Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel
2017-01-13
The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.
Hong, Huachang; Xiong, Yujing; Ruan, Mengyong; Liao, Fanglei; Lin, Hongjun; Liang, Yan
2013-02-01
The formations of THMs, HAAs, and HNMs from chlorination and chloramination of water from Jinlan Reservoir were investigated in this study. Results showed that monochloramine rather than chlorine generally resulted in lower concentration of DBPs, and the DBPs formation varied greatly as the treatment conditions changed. Specifically, the yields of THMs, HAAs and HNMs all increased with the high bromide level and high disinfectant dose both during chlorination and chloramination. The longer reaction time had a positive effect on the formation of THMs, HAAs and HNMs during chlorination and HNMs during chloramination. However, no time effect was observed on the formation of THMs and HAAs during chloramination. An increase in pH enhanced the levels of THMs and HNMs upon chlorination but reduced levels of HNMs upon chloramination. As for the THMs in chloramination and HAAs in chlorination and chloramination, no obvious pH effect was observed. The elevated temperature significantly increased the yields of THMs during chlorination and HNMs during chloramination, but has no effect on THMs and HAAs yields during chloramination. In the same temperature range, the formation of HAAs and HNMs in chlorination showed a first increasing and then a decreasing trend. In chloramination study, addition of nitrite markedly increased the formation of HNMs but had little impact on the formation of THMs and HAAs. While in chlorination study, the presence of high nitrite levels significantly reduced the yields of THMs, HAAs and HNMs. Range analysis revealed that the bromide and disinfectant levels were the major factors affecting THMs, HAAs and HNMs formation, in both chlorination and chloramination. Finally, comparisons of the speciation of mono-halogenated, di-halogenated, tri-halogenated HAAs and HNMs between chlorination and monochloramination were also conducted, and factors influencing the speciation pattern were identified. Copyright © 2012 Elsevier B.V. All rights reserved.
De Haas-Van Alphen affect and helicons in metals
International Nuclear Information System (INIS)
Vol'skij, E.P.
1975-01-01
Specific features of helicon electrodynamics associated with the de Haas-van Alphen effect are considered for an uncompensated metal with the closed Fermi surface of arbitrary shape. The consideration is carried out entirely in the local limit, when the metal may be characterized by a static tensor for the magnetic resistance and by a static tensor for the differential magnetic permeability which describes the anisotropy of the de Haas-van Alphen effect. The amplitude of the effect is assumed to be of an arbitrary value, but in the limits determined by the thermodynamical stability of a uniformly magnetized state. It has been shown that in the general case the de Haas-van Alphen effect may strongly influence not only the phase velocity, but also the damping and polarization of a helicon. A significant effect of nondiagonal components of the differential magnetic permeability tensor that sometimes arise even at very small deviations of the magnetic field from the symmetric direction, is noted. The resonance excitation of waves in a plate is considered. The question of a possible relation between periodic diamagnetic structures in metals and helicons is discussed
Zhang, Hong; Andrews, Susan A
2012-05-15
This study investigated the effect of copper corrosion products, including Cu(II), Cu(2)O, CuO and Cu(2)(OH)(2)CO(3), on chlorine degradation, HAA formation, and HAA speciation under controlled experimental conditions. Chlorine decay and HAA formation were significantly enhanced in the presence of copper with the extent of copper catalysis being affected by the solution pH and the concentration of copper corrosion products. Accelerated chlorine decay and increased HAA formation were observed at pH 8.6 in the presence of 1.0 mg/L Cu(II) compared with that observed at pH 6.6 and pH 7.6. Further investigation of chlorine decay in the presence of both Suwannee River NOM and Cu(II) indicated that an increased reactivity of NOM with dissolved and/or solid surface-associated Cu(II), rather than chlorine auto-decomposition, was a primary reason for the observed rapid chlorine decay. Copper corrosion solids [Cu(2)O, CuO, Cu(2)(OH)(2)CO(3)] exhibited catalytic effects on both chlorine decay and HAA formation. Contrary to the results observed when in the absence of copper corrosion products, DCAA formation was consistently predominant over other HAA species in the presence of copper corrosion products, especially at neutral and high pH. This study improves the understanding for water utilities and households regarding chlorine residuals and HAA concentrations in distribution systems, in particular once the water reaches domestic plumbing where copper is widely used. Copyright © 2012 Elsevier Ltd. All rights reserved.
Comparison of the effect of Haas and Hyrax rapid palatal expanders on nasal cavity dimensions
Directory of Open Access Journals (Sweden)
Amini F.
2009-11-01
Full Text Available "nBackground and Aim: In treatment of posterior crossbite awareness of the effects of Haas and Hyrax rapid maxillary expanders (RME on nasal cavity will help the clinician to select the better appliance. This study was carried out to compare the effects of Haas and Hyrax expanders on the nasal cavity of patients treated for posterior crossbite. "nMaterials and Methods: A clinical trial study was designed on posteroanterior (PA cephalograms of 30 subjects to evaluate the nasal cavity width of 14 subjects (8 female & 6 male with mean chronological age of 12± 2years who received RME with Hyrax type and 16 subjects (9 female & 7 male with mean chronological age of 11±1.6 years who received Haas type palatal expander. Paired t-test was used to analyze the outcomes of expansion in each group. Student t-test was used to compare Haas and Hyrax groups. "nResults: The mean value of screw expansion was 9±2 mm in both groups. In Hyrax group nasal cavity width"n(Nc-cN increased from 29.2 ±1.94 mm to 31.7 ±1.93mm (p= 0.001 and In Haas group it was increased from 27.75± 2.21 mm to 29.35 ± 2.26 mm(p= 0.043. When two groups were compared to each other, statistically this increase was more significant in Hyrax than in the Haas group (p=0.038. "nConclusion: In this study RME affected geometry of the nasal cavity by increasing the nasal cavity width. However In our sample, Hyrax appliance demonstrated better performance over the Haas appliance in all variables.
Effects of operating conditions on THMs and HAAs formation during wastewater chlorination
Energy Technology Data Exchange (ETDEWEB)
Sun Yingxue; Wu Qianyuan [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Hu Hongying, E-mail: hyhu@tsinghua.edu.cn [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Tian Jie [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China)
2009-09-15
Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.
Effects of operating conditions on THMs and HAAs formation during wastewater chlorination
International Nuclear Information System (INIS)
Sun Yingxue; Wu Qianyuan; Hu Hongying; Tian Jie
2009-01-01
Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.
Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders
Directory of Open Access Journals (Sweden)
Matheus Melo Pithon
2012-06-01
Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.
Collins, Morgan E; Black, Joshua J; Liu, Zhengchang
2017-07-01
Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2 How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. Copyright © 2017 American
Galvano-magnetic properties and Shubnikov de Haas effect of Te-whiskers
International Nuclear Information System (INIS)
Berezovets, Veacheslav; Bondarchuk, Nikolai; Nikolaeva, Albina; Nijankovskii, Victor
2009-01-01
The work is devoted to investigation of the peculiarities of magnetoresistance, Hall effect and Shubnikov de Haas oscillations in Te-whiskers. Te-whiskers was prepared from vapor-gas phase on the substrate pure tellurium and grown naturally, of the walls of a crucible in the course of growing Te single crystals by the Czochralski method . The measurements of the galvanomagnetic properties and Shubnikov de Haas oscillation correspond to the notion of the occurrence of the effect of intraband magnetic breakdown when two different quasi-classical cyclotron trajectories coexist simultaneously in a magnetic field. This effect is a consequence of the presence of the saddle point in the dispersion law of the tellurium valence band. (authors)
2010-04-29
... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...
Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko
2015-03-01
The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
The measurement of the amplitude of de Haas-van Alphen oscillations in indium
International Nuclear Information System (INIS)
Wilde, J. de; Meredith, D.J.
1976-01-01
A flux-gate magnetometer incorporating a superconducting flux transformer is described and its application to the measurement of de Haas-van Alphen oscillation amplitude is compared with conventional techniques. Measurements on the third zone Fermi surface of indium in magnetic fields of up to 4 T are given to show the advantages of the method. (author)
Study on the TOC concentration in raw water and HAAs in Tehran's water treatment plant outlet.
Ghoochani, Mahboobeh; Rastkari, Noushin; Nabizadeh Nodehi, Ramin; Mahvi, Amir Hossein; Nasseri, Simin; Nazmara, Shahrokh
2013-11-12
A sampling has been undertaken to investigate the variation of haloacetic acids formation and nature organic matter through 81 samples were collected from three water treatment plant and three major rivers of Tehran Iran. Changes in the total organic matter (TOC), ultraviolet absorbance (UV254), specific ultraviolet absorbance (SUVA) were measured in raw water samples. Haloacetic acids concentrations were monitored using a new static headspace GC-ECD method without a manual pre-concentration in three water treatment plants. The average concentration of TOC and HAAs in three rivers and three water treatment plants in spring, summer and fall, were 4, 2.41 and 4.03 mg/L and 48.75, 43.79 and 51.07 μg/L respectively. Seasonal variation indicated that HAAs levels were much higher in spring and fall.
Cunha, Joana T; Costa, Carlos E; Ferraz, Luís; Romaní, Aloia; Johansson, Björn; Sá-Correia, Isabel; Domingues, Lucília
2018-04-02
Acetic acid tolerance and xylose consumption are desirable traits for yeast strains used in industrial biotechnological processes. In this work, overexpression of a weak acid stress transcriptional activator encoded by the gene HAA1 and a phosphoribosyl pyrophosphate synthetase encoded by PRS3 in a recombinant industrial Saccharomyces cerevisiae strain containing a xylose metabolic pathway was evaluated in the presence of acetic acid in xylose- or glucose-containing media. HAA1 or PRS3 overexpression resulted in superior yeast growth and higher sugar consumption capacities in the presence of 4 g/L acetic acid, and a positive synergistic effect resulted from the simultaneous overexpression of both genes. Overexpressing these genes also improved yeast adaptation to a non-detoxified hardwood hydrolysate with a high acetic acid content. Furthermore, the overexpression of HAA1 and/or PRS3 was found to increase the robustness of yeast cell wall when challenged with acetic acid stress, suggesting the involvement of the modulation of the cell wall integrity pathway. This study clearly shows HAA1 and/or, for the first time, PRS3 overexpression to play an important role in the improvement of industrial yeast tolerance towards acetic acid. The results expand the molecular toolbox and add to the current understanding of the mechanisms involved in higher acetic acid tolerance, paving the way for the further development of more efficient industrial processes.
