bars of nuclear reactors; Uso de hafnio en barras de control de reactores nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez S, J.R.; Alonso V, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: jrrs@nuclear.inin-mx

    2003-07-01

    Recently the use of hafnium as neutron absorber material in nuclear reactors has been reason of investigation by virtue of that this material has nuclear properties as to the neutrons absorption and structural that can prolong the useful life of the control mechanisms of the nuclear reactors. In this work some of those more significant hafnium properties are presented like nuclear material. Also there are presented calculations carried out with the HELIOS code for fuel cells of uranium oxide and of uranium and plutonium mixed oxides under controlled conditions with conventional bars of boron carbide and also with similar bars to which are substituted the absorbent material by metallic hafnium, the results are presented in this work. (Author)

  7. 49 CFR 173.6 - Materials of trade exceptions.

    Science.gov (United States)

    2010-10-01

    ...-reactive (see § 173.124), poisonous by inhalation (see § 173.133), or a hazardous waste. (b) Packaging. (1..., boxes or compartments. (4) For gasoline, a packaging must be made of metal or plastic and conform to the...

  8. Strong influence of polymer architecture on the microstructural evolution of hafnium-alkoxide-modified silazanes upon ceramization.

    Science.gov (United States)

    Papendorf, Benjamin; Nonnenmacher, Katharina; Ionescu, Emanuel; Kleebe, Hans-Joachim; Riedel, Ralf

    2011-04-04

    The present study focuses on the synthesis and ceramization of novel hafnium-alkoxide-modified silazanes as well as on their microstructure evolution at high temperatures. The synthesis of hafnia-modified polymer-derived SiCN ceramic nanocomposites is performed via chemical modification of a polysilazane and of a cyclotrisilazane, followed by cross-linking and pyrolysis in argon atmosphere. Spectroscopic investigation (i.e., NMR, FTIR, and Raman) shows that the hafnium alkoxide reacts with the N-H groups of the cyclotrisilazane; in the case of polysilazane, reactions of N-H as well as Si-H groups with the alkoxide are observed. Consequently, scanning and transmission electron microscopy studies reveal that the ceramic nanocomposites obtained from cyclotrisilazane and polysilazane exhibited markedly different microstructures, which is a result of the different reaction pathways of the hafnium alkoxide with cyclotrisilazane and with polysilazane. Furthermore, the two prepared ceramic nanocomposites are unexpectedly found to exhibit extremely different high-temperature behavior with respect to decomposition and crystallization; this essential difference is found to be related to the different distribution of hafnium throughout the ceramic network in the two samples. Thus, the homogeneous distribution of hafnium observed in the polysilazane-derived ceramic leads to an enhanced thermal stability with respect to decomposition, whereas the local enrichment of hafnium within the matrix of the cyclotrisilazane-based sample induces a pronounced decomposition upon annealing at high temperatures. The results indicate that the chemistry and architecture of the precursor has a crucial effect on the microstructure of the resulting ceramic material and consequently on its high-temperature behavior. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Hafnium at subduction zones: isotopic budget of input and output fluxes; L'hafnium dans les zones de subduction: bilan isotopique des flux entrant et sortant

    Energy Technology Data Exchange (ETDEWEB)

    Marini, J.Ch

    2004-05-15

    Subduction zones are the primary regions of mass exchanges between continental crust and mantle of Earth through sediment subduction toward the earth's mantle and by supply of mantellic magmas to volcanic arcs. We analyze these mass exchanges using Hafnium and Neodymium isotopes. At the Izu-Mariana subduction zone, subducting sediments have Hf and Nd isotopes equivalent to Pacific seawater. Altered oceanic crust has Hf and Nd isotopic compositions equivalent to the isotopic budget of unaltered Pacific oceanic crust. At Luzon and Java subduction zones, arc lavas present Hf isotopic ratios highly radiogenic in comparison to their Nd isotopic ratios. Such compositions of the Luzon and Java arc lavas are controlled by a contamination of their sources by the subducted oceanic sediments. (author)

  10. 49 CFR 173.465 - Type A packaging tests.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Type A packaging tests. 173.465 Section 173.465 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.465 Type A packaging tests. (a) The packaging...

  11. 49 CFR 173.3 - Packaging and exceptions.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging and exceptions. 173.3 Section 173.3... SHIPMENTS AND PACKAGINGS General § 173.3 Packaging and exceptions. (a) The packaging of hazardous materials.... standard packaging must be open to inspection by a representative of the Department. (b) The regulations...

  12. 46 CFR 173.062 - Drainage of weather deck.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Drainage of weather deck. 173.062 Section 173.062 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.062 Drainage of weather deck. The weather deck of each sailing...

  13. 29 CFR 1915.173 - Drums and containers.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Drums and containers. 1915.173 Section 1915.173 Labor... Vessels, Drums and Containers, Other Than Ship's Equipment § 1915.173 Drums and containers. (a) Shipping drums and containers shall not be pressurized to remove their contents. (b) A temporarily assembled...

  14. 25 CFR 173.2 - Project engineer's authority.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Project engineer's authority. 173.2 Section 173.2 Indians... LANDS WITHDRAWN OR ACQUIRED IN CONNECTION WITH INDIAN IRRIGATION PROJECTS § 173.2 Project engineer's authority. The project engineer is the official charged with the responsibility for the enforcement of this...

  15. 49 CFR 173.183 - Nitrocellulose base film.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Nitrocellulose base film. 173.183 Section 173.183... Nitrocellulose base film. Films, nitrocellulose base, must be packaged in packagings conforming to the... tape or paper; authorized only for not over 600 m (1969 feet) of film. [Amdt. 173-224, 55 FR 52643 Dec...

  16. 34 CFR 668.173 - Refund reserve standards.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Refund reserve standards. 668.173 Section 668.173 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION STUDENT ASSISTANCE GENERAL PROVISIONS Financial Responsibility § 668.173...

  17. 13 CFR 120.173 - Lead-based paint.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Lead-based paint. 120.173 Section 120.173 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Policies Applying to All Business Loans Requirements Imposed Under Other Laws and Orders § 120.173 Lead-based paint. If...

  18. 49 CFR 173.185 - Lithium cells and batteries.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Lithium cells and batteries. 173.185 Section 173... Class 7 § 173.185 Lithium cells and batteries. (a) Cells and batteries. A lithium cell or battery, including a lithium polymer cell or battery and a lithium-ion cell or battery, must conform to all of the...

  19. 21 CFR 173.275 - Hydrogenated sperm oil.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Hydrogenated sperm oil. 173.275 Section 173.275... CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.275 Hydrogenated sperm oil. The food additive hydrogenated sperm oil may be safely used in accordance with the following prescribed...

  20. 49 CFR 173.31 - Use of tank cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Use of tank cars. 173.31 Section 173.31... SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.31 Use of tank cars. (a) General. (1) No person may offer a hazardous material for transportation in a tank car unless the tank car...

  1. 19 CFR 173.1 - Authority to review for error.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to review for error. 173.1 Section 173.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.1 Authority to review for error. Port directors...

  2. 46 CFR 173.051 - Public nautical school ships.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Public nautical school ships. 173.051 Section 173.051 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.051 Public nautical school ships. Each public nautical school...

  3. Atomic layer deposition of calcium oxide and calcium hafnium oxide films using calcium cyclopentadienyl precursor

    International Nuclear Information System (INIS)

    Kukli, Kaupo; Ritala, Mikko; Sajavaara, Timo; Haenninen, Timo; Leskelae, Markku

    2006-01-01

    Calcium oxide and calcium hafnium oxide thin films were grown by atomic layer deposition on borosilicate glass and silicon substrates in the temperature range of 205-300 o C. The calcium oxide films were grown from novel calcium cyclopentadienyl precursor and water. Calcium oxide films possessed refractive index 1.75-1.80. Calcium oxide films grown without Al 2 O 3 capping layer occurred hygroscopic and converted to Ca(OH) 2 after exposure to air. As-deposited CaO films were (200)-oriented. CaO covered with Al 2 O 3 capping layers contained relatively low amounts of hydrogen and re-oriented into (111) direction upon annealing at 900 o C. In order to examine the application of CaO in high-permittivity dielectric layers, mixtures of Ca and Hf oxides were grown by alternate CaO and HfO 2 growth cycles at 230 and 300 o C. HfCl 4 was used as a hafnium precursor. When grown at 230 o C, the films were amorphous with equal amounts of Ca and Hf constituents (15 at.%). These films crystallized upon annealing at 750 o C, showing X-ray diffraction peaks characteristic of hafnium-rich phases such as Ca 2 Hf 7 O 16 or Ca 6 Hf 19 O 44 . At 300 o C, the relative Ca content remained below 8 at.%. The crystallized phase well matched with rhombohedral Ca 2 Hf 7 O 16 . The dielectric films grown on Si(100) substrates possessed effective permittivity values in the range of 12.8-14.2

  4. A study of a production process for hafnium-free zirconium from zircon

    International Nuclear Information System (INIS)

    Ratanalert, N.

    1985-01-01

    The purpose of this experiment was to extract and purify the zirconium from zircon. The effects of time of extraction and stripping of zirconium, concentration of feed solution, concentration of hydrochloric acid in stripping process, equilibrium curve of extraction of zirconium and hafnium and equilibrium curve of stripping zirconium or scrubbing hafnium were studied from standard zirconium and hafnium. The results, subsequently were applied to the extraction procedures for zirconium from zircon. Minus 100 mesh zircon was fused with sodium hydroxide in the ratio of 1 : 6 at 700 degree C for l hour. After fusion the zirconate was leached with water and dissolved in hot concentrated hydrochloric acid. Zirconyl chloride octahydrate crystallized out when the solution was cooled. An agueons solution of zirconyl chloride was used as the feed to the hexone - thiocyanate solvent extraction process. This was prepared by dissolving zirconyl chloride octahydrate crystal in waster. This zirconium feed solution in 1 M HCl and 1 M N H 4 CNS was extracted with 2.7 m N H 4 CNS in hexone and then stripped with 3.6 M HCl the aqueous phase was got rid of thiocyanate ion by extracting with pure hexone, then the zirconium in aqueous phase was precipitated with sulfuric acid and ammonium hydroxide at pH 1.8 - 2.0 and zirconium oxide was obtained by ignition at 700 degree C. The process could be modified to improve the purity of zirconium by using cation exchange resin to get rid of thiocyanate ion after solvent extraction process

  5. Laser coating of hafnium on Ti6Al4 for biomedical applications

    CSIR Research Space (South Africa)

    Phume, L

    2012-12-01

    Full Text Available Al4V FOR BIOMEDICAL APPLICATIONS Lerato Phume 1, 2, S.L. Pityana 1, 2, C. Meacock 1, A.P.I Popoola 2 1. National Laser Centre, Council for Scientific and Industrial Research, P.O. Box 395, Pretoria, 0001, South Africa 2. Department of Chemical... and Metallurgical Engineering, Tshwane University of Technology, Private Bag X 680, Pretoria, 0001, South Africa (b) (c) (e) To investigate laser surface coating of Ti6Al4V with preplaced Hafnium powder, to determine the influence of the energy density...

  6. Improvement of aging kinetics and precipitate size refinement in Mg–Sn alloys by hafnium additions

    Energy Technology Data Exchange (ETDEWEB)

    Behdad, S. [Department of Mechanical and Materials Engineering, Florida International University, Miami, FL 33174 (United States); Zhou, L. [Department of Materials Science and Engineering and Advanced Materials Processing and Analysis Center, University of Central Florida, Orlando, FL 32816 (United States); Henderson, H.B.; Manuel, M.V. [Department of Materials Science and Engineering, University of Florida, Gainesville, FL 32611 (United States); Sohn, Y. [Department of Materials Science and Engineering and Advanced Materials Processing and Analysis Center, University of Central Florida, Orlando, FL 32816 (United States); Agarwal, A. [Department of Mechanical and Materials Engineering, Florida International University, Miami, FL 33174 (United States); Boesl, B., E-mail: bboesl@fiu.edu [Department of Mechanical and Materials Engineering, Florida International University, Miami, FL 33174 (United States)

    2016-01-10

    Two Mg–Sn alloys were microalloyed by addition of Hafnium and their age-hardening response was studied at 200 °C. Time to reach peak hardness was significantly reduced and improved by Hf addition. TEM study showed Hf clusters in the close vicinity and at the surface of Mg{sub 2}Sn precipitates, which confirms that Hf clusters act as additional nucleation centers for Mg{sub 2}Sn precipitate formation. Our results support the validity of thermokinetic criterion proposed by Mendis for selection of microalloying elements in order to refine precipitate size, accelerate aging kinetics and enhance peak hardness.

  7. Critical evaluation of the determination of zirconium and hafnium by instrumental and radiochemical neutron activation analysis

    International Nuclear Information System (INIS)

    Burger, Mario; Kraehenbuehl, Urs

    1991-01-01

    Neutron activation analysis (instrument or radiochemical) is suitable for the determination of zirconium and hafnium in samples of geochemical origin only when sufficient attention is paid to inter-fering nuclides. The size of the necessary correction for INAA depends on the composition of the sample; this problem is discussed. The radio-chemical technique which is recommended involves separation of the samples, precipitations and anion-exchange separation. Results are given for various standard reference materials and for meteorites. (author). 12 refs.; 1 fig.; 9 tabs

  8. High temperature thermodynamics of solutions of oxygen in zirconium and hafnium

    International Nuclear Information System (INIS)

    Boureau, G.; Gerdanian, P.

    1984-01-01

    The Tian-Calvet microcalorimetric method has been applied to the determination at 1323 Kelvin of ΔH(O 2 ), the partial molar enthalpy of mixing of oxygen in zirconium and in hafnium. No measurable departure from Henry's law has been found for dilute solutions (ratio oxygen over metal smaller than 0.1). For concentrated solutions repulsive interactions are found in agreement with the existence of ordered structures at lower temperatures. The domain of homogeneity of zirconium has been found larger than previously assumed. (author)

  9. Complexing of zirconium and hafnium with ortho-aminobenzoic acid and paraaminobenzoic acid

    International Nuclear Information System (INIS)

    Alekseeva, I.I.; Nemzer, I.I.; Yuranova, L.I.; Borisova, V.V.; Prozorovskaya, Z.N.

    1977-01-01

    Formation of complexes between zirconium and hafnium and ortho- and para-aminobenzoic acids has been studied by the kinetic method. It has been found that at pH=1.3-2.0 and concentrations of metals 10 -5 -10 -6 mole complex compounds are formed with composition Me:L=1:2 and 1:1 (Me=Zr, Hf; L=ortho- or para-aminobenzoic acids). Stepwise constants and overall effective constants of complex formation have been calculated

  10. Investigation of interaction of zirconium and hafnium tetrafluorides with strontium fluoride

    International Nuclear Information System (INIS)

    Ratnikova, I.D.; Korenev, Yu.M.; Novoselova, A.V.

    1980-01-01

    Diagrams of the condensated state of systems SrF 2 -EF 4 have been plotted, where E represents Zr, Hf. In these systems, three intermediate compounds of Sr 3 EF 10 , Sr 2 EF 8 and Sr EF 6 compositions are formed. All those compounds melt incongruently at temperatures of 982, 865 and 750 deg C, respectively - zirconium salt; at temperatures of 1000, 900 and 820 deg C - hafnium salts. Fluoro-metallates of composition 2:1, and 1:1, exist in two polymorphic forms. Tetrafluorides were found to dissolve in strontium fluoride: they form solid solutions having fluorite structure

  11. Near net shape processing of zirconium or hafnium metals and alloys

    International Nuclear Information System (INIS)

    Evans, S.C.

    1992-01-01

    This patent describes a process for producing a metal shape. It comprises: plasma arc melting a metal selected from zirconium, hafnium and alloys thereof comprising at least about 90 w/o of these metals to form a liquid pool; pouring the metal form the pool into a mold to form a near net shape; and reducing the metal from its near net shape to a final size while maintaining the metal temperature below the alpha-beta transition temperature throughout the size reducing step

  12. Thermal behaviour of hafnium diethylenetriaminepentaacetate studied using the perturbed angular correlation technique

    Energy Technology Data Exchange (ETDEWEB)

    Chain, Cecilia Y. [Universidad Nacional de La Plata (Argentina). Dept. de Fisica; Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), La Plata (Argentina). IFLP-CCT; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Buenos Aires (Argentina); Rivas, Patricia [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), La Plata (Argentina). IFLP-CCT; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Buenos Aires (Argentina); Universidad Nacional de La Plata (Argentina). Facultad de Ciencias Agrarias y Forestales; Pasquevich, Alberto F. [Universidad Nacional de La Plata (Argentina). Dept. de Fisica; Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), La Plata (Argentina). IFLP-CCT; Comision de Investigaciones Cientificas de la Provincia de Buenos Aires (CIC-PBA) (Argentina)

    2014-07-01

    Polyaminecarboxilic ligands like diethylenetriaminepentaacetic acid form stable complexes with many heavy metal ions, excelling as cation chelants especially in the field of radiopharmacy. The aim of this work is to characterize, by using the Time Differential Perturbed Angular Correlations (TDPAC) technique, the hyperfine interactions at hafnium sites in hafnium diethylenetriaminepentaacetate and to investigate their evolution as temperature increases. TDPAC results for KHfDTPA.3H{sub 2}O obtained by chemical synthesis yield a well defined and highly asymmetric interaction of quadrupole frequency ω{sub Q} = 141 Mrad/s, which is consistent with the existence of a unique site for the metal in the crystal lattice. The thermal behaviour of the chelate is investigated by means of differential scanning calorimetry and thermogravimetrical analyses revealing that an endothermic dehydration of KHfDTPA.3H{sub 2}O takes place in one step between 80 C and 180 C. The anhydrous KHfDTPA thus arising is characterized by a fully asymmetric and well defined interaction of quadrupole frequency ω{sub Q} = 168 Mrad/s. (orig.)

  13. Rare-earth hafnium oxide materials for magnetohydrodynamic (MHD) generator application

    Energy Technology Data Exchange (ETDEWEB)

    Marchant, D. D; Bates, J. L.

    1979-01-01

    Several ceramic materials based on rare-earth hafnium oxides have been identified as potential high-temperature electrodes and low-temperature current leadouts for open cycle coal-fired MHD generator channels. The electrode-current leadouts combination must operate at temperatures between 400 and 2000K with an electrical conductivity greater than 10/sup -2/ ohm/sup -1/ cm/sup -1/. The electrodes will be exposed to flowing (linear flow rates up to 100 m/s) potassium seeded coal combustion gases (plasma core temperatures between 2400 to 3200/sup 0/K) and coal slag. During operation the electrodes must conduct direct electric current at densities near 1.5 amp/cm/sup 2/. Consequently, the electrodes must be resistant to electrochemical decompositions and interactions with both the coal slag and potassium salts (e.g., K/sub 2/SO/sub 4/, K/sub 2/CO/sub 3/). The current leadout materials are placed between the hot electrodes and the water-cooled copper structural members and must have electrical conductivities greater than 10/sup -2/ ohm/sup -1/ cm/sup -1/ between 1400 and 400/sup 0/K. The current leadouts must be thermally and electrochemically compatible with the electrode, copper, and potassium salts. Ideally, the electrodes and current leadouts should exhibit minimal ionic conductivity. The fabrication, electrical conductivity, and electrochemical corrosion of rare-earth hafnium oxide materials are discussed. (WHK)

  14. Thermal behaviour of hafnium diethylenetriaminepentaacetate studied using the perturbed angular correlation technique

    International Nuclear Information System (INIS)

    Chain, Cecilia Y.; Rivas, Patricia

    2014-01-01

    Polyaminecarboxilic ligands like diethylenetriaminepentaacetic acid form stable complexes with many heavy metal ions, excelling as cation chelants especially in the field of radiopharmacy. The aim of this work is to characterize, by using the Time Differential Perturbed Angular Correlations (TDPAC) technique, the hyperfine interactions at hafnium sites in hafnium diethylenetriaminepentaacetate and to investigate their evolution as temperature increases. TDPAC results for KHfDTPA.3H 2 O obtained by chemical synthesis yield a well defined and highly asymmetric interaction of quadrupole frequency ω Q = 141 Mrad/s, which is consistent with the existence of a unique site for the metal in the crystal lattice. The thermal behaviour of the chelate is investigated by means of differential scanning calorimetry and thermogravimetrical analyses revealing that an endothermic dehydration of KHfDTPA.3H 2 O takes place in one step between 80 C and 180 C. The anhydrous KHfDTPA thus arising is characterized by a fully asymmetric and well defined interaction of quadrupole frequency ω Q = 168 Mrad/s. (orig.)

  15. Preparation, structure and properties of hafnium compounds in the system Hf-C-N-O

    International Nuclear Information System (INIS)

    Brundiers, G.D.

    1975-08-01

    Highly dense, homogenous and single phase hafnium carbonitride samples (with low oxygen content) were prepared in the whole concentration range of the ternary cubic carbonitrides. Stoichiometric hafnium oxicarbides were also prepared within the range of solubility. The procedure involved the hot pressing of powders of HfC, HfN, Hf, Hf-Oxide and carbon at temperatures of 3,000 0 C and pressures up to 550 kpf/cm 2 using a novel technique. Small single crystals of slightly substoichiometric HfN were also repared. The densification of the powders was studied as a function of the non-metal concentration. Carbonitrides with N/Hf ratio of 0.37 were prepared in a high temperature autoclave operating at medium pressures by the reaction of HfC with nitrogen. All the samples were characterized by density measurements, chemical, X-ray and metallographic analysis and in some cases with the aid of quantitative metallography and microprobe analysis. Typical properties investigated were lattice parameter, thermal expansion, microhardness and electrical resistivity as function of the non-metal content. For specific concentrations extreme values in the properties are attained. With the aid of the valence electron concentration (VEC) parameter, the properties can be correlated with the density of states of electrons at the Fermi level. (orig./HK) [de

  16. Titrimetric determination of thiocyanate in solutions of the hafnium-zirconium separation process

    International Nuclear Information System (INIS)

    Vazquez, Cristina; Botbol, Moises; Hernandez, M.H.

    1980-01-01

    The control of the thiocyanate concentration is necessary during the process of separating hafnium from zirconium by the hexone-thiocyanate method. Said control is carried out by titrimetric determination of thiocyanate in aqueous and organic solutions containing hydrochloric acid and ammonium thiocyanate in presence or absence of zirconium and/or hafnium. The method consists in a redox volumetric analysis using a cerium (IV) salt as titrating agent, and ferroine as the final point indicator. Owing to the instability of thiocyanate in an acid medium it is necessary to know previously if the decomposition of solutions with different concentration of ammonium thiocyanate and hydrochloric acid may have an influence upon the analytic results or may even invalidate them. In order to obtain reliable results, it must be taken into account that the stability of the solutions depends on the thiocyanate concentration, the acidity and the time elapsed from the moment the sample is taken until the test is performed. The decomposition process can be slowed down by cooling the solutions. This method allows to control the plant and does not require any special equipment. (M.E.L) [es

  17. Molecular structure, vibrational, HOMO-LUMO, MEP and NBO analysis of hafnium selenite

    Science.gov (United States)

    Yankova, Rumyana; Genieva, Svetlana; Dimitrova, Ginka

    2017-08-01

    In hydrothermal condition hafnium selenite with estimated chemical composition Hf(SeO3)2·n(H2O) was obtained and characterized by powder X-Ray diffraction, IR spectroscopy and thermogravimetrical analysis. The composition of the obtained crystalline phase was established as dihydrate of tetraaqua complex of the hafnium selenite [Hf(SeO3)2(H2O)4]·2H2O. The results of the thermogravimetrical analysis are shown that the two hydrated water molecules are released in the temperature interval 80-110°C, while the four coordinated water molecules - at 210-300°C. By DFT method, with Becke's three parameter exchange-functional combined with gradient-corrected correlation functional of Lee, Yang and Parr and 6-31G(d), 6-311 + G(d,p) basis sets and LANL2DZ for Hf atom were calculated the molecular structure, vibrational frequencies and thermodynamic properties of the structure. The UV-Vis spectra and electronic properties are presented. The energy and oscillator strength calculated by time-dependent density functional theory corresponds well with the experimental ones. Molecular electrostatic potential (MEP) was performed. Mulliken population analysis on atomic charges was also calculated. The stability and intramolecular interactions are interpreted by NBO analysis.

  18. Correlations between nuclear data and results of integral slab experiments. Case of hafnium

    International Nuclear Information System (INIS)

    Palau, J.M.

    1997-01-01

    The aim of this thesis was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor. In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods (APOLLO2 code) together with Monte Carlo- type simulations (TRIPOLI4 code) enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope 177 Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  19. Correlations between nuclear data and integral slab experiments: the case of hafnium

    International Nuclear Information System (INIS)

    Palau, J.M.

    1999-01-01

    The aim of this work was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor.In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods together with Monte Carlo- type simulations enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope 177 Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  20. Highly substituted zirconium and hafnium cyclopentadienyl bifunctional β-diketiminate complexes – Synthesis, structure, and catalytic activity towards ethylene polymerization

    Czech Academy of Sciences Publication Activity Database

    Havlík, A.; Lamač, Martin; Pinkas, Jiří; Varga, Vojtěch; Růžička, A.; Olejník, R.; Horáček, Michal

    2015-01-01

    Roč. 786, JUN 2015 (2015), s. 71-80 ISSN 0022-328X R&D Projects: GA ČR GAP106/10/0924 Institutional support: RVO:61388955 Keywords : Zirconium * Hafnium * Cyclopentadienyl Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.336, year: 2015

  1. Differential perturbed angular correlation: use of physico-chemical study of some hafnium complexes derivates of hydroxy acids and EDTA

    International Nuclear Information System (INIS)

    Silveira, J.G. da.

    1981-01-01

    Measures of quadrupolar interaction to nucleus level of the metal, in some hafnium complexes are presented, including the analysis by combustion, microanalysis, infrared spectroscopy and thermogravimetry. The hyperfine interaction parameters, the temperature effects and the thermal neutrons capture effects over the irradiated Hf Y (Y = EDTA) are also studied. (author)

  2. A thermally robust and thickness independent ferroelectric phase in laminated hafnium zirconium oxide

    Directory of Open Access Journals (Sweden)

    S. Riedel

    2016-09-01

    Full Text Available Ferroelectric properties in hafnium oxide based thin films have recovered the scaling potential for ferroelectric memories due to their ultra-thin-film- and CMOS-compatibility. However, the variety of physical phenomena connected to ferroelectricity allows a wider range of applications for these materials than ferroelectric memory. Especially mixed HfxZr1-xO2 thin films exhibit a broad compositional range of ferroelectric phase stability and provide the possibility to tailor material properties for multiple applications. Here it is shown that the limited thermal stability and thick-film capability of HfxZr1-xO2 can be overcome by a laminated approach using alumina interlayers.

  3. Surface State Capture Cross-Section at the Interface between Silicon and Hafnium Oxide

    Directory of Open Access Journals (Sweden)

    Fu-Chien Chiu

    2013-01-01

    Full Text Available The interfacial properties between silicon and hafnium oxide (HfO2 are explored by the gated-diode method and the subthreshold measurement. The density of interface-trapped charges, the current induced by surface defect centers, the surface recombination velocity, and the surface state capture cross-section are obtained in this work. Among the interfacial properties, the surface state capture cross-section is approximately constant even if the postdeposition annealing condition is changed. This effective capture cross-section of surface states is about 2.4 × 10−15 cm2, which may be an inherent nature in the HfO2/Si interface.

  4. Thermal expansion studies on Hafnium titanate (HfTiO4)

    International Nuclear Information System (INIS)

    Panneerselvam, G.; Subramanian, G.G.S.; Antony, M.P.

    2006-01-01

    The lattice thermal expansion characteristics of hafnium titanate (HfTiO 4 ) have been studied by measuring the lattice parameter as a function of temperature by high temperature X-ray diffraction technique (HT-XRD) in the temperature range 298-1973K. Percentage linear thermal expansion and mean linear thermal expansion coefficients were computed from the lattice parameter data. The thermal expansion of HfTiO 4 is highly anisotropic. The expansivity along 'a' axis is large; as compared to the expansivity along 'b' axis which is negative below 1073 K. The percentage linear thermal expansion in the temperature range 298-1973 K along a, b and c axis are 2.74, 0.901 and 1.49 respectively. Thermal expansion values obtained in the present study are in reasonable agreement with the existing thermal expansion data. (author)

  5. Density and surface tension of melts of zirconium and hafnium fluorides with lithium fluoride

    International Nuclear Information System (INIS)

    Katyshev, S.F.; Artemov, V.V.; Desyatnik, V.N.

    1988-01-01

    A study was conducted to determine the temperature dependence of the density and surface tension of melts of LiF-ZrF 4 and LiF-HfF 4 . Density and surface tension were determined by the method of maximum pressure in an argon bubble. On the basis of experimental data over the entire concentration range the molar volumes and their relative deviations from the additive molar volumes were calculated for 1100 0 K. The positive deviations of the molar volumes from additivity in the LiF-HfF 4 system (22.45%) were greater than in the LiF-ZrF 4 system (15.75%). This indicated that the reaction with lithium fluoride is intensified with the switch to the hafnium fluoride. Results also demonstrated that the fluorides are surface-active components in the molten mixtures

  6. Extraction of hafnium with chelating agents from aqueous-alcoholic solutions

    International Nuclear Information System (INIS)

    Hala, J.; Prihoda, J.

    1975-01-01

    The extraction was studied of hafnium into solutions of N-benzoyl-N-phenylhydroxylamine, 2-thenoyltrifluoroacetone and di-n-butylphosphoric acid in benzene, toluene, chloroform and tetrachloromethane from aqueous alcoholic solutions with a formal acidity of 2M-HClO 4 . Methyl-, ethyl-, n- and isopropyl- and tert-butyl alcohol were used as organic components in the mixed aqueous-organic phase. In the extraction into N-benzoyl-N-phenylhydroxylamine the presence of the alcohols resulted in synergic effects analogous to the previously described extraction by substituted benzoylpyrazolone. With the other two extractants, the effect of the alcohols was antagonistic, due to the interaction of alcohol or water with the reagent in the organic phase, and to the decrease in the reagent distribution constant. (author)

  7. Interface and oxide traps in high-κ hafnium oxide films

    International Nuclear Information System (INIS)

    Wong, H.; Zhan, N.; Ng, K.L.; Poon, M.C.; Kok, C.W.

    2004-01-01

    The origins of the interface trap generation and the effects of thermal annealing on the interface and bulk trap distributions are studied in detail. We found that oxidation of the HfO 2 /Si interface, removal of deep trap centers, and crystallization of the as-deposited film will take place during the post-deposition annealing (PDA). These processes will result in the removal of interface traps and deep oxide traps and introduce a large amount of shallow oxide traps at the grain boundaries of the polycrystalline film. Thus, trade-off has to be made in considering the interface trap density and oxide trap density when conducting PDA. In addition, the high interface trap and oxide trap densities of the HfO 2 films suggest that we may have to use the SiO 2 /HfO 2 stack or hafnium silicate structure for better device performance

  8. Wake-up effects in Si-doped hafnium oxide ferroelectric thin films

    International Nuclear Information System (INIS)

    Zhou, Dayu; Xu, Jin; Li, Qing; Guan, Yan; Cao, Fei; Dong, Xianlin; Müller, Johannes; Schenk, Tony; Schröder, Uwe

    2013-01-01

    Hafnium oxide based ferroelectric thin films have shown potential as a promising alternative material for non-volatile memory applications. This work reports the switching stability of a Si-doped HfO 2 film under bipolar pulsed-field operation. High field cycling causes a “wake-up” in virgin “pinched” polarization hysteresis loops, demonstrated by an enhancement in remanent polarization and a shift of negative coercive voltage. The rate of wake-up is accelerated by either reducing the frequency or increasing the amplitude of the cycling field. We suggest de-pinning of domains due to reduction of the defect concentration at bottom electrode interface as origin of the wake-up

  9. Atom-vacancy ordering and magnetic susceptibility of nonstoichiometric hafnium carbide

    International Nuclear Information System (INIS)

    Gusev, A.I.; Zyryanova, A.N.

    1999-01-01

    Experimental results on magnetic susceptibility of nonstoichiometric hafnium carbide HfC y (0.6 0.71 , HfC 0.78 and HfC 0.83 in the range of 870-930 K the anomalies are revealed which are associated with superstructure short-range ordering in a non-metallics sublattice. It is shown that a short-range order in HfC 0.71 and HfC 0.78 carbides corresponds to Hf 3 C 2 ordered phase, and in HfC 0.83 carbide - to Hf 6 C 5 ordered phase. HfC 0.78 carbide is found to possesses zero magnetic susceptibility in temperature range 910-980 K [ru

  10. Sub-10 nm low current resistive switching behavior in hafnium oxide stack

    Energy Technology Data Exchange (ETDEWEB)

    Hou, Y., E-mail: houyi@pku.edu.cn, E-mail: lfliu@pku.edu.cn [Institute of Microelectronics, Peking University, 100871 Beijing (China); IMEC, Kapeldreef 75, B-3001 Heverlee (Belgium); Department of Physics and Astronomy, KU Leuven, Celestijnenlaan 200D, B-3001 Heverlee (Belgium); Celano, U.; Xu, Z.; Vandervorst, W. [IMEC, Kapeldreef 75, B-3001 Heverlee (Belgium); Department of Physics and Astronomy, KU Leuven, Celestijnenlaan 200D, B-3001 Heverlee (Belgium); Goux, L.; Fantini, A.; Degraeve, R.; Youssef, A.; Jurczak, M. [IMEC, Kapeldreef 75, B-3001 Heverlee (Belgium); Liu, L., E-mail: houyi@pku.edu.cn, E-mail: lfliu@pku.edu.cn; Cheng, Y.; Kang, J. [Institute of Microelectronics, Peking University, 100871 Beijing (China)

    2016-03-21

    In this letter, a tip-induced cell relying on the conductive atomic force microscope is proposed. It is verified as a referable replica of an integrated resistive random access memory (RRAM) device. On the basis of this cell, the functionality of sub-10 nm resistive switching is confirmed in hafnium oxide stack. Moreover, the low current switching behavior in the sub-10 nm dimension is found to be more pronounced than that of a 50 × 50 nm{sup 2} device. It shows better ON/OFF ratio and low leakage current. The enhanced memory performance is ascribed to a change in the shape of the conductive filament as the device dimensions are reduced to sub-10 nm. Therefore, device downscaling provides a promising approach for the resistance optimization that benefits the RRAM array design.

  11. Solvent extraction of hafnium(IV) by dinonylnaphthalene sulfonic acid from mixed aqueous-organic media

    International Nuclear Information System (INIS)

    Hala, J.; Piperkovova, H.

    1979-01-01

    The extraction of hafnium(IV) by heptane and toluene solutions of dinonylnaphthalene sulfonic acid (HD) from mixed aqueous-organic solutions has been studied. Alcohols, ketones, carboxylic acids, cyclic ethers, dimethylsulfoxide and dimethylformamide were used as the organic component of the mixed phase. Methanol, ethanol, formic acid and dioxane increased the extractability of Hf(IV) whereas other solvents showed only an antagonistic effect. The results were discussed from the point of view of the changes in micellar structure of HD, and compared with the uptake of Hf(IV) by resinous cation exchangers. The solubilization by HD of alcohols, carboxylic acids and dimethylsulfoxide was demonstrated by using the corresponding 14 C and 35 S labelled compounds. (author)

  12. Study of bulk Hafnium oxide (HfO2) under compression

    Science.gov (United States)

    Pathak, Santanu; Mandal, Guruprasad; Das, Parnika

    2018-04-01

    Hafnium oxide (HfO2) is a technologically important material. This material has K-value of 25 and band gap 5.8 eV. A k value of 25-30 is preferred for a gate dielectric [1]. As it shows good insulating and capacitive properties, HfO2 is being considered as a replacement to SiO2 in microelectronic devices as gate dielectrics. On the other hand because of toughening mechanism due to phase transformation induced by stress field observed in these oxides, HFO2 has been a material of investigations in various configurations for a very long time. However the controversies about phase transition of HfO2 under pressure still exists. High quality synchrotron radiation has been used to study the structural phase transition of HfO2 under pressure.