Electrons in a Magnetic Field: Special Spin in de Haas-van Alphen effect
International Nuclear Information System (INIS)
Shrivastava, Keshav N
2012-01-01
When the magnetic field is applied in a metal, the electrons behave like a harmonic oscillator. When the field is increased these harmonic oscillator type levels cross the Fermi energy at a particular point resulting into the discontinuities in the population of any particular level at that point. For a large orbital magnetic moment, different from L = 0 and both signs of spin in the total magnetic momentum quantum number, j = l ± s, the discontinuities in the population of the electrons in a particular level become double valued resulting into doubling of oscillations in the magnetization. There is a double valued change in the energy of the electrons when they transfer from the harmonic oscillator type level to the Fermi level. The magnetization depends on the value of j = l ± s so that there is a double valued period in the oscillations. The de Haas-van Alphen effect is usually described for the L = 0 electrons. Hence, we see that the de Haas-van Alphen effect is considerably modified in going from L = 0 to j = l ± s, with both signs in the spin.
Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris
International Nuclear Information System (INIS)
Ge, Fei; Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin
2011-01-01
The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L -1 iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L -1 manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH) 3(am) or MnO 2(am) coat the algal cells , which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).
Façanha, Anna Júlia de Oliveira; Lara, Tulio Silva; Garib, Daniela Gamba; da Silva Filho, Omar Gabriel
2014-01-01
Objective The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months); and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months). Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho AnalyzerTM 3D software. Results The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders. PMID:24945513
Directory of Open Access Journals (Sweden)
Anna Júlia de Oliveira Façanha
2014-04-01
Full Text Available Objective: The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods: The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months; and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months. Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho Analyzer(tm 3D software. Results: The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion: Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders.
Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris
Energy Technology Data Exchange (ETDEWEB)
Ge, Fei, E-mail: gefei@xtu.edu.cn [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China); Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China)
2011-05-15
The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L{sup -1} iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L{sup -1} manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH){sub 3(am)} or MnO{sub 2(am)} coat the algal cells{sub ,} which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Markéta; Zapletal, Miloš
2016-01-01
Roč. 53, č. 1 (2016), s. 101-102 ISSN 0018-7003. [Pavel Haas Study Day. Cardiff, 30.01.2016] R&D Projects: GA ČR(CZ) GP14-35842P Institutional support: RVO:68378076 Keywords : Pavel Haas * conference * music * inter-war * avantgarde Subject RIV: AL - Art, Architecture, Cultural Heritage
Kas tasemetööd täidavad oma eesmärki? / Marge Lepik, Kristi Mere, Merike Haas...[jt.
2009-01-01
Küsimusele vastavad Lääne-Viru maavalitsuse haridusosakonna juhataja Marge Lepik, Haridus- ja Teadusministeeriumi välishindamisosakonna peaekspert Kristi Mere, Viira kooli klassiõpetaja Merike Haas, Rääma põhikooli direktor Elmo Joa ja Tallinna Ülikooli Haapsalu kolledži õppejõud Sirje Piht
De Haas-van Alphen effect of a two-dimensional ultracold atomic gas
Farias, B.; Furtado, C.
2016-01-01
In this paper, we show how the ultracold atom analogue of the two-dimensional de Haas-van Alphen effect in electronic condensed matter systems can be induced by optical fields in a neutral atomic system. The interaction between the suitable spatially varying laser fields and tripod-type trapped atoms generates a synthetic magnetic field which leads the particles to organize themselves in Landau levels. Initially, with the atomic gas in a regime of lowest Landau level, we display the oscillatory behaviour of the atomic energy and its derivative with respect to the effective magnetic field (B) as a function of 1/B. Furthermore, we estimate the area of the Fermi circle of the two-dimensional atomic gas.
Directory of Open Access Journals (Sweden)
Denny Nurkertamanda
2012-02-01
Full Text Available Chitose Indonesia Manufacturing merupakan perusahaan yang memproduksi dan menjual furniture dari logam dengan kerjasama negara Jepang. Berdasarkan data penjualan Chitose Indonesia Manufacturing pada tahun 2003, kursi lipat Chitose Yamato merupakan jenis kursi lipat yang memiliki angka penjualan sebesar 59% dari keseluruhan jenis produk yang diproduksi. Kursi lipat Chitose Yamato HAA merupakan salah satu sarana untuk duduk yang dilengkapi dengan sandaran sesuai dengan bentuk punggung manusia dan dapat dilipat untuk memudahkan penyimpanannya. Selain itu juga rangka kakinya yang berbentuk H sehingga dapat digunakan pada permukaan yang datar atau bergelombang. Material yang digunakan pada rangka kursi lipat Chitose Yamato HAA adalah berupa elemen struktur rangka yang bersifat isotropik, yakni memiliki keseragaman sifat dan bahan suatu elemen (regangan, tegangan, mekanis, dsb. Pada analisa moda kegagalan dilakukan identifikasi moda kegagalan yang potensial, keparahan yang ditimbulkan, dan frekuensi kejadian moda kegagalan. Dengan menggunakan analisa moda kegagalan, maka diharapkan kualitas produk akan meningkat dan dapat digunakan sesuai dengan fungsinya. RPN adalah indikator kekritisan untuk menentukan tindakan koreksi yang sesuai dengan moda kegagalan. RPN digunakan oleh banyak prosedur FMEA untuk menaksir resiko menggunakan tiga kriteria yaitu Keparahan efek (Severity S, Kejadian penyebab (Occurrence O, Deteksi penyebab (Detection D. Angka prioritas RPN merupakan hasil kali rating keparahan, kejadian, dan deteksi. Angka ini hanyalah menunjukkan rangking atau urutan defisiensi desain sistem. Kata kunci : Moda Kegagalan, Efek Kegagalan, Penyebab Kegagalan, Deteksi, Kejadian, Keparahan, RPN (Risk Priority Number. Chitose Manufacturing Indonesia is a company that produce and sells furniture made from alloy in cooperation with Japan. Based on Sales data by Chitose Indonesia Manufacturing in 2003, Chitose Yamato foldable chair has a sales number
Czech Academy of Sciences Publication Activity Database
Mikhailova, M. P.; Veinger, A.I.; Kochman, I.V.; Semenikhin, P.V.; Kalinina, K.V.; Parfeniev, R.V.; Berezovets, V.A.; Safonchik, M.O.; Hospodková, Alice; Pangrác, Jiří; Zíková, Markéta; Hulicius, Eduard
2016-01-01
Roč. 10, č. 4 (2016), 1-8, č. článku 046013. ISSN 1934-2608 R&D Projects: GA ČR GA13-15286S; GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : Shubnikov-de Haas oscillations * microwave absorption * electron-paramagnetic resonance * composite quantum wells * InAs/GaSb/AlSb * MOVPE Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.325, year: 2016
Corrosion in Haas expanders with and without use of an antimicrobial agent: an in situ study
BAGATIN, Cristhiane Ristum; ITO, Izabel Yoko; ANDRUCIOLI, Marcela Cristina Damião; NELSON-FILHO, Paulo; FERREIRA, José Tarcísio Lima
2011-01-01
Objectives The purpose of this study was to evaluate in situ the occurrence of corrosion in the soldering point areas between the wire, silver brazing and band in Haas expanders. Material and Methods Thirty-four 7-12-year-old patients who needed maxillary expansion with a Haas expander were randomly assigned to two groups of 17 individuals each, according to the oral hygiene protocol adopted during the orthodontic treatment: Group I (control), toothbrushing with a fluoride dentifrice and Group II (experimental), toothbrushing with the same dentifrice plus 0.12% chlorhexidine gluconate (Periogard®) mouthrinses twice a week. The appliances were removed after approximately 4 months. Fragments of the appliances containing a metallic band with a soldered wire were sectioned at random for examination by stereomicroscopy, scanning electron microscopy (SEM) and energy dispersive x-ray spectroscopy (EDS). Data were analyzed statistically by Fisher's test at 5% significance level. Results The analysis by optical microscopy revealed areas with color change suggestive of corrosion in the soldering point areas joining the band and the wire in all specimens of both groups, with no statistically significant difference between the groups (p=1). The peaks of chemical elements (Ni, Fe, Cr, O, C and P) revealed by EDS were also similar in both groups. Conclusion: Color changes and peaks of chemical elements suggestive of corrosion were observed in the soldering point areas between the wire, silver brazing and band in both control and experimental groups, which indicate that the 0.12% chlorhexidine gluconate mouthrinses did not influence the occurrence of corrosion in situ. PMID:22231004
Shubnikov-de Haas effect study of InAs after transmutation doping at low temperatures
International Nuclear Information System (INIS)
Gerstenberg, H.; Mueller, P.
1990-01-01
Degenerate InAs single crystals have been irradiated by thermal neutrons below 6 K. The Shubnikov-de Haas effect and the electrical resistivity have been measured as a function of the neutron dose and the annealing temperature. The effects of transmutation doping and simultaneous introduction of lattice defects have been analysed in terms of the conduction electron density and the scattering rates τ ρ -1 - ρne 2 /m * and τ x -1 2πkub(B)X/h/2π (where X is the Dingle temperature). The measured conduction electron density after irradiation and thermal annealing agreed well with the values calculated from the experimental and materials parameters. The effects of radiation damage may qualitatively be explained assuming neutral In vacancies to be the most common type of defect in thermal-neutron-irradiated InAs. A comparison with similar experiments on InSb is given. (author)
Upper Critical Field and de Haas-van Alphen Oscillations in KOs2O6 Measured in a Hybrid Magnet
Taichi Terashima,; Nobuyuki Kurita,; Atsushi Harada,; Kota Kodama,; Jun-ichi Yamaura,; Zenji Hiroi,; Hisatomo Harima,; Shinya Uji,
2010-08-01
Magnetic torque measurements have been performed on a KOs2O6 single crystal in magnetic fields up to 35.3 T and at temperatures down to 0.6 K. The upper critical field is determined to be ˜30 T. De Haas-van Alphen oscillations are observed. A large mass enhancement of (1+λ) = m* / mband = 7.6 is found. It is suggested that, for the large upper critical field to be reconciled with Pauli paramagnetic limiting, the observed mass enhancement must be of electron-phonon origin, including electron-rattling-mode interactions, for the most part.
Directory of Open Access Journals (Sweden)
Marco Antônio Scanavini
2006-02-01
Full Text Available OBJETIVO: avaliar cefalometricamente os efeitos da expansão rápida da sutura palatina mediana sobre o posicionamento vertical e sagital da maxila, comparando os aparelhos de Haas e Hyrax. METODOLOGIA: a amostra consistiu de 93 telerradiografias obtidas de 31 pacientes jovens, brasileiros, de ambos os gêneros, na faixa etária inicial média de 13 anos e 2 meses. As radiografias foram tomadas ao início do tratamento (pré-disjunção, imediatamente após a disjunção (pós-disjunção e ao final do nivelamento. RESULTADOS E CONCLUSÕES: constatou-se que os dois aparelhos disjuntores apresentaram resultados semelhantes, com a ocorrência de deslocamento da maxila em direção inferior, sem rotação, que se manteve ao final do nivelamento e ocorrência de um deslocamento anterior logo após a disjunção, que retornou aos valores pré-disjunção ao final do nivelamento.AIM: the purpose of this cephalometric study was to evaluate, by lateral cephalograms, the changes in maxilar positioning after rapid disjunction of the midpalatal suture, following the use of two types of maxillary disjunction appliances, checked in different phases, and the likely differences between the two appliances Haas and Hyrax. METHODS: the sample comprised of 93 lateral cephalograms, taken before treatment (pre-disjunction, immediately after disjunction and at the end of levelling, obtained from 31 brazilian youths with both genres and average age of 13 years and 2 months. RESULTS AND CONCLUSIONS: both types of appliances showed similar results, with anterior and lower displacement of maxila right after disjunction. Lower displacement was without rotation, and mainttened stable until the end of levelling. Anterior displacement, however, was not stable and cephalometric measurements like SNA and Nperp-A tended to returned to initial values at the end of levelling.
de Haas-van Alphen effect investigations of the electronic structure of pure and aluminum-doped MgB2
International Nuclear Information System (INIS)
Carrington, A.; Yelland, E.A.; Fletcher, J.D.; Cooper, J.R.
2007-01-01
Our understanding of the superconducting properties of MgB 2 is strongly linked to our knowledge of its electronic structure. In this paper we review experimental measurements of the Fermi surface parameters of pure and Al-doped MgB 2 using the de Haas-van Alphen (dHvA) effect. In general, the measurements are in excellent agreement with the theoretical predictions of the electronic structure, including the strength of the electron-phonon coupling on each Fermi surface sheet. For the Al doped samples, we are able to measure how the band structure changes with doping. These results are in excellent agreement with calculations based on the virtual crystal approximation. We also review work on the dHvA effect in the superconducting state
Topological nature of the node-arc semimetal PtSn4 probed by de Haas-van Alphen quantum oscillations
Wang, Y. J.; Liang, D. D.; Ge, M.; Yang, J.; Gong, J. X.; Luo, L.; Pi, L.; Zhu, W. K.; Zhang, C. J.; Zhang, Y. H.
2018-04-01
Dirac node arc semimetal state is a new topological quantum state which is proposed to exist in PtSn4 (Wu et al 2016 Dirac node arcs in PtSn4 Nat. Phys. 12 667–71). We present a systematic de Haas-van Alphen quantum oscillation study on this compound. Two intriguing oscillation branches, i.e. F 1 and F 2, are detected in the fast Fourier transformation spectra, both of which are characterized to possess tiny effective mass and ultrahigh quantum mobility. And the F 2 branch exhibits an angle-dependent nontrivial Berry phase. The features are consistent with the existence of the node arc semimetal state and shed new light on its complicated Fermi surfaces and topological nature.
Herzog, F.; Hardtdegen, H.; Schäpers, Th; Grundler, D.; Wilde, M. A.
2017-10-01
The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin-orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI.
International Nuclear Information System (INIS)
Herzog, F; Grundler, D; Wilde, M A; Hardtdegen, H; Schäpers, Th
2017-01-01
The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin–orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI. (paper)
Energy Technology Data Exchange (ETDEWEB)
Knolle, Johannes; Cooper, Nigel [T.C.M. Group, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)
2016-07-01
The de Haas-van Alphen effect (dHvAE), describing oscillations of the magnetization as a function of magnetic field, is commonly assumed to be a definite sign for the presence of a Fermi surface (FS). Indeed, the effect forms the basis of a well-established experimental procedure for accurately measuring FS topology and geometry of metallic systems, with parameters commonly extracted by fitting to the Lifshitz-Kosevich (LK) theory based on Fermi liquid theory. Here we show that, in contrast to this canonical situation, there can be quantum oscillations even for band insulators of certain types. We provide simple analytic formulas describing the temperature dependence of the quantum oscillations in this setting, showing strong deviations from LK theory. We draw connections to recent experiments on the tentative topological Kondo insulator SmB{sub 6}.
Huang, Huaqing; Liu, Feng
2017-05-01
The extremely stringent requirement on material quality has hindered the investigation and potential applications of exotic chiral magnetic effect in Dirac semimetals. Here, we propose that gray tin is a perfect candidate for observing the chiral anomaly effect and Shubnikov-de-Haas (SdH) oscillation at relatively low magnetic field. Based on effective k .p analysis and first-principles calculations, we discover that gray tin becomes a Dirac semimetal under tensile uniaxial strain, in contrast to a topological insulator under compressive uniaxial strain as known before. In this newly found Dirac semimetal state, two Dirac points which are tunable by tensile [001] strains lie in the kz axis and Fermi arcs appear in the (010) surface. Due to the low carrier concentration and high mobility of gray tin, a large chiral anomaly induced negative magnetoresistance and a strong SdH oscillation are anticipated in this half of the strain spectrum. Comparing to other Dirac semimetals, the proposed Dirac semimetal state in the nontoxic elemental gray tin can be more easily manipulated and accurately controlled. We envision that gray tin provides a perfect platform for strain engineering of chiral magnetic effects by sweeping through the strain spectrum from positive to negative and vice versa.
High field magnetoresistance and de Haas-van Alphen effect in antiferromagnetic PrB6 and NdB6
International Nuclear Information System (INIS)
Onuki, Y.; Umezawa, A.; Kwok, W.K.; Crabtree, G.W.; Nishihara, M.; Yamazaki, T.; Omi, T.; Komatsubara, T.
1987-08-01
The transport properties and the de Haas-van Alphen (dHvA) effect have been measured for antiferromagnetic PrB 6 and NdB 6 . The number of conduction electrons is approximately one per unit cell. The magnetoresistance shows the existence of open orbits implying a multiply connected Fermi surface. The angular dependence of the magnetoresistance is roughly similar to that of the reference material, LaB 6 . The dHvA data in PrB 6 shows both paramagnetic and antiferromagnetic Fermi surfaces. The antiferromagnetic Fermi surface arises from new magnetic Brillouin zone boundaries and antiferromagnetic gaps introduced by the magnetic order, and the paramagnetic Fermi surface from magnetic breakdown through the small antiferromagnetic gaps in high field. Hybridization between the conduction electrons and the f electrons has been observed through the cyclotron masses, which in PrB 6 are three times larger than the corresponding masses of LaB 6 . In NdB 6 only the antiferromagnetic Fermi surface, quite different from those of LaB 6 and PrB 6 , has been observed. 26 refs., 10 figs., 3 tabs
International Nuclear Information System (INIS)
Laukhin, V.N.; Audouard, A.; Rakoto, H.; Broto, J.M.; Goze, F.; Coffe, G.; Brossard, L.; Redoules, J.P.; Kartsovnik, M.V.; Kushch, N.D.; Buravov, L.I.; Khomenko, A.G.; Yagubskii, E.B.; Askenazy, S.; Pari, P.
1995-01-01
Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal α-(ET) 2 TlHg(SeCN) 4 have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F 0 =653±3 T and slow frequency oscillations with F s =38±5 T have been revealed. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Laukhin, V.N. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France)]|[Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Audouard, A. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Rakoto, H. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Broto, J.M. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Goze, F. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Coffe, G. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Brossard, L. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Redoules, J.P. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Kartsovnik, M.V. [Institute of Solid State Physics, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Kushch, N.D. [Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Buravov, L.I.
1995-05-01
Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal {alpha}-(ET){sub 2}TlHg(SeCN){sub 4} have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F{sub 0}=653{+-}3 T and slow frequency oscillations with F{sub s}=38{+-}5 T have been revealed. (orig.).
Pavlosiuk, Orest; Kaczorowski, Dariusz; Wiśniewski, Piotr
2015-01-01
We present electronic transport and magnetic properties of single crystals of semimetallic half-Heusler phase LuPdBi, having theoretically predicted band inversion requisite for nontrivial topological properties. The compound exhibits superconductivity below a critical temperature Tc = 1.8 K, with a zero-temperature upper critical field Bc2 ≈ 2.3 T. Although superconducting state is clearly reflected in the electrical resistivity and magnetic susceptibility data, no corresponding anomaly can be seen in the specific heat. Temperature dependence of the electrical resistivity suggests existence of two parallel conduction channels: metallic and semiconducting, with the latter making negligible contribution at low temperatures. The magnetoresistance is huge and clearly shows a weak antilocalization effect in small magnetic fields. Above about 1.5 T, the magnetoresistance becomes linear and does not saturate in fields up to 9 T. The linear magnetoresistance is observed up to room temperature. Below 10 K, it is accompanied by Shubnikov-de Haas oscillations. Their analysis reveals charge carriers with effective mass of 0.06 me and a Berry phase very close to π, expected for Dirac-fermion surface states, thus corroborating topological nature of the material. PMID:25778789
Split Fermi Surfaces of the Spin-Orbit-Coupled Metal Cd2Re2O7 Probed by de Haas-van Alphen Effect
Matsubayashi, Yasuhito; Sugii, Kaori; Hirose, Hishiro T.; Hirai, Daigorou; Sugiura, Shiori; Terashima, Taichi; Uji, Shinya; Hiroi, Zenji
2018-05-01
The superconducting pyrochlore oxide Cd2Re2O7 shows a structural transition with inversion symmetry breaking (ISB) at Ts1 = 200 K. A recent theory [https://doi.org/10.1103/PhysRevLett.115.026401" xlink:type="simple">L. Fu, Phys. Rev. Lett. 115, 026401 (2015)] suggests that the origin is an electronic instability that leads to a multipolar order in the spin-orbit-coupled metal. To observe the Fermi surface of the low-temperature phase of Cd2Re2O7, we perform de Haas-van Alphen effect measurements by means of magnetic torque. In reference to a calculated band structure, the spin-split Fermi surfaces with large cyclotron masses of 5-9m0 are revealed. The splitting is suggested to be due to an antisymmetric spin-orbit coupling induced by ISB, the strength of which is estimated to be approximately 67 K, which is rather smaller than those of typical non-centrosymmetric metals.