  13. Separation of hafnium from zirconium in their tetrachloride solution in molten alkali metal chlorides

    Energy Technology Data Exchange (ETDEWEB)

    Salyulev, A B; Kudyakov, V Ya; Smirnov, M V; Moskalenko, N I [AN SSSR, Sverdlovsk. Inst. Ehlektrokhimii

    1984-08-01

    The coefficient of HfCl/sub 4/ and ZrCl/sub 4/ separation in the process of vapour sublimation from their solutions in molten NaCl, KCl, CsCl, NaCl-KCl and NaCl-CsCl equimolar mixtures is found to vary in the series from approximately 1.10 to approximately 1.22 and practically not to depend on the temperature (in the 600-910 deg) range and concentration (2-25 mol.% ZrCl/sub 4/+HfCl/sub 4/). HfCl/sub 4/ and ZrCl/sub 4/ are shown to form almost perfect solutions with each other, which in their turn form imperfect solutions with molten alkali metal chlorides, with the strength of hafnium complex chloride anions increasing higher than that of zirconium in the series from NaCl to CsCl.

  14. Separation of hafnium from zirconium in their tetrachloride solution in molten alkali metal chlorides

    International Nuclear Information System (INIS)

    Salyulev, A.B.; Kudyakov, V.Ya.; Smirnov, M.V.; Moskalenko, N.I.

    1984-01-01

    The coefficient of HfCl 4 and ZrCl 4 separation in the process of vapour sublimation from their solutions in molten NaCl, KCl, CsCl, NaCl-KCl and NaCl-CsCl equimolar mixtures is found to vary in the series from approximately 1.10 to approximately 1.22 and practically not to depend on the temperature (in the 600-910 deg) range and concentration (2-25 mol.% ZrCl 4 +HfCl 4 ). HfCl 4 and ZrCl 4 are shown to form almost perfect solutions with each other, which in their turn form imperfect solutions with molten alkali metal chlorides, with the strength of hafnium complex chloride anions increasing higher than that of zirconium in the series from NaCl to CsCl

  15. Influence of plastic deformation on nitriding of a molybdenum-hafnium alloy

    International Nuclear Information System (INIS)

    Lakhtin, Yu.M.; Kogan, Ya.D.; Shashkov, D.P.; Likhacheva, T.E.

    1982-01-01

    The influence of a preliminary plastic strain on the structure and properties of molybdenum alloy with 0.2 wt.% Hf upon nitriding in the ammonia medium at 900-1200 deg C during 1-6 h is investigated. The study of microhardness distribution across the nitrided layer thickness has shown that with increase of the degree of preliminary plastic strain up to 50 % the nitrided layer hardness decreases and with further reduction growth up to 90 % - increases. Nitriding sharply (hundred times) increases wear resistance of molybdenum alloy with hafnium addition. At the reduction degree 25 % the wear resistance is less than at other values of percentage reduction in area owing to the minimum thickness of the nitride zone. The alloy strained before nitriding by 25 % has shown the best results during heat resistance testing

  16. Hafnium at subduction zones: isotopic budget of input and output fluxes

    International Nuclear Information System (INIS)

    Marini, J.Ch.

    2004-05-01

    Subduction zones are the primary regions of mass exchanges between continental crust and mantle of Earth through sediment subduction toward the earth's mantle and by supply of mantellic magmas to volcanic arcs. We analyze these mass exchanges using Hafnium and Neodymium isotopes. At the Izu-Mariana subduction zone, subducting sediments have Hf and Nd isotopes equivalent to Pacific seawater. Altered oceanic crust has Hf and Nd isotopic compositions equivalent to the isotopic budget of unaltered Pacific oceanic crust. At Luzon and Java subduction zones, arc lavas present Hf isotopic ratios highly radiogenic in comparison to their Nd isotopic ratios. Such compositions of the Luzon and Java arc lavas are controlled by a contamination of their sources by the subducted oceanic sediments. (author)

  17. Rapid screening of nuclear grade zirconium silicate without separation of hafnium from the bulk matrix

    International Nuclear Information System (INIS)

    Venkatesh, Manisha; Sharma, P.K.; Avhad, D.K.; Basu, H.; Singhal, R.K.; Reddy, A.V.R.

    2014-01-01

    Zirconium silicate, also zirconium orthosilicate, (ZrSiO 4 ) is a chemical compound, and occurs in nature as zircon, a silicate mineral. The concentration of Hafnium in nuclear grade Zirconium must be less than 0.2% w/w of Zr. In view of this it must be accurately chemically characterized before issuing a certification for export under non nuclear category. As the chemistry of Zr and Hf is similar, it is difficult to separate Hf by direct wet chemical method. During this work, concentration of Hf in zirconium silicate was measured by Field Portable X-ray Fluorescence (FPXRF) and results obtained were validated by using detailed chemical method. FPXRF spectrometry has become a common analytical technique for on-site screening and fast turnaround analysis of contaminant elements in environmental samples

  18. 49 CFR 173.2 - Hazardous materials classes and index to hazard class definitions.

    Science.gov (United States)

    2010-10-01

    ....50 1 1.6 Extremely insensitive detonating substances 173.50 2 2.1 Flammable gas 173.115 2 2.2 Non-flammable compressed gas 173.115 2 2.3 Poisonous gas 173.115 3 Flammable and combustible liquid 173.120 4 4.1 Flammable solid 173.124 4 4.2 Spontaneously combustible material 173.124 4 4.3 Dangerous when wet...

  19. 7 CFR 993.173 - Reports of accounting.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Reports of accounting. 993.173 Section 993.173... accounting. (a) Independent handler's reports of accounting. Within 10 days (exclusive of Saturdays, Sundays... association, makes an accounting or settlement with a producer or dehydrator for prunes delivered to him, he...

  20. 49 CFR 173.23 - Previously authorized packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Previously authorized packaging. 173.23 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.23 Previously authorized packaging. (a) When the regulations specify a packaging with a specification marking...

  1. 49 CFR 173.206 - Packaging requirements for chlorosilanes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging requirements for chlorosilanes. 173.206...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Non-bulk Packaging for Hazardous Materials Other Than Class 1 and Class 7 § 173.206 Packaging requirements for chlorosilanes. (a) When § 172.101 of this...

  2. 21 CFR 173.250 - Methyl alcohol residues.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methyl alcohol residues. 173.250 Section 173.250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD.... Methyl alcohol may be present in the following foods under the conditions specified: (a) In spice...

  3. 1 CFR 17.3 - Criteria for emergency publication.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Criteria for emergency publication. 17.3..., AND PROCESSING OF DOCUMENTS FILING FOR PUBLIC INSPECTION AND PUBLICATION SCHEDULES Emergency Schedule § 17.3 Criteria for emergency publication. The emergency schedule is designed to provide the fastest...

  4. 27 CFR 25.173 - Brewer in default.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Brewer in default. 25.173... OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.173 Brewer in default. (a) When a... the brewer is otherwise in default in payment of tax under § 25.164, beer may not be removed for...

  5. 9 CFR 381.173 - Mechanically Separated (Kind of Poultry).

    Science.gov (United States)

    2010-01-01

    ... Poultry). 381.173 Section 381.173 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...

  6. 40 CFR 265.173 - Management of containers.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 265.173... DISPOSAL FACILITIES Use and Management of Containers § 265.173 Management of containers. (a) A container... waste. (b) A container holding hazardous waste must not be opened, handled, or stored in a manner which...

  7. 40 CFR 264.173 - Management of containers.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 264.173... Use and Management of Containers § 264.173 Management of containers. (a) A container holding hazardous... container holding hazardous waste must not be opened, handled, or stored in a manner which may rupture the...

  8. 14 CFR 25.173 - Static longitudinal stability.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 25.173... AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Flight Stability § 25.173 Static... forces (including friction) must be as follows: (a) A pull must be required to obtain and maintain speeds...

  9. 14 CFR 23.173 - Static longitudinal stability.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 23.173... Stability § 23.173 Static longitudinal stability. Under the conditions specified in § 23.175 and with the airplane trimmed as indicated, the characteristics of the elevator control forces and the friction within...

  10. 49 CFR 173.316 - Cryogenic liquids in cylinders.

    Science.gov (United States)

    2010-10-01

    ... filling density for hydrogen, cryogenic liquid is defined as the percent ratio of the weight of lading in... 49 Transportation 2 2010-10-01 2010-10-01 false Cryogenic liquids in cylinders. 173.316 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.316 Cryogenic liquids in...

  11. 49 CFR 173.194 - Gas identification sets.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Gas identification sets. 173.194 Section 173.194... Gas identification sets. Gas identification sets containing poisonous material must be packaged in... silical gel, gas identification sets may be shipped as follows: (1) If the poisonous material does not...

  12. 21 CFR 133.173 - Pasteurized process cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese food. 133.173 Section 133.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

  13. 49 CFR 173.219 - Life-saving appliances.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Life-saving appliances. 173.219 Section 173.219... Life-saving appliances. (a) A life-saving appliance, self-inflating or non-self-inflating, containing small quantities of hazardous materials that are required as part of the life-saving appliance must...

  14. Extraction of hafnium by 1-phenyl-3-methyl-4-benzoyl-5-pyralozone from aqueous-alcoholic solutions

    International Nuclear Information System (INIS)

    Hala, J.; Prihoda, J.

    1975-01-01

    Extraction of hafnium by 1-phenyl-3-methyl-4-benzoyl-5-pyrazolone (HL) in benzene, toluene, chloroform and tetrachloromethane from aqueous-alcoholic solutions of the formal acidity of 2M-HClO 4 was studied. Methyl, ethyl, n- and isopropyl, tert-butyl and allyl alcohol as well as ethylene glycol monomethyl ether and propylene glycol were used as organic components of the mixed aqueous-organic phase. Their presence in some cases resulted in a synergic increase in the distribution ratio of hafnium. The increase is interpreted using the results of a slope analysis and measurements of the alcohol distribution and the relative permittivity of the organic phase. It is suggested that HfL 4 molecules were solvated by alcohol molecules in the organic phase. At high alcohol concentration synergism changed into antagonism. This was caused by changes in the distribution of HL and its interaction with the alcohol in the organic phase. (author)

  15. Hafnium isotope evidence for a transition in the dynamics of continental growth 3.2 Gyr ago.

    Science.gov (United States)

    Næraa, T; Scherstén, A; Rosing, M T; Kemp, A I S; Hoffmann, J E; Kokfelt, T F; Whitehouse, M J

    2012-05-30

    Earth's lithosphere probably experienced an evolution towards the modern plate tectonic regime, owing to secular changes in mantle temperature. Radiogenic isotope variations are interpreted as evidence for the declining rates of continental crustal growth over time, with some estimates suggesting that over 70% of the present continental crustal reservoir was extracted by the end of the Archaean eon. Patterns of crustal growth and reworking in rocks younger than three billion years (Gyr) are thought to reflect the assembly and break-up of supercontinents by Wilson cycle processes and mark an important change in lithosphere dynamics. In southern West Greenland numerous studies have, however, argued for subduction settings and crust growth by arc accretion back to 3.8 Gyr ago, suggesting that modern-day tectonic regimes operated during the formation of the earliest crustal rock record. Here we report in situ uranium-lead, hafnium and oxygen isotope data from zircons of basement rocks in southern West Greenland across the critical time period during which modern-like tectonic regimes could have initiated. Our data show pronounced differences in the hafnium isotope-time patterns across this interval, requiring changes in the characteristics of the magmatic protolith. The observations suggest that 3.9-3.5-Gyr-old rocks differentiated from a >3.9-Gyr-old source reservoir with a chondritic to slightly depleted hafnium isotope composition. In contrast, rocks formed after 3.2 Gyr ago register the first additions of juvenile depleted material (that is, new mantle-derived crust) since 3.9 Gyr ago, and are characterized by striking shifts in hafnium isotope ratios similar to those shown by Phanerozoic subduction-related orogens. These data suggest a transitional period 3.5-3.2 Gyr ago from an ancient (3.9-3.5 Gyr old) crustal evolutionary regime unlike that of modern plate tectonics to a geodynamic setting after 3.2 Gyr ago that involved juvenile crust generation by plate

  16. Results for heterogeneous poisoning of the critical HTR-test facility KAHTER using absorber elements containing hafnium and boron

    International Nuclear Information System (INIS)

    Drueke, V.; Filges, D.; Nabi, R.; Neef, R.D.; Paul, N.; Schaal, H.

    1979-10-01

    Experiments and checking computations for investigating the initial-core poisoning of the pebble bed high temperature reactor are described. Following the example of the THTR-300, THTR absorber elements poisoned with hafnium/boron were added to the THTR fuel- and graphite elements of the KAHTER core. Three different hafnium-boron poisoned core loadings, corresponding to 2.7, 5.3 and 8% reactivity compensation, were used in the experiments. For purposes of comparison, two cores exclusively boron poisoned were also studied. The poisoning of these cores correspond to 2.7 and 8% reactivity compensation. The experiments and checking computations should serve to test the accuracy of the theoretical models and data sets in modeling the reactivity effects of absorber poisoned elements in the THTR. In particular, the applicability of the nuclear data of hafnium and the treatment of resonance calculations should be verified. In addition, to determining critical masses and ksub(eff), special emphasis was placed in the experiments on the exact determination of all reactivity effects. In some cases, repeated loading of a configuration also provided a measure of the reproducibility of ksub(eff). The experiments were checked computationally using the GAMTEREX code package and the program system RSYST. These two computation packages contain different data bases, - although the hafnium data are identical -, and the computing models differ in certain phases of the calculations. Both code systems compute ksub(eff) values to within the present accuracy requirements, whereas the program system RSYST gives better agreement with experimental measurements. (orig.) 891 RW/orig. 892 RDG [de

  17. Ion-bombardment-induced reduction in vacancies and its enhanced effect on conductivity and reflectivity in hafnium nitride films

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Zhiqing; Wang, Jiafu; Hu, Chaoquan; Zhang, Xiaobo; Dang, Jianchen; Gao, Jing; Zheng, Weitao [Jilin University, School of Materials Science and Engineering, Key Laboratory of Mobile Materials, MOE, and State Key Laboratory of Superhard Materials, Changchun (China); Zhang, Sam [Nanyang Technological University, School of Mechanical and Aerospace Engineering, Singapore (Singapore); Wang, Xiaoyi [Chinese Academy of Sciences, Key Laboratory of Optical System Advanced Manufacturing Technology, Changchun Institute of Optics, Fine Mechanics and Physics, Changchun (China); Chen, Hong [Jilin University, Department of Control Science and Engineering, Changchun (China)

    2016-08-15

    Although the role of ion bombardment on electrical conductivity and optical reflectivity of transition metal nitrides films was reported previously, the results were controversial and the mechanism was not yet well explored. Here, we show that proper ion bombardment, induced by applying the negative bias voltage (V{sub b}), significantly improves the electrical conductivity and optical reflectivity in rocksalt hafnium nitride films regardless of level of stoichiometry (i.e., in both near-stoichiometric HfN{sub 1.04} and over-stoichiometric HfN{sub 1.17} films). The observed improvement arises from the increase in the concentration of free electrons and the relaxation time as a result of reduction in nitrogen and hafnium vacancies in the films. Furthermore, HfN{sub 1.17} films have always much lower electrical conductivity and infrared reflectance than HfN{sub 1.04} films for a given V{sub b}, owing to more hafnium vacancies because of larger composition deviation from HfN exact stoichiometry (N:Hf = 1:1). These new insights are supported by good agreement between experimental results and theoretical calculations. (orig.)

  18. Nano-scale Radiotherapy-NBTXR3 Hafnium Oxide Nanoparticles as Promising Cancer Therapy

    International Nuclear Information System (INIS)

    Maggiorella, L.; Barouch, G.; Devaux, C.; Pottier, A.; Levy, L.; Deutsch, E.; Bourhis, J.; Borghi, E.

    2011-01-01

    Complete text of publication follows: Background: There is considerable interest in approaches that could improve the therapeutic window of radiotherapy, which represents a crucial modality of treatment in oncology. We present the rationale for designing NBTXR3 nanoparticles activated by radiotherapy and validate the concept. We performed the Monte Carlo calculations for the first time based on the 'local model' simulation that showed a dose enhancement of radiation to tumour cells of approximately nine-fold. NBTXR3 was shown to deposit high energy when the ionizing radiation source is 'on' and to have chemically inert behavior in cellular and subcellular systems demonstrated by very good systemic tolerance, thus decreasing potential health hazards. Material and Methods: We used conventional methods, implemented in different ways, to explore interactions of high Z matter and ionizing radiation with biological systems. In addition, microtomography was performed to explore the nanoparticle volume occupancy inside the tumour and its persistence overtime in mouse tumour models. The antitumour activity of NBTXR3 and tolerance were evaluated in Ewing tumour (A673) and fibrosarcoma (HT1080) using high energy source. Results and Conclusion: We created and developed NBTXR3 nanoparticles with a crystalline hafnium oxide core which provide high electron density structure and inert behavior in biological media. NBTXR3 nanoparticles' characteristics, size, charge and shape, allow for efficient interaction with biological entities, cell membrane binding and cellular uptake. The nanoparticles were shown to form clusters at the subcellular level in tumour models. Of most importance, we show NBTXR3 intra-tumour bioavailability with dispersion of nanoparticles in the three dimensions and persistence within the tumour structure, supporting the use of NBTXR3 as effective antitumour therapeutic agent. Antitumour activity of NBTXR3 showed marked advantage in terms of survival, tumour

  19. Hafnium-doped hydroxyapatite nanoparticles with ionizing radiation for lung cancer treatment.

    Science.gov (United States)

    Chen, Min-Hua; Hanagata, Nobutaka; Ikoma, Toshiyuki; Huang, Jian-Yuan; Li, Keng-Yuan; Lin, Chun-Pin; Lin, Feng-Huei

    2016-06-01

    Recently, photodynamic therapy (PDT) is one of the new clinical options by generating cytotoxic reactive oxygen species (ROS) to kill cancer cells. However, the optical approach of PDT is limited by tissue penetration depth of visible light. In this study, we propose that a ROS-enhanced nanoparticle, hafnium-doped hydroxyapatite (Hf:HAp), which is a material to yield large quantities of ROS inside the cells when the nanoparticles are bombarded with high penetrating power of ionizing radiation. Hf:HAp nanoparticles are generated by wet chemical precipitation with total doping concentration of 15mol% Hf(4+) relative to Ca(2+) in HAp host material. The results show that the HAp particles could be successfully doped with Hf ions, resulted in the formation of nano-sized rod-like shape and with pH-dependent solubility. The impact of ionizing radiation on Hf:HAp nanoparticles is assessed by using in-vitro and in-vivo model using A549 cell line. The 2',7'-dichlorofluorescein diacetate (DCFH-DA) results reveal that after being exposed to gamma rays, Hf:HAp could significantly lead to the formation of ROS in cells. Both cell viability (WST-1) and cytotoxicity (LDH) assay show the consistent results that A549 lung cancer cell lines are damaged with changes in the cells' ROS level. The in-vivo studies further demonstrate that the tumor growth is inhibited owing to the cells apoptosis when Hf:HAp nanoparticles are bombarded with ionizing radiation. This finding offer a new therapeutic method of interacting with ionizing radiation and demonstrate the potential of Hf:HAp nanoparticles in tumor treatment, such as being used in a palliative treatment after lung surgical procedure. Photodynamic therapy (PDT) is one of the new clinical options by generating cytotoxic reactive oxygen species (ROS) to kill cancer cells. Unfortunately, the approach of PDT is usually limited to the treatment of systemic disease and deeper tumor, due to the limited tissue penetration depth of visible

  20. Characterization of hafnium oxide resistive memory layers deposited on copper by atomic layer deposition

    Energy Technology Data Exchange (ETDEWEB)

    Briggs, B.D.; Bishop, S.M. [SUNY College of Nanoscale Science and Engineering, 255 Fuller Road, Albany, NY 12203 (United States); Leedy, K.D. [Air Force Research Laboratory, 2241 Avionics Circle, Wright Patterson Air Force Base, Dayton, OH 45433 (United States); Cady, N.C., E-mail: ncady@albany.edu [SUNY College of Nanoscale Science and Engineering, 255 Fuller Road, Albany, NY 12203 (United States)

    2014-07-01

    Hafnium oxide-based resistive memory devices have been fabricated on copper bottom electrodes. The HfO{sub x} active layers in these devices were deposited by atomic layer deposition (ALD) at 250 °C with tetrakis(dimethylamido)hafnium(IV) as the metal precursor and an O{sub 2} plasma as the reactant. Depth profiles of the HfO{sub x} by X-ray photoelectron spectroscopy and secondary ion mass spectroscopy revealed a copper concentration on the order of five atomic percent throughout the HfO{sub x} film. In addition to the Cu doped HfO{sub x}, a thin layer (20 nm) of Cu{sub x}O is present at the surface. This surface layer is believed to have formed during the ALD process, and greatly complicates the analysis of the switching mechanism. The resistive memory structures fabricated from the ALD HfO{sub x} exhibited non-polar resistive switching, independent of the top metal electrode (Ni, Pt, Al, Au). Resistive switching current voltage (I–V) curves were analyzed using Schottky emission and ionic hopping models to gain insight into the physical mechanisms underpinning the device behavior. During the forming process it was determined that, at voltages in excess of 2.5 V, an ionic hopping model is in good agreement with the I–V data. The extracted ion hopping distance ∼ 4 Å was within the range of interatomic spacing of HfO{sub 2} during the forming process consistent with ionic motion of Cu{sup 2+} ions. Lastly the on state I–V data was dominated at larger voltages by Schottky emission with an estimated barrier height of ∼ 0.5 eV and a refractive index of 2.59. The consequence of the Schottky emission analysis indicates the on state resistance to be a product of a Pt/Cu{sub 2}O/Cu filament(s)/Cu{sub 2}O/Cu structure. - Highlights: • HfO{sub 2} was grown via atomic layer deposition at 250 and 100 °C on Cu substrates. • A Cu{sub 2}O surface layer and Cu doping were observed in post-deposition of HfO{sub 2}. • Resistive memory devices were fabricated and

  1. 46 CFR 173.058 - Double bottom requirements.

    Science.gov (United States)

    2010-10-01

    ... PERTAINING TO VESSEL USE School Ships § 173.058 Double bottom requirements. Each new sailing school vessel... service must comply with the double bottom requirements in §§ 171.105 through 171.109, inclusive, of this...

  2. 46 CFR 173.007 - Location of the hook load.

    Science.gov (United States)

    2010-10-01

    ... PERTAINING TO VESSEL USE Lifting § 173.007 Location of the hook load. When doing the calculations required in this subpart, the hook load must be considered to be located at the head of the crane. ...

  3. 49 CFR 173.218 - Fish meal or fish scrap.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Fish meal or fish scrap. 173.218 Section 173.218... Fish meal or fish scrap. (a) Except as provided in Column (7) of the HMT in § 172.101 of this subchapter, fish meal or fish scrap, containing at least 6%, but not more than 12% water, is authorized for...

  4. 32 CFR 173.3 - Profit reduction clause.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Profit reduction clause. 173.3 Section 173.3... violating 18 U.S.C. 201-224 (bribery, graft, and conflicts of interest), 18 U.S.C. 371 (conspiracy), 18 U.S.... 1341 (fraud), 18 U.S.C. 1343 (fraud by wire) for any act in connection with or related to the obtaining...

  5. Recoil Induced Room Temperature Stable Frenkel Pairs in a-Hafnium Upon Thermal Neutron Capture

    Science.gov (United States)

    Butz, Tilman; Das, Satyendra K.; Dey, Chandi C.; Ghoshal, Shamik

    2013-11-01

    Ultrapure hafnium metal (110 ppm zirconium) was neutron activated with a thermal neutron flux of 6:6 · 1012 cm-2s-1 in order to obtain 181Hf for subsequent time differential perturbed angular correlation (TDPAC) experiments using the nuclear probe 181Hf(β-) 181Ta. Apart from the expected nuclear quadrupole interaction (NQI) signal for a hexagonal close-packed (hcp) metal, three further discrete NQIs were observed with a few percent fraction each. The TDPAC spectra were recorded for up to 11 half lives with extreme statistical accuracy. The fitted parameters vary slightly within the temperature range between 248 K and 373 K. The signals corresponding to the three additional sites completely disappear after `annealing' at 453 K for one minute. Based on the symmetry of the additional NQIs and their temperature dependencies, they are tentatively attributed to Frenkel pairs produced by recoil due to the emission of a prompt 5:694 MeV -ray following thermal neutron capture and reported by the nuclear probe in three different positions. These Frenkel pairs are stable up to at least 373 K.

  6. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    Science.gov (United States)

    Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

    2014-11-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

  7. Characteristics of laser produced plasmas of hafnium and tantalum in the 1-7 nm region

    Science.gov (United States)

    Li, Bowen; Otsuka, Takamitsu; Sokell, Emma; Dunne, Padraig; O'Sullivan, Gerry; Hara, Hiroyuki; Arai, Goki; Tamura, Toshiki; Ono, Yuichi; Dinh, Thanh-Hung; Higashiguchi, Takeshi

    2017-11-01

    Soft X-ray (SXR) spectra from hafnium and tantalum laser produced plasmas were recorded in the 1-7 nm region using two Nd:YAG lasers with pulse lengths of 170 ps and 10 ns, respectively, operating at a range of power densities. The maximum focused peak power density was 2. 3 × 1014 W cm-2 for 170 ps pulses and 1. 8 × 1012 W cm-2 for 10 ns pulses, respectively. Two intense quasicontinuous intensity bands resulting from n = 4 - n = 4 and n = 4 - n = 5 unresolved transition arrays (UTAs) dominate both sets of experimental spectra. Comparison with calculations performed with the Cowan suite of atomic structure codes as well as consideration of previous experimental and theoretical results aided identification of the most prominent features in the spectra. For the 10 ns spectrum, the highest ion stage that could be identified from the n = 4 - n = 5 arrays were lower than silver-like Hf25+ and Ta26+ (which has a 4 d 104 f ground configuration) indicating that the plasma temperature attained was too low to produce ions with an outermost 4 d subshell, while for the 170 ps plasmas the presence of significantly higher stages was deduced and lines due to 4 d-5 p transitions were clearly evident. Furthermore, we show an enhancement of emission from tantalum using dual laser irradiation, and the effect of pre-pulse durations and delay times between two pulses are demonstrated.

  8. Ferroelectric transistors with monolayer molybdenum disulfide and ultra-thin aluminum-doped hafnium oxide

    Science.gov (United States)

    Yap, Wui Chung; Jiang, Hao; Liu, Jialun; Xia, Qiangfei; Zhu, Wenjuan

    2017-07-01

    In this letter, we demonstrate ferroelectric memory devices with monolayer molybdenum disulfide (MoS2) as the channel material and aluminum (Al)-doped hafnium oxide (HfO2) as the ferroelectric gate dielectric. Metal-ferroelectric-metal capacitors with 16 nm thick Al-doped HfO2 are fabricated, and a remnant polarization of 3 μC/cm2 under a program/erase voltage of 5 V is observed. The capability of potential 10 years data retention was estimated using extrapolation of the experimental data. Ferroelectric transistors based on embedded ferroelectric HfO2 and MoS2 grown by chemical vapor deposition are fabricated. Clockwise hysteresis is observed at low program/erase voltages due to slow bulk traps located near the 2D/dielectric interface, while counterclockwise hysteresis is observed at high program/erase voltages due to ferroelectric polarization. In addition, the endurances of the devices are tested, and the effects associated with ferroelectric materials, such as the wake-up effect and polarization fatigue, are observed. Reliable writing/reading in MoS2/Al-doped HfO2 ferroelectric transistors over 2 × 104 cycles is achieved. This research can potentially lead to advances of two-dimensional (2D) materials in low-power logic and memory applications.

  9. Silicon-doped hafnium oxide anti-ferroelectric thin films for energy storage

    Science.gov (United States)

    Ali, Faizan; Liu, Xiaohua; Zhou, Dayu; Yang, Xirui; Xu, Jin; Schenk, Tony; Müller, Johannes; Schroeder, Uwe; Cao, Fei; Dong, Xianlin

    2017-10-01

    Motivated by the development of ultracompact electronic devices as miniaturized energy autonomous systems, great research efforts have been expended in recent years to develop various types of nano-structural energy storage components. The electrostatic capacitors characterized by high power density are competitive; however, their implementation in practical devices is limited by the low intrinsic energy storage density (ESD) of linear dielectrics like Al2O3. In this work, a detailed experimental investigation of energy storage properties is presented for 10 nm thick silicon-doped hafnium oxide anti-ferroelectric thin films. Owing to high field induced polarization and slim double hysteresis, an extremely large ESD value of 61.2 J/cm3 is achieved at 4.5 MV/cm with a high efficiency of ˜65%. In addition, the ESD and the efficiency exhibit robust thermal stability in 210-400 K temperature range and an excellent endurance up to 109 times of charge/discharge cycling at a very high electric field of 4.0 MV/cm. The superior energy storage performance together with mature technology of integration into 3-D arrays suggests great promise for this recently discovered anti-ferroelectric material to replace the currently adopted Al2O3 in fabrication of nano-structural supercapacitors.

  10. Hafnium Films and Magnetic Shielding for TIME, A mm-Wavelength Spectrometer Array

    Science.gov (United States)

    Hunacek, J.; Bock, J.; Bradford, C. M.; Butler, V.; Chang, T.-C.; Cheng, Y.-T.; Cooray, A.; Crites, A.; Frez, C.; Hailey-Dunsheath, S.; Hoscheit, B.; Kim, D. W.; Li, C.-T.; Marrone, D.; Moncelsi, L.; Shirokoff, E.; Steinbach, B.; Sun, G.; Trumper, I.; Turner, A.; Uzgil, B.; Weber, A.; Zemcov, M.

    2018-04-01

    TIME is a mm-wavelength grating spectrometer array that will map fluctuations of the 157.7-μm emission line of singly ionized carbon ([CII]) during the epoch of reionization (redshift z ˜ 5-9). Sixty transition-edge sensor (TES) bolometers populate the output arc of each of the 32 spectrometers, for a total of 1920 detectors. Each bolometer consists of gold absorber on a ˜ 3 × 3 mm silicon nitride micro-mesh suspended near the corners by 1 × 1 × 500 μm silicon nitride legs targeting a photon-noise-dominated NEP ˜ 1 × 10^{-17} W/√{Hz} . Hafnium films are explored as a lower-T_c alternative to Ti (500 mK) for TIME TESs, allowing thicker support legs for improved yield. Hf T_c is shown to vary between 250 and 450 mK when varying the resident Ar pressure during deposition. Magnetic shielding designs and simulations are presented for the TIME first-stage SQUIDs. Total axial field suppression is predicted to be 5 × 10^7.

  11. Tuning the magnetic properties of pure hafnium by high pressure torsion

    International Nuclear Information System (INIS)

    Cepeda-Jiménez, C.M.; Beltrán, J.I.; Hernando, A.; García, M.A.; Ynduráin, F.; Zhilyaev, A.; Pérez-Prado, M.T.

    2017-01-01

    This work demonstrates that room temperature (RT) ferromagnetism might be triggered in pure hafnium (Hf), a classic paramagnet, by severe plastic deformation (SPD) via high pressure torsion (HPT). The origin of this phenomenon is elucidated by a combined approach including density functional theory (DFT) calculations and transmission electron microscopy (TEM). In particular, it is shown that the elastic lattice distorsions induced in pure Hf as a consequence of grain refinement down to the nanocrystalline regime by HPT lead to the development of a new monoclinic crystalline structure that exhibits a spontaneous magnetization at RT. DFT calculations are utilized to prove that local stretching of the original pure Hf hexagonal close packed (hcp) lattice along specific pyramidal directions, due to the presence of internal stresses in the deformed nanostructure, may give rise to the emergence of the monoclinic phase, which is endowed with a net magnetic moment. An excellent agreement is found between DFT calculations and experimental TEM observations, which provide a first evidence of the presence of the pure Hf monoclinic crystal lattice. This work shows that SPD may constitute a viable, yet widely unexplored, strategy to tune the magnetic properties and, in particular, to induce RT ferromagnetism in bulk non-magnetic metals.

  12. In-Pile Experiment of a New Hafnium Aluminide Composite Material to Enable Fast Neutron Testing in the Advanced Test Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Donna Post Guillen; Douglas L. Porter; James R. Parry; Heng Ban

    2010-06-01

    A new hafnium aluminide composite material is being developed as a key component in a Boosted Fast Flux Loop (BFFL) system designed to provide fast neutron flux test capability in the Advanced Test Reactor. An absorber block comprised of hafnium aluminide (Al3Hf) particles (~23% by volume) dispersed in an aluminum matrix can absorb thermal neutrons and transfer heat from the experiment to pressurized water cooling channels. However, the thermophysical properties, such as thermal conductivity, of this material and the effect of irradiation are not known. This paper describes the design of an in-pile experiment to obtain such data to enable design and optimization of the BFFL neutron filter.

  13. Rapid formation of nanocrystalline HfO2 powders from amorphous hafnium hydroxide under ultrasonically assisted hydrothermal treatment

    International Nuclear Information System (INIS)

    Meskin, Pavel E.; Sharikov, Felix Yu.; Ivanov, Vladimir K.; Churagulov, Bulat R.; Tretyakov, Yury D.

    2007-01-01

    Peculiarities of hafnium hydroxide hydrothermal decomposition were studied by in situ heat flux calorimetry for the first time. It was shown that this process occurs in one exothermal stage (ΔH = -17.95 kJ mol -1 ) at 180-250 deg. C resulting in complete crystallization of amorphous phase with formation of pure monoclinic HfO 2 . It was found that the rate of m-HfO 2 formation can be significantly increased by combining hydrothermal treatment with simultaneous ultrasonic activation

  14. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    International Nuclear Information System (INIS)

    Nguyen, Duc; Girolami, Gregory S.; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Lyding, Joseph; Gruebele, Martin

    2014-01-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB 2 glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB 2 has a very high bulk glass transition temperature T g , and we observe no three-state hopping or sequential two-state hopping previously seen on lower T g glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses

  15. Materials properties of hafnium and zirconium silicates: Metal interdiffusion and dopant penetration studies

    Science.gov (United States)

    Quevedo Lopez, Manuel Angel

    Hafnium and Zirconium based gate dielectrics are considered potential candidates to replace SiO2 or SiON as the gate dielectric in CMOS processing. Furthermore, the addition of nitrogen into this pseudo-binary alloy has been shown to improve their thermal stability, electrical properties, and reduce dopant penetration. Because CMOS processing requires high temperature anneals (up to 1050°C), it is important to understand the diffusion properties of any metal associated with the gate dielectric in silicon at these temperatures. In addition, dopant penetration from the doped polysilicon gate into the Si channel at these temperatures must also be studied. Impurity outdiffusion (Hf, Zr) from the dielectric, or dopant (B, As, P) penetration through the dielectric into the channel region would likely result in deleterious effects upon the carrier mobility. In this dissertation extensive thermal stability studies of alternate gate dielectric candidates ZrSixOy and HfSixO y are presented. Dopant penetration studies from doped-polysilicon through HfSixOy and HfSixOyNz are also presented. Rutherford Backscattering Spectroscopy (RBS), Heavy Ion RBS (HI-RBS), X-ray Photoelectron Spectroscopy (XPS), High Resolution Transmission Electron Microscopy (HR-TEM), and Time of Flight and Dynamic Secondary Ion Mass Spectroscopy (ToF-SIMS, D-SIMS) methods were used to characterize these materials. The dopant diffusivity is calculated by modeling of the dopant profiles in the Si substrate. In this disseration is reported that Hf silicate films are more stable than Zr silicate films, from the metal interdiffusion point of view. On the other hand, dopant (B, As, and P) penetration is observed for HfSixO y films. However, the addition of nitrogen to the Hf - Si - O systems improves the dopant penetration properties of the resulting HfSi xOyNz films.