International Nuclear Information System (INIS)
Ōnuki, Yoshichika; Hedo, Masato; Nakama, Takao; Nakamura, Ai; Aoki, Dai; Boukahil, Mounir; Haga, Yoshinori; Takeuchi, Tetsuya; Harima, Hisatomo
2015-01-01
We succeeded in growing single crystals of EuCo 2 Si 2 by the Bridgman method, and carried out the de Haas-van Alphen (dHvA) experiments. EuCo 2 Si 2 was previously studied from a viewpoint of the trivalent electronic state on the basis of the magnetic susceptibility and X-ray absorption experiments, whereas most of the other Eu compounds order magnetically, with the divalent electronic state. The detected dHvA branches in the present experiments are found to be explained by the results of the full potential linearized augmented plane wave energy band calculations on the basis of a local density approximation (LDA) for YCo 2 Si 2 (LDA) and EuCo 2 Si 2 (LDA + U), revealing the trivalent electronic state. The detected cyclotron effective masses are moderately large, ranging from 1.2 to 2.9 m 0
International Nuclear Information System (INIS)
2008-01-01
Wind turbines and the movement of their blades can have penalizing effects on the processing of radars data. These disturbances can have a strong impact on the air, maritime and fluvial safety, on the protection of the territory and on the prevention of natural hazards. Reports made by the national agency of frequencies (ANFR) have established recommendations for the definition of protection areas (5 km) and coordination areas (5 to 30 km) which have to be taken into consideration prior to any project of wind turbine. (J.S.)
Energy Technology Data Exchange (ETDEWEB)
NONE
2008-07-01
Wind turbines and the movement of their blades can have penalizing effects on the processing of radars data. These disturbances can have a strong impact on the air, maritime and fluvial safety, on the protection of the territory and on the prevention of natural hazards. Reports made by the national agency of frequencies (ANFR) have established recommendations for the definition of protection areas (5 km) and coordination areas (5 to 30 km) which have to be taken into consideration prior to any project of wind turbine. (J.S.)
Romanova, Taisiia A.; Knyazev, Dmitry A.; Wang, Zhaosheng; Sadakov, Andrey V.; Prudkoglyad, Valery A.
2018-05-01
We report Shubnikov-de Haas (SdH) and Hall oscillations in Cu-doped high quality bismuth selenide single crystals. To increase the accuracy of Berry phase determination by means of the of the SdH oscillations phase analysis we present a study of n-type samples with bulk carrier density n ∼1019 -1020cm-3 at high magnetic field up to 60 Tesla. In particular, Landau level fan diagram starting from the value of the Landau index N = 4 was plotted. Thus, from our data we found π-Berry phase that directly indicates the Dirac nature of the carriers in three-dimensional topological insulator (3D TI) based on Cu-doped bismuth selenide. We argued that in our samples the magnetotransport is determined by a general group of carriers that exhibit quasi-two-dimensional (2D) behaviour and are characterized by topological π-Berry phase. Along with the main contribution to the conductivity the presence of a small group of bulk carriers was registered. For 3D-pocket Berry phase was identified as zero, which is a characteristic of trivial metallic states.
Singh, Yogesh; Martin, C.; Bud'Ko, S. L.; Ellern, A.; Prozorov, R.; Johnston, D. C.
2010-10-01
Single crystals of superconducting OsB2 [Tc=2.10(5)K] have been grown using a Cu-B eutectic flux. We confirm that OsB2 crystallizes in the reported orthorhombic structure (space group Pmmn ) at room temperature. Both the normal and superconducting state properties of the crystals are studied using various techniques. Heat capacity versus temperature C(T) measurements yield the normal state electronic specific heat coefficient γ=1.95(1)mJ/molK2 and the Debye temperature ΘD=539(2)K . The measured frequencies of Shubnikov-de Haas oscillations are in good agreement with those predicted by band structure calculations. Magnetic susceptibility χ(T,H) , electrical resistivity ρ(T) , and C(T,H) measurements ( H is the magnetic field) demonstrate that OsB2 is a bulk low- κ [κ(Tc)=2(1)] type-II superconductor that is intermediate between the clean and dirty limits [(ξ(T=0)/ℓ=0.97)] with a small upper critical magnetic field Hc2(T=0)=186(4)Oe . The penetration depth is λ(T=0)=0.300μm . An anomalous (not single-gap BCS) T dependence of λ was fitted by a two-gap model with Δ1(T=0)/kBTc=1.9 and Δ2(T=0)/kBTc=1.25 , respectively. The discontinuity in the heat capacity at Tc , ΔC/γTc=1.32 , is smaller than the weak-coupling BCS value of 1.43, consistent with the two-gap nature of the superconductivity in OsB2 . An anomalous increase in ΔC at Tc of unknown origin is found in finite H ; e.g., ΔC/γTc≈2.5 for H≈25Oe .
Directory of Open Access Journals (Sweden)
Harisnal Hadi
2017-08-01
Full Text Available The preparation of the artwork entitled "Subhaa", is inspired by the Minangkabau cultural phenomenon. This work focuses on the feelings of children who will be circumcised, the pressure and fear felt by the child who will be circumcised tilled in the form of Polymetrik art works. Circumcision or commonly called Basunaik by Minangkabau society is a Sunna that must be run boys of Islam; indirectly circumcision is also required for boys in Minangkabau. In the area of darek (mainland khitan has its own ceremony, begins with a child who will be circumcised is brought to the bako house to change his clothes, then paraded around the village, after arriving at home circumcised will be held. In the evening there will be entertainment in the form of randai and bagurau saluang. This piece of music is in the form of a new composition. The performance focuses more on the composition of sound as a contextual meaning to be conveyed to the appreciator. This work is a little contrary to the aesthetics that have been awakened in the brain and soul of the arts in the Sendratasik Department of FBS Universitas Negeri Padang. But it cannot be denied that a new works will create its own aesthetic realm. Keywords: Basunaik, Artwork Music. Abstrak Penyusunan karya seni yang berjudul “Subhaa”, ini terinspirasi dari fenomena budaya Minangkabau. Karya ini menitik beratkan garapan pada perasaan anak yang akan dikhitan, tekanan dan ketakutan yang dirasakan oleh anak yang akan dikhitan digarap dalam bentuk penggarapan Polymetrik. Khitan atau biasa disebut Basunaik oleh masyarakat Minangkabau merupakan sunah yang harus dijalankan anak laki-laki Islam, secara tidak langsung khitan juga diwajibkan bagi anak laki-laki di Minangkabau. Di daerah darek (daratan khitan memiliki upacara tersendiri, diawali dengan anak yang akan dikhitan dibawa ke rumah bako untuk mengganti baju, lalu diarak keliling kampung, setelah sampai di rumah baru diadakan khitan, malamnya diadakan hiburan berupa randai dan bagurau saluang. Karya musik ini berbentuk komposisi garapan baru. Penggarapan lebih menitik beratkan kepada penggarapan bunyi sebagai makna kontekstual yang akan disampaikan kepada apresiator. Karya ini memang sedikit bertolak belakang dengan estetika yang sudah terbangun dalam otak dan jiwa kalangan seni di jurusan pendidikan sendratasik FBS Universitas Negeri Padang. Namun tidak bisa dipungkiri sebuah karya garapan baru akan menciptakan ranah estetikanya sendiri. Kata Kunci: Basunaik, Karya seni Musik.
Recovery from hospital-acquired anemia after acute myocardial infarction and effect on outcomes.
Salisbury, Adam C; Kosiborod, Mikhail; Amin, Amit P; Reid, Kimberly J; Alexander, Karen P; Spertus, John A; Masoudi, Frederick A
2011-10-01
New-onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. The patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center Translational Research Investigating Underlying disparities in acute myocardial infarction Patients' Health Status (TRIUMPH) registry, we identified 530 patients with AMI and HAA (defined as normal hemoglobin at admission with the development of anemia by discharge) who had a repeat, protocol-driven hemoglobin measurement at 1 month after discharge. The 1-month measures were used to define persistent (persistent anemia) and transient (anemia resolved) HAA. The patients' health status was assessed at 1, 6, and 12 months after AMI using the Short-Form 12 Physical Component Summary, and the health status of patients with persistent and transient HAA was compared using multivariate repeated measures regression analysis. Mortality was compared using the log-rank test and proportional hazards regression analysis. Overall, 165 patients (31%) developed persistent HAA. The adjusted mean Short-Form 12 Physical Component Summary scores at the follow-up visit were significantly lower in those with persistent HAA than in those with transient HAA (-2.0 points, 95% confidence interval -3.6 to -0.3; p = 0.02). During a median follow-up of 36 months, the crude mortality (13% vs 5%, p = 0.002) and multivariate-adjusted mortality (hazard ratio 2.08, 95% confidence interval 1.02 to 4.21, p = 0.04) was greater in patients with persistent HAA. In conclusion, HAA persists 1 month after discharge in nearly 1 of 3 patients and is associated with worse health status and greater mortality. Additional investigation is needed to understand whether HAA prevention, recognition, and treatment, particularly among those with persistent HAA, will improve outcomes. Copyright © 2011 Elsevier Inc. All rights reserved.
Reducing and verifying haloacetic acids in treated drinking water using a biological filter system.
Lou, Jie C; Chan, Hung Y; Yang, Chih Y; Tseng, Wei B; Han, Jia Y
2014-01-01
This study focused on reducing the haloacetic acid (HAA) concentrations in treated drinking water. HAA has been thought to be one possible nutrient supporting heterotrophic bacteria regrowth in drinking water. In this study, experiments were conducted using a pilot-scale system to evaluate the efficiency of biological filters (BF) for reducing excess HAA concentrations in water. The BF system reduced the total HAA concentration and the concentrations of five HAA species in the water. Dichloroacetic acid (DCAA), monobromoacetic acid (MBAA) and dibromoacetic acid (DBAA) were the three main HAA5 species that were present in the treated drinking water in this investigation. Combined, these three species represent approximately 77% of the HAA5 in the finished water after BF. The verification of the empirical HAA equation for the outlet in the BF system indicated linear relationships with high correlation coefficients. The empirical equation for the HAA5 concentrations in the finished water was established by examining other nutrients (e.g., dissolved organic carbon (DOC), ultraviolet absorbance at 254 nm wavelength (UV254), and ammonia nitrogen) that can reduce pathogenic contamination. These findings may be useful for designing advanced processes for conventional water treatment plants or for managing water treatment and distribution systems for providing high-quality drinking water.