  16. Protective coatings of hafnium dioxide by atomic layer deposition for microelectromechanical systems applications

    Energy Technology Data Exchange (ETDEWEB)

    Berdova, Maria, E-mail: maria.berdova@aalto.fi [Aalto University, Department of Materials Science and Engineering, 02150, Espoo (Finland); Wiemer, Claudia; Lamperti, Alessio; Tallarida, Grazia; Cianci, Elena [Laboratorio MDM, IMM CNR, Via C. Olivetti 2, 20864, Agrate Brianza, MB (Italy); Lamagna, Luca; Losa, Stefano; Rossini, Silvia; Somaschini, Roberto; Gioveni, Salvatore [STMicroelectronics, Via C. Olivetti 2, 20864, Agrate Brianza, MB (Italy); Fanciulli, Marco [Laboratorio MDM, IMM CNR, Via C. Olivetti 2, 20864, Agrate Brianza, MB (Italy); Università degli studi di Milano Bicocca, Dipartimento di Scienza dei Materiali, 20126, Milano (Italy); Franssila, Sami, E-mail: sami.franssila@aalto.fi [Aalto University, Department of Materials Science and Engineering, 02150, Espoo (Finland)

    2016-04-15

    Graphical abstract: - Highlights: • Atomic layer deposition of HfO{sub 2} from (CpMe){sub 2}Hf(OMe)Me or Hf(NMeEt){sub 4} and ozone for potential applications in microelectromechanical systems. • ALD HfO{sub 2} protects aluminum substrates from degradation in moist environment and at the same time retains good reflectance properties of the underlying material. • The resistance of hafnium dioxide to moist environment is independent of chosen precursors. - Abstract: This work presents the investigation of HfO{sub 2} deposited by atomic layer deposition (ALD) from either HfD-CO4 or TEMAHf and ozone for microelectromechanical systems (MEMS) applications, in particular, for environmental protection of aluminum micromirrors. This work shows that HfO{sub 2} films successfully protect aluminum in moist environment and at the same time retain good reflectance properties of underlying material. In our experimental work, the chemical composition, crystal structure, electronic density and roughness of HfO{sub 2} films remained the same after one week of humidity treatment (relative humidity of 85%, 85 °C). The reflectance properties underwent only minor changes. The observed shift in reflectance was only from 80–90% to 76–85% in 400–800 nm spectral range when coated with ALD HfO{sub 2} films grown with Hf(NMeEt){sub 4} and no shift (remained in the range of 68–83%) for films grown from (CpMe){sub 2}Hf(OMe)Me.

  17. Study of hafnium (IV) oxide nanoparticles synthesized by polymerized complex and polymer precursor derived sol-gel methods

    KAUST Repository

    Ramos-Gonzá lez, R.; Garcí a-Cerda, L. A.; Alshareef, Husam N.; Gnade, Bruce E.; Quevedo-Ló pez, Manuel Angel Quevedo

    2010-01-01

    This work reports the preparation and characterization of hafnium (IV) oxide (HfO2) nanoparticles grown by derived sol-gel routes that involves the formation of an organic polymeric network. A comparison between polymerized complex (PC) and polymer precursor (PP) methods is presented. For the PC method, citric acid (CA) and ethylene glycol (EG) are used as the chelating and polymerizable reagents, respectively. In the case of PP method, poly(acrylic acid) (PAA) is used as the chelating reagent. In both cases, different precursor gels were prepared and the hafnium (IV) chloride (HfCl4) molar ratio was varied from 0.1 to 1.0 for the PC method and from 0.05 to 0.5 for the PP method. In order to obtain the nanoparticles, the precursors were heat treated at 500 and 800 °C. The thermal characterization of the precursor gels was carried out by thermogravimetric analysis (TGA) and the structural and morphological characterization by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The XRD patterns of the samples obtained by both methods shows the formation of HfO2 at 500 °C with monoclinic crystalline phase. The PC method exhibited also the cubic phase. Finally, the HfO2 nanoparticles size (4 to 11 nm) was determined by TEM and XRD patterns. © (2010) Trans Tech Publications.

  18. Study of hafnium (IV) oxide nanoparticles synthesized by polymerized complex and polymer precursor derived sol-gel methods

    KAUST Repository

    Ramos-González, R.

    2010-03-01

    This work reports the preparation and characterization of hafnium (IV) oxide (HfO2) nanoparticles grown by derived sol-gel routes that involves the formation of an organic polymeric network. A comparison between polymerized complex (PC) and polymer precursor (PP) methods is presented. For the PC method, citric acid (CA) and ethylene glycol (EG) are used as the chelating and polymerizable reagents, respectively. In the case of PP method, poly(acrylic acid) (PAA) is used as the chelating reagent. In both cases, different precursor gels were prepared and the hafnium (IV) chloride (HfCl4) molar ratio was varied from 0.1 to 1.0 for the PC method and from 0.05 to 0.5 for the PP method. In order to obtain the nanoparticles, the precursors were heat treated at 500 and 800 °C. The thermal characterization of the precursor gels was carried out by thermogravimetric analysis (TGA) and the structural and morphological characterization by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The XRD patterns of the samples obtained by both methods shows the formation of HfO2 at 500 °C with monoclinic crystalline phase. The PC method exhibited also the cubic phase. Finally, the HfO2 nanoparticles size (4 to 11 nm) was determined by TEM and XRD patterns. © (2010) Trans Tech Publications.

  19. 49 CFR 173.340 - Tear gas devices.

    Science.gov (United States)

    2010-10-01

    ... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.340 Tear gas devices. (a) Packagings for...) Tear gas devices may not be assembled with, or packed in the same packaging with, mechanically- or manually-operated firing, igniting, bursting, or other functioning elements unless of a type and design...

  20. 40 CFR 98.173 - Calculating GHG emissions.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Iron and Steel Production § 98.173 Calculating GHG emissions... for the process as specified in paragraphs (b)(1)(i) through (b)(1)(vii) of this section. The... the gaseous fuel (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf per kg-mole at standard...

  1. 33 CFR 173.27 - Numbers: Display; size; color.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Numbers: Display; size; color...: Display; size; color. (a) Each number required by § 173.15 must: (1) Be painted on or permanently attached...; (3) Contrast with the color of the background and be distinctly visible and legible; (4) Have spaces...

  2. 21 CFR 173.21 - Perfluorinated ion exchange membranes.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Perfluorinated ion exchange membranes. 173.21... ion exchange membranes. Substances identified in paragraph (a) of this section may be safely used as ion exchange membranes intended for use in the treatment of bulk quantities of liquid food under the...

  3. 49 CFR 173.60 - General packaging requirements for explosives.

    Science.gov (United States)

    2010-10-01

    ... explosives contained in the package, so that neither interaction between the explosives and the packaging... 49 Transportation 2 2010-10-01 2010-10-01 false General packaging requirements for explosives. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1...

  4. 21 CFR 173.395 - Trifluoromethane sulfonic acid.

    Science.gov (United States)

    2010-04-01

    ...) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.395 Trifluoromethane sulfonic acid. Trifluoromethane sulfonic acid... acid) may safely be used in the production of cocoa butter substitute from palm oil (1-palmitoyl-2...

  5. 14 CFR 135.173 - Airborne thunderstorm detection equipment requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airborne thunderstorm detection equipment... Aircraft and Equipment § 135.173 Airborne thunderstorm detection equipment requirements. (a) No person may... the aircraft is equipped with either approved thunderstorm detection equipment or approved airborne...

  6. 49 CFR 173.306 - Limited quantities of compressed gases.

    Science.gov (United States)

    2010-10-01

    ... container must be weighed and leak tested. The leak detection equipment must be sufficiently sensitive to... Section 173.306 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... softening provided that it does not leak. (vi) As an alternative to the hot water bath test in paragraph (a...

  7. 49 CFR 173.312 - Requirements for shipment of MEGCs.

    Science.gov (United States)

    2010-10-01

    ...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.312 Requirements... MEGC's structural or service equipment may be affected. (4) No person may fill or offer for... requalification due date. (5) Prior to filling and offering a MEGC for transportation, the MEGC's structural and...

  8. 49 CFR 173.7 - Government operations and materials.

    Science.gov (United States)

    2010-10-01

    ...) Determining the airworthiness and directing maintenance of the aircraft; and (3) Dispatching the aircraft... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.7 Government operations and materials. (a) Hazardous... regulations in this subchapter or in packagings of equal or greater strength and efficiency as certified by...

  9. Corrosion resistant surface for vanadium nitride and hafnium nitride layers as function of grain size

    Science.gov (United States)

    Escobar, C. A.; Caicedo, J. C.; Aperador, W.

    2014-01-01

    In this research it was studied vanadium nitride (VN) and hafnium nitride (HfN) film, which were deposited onto silicon (Si (100)) and AISI 4140 steel substrates via r.f. magnetron sputtering technique in Ar/N2 atmosphere with purity at 99.99% for both V and Hf metallic targets. Both films were approximately 1.2±0.1 μm thick. The crystallography structures that were evaluated via X-ray diffraction analysis (XRD) showed preferential orientations in the Bragg planes VN (200) and HfN (111). The chemical compositions for both films were characterized by EDX. Atomic Force Microscopy (AFM) was used to study the morphology; the results reveal grain sizes of 78±2 nm for VN and 58±2 nm for HfN and roughness values of 4.2±0.1 nm for VN and 1.5±0.1 nm for HfN films. The electrochemical performance in VN and HfN films deposited onto steel 4140 were studied by Tafel polarization curves and impedance spectroscopy methods (EIS) under contact with sodium chloride at 3.5 wt% solution, therefore, it was found that the corrosion rate decreased about 95% in VN and 99% for HfN films in relation to uncoated 4140 steel, thus demonstrating, the protecting effect of VN and HfN films under a corrosive environment as function of morphological characteristics (grain size). VN(grain size)=78±2.0 nm, VN(roughness)=4.2±0.1 nm, VN(corrosion rate)=40.87 μmy. HfN(grain size)=58±2.0 nm, HfN(roughness)=1.5±0.1 nm, HfN(corrosion rate)=0.205 μmy. It was possible to analyze that films with larger grain size, can be observed smaller grain boundary thus generating a higher corrosion rate, therefore, in this work it was found that the HfN layer has better corrosion resistance (low corrosion rate) in relation to VN film which presents a larger grain size, indicating that the low grain boundary in (VN films) does not restrict movement of the Cl- ion and in this way the corrosion rate increases dramatically.

  10. Synthesis and characterization of hafnium carbide microcrystal chains with a carbon-rich shell via CVD

    International Nuclear Information System (INIS)

    Tian, Song; Li, Hejun; Zhang, Yulei; Liu, Sen; Fu, Yangxi; Li, Yixian; Qiang, Xinfa

    2013-01-01

    Graphical abstract: Novel HfC microcrystal chains have been synthesized via a catalyst-assisted chemical vapor deposition process. SEM results show the chains have a periodically changing diameter and a nanoscale sharpening tip. Analysis of TEM/SAED/EELS/EDX data shows the single-crystal chains grow along a [0 0 1] direction and consist of a HfC core and a thin carbon-rich shell with embedded HfC nanocrystallites surrounding the core. This work achieves the controllable preparation of nanoscale HfC sharpening tips for application as a point electron emission source and facilitates the application of HfC ultrafast laser-triggered tips in attosecond science. Highlights: •HfC microcrystal chains were synthesized by a catalyst-assisted CVD. •The chains grow along a [0 0 1] direction and have a periodically changing diameter. •Single-crystal HfC core is sheathed by a thin carbon-rich shell. •A growth mechanism model is proposed to explain the growth of microcrystal chians. •This work achieves the controllable preparation of nanoscale HfC sharpening tips. -- Abstract: Novel hafnium carbide (HfC) microcrystal chains, with a periodically changing diameter and a nanoscale sharpening tip at the chain end, have been synthesized via a catalyst-assisted chemical vapor deposition (CVD) process. The as-synthesized chains with many octahedral microcrystals have diameters of between several hundreds of nm and 6 μm and lengths of ∼500 μm. TEM diffraction studies show that the chains are single-crystalline HfC and preferentially grow along a [0 0 1] crystal orientation. TEM/EELS/EDX analysis proves the chains are composed of a HfC core and a thin (several tens of nm to 100 nm) carbon-rich shell with the embedded HfC nanocrystallites (typically below 10 nm) surrounding the core. The growth mechanism model for the chains based on the vapor–liquid–solid process, the vapor–solid process, and the HfC crystal growth characteristics is discussed

  11. Hafnium in peralkaline and peraluminous boro-aluminosilicate glass, and glass subcomponents: a solubility study

    International Nuclear Information System (INIS)

    Davis, Linda L.; Darab, John G.; Qian, Maoxu; Zhao, Donggao; Palenik, Christopher S.; Li, Hong; Strachan, Denis M.; Li, Liyu

    2003-01-01

    A relationship between the solubility of hafnia (HfO2) and the host glass composition was explored by determining the solubility limits of HfO2 in peralkaline and peraluminous borosilicate glasses in the system SiO2-Al2O3-B2O3-Na2O, and in glasses in the system SiO2-Na2O-Al2O3 in air at 1450 C. The only Hf-bearing phase to crystallize in the peralkaline borosilicate melts is hafnia, while in the boron-free melts sodium-hafnium silicates crystallize. All peraluminous borosilicate melts crystallize hafnia, but the slightly peraluminous glasses also have sector-zoned hafnia crystals that contain Al and Si. The more peraluminous borosilicate glasses also crystallize a B-containing mullite. The general morphology of the hafnia crystals changes as peralkalinity (Na2O/(Na2O+Al2O3)) decreases, as expected in melts with increasing viscosity. In all of the glasses with Na2O > Al2O3, the solubility of hafnia is linearly and positively correlated with Na2O/(Na2O + Al2O3) or Na2O - Al2O3 (excess sodium), despite the presence of 5 to 16 mol% B2O3. The solubility of hafnia is higher in the sodium-aluminum borosilicate glasses than in the sodium-aluminosilicate glasses, suggesting that the boron is enhancing the effect that excess sodium has on the incorporation of Hf into the glass structure. The results of this solubility study are compared to other studies of high-valence cation solubility in B-free silicate melts. From this, for peralkaline B-bearing glasses, it is shown that, although the solubility limits are higher, the solution behavior of hafnia is the same as in B-free silicate melts previously studied. By comparison, also, it is shown that in peraluminous melts, there must be a different solution mechanism for hafnia: different than for peralkaline sodium-aluminum borosilicate glasses and different than for B-free silicate melts studied by others

  12. Nano-crystals of cerium–hafnium binary oxide: Their size-dependent structure

    Energy Technology Data Exchange (ETDEWEB)

    Raitano, Joan M. [Department of Applied Physics and Applied Mathematics, Materials Science and Engineering Program, Columbia University, New York, NY 10027 (United States); Khalid, Syed [National Synchrotron Light Source, Brookhaven National Laboratory, Upton, NY 11973 (United States); Marinkovic, Nebojsa [Chemical Engineering Department, Columbia University, 500 W 120th St, Mudd 801, New York, NY 10027 (United States); Chan, Siu-Wai, E-mail: sc174@columbia.edu [Department of Applied Physics and Applied Mathematics, Materials Science and Engineering Program, Columbia University, New York, NY 10027 (United States)

    2015-09-25

    Highlights: • (1 − x)CeO{sub 2}–xHfO{sub 2} was precipitated (0 < x < 1) and calcined in air. • For x ⩽ 0.14, crystallites ⩽140 nm in size exhibit only the fluorite structure. • This low hafnia solubility is attributable to no auto-reduction (Ce{sup 3+} = 0). • The low solubility is also due to the high temperature required for homogenization. • Coarsening is lessened as Hf{sup 4+} ions slow cation diffusion in these crystallites. - Abstract: Cerium oxide (CeO{sub 2}, “ceria”) and hafnium oxide (HfO{sub 2}, “hafnia”) were aqueously co-precipitated and subsequently calcined to allow for homogenization. The size of the (1−x)CeO{sub 2}–xHfO{sub 2} crystallites, determined by the Scherrer equation, varied from 140 nm for x = 0 to 15 nm for x = 0.73. For x ⩽ 0.14, only cubic structures are visible in X-ray diffractograms, and the lattice parameters are consistent with the values expected for structurally cubic solid solutions of hafnia in ceria. At x = 0.26, tetragonal and monoclinic phases nucleated with the former not being observed in the bulk phase diagram for ceria–hafnia. Therefore, the solubility limit of the cubic structure is between x = 0.14 and x = 0.26 for 40–61 nm crystallites, the sizes of these respective compositions. More specifically, for the 40 nm crystallites of x = 0.26 (1 − x)CeO{sub 2}–xHfO{sub 2}, 15% of the hafnia remains in a structurally cubic solid solution with ceria based on the observed cubic lattice parameter. The compositional domain for the cubic fluorite structure in this study is narrower than other nanostructured (1 − x)CeO{sub 2}–xHfO{sub 2} studies, especially studies with crystallite sizes less than 10 nm, but wider than observed in the bulk and helps to expand the size regime over which the relationship between crystallite size and phase stability is known. The extent of this cubic-structure domain is mainly attributable to the intermediate crystallite size and the roughly zero Ce{sup 3

  13. A search for long-lived radionuclides produced by fast-neutron irradiations of copper, silver, europium, terbium, and hafnium

    International Nuclear Information System (INIS)

    Meadows, J.W.; Smith, D.L.; Ikeda, Y.; Konno, C.

    1990-01-01

    Identical sample packets, each containing samples of elemental copper, silver, europium, terbium, and hafnium, as well as titanium, iron and nickel as dosimeters, have been irradiated in three distinct accelerator neutron fields (at Argonne National Laboratory and Los Alamos National Laboratory in the U.S.A., and Japan Atomic Energy Research Institute, Tokai, Japan) as part of an interlaboratory research collaboration to search for the production of long-lived radionuclides for fusion waste disposal applications. This paper is a progress report on this project. To date, we have detected the following activities, and have obtained preliminary experimental cross section values for several of these: Ag-106m,108m,110m; Eu-150m,152g,154; Tb-158,160; and Hf-175,178m2,179m2,181. (author). 11 refs, 1 fig., 4 tabs

  14. Improved DC performance of AlGaN/GaN high electron mobility transistors using hafnium oxide for surface passivation

    International Nuclear Information System (INIS)

    Liu, Chang; Chor, Eng Fong; Tan, Leng Seow

    2007-01-01

    Improved DC performance of AlGaN/GaN high electron mobility transistors (HEMTs) have been demonstrated using reactive-sputtered hafnium oxide (HfO 2 ) thin film as the surface passivation layer. Hall data indicate a significant increase in the product of sheet carrier concentration (n s ) and electron mobility (μ n ) in the HfO 2 -passivated HEMTs, compared to the unpassivated HEMTs. This improvement in electron carrier characteristics gives rise to a 22% higher I Dmax and an 18% higher g mmax in HEMTs with HfO 2 passivation relative to the unpassivated devices. On the other hand, I gleak of the HEMTs decreases by nearly one order of magnitude when HfO 2 passivation is applied. In addition, drain current is measured in the subthreshold regime. Compared to the unpassivated HEMTs, HfO 2 -passivated HEMTs exhibit a much smaller off-state I D , indicating better turn-off characteristics

  15. About the structure and stability of complex carbonates of thorium (IV), cerium (IV), zirconium (IV), hafnium (IV)

    International Nuclear Information System (INIS)

    Dervin, Jacqueline

    1972-01-01

    This research thesis addressed the study of complex carbonates of cations of metals belonging to the IV A column, i.e. thorium (IV), zirconium (IV), hafnium (IV), and also cerium (IV) and uranium (VI), and more particularly focused on ionic compounds formed in solution, and also on the influence of concentration and nature of cations on stability and nature of the formed solid. The author first presents methods used in this study, discusses their precision and scope of validity. She reports the study of the formation of different complex ions which have been highlighted in solution, and the determination of their formation constants. She reports the preparation and study of the stability domain of solid complexes. The next part reports the use of thermogravimetric analysis, IR spectrometry, and crystallography for the structural study of these compounds

  16. Tribo-electrochemical characterization of hafnium multilayer systems deposited on nitride/vanadium nitride AISI 4140 steel

    Science.gov (United States)

    Mora, M.; Vera, E.; Aperador, W.

    2016-02-01

    In this work is presented the synergistic behaviour among corrosion/wear (tribocorrosion) of the multilayer coatings hafnium nitride/vanadium nitride [HfN/VN]n. The multilayers were deposited on AISI 4140 steel using the technique of physical vapor deposition PVD magnetron sputtering, the tests were performed using a pin-on-disk tribometer, which has an adapted potentiostat galvanostat with three-electrode electrochemical cell. Tribocorrosive parameters such as: Friction coefficient between the coating and the counter body (100 Cr6 steel ball); Polarization resistance by means of electrochemical impedance spectroscopy technique and corrosion rate by polarization curves were determined. It was observed an increase in the polarization resistance, a decrease in the corrosion rate and a low coefficient of friction in comparison with the substrate, due to an increase on the number of bilayers.

  17. Tribo-electrochemical characterization of hafnium multilayer systems deposited on nitride/vanadium nitride AISI 4140 steel

    International Nuclear Information System (INIS)

    Mora, M; Vera, E; Aperador, W

    2016-01-01

    In this work is presented the synergistic behaviour among corrosion/wear (tribocorrosion) of the multilayer coatings hafnium nitride/vanadium nitride [HfN/VN]n. The multilayers were deposited on AISI 4140 steel using the technique of physical vapor deposition PVD magnetron sputtering, the tests were performed using a pin-on-disk tribometer, which has an adapted potentiostat galvanostat with three-electrode electrochemical cell. Tribocorrosive parameters such as: Friction coefficient between the coating and the counter body (100 Cr6 steel ball); Polarization resistance by means of electrochemical impedance spectroscopy technique and corrosion rate by polarization curves were determined. It was observed an increase in the polarization resistance, a decrease in the corrosion rate and a low coefficient of friction in comparison with the substrate, due to an increase on the number of bilayers. (paper)

  18. The interfacial orientation relationship of oxide nanoparticles in a hafnium-containing oxide dispersion-strengthened austenitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Yinbin, E-mail: miao2@illinois.edu [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Mo, Kun [Nuclear Engineering Division, Argonne National Laboratory, Lemont, IL 60493 (United States); Cui, Bai [Department of Mechanical and Materials Engineering, University of Nebraska-Lincoln, Lincoln, NE 68588 (United States); Department of Material Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Chen, Wei-Ying [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Miller, Michael K.; Powers, Kathy A. [Center for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, TN 37830 (United States); McCreary, Virginia; Gross, David [Department of Material Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Almer, Jonathan [X-ray Science Division, Argonne National Laboratory, Lemont, IL 60493 (United States); Robertson, Ian M. [Department of Material Science and Engineering, University of Wisconsin-Madison, Madison, WA 53706 (United States); Department of Material Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Stubbins, James F. [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States)

    2015-03-15

    This work reports comprehensive investigations on the orientation relationship of the oxide nanoparticles in a hafnium-containing austenitic oxide dispersion-strengthened 316 stainless steel. The phases of the oxide nanoparticles were determined by a combination of scanning transmission electron microscopy–electron dispersive X-ray spectroscopy, atom probe tomography and synchrotron X-ray diffraction to be complex Y–Ti–Hf–O compounds with similar crystal structures, including bixbyite Y{sub 2}O{sub 3}, fluorite Y{sub 2}O{sub 3}–HfO{sub 2} solid solution and pyrochlore (or fluorite) Y{sub 2}(Ti,Hf){sub 2−x}O{sub 7−x}. High resolution transmission electron microscopy was used to characterize the particle–matrix interfaces. Two different coherency relationships along with one axis-parallel relation between the oxide nanoparticles and the steel matrix were found. The size of the nanoparticles significantly influences the orientation relationship. The results provide insight into the relationship of these nanoparticles with the matrix, which has implications for interpreting material properties as well as responses to radiation. - Highlights: • The oxide nanoparticles in a hafnium-containing austenitic ODS were characterized. • The nanoparticles are Y–Hf–Ti–O enriched phases according to APT and STEM–EDS. • Two coherency and an axis-parallel orientation relationships were found by HR-TEM. • Particle size has a prominent effect on the orientation relationship (OR). • Formation mechanism of the oxide nanoparticles was discussed based on the ORs.

  19. 49 CFR 173.189 - Batteries containing sodium or cells containing sodium.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries containing sodium or cells containing sodium. 173.189 Section 173.189 Transportation Other Regulations Relating to Transportation PIPELINE AND... Than Class 1 and Class 7 § 173.189 Batteries containing sodium or cells containing sodium. (a...

  20. 36 CFR 1192.173 - Automated guideway transit vehicles and systems.

    Science.gov (United States)

    2010-07-01

    .... Vertical alignment may be accomplished by vehicle air suspension or other suitable means of meeting the... vehicles and systems. 1192.173 Section 1192.173 Parks, Forests, and Public Property ARCHITECTURAL AND... TRANSPORTATION VEHICLES Other Vehicles and Systems § 1192.173 Automated guideway transit vehicles and systems. (a...

  1. 49 CFR 173.182 - Barium azide-50 percent or more water wet.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Barium azide-50 percent or more water wet. 173.182 Section 173.182 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... Class 1 and Class 7 § 173.182 Barium azide—50 percent or more water wet. Barium azide—50 percent or more...

  2. 19 CFR 191.173 - Imported duty-paid derivatives (no manufacture).

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Imported duty-paid derivatives (no manufacture). 191.173 Section 191.173 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... § 191.173 Imported duty-paid derivatives (no manufacture). When the basis for drawback under 19 U.S.C...

  3. Implantation of titanium, chromium, yttrium, molybdenum, silver, hafnium, tantalum, tungsten and platinum ions generated by a metal vapor vacuum ion source into 440C stainless steel

    International Nuclear Information System (INIS)

    Sasaki, Jun; Hayashi, Kazunori; Sugiyama, Kenji; Ichiko, Osami; Hashiguchi, Yoshihiro

    1992-01-01

    Titanium, yttrium, molybdenum, silver, chromium, hafnium, tantalum, tungsten and platinum ions generated by a metal vapor vacuum arc (MEVVA) ion source were implanted into 440C stainless steel in the dose region 10 17 ions cm -2 with extraction voltages of up to 70 kV. Glow discharge spectroscopy (GDS), friction coefficient, and Vickers microhardness of the specimens were studied. Grooves made by friction tests were investigated by electron probe microanalysis (EPMA). GDS showed incorporation of carbon in the yttrium, hafnium, tantalum, tungsten and platinum implanted specimens, as well as titanium implanted samples. A large amount of oxygen was observed in the yttrium implanted specimen. The friction coefficient was measured by reciprocating sliding of an unimplanted 440C ball without lubricant at a load of 0.245 N. The friction decreased and achieved a stable state after implantation of titanium, hafnium and tantalum. The friction coefficient of the platinum implanted specimen showed a gradual decrease after several cycles of sliding at high friction coefficient. The yttrium implanted sample exhibited a decreased but slightly unstable friction coefficient. Results from EPMA showed that the implanted elements, which gave decreased friction, remained even after sliding of 200 cycles. Implantation of chromium, molybdenum, silver and tungsten did not provide a decrease in friction and the implants were gone from the wear grooves after the sliding tests. (orig.)

  4. Mechanistic Studies of Hafnium-Pyridyl Amido-Catalyzed 1-Octene Polymerization and Chain Transfer Using Quench-Labeling Methods.

    Science.gov (United States)

    Cueny, Eric S; Johnson, Heather C; Anding, Bernie J; Landis, Clark R

    2017-08-30

    Chromophore quench-labeling applied to 1-octene polymerization as catalyzed by hafnium-pyridyl amido precursors enables quantification of the amount of active catalyst and observation of the molecular weight distribution (MWD) of Hf-bound polymers via UV-GPC analysis. Comparison of the UV-detected MWD with the MWD of the "bulk" (all polymers, from RI-GPC analysis) provides important mechanistic information. The time evolution of the dual-detection GPC data, concentration of active catalyst, and monomer consumption suggests optimal activation conditions for the Hf pre-catalyst in the presence of the activator [Ph 3 C][B(C 6 F 5 ) 4 ]. The chromophore quench-labeling agents do not react with the chain-transfer agent ZnEt 2 under the reaction conditions. Thus, Hf-bound polymeryls are selectively labeled in the presence of zinc-polymeryls. Quench-labeling studies in the presence of ZnEt 2 reveal that ZnEt 2 does not influence the rate of propagation at the Hf center, and chain transfer of Hf-bound polymers to ZnEt 2 is fast and quasi-irreversible. The quench-label techniques represent a means to study commercial polymerization catalysts that operate with high efficiency at low catalyst concentrations without the need for specialized equipment.

  5. An Auger electron spectroscopy study on the anodization process of high-quality thin-film capacitors made of hafnium

    International Nuclear Information System (INIS)

    Noya, Atsushi; Sasaki, Katsutaka; Umezawa, Toshiji

    1989-01-01

    Formation process of the anodic oxide film of hafnium for use as a thin-film capacitor has been examined by the current-voltage characteristics of the anodization and the in-depth analysis of formed oxide using Auger electron spectroscopy. It is found that the oxide growth obeys three different rate laws such as the linear rate law at first and next the parabolic rate law during the constant current anodization, and then the reciprocal logarithmic rate law during the constant voltage anodization following after the constant current process. From the Auger electron spectroscopy analysis, it is found that the shape of the compositional depth profile of the grown oxide film varies associating with the rate law of oxidation obeyed. The variation of depth profile correlating with the rate law is discussed with respect to each elementary process such as the transport and/or the reaction of chemical species interpreted from the over-all behavior of anodization process. It is revealed that the stoichiometric film having an interface with sharp transition, which is favorable for obtaining excellent electrical properties of the capacitor, can be obtained under the condition that the phase-boundary reaction is the rate-determining step of the anodization. The constant voltage anodization process also satisfies such circumstances and therefore can be favorable method for preparing highquality thin-film capacitors. (author)

  6. Evaluation and Enhancement of the Oxygen Reduction Reaction Activity on Hafnium Oxide Nanoparticles Assisted by L(+)-lysine

    International Nuclear Information System (INIS)

    Chisaka, Mitsuharu; Itagaki, Noriaki

    2016-01-01

    Evaluation of the oxygen reduction reaction (ORR) on oxide compounds is difficult owing to the insulating nature of oxides. In this study, various amounts of L(+)-lysine were added to the precursor dispersion for the hydrothermal synthesis of hafnium oxide nanoparticles on reduced graphene oxide sheets (HfO_x–rGO) to coat the HfO_x catalysts with layers of carbon, thereby increasing the conductivity and number of active sites. When the mass ratio of L(+)-lysine to GO, R, was above 26, carbon layers were formed and the amount monotonically increased with increasing R, as noted by cyclic voltammogrametry. X-ray photoelectron spectroscopy and rotating disk electrode analyses revealed that pyrolysis produced ORR-active oxygen defects, whose formation was proposed to involve carbothermal reduction. When 53 ≤ R ≤ 210, HfO_x–rGO contained a similar amount of oxygen defects and ORR activity, as represented by an onset potential of 0.9 V versus the reversible hydrogen electrode in 0.1 mol dm"−"3 H_2SO_4. However, the number of active sites depended on R due to the amount of L(+)-lysine-derived carbon layers that increased both the number of active sites and resistivity towards oxygen diffusion.

  7. IER-297 CED-2: Final Design for Thermal/Epithermal eXperiments with Jemima Plates with Polyethylene and Hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, A. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Percher, C. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Zywiec, W. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Heinrichs, D. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-11

    This report presents the final design (CED-2) for IER-297, and focuses on 15 critical configurations using highly enriched uranium (HEU) Jemima plates moderated by polyethylene with and without hafnium diluent. The goal of the U.S. Nuclear Criticality Safety Program’s Thermal/Epithermal eXperiments (TEX) is to design and conduct new critical experiments to address high priority nuclear data needs from the nuclear criticality safety and nuclear data communities, with special emphasis on intermediate energy (0.625 eV – 100 keV) assemblies that can be easily modified to include various high priority diluent materials. The TEX (IER 184) CED-1 Report [1], completed in 2012, demonstrated the feasibility of meeting the TEX goals with two existing NCSP fissile assets, plutonium Zero Power Physics Reactor (ZPPR) plates and highly enriched uranium (HEU) Jemima plates. The first set of TEX experiments will focus on using the plutonium ZPPR plates with polyethylene moderator and tantalum diluents.

  8. Trap state passivation improved hot-carrier instability by zirconium-doping in hafnium oxide in a nanoscale n-metal-oxide semiconductor-field effect transistors with high-k/metal gate

    International Nuclear Information System (INIS)

    Liu, Hsi-Wen; Tsai, Jyun-Yu; Liu, Kuan-Ju; Lu, Ying-Hsin; Chang, Ting-Chang; Chen, Ching-En; Tseng, Tseung-Yuen; Lin, Chien-Yu; Cheng, Osbert; Huang, Cheng-Tung; Ye, Yi-Han

    2016-01-01

    This work investigates the effect on hot carrier degradation (HCD) of doping zirconium into the hafnium oxide high-k layer in the nanoscale high-k/metal gate n-channel metal-oxide-semiconductor field-effect-transistors. Previous n-metal-oxide semiconductor-field effect transistor studies demonstrated that zirconium-doped hafnium oxide reduces charge trapping and improves positive bias temperature instability. In this work, a clear reduction in HCD is observed with zirconium-doped hafnium oxide because channel hot electron (CHE) trapping in pre-existing high-k bulk defects is the main degradation mechanism. However, this reduced HCD became ineffective at ultra-low temperature, since CHE traps in the deeper bulk defects at ultra-low temperature, while zirconium-doping only passivates shallow bulk defects.

  9. Lithium perbromate monohydrate at 296 and 173 K

    International Nuclear Information System (INIS)

    Blackburn, A.C.; Gerkin, R.E.

    1995-01-01

    Lithium tetraoxobromate(1-) monohydrate, LiBrO 4 .H 2 O, whose perchlorate analog has not yet been described, is found to be isomorphic with NaBrO 4 .H 2 O and NaClO 4 .H 2 O. Each of the two inequivalent Li ions is coordinated by six O atoms, thus forming distorted octahedra, each of which has three inequivalent Li-O distances. At room temperature, the average Li(1)-O and Li(2)-O distances are 2.150 and 2.164 A, respectively. The perbromate ion displays very nearly regular tetrahedral geometry, although it is not subject to symmetry constraints. At 296 K the average observed Br-O distance is 1.610 (4) A and the average O-Br-O angle is 109.5 (6) , while at 173 K the corresponding values are 1.613 (4) A and 109.5 (7) . The perbromate ion shows rigid-body behavior but the lithium coordination polyhedra do not. At 296 K, the average rigid-body corrected Br-O distance in the perbromate ion is 1.624 (3) A, in excellent agreement with the corresponding value reported for NaBrO 4 .H 2 O. Refinement of the two inequivalent H atoms allowed detailed analysis of the hydrogen bonding, which is more extensive than in NaBrO 4 .H 2 O or in NaClO 4 .H 2 O. The average observed B values for the H atoms [2.9 (3) A 2 at 296 K and 2.8 (3) A 2 at 173 K] are sufficiently small to suggest that dynamic disordering of the H atoms (determined by magnetic resonance methods for NaClO 4 .H 2 O) is not significant in the title salt. (orig.)