Energy Technology Data Exchange (ETDEWEB)
Kawamata, Shuichi, E-mail: s-kawamata@riast.osakafu-u.ac.jp; Kawamura, Yuichi [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan); Research Organization for University-Community Collaborations, Osaka Prefecture University, Sakai 599-8570 (Japan); Hibino, Akira; Tanaka, Sho [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan)
2016-10-14
In order to develop optical devices for 2–3 μm wavelength regions, the InP-based InGaAs/GaAsSb type II multiple quantum well system has been investigated. By doping nitrogen into InGaAs layers, the system becomes effective in creating the optical devices with a longer wavelength. In this report, electrical transport properties are reported on the InGaAsN/GaAsSb type II system. The epitaxial layers with the single hetero or multiple quantum well structure on InP substrates are grown by the molecular beam epitaxy. The electrical resistance of samples with different nitrogen concentrations has been measured as a function of the magnetic field up to 9 Tesla at several temperatures between 2 and 6 K. The oscillation of the resistance due to the Shubnikov-de Haas (SdH) effect has been observed at each temperature. The effective mass is obtained from the temperature dependence of the amplitude of the SdH oscillations. The value of the effective mass increases from 0.048 for N = 0.0% to 0.062 for N = 1.2 and 1.5% as the nitrogen concentration increases. The mass enhancement occurs with corresponding to the reduction of the bandgap energy. These results are consistent with the band anticrossing model.
Note on de Haas-van Alphen diamagnetism in thin, free-electron films
Directory of Open Access Journals (Sweden)
J. A. Grzesik
2012-03-01
Full Text Available We revisit the problem of de Haas-van Alphen (dHvA diamagnetic susceptibility oscillations in a thin, free-electron film trapped in a synthetic harmonic potential well. A treatment of this phenomenon at zero temperature was announced many years ago by Childers and Pincus (designated hereafter as CP, and we traverse initially much the same ground, but from a slightly different analytic perspective. That difference hinges around our use, in calculating the Helmholtz free energy F, of an inverse Laplace transform, Bromwich-type contour integral representation for the sharp distribution cutoff at Fermi level μ. The contour integral permits closed-form summation all at once over the discrete orbital Landau energy levels transverse to the magnetic field, and the energy associated with the in-plane canonical momenta ℏ k x and ℏ k z. Following such summation/integration, pole/residue pairs appear in the plane of complex transform variable s, a fourth-order pole at origin s = 0, and an infinite ladder, both up and down, of simple poles along the imaginary axis. The residue sum from the infinite pole ladder automatically engenders a Fourier series with period one in dimensionless variable μ/ ℏ ω (with effective angular frequency ω suitably defined, series which admits closed-form summation as a cubic polynomial within any given periodicity slot. Such periodicity corresponds to Landau levels slipping sequentially beneath Fermi level μ as the ambient magnetic field H declines in strength, and is manifested by the dHvA pulsations in diamagnetic susceptibility. The coëxisting steady contribution from the pole at origin has a similar cubic structure but is opposite in sign, inducing a competition whose outcome is a net magnetization that is merely quadratic in any given periodicity slot, modulated by a slow amplitude growth. Apart from some minor notes of passing discord, these simple algebraic structures confirm most of the CP formulae, and their
Voskobojnikov, I B; Samarin, N A; Cluchanko, N E; Lyubovskaya, R N; Moshchalkov, V V
2002-01-01
Within 0.33-1.44 K temperature range at B <= 50 T magnetic field values one measured the De Haas-Van Alphen effect for (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic quasi-two-dimensional conductor. Analysis of quantum oscillations with regard to data on cyclotron resonance derived for 40-120 GHz frequency interval enabled to determine that a complex spectrum of quantum oscillations was formed by alpha approx 256 T and beta approx 670-610 T fundamental frequencies as well as, by combination and multiple frequencies. It is shown that nature of temperature rearrangement of oscillation spectrum may be interpreted in terms of model taking account of occurrence of magnetic phase transition at T sub c approx 0.9 K and proximity of a fundamental frequency with m* = 1.48m sub 0 efficient mass to the spin dumping condition
Zhang, Huijuan; Zhu, Jiping; Aranda-Rodriguez, Rocio; Feng, Yong-Lai
2011-11-07
Haloacetic acids (HAAs) are by-products of the chlorination of drinking water containing natural organic matter and bromide. A simple and sensitive method has been developed for determination of ten HAAs in drinking water. The pressure-assisted electrokinetic injection (PAEKI), an on-line enrichment technique, was employed to introduce the sample into a capillary electrophoresis (CE)-electrospray ionization-tandem mass spectrometry system (ESI-MS/MS). HAAs were monitored in selected reaction monitoring mode. With 3 min of PAEKI time, the ten major HAAs (HAA10) in drinking water were enriched up to 20,000-fold into the capillary without compromising resolution. A simple solid phase clean-up method has been developed to eliminate the influence of ionic matrices from drinking water on PAEKI. Under conditions optimized for mass spectrometry, PAEKI and capillary electrophoresis, detection limits defined as three times ratio of signal to noise have been achieved in a range of 0.013-0.12 μg L(-1) for ten HAAs in water sample. The overall recoveries for all ten HAAs in drinking water samples were between 76 and 125%. Six HAAs including monochloro- (MCAA), dichloro- (DCAA), trichloro- (TCAA), monobromo- (MBAA), bromochloro- (BCAA), and bromodichloroacetic acids (BDCAA) were found in tap water samples collected. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Human Factors Interface with Systems Engineering for NASA Human Spaceflights
Wong, Douglas T.
2009-01-01
This paper summarizes the past and present successes of the Habitability and Human Factors Branch (HHFB) at NASA Johnson Space Center s Space Life Sciences Directorate (SLSD) in including the Human-As-A-System (HAAS) model in many NASA programs and what steps to be taken to integrate the Human-Centered Design Philosophy (HCDP) into NASA s Systems Engineering (SE) process. The HAAS model stresses systems are ultimately designed for the humans; the humans should therefore be considered as a system within the systems. Therefore, the model places strong emphasis on human factors engineering. Since 1987, the HHFB has been engaging with many major NASA programs with much success. The HHFB helped create the NASA Standard 3000 (a human factors engineering practice guide) and the Human Systems Integration Requirements document. These efforts resulted in the HAAS model being included in many NASA programs. As an example, the HAAS model has been successfully introduced into the programmatic and systems engineering structures of the International Space Station Program (ISSP). Success in the ISSP caused other NASA programs to recognize the importance of the HAAS concept. Also due to this success, the HHFB helped update NASA s Systems Engineering Handbook in December 2007 to include HAAS as a recommended practice. Nonetheless, the HAAS model has yet to become an integral part of the NASA SE process. Besides continuing in integrating HAAS into current and future NASA programs, the HHFB will investigate incorporating the Human-Centered Design Philosophy (HCDP) into the NASA SE Handbook. The HCDP goes further than the HAAS model by emphasizing a holistic and iterative human-centered systems design concept.
Haloacetic acids in the aquatic environment. Part I: macrophyte toxicity
International Nuclear Information System (INIS)
Hanson, Mark L.; Solomon, Keith R.
2004-01-01
Haloacetic acids (HAAs) are contaminants of aquatic ecosystems with numerous sources, both anthropogenic and natural. The toxicity of HAAs to aquatic plants is generally uncharacterized. Laboratory tests were conducted with three macrophytes (Lemna gibba, Myriophyllum sibiricum and Myriophyllum spicatum) to assess the toxicity of five HAAs. Myriophyllum spp. has been proposed as required test species for pesticide registration in North America, but few studies have been conducted under standard test conditions. The HAAs in the present experiments were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). MCA was the most toxic to Myriophyllum spp. with EC 50 values ranging from 8 to 12.4 mg/l depending on the endpoint, followed by DCA (EC 50 range 62-722.5 mg/l), TCA (EC 50 range 49.5-1702.6 mg/l), CDFA (EC 50 range 105.3 to >10,000 mg/l) and with TFA (EC 50 range 222.1 to 10,000 mg/l) the least toxic. Generally, L. gibba was less sensitive to HAA toxicity than Myriophyllum spp., with the difference in toxicity between them approximately threefold. The range of toxicity within Myriophyllum spp. was normally less than twofold. Statistically, plant length and node number were the most sensitive endpoints as they had the lowest observed coefficients of variation, but they were not the most sensitive to HAA toxicity. Toxicological sensitivity of endpoints varied depending on the measure of effect chosen and the HAA, with morphological endpoints usually an order of magnitude more sensitive than pigments for all plant species. Overall, mass and root measures tended to be the most sensitive indicators of HAA toxicity. The data from this paper were subsequently used in an ecological risk assessment for HAAs and aquatic plants. The assessment found HAAs to be of low risk to aquatic macrophytes and the results are described in the second manuscript of this series
Haas, Annika
2007-01-01
Turundusagentuur PNG (loovjuhiks Jüri Peetson) ühendas tänuõhtu oma klientidele ja koostööpartneritele hispaania laulja Enrique Iglesiase esinemisega 1. dets. Tallinnas Saku Suurhalli restoranis Platoo
Haas, Annika
2008-01-01
Eesti Kunstimuuseumi Kunstisõprade Seltsi eestvõttel tähistati 4. novembril 2008 Kumule Euroopa aasta muuseumi tiitli andmist. Ühel juuresolevatest fotodest president Toomas Hendrik Ilves koos Kumu kunstimuuseumi direktrissi Sirje Helme ja Eesti Kunstimuuseumi Kunstisõprade Seltsi juhatuse esimehe Enn Kunilaga
Haas, Annika
2007-01-01
21. veebruaril 2007 tähistas Tiigrihüppe SA Tallinnas Olümpia hotelli konverentsikeskuses konverentsiga "Kogu tõde Tiigrihüppest" Tiigrihüppe programmi 10. aastapäeva. Kohal viibis ka programmi üks algatajaid Toomas Hendrik Ilves
Haas, Annika
2009-01-01
Eesti Posti peakontori hoovis esitleti Indrek Kaingi kujundatud rahvusmustriga tenniseid. Esimesed eksklusiivsed kaks paari MULK-kirjaga papusid kingiti president Toomas Hendrik Ilvesele ning ettevõtte Skype presidendile Josh Silvermanile
Haas, Annika
2006-01-01
Tallinna Ülikoolis toimunud ameerika kultuurantropoloogi Clifford Geertzi mälestusõhtust, kus esinesid rektor Rein Raud, Eesti Humanitaarinstituudi dotsent Lorenzo Cañás Bottos ja kultuuriteooria lektor Marek Tamm
Haas, Annika
2008-01-01
8. aug. Tallinnas kinos Sõprus ja klubis Juuksur tähistati 30 aasta möödumist ansambli Joy Divison sünnist ja Anton Corbijni debüütfilmi "Control" jõudmist Eesti kinodesse (näidati dokumentaalfilmi "Joy Divison")
Haas, Annika
2006-01-01
Inglise rocklaulja Gordon Matthew Sumneri raamatu "Sting. Murtud muusika" esitlusest Tallinnas Viru Keskuse Rahva Raamatu kaupluses ja kontserdist Saku Suurhallis Broken Musicu nimelise tuuri raames 28. juulil
2011-01-01
Aromatic amines and heterocyclic aromatic amines (HAAs) are structurally related classes of carcinogens that are formed during the combustion of tobacco or during the high-temperature cooking of meats. Both classes of procarcinogens undergo metabolic activation by N-hydroxylation of the exocyclic amine group, to produce a common proposed intermediate, the arylnitrenium ion, which is the critical metabolite implicated in toxicity and DNA damage. However, the biochemistry and chemical properties of these compounds are distinct and different biomarkers of aromatic amines and HAAs have been developed for human biomonitoring studies. Hemoglobin adducts have been extensively used as biomarkers to monitor occupational and environmental exposures to a number of aromatic amines; however, HAAs do not form hemoglobin adducts at appreciable levels and other biomarkers have been sought. A number of epidemiologic studies that have investigated dietary consumption of well-done meat in relation to various tumor sites reported a positive association between cancer risk and well-done meat consumption, although some studies have shown no associations between well-done meat and cancer risk. A major limiting factor in most epidemiological studies is the uncertainty in quantitative estimates of chronic exposure to HAAs and, thus, the association of HAAs formed in cooked meat and cancer risk has been difficult to establish. There is a critical need to establish long-term biomarkers of HAAs that can be implemented in molecular epidemioIogy studies. In this review article, we highlight and contrast the biochemistry of several prototypical carcinogenic aromatic amines and HAAs to which humans are chronically exposed. The biochemical properties and the impact of polymorphisms of the major xenobiotic-metabolizing enzymes on the biological effects of these chemicals are examined. Lastly, the analytical approaches that have been successfully employed to biomonitor aromatic amines and HAAs, and
Xue, Runmiao; Shi, Honglan; Ma, Yinfa; Yang, John; Hua, Bin; Inniss, Enos C; Adams, Craig D; Eichholz, Todd
2017-12-01
Free chlorine is a commonly used disinfectant in drinking water treatment. However, disinfection by-products (DBPs) are formed during water disinfection. Haloacetic acids (HAAs) and trihalomethanes (THMs) are two major groups of DBPs. Iodo-HAAs and iodo-THMs (I-HAAs and I-THMs) are formed during the disinfection of the water containing high levels of iodide and are much more toxic than their chlorinated and brominated analogs. Peracetic acid (PAA) is a strong antimicrobial disinfectant that is expected to reduce the formation of HAAs and THMs during disinfection. In this study, the formations of thirteen HAAs and ten THMs, including the iodinated forms, have been investigated during PAA disinfection and chlorination as the comparison. The DBP formations under different iodide concentrations, pHs, and contact times were systematically investigated. Two types of commercial PAAs containing different concentrations of PAA and hydrogen peroxide (H 2 O 2 ) were studied. A solid-phase microextraction gas chromatography-mass spectrometry method was upgraded for THM analysis including I-THMs. HAAs were analyzed by following a recently developed high performance ion chromatography-tandem mass spectrometry method. Results show that the ratio of PAA and H 2 O 2 concentration significantly affect the formation of I-THMs and I-HAAs. During PAA disinfection with lower PAA than H 2 O 2 , no detectable levels of THMs and HAAs were observed. During PAA disinfection with higher PAA than H 2 O 2 , low levels of monoiodoacetic acid, diiodoacetic acid, and iodoform were formed, and these levels were enhanced with the increase of iodide concentration. No significant quantities of chloro- or bromo-THMs and HAAs were formed during PAA disinfection treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.
Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael
2017-12-01
Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.
A New Approach to Eliminate High Amplitude Artifacts in EEG Signals
Directory of Open Access Journals (Sweden)
Ana Rita Teixeira
2016-09-01
Full Text Available High amplitude artifacts represent a problem during EEG recordings in neuroscience research. Taking this into account, this paper proposes a method to identify high amplitude artifacts with no requirement for visual inspection, electrooscillogram (EOG reference channel or user assigned parameters. A potential solution to the high amplitude artifacts (HAA elimination is presented based on blind source separation methods. The assumption underlying the selection of components is that HAA are independent of the EEG signal and different HAA can be generated during the EEG recordings. Therefore, the number of components related to HAA is variable and depends on the processed signal, which means that the method is adaptable to the input signal. The results show, when removing the HAA artifacts, the delta band is distorted but all the other frequency bands are preserved. A case study with EEG signals recorded while participants performed on the Halstead Category Test (HCT is presented. After HAA removal, data analysis revealed, as expected, an error-related frontal ERP wave: the feedback-related negativity (FRN in response to feedback stimuli.
Anodic dissolution of samarium in acetonitrile solution of acetylacetone
International Nuclear Information System (INIS)
Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.
2003-01-01
Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru
Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J
2013-10-01
Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.
Avoiding pitfalls in the determination of halocarboxylic acids: the photochemistry of methylation.
Rubio, F J; Urbansky, E T; Magnuson, M L
2000-06-01
Haloethanoic (haloacetic) acids are formed during chlorination of drinking water and are regulated by the Environmental Protection Agency (EPA). These compounds are normally quantified by gas chromatography with electron capture detection (GC-ECD) as the methyl esters. EPA Method 552 uses diazomethane (CH2N2) for this purpose, but has only been validated by EPA for HAA6: chloro-, dichloro-, bromo-, dibromo-, bromochloro- and trichloroacetic acids. EPA Method 552.2 was developed and validated for all nine analytes (HAA9 = HAA6 + dibromochloro-, bromodichloro- and tribromoethanoic acids). Since the promulgation of Method 552.2, which uses acidic methanol, a debate has ensued over discrepancies observed by various laboratories when using diazomethane instead. In an effort to identify and eliminate potential sources for these discrepancies, a comparative study was undertaken for HAA9. Better accuracy and precision were observed for all HAA9 species by Method 552.2; recoveries were satisfactory in de-ionized and tap water. Method 552 remains satisfactory for HAA6. Systematic differences in instrumental response are observed for the two methods, but these are precise and may be accounted for using similarly treated standards and analyte-fortified (spiked) samples. That notwithstanding, Method 552 (CH2N2) was shown to be unsuitable for dibromochloro-, bromodichloro- and tribromoethanoic acids (HAA9-6). The primary problem appears to be a photoactivated reaction between diazomethane and the HAA9-6 analytes; however, side reactions were found to occur even in the dark. Analyte loss is most pronounced under typical laboratory lighting (white F40 fluorescent lamps + sunlight), but it is also observed under Philips gold F40 lamps (lambda > or = 520 nm), and in the dark.
Directory of Open Access Journals (Sweden)
Lijun Yang
Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.
Babushok, Daria V.; Grignon, Anne‐Laure; Li, Yimei; Atienza, Jamie; Xie, Hongbo M.; Lam, Ho‐Sun; Hartung, Helge; Bessler, Monica
2016-01-01
Hepatitis‐associated aplastic anemia (HAA) is a variant of acquired aplastic anemia (AA) in which immune‐mediated bone marrow failure (BMF) develops following an acute episode of seronegative hepatitis. Dyskeratosis congenita (DC) is an inherited BMF syndrome characterized by the presence of short telomeres, mucocutaneous abnormalities, and cancer predisposition. While both conditions may cause BMF and hepatic impairment, therapeutic approaches are distinct, making it imperative to establish the correct diagnosis. In clinical practice, lymphocyte telomere lengths (TL) are used as a first‐line screen to rule out inherited telomeropathies before initiating treatment for AA. To evaluate the reliability of TL in the HAA population, we performed a retrospective analysis of TL in 10 consecutively enrolled HAA patients compared to 19 patients with idiopathic AA (IAA). HAA patients had significantly shorter telomeres than IAA patients (P = 0.009), including four patients with TL at or below the 1st percentile for age‐matched controls. HAA patients had no clinical features of DC and did not carry disease‐causing mutations in known genes associated with inherited telomere disorders. Instead, short TLs were significantly correlated with severe lymphopenia and skewed lymphocyte subsets, features characteristic of HAA. Our results indicate the importance of caution in the interpretation of TL measurements in HAA, because, in this patient population, short telomeres have limited specificity. Am. J. Hematol. 91:243–247, 2016. © 2015 The Authors. American Journal of Hematology Published by Wiley Periodicals, Inc. PMID:26615915
Effect of drinking water disinfection by-products in human peripheral blood lymphocytes and sperm.
Ali, Aftab; Kurzawa-Zegota, Malgorzata; Najafzadeh, Mojgan; Gopalan, Rajendran C; Plewa, Michael J; Anderson, Diana
2014-12-01
Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose hazards to public health. Two major classes of DBPs are found in finished drinking water: haloacetic acids (HAAs) and trihalomethanes (THMs). HAAs are formed following disinfection with chlorine, which reacts with iodide and bromide in the water. Previously the HAAs were shown to be cytotoxic, genotoxic, mutagenic, teratogenic and carcinogenic. To determine the effect of HAAs in human somatic and germ cells and whether oxidative stress is involved in genotoxic action. In the present study both somatic and germ cells have been examined as peripheral blood lymphocytes and sperm. The effects of three HAA compounds: iodoacetic acid (IAA), bromoacetic acid (BAA) and chloroacetic acid (CAA) were investigated. After determining appropriate concentration responses, oxygen radical involvement with the antioxidants, butylated hydroxanisole (BHA) and the enzyme catalase, were investigated in the single cell gel electrophoresis (Comet) assay under alkaline conditions, >pH 13 and the micronucleus assay. In the Comet assay, BHA and catalase were able to reduce DNA damage in each cell type compared to HAA alone. In the micronucleus assay, micronuclei (MNi) were found in peripheral lymphocytes exposed to all three HAAs and catalase and BHA were in general, able to reduce MNi induction, suggesting oxygen radicals play a role in both assays. These observations are of concern to public health since both human somatic and germ cells show similar genotoxic responses. Copyright © 2014. Published by Elsevier B.V.