  10. George de Hevesy (1885-1966). Discoverer of hafnium, founder of radioanalytical chemistry and X-ray fluorescence analysis and father of nuclear medicine

    International Nuclear Information System (INIS)

    Niese, Siegfried

    2017-01-01

    George de Hevesy known as discoverer of hafnium, founder of radioanalytical chemistry and X-ray fluorescence analysis and father of nuclear medicine has done important research work in inorganic, physical and radioanalytical and physiological chemistry as well as in geochemistry, radiation biology and medicine. When he must flee for political reasons from a country he must change his colleagues, his equipments, and the topic of his work. It is extremely surprising that he could receive important results under such circumstances even at an advanced age. (author)

  11. A spanish mineral of zirconium and hafnium. Separation of the two elements by liquid-liquid extraction, using tributyl phosphate as chelating agent

    International Nuclear Information System (INIS)

    Ruiz Sanchez, F.; Cruz Castillo, F. de la; Fernandez Cellini, R.

    1962-01-01

    The zirconium and Hafnium oxides are obtained from a Spanish mineral of zircon with an average contest of 55% in ZrO 2 -HfO 2 . An alkaline fusion to open the mineral, followed by a purification by crystallization as (Zr O-Hf O)Cl 2 H 2 O or as (Zr-Hf) (SO 4 ) 2 . 4H 2 O, is used. A discussion of the best experimental conditions for opening the mineral and of the purification method is made. (Author) 45 refs

  12. 49 CFR 173.474 - Quality control for construction of packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Quality control for construction of packaging. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.474 Quality control for construction of packaging. Prior to the first use of any packaging for the shipment of Class 7...

  13. 49 CFR 173.466 - Additional tests for Type A packagings designed for liquids and gases.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Additional tests for Type A packagings designed...) Materials § 173.466 Additional tests for Type A packagings designed for liquids and gases. (a) In addition to the tests prescribed in § 173.465, Type A packagings designed for liquids and gases must be...

  14. 49 CFR 173.161 - Chemical kits and first aid kits.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

  15. 30 CFR 206.173 - How do I calculate the alternative methodology for dual accounting?

    Science.gov (United States)

    2010-07-01

    ... measured at facility measurement points whose quality exceeds 1,000 Btu/cf are subject to dual accounting... for dual accounting? 206.173 Section 206.173 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... the alternative methodology for dual accounting? (a) Electing a dual accounting method. (1) If you are...

  16. 49 CFR 173.172 - Aircraft hydraulic power unit fuel tank.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Aircraft hydraulic power unit fuel tank. 173.172... Class 1 and Class 7 § 173.172 Aircraft hydraulic power unit fuel tank. Aircraft hydraulic power unit fuel tanks containing a mixture of anhydrous hydrazine and monomethyl hydrazine (M86 fuel) and designed...

  17. 49 CFR 173.159a - Exceptions for non-spillable batteries.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Exceptions for non-spillable batteries. 173.159a... Class 1 and Class 7 § 173.159a Exceptions for non-spillable batteries. (a) Exceptions for hazardous...-spillable batteries offered for transportation or transported in accordance with this section are subject to...

  18. 21 CFR 173.140 - Esterase-lipase derived from Mucor miehei.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Esterase-lipase derived from Mucor miehei. 173.140... HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.140 Esterase-lipase derived from Mucor miehei. Esterase-lipase enzyme, consisting of enzyme derived from Mucor miehei var. Cooney et Emerson by...

  19. 19 CFR 173.5 - Review of entry covering household or personal effects.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Review of entry covering household or personal effects. 173.5 Section 173.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... authority to grant. Where the port director has no authority to grant the waiver, the application shall be...

  20. 21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer.

    Science.gov (United States)

    2010-04-01

    ... vinaceae var. raffinoseutilizer. 173.145 Section 173.145 Food and Drugs FOOD AND DRUG ADMINISTRATION... Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. The food additive alpha-galactosidase and parent mycelial microorganism Mortierella vinaceae var. raffinoseutilizer may be safely used...

  1. 33 CFR 173.85 - Fees levied by the Coast Guard.

    Science.gov (United States)

    2010-07-01

    .... 173.85 Section 173.85 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Issue of Certificate of.... (b) Fees are payable by check or money-order made payable to the “U.S. Coast Guard”; by major credit...

  2. 21 CFR 173.280 - Solvent extraction process for citric acid.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Solvent extraction process for citric acid. 173.280... HUMAN CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.280 Solvent extraction process for citric acid. A solvent extraction process for recovery of citric acid from...

  3. 21 CFR 173.70 - Chloromethylated aminated styrene-divinylbenzene resin.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Chloromethylated aminated styrene-divinylbenzene resin. 173.70 Section 173.70 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Polymer...

  4. 49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium.

    Science.gov (United States)

    2010-10-01

    ... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...

  5. Multi-quasi-particle states in 173Hf

    International Nuclear Information System (INIS)

    Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.

    1991-01-01

    Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd( 18 O, 5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 13/2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3qp states are the previously known K π =19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π =(13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5qp state with K π =(29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. (orig.)

  6. Multi-quasi-particles states in 173Hf

    International Nuclear Information System (INIS)

    Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.

    1990-10-01

    Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd ( 18 O,5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 1 3 /2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3 qp states are the previously known K π 19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π = (13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5 qp state with K π = (29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. 28 refs., 2 tabs., 9 figs

  7. A fast response hafnium selective polymeric membrane electrode based on N,N'-bis(α-methyl-salicylidene)-dipropylenetriamine as a neutral carrier

    International Nuclear Information System (INIS)

    Rezaei, B.; Meghdadi, S.; Zarandi, R. Fazel

    2008-01-01

    In this study a new hafnium selective sensor was fabricated from polyvinylchloride (PVC) matrix membrane containing neutral carrier N,N'-bis(α-methyl-salicylidene)-dipropylenetriamine (Mesaldpt) as a new ionophore, sodium tetraphenyl borate (NaTPB) as anionic discriminator and dioctyl phthalate (DOP) as plasticizing solvent mediator in tetrahydrofuran solvent. The electrode exhibits Nernstian response for Hf 4+ (Hafnium(IV)) over a wide concentration range (2.0 x 10 -7 to 1.0 x 10 -1 M) with the determination coefficient of 0.9966 and slope of 15.1 ± 0.1 mV decades -1 . The limit of detection is 1.9 x 10 -7 M. The electrode has a fast response time of 18 s and a working pH range of 4-8. The proposed membrane shows excellent discriminating ability towards Hf 4+ ion with regard to several alkali, alkaline earth transition and heavy metal ions. It can be used over a period of 1.5 months with good reproducibility. It is successfully applied for direct determination of Hf 4+ in solutions by standard addition method for real sample analysis

  8. A fast response hafnium selective polymeric membrane electrode based on N,N'-bis({alpha}-methyl-salicylidene)-dipropylenetriamine as a neutral carrier

    Energy Technology Data Exchange (ETDEWEB)

    Rezaei, B. [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)], E-mail: rezaei@cc.iut.ac.ir; Meghdadi, S.; Zarandi, R. Fazel [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)

    2008-08-30

    In this study a new hafnium selective sensor was fabricated from polyvinylchloride (PVC) matrix membrane containing neutral carrier N,N'-bis({alpha}-methyl-salicylidene)-dipropylenetriamine (Mesaldpt) as a new ionophore, sodium tetraphenyl borate (NaTPB) as anionic discriminator and dioctyl phthalate (DOP) as plasticizing solvent mediator in tetrahydrofuran solvent. The electrode exhibits Nernstian response for Hf{sup 4+} (Hafnium(IV)) over a wide concentration range (2.0 x 10{sup -7} to 1.0 x 10{sup -1} M) with the determination coefficient of 0.9966 and slope of 15.1 {+-} 0.1 mV decades{sup -1}. The limit of detection is 1.9 x 10{sup -7} M. The electrode has a fast response time of 18 s and a working pH range of 4-8. The proposed membrane shows excellent discriminating ability towards Hf{sup 4+} ion with regard to several alkali, alkaline earth transition and heavy metal ions. It can be used over a period of 1.5 months with good reproducibility. It is successfully applied for direct determination of Hf{sup 4+} in solutions by standard addition method for real sample analysis.

  9. 49 CFR 17.3 - What programs and activities of the Department are subject to these regulations?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What programs and activities of the Department are subject to these regulations? 17.3 Section 17.3 Transportation Office of the Secretary of Transportation INTERGOVERNMENTAL REVIEW OF DEPARTMENT OF TRANSPORTATION PROGRAMS AND ACTIVITIES § 17.3 What programs and activities...

  10. 49 CFR 173.418 - Authorized packages-pyrophoric Class 7 (radioactive) materials.

    Science.gov (United States)

    2010-10-01

    ... must not be fissile unless excepted by § 173.453; (b) Contained in sealed and corrosion resistant receptacles with positive closures (friction or slip-fit covers or stoppers are not authorized); (c) Free of...

  11. Metallorganic chemical vapor deposition and atomic layer deposition approaches for the growth of hafnium-based thin films from dialkylamide precursors for advanced CMOS gate stack applications

    Science.gov (United States)

    Consiglio, Steven P.

    To continue the rapid progress of the semiconductor industry as described by Moore's Law, the feasibility of new material systems for front end of the line (FEOL) process technologies needs to be investigated, since the currently employed polysilicon/SiO2-based transistor system is reaching its fundamental scaling limits. Revolutionary breakthroughs in complementary-metal-oxide-semiconductor (CMOS) technology were recently announced by Intel Corporation and International Business Machines Corporation (IBM), with both organizations revealing significant progress in the implementation of hafnium-based high-k dielectrics along with metal gates. This announcement was heralded by Gordon Moore as "...the biggest change in transistor technology since the introduction of polysilicon gate MOS transistors in the late 1960s." Accordingly, the study described herein focuses on the growth of Hf-based dielectrics and Hf-based metal gates using chemical vapor-based deposition methods, specifically metallorganic chemical vapor deposition (MOCVD) and atomic layer deposition (ALD). A family of Hf source complexes that has received much attention recently due to their desirable properties for implementation in wafer scale manufacturing is the Hf dialkylamide precursors. These precursors are room temperature liquids and possess sufficient volatility and desirable decomposition characteristics for both MOCVD and ALD processing. Another benefit of using these sources is the existence of chemically compatible Si dialkylamide sources as co-precursors for use in Hf silicate growth. The first part of this study investigates properties of MOCVD-deposited HfO2 and HfSixOy using dimethylamido Hf and Si precursor sources using a customized MOCVD reactor. The second part of this study involves a study of wet and dry surface pre-treatments for ALD growth of HfO2 using tetrakis(ethylmethylamido)hafnium in a wafer scale manufacturing environment. The third part of this study is an investigation of

  12. PRODUCTION OF HAFNIUM METAL

    Science.gov (United States)

    Elger, G.W.; Boubel, R.W.

    1963-01-01

    This patent deals with a process of producing pure Hf metal from oxygen- contaminated gaseous Hf chloride. The oxygen compounds in the chioride gas are halogenated by contacting the gas at elevated temperature with Cl/sub 2/ in the presence of C. The Hf chloride, still in gaseous form, is contacted with molten Mg whereby Hf metal is formed and condensed on the Mg. (AEC)

  13. Effects of oxygen partial pressure and annealing temperature on the residual stress of hafnium oxide thin-films on silicon using synchrotron-based grazing incidence X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Debaleen [Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Sinha, Anil Kumar [ISU, Raja Ramanna Centre for Advanced Technology, Indore 452 013 (India); Homi Bhabha National Institute, BARC, Mumbai 400 094 (India); Chakraborty, Supratic, E-mail: supratic.chakraborty@saha.ac.in [Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India)

    2016-10-30

    Highlights: • Residual stress estimation thin hafnium oxide film with thickness of <10 nm. • A mathematical expression is proposed for stress estimation of thin-film using GIXRD. • Residual stress varies with argon content in Ar/O{sub 2} plasma and annealing temperature. • Variation of stress is explained by IL swelling and enhanced structural relaxation. - Abstract: Synchrotron radiation-based grazing incidence X-ray diffraction (GI-XRD) technique is employed here to estimate the residual stress of < 10 nm thin hafnium oxide film deposited on Si (100) substrate at different argon/oxygen ratios using reactive rf sputtering. A decrease in residual stress, tensile in nature, is observed at higher annealing temperature for the samples deposited with increasing argon ratio in the Ar/O{sub 2} plasma. The residual stress of the films deposited at higher p{sub Ar} (Ar:O{sub 2} = 4:1) is also found to be decreased with increasing annealing temperature. But the stress is more or less constant with annealing temperature for the films deposited at lower Ar/O{sub 2} (1:4) ratio. All the above phenomena can be explained on the basis of swelling of the interfacial layer and enhanced structural relaxation in the presence of excess Hf in hafnium oxide film during deposition.

  14. 49 CFR 173.428 - Empty Class 7 (radioactive) materials packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Empty Class 7 (radioactive) materials packaging... SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.428 Empty Class 7 (radioactive) materials packaging. A packaging which previously contained Class 7 (radioactive...

  15. 49 CFR 173.220 - Internal combustion engines, self-propelled vehicles, mechanical equipment containing internal...

    Science.gov (United States)

    2010-10-01

    ... and vehicles with certain electronic equipment when transported by aircraft or vessel. When an... vehicles, mechanical equipment containing internal combustion engines, and battery powered vehicles or... Than Class 1 and Class 7 § 173.220 Internal combustion engines, self-propelled vehicles, mechanical...

  16. 49 CFR 173.134 - Class 6, Division 6.2-Definitions and exceptions.

    Science.gov (United States)

    2010-10-01

    ... transportation and also capable of cutting or penetrating skin or a packaging material. Sharps includes needles... § 173.199, as appropriate. (9) Dried blood spots or specimens for fecal occult blood detection placed on... cutting or penetrating skin or packaging material, the primary container must be capable of retaining the...

  17. 46 CFR 173.020 - Intact stability standards: Counterballasted and non-counterballasted vessels.

    Science.gov (United States)

    2010-10-01

    ...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.020 Intact stability standards... vessel that is not equipped to counter-ballast while lifting must be shown by design calculations to... and crane radius. (b) Each vessel must have a righting arm curve with the following characteristics...

  18. 46 CFR 173.025 - Additional intact stability standards: Counterballasted vessels.

    Science.gov (United States)

    2010-10-01

    ...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.025 Additional intact stability standards: Counterballasted vessels. (a) Each vessel equipped to counterballast while lifting must be shown... loading and operation and at each combination of hook load and crane radius. (b) When doing the...

  19. 49 CFR 173.150 - Exceptions for Class 3 (flammable and combustible liquids).

    Science.gov (United States)

    2010-10-01

    ... HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS... § 173.156. (d) Alcoholic beverages. An alcoholic beverage (wine and distilled spirits as defined in 27...-on baggage; or (3) Is a Packing Group III alcoholic beverage in a packaging of 250 L (66 gallons) or...

  20. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  1. 49 CFR 173.195 - Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen cyanide, anhydrous, stabilized... Hazardous Materials Other Than Class 1 and Class 7 § 173.195 Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution). (a) Hydrogen cyanide, anhydrous, stabilized, must be packed in...

  2. Development of the common law in view of Sections 39(2) and 173 ...

    African Journals Online (AJOL)

    The common (or non-statutory) law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the ...

  3. 49 CFR 173.476 - Approval of special form Class 7 (radioactive) materials.

    Science.gov (United States)

    2010-10-01

    ... (radioactive) materials must maintain on file for at least one year after the latest shipment, and provide to... evidence based on calculative methods to show that the material is able to pass the tests; or other... shipping papers as “Radioactive Material, Special Form, n.o.s.” [Amdt. 173-244, 60 FR 50307, Sept. 28, 1995...

  4. Tank 241-B-108, cores 172 and 173 analytical results for the final report

    Energy Technology Data Exchange (ETDEWEB)

    Nuzum, J.L., Fluoro Daniel Hanford

    1997-03-04

    The Data Summary Table (Table 3) included in this report compiles analytical results in compliance with all applicable DQOS. Liquid subsamples that were prepared for analysis by an acid adjustment of the direct subsample are indicated by a `D` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a fusion digest are indicated by an `F` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a water digest are indicated by a I.wl. or an `I` in the A column of Table 3. Due to poor precision and accuracy in original analysis of both Lower Half Segment 2 of Core 173 and the core composite of Core 173, fusion and water digests were performed for a second time. Precision and accuracy improved with the repreparation of Core 173 Composite. Analyses with the repreparation of Lower Half Segment 2 of Core 173 did not show improvement and suggest sample heterogeneity. Results from both preparations are included in Table 3.

  5. 49 CFR 173.9 - Transport vehicles or freight containers containing lading which has been fumigated.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Transport vehicles or freight containers... MATERIALS REGULATIONS SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.9 Transport... hazardous material. (b) No person may offer for transportation or transport a rail car, freight container...

  6. 49 CFR 173.164 - Mercury (metallic and articles containing mercury).

    Science.gov (United States)

    2010-10-01

    ... ounces) of mercury per package; (iv) Tubes which are completely jacketed in sealed leakproof metal cases... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For...

  7. 49 CFR 173.33 - Hazardous materials in cargo tank motor vehicles.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hazardous materials in cargo tank motor vehicles... Transportation § 173.33 Hazardous materials in cargo tank motor vehicles. (a) General requirements. (1) No person may offer or accept a hazardous material for transportation in a cargo tank motor vehicle except as...

  8. Are there non-statistical effects in /sup 173/Yb(n,gamma)/sup 174/Yb?

    International Nuclear Information System (INIS)

    Pospisil, S.; Becvar, F.; Chrien, R.E.; Kopecky, J.

    1987-01-01

    The resonance-averaged capture of neutrons in 173 Yb has been studied at energy of 2 keV. With a statistical significance of 99.5% an enhancement of E1-transition to the neutron 2QP levels in 174 Yb is observed. 8 refs

  9. Classroom Materials for Teaching "The Particle Nature of Matter." Practical Paper No. 173.

    Science.gov (United States)

    Pella, Milton O.; And Others

    This document presents the lesson plans and tests used in the research study reported in Technical Report 173 (ED 070 658), together with descriptions of models and films developed for the teaching program. Thirty-one lessons are included, covering the topics of matter and energy; making interferences; particles; a model for matter; particles and…

  10. Contribution towards ALD and MOCVD of rare earth oxides and hafnium oxide. From precursor evaluation to process development and thin film characterization

    International Nuclear Information System (INIS)

    Xu, Ke

    2013-01-01

    elements for ALD applications. A possible synthesis route is the salt metatheses route. It could be expected that the monodentate guanidine ligand would provide increased reactivity towards water, where the bulky guanidine ligands will shield the RE center providing self-limiting growth behavior. In Chapter 4 and 7, ALD of rare earth oxides and hafnium oxide using corresponding guanidinate precursors are in detail investigated. According to the measurements, these processes are true ALD processes with broad ALD windows, high growth per cycle in the saturated area. Furthermore, the rare earth guanidinate and hafnium guanidinate precursors exhibit matching ALD window in the temperature range of 200 - 225 C. This motivated us to deposite trinary oxide thin films (HfREOx) using corresponding precursor combinations.

  11. 25 CFR 1000.173 - How does a newly selected Tribe/Consortium initiate the negotiation phase?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false How does a newly selected Tribe/Consortium initiate the negotiation phase? 1000.173 Section 1000.173 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN SELF-DETERMINATION AND EDUCATIO...

  12. 21 CFR 173.320 - Chemicals for controlling microorganisms in cane-sugar and beet-sugar mills.

    Science.gov (United States)

    2010-04-01

    ...-sugar and beet-sugar mills. 173.320 Section 173.320 Food and Drugs FOOD AND DRUG ADMINISTRATION... controlling microorganisms in cane-sugar and beet-sugar mills. Agents for controlling microorganisms in cane-sugar and beet-sugar mills may be safely used in accordance with the following conditions: (a) They are...

  13. 21 CFR 173.315 - Chemicals used in washing or to assist in the peeling of fruits and vegetables.

    Science.gov (United States)

    2010-04-01

    ... peeling of fruits and vegetables. 173.315 Section 173.315 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in washing or to assist in the peeling of fruits and vegetables. Chemicals may be safely used to wash or to assist in the peeling of fruits and vegetables in accordance with the following conditions...

  14. Tumor vessel normalization by the PI3K inhibitor HS-173 enhances drug delivery.

    Science.gov (United States)

    Kim, Soo Jung; Jung, Kyung Hee; Son, Mi Kwon; Park, Jung Hee; Yan, Hong Hua; Fang, Zhenghuan; Kang, Yeo Wool; Han, Boreum; Lim, Joo Han; Hong, Soon-Sun

    2017-09-10

    Tumor vessels are leaky and immature, which causes poor oxygen and nutrient supply to tumor vessels and results in cancer cell metastasis to distant organs. This instability of tumor blood vessels also makes it difficult for anticancer drugs to penetrate and reach tumors. Numerous tumor vessel normalization approaches have been investigated for improving drug delivery into tumors. In this study, we investigated whether phosphoinositide 3-kinase (PI3K) inhibitors are able to improve vascular structure and function over the prolonged period necessary to achieve effective vessel normalization. The PI3K inhibitors, HS-173 and BEZ235 potently suppressed tumor growth and hypoxia, and increased tumor apoptosis in animal models. PI3K inhibitors also induced a regular, flat monolayer of endothelial cells (ECs) in vessels, improving stability of vessel structure, and normalized tumor vessels by increasing vascular maturity, pericyte coverage, basement membrane thickness, and tight-junctions. These effects resulted in a decrease in tumor vessel tortuosity and vessel thinning, and improved vessel function and blood flow. The tumor vessel stabilization effect of the PI3K inhibitor HS-173 also decreased the number of metastatic lung nodules in vivo metastasis model. Furthermore, HS-173 improved the delivery of doxorubicin into the tumor region, enhancing its anticancer effects. Mechanistic studies suggested that PI3K inhibitor HS-173-induced vessel normalization reflected changes in endothelial Notch signaling. Taken together, our findings indicate that vessel normalization by PI3K inhibitors restrained tumor growth and metastasis while improving chemotherapy by enhancing drug delivery into the tumor, suggesting that HS-173 may have a therapeutic value as an enhancer or an anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Effect of Advanced Plasma Source bias voltage on properties of HfO2 films prepared by plasma ion assisted electron evaporation from metal hafnium

    International Nuclear Information System (INIS)

    Zhu, Meiping; Yi, Kui; Arhilger, Detlef; Qi, Hongji; Shao, Jianda

    2013-01-01

    HfO 2 films, using metal hafnium as starting material, are deposited by plasma-ion assisted electron evaporation with different Advanced Plasma Source (APS) bias voltages. The refractive index and extinction coefficient are calculated, the chemical state and composition, as well as the stress and aging behavior is investigated. Laser induced damage threshold (LIDT) and damage mechanism are also evaluated and discussed. Optical, structural, mechanical and laser induced damage properties of HfO 2 films are found to be sensitive to APS bias voltage. The film stress can be tuned by varying the APS bias voltage. Damage morphologies indicate the LIDT of the HfO 2 films at 1064 nm and 532 nm are dominated by the nodular-defect density in coatings, while the 355 nm LIDT is dominated by the film absorption. HfO 2 films with higher 1064 nm LIDT than samples evaporated from hafnia are achieved with bias voltage of 100 V. - Highlights: • HfO 2 films are evaporated with different Advanced Plasma Source (APS) bias voltages. • Properties of HfO 2 films are sensitive to APS bias voltage. • With a bias voltage of 100 V, HfO 2 coatings without any stress can be achieved. • Higher 1064 nm laser induced damage threshold is achieved at a bias voltage of 100 V

  16. Design of an Extractive Distillation Column for the Environmentally Benign Separation of Zirconium and Hafnium Tetrachloride for Nuclear Power Reactor Applications

    Directory of Open Access Journals (Sweden)

    Le Quang Minh

    2015-09-01

    Full Text Available Nuclear power with strengthened safety regulations continues to be used as an important resource in the world for managing atmospheric greenhouse gases and associated climate change. This study examined the environmentally benign separation of zirconium tetrachloride (ZrCl4 and hafnium tetrachloride (HfCl4 for nuclear power reactor applications through extractive distillation using a NaCl-KCl molten salt mixture. The vapor–liquid equilibrium behavior of ZrCl4 and HfCl4 over the molten salt system was correlated with Raoult’s law. The molten salt-based extractive distillation column was designed optimally using a rigorous commercial simulator for the feasible separation of ZrCl4 and HfCl4. The molten salt-based extractive distillation approach has many potential advantages for the commercial separation of ZrCl4 and HfCl4 compared to the conventional distillation because of its milder temperatures and pressure conditions, smaller number of required separation trays in the column, and lower energy requirement for separation, while still taking the advantage of environmentally benign feature by distillation. A heat-pump-assisted configuration was also explored to improve the energy efficiency of the extractive distillation process. The proposed enhanced configuration reduced the energy requirement drastically. Extractive distillation can be a promising option competing with the existing extraction-based separation process for zirconium purification for nuclear power reactor applications.

  17. A silicon doped hafnium oxide ferroelectric p–n–p–n SOI tunneling field–effect transistor with steep subthreshold slope and high switching state current ratio

    Directory of Open Access Journals (Sweden)

    Saeid Marjani

    2016-09-01

    Full Text Available In this paper, a silicon–on–insulator (SOI p–n–p–n tunneling field–effect transistor (TFET with a silicon doped hafnium oxide (Si:HfO2 ferroelectric gate stack is proposed and investigated via 2D device simulation with a calibrated nonlocal band–to–band tunneling model. Utilization of Si:HfO2 instead of conventional perovskite ferroelectrics such as lead zirconium titanate (PbZrTiO3 and strontium bismuth tantalate (SrBi2Ta2O9 provides compatibility to the CMOS process as well as improved device scalability. By using Si:HfO2 ferroelectric gate stack, the applied gate voltage is effectively amplified that causes increased electric field at the tunneling junction and reduced tunneling barrier width. Compared with the conventional p–n–p–n SOI TFET, the on–state current and switching state current ratio are appreciably increased; and the average subthreshold slope (SS is effectively reduced. The simulation results of Si:HfO2 ferroelectric p–n–p–n SOI TFET show significant improvement in transconductance (∼9.8X enhancement at high overdrive voltage and average subthreshold slope (∼35% enhancement over nine decades of drain current at room temperature, indicating that this device is a promising candidate to strengthen the performance of p–n–p–n and conventional TFET for a switching performance.

  18. L2₁ and XA Ordering Competition in Hafnium-Based Full-Heusler Alloys Hf₂VZ (Z = Al, Ga, In, Tl, Si, Ge, Sn, Pb).

    Science.gov (United States)

    Wang, Xiaotian; Cheng, Zhenxiang; Wang, Wenhong

    2017-10-20

    For theoretical designing of full-Heusler based spintroinc materials, people have long believed in the so-called Site Preference Rule (SPR). Very recently, according to the SPR, there are several studies on XA-type Hafnium-based Heusler alloys X₂YZ, i.e., Hf₂VAl, Hf₂CoZ (Z = Ga, In) and Hf₂CrZ (Z = Al, Ga, In). In this work, a series of Hf₂-based Heusler alloys, Hf₂VZ (Z = Al, Ga, In, Tl, Si, Ge, Sn, Pb), were selected as targets to study the site preferences of their atoms by first-principle calculations. It has been found that all of them are likely to exhibit the L2₁-type structure instead of the XA one. Furthermore, we reveal that the high values of spin-polarization of XA-type Hf₂VZ (Z = Al, Ga, In, Tl, Si, Ge, Sn, Pb) alloys have dropped dramatically when they form the L2₁-type structure. Also, we prove that the electronic, magnetic, and physics nature of these alloys are quite different, depending on the L2₁-type or XA-type structures.

  19. 173 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    Again, individuals and non-governmental organization (NGO's) suffer great restraint in .... by individuals or non-governmental organizations (NGOs) with observer status before the African. Commission on Human and ..... Innovations and Prospect of the African Court on Human and Peoples' Rights. In furtherance of effective ...

  20. Impedance Characterization of the Capacitive field-Effect pH-Sensor Based on a thin-Layer Hafnium Oxide Formed by Atomic Layer Deposition

    Directory of Open Access Journals (Sweden)

    Michael LEE

    2014-05-01

    Full Text Available As a sensing element, silicon dioxide (SiO2 has been applied within ion-sensitive field effect transistors (ISFET. However, a requirement of increasing pH-sensitivity and stability has observed an increased number of insulating materials that obtain high-k gate being applied as FETs. The increased high-k gate reduces the required metal oxide layer and, thus, the fabrication of thin hafnium oxide (HfO2 layers by atomic layer deposition (ALD has grown with interest in recent years. This metal oxide presents advantageous characteristics that can be beneficial for the advancements within miniaturization of complementary metal oxide semiconductor (CMOS technology. In this article, we describe a process for fabrication of HfO2 based on ALD by applying water (H2O as the oxygen precursor. As a first, electrochemical impedance spectroscopy (EIS measurements were performed with varying pH (2-10 to demonstrate the sensitivity of HfO2 as a potential pH sensing material. The Nyquist plot demonstrates a high clear shift of the polarization resistance (Rp between pH 6-10 (R2 = 0.9986, Y = 3,054X + 12,100. At acidic conditions (between pH 2-10, the Rp change was small due to the unmodified oxide gate (R2 = 0.9655, Y = 2,104X + 4,250. These preliminary results demonstrate the HfO2 substrate functioned within basic to neutral conditions and establishes a great potential for applying HfO2 as a dielectric material for future pH measuring FET sensors.

  1. Synergistic effect of carbon nanotube as sintering aid and toughening agent in spark plasma sintered molybdenum disilicide-hafnium carbide composite

    Energy Technology Data Exchange (ETDEWEB)

    Mukherjee, Biswajyoti; Asiq Rahman, O.S.; Sribalaji, M [Materials Science and Engineering, Indian Institute of Technology Patna, Bihta Kanpa Road, Bihta, Patna, Bihar 801103 (India); Bakshi, Srinivasa Rao [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai 600036 (India); Keshri, Anup Kumar, E-mail: anup@iitp.ac.in [Materials Science and Engineering, Indian Institute of Technology Patna, Bihta Kanpa Road, Bihta, Patna, Bihar 801103 (India)

    2016-12-15

    Hafnium carbide (HfC) along with sintering aids was consolidated at a relatively lower temperature i.e. 1600 °C (i.e. T=~0.41 T{sub m}) under a uniaxial load of 50 MPa by spark plasma sintering. Two different sintering aids such as molybdenum disilicide (MoSi{sub 2}) and carbon nanotube (CNT) were added to enhance the densification and lower the extent of grain growth in the sintered pellets. Density of the sintered pellet increased from 96.0±0.8% in HfC +5 wt% MoSi{sub 2} (HM) to 99.0±0.5% with the addition of 2 wt% CNT in HfC+5 wt% MoSi{sub 2} (HMC) at sintering temperature of 1600 °C. Further, the extent of grain growth drastically reduced from 204% in HM to 50% in HMC. Analysis of linear shrinkage during densification revealed that CNT addition increased densification rate and decreased the time required to reach the density of 99.0±0.5% at 1600 °C. Increased densification and lower degree of grain growth could be due to the synergistic effect offered by the CNT, which are as follows: (i) Lubrication effect of CNT, (ii) Lower activation energy for grain boundary diffusion (iii) Reduction in liquid phase sintering temperature and (iv) Grain boundary pinning. Fracture toughness of the sintered HM and HMC composite was obtained using indentation technique. By the addition of 2 wt% CNT in HM, drastic increase of 91% in fracture toughness was seen. This significant improvement in fracture toughness was due to the enhanced densification and relatively lower grain size of HMC. Also crack bridging, crack deflection, crack arrest, CNT and graphene sheet pull-out and swording played major role in toughening of HMC pellet.

  2. Technical Note: A simulation study on the feasibility of radiotherapy dose enhancement with calcium tungstate and hafnium oxide nano- and microparticles.

    Science.gov (United States)

    Sherck, Nicholas J; Won, You-Yeon

    2017-12-01

    To assess the radiotherapy dose enhancement (RDE) potential of calcium tungstate (CaWO 4 ) and hafnium oxide (HfO 2 ) nano- and microparticles (NPs). A Monte Carlo simulation study was conducted to gauge their respective RDE potentials relative to that of the broadly studied gold (Au) NP. The study was warranted due to the promising clinical and preclinical studies involving both CaWO 4 and HfO 2 NPs as RDE agents in the treatment of various types of cancers. The study provides a baseline RDE to which future experimental RDE trends can be compared to. All three materials were investigated in silico with the software Penetration and Energy Loss of Positrons and Electrons (PENELOPE 2014) developed by Francesc Salvat and distributed in the United States by the Radiation Safety Information Computational Center (RSICC) at Oak Ridge National Laboratory. The work utilizes the extensively studied Au NP as the "gold standard" for a baseline. The key metric used in the evaluation of the materials was the local dose enhancement factor (DEF loc ). An additional metric used, termed the relative enhancement ratio (RER), evaluates material performance at the same mass concentrations. The results of the study indicate that Au has the strongest RDE potential using the DEF loc metric. HfO 2 and CaWO 4 both underperformed relative to Au with lower DEF loc of 2-3 × and 4-100 ×, respectively. The computational investigation predicts the RDE performance ranking to be: Au > HfO 2 > CaWO 4 . © 2017 American Association of Physicists in Medicine.

  3. Thermodynamic and kinetic studies in the systems alkali chloride-zinconium (or hafnium) tetrachloride: Part I. Vapour pressure measurements over hexachloro compounds and use of vapour pressure data in fractional decomposition

    International Nuclear Information System (INIS)

    Ray, H.S.; Bhat, B.G.; Reddy, G.S.; Biswas, A.K.

    1978-01-01

    A molten tin isoteniscope has been used to measure the vapour pressures over ZrCl 4 , HfCl 4 and the hexachlore zirconates (M 2 ZrCl 6 ) and the hexachloro hafnates (M 2 HfCl 6 ) of four alkali metals (M = Na,K,Rb,Cs). The method of preparation of these compounds and the effect of small amounts of residual alkali chlorides on the their vapour pressure are discussed. The pressure-temperature plots are examined in the light of some theoretical postulates. A scheme for separation of hafnium from zirconoium by multistage fractional decomposition of the hexachlore compounds of any alkali metal is described. The scheme, which is analogous to rectification in liquid-vapour systems, employs a countercurrent flow of Zr(Hf)Cl 4 in a gas stream and a moving bed of alkali chlorides. The separation is based on the difference in the dissociation equilibrium for zirconium and hafnium compounds. Stage calculations for such a scheme and the main conclusions of a computational work are presented. (author)

  4. OBIECTUL INFRACŢIUNII PREVĂZUTE LA ART.173 CP RM

    Directory of Open Access Journals (Sweden)

    Mihaela BOTNARENCO

    2015-11-01

    Full Text Available În cadrul prezentului articol analizei este supus obiectul infracţiunii de hărţuire sexuală. Inter alia, autorul formulează definiţia conceptelor de inviolabilitate sexuală şi de libertate sexuală şi stabileşte situaţiile particulare în care aceste valori sociale şi relaţiile sociale aferente sunt proteguite prin incriminarea faptei infracţionale prevăzute la art.173 CP RM. Concomitent este studiat obiectul juridic secundar al infracţiunii de hărţuire sexuală în corelaţie cu acţiunea principală, dar şi cu acţiunea secundară din conţinutul laturii obiective a componenţei de infracţiune analizate.OBJECT OF CRIME PROVIDED BY ART.173 CRIMINAL CODE OF MOLDOVA The purpose of this article is to analyze the object of the sexual harassment. Inter alia, the author defines the notions of sexual inviolability and sexual freedom as well as identifies the specific situations when these social values and related social relationships are protected by the criminal law. Moreover, the author makes a thorough analysis of the secondary legal object of this crime in connection with main and secondary acts included in the objective side of sexual harassment.

  5. Evolution of E 2 transition strength in deformed hafnium isotopes from new measurements on 172Hf,174Hf, and 176Hf

    Science.gov (United States)

    Rudigier, M.; Nomura, K.; Dannhoff, M.; Gerst, R.-B.; Jolie, J.; Saed-Samii, N.; Stegemann, S.; Régis, J.-M.; Robledo, L. M.; Rodríguez-Guzmán, R.; Blazhev, A.; Fransen, Ch.; Warr, N.; Zell, K. O.

    2015-04-01

    Background: The available data for E 2 transition strengths in the region between neutron-deficient hafnium and platinum isotopes are far from complete. More and precise data are needed to enhance the picture of structure evolution in this region and to test state-of-the-art nuclear models. In a simple model, the maximum collectivity is expected at the middle of the major shell. However, for actual nuclei, particularly in heavy-mass regions, which should be highly complex, this picture may no longer be the case, and one should use a more realistic nuclear-structure model. We address this point by studying the spectroscopy of Hf as a representative case. Purpose: We remeasure the 21+ half-lives of 172,174,176Hf, for which there is some disagreement in the literature. The main goal is to measure, for the first time, the half-lives of higher-lying states of the rotational band. The new results are compared to a theoretical calculation for absolute transition strengths. Method: The half-lives were measured using γ -γ and conversion-electron-γ delayed coincidences with the fast timing method. For the determination of half-lives in the picosecond region, the generalized centroid difference method was applied. For the theoretical calculation of the spectroscopic properties, the interacting boson model is employed, whose Hamiltonian is determined based on microscopic energy-density functional calculations. Results: The measured 21+ half-lives disagree with results from earlier γ -γ fast timing measurements, but are in agreement with data from Coulomb excitation experiments and other methods. Half-lives of the 41+ and 61+ states were measured, as well as a lower limit for the 81+ states. Conclusions: This work shows the importance of a mass-dependent effective boson charge in the interacting boson model for the description of E 2 transition rates in chains of nuclei. It encourages further studies of the microscopic origin of this mass dependence. New experimental

  6. Three-quasiparticle isomer in 173Ta and the excitation energy dependence of K -forbidden transition rates

    OpenAIRE

    Wood, RT; Walker, PM; Lane, G J; Carroll, R. J.; Cullen, David; Dracoulis, G D; Hota, S. S.; Kibédi, T.; Palalani, N; Podolyak, Zs.; Reed, MW; Schiffl, K; Wright, A.M

    2017-01-01

    Using the 168Er(10B,5n) reaction at a beam energy of 68 MeV, new data have been obtained for the population and decay of a T1/2=148ns, Kπ=21/2− three-quasiparticle isomer at 1717 keV in 173Ta. Revised decay energies and intensities have been determined, together with newly observed members of a rotational band associated with the isomer. By comparison with other isomers in the A≈180 deformed region, the 173Ta isomer properties help to specify the key degrees of freedom that determine K-forbid...

  7. The human story of Crew 173- capturing a Mars analog mission

    Science.gov (United States)

    Shaw, Niamh; Musilova, Michaela; Pons Lorente, Arnau; Sisaid, Idriss; Naor, Roy; Blake, Richard

    2017-04-01

    An international crew of six scientists, engineers, artists and entrepreneurs with different space specialisations were selected by the Mars Society to take part in a Martian simulation in January 2017. An ambitious outreach and media strategy was developed, aimed at communicating the benefits of missions to Mars to the public and to capture the public's interest by telling the human story of the crew's mission. Entitled Crew 173 Team PRIMA, they entered the Mars Desert Research Station in the Utah Desert and conducted research in 3D printing, hydroponics, geology and astronomy. Both the scientific and community experience of this mission was documented through still image, video, audio, diary and daily journalling by the resident artist of the mission, Niamh Shaw. The full experience of the crew was documented (before, during and after the expedition), to capture each individual experience of the crew and the human experience of isolation of future human space missions.

  8. 6-Peroxo-6-zirconium crown and its hafnium analogue embedded in a triangular polyanion: [M6(O2)6(OH)6(gamma-SiW10O36)3]18- (M = Zr, Hf).

    Science.gov (United States)

    Bassil, Bassem S; Mal, Sib Sankar; Dickman, Michael H; Kortz, Ulrich; Oelrich, Holger; Walder, Lorenz

    2008-05-28

    We have synthesized and structurally characterized the unprecedented peroxo-zirconium(IV) containing [Zr6(O2)6(OH)6(gamma-SiW10O36)3]18- (1). Polyanion 1 comprises a cyclic 6-peroxo-6-zirconium core stabilized by three decatungstosilicate units. We have also prepared the isostructural hafnium(IV) analogue [Hf6(O2)6(OH)6(gamma-SiW10O36)3]18- (2). We investigated the acid/base and redox properties of 1 by UV-vis spectroscopy and electrochemistry studies. Polyanion 1 represents the first structurally characterized Zr-peroxo POM with side-on, bridging peroxo units. The simple, one-pot synthesis of 1 and 2 involving dropwise addition of aqueous hydrogen peroxide could represent a general procedure for incorporating peroxo groups into a large variety of transition metal and lanthanide containing POMs.

  9. Revisão radiológica de 173 casos consecutivos de paracoccidioidomicose Radiological review of 173 consecutive cases of paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Henrique Simão Trad

    2006-06-01

    Full Text Available OBJETIVO: Revisar e determinar a incidência dos achados radiológicos mais importantes da paracoccidioidomicose, e verificar as possíveis variantes de suas apresentações. MATERIAIS E MÉTODOS: Foram revistos 173 casos consecutivos de paracoccidioidomicose, atendidos no período de 1970 a 1980. Os estudos radiológicos direcionados a cada caso foram reanalisados por no mínimo dois radiologistas experientes. RESULTADOS: Foram encontrados 94 casos de acometimento pulmonar isolado e 38 de acometimento pulmonar associado a lesões ganglionares, viscerais, ósseas e à tuberculose. Sem envolvimento pulmonar foram encontrados 41 casos, com lesões intestinais, viscerais, ósseas ou combinadas. Os principais achados radiológicos da forma pulmonar foram opacidade intersticial reticular e nodular bilateral, seguida por consolidação, também bilateral. As formas visceral e intestinal apresentaram lesões predominantes no fígado, jejuno e íleo. Na forma ganglionar houve predominância do comprometimento difuso abdominal e periférico, e no ósseo, áreas de lise principalmente em ossos longos e clavícula. CONCLUSÃO: A paracoccidioidomicose é doença granulomatosa comum no Brasil, acometendo principalmente o pulmão, tendo como porta de entrada a inalação dos esporos do fungo. Outras formas desta doença, menos freqüentes ou raras, devem ser permanentemente lembradas no diagnóstico diferencial.OBJECTIVE: To determine the incidence of most significant radiological findings of paracoccidioidomycosis and to verify its possible variants. MATERIALS AND METHODS: One hundred and seventy-three cases of paracoccidioidomycosis presented between 1970 and 1980 were reviewed, including their radiological workup reanalysis by at least two experienced radiologists. RESULTS: Ninety-four cases were pulmonary only and 38 were pulmonary associated with ganglial, visceral and osseous lesions or in association with tuberculosis. There was no pulmonary

  10. Hafnium and neodymium isotopes and REY distribution in the truly dissolved, nanoparticulate/colloidal and suspended loads of rivers in the Amazon Basin, Brazil

    Science.gov (United States)

    Merschel, Gila; Bau, Michael; Schmidt, Katja; Münker, Carsten; Dantas, Elton L.

    2017-09-01

    Radiogenic isotopes in river sediments and river waters have been widely used in provenance studies, as these samples naturally integrate the geology/chemistry of the entire catchment. While the Hf and Nd isotope systems are coupled during igneous processes, they are decoupled during supergene processes at the Earth's surface, which is reflected by the isotope composition of riverine sediments. We present the first data for both Hf and Nd isotope compositions of the dissolved (0.2 μm-filtrates rich in nanoparticles and colloids, NPCs) and the truly dissolved (1 kDa-ultrafiltrates) load of rivers. Hafnium and Nd isotope compositions and concentrations of the Rare Earths and Yttrium (REY) and Hf were determined for suspended particles (>0.2 μm) as well as for the dissolved and the truly dissolved load of the Rio Solimões, the Amazon's largest tributary draining the Andes, and of the Rio Negro, an organic NPC- and particle-rich river draining the rainforest of northern Amazonia. We also analyzed the Nd isotope compositions of suspended sediments and 0.2 μm-filtered water samples from the Amazon River and its tributaries Rio Tapajos, Rio Xingu and Rio Jari. Our novel results clearly show that the decoupling of the Hf and Nd isotope systems is related to incongruent weathering processes on the continent, as this decoupling can already be observed in the different Hf and Nd pools, i.e. in the particulate, the NPC-dominated dissolved and the truly dissolved load of rivers. In the Rio Negro and Rio Solimões, a strong particle size-dependent difference in Hf isotope composition is observed. Values of εHf become more radiogenic as filter poresize decreases, which can be related to the density- and size-dependent distribution of Hf-rich minerals, e.g. zircons, and their absence from the truly dissolved pool. In contrast, the Nd isotope composition of Amazonian river waters reflects that of their catchment geology. Tributaries draining the Precambrian Brazilian and

  11. Study on gamma rays from the 173Ybsub (n,γ) 174Yb reaction with resonance neutrons

    International Nuclear Information System (INIS)

    Aldea, L.; Bechvarzh, F.; Gonzatko, Ya.; Pospishil, S; Telezhnikov, S.A.

    1976-01-01

    Relative intensities of primary transitions from individual 173 Yb + n resonances were measured. For 9 resonances with Jsub (π) = 2 - and for 8 transitions an experimental correlation coefficient Rsub(exp) = 0.40 between GITAsub(n lambda) 0 deg and Isub(*g lambda f) / Esub(*g) 5 deg was found to have a significance level 99.8 %

  12. HS-173, a Novel PI3K Inhibitor, Attenuates the Activation of Hepatic Stellate Cells in Liver Fibrosis

    Science.gov (United States)

    Son, Mi Kwon; Ryu, Ye-Lim; Jung, Kyung Hee; Lee, Hyunseung; Lee, Hee Seung; Yan, Hong Hua; Park, Heon Joo; Ryu, Ji-Kan; Suh, Jun–Kyu; Hong, Sungwoo; Hong, Soon-Sun

    2013-01-01

    Hepatic stellate cells (HSCs) are the primary source of matrix components in liver disease such as fibrosis. Phosphatidylinositol 3-kinase (PI3K) signaling in HSCs has been shown to induce fibrogenesis. In this study, we evaluated the anti-fibrotic activity of a novel imidazopyridine analogue (HS-173) in human HSCs as well as mouse liver fibrosis. HS-173 strongly suppressed the growth and proliferation of HSCs and induced the arrest at the G2/M phase and apoptosis in HSCs. Furthermore, it reduced the expression of extracellular matrix components such as collagen type I, which was confirmed by an in vivo study. We also observed that HS-173 blocked the PI3K/Akt signaling pathway in vitro and in vivo. Taken together, HS-173 suppressed fibrotic responses such as cell proliferation and collagen synthesis by blocking PI3K/Akt signaling. Therefore, we suggest that this compound may be an effective therapeutic agent for ameliorating liver fibrosis through the inhibition of PI3K signaling. PMID:24326778

  13. 49 CFR 173.427 - Transport requirements for low specific activity (LSA) Class 7 (radioactive) materials and...

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Transport requirements for low specific activity... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.427 Transport requirements for low specific... must be transported in accordance with the following conditions: (1) The external dose rate may not...

  14. 49 CFR Appendix B to Part 173 - Procedure for Testing Chemical Compatibility and Rate of Permeation in Plastic Packaging and...

    Science.gov (United States)

    2010-10-01

    ... Rate of Permeation in Plastic Packaging and Receptacles B Appendix B to Part 173 Transportation Other... Plastic Packaging and Receptacles 1. The purpose of this procedure is to determine the chemical compatibility and permeability of liquid hazardous materials packaged in plastic packaging and receptacles...

  15. Fermented Milk Containing Bifidobacterium lactis DN-173 010 in Childhood Constipation: A Randomized, Double-Blind, Controlled Trial

    NARCIS (Netherlands)

    Tabbers, Merit M.; Chmielewska, Ania; Roseboom, Maaike G.; Crastes, Nolwenn; Perrin, Catherine; Reitsma, Johannes B.; Norbruis, Obbe; Szajewska, Hania; Benninga, Marc A.

    2011-01-01

    BACKGROUND: Constipation is a frustrating symptom affecting 3% of children worldwide. A fermented dairy product containing Bifidobacterium lactis strain DN-173 010 was effective in increasing stool frequency in constipated women. Our aim was to assess the effects of this product in constipated

  16. Zirconium Zr and hafnium Hf

    International Nuclear Information System (INIS)

    Busev, A.I.; Tiptsova, V.G.; Ivanov, V.M.

    1978-01-01

    The basic methods for extracting and determining Zr(4) and Hf(4) are described. Diantipyrinemethane and its alkyl homologs selectively extract Zr and Hf from HNO 3 solutions in the presence of nitrates. Zr is selectively extracted with tetraethyldiamide of heptyl phosphoric acid (in benzene) as well as with 2-thenoyltrifluoroacetone (in an acid). The latter reagents is suitable for rapid determination of 95 Zr in a mixture with 95 Nb and other fragments. The complexometric determination of Zr is based on formation of a stable complex of Zr with EDTA. The titration is carried out in the presence of n-sulfobenzene-azo-pyrocatechol, eriochrome black T. The determination is hindered by Hf, fluoride-, phosphate-, oxalate- and tartrate-ions. The method is used for determining Zr in zircon and eudialyte ore. Zr is determined photometrically with the aid of xylenol orange, arsenazo 3 and pyrocatechol violet (in phosphorites). Hf is determined in the presence of Zr photometrically with the aid of xylenol orange or methyl-thymol blue. The method is based on Zr being masked with hydrogen peroxide in the presence of sulfate-ions

  17. Cathodoluminescence of Irradiated Hafnium Dioxide

    Science.gov (United States)

    2011-03-01

    Martin and Michael Rhoby for their hard work in fixing assorted problems that cropped up during the course of my thesis work. Emily A. Purcell...Cathodoluminescence Microscopy of Inorganic Solids. New York: Plenum Press, 1990. [13] D. Drouin, A. R. Couture, D. Joly , X. Tastet, V. Aimez and R. Gauvin

  18. Alkali metal hafnium oxide scintillators

    Science.gov (United States)

    Bourret-Courchesne, Edith; Derenzo, Stephen E.; Taylor, Scott Edward

    2018-05-08

    The present invention provides for a composition comprising an inorganic scintillator comprising an alkali metal hafnate, optionally cerium-doped, having the formula A2HfO3:Ce; wherein A is an alkali metal having a valence of 1, such as Li or Na; and the molar percent of cerium is 0% to 100%. The alkali metal hafnate are scintillators and produce a bright luminescence upon irradiation by a suitable radiation.

  19. 49 CFR 173.477 - Approval of packagings containing greater than 0.1 kg of non-fissile or fissile-excepted uranium...

    Science.gov (United States)

    2010-10-01

    ... kg of non-fissile or fissile-excepted uranium hexafluoride. 173.477 Section 173.477 Transportation... non-fissile or fissile-excepted uranium hexafluoride. (a) Each offeror of a package containing more than 0.1 kg of uranium hexafluoride must maintain on file for at least one year after the latest...

  20. Laparoscopic Heller-Dor for primary esophageal achalasia: outcomes in 173 patients.

    Science.gov (United States)

    Rosati, Riccardo; Fumagalli Romario, Uberto; Ceolin, Martina; Massaron, Simonetta; Peracchia, Alberto

    2013-01-01

    Laparoscopic Heller myotomy combined with anterior (Dor) fundoplication is the most widely-used surgical procedure for treating esophageal achalasia in Europe From November 1992 through May 2010 we performed laparoscopic Heller-Dor on 173 patients Conversion to laparotomy was required in three cases (1.7%) at the beginning of the experience (for mucosal) perforation which was the most frequent intraoperative complication, managed laparoscopically with the increasing experience. Five (2.9%) cases had minor postoperative complications. Clinical results were satisfactory in 99.4% of cases. One patient (0.6%) had severe persistent dysphagia. Mean esophageal diameter decreased from 50 mm ± 12 (range 20- 90) to 25 mm ± 7 (range 15-80). Lower esophageal sphincter pressure decreased from 32 mmHg (median, range 10- 93) pre-operatively to 11 mmHg (median, range 5-21) at one year follow up and residual pressure from 12 mmHg (median, range 3-30) to 4 mmHg (median, range 1-8). Impedance and pH monitoring showed normal levels in 39/47 (83%) patients who agreed to testing. The good outcomes of this experience, in part due to careful adherence to technical aspects of the operation, confirm that the laparoscopic Heller-Dor is the gold standard surgical treatment for esophageal achalasia.

  1. Study of CPO resonances on the intercombination line in 173Yb

    Science.gov (United States)

    Kumar, Pushpander; Singh, Alok K.; Bharti, Vineet; Natarajan, Vasant; Pandey, Kanhaiya

    2018-02-01

    We study coherent population oscillations in an odd isotope of the two-electron atom Yb. The experiments are done using magnetic sublevels of the {F}g=5/2\\to {F}e=3/2 hyperfine transition in 173Yb of the {}1{{{S}}}0\\to {}3{{{P}}}1 intercombination line. The experiments are done both with and without an applied magnetic field. In the absence of an applied field, the complicated sublevel structure along with the saturated fluorescence effect causes the linewidth to be larger than the 190 kHz natural linewidth of the transition. In the presence of a field (of magnitude 330 mG), a well-defined quantization axis is present which results in the formation of two M-type systems. The total fluorescence is then limited by spin coherence among the ground sublevels. In addition, the pump beam gets detuned from resonance which results in a reduced scattering rate from the {}3{{{P}}}1 state. Both of these effects result in a reduction of the linewidth to a subnatural value of about 100 kHz.

  2. A new topical hemostatic agent TT-173 reduces blood loss in a sheep model of total knee arthroplasty.

    Science.gov (United States)

    Centeno, Alberto; Rojas, Santiago; Arias, Belén; Miquel, Ignasi; Sánchez, Pilar; Ureta, Claudia; Rincón, Esther; López, Ramón; Murat, Jesús

    2017-12-01

    Total knee arthroplasty is associated with blood loss during the intervention and may require allogenic blood transfusion. Treatments such as tranexamic acid and fibrin sealants improved the bleeding control in several clinical trials, but the hemorrhage associated with the intervention is still significant. Thus far, very few studies have evaluated hemostatic treatments in animal models of total knee arthroplasty. This work describes a sheep model of bleeding associated with total knee arthroplasty and investigates a new class of hemostatic treatment based on recombinant tissue factor. Sheep were treated with the anticoagulant heparin, and the joint was accessed by a paramedial incision. Ligaments and menisci were eliminated and femoral condyles and tibia plateau were sectioned exposing the trabecular bone. An intra-articular drain was used to recover and quantify the blood loss during the 90-min period after treatment. The efficacy of one milligram and three milligrams of TT-173 was evaluated and compared with tranexamic acid. The occurrence of analytical alterations and systemic absorption was also investigated. Treatment with TT-173 reduced the blood loss in comparison with control or tranexamic acid. No significant differences were observed between the two doses evaluated. Moreover, a dose of six milligrams of TT-173 did not induce any clinical or analytical alteration, and significant systemic absorption was not observed. Data obtained strongly suggest that TT-173 could be useful in reducing the blood loss associated with total knee arthroplasty and without safety concerns derived from the systemic absorption of the product. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. 49 CFR 173.301 - General requirements for shipment of compressed gases and other hazardous materials in cylinders...

    Science.gov (United States)

    2010-10-01

    ... less; (vi) A fire extinguisher; or (vii) A “B” style cylinder with a capacity of 40 ft 3 (1.13 m3) or an “MC” style cylinder with a capacity of 10 ft 3 (0.28m3) containing acetylene. (2) For cylinders... citations affecting § 173.301, see the List of CFR Sections Affected, which appears in the Finding Aids...

  4. Cobalt(II), nickel(II), copper(II), zinc(II) and hafnium(IV) complexes of N'-(furan-3-ylmethylene)-2-(4-methoxyphenylamino)acetohydrazide.

    Science.gov (United States)

    Emam, Sanaa M; El-Saied, Fathy A; Abou El-Enein, Saeyda A; El-Shater, Heba A

    2009-03-01

    Cobalt(II), nickel(II), copper(II), zinc(II) and hafnium(IV) complexes of furan-2-carbaldehyde 4-methoxy-N-anilinoacetohydrazone were synthesized and characterized by elemental and thermal (TG and DTA) analyses, IR, UV-vis and (1)H NMR spectra as well as magnetic moment and molar conductivity. Mononuclear complexes are obtained with 1:1 molar ratio except complexes 3 and 9 which are obtained with 1:2 molar ratios. The IR spectra of ligand and metal complexes reveal various modes of chelation. The ligand behaves as a neutral bidentate one and coordination occurs via the carbonyl oxygen atom and azomethine nitrogen atom. The ligand behaves also as a monobasic tridentate one and coordination occurs through the enolic oxygen atom, azomethine nitrogen atom and the oxygen atom of furan ring. Moreover, the ligand behaves as a neutral tridentate and coordination occurs via the carbonyl oxygen, azomethine nitrogen and furan oxygen atoms as well as a monobasic bidentate and coordination occurs via the enolic oxygen atom and azomethine nitrogen atom. The electronic spectra and magnetic moment measurements reveal that all complexes possess octahedral geometry except the copper complex 10 possesses a square planar geometry. The thermal studies showed the type of water molecules involved in metal complexes as well as the thermal decomposition of some metal complexes.

  5. Determination of hafnium at the 10−4% level (relative to zirconium content) using neutron activation analysis, inductively coupled plasma mass spectrometry and inductively coupled plasma atomic emission spectrometry

    International Nuclear Information System (INIS)

    Smolik, Marek; Polkowska-Motrenko, Halina; Hubicki, Zbigniew; Jakóbik-Kolon, Agata; Danko, Bożena

    2014-01-01

    Graphical abstract: -- Highlights: •We worked out ICP-MS method of Hf determination in Zr and Zr compounds. •We used NAA method as reference one. •We obtained pure zirconium matrix by ion exchange (Diphonix ® resin). •These permit to determine ≥1 × 10 −4 % Hf in Zr sample by ICP MS with good precision and accuracy. -- Abstract: Hafnium at the very low level of 1–8 ppm (in relation to zirconium) was determined in zirconium sulfate solutions (originating from investigations of the separation of ca. 44 ppm Hf from zirconium by means of the ion exchange method) by using three independent methods: inductively coupled plasma mass spectrometry (ICP MS), neutron activation analysis (NAA) and inductively coupled plasma atomic emission spectrometry (ICP-AES). The results of NAA and ICP MS determinations were consistent with each other across the entire investigated range (the RSD of both methods did not exceed 38%). The results of ICP-AES determination were more diverse, particularly at less than 5 ppm Hf (RSD was significantly higher: 29–253%). The ion exchange method exploiting Diphonix ® resin proved sufficient efficiency in Zr–Hf separation when the initial concentration ratio of the elements ([Zr] 0 /[Hf] 0 ) ranged from 1200 to ca. 143,000

  6. The kinase domain residue serine 173 of Schizosaccharomyces pombe Chk1 kinase is critical for the response to DNA replication stress

    Directory of Open Access Journals (Sweden)

    Naomi Coulton

    2017-12-01

    Full Text Available While mammalian Chk1 kinase regulates replication origins, safeguards fork integrity and promotes fork progression, yeast Chk1 acts only in G1 and G2. We report here that the mutation of serine 173 (S173A in the kinase domain of fission yeast Chk1 abolishes the G1-M and S-M checkpoints with little impact on the G2-M arrest. This separation-of-function mutation strongly reduces the Rad3-dependent phosphorylation of Chk1 at serine 345 during logarithmic growth, but not when cells experience exogenous DNA damage. Loss of S173 lowers the restrictive temperature of a catalytic DNA polymerase epsilon mutant (cdc20.M10 and is epistatic with a mutation in DNA polymerase delta (cdc6.23 when DNA is alkylated by methyl-methanesulfate (MMS. The chk1-S173A allele is uniquely sensitive to high MMS concentrations where it displays a partial checkpoint defect. A complete checkpoint defect occurs only when DNA replication forks break in cells without the intra-S phase checkpoint kinase Cds1. Chk1-S173A is also unable to block mitosis when the G1 transcription factor Cdc10 (cdc10.V50 is impaired. We conclude that serine 173, which is equivalent to lysine 166 in the activation loop of human Chk1, is only critical in DNA polymerase mutants or when forks collapse in the absence of Cds1.

  7. A spanish mineral of zirconium and hafnium. Separation of the two elements by liquid-liquid extraction, using tributyl phosphate as chelating agent; Beneficio de un mineral espanol de circonio-hafnio. Separacion de ambos elementos por extraccion liquido-liquido, empleando fosfato de tributilo como agente de quelacion

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz Sanchez, F; Cruz Castillo, F. de la; Fernandez Cellini, R

    1962-07-01

    The zirconium and Hafnium oxides are obtained from a Spanish mineral of zircon with an average contest of 55% in ZrO{sub 2}-HfO{sub 2}. An alkaline fusion to open the mineral, followed by a purification by crystallization as (Zr O-Hf O)Cl{sub 2} H{sub 2}O or as (Zr-Hf) (SO{sub 4}){sub 2}. 4H{sub 2}O, is used. A discussion of the best experimental conditions for opening the mineral and of the purification method is made. (Author) 45 refs.

  8. Ontwikkeling van die gemenereg in die lig van artikel 39(2 en 173 van die Grondwet

    Directory of Open Access Journals (Sweden)

    LTC Harms

    2004-10-01

    Full Text Available DEVELOPMENT OF THE COMMON LAW IN VIEW OF SECTIONS 39(2 AND 173 OF THE CONSTITUTIONThe point of departure in the Constitution is that the existing legal order should largely be kept intact, despite the fact that this is disliked by some. The common (or non-statutory law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the common law with reference to especially the boni mores, moral standards and the common notion of what is right and fair. The Bill of Rights now is a source and summation of such notion.At times there had been an exaggerated call for petere fontes. The Courts however still have the competence to adapt the law to serve commercial and other needs, even without reference to the Bill of Rights. The underlying principles of the common law are largely, though not in all respects, consistent with the Bill of Rights. There is an essential distinction between the development of a rule of the common law in accordance with constitutional norms, and the invalidation of a rule which is inconsistent with the Constitution. Courts tend not to make this distinction and this leads to inconsistencies. Some believe that the common law is perfect and unaffected by the Bill of Rights. Others consider the Bill of Rights to have granted the judiciary a hunting license on the common law, making the positive law a matter of judicial discretion and allowing the courts to infringe upon the domain of the legislature and to ignore precedents. The common law consists of a myriad rules developed over many centuries involving great minds. It represents a fine web, the disturbance of which at one point may have severe unexpected consequences elsewhere. The new era makes extraordinary demands on judicial officers. The

  9. 3' fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3.

    Science.gov (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki

    2013-03-05

    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.

  10. Efficient UV-emitting X-ray phosphors: octahedral Zr(PO4)6 luminescence centers in potassium hafnium-zirconium phosphates K2Hf1-xZrx(PO4)2 and KHf2(1-x)Zr2x(PO4)3

    International Nuclear Information System (INIS)

    Torardi, C.C.; Miao, C.R.; Li, J.

    2003-01-01

    Potassium hafnium-zirconium phosphates, K 2 Hf 1-x Zr x (PO 4 ) 2 and KHf 2(1-x) Zr 2x (PO 4 ) 3 , are broad-band UV-emitting phosphors. At room temperature, they have emission peak maxima at approximately 322 and 305 nm, respectively, under 30 kV peak molybdenum X-ray excitation. Both phosphors demonstrate luminescence efficiencies that make them up to ∼60% as bright as commercially available CaWO 4 Hi-Plus. The solid-state and flux synthesis conditions, and X-ray excited UV luminescence of these two phosphors are discussed. Even though the two compounds have different atomic structures, they contain zirconium in the same active luminescence environment as that found in highly efficient UV-emitting BaHf 1-x Zr x (PO 4 ) 2 . All the three materials have hafnium and zirconium in octahedral coordination via oxygen-atom corner sharing with six separate PO 4 tetrahedra. This octahedral Zr(PO 4 ) 6 moiety appears to be an important structural element for efficient X-ray excited luminescence, as are the edge-sharing octahedral TaO 6 chains for tantalate emission

  11. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.

    2015-08-13

    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  12. [Acute ethanol intoxication among children and adolescents. A retrospective analysis of 173 patients admitted to a university children hospital].

    Science.gov (United States)

    Schöberl, S; Nickel, P; Schmutzer, G; Siekmeyer, W; Kiess, W

    2008-01-01

    In the last time the alcohol consumption among children and adolescents is a big theme in all kind of media. The ethanol consumption among children and adolescents has risen during the last years, but also new hazardous drinking patterns like "binge-drinking" are increasing. These drinking episodes are responsible for many hospital presentations of children and adolescents with acute ethanol intoxication. This study is a retrospective analysis of 173 patients admitted to the university children hospital of Leipzig due to acute ethanol intoxication during the period 1998-2004. Investigated parameters were: socio-demographic factors, clinical presentation and management as well as quantity and type of alcohol. During the years 1998-2004 the rate of alcohol intoxicated patients in this study increased, from 1998-2003 at about 171.4%. Totally 173 patients with an average age of 14.5 years were admitted to the university children hospital. There were significantly more boys than girls. The mean blood alcohol concentration of these patients was 1.77%. Some of the patients had severe symptoms. 62 were unconscious, 2 were in coma and at least 3 patients had to be ventilated. A difference between socioeconomic groups could be observed by comparing the different school types. 44.8% of the patients went to the middle school. Furthermore 17 patients of this study had mental disorders or psychosocial problems and were therefore in psychological or psychiatric treatment. In this study a significant influence of social classes or psychosocial problems on alcohol consumption such as binge-drinking leading to acute ethanol intoxication could not be found. Alarming is the increasing number of ethanol intoxicated patients, the young age, the high measured blood ethanol concentrations and the severe symptoms of these patients. This is the reason why early and intensive prevention strategies are required.

  13. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.; Peyvandi, F.; Pagliari, M.; Cairo, A.; Abdel-Azeim, Safwat; Chermak, Edrisse; Lazzareschi, I.; Mastrangelo, S.; Cavallo, Luigi; Oliva, R.; De Cristofaro, R.

    2015-01-01

    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  14. 41 CFR 302-9.173 - How many replacement POV's may my agency authorize me to transport to my post of duty at...

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false How many replacement POV's may my agency authorize me to transport to my post of duty at Government expense? 302-9.173... How many replacement POV's may my agency authorize me to transport to my post of duty at Government...

  15. Abnormal glomerular filtration rate in children, adolescents and young adults starts below 75 mL/min/1.73 m(2).

    Science.gov (United States)

    Pottel, Hans; Hoste, Liesbeth; Delanaye, Pierre

    2015-05-01

    The chronic kidney disease (CKD) classification system for children is similar to that for adults, with both mainly based on estimated glomerular filtration rate (eGFR) combined with fixed cut-off values. The main cut-off eGFR value used to define CKD is 60 mL/min/1.73 m(2), a value that is also applied for children older than 2 years of age, adolescents and young adults. Based on a literature search, we evaluated inclusion criteria for eGFR in clinical trials or research studies on CKD for children. We also collected information on direct measurements of GFR (mGFR) in children and adolescents, with the aim to estimate the normal reference range for GFR. Using serum creatinine (Scr) normal reference values and Scr-based eGFR-equations, we also evaluated the correspondence between Scr normal reference values and (e)GFR normal reference values. Based on our literature search, the inclusion of children in published CKD studies has been based on cut-off values for eGFR of >60 mL/min/1.73 m(2). The lower reference limits for mGFR far exceed this adult threshold. Using eGFR values calculated using Scr-based formulas, we found that abnormal Scr levels in children already correspond to eGFR values that are below a cut-off of 75 mL/min/1.73 m(2). Abnormal GFR in children, adolescents and young adults starts below 75 mL/min/1.73 m(2), and as abnormality is a sign of disease, we recommend referring children, adolescents and young adults with an (e)GFR of <75 mL/min/1.73 m(2) for further clinical assessment.

  16. Nutritional determinants of worldwide diabetes: an econometric study of food markets and diabetes prevalence in 173 countries.

    Science.gov (United States)

    Basu, Sanjay; Stuckler, David; McKee, Martin; Galea, Gauden

    2013-01-01

    Ageing and urbanization leading to sedentary lifestyles have been the major explanations proposed for a dramatic rise in diabetes worldwide and have been the variables used to predict future diabetes rates. However, a transition to Western diets has been suggested as an alternative driver. We sought to determine what socio-economic and dietary factors are the most significant population-level contributors to diabetes prevalence rates internationally. Multivariate regression models were used to study how market sizes of major food products (sugars, cereals, vegetable oils, meats, total joules) corresponded to diabetes prevalence, incorporating lagged and cumulative effects. The underlying social determinants of food market sizes and diabetes prevalence rates were also studied, including ageing, income, urbanization, overweight prevalence and imports of foodstuffs. Data were obtained from 173 countries. Population-based survey recipients were the basis for diabetes prevalence and food market data. We found that increased income tends to increase overall food market size among low- and middle-income countries, but the level of food importation significantly shifts the content of markets such that a greater proportion of available joules is composed of sugar and related sweeteners. Sugar exposure statistically explained why urbanization and income have been correlated with diabetes rates. Current diabetes projection methods may estimate future diabetes rates poorly if they fail to incorporate the impact of nutritional factors. Imported sugars deserve further investigation as a potential population-level driver of global diabetes.

  17. 3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3

    Science.gov (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki

    2013-01-01

    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299

  18. Evaluation of the performance of national health systems in 2004-2011: An analysis of 173 countries.

    Science.gov (United States)

    Sun, Daxin; Ahn, Haksoon; Lievens, Tomas; Zeng, Wu

    2017-01-01

    In an effort to improve health service delivery and achieve better health outcomes, the World Health Organization (WHO) has called for improved efficiency of health care systems to better use the available funding. This study aims to examine the efficiency of national health systems using longitudinal country-level data. Data on health spending per capita, infant mortality rate (IMR), under 5 mortality rate (U5MR), and life expectancy (LE) were collected from or imputed for 173 countries from 2004 through 2011. Data envelopment analyses were used to evaluate the efficiency and regression models were constructed to examine the determinants of efficiency. The average efficiency of the national health system, when examined yearly, was 78.9%, indicating a potential saving of 21.1% of health spending per capita to achieve the same level of health status for children and the entire population, if all countries performed as well as their peers. Additionally, the efficiency of the national health system varied widely among countries. On average, Africa had the lowest efficiency of 67%, while West Pacific countries had the highest efficiency of 86%. National economic status, HIV/AIDS prevalence, health financing mechanisms and governance were found to be statistically associated with the efficiency of national health systems. Taking health financing as an example, a 1% point increase of social security expenses as a percentage of total health expenditure correlated to a 1.9% increase in national health system efficiency. The study underscores the need to enhance efficiency of national health systems to meet population health needs, and highlights the importance of health financing and governance in improving the efficiency of health systems, to ultimately improve health outcomes.