Recovery from Hospital-Acquired Anemia after Acute Myocardial Infarction and Effect on Outcomes
Salisbury, Adam C.; Kosiborod, Mikhail; Amin, Amit P.; Reid, Kimberly J.; Alexander, Karen P.; Spertus, John A.; Masoudi, Frederick A.
2011-01-01
New onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. Patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center TRIUMPH registry, we identified 530 AMI patients with HAA (defined as normal hemoglobin at admission with development of anemia by discharge) who had repeat, protocol-driven hemoglobin measurement 1 month after discharge. The 1-m...
Liao, G Z; Wang, G Y; Xu, X L; Zhou, G H
2010-05-01
Heterocyclic aromatic amines (HAAs), potent mutagens/carcinogens, are pyrolysis formed during the cooking of meat and fish. In the present study, the effects of various cooking methods, pan-frying, deep-frying, charcoal grilling and roasting on the formation of HAAs in chicken breast and duck breast were studied. The various HAAs formed during cooking were isolated by solid-phase extraction and analyzed by high-performance liquid chromatography (HPLC). Results showed that chicken breast cooked by charcoal grilling contained the highest content of total HAAs, as high as 112 ng/g, followed by pan-fried duck breast (53.3 ng/g), charcoal grilled duck breast (32 ng/g), pan-fried chicken breast (27.4 ng/g), deep-fried chicken breast (21.3 ng/g), deep-fried duck breast (14 ng/g), roasted duck breast (7 ng/g) and roasted chicken breast (4 ng/g). For individual HAA, the most abundant HAA was 9H-pyrido-[4,3-b]indole (Norharman), which was detected in charcoal grilled chicken breast at content as high as 32.2 ng/g, followed by 1-methyl-9H-pyrido[4,3-b] indole (Harman) and 2-amino-1-methyl-6-phenylimidazo[4,5-f]pyridine(PhIP) at 32 and 31.1 ng/g in charcoal grilled chicken breast, respectively. The content of PhIP in pan-fried duck and chicken breast were 22 and 18.3 ng/g, respectively. Generally, the type and content of HAAs in cooked poultry meat varies with cooking method and cooking conditions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Hong, Huachang; Yan, Xiaoqing; Song, Xuhui; Qin, Yanyan; Sun, Hongjie; Lin, Hongjun; Chen, Jianrong; Liang, Yan
2017-07-15
The main objective of this study was to assess the effects of disinfection conditions on bromine incorporation into disinfection by-products (DBPs) during chlorination of water with low specific UV absorbance (SUVA). Five classes of DBPs were included: trihalomethanes (THMs), dihaloacetic acids (di-HAAs), trihaloacetic acids (tri-HAAs), dihaloacetonitriles (DHANs) and trihalonitromethanes (THNMs). Results showed that the bromine utilization in DBPs formation was positive related with reaction time, pH and temperature. On the other hand, the bromine substitution factors (BSFs) of DBPs were generally increased with pH (except tri-HAAs) and bromide concentration, but decreased with the reaction time, temperature and chlorine dose. Moreover, the BSFs values varied with DBP classes with the ranking being as following: THNMs≫DHANs≫tri-HAAs>THM≈di-HAAs. These results were mostly similar with the references, yet the pH effect on BSFs as well as the rank of BSFs for different DBP classes may differ with the specific UV absorbance of organic matter. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Pan; Hong, Yanting; Ke, Weixin; Hu, Xiaosong; Chen, Fang
2017-09-01
Heterocyclic aromatic amines (HAAs) are one type of neo-formed contaminants in protein-rich foods during heat processing. Recently, accumulative studies have focused on the formation of HAs in Western foods. However, there is little knowledge about the occurrence of HAAs in traditional Chinese foods. The objective of this study was to determinate the contents of main HAs in traditional marinated meat products by UPLC-MS/MS, and to investigate the effects of animal species and the ingredients (soy sauce, rock candy, and rice wine) on the formation of HAAs in marinated meats. Five HAs - 2-amino-3-methylimidazo[4,5-f]-quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4-dimethylimidazo[4,5-f]quinoxaline (MeIQ), 9H-pyrido[3,4-b]indole (Norharman) and l-methyl-9H-pyrido[3,4-b]indole (Harman) - were detected in 12 marinated meats, but 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) was only found in three chicken marinates. The animal species and ingredients (soy sauce, rock candy and rice wine) have significant influence on the formation of HAAs in meat marinates. Beef had the highest content of total HAAs compared with pork, mutton and chicken. Meanwhile, soy sauce contributed to the formation of HAAs more greatly than rock candy, soy sauce, and rice wine. Choice of raw materials and optimisation of ingredients recipe should be become a critical point to control the HAAs formation in marinated meats. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Chlorination of drinking water results in the formation of hundreds of disinfection byproducts (DBPs), the most prevalent are trihalomethanes (THMs) and haloacetic acids (HAAs). Four THMs (chloroform, bromodichloromethane, chlorodibromomethane, bromoform) and five HAAs (chloroac...
Hepatic artery aneurysms (HAAs)
International Nuclear Information System (INIS)
Nosratini, H.
2004-01-01
The hepatic artery aneurysms are rare, especially in interahepatic branches, The frequency consists of 75-80% extrahepatic and 20-25% intrahepatic. Catheterization is achieved usually from common femoral artery, other methods implemented in the case of unsuccessful catheterization from femoral artery, are translumbar and brachial catheterization. The study consist of 565 patients that were referred to the angiography ward, During seven years of assessment, five cases of hepatic artery aneurysm were found; this is a rare condition reported in the English literature. In the literature as well as in this case report the hepatic artery aneurysms are rare. In reported series the extrahepatic artery aneurysms are found more often than in the intrahepatic artery aneurysm but in this case report intrahepatic artery aneurysms are more than extrahepatic one. (author)
International Nuclear Information System (INIS)
Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre
2010-01-01
2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.
Directory of Open Access Journals (Sweden)
Liu S
2014-12-01
Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.
Tengilimoglu-Metin, Mercan Merve; Kizil, Mevlude
2017-12-01
The aim of this study was to investigate the inhibitory effect of different levels of artichoke extract (0, 0.5, and 1.0%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast meat cooked by either pan-frying or oven-roasting. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of 12 HAAs (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2) were assessed. The total HAA content in beef and chicken breast ranged from not detectable to 49.26ng/g, and not detectable to 83.06ng/g, respectively. The inhibitory effects of 0.5 and 1.0% artichoke extracts on total HAAs levels were found to be 6-46% and 25-98% in beef, and 5-97% and 14-95% in chicken breast, respectively. The present study showed that artichoke extracts could mitigate HAA formation especially in oven-roasted beef and chicken breast meat. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cardador, Maria Jose; Gallego, Mercedes
2012-07-25
Chlorine solutions are usually used to sanitize fruit and vegetables in the fresh-cut industry due to their efficacy, low cost, and simple use. However, disinfection byproducts such as haloacetic acids (HAAs) can be formed during this process, which can remain on minimally processed vegetables (MPVs). These compounds are toxic and/or carcinogenic and have been associated with human health risks; therefore, the U.S. Environmental Protection Agency has set a maximum contaminant level for five HAAs at 60 μg/L in drinking water. This paper describes the first method to determine the nine HAAs that can be present in MPV samples, with static headspace coupled with gas chromatography-mass spectrometry where the leaching and derivatization of the HAAs are carried out in a single step. The proposed method is sensitive, with limits of detection between 0.1 and 2.4 μg/kg and an average relative standard deviation of ∼8%. From the samples analyzed, we can conclude that about 23% of them contain at least two HAAs (<0.4-24 μg/kg), which showed that these compounds are formed during washing and then remain on the final product.
Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.
Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao
2012-10-01
Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cooking does not decrease hydrophilic antioxidant capacity of wild blueberries.
Murphy, Rebecca Ree; Renfroe, Michael H; Brevard, Patricia Bowling; Lee, Robert E; Gloeckner, Janet W
2009-01-01
The present study examined the effects of domestic cooking methods on the hydrophilic antioxidant activity (HAA) of wild blueberries. Baked, microwaved, simmered, and pan-fried frozen wild blueberries, and a thawed uncooked control, were analyzed for HAA using an ABTS/H(2)O(2)/HRP decoloration method. All cooking treatments were derived from recipes using wild blueberries, and were performed in triplicate. A randomized block design was used to determine whether there were statistical differences in antioxidant content after cooking and between each of the trials. There were no statistically significant decreases after cooking the thawed berries. On both a fresh weight and a dry weight basis, pan-fried blueberries had significantly higher HAA than baked, simmered, and control blueberries (Pcooked berries retained significant HAA. Cooked wild blueberries can be recommended as a good source of dietary antioxidants.
Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...
Indian Academy of Sciences (India)
(TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...
BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...
Mehrez, O Abou; Dossier-Berne, F; Legube, B
2015-01-01
Chlorination and monochloramination of aminophenols (AP) were carried out in aqueous solution at 25°C and at pH 8.5. Oxidant demand and disinfection by-product formation were determined in excess of oxidant. Experiments have shown that chlorine consumption of AP was 40-60% higher than monochloramine consumption. Compared with monochloramination, chlorination of AP formed more chloroform and haloacetic acids (HAA). Dichloroacetic acid was the major species of HAA. Chloroform and HAA represented, respectively, only 1-8% and 14-15% of adsorbable organic halides (AOX) by monochloramination but up to 29% and 39% of AOX by chlorination.
Marsà, Alicia; Cortés, Constanza; Hernández, Alba; Marcos, Ricard
2018-04-07
Disinfection by-products (DBPs) are compounds produced in the raw water disinfection processes. Although increased cancer incidence has been associated with exposure to this complex mixture, the carcinogenic potential of individual DBPs remains not well known; thus, further studies are required. Haloacetic acids (HAAs) constitute an important group among DBPs. In this study, we have assessed the in vitro carcinogenic potential of three HAAs namely chloro-, bromo-, and iodoacetic acids. Using a long-term (8 weeks) and sub-toxic doses exposure scenario, different in vitro transformation markers were evaluated using a human urothelial cell line (T24). Our results indicate that long-term exposure to low doses of HAAs did not reproduce the genotoxic effects observed in acute treatments, where oxidative DNA damage was induced. No changes in the transformation endpoints analyzed were observed, as implied by the absence of significant morphological, cell growth rate and anchorage-independent cell growth pattern modifications. Interestingly, HAA-long-term exposed cells developed resistance to oxidative stress damage, what would explain the observed differences between acute and long-term exposure conditions. Accordingly, data obtained under long-term exposure to sub-toxic doses of HAAs could be more accurate, in terms of risk assessment, than under acute exposure scenarios. Copyright © 2018. Published by Elsevier Inc.