  19. 173 - 177 Falodun J

    African Journals Online (AJOL)

    DR. AMIN

    palm oil mill effluent and NPK 15:15:15 fertilizer on the growth and yield of soyabean genotype ... growing maize and reported a significant effect on yield. Organic fertilizers supply the ... (1984) and significant differences among treatment.

  20. Pages 166- 173.pmd

    African Journals Online (AJOL)

    Administrator

    The logistic regression model to predict neonatal mortality had a good fit (AUC: 0.8507, misclassification rate: 13.6%) ... intensive care units, principal component analysis, logistic regression, ... between cost of neonatal care and length of stay.

  1. Phase equilibria in the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K

    Energy Technology Data Exchange (ETDEWEB)

    Han, Feng; Luo, Hao [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Zhan, Yongzhong [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Guangxi Univ., Nanning (China). Center of Ecological Collaborative Innovation for Aluminum Industry

    2017-10-15

    The isothermal section of the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K has been experimentally determined. All equilibrated alloys were characterized via X-ray powder diffraction and scanning electron microscopy equipped with energy-dispersive X-ray analysis. A ternary phase Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} was found at 1 173 K. The experimental results show that the isothermal section consists of 11 single-phase regions, 26 two-phase regions and 13 three-phase regions. The existence of eight compounds, i.e. ZrSi{sub 2}, ZrSi, Zr{sub 5}Si{sub 4}, Zr{sub 3}Si{sub 2}, Zr{sub 2}Si, ZrB, ZrB{sub 2} and Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} in this system has been confirmed in the Zr-Si-ZrB{sub 2} region at 1 173 K.

  2. Passive behaviour of zirconium, hafnium and niobium

    International Nuclear Information System (INIS)

    Hornkjoel, S.

    1990-01-01

    The paper deals mainly with the results of stationary and transient polarization measurements together with capacitance measurements on passive electrodes of Zr, Hf and Nb over the entire pH-scale. The passive current densities are exstremely low, and essentially both pH and potential independent, exept for Nb at high pH. The extrapolated potential of zero inverse capacitance seems to be different from the extrapolated potential of zero film thickness for Zr and Hf, but not for Nb. The potential versus time curves at constant current show a downwards bending for Zr and Hf. It is shown that the pitting potentials of Zr and Hf are dependent of the concentration of halide ions and the type of halide ion, but not on pH. It is also shown that the pitting induction is second-order stimulated by chloride ions and first-order hindered by sulphate ions. Results from electron transfer reactions on passive niobium are reported. 9 refs

  3. Nanomechanical properties of hafnium nitride coating

    International Nuclear Information System (INIS)

    Chen Yao; Laha, Tapas; Balani, Kantesh; Agarwal, Arvind

    2008-01-01

    Nanomechanical properties of plasma-sprayed HfN coating with and without hot isostatic pressing (HIP) treatment were evaluated using nanoindentation. For HIPed HfN coating, the elastic modulus (E) and yield strength increase whereas the hardness (H), H/E ratio and fraction of the elastic work decrease. HIPed HfN coating shows a larger pile-up around the indent as compared to as-sprayed HfN. HIPing causes densification and improvement in inter-splat bonding which subsequently lead to increase in nanomechanical properties

  4. High-pressure torsion of hafnium

    International Nuclear Information System (INIS)

    Edalati, Kaveh; Horita, Zenji; Mine, Yoji

    2010-01-01

    Pure Hf (99.99%) is processed by high-pressure torsion (HPT) under pressures of 4 and 30 GPa to form an ultrafine-grained structure with a gain size of ∼180 nm. X-ray diffraction analysis shows that, unlike Ti and Zr, no ω phase formation is detected after HPT processing even under a pressure of 30 GPa. A hydride formation is detected after straining at the pressure of 4 GPa. The hydride phase decomposes either by application of a higher pressure as 30 GPa or by unloading for prolong time after HPT processing. Microhardness, tensile and bending tests show that a high hardness (360 Hv) and an appreciable ductility (8%) as well as high tensile and bending strength (1.15 and 2.75 GPa, respectively) are achieved following the high-pressure torsion.

  5. Comparative performance of the CKD Epidemiology Collaboration (CKD-EPI) and the Modification of Diet in Renal Disease (MDRD) Study equations for estimating GFR levels above 60 mL/min/1.73 m2.

    Science.gov (United States)

    Stevens, Lesley A; Schmid, Christopher H; Greene, Tom; Zhang, Yaping Lucy; Beck, Gerald J; Froissart, Marc; Hamm, Lee L; Lewis, Julia B; Mauer, Michael; Navis, Gerjan J; Steffes, Michael W; Eggers, Paul W; Coresh, Josef; Levey, Andrew S

    2010-09-01

    The Modification of Diet in Renal Disease (MDRD) Study equation underestimates measured glomerular filtration rate (GFR) at levels>60 mL/min/1.73 m2, with variable accuracy among subgroups; consequently, estimated GFR (eGFR)>or=60 mL/min/1.73 m2 is not reported by clinical laboratories. Here, performance of a more accurate GFR-estimating equation, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation, is reported by level of GFR and clinical characteristics. Test of diagnostic accuracy. Pooled data set of 3,896 people from 16 studies with measured GFR (not used for the development of either equation). Subgroups were defined by eGFR, age, sex, race, diabetes, prior solid-organ transplant, and body mass index. eGFR from the CKD-EPI and MDRD Study equations and standardized serum creatinine. Measured GFR using urinary or plasma clearance of exogenous filtration markers. Mean measured GFR was 68+/-36 (SD) mL/min/1.73 m2. For eGFR73 m2, both equations have similar bias (median difference compared with measured GFR). For eGFR of 30-59 mL/min/1.73 m2, bias was decreased from 4.9 to 2.1 mL/min/1.73 m2 (57% improvement). For eGFR of 60-89 mL/min/1.73 m2, bias was decreased from 11.9 to 4.2 mL/min/1.73 m2 (61% improvement). For eGFR of 90-119 mL/min/1.73 m2, bias was decreased from 10.0 to 1.9 mL/min/1.73 m2 (75% improvement). Similar or improved performance was noted for most subgroups with eGFR73 m2, other than body mass indexor=90 mL/min/1.73 m2. Limited number of elderly people and racial and ethnic minorities with measured GFR. The CKD-EPI equation is more accurate than the MDRD Study equation overall and across most subgroups. In contrast to the MDRD Study equation, eGFR>or=60 mL/min/1.73 m2 can be reported using the CKD-EPI equation. Copyright (c) 2010 National Kidney Foundation, Inc. All rights reserved.

  6. Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571).

    Science.gov (United States)

    Tabbers, Merit M; Chmielewska, Ania; Roseboom, Maaike G; Boudet, Claire; Perrin, Catherine; Szajewska, Hania; Benninga, Marc A

    2009-03-18

    Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30-50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency fermented dairy product is effective in the treatment of constipated children with a defecation frequency fermented dairy product containing Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5-10 minutes after each meal (3 times a day) and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence), adverse effects (nausea, diarrhoea, bad taste) and intake of rescue medication (Bisacodyl). Rate of success and rate of responders are also evaluated, with success defined as > or = 3 bowel movements per week and or = 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary) will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. This study is aimed to show that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency after 3 weeks of product consumption in children with functional constipation and a defecation

  7. Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571

    Directory of Open Access Journals (Sweden)

    Perrin Catherine

    2009-03-01

    Full Text Available Abstract Background Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30–50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency Methods/design It is a two nation (The Netherlands and Poland double-blind, placebo-controlled randomised multicentre trial in which 160 constipated children (age 3–16 years with a defecation frequency Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5–10 minutes after each meal (3 times a day and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence, adverse effects (nausea, diarrhoea, bad taste and intake of rescue medication (Bisacodyl. Rate of success and rate of responders are also evaluated, with success defined as ≥ 3 bowel movements per week and ≤1 faecal incontinence episode over the last 2 weeks of product consumption and responder defined as a subject reporting a stool frequency ≥ 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. Conclusion This

  8. Fibroblast Growth Factor-23 and Vitamin D Metabolism in Subjects with eGFR ≥60 ml/min/1.73 m².

    Science.gov (United States)

    Nakatani, Shinya; Nakatani, Ayumi; Tsugawa, Naoko; Yamada, Shinsuke; Mori, Katsuhito; Imanishi, Yasuo; Ishimura, Eiji; Okano, Toshio; Inaba, Masaaki

    2015-01-01

    Fibroblast growth factor (FGF)-23 and parathyroid hormone (PTH) are both potent phosphaturic hormones. Since they exert opposite effects on vitamin D metabolism, the measurement of 3 vitamin D metabolites; 25-hydroxyvitamin D (25-OH-D), 1,25-dihydroxyvitamin D (1,25(OH)2D), and 24,25-dihydroxyvitamin D (24,25(OH)2D), allows the distinction of the effects of FGF-23 from those of PTH. The aim of this study was to elucidate which factor, FGF-23 or PTH, plays a more important role in the regulation of vitamin D metabolites in subjects with estimated glomerular filtration (eGFR) ≥60 ml/min/1.73 m(2). Subjects with eGFR ≥60 ml/min/1.73 m(2) (n = 20) were enrolled and their serum levels of FGF-23, intact PTH, and vitamin D metabolites were determined. Serum FGF-23 correlated inversely with 1,25(OH)2D (r = -0.717, p = 0.0004) and the 1,25(OH)2D/25-OH-D ratio (r = -0.518, p = 0.019), compared with a significant positive correlation between serum intact PTH and the 1,25(OH)2D/25-OH-D ratio (r = 0.562, p = 0.010). Multiple regression analyses revealed serum FGF-23 as a significant factor that was associated with serum 1,25(OH)2D (β = -0.593, p = 0.018), 1,25(OH)2D/25-OH-D ratio (β = -0.521, p = 0.025), and the 24,25(OH)2D/1,25(OH)2D ratio (β = 0.632, p = 0.008), and intact PTH as a significant factor associated with the 1,25(OH)2D/25-OH-D ratio (β = 0.445, p = 0.028). This study demonstrated that, even in subjects with eGFR ≥60 ml/min/1.73 m(2), FGF-23 might play an important role in the regulation of vitamin D metabolism. In addition to the established role of PTH, the association between FGF-23 and indices of vitamin D metabolism suggested the potential role of FGF-23 on phosphate metabolism in such patients. © 2015 S. Karger AG, Basel.

  9. Separation of zirconium and hafnium; Separation du zirconium et de l'hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Saint-James, D [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1959-07-01

    This account is more chemical than metallurgical in character. The reason for this is that so-called 'nuclear metal' must fulfil standards of purity which only chemical processes can attain. This paper must therefore be considered as a preliminary study, from which the metallurgists can form an idea of the treatments leading to the production of the metal. (author) [French] Cet expose a un caractere chimique plutot que metallurgique. La raison en est que le metal dit 'nucleaire' a des exigences de purete que seuls des processus chimiques peuvent satisfaire. Il faut donc considerer cet expose comme un preliminaire, permettant de donner une idee aux metallurgistes des traitements qui aboutissent a l'elaboration du metal. (auteur)

  10. Triangular flow of negative pions emitted in PbAu collisions at $\\sqrt{S_{NN}} = 17.3$ GeV

    CERN Document Server

    Adamová, D.

    Differential triangular flow, $v_3(p_T)$, of negative pions is measured at $\\sqrt{s_{NN}}$= 17.3~GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30\\% with a mean centrality of 5.5\\%. This is the first measurement of the triangular flow at SPS energies. The $p_T$ range extends from about 0.05~GeV/c to more than 2~GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydro calculation combined with an UrQMD cascade model for the late stages.

  11. Study of heat conductivity, electric conductivity and thermo-emf of BiSrCaCu2Ox and Bi1.82Sr1.73Ca1.73Ca1.25Cu2.2Ox systems

    International Nuclear Information System (INIS)

    Zhukova, T.B.; Parfen'eva, L.S.; Popov, V.V.; Melekh, B.T.; Smirnov, I.A.; Khalmedov, Kh.M.

    1991-01-01

    Phase compositions are determined and temperature dependences are measured of x-heat conductivity, ρ-electric resistance and α-thermo-emf of polycrystal, monophase, highly textured HTSC samples of BiSrCaCu 2 O x and Bi 1.82 Sr 1.73 Ca 1.25 Cu 2.2 O x produced through method of direct induction melting in the air in a cold container. Sample 'aging' after storage in the air and vacuum, leading to decrease in the number of foring phases and increase in the basic phase content as well as to change of x, ρ and α coefficients is identified

  12. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  13. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Science.gov (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

    2015-01-01

    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  14. Energy dependence of particle ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{_{NN}}} =$~6.3 to 17.3 GeV

    CERN Document Server

    Alt, C; Baatar, B; Barna, D; Bartke, J; Betev, L; Bialkowska, H; Blume, C; Boimska, B; Botje, M; Bracinik, J; Bramm, R; Bunccic, P; Cerny, V; Christakoglou, P; Chvala, O; Cramer, J G; Csató, P; Dinkelaker, P; Eckardt, V; Flierl, D; Fodor, Z; Foka, P; Friese, V; Gál, J; Gazdzicki, M; Genchev, V; Georgopoulos, G; Gladysz, E; Grebieszkow, K; Hegyi, S; Höhne, C; Kadija, K; Karev, A; Kliemant, M; Kniege, S; Kolesnikov, V I; Kornas, E; Korus, R; Kowalski, M; Kraus, I; Kreps, M; Kresan, D; Van Leeuwen, M; Lévai, P; Litov, L; Lungwitz, B; Makariev, M; Malakhov, A I; Mateev, M; Melkumov, G L; Mischke, A; Mitrovski, M; Molnár, J; Mrówczynski, St; Nicolic, V; Pálla, G; Panagiotou, A D; Panayotov, D; Petridis, A; Pikna, M; Prindle, D; Pühlhofer, F; Renfordt, R; Roland, C; Roland, G; Rybczynski, M; Rybicki, A; Sandoval, A; Schmitz, N; Schuster, T; Seyboth, P; Siklér, F; Sitár, B; Skrzypczak, E; Stefanek, G; Stock, R; Ströbele, H; Susa, T; Szentpétery, I; Sziklai, J; Szymanski, P; Trubnikov, V; Varga, D; Vassiliou, M; Veres, G I; Vesztergombi, G; Vranic, D; Wetzler, A; Wlodarczyk, Z; Yoo, I K

    2009-01-01

    We present recent measurements of the energy dependence of event-by-event fluctuations in the K/pi and (p + \\bar{p})/pi multiplicity ratios in heavy ion collisions at the CERN SPS. The particle ratio fluctuations were obtained for central Pb+Pb collisions at five collision energies, \\sqrt{s_{_{NN}}}, between 6.3 and 17.3 GeV. After accounting for the effects of finite-number statistics and detector resolution, we extract the strength of non-statistical fluctuations at each energy. For the K/pi ratio, larger fluctuations than expected for independent particle production are found at all collision energies. The fluctuations in the (p + \\bar{p})/pi ratio are smaller than expectations from independent particle production, indicating correlated pion and proton production from resonance decays. For both ratios, the deviation from purely statistical fluctuations shows an increase towards lower collision energies. The results are compared to transport model calculations, which fail to describe the energy dependence o...

  15. A Search for Technosignatures from 14 Planetary Systems in the Kepler Field with the Green Bank Telescope at 1.15–1.73 GHz

    Science.gov (United States)

    Margot, Jean-Luc; Greenberg, Adam H.; Pinchuk, Pavlo; Shinde, Akshay; Alladi, Yashaswi; Prasad MN, Srinivas; Bowman, M. Oliver; Fisher, Callum; Gyalay, Szilard; McKibbin, Willow; Miles, Brittany; Nguyen, Donald; Power, Conor; Ramani, Namrata; Raviprasad, Rashmi; Santana, Jesse; Lynch, Ryan S.

    2018-05-01

    Analysis of Kepler mission data suggests that the Milky Way includes billions of Earth-sized planets in the habitable zone of their host stars. Current technology enables the detection of technosignatures emitted from a large fraction of the Galaxy. We describe a search for technosignatures that is sensitive to Arecibo-class transmitters located within ∼420 ly of Earth and transmitters that are 1000 times more effective than Arecibo within ∼13000 ly of Earth. Our observations focused on 14 planetary systems in the Kepler field and used the L-band receiver (1.15–1.73 GHz) of the 100 m diameter Green Bank Telescope. Each source was observed for a total integration time of 5 minutes. We obtained power spectra at a frequency resolution of 3 Hz and examined narrowband signals with Doppler drift rates between ±9 Hz s‑1. We flagged any detection with a signal-to-noise ratio in excess of 10 as a candidate signal and identified approximately 850,000 candidates. Most (99%) of these candidate signals were automatically classified as human-generated radio-frequency interference (RFI). A large fraction (>99%) of the remaining candidate signals were also flagged as anthropogenic RFI because they have frequencies that overlap those used by global navigation satellite systems, satellite downlinks, or other interferers detected in heavily polluted regions of the spectrum. All 19 remaining candidate signals were scrutinized and none were attributable to an extraterrestrial source.

  16. BITUMINOUS MIX RESPONSE TO PLASTIC DEFORMATIONS: COMPARISON OF THE SPANISH NLT-173 AND UNE-EN 12697-22 WHEEL-TRACKING TESTS

    Directory of Open Access Journals (Sweden)

    GEMA GARCÍA-TRAVÉ

    2012-01-01

    Full Text Available La formación de roderas es uno de los mayores deterioros que se producen en los firmes flexibles, lo que ocasiona la pérdida de regularidad superficial que repercute de forma negativa en la calidad del servicio prestado a los usuarios. Existen distintos ensayos de laboratorio que permiten evaluar las deformaciones plásticas producidas en las capas del pavimento, entre ellos podemos destacar los ensayos de simulación. El objetivo de esta investigación es analizar el comportamiento de una mezcla bituminosa en caliente frente a deformaciones plásticas, mediante dos métodos de ensayo diferentes; ensayo en pista de laboratorio de acuerdo a la normativa española NLT-173 y el ensayo de rodadura UNE-EN 12697-22 (ensayo obligatorio tras la entrada en vigor del Marcado CE de mezclas bituminosas en 2008. La finalidad última de este artículo es formular una propuesta de modificación de la normativa española (PG-3 sobre los límites exigibles en éste último ensayo.

  17. New candidates for active asteroids: Main-belt (145) Adeona, (704) Interamnia, (779) Nina, (1474) Beira, and near-Earth (162,173) Ryugu

    Science.gov (United States)

    Busarev, Vladimir V.; Makalkin, Andrei B.; Vilas, Faith; Barabanov, Sergey I.; Scherbina, Marina P.

    2018-04-01

    For the first time, spectral signs of subtle coma activity were observed for four main-belt primitive asteroids (145) Adeona, (704) Interamnia, (779) Nina, and (1474) Beira around their perihelion distances in September 2012, which were interpreted as manifestations of the sublimation of H2O ice in/under the surface matter (Busarev et al., 2015a, 2015b). We confirm the phenomenon for Nina when it approached perihelion in September 2016. At the same time, based on results of spectral observations of near-Earth asteroid (162,173) Ryugu (Vilas, 2008) being a target of Japan's Hayabusa 2 space mission, we suspected a periodic similar transient activity on the Cg-type asteroid. However, unlike the main-belt primitive asteroids demonstrating sublimation of ices close to their perihelion distances, the effect on Ryugu was apparently registered near aphelion. To explain the difference, we calculated the subsolar temperature depending on heliocentric distance of the asteroids, considered qualitative models of internal structure of main-belt and near-Earth primitive asteroids including ice and performed some analytical estimations. Presumed temporal sublimation/degassing activity of Ryugu is a sign of a residual frozen core in its interior. This could be an indication of a relatively recent transition of the asteroid from the main asteroid belt to the near-Earth area.

  18. Triangular flow of negative pions emitted in PbAu collisions at √{sNN} = 17.3 GeV

    Science.gov (United States)

    Adamová, D.; Agakichiev, G.; Andronic, A.; Antończyk, D.; Appelshäuser, H.; Belaga, V.; Bielčíková, J.; Braun-Munzinger, P.; Busch, O.; Cherlin, A.; Damjanović, S.; Dietel, T.; Dietrich, L.; Drees, A.; Dubitzky, W.; Esumi, S. I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glässel, P.; Hering, G.; Holeczek, J.; Kalisky, M.; Karpenko, Iu.; Krobath, G.; Kushpil, V.; Maas, A.; Marín, A.; Milošević, J.; Miśkowiec, D.; Panebrattsev, Y.; Petchenova, O.; Petráček, V.; Radomski, S.; Rak, J.; Ravinovich, I.; Rehak, P.; Sako, H.; Schmitz, W.; Schuchmann, S.; Sedykh, S.; Shimansky, S.; Stachel, J.; Šumbera, M.; Tilsner, H.; Tserruya, I.; Tsiledakis, G.; Wessels, J. P.; Wienold, T.; Wurm, J. P.; Yurevich, S.; Yurevich, V.

    2017-01-01

    Differential triangular flow, v3 (pT), of negative pions is measured at √{sNN} = 17.3 GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30% with a mean centrality of 5.5%. This is the first measurement as a function of transverse momentum of the triangular flow at SPS energies. The pT range extends from about 0.05 GeV/c to more than 2 GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydrodynamic calculation combined with an UrQMD cascade model for the late stages.

  19. Production of lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using soybean flour and rice straw as the substrate.

    Science.gov (United States)

    Zhu, Zhen; Zhang, Guoyi; Luo, Yi; Ran, Wei; Shen, Qirong

    2012-05-01

    This work was aimed to produce lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using agro-industrial byproducts. A central composite design was used to get the highest lipopeptides production. Results revealed that the optimal conditions for maximum lipopeptides production were 1.79% starch and 1.91% yeast extract by employing 5.58 g soybean flour and 3.67 g rice straw as the solid substrate with initial pH 7.5, moisture content 55% and a 10% inoculum level at 30°C for 2 days. Under these conditions, the experimental yield of lipopeptides reached 50.01 mg/gds, which was very close to the predicted value (49.91 mg/gds). At high concentration, the lipopeptides extracted from fermented substrates showed strong antibiotic activity against Rhizoctonia solani and Ralstonia solanacearum and certain emulsification but good emulsion stability. This is the first report on lipopeptides production that uses rice straw as a major substrate. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Finding of 13(2) , 17(3) -cyclopheophorbide a enol as a degradation product of chlorophyll in shrunk zooxanthellae of the coral Montipora digitata.

    Science.gov (United States)

    Suzuki, Toshiyuki; Casareto, Beatriz Estela; Shioi, Yuzo; Ishikawa, Yoshio; Suzuki, Yoshimi

    2015-02-01

    We examined the morphology and pigment composition of zooxanthellae in corals subjected to normal temperature (27°C) and thermal stress (32°C). We observed several normal and abnormal morphological types of zooxanthellar cells. Normal cells were intact and their chloroplasts were unbroken (healthy); abnormal cells were shrunken and had partially degraded or broken chloroplasts, or they were bleached and without chloroplasts. At 27°C, most healthy zooxanthellar cells were retained in the coral tissue, whereas shrunken zooxanthellae were expelled. Under thermal stress, the abundance of healthy zooxanthellae declined and the proportion of shrunken/abnormal cells increased in coral tissues. The rate of algal cell expulsion was reduced under thermal stress. Within the shrunken cells, we detected the presence of a chl-like pigment that is not ordinarily found in healthy zooxanthellae. Analysis of the absorption spectrum, absorption maxima, and retention time (by HPLC) indicated that this pigment was 13(2) , 17(3) -cyclopheophorbide a enol (cPPB-aE), which is frequently found in marine and lacustrine sediments, and in protozoans that graze on phytoplankton. The production of cPPB-aE in shrunken zooxanthellae suggests that the chls have been degraded to cPPB-aE, a compound that is not fluorescent. The lack of a fluorescence function precludes the formation of reactive oxygen species. We therefore consider the formation of cPPB-aE in shrunken zooxanthellae to be a mechanism for avoiding oxidative stress. © 2014 The Authors. Journal of Phycology published by Wiley Periodicals, Inc. on behalf of Phycological Society of America.

  1. Macrophage Migration Inhibitory Factor Promoter Polymorphisms (−794 CATT5–8 and −173 G>C: Relationship with mRNA Expression and Soluble MIF Levels in Young Obese Subjects

    Directory of Open Access Journals (Sweden)

    Inés Matia-García

    2015-01-01

    Full Text Available We analyzed the relationship of −794 CATT5–8 and −173 G>C MIF polymorphisms with mRNA and soluble MIF in young obese subjects. A total of 250 young subjects, 150 normal-weight and 100 obese subjects, were recruited in the study. Genotyping of −794 CATT5–8 and −173 G>C MIF polymorphisms was performed by PCR and PCR-RFLP, respectively. MIF mRNA expression was determined by real-time PCR and serum MIF levels were measured using an ELISA kit. For both MIF promoter polymorphisms, no significant differences in the genotype and allele frequencies between groups were observed. MIF mRNA expression was slightly higher in obese subjects than in normal-weight subjects (1.38-fold, while soluble MIF levels did not show differences between groups. In addition, we found an increase in MIF mRNA expression in carriers of the 6,6 and C/C genotypes and the 6G haplotype of the −794 CATT5–8 and −173 G>C MIF polymorphisms, although it was not significant. In conclusion, this study found no relationship between obesity and MIF gene promoter polymorphisms with MIF mRNA expression in young obese subjects.

  2. Tuberculosis in Scottish military veterans: evidence from a retrospective cohort study of 57 000 veterans and 173 000 matched non-veterans.

    Science.gov (United States)

    Bergman, Beverly P; Mackay, D F; Pell, J P

    2017-02-01

    Tuberculosis was a major cause of morbidity and manpower loss in the Armed Forces during World War II. Military control programmes commenced in the 1950s but were initially limited in scope by the many recruits who were already tuberculin positive on enlistment. The aim of our study was to examine whether veterans have an increased risk of tuberculosis compared with non-veterans. Retrospective cohort study of 57 000 veterans born 1945-1985, and 173 000 people with no record of military service, resident in Scotland, matched for age, sex and area of residence, using Cox proportional hazard analysis to compare the risk of tuberculosis overall, by birth cohort, length of service and year of diagnosis and to examine comorbidities. Over mean 29 years follow-up, 69 (0.12%) veterans were recorded as having tuberculosis, compared with 267 (0.15%) non-veterans (unadjusted HR 0.90, 95% CIs 0.69 to 1.19, p=0.463). Only the 1945-1949 veterans' birth cohort was at higher risk, unadjusted HR 1.54, 95% CIs 0.98 to 2.45, p=0.061, although the difference in risk did not achieve significance. Veterans born from 1950 were at significantly reduced risk of tuberculosis compared with non-veterans after adjusting for deprivation, HR 0.67, 95% CI 0.47 to 0.95, p=0.026. The most common comorbidities were smoking-related and alcohol-related disease. The risk of comorbid hepatitis B or C was very low, in both veterans and non-veterans. No length of service was associated with an increased risk of tuberculosis in comparison with non-veterans. Scottish veterans born before 1950 are at moderately increased risk of tuberculosis compared with age, sex and geographically matched civilians with no record of service, although the difference is not statistically significant. Scottish veterans born from 1950 show a reduction in risk compared with civilians. Tuberculosis should be considered in the differential diagnosis of respiratory disease in the older veteran. Published by the BMJ Publishing

  3. Hafnium isotope ratios of nine GSJ reference samples

    International Nuclear Information System (INIS)

    Hanyu, Takeshi; Nakai, Shun'ichi; Tatsuta, Riichiro

    2005-01-01

    176 Hf/ 177 Hf ratios of nine geochemical reference rocks from the Geological Survey of Japan, together with BIR-1 and BCR-2, were determined using multi-collector inductively coupled plasma mass spectrometry. Our data for BIR-1, BCR-2 and JB-1 are in agreement with those previously reported, demonstrating the appropriateness of the chemical procedure and isotopic measurement employed in this study. The reference rocks have a wide range of 176 Hf/ 177 Hf covering the field defined by various volcanic rocks, such as mid-ocean ridge basalts, ocean island basalts, and subduction related volcanic rocks. They are therefore suitable as rock standards for Hf isotope measurement of geological samples. (author)

  4. Control of the hafnium content in Co samples by SSMS

    International Nuclear Information System (INIS)

    Lukaszew, R.A.; Cretella, R.F.

    1989-01-01

    The production of 60 Co requires a strict control of the chemical composition of the cobalt before irradiation in order to avoid the activation of some undesirable elements and to constrain the presence of slow neutron poisons. A methodology by SSMS for the survey analysis of metallic Co prior to its irradiation in the nuclear reactor at Embalse (Cdba., Argentina) is described. The low detection limit attained for Hf (below 0.5 ppm) is outlined. The results obtained for some other impurities without a standard reference are compared with atomic emission spectrographic data and show satisfactory agreement. (orig.)

  5. Production of long-lived hafnium isomers in reactor irradiations

    Czech Academy of Sciences Publication Activity Database

    Adam, Jindřich

    -, - (2006), s. 48-56 ISSN 1574-1818 R&D Projects: GA MŠk 1P04LA213 Institutional research plan: CEZ:AV0Z10480505 Keywords : production * Hf Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders

  6. Hafnium Isotopic Variations in Central Atlantic Intraplate Volcanism

    Science.gov (United States)

    Geldmacher, J.; Hanan, B. B.; Hoernle, K.; Blichert-Toft, J.

    2008-12-01

    Although one of the geochemically best investigated volcanic regions on Earth, almost no Hf isotopic data have been published from the broad belt of intraplate seamounts and islands in the East Atlantic between 25° and 36° N. This study presents 176Hf/177Hf ratios from 61 representative samples from the Canary, Selvagen and Madeira Islands and nearby large seamounts, encompassing the full range of different evolutionary stages and geochemical endmembers. The majority of samples have mafic, mainly basaltic compositions with Mg-numbers within or near the range of magmas in equilibrium with mantle olivine (68-75). No correlation was found between Mg-number and 176Hf/177Hf ratios in the data set. In comparison to observed Nd isotope variations published for this volcanic province (6 ɛNd units), 176Hf/177Hf ratios span a larger range (14 ɛHf units). Samples from the Madeira archipelago have the most radiogenic compositions (176Hf/177Hfm= 0.283132-0.283335), widely overlapping the field for central Atlantic N-MORB. They form a relatively narrow, elongated trend (stretching over >6 ɛHf units) between a radiogenic MORB-like endmember and a composition located on the Nd-Hf mantle array. In contrast, all Canary Islands samples plot below the mantle array (176Hf/177Hfm = 0.282943-0.283067) and, despite being from an archipelago that stretches over a much larger geographic area, form a much denser cluster with less compositional variation (~4 ɛHf units). All samples from the seamounts NE of the Canaries, proposed to belong to the same Canary hotspot track (e.g. Geldmacher et al., 2001, JVGR 111; Geldmacher et al., 2005, EPSL 237), fall within the Hf isotopic range of this cluster. The cluster largely overlaps the composition of the proposed common mantle endmember 'C' (Hanan and Graham, 1996, Science 272) but spans a space between a more radiogenic (depleted) composition and a HIMU-type endmember. Although samples of Seine and Unicorn seamounts, attributed to the Madeira hotspot track, show less radiogenic Hf and Nd isotope ratios than Madeira, their isotopic compositions lie along an extension of the Madeira trend in plots of Hf versus Sr, Nd, Pb isotopes. The new Hf isotope ratios confirm the existence of at least two geochemically distinct volcanic provinces (Canary and Madeira) in the East Atlantic as previously proposed.

  7. Electric field cycling behavior of ferroelectric hafnium oxide.

    Science.gov (United States)

    Schenk, Tony; Schroeder, Uwe; Pešić, Milan; Popovici, Mihaela; Pershin, Yuriy V; Mikolajick, Thomas

    2014-11-26

    HfO2 based ferroelectrics are lead-free, simple binary oxides with nonperovskite structure and low permittivity. They just recently started attracting attention of theoretical groups in the fields of ferroelectric memories and electrostatic supercapacitors. A modified approach of harmonic analysis is introduced for temperature-dependent studies of the field cycling behavior and the underlying defect mechanisms. Activation energies for wake-up and fatigue are extracted. Notably, all values are about 100 meV, which is 1 order of magnitude lower than for conventional ferroelectrics like lead zirconate titanate (PZT). This difference is mainly atttributed to the one to two orders of magnitude higher electric fields used for cycling and to the different surface to volume ratios between the 10 nm thin films in this study and the bulk samples of former measurements or simulations. Moreover, a new, analog-like split-up effect of switching peaks by field cycling is discovered and is explained by a network model based on memcapacitive behavior as a result of defect redistribution.

  8. Elastic and Thermodynamic Properties of Zirconium and Hafnium ...

    Indian Academy of Sciences (India)

    65

    Here Rh3V is chosen as the parent binary compound and the doping ..... Grüneisen parameter ζ [44] are two key quantities in solid state problems due to their .... The authors wish to thank DRDO (ER & IPR), New Delhi for the financial support.

  9. Electronic structure of hafnium: A Compton profile study

    Indian Academy of Sciences (India)

    To extract the true Compton profile from the raw data, the raw data were cor- rected for ... For the present sample and experimental conditions, the contribution of .... are in better agreement with the simple renormalized free atom calculations for.

  10. Hafnium(IV) complexation with oxalate at variable temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Friend, Mitchell T.; Wall, Nathalie A. [Washington State Univ., Pullmanm, WA (United States). Dept. of Chemistry

    2017-08-01

    Appropriate management of fission products in the reprocessing of spent nuclear fuel (SNF) is crucial in developing advanced reprocessing schemes. The addition of aqueous phase complexing agents can prevent the co-extraction of these fission products. A solvent extraction technique was used to study the complexation of Hf(IV) - an analog to fission product Zr(IV) - with oxalate at 15, 25, and 35 C in 1 M HClO{sub 4} utilizing a {sup 175+181}Hf radiotracer. The mechanism of the solvent extraction system of 10{sup -5} M Hf(IV) in 1 M HClO{sub 4} to thenoyltrifluoroacetone (TTA) in toluene demonstrated a 4{sup th}-power dependence in both TTA and H{sup +}, with Hf(TTA){sub 4} the only extractable species. The equilibrium constant for the extraction of Hf(TTA){sub 4} was determined to be log K{sub ex}=7.67±0.07 (25±1 C, 1 M HClO{sub 4}). The addition of oxalate to the aqueous phase decreased the distribution ratio, indicating aqueous Hf(IV)-oxalate complex formation. Polynomial fits to the distribution data identified the formation of Hf(ox){sup 2+} and Hf(ox){sub 2(aq)} and their stability constants were measured at 15, 25, and 35 C in 1 M HClO{sub 4}. van't Hoff analysis was used to calculate Δ{sub r}G, Δ{sub r}H, and Δ{sub r}S for these species. Stability constants were observed to increase at higher temperature, an indication that Hf(IV)-oxalate complexation is endothermic and driven by entropy.

  11. Iron(3) chloride interaction with zirconium and hafnium tetrahalides

    International Nuclear Information System (INIS)

    Berdonosov, S.; Kharisov, B.I.; Melikhov, I.V.

    1988-01-01

    Using FeCl 3 , labelled with 36 Cl radionuclide, it is shown, that during reaction between FeCl 3 and MCl (M=Zr, Hf) resulting in Cl 2 splitting-off and FeMCl 6 formation, chlorine is splitted from MCl 4 . From the analysis of Moessbauer spectra and visual observations it follows, that reaction between FeCl 3 and MBr 4 starts at 50 deg C temperature, whereupon bromine and FeMCl 3 Br 3 compounds are formed. Considerations about the possible mechanism of reactions between FeCl 3 and MCl 4 or MBr 4 are proposed

  12. Cesium hafnium chloride scintillator coupled with an avalanche photodiode photodetector

    Czech Academy of Sciences Publication Activity Database

    Kurosawa, S.; Kodama, S.; Yokota, Y.; Horiai, T.; Yamaji, A.; Shoji, Y.; Král, Robert; Pejchal, Jan; Ohashi, Y.; Kamada, K.; Nikl, Martin; Yoshikawa, A.

    2017-01-01

    Roč. 12, Feb (2017), s. 1-8, č. článku C02042. ISSN 1748-0221 Grant - others:AV ČR(CZ) JSPS-17-18 Program:Bilaterální spolupráce Institutional support: RVO:68378271 Keywords : gamma detectors * scintillators and scintillating fibres * scintillators * scintillation and light emission processes Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.220, year: 2016

  13. Spectroscopy of very neutron-deficient hafnium and tungsten isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Dracoulis, G D; Fabricius, B; Davidson, P M [Australian National Univ., Canberra, ACT (Australia). Dept. of Nuclear Physics; Macchiavelli, A O; Oliviera, J; Burde, J; Stephens, F; Deleplanque, M A [Lawrence Berkeley Lab., CA (United States)

    1992-08-01

    Level schemes of the very neutron-deficient isotopes {sup 158}Hf and {sup 162}W have been identified, and that for {sup 164}W extended. Alignment of the H{sub 9/2} neutrons is suggested. (author). 12 refs., 7 figs.

  14. Neutron Detection Utilizing Gadolinium Doped Hafnium Oxide Films

    National Research Council Canada - National Science Library

    Blasy, Bryan D

    2008-01-01

    ... retains monoclinic local symmetery for all levels of doping. Current as a function of voltage experiments identified the films as having poor diode characteristics with high leakage current in the forward bias region...

  15. Crystal structures of superconducting sodium intercalates of hafnium nitride chloride

    International Nuclear Information System (INIS)

    Oro-Sole, J.; Frontera, C.; Beltran-Porter, D.; Lebedev, O.I.; Van Tendeloo, G.; Fuertes, A.

    2006-01-01

    Sodium intercalation compounds of HfNCl have been prepared at room temperature in naphtyl sodium solutions in tetrahydrofuran and their crystal structure has been investigated by Rietveld refinement using X-ray powder diffraction data and high-resolution electron microscopy. The structure of two intercalates with space group R3-bar m and lattice parameters a=3.58131(6)A, c=57.752(6)A, and a=3.58791(8)A, c=29.6785(17)A is reported, corresponding to the stages 2 and 1, respectively, of Na x HfNCl. For the stage 2 phase an ordered model is presented, showing two crystallographically independent [HfNCl] units with an alternation of the Hf-Hf interlayer distance along the c-axis, according with the occupation by sodium atoms of one out of two van der Waals gaps. Both stages 1 and 2 phases are superconducting with critical temperatures between 20 and 24K, they coexist in different samples with proportions depending on the synthesis conditions, and show a variation in c spacing that can be correlated with the sodium stoichiometry. High-resolution electron microscopy images of the host and intercalated samples show bending of the HfNCl bilayers as well as stacking faults in some regions, which coexist in the same crystal with ordered domains

  16. Elastic and thermodynamic properties of zirconium- and hafnium ...

    Indian Academy of Sciences (India)

    2018-02-02

    Feb 2, 2018 ... ties. The volume optimization curves (both LDA and GGA) for binary Rh3V, Rh3Zr and Rh3Hf compounds are shown in ... the strength of covalent bonding of the given material. ..... Bulk modulus is correlated with binding energy or cohesive energy of atoms, since it is a measure of average atomic bond.

  17. Effect of a fermented milk containing Bifidobacterium animalis DN-173 010 on the health-related quality of life and symptoms in irritable bowel syndrome in adults in primary care: a multicentre, randomized, double-blind, controlled trial.

    Science.gov (United States)

    Guyonnet, D; Chassany, O; Ducrotte, P; Picard, C; Mouret, M; Mercier, C-H; Matuchansky, C

    2007-08-01

    Health-related quality of life (HRQoL) has been rarely evaluated as a primary endpoint in the assessment of the effect of probiotics on the irritable bowel syndrome (IBS). To study the effects of fermented milk containing Bifidobacterium animalis DN-173 010 and yoghurt strains on the IBS in a multicentre, double-blind, controlled trial. A total of 274 primary care adults with constipation-predominant IBS (Rome II) were randomized to consume for 6 weeks either the test fermented milk or a heat-treated yoghurt (control). HRQoL and digestive symptoms were assessed after 3 and 6 weeks on an intention-to-treat population of 267 subjects. The HRQoL discomfort score, the primary endpoint, improved (P food on discomfort HRQoL score and bloating in constipation-predominant IBS, and on stool frequency in subjects with <3 stools/week.

  18. MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

    Science.gov (United States)

    Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Jf, Muñoz-Valle

    2018-07-15

    Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Energy dependence of kaon-to-proton ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{NN}}$ = 6.3 to 17.3 GeV

    CERN Document Server

    Anticic, T.; Barna, D.; Bartke, J.; Beck, H.; Betev, L.; Bialkowska, H.; Blume, C.; Bogusz, M.; Boimska, B.; Book, J.; Botje, M.; Buncic, P.; Cetner, T.; Christakoglou, P.; Chung, P.; Chvala, O.; Cramer, J.G.; Eckardt, V.; Fodor, Z.; Foka, P.; Friese, V.; Gazdzicki, M.; Grebieszkow, K.; Hohne, C.; Kadija, K.; Karev, A.; Kolesnikov, V.I.; Kollegger, T.; Kowalski, M.; Kresan, D.; Laszlo, A.; Lacey, R.; van Leeuwen, M.; Mackowiak, M.; Makariev, M.; Malakhov, A.I.; Mateev, M.; Melkumov, G.L.; Mitrovski, M.; Mrowczynski, St.; Nicolic, V.; Palla, G.; Panagiotou, A.D.; Peryt, W.; Pluta, J.; Prindle, D.; Puhlhofer, F.; Renfordt, R.; Roland, C.; Roland, G.; Rybczynski, M.; Rybicki, A.; Sandoval, A.; Schmitz, N.; Schuster, T.; Seyboth, P.; Sikler, F.; Skrzypczak, E.; Slodkowski, M.; Stefanek, G.; Stock, R.; Strobele, H.; Susa, T.; Szuba, M.; Utvic, M.; Varga, D.; Vassiliou, M.; Veres, G.I.; Vesztergombi, G.; Vranic, D.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.

    2011-01-01

    Kaons and protons carry large parts of two conserved quantities, strangeness and baryon number. It is argued that their correlation and thus also fluctuations are sensitive to conditions prevailing at the anticipated parton-hadron phase boundary. Fluctuations of the $(\\mathrm{K}^+ + \\mathrm{K}^-)/(\\mathrm{p}+\\bar{\\mathrm{p}})$ and $\\mathrm{K}^+/\\mathrm{p}$ ratios have been measured for the first time by NA49 in central Pb+Pb collisions at 5 SPS energies between $\\sqrt{s_{NN}}$= 6.3~GeV and 17.3~GeV. Both ratios exhibit a change of sign in $\\sigma_{\\mathrm{dyn}}$, a measure of non-statistical fluctuations, around $\\sqrt{s_{NN}}$ = 8~GeV. Below this energy, $\\sigma_{\\mathrm{dyn}}$ is positive, indicating higher fluctuation compared to a mixed event background sample, while for higher energies, $\\sigma_{\\mathrm{dyn}}$ is negative, indicating correlated emission of kaons and protons. The results are compared to UrQMD calculations which which give a good description at the higher SPS energies, but fail to reproduc...

  20. Synthesis and silica coating of calcia-doped ceria/plate-like titanate (K0.8Li0.27Ti1.73O4) nanocomposite by seeded polymerization technique

    International Nuclear Information System (INIS)

    El-Toni, Ahmed Mohamed; Yin, Shu; Sato, Tsugio

    2007-01-01

    Calcia-doped ceria is of potential interest as an ultraviolet (UV) radiation blocking material in personal care products because of the excellent UV light absorption property and low catalytic ability for the oxidation of organic materials superior to undoped ceria. In order to reduce the oxidation catalytic activity further, calcia-doped ceria was coated with amorphous silica by means of seeded polymerization technique. Generally, nanoparticles of inorganic materials do not provide a good coverage for human skin because of the agglomeration of the particles. The plate-like particles are required to enhance the coverage ability of inorganic materials. This can be accomplished by synthesis of calcia-doped ceria/plate-like potassium lithium titanate (K 0.8 Li 0.27 Ti 1.73 O 4 ) nanocomposite with subsequent silica coating to control catalytic activity of calcia-doped ceria. Calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was prepared by soft chemical method followed by silica coating via seeded polymerization technique. Silica coated calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was characterized by X-ray diffraction, SEM, TEM, XPS and FT-IR

  1. Successive composition of two laser channels upon excitation of He-Ar-Xe (2.03 μm) and Ar-Xe (1.73 μm) mixtures by uranium fission fragments

    International Nuclear Information System (INIS)

    Pikulev, A A; Tsvetkov, V M; Sosnin, P V; Sinyanskii, A A

    2009-01-01

    The operation efficiency of the scheme with successive composition of two laser channels upon excitation of the active medium by uranium-235 fission fragments is studied experimentally and numerically. For the He:Ar:Xe = 380:380:1 mixture (at a pressure of 1 atm and the lasing wavelength λ = 2.03 μm) the maximum lasing power of a double channel (1 kW) is almost twice that of a single channel (540 W). Calculations show that in the case of ideal composition (without losses on mirrors) the lasing power of the double channel can be increased to 1.2 kW. For the Ar:Xe = 380:1 mixture (the pressure is 0.5 atm, λ = 1.73 μm) the maximum lasing power of the double channel (620 W) is slightly above that of the single channel (520 W), which is caused by the losses on aluminum mirrors employed for channel doubling and by a negative effect of optical inhomogeneities. In the case of ideal composition, the lasing power can be increased to 830 W. (lasers)

  2. Evaluation of the 175Lu(n,2n)174Lu, 175Lu(n,2n/sup 174m/Lu, and 175Lu(n,3n)173Lu cross sections from threshold to 20 MeV

    International Nuclear Information System (INIS)

    Philis, C.; Young, P.G.; Arthur, E.D.

    1978-04-01

    An evaluation of the 175 Lu(n,2n) 174 Lu, 175 Lu(n,2n)/sup 174m/Lu, and 175 Lu(n,3n) 173 Lu reactions from threshold to 20 MeV is presented. Available experimental data were renormalized to a consistent set of standards and were used along with results from statistical-preequilibrium model calculations to produce recommended curves for each of these reactions

  3. Areva at March 31, 2014: Downturn in revenue as anticipated, to euro 1.781 bn (-17.3% like for like), Backlog of euro 40.2 bn

    International Nuclear Information System (INIS)

    Duperray, Julien; Berezowskyj, Katherine; Grange, Aurelie; Rosso, Jerome; Thebault, Alexandre; Scorbiac, Marie de; Repaire, Philippine du

    2014-01-01

    Following the marked growth of the nuclear operations in 2013, thanks in particular to the strength of recurring activities and the contribution of exceptional items such as significant uranium sales volumes and non-recurring foreign contracts, revenue in the first quarter of the year fell sharply, as Areva had anticipated. A strong seasonal effect will materialize in 2014, with greater activity to be expected in the second half of the year. As indicated when releasing 2013 annual results, the current economic environment is still unfavorable, with market prices deteriorating in the front end of the cycle and lackluster demand from customers for installed base services. AREVA's operations generated consolidated revenue of 1.781 billion euros in the first quarter of 2014, a decrease of 18.1% (-17.3 % like for like) compared with the same period in 2013. The Front End Business Group (BG) reported strong growth of +59.0% (+59.8% like for like). Revenue was down in the Mining, Reactors and Services, Back End and Renewable Energies BGs, at -63.0% (-62.3% like for like), -14.1% (-12.5% like for like), -41.7% (-41.6% like for like) and -38.2% (-34.6% like for like) respectively. Foreign exchange had a negative impact of 18 million euros over the period, while the change in consolidation scope had a negative impact of 3 million euros. The group's backlog reached 40.2 billion euros at March 31, 2014, a decrease of 2.9% compared with December 31, 2013 and of 8.8% year on year

  4. RT-173: Helix, 2017 Helix Technical Report

    Science.gov (United States)

    2018-01-16

    and to coordinate across the problem domain and solution domain. Categories include: communication; listening and comprehension ; working in a...proficiency set as a useful and comprehensive model. The forces identified in Figure 1 – experiences, mentoring, education and training – are linked

  5. 10 CFR 205.173 - Public hearings.

    Science.gov (United States)

    2010-01-01

    ... proposed rule or regulation is likely to have a substantial impact on the Nation's economy or large numbers... hearing, together with the written comments submitted and other relevant information developed during the...

  6. 49 CFR 173.54 - Forbidden explosives.

    Science.gov (United States)

    2010-10-01

    ... dimension of which exceeds 23 mm (0.906 inch), or a toy torpedo containing a mixture of potassium chlorate... subpart. (b) An explosive mixture or device containing a chlorate and also containing: (1) An ammonium...

  7. 21 CFR 173.65 - Divinylbenzene copolymer.

    Science.gov (United States)

    2010-04-01

    ... weight-percent ethyl-vinyl-benzene, and no more than 4 weight-percent nonpolymerizable impurities. (b) In... Archives and Records Administration (NARA). For information on the availability of this material at NARA...

  8. 35_173 - 179_BIO 015 Akhilendra

    African Journals Online (AJOL)

    userpc

    population live in small and medium ci ... based development projects should focus ... nges of sustainability viz; lack of basic amenities and facilities, heal ... rds sustainable living environment of Damaturu town in Yobe Sta ... rojects should focus on major areas of water, electricity, housi .... Ministry of Lands and Housing.

  9. 21 CFR 173.300 - Chlorine dioxide.

    Science.gov (United States)

    2010-04-01

    ... sodium chlorite by electrolysis. (2) The generator effluent contains at least 90 percent (by weight) of... Health Association, 800 I St. NW., Washington, DC 20001-3750. You may inspect a copy at the Center for...

  10. 14 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... issuance of a Contracting Officer final decision. Contract disputes for purposes of ADR only may also... communication or the use of ADR. The Default Adjudicative Process is conducted by a DRO or Special Master... Office of Dispute Resolution for Acquisition. For a post-award protest, the awardee of the contract that...

  11. BDML Metadata: 173 [SSBD[Archive

    Lifescience Database Archive (English)

    Full Text Available NC-SA 0.180 af0395dc-f2a1-4e46-9a3b-28e282ab0526 0.105 x 0.105 x 0.5 (micrometer), 40 (second) http://ssbd.qbic.riken.jp/data.../source/Ce_KK_P002/RNAi_R10E4.4_061107_02.zip http://ssbd.qbic.riken.jp/data.../bdml/Ce_KK_P002/RNAi_R10E4.4_061107_02.bdml0.18.xml http://ssbd.qbic.riken.jp/data/pdpml/Ce_KK_...P002.pdpml0.06.xml http://ssbd.qbic.riken.jp/search/af0395dc-f2a1-4e46-9a3b-28e282ab0526/ http://ssbd.qbic.riken.jp/omero/webclient/?show=dataset-88 ...

  12. 21 CFR 173.340 - Defoaming agents.

    Science.gov (United States)

    2010-04-01

    ... cooking purposes, whereby no more than 10 parts per million is present in the cooked food. Formaldehyde As... alcohol Magnesium stearate As defined in § 172.863 of this chapter. Mineral oil: Conforming with § 172.878... chapter. Soybean oil fatty acids, hydroxylated Tallow, hydrogenated, oxidized or sulfated Tallow alcohol...

  13. 21 CFR 173.370 - Peroxyacids.

    Science.gov (United States)

    2010-04-01

    ... good manufacturing practice (unless precluded by the U.S. Department of Agriculture's standards of... the Division of Petition Review, Center for Food Safety and Applied Nutrition, Food and Drug... National Archives and Records Administration (NARA). For information on the availability of this material...

  14. Publications | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Building Capacity for Sustainable Responses to Climate Change in Cities of Portuguese-speaking Small Island Developing States (Cabo Verde and São Tomé e Príncipe) - Final Technical Report (restricted access). Small Island Developing States (SIDS) are highly vulnerable to climate change. In some locations coastal ...

  15. 50 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... part; Authentic native articles of handicrafts and clothing means items made by an Indian, Aleut, or... species, or a fire or other natural catastrophic event in areas prone to such events). Conservation plan... captive populations of the affected species: (a) Provision of health care, management of populations by...

  16. 49 CFR 173.158 - Nitric acid.

    Science.gov (United States)

    2010-10-01

    ... as identified by American Iron and Steel Institute type number, and, in addition, the letters “HT” following the steel designation on containers subject to stress relieving or heat treatment during... °F)), (B) Stabilized Type 347 in the as-welded condition, (C) Stabilized Type 347 stress-relieved...

  17. Search Results | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    As currently foreseen, neither the two-state nor the one-state solution offers much hope of resolving the Israeli-Palestinian conflict. Project ... The first phase of the project was funded after qualifying in a competition for projects featuring an ecosystem approach to human health in West Africa (100772). Project.

  18. 40 CFR 763.173 - Exemptions.

    Science.gov (United States)

    2010-07-01

    ... inadequate to allow the Agency to make a reasoned judgment on any of the information required in paragraph (d... the appropriate ban. This letter will be considered a final Agency action for purposes of judicial... notice will be considered a final Agency action for purposes of judicial review. (j) The length of an...

  19. 32 CFR 17.3 - Commission personnel.

    Science.gov (United States)

    2010-07-01

    ... with 32 CFR part 9, the Appointing Authority shall appoint at least three but no more than seven members and one or two alternate members. The Appointing Authority may remove members and alternate... Appointing Authority may replace the member, direct that an alternate member serve in the place of the...

  20. 47 CFR 87.173 - Frequencies.

    Science.gov (United States)

    2010-10-01

    ....000-117.975 MHz Q DGP Differential GPS. 108.050 MHz Q RLT 108.100-111.950 MHz Q RLL ILS Localizer. 108....600-121.925 MHz O, L, Q MA, FAC, MOU, RLT, GCO, RCO, RPC 25 kHz channel spacing. 121.950 MHz K FAS 121.... 122.700 MHz G, L MA, FAU, MOU Unicom at airports with no control tower; Aeronautical utility stations...

  1. 49 CFR 173.308 - Lighters.

    Science.gov (United States)

    2010-10-01

    ... word “sample” must appear on the shipping paper as part of the proper shipping name or in association... lighter design conforms to paragraph (a) of this section and passes or does not pass the required leakage... at least three years thereafter, a copy of each lighter's test report must be maintained by the...

  2. 33 CFR 173.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ...: (a) [Reserved] (b) Issuing authority means a State that has a numbering system approved by the Coast Guard or the Coast Guard where a number system has not been approved. Issuing authorities are listed in..., firm, partnership, corporation, company, association, joint-stock association, or governmental entity...

  3. 173 Résumé Abstract

    African Journals Online (AJOL)

    AKA BOKO

    1Laboratoire de Physique Appliquée de l'Université de Fianarantsoa - Madagascar. 2 Département de Sciences Exactes ... 3 Laboratoire de Mathématiques Et Physique des Systèmes-Groupes de Mécanique. Énergétique à .... Par définition, la vitesse de séchage est la variation par rapport au temps de l'humidité absolue ...

  4. 7 CFR 989.173 - Reports.

    Science.gov (United States)

    2010-01-01

    ... certified by an organic certification organization currently registered with the California Department of Food and Agriculture or such certifying organization accredited under the National Organic Program... shall provide copies of the organic certificate(s) applicable to the quantity of raisins reported as...

  5. 7 CFR 1.173 - Judges.

    Science.gov (United States)

    2010-01-01

    ... proceeding, (2) is related within the third degree by blood or marriage to any party to the proceeding, or (3... present. Any memorandum or other communication addressed to the Judicial Officer or a Judge, during the... prior to any hearing to be conducted by telephone or audio-visual telecommunication; (8) Require that...

  6. 49 CFR 173.29 - Empty packagings.

    Science.gov (United States)

    2010-10-01

    ... hazardous material shall be offered for transportation and transported in the same manner as when it.... (c) A non-bulk packaging containing only the residue of a hazardous material covered by Table 2 of... in Column 10a of the § 172.101 table for transportation by vessel, an empty drum or cylinder may be...

  7. 49 CFR 173.63 - Packaging exceptions.

    Science.gov (United States)

    2010-10-01

    ... transport personnel to remote work sites, such as offshore drilling units. (b) Cartridges, small arms, and... than 1 g explosive (excluding ignition and delay charges) that are electric blasting caps with leg wires 4 feet long or longer, delay connectors in plastic sheaths, or blasting caps with empty plastic...

  8. Publications | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Physico-chemical characteristics and fatty acid profile of desert date kernel oil in ... Learning for an uncertain future : vulnerabilities of agricultural production to ... trends in temperature, rainfall, sunshine, humidity and tidal water level in the ...

  9. 43 CFR 17.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... participate in the program as an employee but only to the extent set forth in paragraph (c) of this section... impairing accomplishment of the objectives of the program as respect individuals of a particular race, color..., financial aid, or other benefits provided under a program receiving Federal financial assistance shall be...

  10. 21 CFR 173.50 - Polyvinylpolypyrrolidone.

    Science.gov (United States)

    2010-04-01

    ... percent acetic acid, and 50 percent alcohol, no more than 50 parts per million of extractables is obtained with each solvent. (c) It is used or intended for use as a clarifying agent in beverages and vinegar...

  11. WESF (173)Cs gamma ray sources

    Science.gov (United States)

    Kenna, B. T.

    1984-10-01

    The Waste Encapsulation and Storage Facility (WESP) at Hanford, Washington has been separating cesium from stored liquid defense waste since 1945. This is done to alleviate the heat generated by the decay of radioactive Cs137. The cesium is converted to CsCl, doubly encapsulated in 316l stainless steel, and placed in storage. The potential utility of these Cs137 capsules as gamma radiation sources was demonstrated. Registration of the capsule with the NRC as a sealed gamma source would facilitate the licensing of non-DOE irradiation facilities using this source. To grant this registration, the NRC requires characteristics of the capsule. It must also be demonstrated that the capsule will maintain its integrity under both normal circumstances and specified abnormal conditions. The required information is provided through collation of results of studies and tests done previously by other laboratories.

  12. 21 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL CIVIL MONEY PENALTIES... giving rise to civil money penalty actions brought under 21 U.S.C. 333(g)(1): (1) Significant departure... has the same definition for civil money penalty actions that may be brought under that act. (e) Any...

  13. 21 CFR 173.165 - Candida lipolytica.

    Science.gov (United States)

    2010-04-01

    ... may be safely used as the organism for fermentation production of citric acid in accordance with the... intended for use as a pure culture in the fermentation process for the production of citric acid from... such as oil, grease, detergent residues, etc. Examine all glassware including stoppers and stopcocks...

  14. Separation of magnesium from magnesium chloride and zirconium and/or hafnium subchlorides in the production of zirconium and/or hafnium sponge metal

    International Nuclear Information System (INIS)

    Abodishish, H.A.M.; Adams, R.J.; Kearl, S.R.

    1992-01-01

    This patent describes the producing of a refractory metal wherein a sponge refractory metal is produced as an intermediate product by the use of magnesium with the incidental production of magnesium chloride, and wherein residual magnesium is separated from the magnesium chloride and from refractory metal to a vacuum distillation step which fractionally distills the magnesium, the magnesium chloride, and the metal sub-chlorides; the steps of: recovering fractionally distilled vapors of magnesium chloride and metal sub-chlorides from a sponge refractory metal; separately condensing the vapors as separately recovered; and recycling the separately recovered magnesium at a purity of at least about 96%

  15. Quantitative microanalysis of hafnium - zirconium system by X-ray fluorescence

    International Nuclear Information System (INIS)

    Majid, C.A.; Hussain, M.A.; Saeed, K.

    1986-01-01

    X-ray fluorescence technique has been used for the analysis of Hf in the presence of Zr by developing a method. In this method the spectral interference of Hf lines by Zr is eliminated completely and the Hf detection is accomplished using the most efficient Li line of its L-series. The principle of the method is based on the extinction properties of crystals for some orders of reflection. Ge(III) is used as the analyzing crystal. This method can be used accurately to detect Hf in any concentration of Zr at least from about 20 ppm to 100%. Also no information about the expected range of the analyte sample, is required in advance. (authors)

  16. X-Ray fluorescence of microquantities of hafnium in zirconium by precipitation as thin film

    International Nuclear Information System (INIS)

    Vigoda de Leyt, Dora; Caridi, A.F.; Deibe, Jorge

    1988-01-01

    The importance of Zr and Hf in the nuclear industry represents and increasing need for the development of reliable chemical methods to determine Hf traces in Zr matrix. A precipitation method in amoniacal medium was developed. A thin film is obtained where matrix effects are absent or minimized. Hf in the range of 5-70.10 -9 Kg in a 5.10 -6 Kg Zr matrix was studied. Fluorescence Hf Lα and Hf Lβ X-rays are excited by a W-anode tube 17 kV-25mA and 50kV-25mA. Radiation scattered by the tube was used as internal standard. Bartlett criterion was used for the regression analysis. Determination limit was fixed in 5±4. 10 -9 Kg Hf at a 95 % probability. (Author) [es

  17. Hafnium-tungsten chronometry of angrites and the earliest evolution of planetary objects

    DEFF Research Database (Denmark)

    Markowski, A.; Quitté, G.; Kleine, T.

    2007-01-01

    Angrites are amongst the oldest basalts in the solar system and their origins are enigmatic, some even proposing the planet Mercury as the parent body (APB). Whatever their exact provenance their chronometry provides insights into early stages of planetary melting and differentiation. We present...... various short-lived chronometers provides evidence that Al, Mn and Hf were homogeneously distributed in the solar nebula, although we cannot rule out the possibility of local small heterogeneities. Contrary to recent proposals, the data are also consistent with the previously determined age of the solar...... for such late melting and core formation are unclear. Quenched angrites are coeval with non-magmatic IAB iron meteorites and CB chondrules at ~ 4562 Ma. However, demonstration of a genetic link between angrite melting and impact events must await the acquisition of still higher resolution chronometry....

  18. Pressure-dependence of the phase transitions and thermal expansion in zirconium and hafnium pyrovanadate

    Energy Technology Data Exchange (ETDEWEB)

    Gallington, Leighanne C.; Hester, Brett R.; Kaplan, Benjamin S. [School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA 30332‐0400 (United States); Wilkinson, Angus P., E-mail: angus.wilkinson@chemistry.gatech.edu [School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA 30332‐0400 (United States); School of Materials Science and Engineering, Georgia Institute of Technology, Atlanta, GA 30332‐0245 (United States)

    2017-05-15

    Low or negative thermal expansion (NTE) has been previously observed in members of the ZrP{sub 2}O{sub 7} family at temperatures higher than their order-disorder phase transitions. The thermoelastic properties and phase behavior of the low temperature superstructure and high temperature negative thermal expansion phases of ZrV{sub 2}O{sub 7} and HfV{sub 2}O{sub 7} were explored via in situ variable temperature/pressure powder x-ray diffraction measurements. The phase transition temperatures of ZrV{sub 2}O{sub 7} and HfV{sub 2}O{sub 7} exhibited a very strong dependence on pressure (∼700 K GPa), with moderate compression suppressing the formation of their NTE phases below 513 K. Compression also reduced the magnitude of the coefficients of thermal expansion in both the positive and negative thermal expansion phases. Additionally, the high temperature NTE phase of ZrV{sub 2}O{sub 7} was found to be twice as stiff as the low temperature positive thermal expansion superstructure (24 and 12 GPa respectively). - Graphical abstract: The temperature at which ZrV{sub 2}O{sub 7} transforms to a phase displaying negative thermal expansion is strongly pressure dependent. The high temperature form of ZrV{sub 2}O{sub 7} is elastically stiffer than the low temperature form. - Highlights: • The order-disorder phase transition temperatures in ZrV{sub 2}O{sub 7} and HfV{sub 2}O{sub 7} are strongly pressure dependent (∼700 K.GPa). • The high temperature (disordered) phase of ZrV{sub 2}O{sub 7} is much stiffer than the ambient temperature (ordered) phase. • Compression reduces the magnitude of the negative thermal expansion in the high temperature phase of ZrV{sub 2}O{sub 7}.

  19. Interaction of chelate cyclopentadienyl compounds of zirconium and hafnium with bromine

    International Nuclear Information System (INIS)

    Brajnina, Eh.M.; Minacheva, M.Kh.

    1975-01-01

    Interaction of bromine with Zr and Hf dibenzoylmethane (DBM) compounds of following type: (DBM) 4 M, CpM(DBM) 3 and Cp 2 M(DBM) 2 leads to the formation of (DBM) 2 MBr 2 , (DBM) 3 MBr and CpZr(DBM) 2 Br in the rations which depend on the conditions of the reaction (Cp=C 5 H 5 )

  20. Investigation of Hafnium oxide/Copper resistive memory for advanced encryption applications

    Science.gov (United States)

    Briggs, Benjamin D.

    The Advanced Encryption Standard (AES) is a widely used encryption algorithm to protect data and communications in today's digital age. Modern AES CMOS implementations require large amounts of dedicated logic and must be tuned for either performance or power consumption. A high throughput, low power, and low die area AES implementation is required in the growing mobile sector. An emerging non-volatile memory device known as resistive memory (ReRAM) is a simple metal-insulator-metal capacitor device structure with the ability to switch between two stable resistance states. Currently, ReRAM is targeted as a non-volatile memory replacement technology to eventually replace flash. Its advantages over flash include ease of fabrication, speed, and lower power consumption. In addition to memory, ReRAM can also be used in advanced logic implementations given its purely resistive behavior. The combination of a new non-volatile memory element ReRAM along with high performance, low power CMOS opens new avenues for logic implementations. This dissertation will cover the design and process implementation of a ReRAM-CMOS hybrid circuit, built using IBM's 10LPe process, for the improvement of hardware AES implementations. Further the device characteristics of ReRAM, specifically the HfO2/Cu memory system, and mechanisms for operation are not fully correlated. Of particular interest to this work is the role of material properties such as the stoichiometry, crystallinity, and doping of the HfO2 layer and their effect on the switching characteristics of resistive memory. Material properties were varied by a combination of atomic layer deposition and reactive sputtering of the HfO2 layer. Several studies will be discussed on how the above mentioned material properties influence switching parameters, and change the underlying physics of device operation.

  1. Influence of the oxygen/argon ratio on the properties of sputtered hafnium oxide

    International Nuclear Information System (INIS)

    Pereira, L.; Barquinha, P.; Fortunato, E.; Martins, R.

    2005-01-01

    In this work we have focused our attention on the role of the gas mixture (O 2 /Ar) used during HfO 2 thin film processing by r.f. magnetron sputtering, to produce dielectrics with suitable characteristics to be used as gate dielectric. Increasing the O 2 /Ar ratio from 0 to 0.2, the films properties (optical gap, permittivity, resistivity and compactness) are improved. At these conditions, films with a band gap around 5 eV were produced, indicating a good stoichiometry. Also the flat band voltage has a reduction of almost three times indicating also a reduction of the same order on the fixed charge density at the semiconductor-insulator interface. The dielectric constant is around 16 which is very good, since the surface of the silicon where the HfO 2 films were deposited contains a SiO 2 layer of about 3 nm that gives an effective dielectric constant above 20, close to the HfO 2 stoichiometric value (∼25). Further increase on the O 2 /Ar ratio does not produce significant improvements

  2. Structure and Optical Properties of Nanocrystalline Hafnium Oxide Thin Films (PostPrint)

    Science.gov (United States)

    2014-09-01

    sputter-deposition. A large band gap coupled with low absorption provide optical transparency over a broad range in the electromagnetic spectrum; HfO2...k) in the middle of the visible spec- trum, and C influences n(k) to a greater extent in shorter wave - lengths [31]. Note that this principle behind...Approved for publicnanocrystalline HfO2 films crystallize in monoclinic structure. Fur - thermore, increasing Ts results in improved structural order and

  3. The Juvenile Hafnium Isotope Signal as a Record of Supercontinent Cycles

    Science.gov (United States)

    Gardiner, Nicholas J.; Kirkland, Christopher L.; van Kranendonk, Martin J.

    2016-12-01

    Hf isotope ratios measured in igneous zircon are controlled by magmatic source, which may be linked to tectonic setting. Over the 200-500 Myr periodicity of the supercontinent cycle - the principal geological phenomenon controlling prevailing global tectonic style - juvenile Hf signals, i.e. most radiogenic, are typically measured in zircon from granites formed in arc settings (crustal growth), and evolved zircon Hf signals in granites formed in continent-collision settings (crustal reworking). Interrogations of Hf datasets for excursions related to Earth events commonly use the median value, however this may be equivocal due to magma mixing. The most juvenile part of the Hf signal is less influenced by crustal in-mixing, and arguably a more sensitive archive of Earth’s geodynamic state. We analyze the global Hf dataset for this juvenile signal, statistically correlating supercontinent amalgamation intervals with evolved Hf episodes, and breakup leading to re-assembly with juvenile Hf episodes. The juvenile Hf signal is more sensitive to Pangaea and Rodinia assembly, its amplitude increasing with successive cycles to a maximum with Gondwana assembly which may reflect enhanced subduction-erosion. We demonstrate that the juvenile Hf signal carries important information on prevailing global magmatic style, and thus tectonic processes.

  4. As-cast structure refinement of Ti-46Al alloy by hafnium and boron additions

    Directory of Open Access Journals (Sweden)

    Zhang Li

    2009-05-01

    Full Text Available The infl uence of Hf and B on the solidifi cation structure of cast Ti-46Al alloys was investigated. The results show that the coupling effect of Hf and B changes the solidifi cation structure morphology and strongly refi nes the grain size. When the Hf+B contents were increased from 0 + 0.0 to 3 + 0.2, 5 + 0.6 and 7 + 1.0 (in at. %, the solidification structure morphology changed from coarse columnar dendrite to fine columnar dendrite, then to equiaxed dendrite, and further to fi ne near granular grain whilst the average grain size decreased to 20 μm. It is concluded that the columnar dendrite refinement is due to the effect of Hf and B on the decrease of Al diffusion coeffi cient in the melt. The fi ne near granular grain formation is attributed to the combined constitutional supercooling formed by Al and B segregation that is strengthened by Hf and B additions at the solid/liquid interface during solidifi cation, and the TiB2 precipitates acting as heterogeneous nuclei

  5. Metal-Element Compounds of Titanium, Zirconium, and Hafnium as Pyrotechnic Fuels

    Science.gov (United States)

    2015-05-04

    59 Ti3O5 (s, 59.9), K (g, 19.9), N2 (g, 8.2), H2O (g, 5.2), KOH (g, 4.0) TiB2 2868 26 / 74 TiO2 (l, 16.3), Ti2O3 (l, 8.7), KBO2 (g, 56.0), N2 (g...Borate Glasses – Structural Studies with NMR and Raman Spectroscopies. J. Phys. Chem. 100, 16720-16728. 9. Massis, T. M. (1996) New Explosive

  6. Characterization of the superconducting state in hafnium hydride under high pressure

    Science.gov (United States)

    Duda, A. M.; Szewczyk, K. A.; Jarosik, M. W.; Szcześniak, K. M.; Sowińska, M. A.; Szcześniak, D.

    2018-05-01

    The hydrogen-rich compounds at high pressure may exhibit notably high superconducting transition temperatures. In the paper, we have calculated the basic thermodynamic parameters of the superconducting state in two selected phases of HfH2 hydride under high-pressure respectively at 180 GPa for Cmma and 260 GPa for P21 / m . Calculations has been conducted in the framework of the Eliashberg formalism. In particular, we have determined the values of the critical temperature (TC) to be equal to 8 K and 13 K for the Cmma and P21 / m phases, respectively. Moreover, we have estimated other thermodynamic properties such as the order parameter (Δ (T)) , the thermodynamic critical field (HC (T)) , and the specific heat for the normal (CN) and superconducting (CS) state. Finally, we have shown that the characteristic ratios: RΔ = 2 Δ (0) /kBTC and RC = ΔC (TC) /CN (TC) , which are related to the above thermodynamic functions, slightly differ from the predictions of the Bardeen-Cooper-Schrieffer theory due to the strong-coupling and retardation effects.

  7. Structure and property evaluation of a vacuum plasma sprayed nanostructured tungsten-hafnium carbide bulk composite

    International Nuclear Information System (INIS)

    Rea, K.E.; Viswanathan, V.; Kruize, A.; Hosson, J.Th.M. de; O'Dell, S.; McKechnie, T.; Rajagopalan, S.; Vaidyanathan, R.; Seal, S.

    2008-01-01

    Vacuum plasma spray (VPS) forming of tungsten-based metal matrix nanocomposites (MMCs) has shown to be a cost effective and time saving method for the formation of bulk monolithic nanostructured thermo-mechanical components. Spray drying of powder feedstock appears to have a significant effect on the improved mechanical properties of the bulk nanocomposite. The reported elastic modulus of the nanocomposite nearly doubles due to the presence of HfC nano particulates in the W matrix. High resolution transmission electron microscopy (HRTEM) revealed the retention of nanostructures at the select process conditions and is correlated with the enhanced mechanical properties of the nanocomposite

  8. Spectroscopic and structural investigation of undoped and Er{sup 3+} doped hafnium silicate layers

    Energy Technology Data Exchange (ETDEWEB)

    Khomenkova, L., E-mail: khomen@ukr.net [CIMAP CEA/CNRS/ENSICAEN/UCBN, 6 Blvd. Maréchal Juin, 14050 Caen Cedex 4 (France); V. Lashkaryov Institute of Semiconductor Physics at NASU, 41 Pr. Nauky, Kyiv 03028 (Ukraine); An, Y.-T. [CIMAP CEA/CNRS/ENSICAEN/UCBN, 6 Blvd. Maréchal Juin, 14050 Caen Cedex 4 (France); Khomenkov, D. [Taras Shevchenko National University of Kyiv, Faculty of Physics, 4 Pr. Hlushkov, Kyiv 03022 (Ukraine); Portier, X.; Labbé, C.; Gourbilleau, F. [CIMAP CEA/CNRS/ENSICAEN/UCBN, 6 Blvd. Maréchal Juin, 14050 Caen Cedex 4 (France)

    2014-11-15

    This paper demonstrates the functionality of radio-frequency magnetron sputtering for the fabrication of undoped and Er-doped Si-rich-HfO{sub 2} films with specific structural and spectroscopic properties. The effect of post-deposition treatment on film properties was investigated by means of Fourier-transform infrared spectroscopy, Raman scattering and photoluminescence methods, as well as Transmission Electron microscopy. It was observed that annealing treatment at 850–1000 °C causes phase separation process and the formation of HfO{sub 2}, SiO{sub 2} and pure Si phases. This process stimulates also an intense light emission in the 700–950-nm spectral range under broad band excitation. The phase separation mechanism as well as the nature of radiative transitions were discussed. Photoluminescence was ascribed to carrier recombination in silicon clusters and host defects. The appearance of silicon clusters was also confirmed by the comparison of luminescent properties of pure HfO{sub 2}, SiO{sub 2}, Si-rich-HfO{sub 2} and Si-rich-SiO{sub 2} films. Additional argument for Si clusters’ formation was obtained under investigation of Er-doped Si-rich HfO{sub 2} films. These latter demonstrated 1.54-µm Er{sup 3+} luminescence under non-resonant excitation originating from an energy transfer from Si clusters towards Er{sup 3+} ions.

  9. Electric field and temperature scaling of polarization reversal in silicon doped hafnium oxide ferroelectric thin films

    International Nuclear Information System (INIS)

    Zhou, Dayu; Guan, Yan; Vopson, Melvin M.; Xu, Jin; Liang, Hailong; Cao, Fei; Dong, Xianlin; Mueller, Johannes; Schenk, Tony; Schroeder, Uwe

    2015-01-01

    HfO 2 -based binary lead-free ferroelectrics show promising properties for non-volatile memory applications, providing that their polarization reversal behavior is fully understood. In this work, temperature-dependent polarization hysteresis measured over a wide applied field range has been investigated for Si-doped HfO 2 ferroelectric thin films. Our study indicates that in the low and medium electric field regimes (E < twofold coercive field, 2E c ), the reversal process is dominated by the thermal activation on domain wall motion and domain nucleation; while in the high-field regime (E > 2E c ), a non-equilibrium nucleation-limited-switching mechanism dominates the reversal process. The optimum field for ferroelectric random access memory (FeRAM) applications was determined to be around 2.0 MV/cm, which translates into a 2.0 V potential applied across the 10 nm thick films

  10. The Rayleigh law in silicon doped hafnium oxide ferroelectric thin films

    International Nuclear Information System (INIS)

    Guan, Yan; Liu, Xiaohua; Zhou, Dayu; Xu, Jin; Cao, Fei; Dong, Xianlin; Mueller, Johannes; Schenk, Tony; Schroeder, Uwe

    2015-01-01

    A wealth of studies have confirmed that the low-field hysteresis behaviour of ferroelectric bulk ceramics and thin films can be described using Rayleigh relations, and irreversible domain wall motion across the array of pining defects has been commonly accepted as the underlying micro-mechanism. Recently, HfO 2 thin films incorporated with various dopants were reported to show pronounced ferroelectricity, however, their microscopic domain structure remains unclear till now. In this work, the effects of the applied electric field amplitude, frequency and temperature on the sub-coercive polarization reversal properties were investigated for 10 nm thick Si-doped HfO 2 thin films. The applicability of the Rayleigh law to ultra-thin ferroelectric films was first confirmed, indicating the existence of a multi-domain structure. Since the grain size is about 20-30 nm, a direct observation of domain walls within the grains is rather challenging and this indirect method is a feasible approach to resolve the domain structure. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Structure and property evaluation of a vacuum plasma sprayed nanostructured tungsten-hafnium carbide bulk composite

    NARCIS (Netherlands)

    Rea, K. E.; Viswanathan, V.; Kruize, A.; De Hosson, J. Th. M.; O'Dell, S.; McKechnie, T.; Rajagopalan, S.; Vaidyanathan, R.; Seal, S.; O’Dell, S.

    2008-01-01

    Vacuum plasma spray (VPS) forming of tungsten-based metal matrix nanocomposites (MMCs) has shown to be a cost effective and time saving method for the formation of bulk monolithic nanostructured then no-mechanical components. Spray drying of powder feedstock appears to have a significant effect on

  12. Radiation Effects on the Electrical Properties of Hafnium Oxide Based MOS Capacitors

    Science.gov (United States)

    2011-03-01

    evaporator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21 12. Copper crucible . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21...picture shows the chamber, controls, and pumps. Figure 12. A copper crucible held a cylindrical pellet of the contact metal. An electron beam evaporated

  13. The Rayleigh law in silicon doped hafnium oxide ferroelectric thin films

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Yan; Liu, Xiaohua [Key Laboratory of Materials Modification by Laser, Ion, and Electron Beams (Ministry of Education), School of Materials Science and Engineering, Dalian University of Technology, Dalian (China); Zhou, Dayu [Key Laboratory of Materials Modification by Laser, Ion, and Electron Beams (Ministry of Education), School of Materials Science and Engineering, Dalian University of Technology, Dalian (China); State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu (China); Xu, Jin [Department of Electronic Engineering, Dalian Neusoft University of Information, Dalian (China); Cao, Fei; Dong, Xianlin [Key Laboratory of Inorganic Functional Materials and Devices, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai (China); Mueller, Johannes [Fraunhofer IPMS-CNT, Dresden (Germany); Schenk, Tony; Schroeder, Uwe [NaMLab gGmbH/TU Dresden (Germany)

    2015-10-15

    A wealth of studies have confirmed that the low-field hysteresis behaviour of ferroelectric bulk ceramics and thin films can be described using Rayleigh relations, and irreversible domain wall motion across the array of pining defects has been commonly accepted as the underlying micro-mechanism. Recently, HfO{sub 2} thin films incorporated with various dopants were reported to show pronounced ferroelectricity, however, their microscopic domain structure remains unclear till now. In this work, the effects of the applied electric field amplitude, frequency and temperature on the sub-coercive polarization reversal properties were investigated for 10 nm thick Si-doped HfO{sub 2} thin films. The applicability of the Rayleigh law to ultra-thin ferroelectric films was first confirmed, indicating the existence of a multi-domain structure. Since the grain size is about 20-30 nm, a direct observation of domain walls within the grains is rather challenging and this indirect method is a feasible approach to resolve the domain structure. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Corrosion of Fe-25 Cr Alloy with microconstituent additions of hafnium and platinum

    International Nuclear Information System (INIS)

    Srinivasan, V.

    1989-01-01

    The study reported was performed with a view to understanding the effects of minor additions of Hf and Pt on the corrosion behavior of a model chromia former, Fe-25Cr. Bulk addition of Hf or Pt was made at 1 wt.% level to the base alloy, Fe-25 Cr, and the experimental alloys were made by an ingot metallurgy route. Coupons were machined from the as-cast rods or forged prismatic bars, and metallographically polished to 1 μ alumina. Multiple samples were exposed to an H 2 /H 2 S/H 2 O/Ar gas mixture at 700 degrees C for times up to 192 hrs. Planar and cross-sections of scales formed on the substrate alloys were examined using a scanning electron microscope with an energy dispersive x-ray spectrometer (SEM/EDAX). A uniform chromia scale formed initially. This scale was broken down locally and slowly by the overgrowth of sulfide rich nodules. The effects of minor additions of Hf or Pt on the growth and breakdown of protective chromia scales are discussed in this paper

  15. High temperature strengthening mechanism of hafnium carbide in a tungsten-rhenium matrix

    International Nuclear Information System (INIS)

    Luo, A.; Shin, K.S.; Jacobson, D.L.

    1991-01-01

    The interrelationship between the testing temperature and HfC strength increment of an arc-melted W-3.6Re-0.4HfC was determined from 1950 K to 2980 K in a vacuum of better than 1.3x10 -5 Pa (10 -7 torr). The present research was focused on the characteristic temperature at which the rapid coarsening of HfC particles occurred and the effect of the second-phase particle size on the high temperature strength properties of this material. It was found that the HfC particle strengthening was effective in a W-Re matrix up to a characteristic temperature of 2450 K in the short-term tensile test. Carbon was found to be the rate-limiting solute in the HfC particle growth. The strength of HfC strengthened alloy at temperature above 0.5 T m is proportional to the square root of particle volume fraction. The yield strengths of W-3.6Re-0.26HfC calculated based on the particle statistical distribution had good agreement with the experimental values from 1950 K to 2980 K. Besides, an addition of 0.26 percent HfC in tungsten resulted in about 28 percent increase in the activation energy of plastic deformation at high temperatures

  16. Precise simultaneous determination of zirconium and hafnium in silicate rocks, meteorites and lunar samples. [Neutron reactions

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, P A; Garg, A N; Ehmann, W D [Kentucky Univ., Lexington (USA). Dept. of Chemistry

    1977-01-01

    A precise, sensitive and rapid analytical technique has been developed for the simultaneous determination of Zr and Hf in natural silicate matrices. The technique is based on radiochemical neutron activation analysis and employs a rapid fusion dissolution of the sample and simultaneous precipitation of the Zr-Hf pair with p-hydroxybenzene arsenic acid in an acidic medium. The indicator radionuclides, /sup 95/Zr and /sup 181/Hf, are counted and the /sup 95/Zr activity is corrected for the contribution from U fission. The chemical yields of the radiochemical separation are based on Hf carrier. The yield is determined by reactivation of the processed samples and standards with a /sup 252/Cf isotopic neutron source and by counting the 18.6 sec half-life sup(179m)Hf. The RNAA procedure for Zr and Hf has been shown to be precise and accurate for natural silicate samples, based on replicate analyses of samples containing Zr in the range of 1 ..mu..g/g to over 600 ..mu..g/g. The procedure is relatively rapid with a total chemical processing time of approximately 3 hours. At least 4 samples are processed simultaneously. Ten additional elements (Fe, Cr, Co, Sc, Eu, La, Lu, Ce, Th and Tb) can be determined by direct Ge(Li) spectrometry (INAA) on the samples prior to dissolution for the RNAA determination of Zr and Hf. Corrections for the U fission contribution can be made on the basis of the known U content or from the INAA Th content, based on the relatively constant natural Th/U ratio.

  17. CONVERSION OF D-XYLOSE INTO FURFURAL WITH ALUMINUM AND HAFNIUM PILLARED CLAYS AS CATALYST

    Directory of Open Access Journals (Sweden)

    WILLIAM CORTÉS

    2013-01-01

    Full Text Available El proceso industrial utilizado para la producción de furfural es la deshidratación de pentosas, la cual se lleva a cabo por medio de ácidos minerales, altamente corrosivos y contaminantes como catalizadores. Debido a los efectos ecológicos y toxicológicos asociados a este proceso, y a la dificultad en la separación del producto, el desarrollo de nuevos catalizadores sólidos ácidos ha tenido una significativa expansión en los últimos años. El presente trabajo de investigación se enfocó en la producción de furfural a partir de D-xilosa empleando como catalizadores sólidos ácidos, arcillas pilarizadas con aluminio y hafnio. Después de 4 h de reacción a temperaturas entre 140 y 170 °C, los resultados evidenciaron una conversión entre el 50 y el 80%, mientras que los niveles de selectividad alcanzados estuvieron entre el 40 y el 65%. Finalmente, la estabilidad de los catalizadores fue evaluada por medio de un tratamiento térmico, antes de usarlo de nuevo. En cuatro reacciones consecutivas no fue observada una disminución significativa en la selectividad. En conclusión, las arcillas pilarizadas evidencian ser catalizadores activos, selectivos y estables para la deshidratación de pentosas.

  18. Early history of Earth's crust-mantle system inferred from hafnium isotopes in chondrites

    DEFF Research Database (Denmark)

    Bizzarro, Martin; Haack, Henning; Rosing, M.

    2003-01-01

    for the chondrite-forming event. This ¿176 value indicates that Earth's oldest minerals were derived from melts of a mantle source with a time-integrated history of depletion rather than enrichment. The depletion event must have occurred no later than 320 Myr after planetary accretion, consistent with timing......The Lu to Hf decay series has been widely used to understand the nature of Earth's early crust-mantle system. The interpretation, however, of Lu-Hf isotope data requires accurate knowledge of the radioactive decay constant of Lu (¿176), as well as bulk-Earth reference parameters. A recent...

  19. Cavitation resistance of 45 and 2H13 steels laser enriched with silicon carbides and hafnium

    International Nuclear Information System (INIS)

    Skodo, M.; Giren, B.; Cenian, A.

    1999-01-01

    Cavitation resistance of 45 and H13 steels with surface layers enriched with Hf and SiC compounds was investigated. All contamination elements were spread over the samples surfaces and subsequently alloyed with core material by CO 2 laser beam. Cavitation tests carried out at the rotating disk facility revealed multiple - 5 to 10 times - increase of erosion resistance of the processed materials during the incubation period of the destruction. This effect was found not to be decisively linked to obtained microhardness changes. (author)

  20. Excess hafnium-176 in meteorites and the early Earth zircon record

    DEFF Research Database (Denmark)

    Bizzarro, Martin; Connelly, James; Thrane, Kristine

    2012-01-01

    The long-lived Lu-to- Hf decay system is a powerful tool to understand ancient chemical fractionation events associated with planetary differentiation. Detrital Hadean zircons (>3.8 Gyr) from the Jack Hills metasedimentary belt of Western Australia record extremely enriched Hf-isotope signals sug...... crust prior to ~4.4 Gyr. This new view suggests continuous juvenile crustal growth and recycling throughout the Hadean and Archean eras, perhaps analogous to modern plate tectonics....

  1. Iron modified titanium–hafnium binary oxides as catalysts in total oxidation of ethyl acetate

    Czech Academy of Sciences Publication Activity Database

    Tsoncheva, T.; Ivanova, R.; Henych, Jiří; Velinov, N.; Kormunda, M.; Dimitrov, M.; Paneva, D.; Slušná, Michaela; Mitov, I.; Štengl, Václav

    2016-01-01

    Roč. 81, JUN (2016), s. 14-19 ISSN 1566-7367 R&D Projects: GA MŠk LM2015073 Institutional support: RVO:61388980 Keywords : Titania–hafnia binary oxide s * Iron modifications * Support effect * Ethyl acetate oxydation Subject RIV: CA - Inorganic Chemistry Impact factor: 3.330, year: 2016

  2. Creep and Oxidation of Hafnium Diboride Based Ultra High Temperature Ceramics at 1500C

    Science.gov (United States)

    2015-12-01

    word ceramic comes from the Greek word keramos, meaning pottery, but now refers to many classes of materials, including clays , abrasives......these situations, the viscosity of the grain boundary becomes an important factor for the creep rate. 25 When grain elongation accompanies grain

  3. Plasma arc cutting: Microstructural modifications of hafnium cathodes during first cycles

    Energy Technology Data Exchange (ETDEWEB)

    Rotundo, F., E-mail: fabio.rotundo@unibo.it [Dept. of Mechanical Engineering (DIEM), Alma Mater Studiorum, Universita di Bologna, Via Saragozza 8, 40123 Bologna (Italy); Martini, C.; Chiavari, C.; Ceschini, L. [Dept. of Metals Science, Electrochemistry and Chemical Techniques (SMETEC), Alma Mater Studiorum, Universita di Bologna, Viale Risorgimento 4, 40136 Bologna (Italy); Concetti, A.; Ghedini, E.; Colombo, V. [Dept. of Mechanical Engineering (DIEM), Alma Mater Studiorum, Universita di Bologna, Via Saragozza 8, 40123 Bologna (Italy); Dallavalle, S. [Cebora S.p.A., Via Andrea Costa 24, 40057 Cadriano di Granarolo (Italy)

    2012-06-15

    In the present work, the microstructural modifications of the Hf insert in plasma arc cutting (PAC) electrodes operating at 250 A were experimentally investigated during first cycles, in order to understand those phenomena occurring on and under the Hf emissive surface and involved in the electrode erosion process. Standard electrodes were subjected to an increasing number of cutting cycles (CCs) on mild steel plates in realistic operative conditions, with oxygen/air as plasma/shield gas. Microstructural analysis was performed for each electrode at different erosion stages by means of scanning electron microscopy (SEM) equipped with energy dispersive spectroscopy (EDS) and Raman spectroscopy. Electrodes cross sections were also observed by means of optical microscopy (both in bright field and in reflected polarised light) after chemical etching. In the insert, three typical zones were found after cutting: monoclinic HfO{sub 2} layer; thermally-modified transition zone with O{sub 2}-Hf solid solution; unmodified Hf. The erosion cavity and the oxide layer thickness increase with the number of cutting cycles. Macrocracking was observed in the oxide layer, while microcracking and grain growth were detected in the remelted Hf. Moreover, detachment was found at the Hf/Cu interface. Based on thermodynamics and kinetics of the Hf high temperature oxidation, conclusions can be drawn on the erosion mechanism involved. - Highlights: Black-Right-Pointing-Pointer Hf microstructural modifications in cathodes after plasma arc cutting cycles investigated. Black-Right-Pointing-Pointer 3 zones identified after cutting: HfO{sub 2} layer; remelted zone with O{sub 2}-Hf solid solution; unmodified Hf. Black-Right-Pointing-Pointer Hf-based ejections both in arc-on and arc-off phases; erosion cavity deepens with cutting cycles. Black-Right-Pointing-Pointer Detachment at the Hf/Cu interfaces, worsening heat dissipation and oxidation/erosion phenomena. Black-Right-Pointing-Pointer The use of a different current ramp at subsequent erosion stages is suggested.

  4. Population of Metastable States in Stable Hafnium and Ytterbium Nuclei via Beam Break-up

    International Nuclear Information System (INIS)

    Malwela, T.; Ntshangase, S.S.; Shirinda, O.; Bark, R.A.; Gueorguieva, E.; Lawrie, J.J.; Mullins, S.M.; Murray, S.H.T.; Sharpey-Schafer, J.F.; Gal, J.; Kalinka, G.; Krasznahorkay, A.; Molnar, J.; Nyako, B.M.; Timar, J.; Zolnai, L.; Hlatshwayo, T.; Juhasz, K.; Komati, F.S.; Scheurer, J.N.

    2005-01-01

    The ''Chessboard'' section of the DIAMANT charged-particle array has been coupled with the AFRODITE γ-ray spectrometer at the iThemba Laboratory for Accelerator Based Sciences. Charged-particle-γ-ray coincidence data were recorded during the bombardment of a 176Yb target with a 13C beam at an energy of 90 MeV. The purpose of the investigation was to study the population of metastable states in hafium nuclei via incomplete fusion reactions in which the beam breaks up due to its α-cluster character. Of note was the observation of the band based on the Kπ = 16+, T1/2 = 31 year isomer in 178Hf to its 19+ member. Also, decays from the high-K isomeric states in 174Yb and 176Yb. which were populated via 3αxn channels, indicative of complete break-up of the 13C beam

  5. An alkali-metal ion extracted layered compound as a template for a metastable phase synthesis in a low-temperature solid-state reaction: preparation of brookite from K0.8Ti1.73Li0.27O4.

    Science.gov (United States)

    Ozawa, Tadashi C; Sasaki, Takayoshi

    2010-03-15

    We have designed a new approach to synthesize brookite, i.e., to extract alkali-metal ions from K(0.8)Ti(1.73)Li(0.27)O(4) (KTLO) and to apply simultaneous heat treatment to the remaining lepidocrocite-type layers of TiO(6) octahedra. For the alkali-metal ion extraction and the simultaneous heat treatment, KTLO was heated at 400 degrees C with polytetrafluoroethylene (PTFE) in flowing Ar. PTFE has been found to be an effective agent to extract strongly electropositive alkali-metal ions from KTLO because of the strong electronegativity of F as its component. The product of this reaction consists of a mixture of brookite, K(2)CO(3), LiF, and PTFE derivatives, indicating the complete extraction of K(+) and Li(+) from KTLO and formation of brookite from the lepidocrocite-type layer of TiO(6) octahedra as a template. This brookite has a partial replacement of O(2-) with F(-) and/or slight oxygen deficiency; thus, its color is light-bluish gray. Fully oxidized brookite formation and complete decomposition of PTFE derivatives have been achieved by further heating in flowing air, and coproduced alkali-metal salts have been removed by washing in water. Powder X-ray diffraction, Raman spectroscopy, and chemical analysis results have confirmed that the final brookite product treated at 600 degrees C is single phase, and it is white. The method to extract alkali-metal ions from a crystalline material using PTFE is drastically different from the common methods such as soft-chemical and electrochemical reactions. It is likely that this new synthetic approach is applicable to other layered systems to prepare a diverse family of compounds, including novel metastable ones.

  6. 49 CFR 173.59 - Description of terms for explosives.

    Science.gov (United States)

    2010-10-01

    ...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1... insensitive detonating substances and which demonstrate a negligible probability of accidental initiation or... processes. Charges, propelling. Articles consisting of propellant charge in any physical form, with or...

  7. 24 CFR 17.3 - Administrative claim; who may file.

    Science.gov (United States)

    2010-04-01

    ... representative. (c) A claim based on death may be presented by the executor or administrator of the decedent's... evidence of his authority to present a claim on behalf of the claimant as agent, executor, administrator...

  8. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

  9. 49 CFR 173.21 - Forbidden materials and packages.

    Science.gov (United States)

    2010-10-01

    ... stabilized or inhibited in a manner to preclude such evolution. The SADT may be determined by any of the test... generate a dangerous evolution of heat, unless packaged in a manner which precludes such an occurrence. (d... container, or overpack with another material, the mixing of which is likely to cause a dangerous evolution...

  10. What we do | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC supports research in developing countries to create real and lasting change. ... Community Based Governance of Wetlands in the Sand River Catchment Area (South Africa) ... Sri Lanka, Central Asia, Far East Asia, South Asia. PROJECT ...

  11. 21 CFR 173.350 - Combustion product gas.

    Science.gov (United States)

    2010-04-01

    .... Caution. The various parts of the absorption train must be connected by gas-tight tubing and joints... gas source is connected in series to the flow-rate device, the flow meter, and the absorption.... Maintain the coolant bath at 0 °C throughout. Remove the absorption vessel from the bath, disconnect, and...

  12. 49 CFR 173.181 - Pyrophoric materials (liquids).

    Science.gov (United States)

    2010-10-01

    ... inner receptacles of glass or metal, not over 1 L (0.3 gallon) capacity each, having positive screwcap... be closed by positive means, not by friction. (c) Steel drums (1A2) or fiber drums (1G) not exceeding... each, closed by positive means, not friction. (1) Inner packagings must have no opening exceeding 25 mm...

  13. 49 CFR 173.319 - Cryogenic liquids in tank cars.

    Science.gov (United States)

    2010-10-01

    ... Federal Railroad Administration may be made by e-mail to [email protected] or telephone call to (202....113A60W. (e) Special requirements for class DOT 113 tank cars—(1) A class DOT-113 tank car need not be... integrity test. When required by paragraph (e)(1) of this section, either of the following thermal integrity...

  14. 33 CFR 173.57 - Contents of report.

    Science.gov (United States)

    2010-07-01

    ... contributed to causing the casualty. (w) The make, model, type (open, cabin, house, or other), beam width at... outdrive, sail, or other), fuel (gas, diesel, or other), construction (wood, steel, aluminum, plastic...

  15. 21 CFR 173.325 - Acidified sodium chlorite solutions.

    Science.gov (United States)

    2010-04-01

    ... processing of red meat, red meat parts, and organs as a component of a spray or in the processing of red meat... rinse prior to consumption. (2) The additive is used as a single application in processing facilities as... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR...

  16. 173 original article glycated haemoglobin levels in patients

    African Journals Online (AJOL)

    boaz

    therapy, two patients had pre-diabetes with HbA1c values of 6.0% and 5.8% while the HbA1c values of the remaining patients were less than .... determined by the blood glucose levels in the .... treatment of MDR-TB on glycaemic homeostasis.

  17. 21 CFR 173.5 - Acrylate-acrylamide resins.

    Science.gov (United States)

    2010-04-01

    ... produced by the polymerization of acrylamide with partial hydrolysis, or by copolymerization of acrylamide... polyacrylate-acrylamide resin is produced by the polymerization and subsequent hydrolysis of acrylonitrile in a... or cane sugar juice and liquor or corn starch hydrolyzate in an amount not to exceed 5 parts per...

  18. 49 CFR 173.199 - Category B infectious substances.

    Science.gov (United States)

    2010-10-01

    ... this section; (ii) Anticoagulants used to stabilize blood or plasma; or (iii) Small quantities of Class... copy or electronic image of these instructions must be retained by the manufacturer and subsequent...

  19. 49 CFR 173.197 - Regulated medical waste.

    Science.gov (United States)

    2010-10-01

    ... requirements of § 178.801(j) and record retention requirements of § 178.801(l) of this subchapter. Inner... constructed of metal or fiberglass and have a capacity of at least 3.5 cubic meters (123.6 cubic feet) and not... welded or seamless construction and a rigid, weatherproof top to prevent the intrusion of water (e.g...

  20. 21 CFR 173.25 - Ion-exchange resins.

    Science.gov (United States)

    2010-04-01

    ..., distilled water and 10 percent ethanol, when, following washing and pretreatment of the resin in accordance... paragraph (a)(18) of this section is used to treat aqueous sugar solutions subject to the condition that the temperature of the sugar solution passing through the resin bed is maintained at 82 °C (179.6 °F) or less and...

  1. 21 CFR 173.310 - Boiler water additives.

    Science.gov (United States)

    2010-04-01

    ...-sodium acrylate resin Contains not more than 0.05 percent by weight of acrylamide monomer. Acrylic acid/2...-hydroxyethylidene-1,1-diphosphonic acid (CAS Reg. No. 2809-21-4) and its sodium and potassium salts Lignosulfonic.... Potassium carbonate Potassium tripolyphosphate Sodium acetate Sodium alginate Sodium aluminate Sodium...

  2. 21 CFR 173.20 - Ion-exchange membranes.

    Science.gov (United States)

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION... centimeters of the following solvents: Distilled water, 5 percent acetic acid, and 50 percent alcohol...

  3. 21 CFR 173.40 - Molecular sieve resins.

    Science.gov (United States)

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION... gram of dry resin (expressed in terms of water regain), and a particle size of 10 to 300 microns. (b...

  4. 173 Christian Missionaries and Civilization in Southern Nigeria ...

    African Journals Online (AJOL)

    NGOZI

    and Christianity into the interiors of West Africa during their civilizing mission in 1841” (p. 87). ... record that civilization in Nigeria started around the mission houses. .... the advent of the missionaries slavery was rampant among the people of ...

  5. 40 CFR 180.173 - Ethion; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ..., meat 0.2 10/1/08 Hog, meat byproducts 0.2 10/1/08 Horse, fat 0.2 10/1/08 Horse, meat 0.2 10/1/08 Horse...: Commodity Parts per million Expiration/Revocation Date Cattle, fat 0.2 10/1/08 Cattle, meat 0.2 10/1/08 Cattle, meat byproducts 0.2 10/1/08 Citrus, dried pulp 25.0 10/1/08 Fruit, citrus, group 10 5.0 10/1/08...

  6. Dicty_cDB: AFI173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available cDNA clone:pph30f12, 3' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehydration... sequence. 74 3e-09 1 CN206834 |CN206834.1 Tor7258 Gametophyte rehydration Librar

  7. 32 CFR 173.2 - Competitive Information Certification.

    Science.gov (United States)

    2010-07-01

    ... Procurement Task Force. (2) The requirement to provide the Certificate may be further limited to certain... Business Ethics and Integrity complying with the Interim rule in lieu of Competitive Information...

  8. What we do | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Learning Initiatives for Network Economies in Asia (LIRNEasia) : Building Capacity in ICT Policy. It is now generally accepted that affordable, effective telecommunication services play an integral role in development. Central Asia, Far East Asia, South Asia, Cambodia, Sri Lanka, Indonesia, Laos, Pakistan, Philippines.

  9. 49 CFR 173.62 - Specific packaging requirements for explosives.

    Science.gov (United States)

    2010-10-01

    ...:“Packaging approved by the competent authority of the United States of America (USA)”. PARTICULAR PACKING.... A jet perforating gun, charged, oil well may be transported under the following conditions: a... from every other kind, and from any gun, tool or other supplies, unless approved in accordance with...

  10. 34 CFR 403.173 - What expenses are allowable?

    Science.gov (United States)

    2010-07-01

    ... ADULT EDUCATION, DEPARTMENT OF EDUCATION STATE VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAM What... coordination between vocational education programs, business, and industry, including advisory council meetings...

  11. 49 CFR 173.4a - Excepted quantities.

    Science.gov (United States)

    2010-10-01

    ... onto a solid unyielding surface from a height of 1.8 m (5.9 feet): (i) Where the sample is in the shape... sample is in the shape of a drum, it must be dropped in each of the following orientations: (A) One drop...

  12. 1935 15' Quad #173 Aerial Photo Mosaic Index - NM

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Aerial Photo Reference Mosaics contain aerial photographs that are retrievable on a frame by frame basis. The inventory contains imagery from various sources that...

  13. 49 CFR 173.196 - Category A infectious substances.

    Science.gov (United States)

    2010-10-01

    ... temperatures and pressures of transport by aircraft to which they could be subjected if refrigeration were lost... pressure producing a pressure differential of not less than 95 kPa (0.95 bar, 14 psi). (7) The primary... well as the temperatures and pressures of transport by aircraft to which they could be subjected if...

  14. All projects related to | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: HEALTH POLICY, DISEASES, LABOUR SHORTAGE, Economic and social development, RESEARCH CAPACITY, RESEARCH FELLOWSHIPS, INSTITUTION BUILDING. Region: Mozambique, Brazil, South Africa. Program: ... Region: Indonesia, Malaysia, Philippines, Viet Nam. Program: Employment and Growth.

  15. 21 CFR 173.150 - Milk-clotting enzymes, microbial.

    Science.gov (United States)

    2010-04-01

    ...; family, Bacillaceae; genus, Bacillus; species, cereus (Frankland and Frankland). (3) Mucor pusillus Lindt...; genus, Mucor; species, pusillus; variety, Lindt. (4) Mucor miehei Cooney et Emerson classified as follows: Class, Phycomycetes; subclass, Zygomycetes; order, Mucorales; family, Mucoraceae; genus, Mucor...

  16. Dicty_cDB: VSF173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TT ATTTCAGGAAAAGCACTTGCATTTTCA sequence update 2001. 3.22 Translated Amino Acid sequence ---*tskkwdmilkql*vf...vasyflapvpkyim* k*r*ffk*krni*rywvifnrsiyxiwicnsxdfspfryyfrkstcif Frame B: ---*tskkwdmilkql*vflahlqlvyylif*hv

  17. 19 CFR 10.173 - Evidence of country of origin.

    Science.gov (United States)

    2010-04-01

    ... entry—(1) Merchandise not wholly the growth, product, or manufacture of a beneficiary developing country... growth, product, or manufacture of a single beneficiary developing country, the exporter of the... shown. Failure to submit the declaration in a timely fashion will result in a denial of duty-free...

  18. 24 CFR 248.173 - Resident homeownership program.

    Science.gov (United States)

    2010-04-01

    ..., consistent with paragraph (f) of this section; (x) How the marketing of currently vacant units and units... 50 percent of such proceeds shall be returned to the Commissioner for use under §§ 248.157 and 248... homeowner under the homeownership program approved under this section shall be paid to the HOME Investment...

  19. People’s Republic of China Scientific Abstracts, Number 173.

    Science.gov (United States)

    1977-08-03

    method, and the PCA reaction suppressing action of disodium chromoglycate and the sapo - ninum of Shao-nien-hung (Ardisia alyxiacfolia Tsiang.) The...element is its sapo - ninum, which is highly toxic, but the toxicity of its acetylated and hydrolytic product is much less. AUTHOR: CH’EN Ti-hua [7II5

  20. 49 CFR 173.50 - Class 1-Definitions.

    Science.gov (United States)

    2010-10-01

    .... (a) Explosive. For the purposes of this subchapter, an explosive means any substance or article... minor explosion hazard. The explosive effects are largely confined to the package and no projection of fragments of appreciable size or range is to be expected. An external fire must not cause virtually...