Associations Between Disinfection By-Product Exposures and Craniofacial Birth Defects.
Kaufman, John A; Wright, J Michael; Evans, Amanda; Rivera-Núñez, Zorimar; Meyer, Amy; Narotsky, Michael G
2018-02-01
The aim of this study was to examine associations between craniofacial birth defects (CFDs) and disinfection by-product (DBP) exposures, including the sum of four trihalomethanes (THM4) and five haloacetic acids (HAA5) (ie, DBP9). We calculated first trimester adjusted odds ratios (aORs) for different DBPs in a matched case-control study of 366 CFD cases in Massachusetts towns with complete 1999 to 2004 THM and HAA data. We detected elevated aORs for cleft palate with DBP9 (highest quintile aOR = 3.52; 95% CI: 1.07, 11.60), HAA5, trichloroacetic acid (TCAA), and dichloroacetic acid. We detected elevated aORs for eye defects with TCAA and chloroform. This is the first epidemiological study of DBPs to examine eye and ear defects, as well as HAAs and CFDs. The associations for cleft palate and eye defects highlight the importance of examining specific defects and DBPs beyond THM4.
Effect of Pre-ozonation on Haloacetic Acids Formation in Ganga River Water at Kanpur, India
Naladala, Nagasrinivasa Rao; Singh, Rambabu; Katiyar, Kumud Lata Devi; Bose, Purnendu; Dutta, Venkatesh
2017-11-01
Almost all natural water bodies which are considered to be sustainable sources of drinking water contain organic matter in dissolved form and pathogens. This dissolved organic matter and pathogens cannot be removed effectively through traditional filtering processes in drinking water treatment plants. Chlorination of such water for disinfection results in large amounts of disinfection by-products (DBPs), mainly trihalomethanes and haloacetic acids (HAAs), which showed many health effects like cancer and reproductive problems in lab animals and in human beings as well. Complete removal of dissolved organic carbon (DOC), which is a precursor compound for HAAs formation, is impossible from a practical point of view; hence, it will be better if DOC activity towards DBPs formation can be reduced via some process. The present article describes the process of pre-ozonating post-coagulated Ganga River water at Kanpur in a continuous flow mode and its effect on HAAs formation. Nearly 58% reduction in HAAs formation was observed during this study at higher doses of ozone.
Haloacetic acids in the aquatic environment. Part II: ecological risk assessment
International Nuclear Information System (INIS)
Hanson, Mark L.; Solomon, Keith R.
2004-01-01
Haloacetic acids (HAAs) are environmental contaminants found in aquatic ecosystems throughout the world as a result of both anthropogenic and natural production. The ecological risk posed by these compounds to organisms in freshwater environments, with a specific focus on aquatic macrophytes, was characterized. The plants evaluated were Lemna gibba, Myriophyllum spicatum and M. sibiricum and the HAAs screened were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). Laboratory toxicity data formed the basis of the risk assessment, but field studies were also utilized. The estimated risk was calculated using hazard quotients (HQ), as well as effect measure distributions (EMD) in a modified probabilistic ecological risk assessment. EMDs were used to estimate HAA thresholds of toxicity for use in HQ assessments. This threshold was found to be a more sensitive measure of low toxicity than the no observed effect concentrations (NOEC) or the effective concentration (EC 10 ). Using both deterministic and probabilistic methods, it was found that HAAs do not pose a significant risk to freshwater macrophytes at current environmental concentrations in Canada, Europe or Africa for both single compound and mixture exposures. Still, HAAs are generally found as mixtures and their potential interactions are not fully understood, rendering this phase of the assessment uncertain and justifying further effects characterization. TCA in some environments poses a slight risk to phytoplankton and future concentrations of TFA and CDFA are likely to increase due to their recalcitrant nature, warranting continued environmental surveillance of HAAs. - Current environmental concentrations of haloacetic acids do not pose a risk to aquatic macrophytes, but could impact plankton
Shen, X. C.; Zhang, Y. L.; Cui, Y. Q.; Xu, L. Y.; Li, X.; Qi, J. H.
2017-07-01
Heterocyclic aromatic amines (HAAs) are potent mutagens that formed at high temperature in cooked, protein-rich food. Owing to their frequent intake, an accurate method is essential to access human health risk of HAAs exposure through detecting these compounds in various heat-treated meat products. In this study, a liquid chromatography-electrospray tandem mass spectrometry (LC--ESI-MS/MS) method was developed to perform the determination of 9 mutagenic heterocyclic amines (HAAs) in meat samples with multiple reaction monitoring (MRM) mode. Ultrasound assisted extraction and diatomaceous earth was employed to extract HAAs from food samples, and the analytes were purified and enriched using tandem solid phase extraction, with propyl sulfonic acid coupled to a C18 cartridge. Two parameters, extraction time and eluent, were carefully optimized to improve the extraction and purification efficiency. The LC separation was carried out using a Zorbax SB-C18 (3.5 μm particle size, 2.1 × 150 mm i.d.) column and optimized some parameters, such as pH, concentration and volume. Under the optimal experimental conditions, recoveries ranged from 52.97% to 97.11% with good quality parameters: limit of detection values between 0.02 and 0.24 ng mL-1, linearity (R2>0.998), and run-to-run and day-to-day precisions lower than 9.81% achieved. To evaluate the performance of the method in high throughput analysis of complex meat samples, the LC-MS/MS method was applied to the analysis of HAAs in three food samples, and the results demonstrated that the method can be used for the trace determination of HAAs in pork samples.
Burattini, Ilaria; Bellagamba, Maria Paola; Spagnoli, Cristina; D'Ascenzo, Rita; Mazzoni, Nadia; Peretti, Anna; Cogo, Paola E; Carnielli, Virgilio P
2013-11-01
To compare the effect of 2.5 vs 4 g/kg/d of amino acid (AA) in parenteral nutrition of extremely low birth weight infants on metabolic tolerance, short-term growth, and neurodevelopment. One hundred thirty-one infants with birth weight between 500 and 1249 g were randomized to 2.5 (standard AA [SAA] group) or 4 (high AA [HAA] group) g/kg/d AA intake, with equal nonprotein energy. The primary outcome was body size at 36 weeks. One hundred thirty-one patients were randomized and 114 analyzed (58 SAA group and 56 HAA group). Study groups had similar demographics and clinical characteristics. Elevated blood urea (BU >70 mg/dL = BU nitrogen >32.6 mg/dL) occurred in 24% vs 59% (P = .000) and hyperglycemia (>175 mg/dL) in 34% vs 11% (P = .003) of the SAA and HAA patients, respectively. Body weight, length, and head circumference at 36 weeks and 2 years were similar between groups. Bayley Scales of Infant and Toddler Development, Third Edition score was 94 ± 13 in the SAA group and 97 ± 15 in the HAA group (P = .35). The HAA group had higher BU levels and better glucose control. An extra 8 g/kg of AA over the first 10 days of life did not improve growth and neurodevelopment. Copyright © 2013 Mosby, Inc. All rights reserved.
Pezdirc, Marko; Žegura, Bojana; Filipič, Metka
2013-09-01
Heterocyclic aromatic amines (HAAs) are potential human carcinogens formed in well-done meats and fish. The most abundant are 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-Amino-3,4,8-trimethyl-3H-imidazo[4,5-f]quinoxaline (4,8-DiMeIQx) and 2-Amino-3-methyl-3H-imidazo[4,5-f]quinoline (IQ). HAAs exert genotoxic activity after metabolic transformation by CYP1A enzymes, that is well characterized, however the genomic and intervening responses are not well explored. We have examined cellular and genomic responses of human hepatoma HepG2 cells after 24h exposure to HAAs. Comet assay revealed increase in formation of DNA strand breaks by PhIP, MeIQx and IQ but not 4,8-DiMeIQx, whereas increased formation of micronuclei was not observed. The four HAAs up-regulated expression of genes encoding metabolic enzymes CYP1A1, CYP1A2 and UGT1A1 and expression of TP53 and its downstream regulated genes CDKN1A, GADD45α and BAX. Consistent with the up-regulation of CDKN1A and GADD45α the cell-cycle analysis showed arrest in S-phase by PhIP and IQ, and in G1-phase by 4,8-DiMeIQx and MeIQx. The results indicate that upon exposure to HAAs the cells respond with the cell-cycle arrest, which enables cells to repair the damage or eliminate them by apoptosis. However, elevated expression of BCL2 and down-regulation of BAX may indicate that HAAs could suppress apoptosis meaning higher probability of damaged cells to survive and mutate. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hiroyasu Umakoshi
Full Text Available To quantify the imaging findings of patients with interstitial pneumonia (IP and emphysema using three-dimensional curved high-resolution computed tomography (3D-cHRCT at a constant depth from the chest wall, and compare the results to visual assessment of IP and each patient's diffusing capacity of the lungs for carbon monoxide (DLco.We retrospectively reviewed the axial CT findings and pulmonary function test results of 95 patients with lung cancer (72 men and 23 women, aged 45-84 years with or without IP, as follows: non-IP (n = 47, mild IP (n = 31, and moderate IP (n = 17. The 3D-cHRCT images of the lung at a 1-cm depth from the chest wall were reconstructed automatically using original software; total area (TA, high-attenuation area (HAA >-500 HU, and low-attenuation area (LAA <-950 HU were calculated on a workstation. The %HAA and %LAA were calculated as follows: [Formula: see text], and [Formula: see text].The %HAA and %LAA respective values were 3.2±0.9 and 27.7±8.2, 3.9±1.2 and 27.6±5.9, and 6.9±2.2 and 25.4±8.7 in non-IP, mild IP, and moderate IP patients, respectively. There were significant differences in %HAA between the 3 groups of patients (P<0.001, but no differences in %LAA (P = 0.558. Multiple linear regression analysis revealed that %HAA and %LAA were negatively correlated with predicted DLco (standard partial regression coefficient [b*] = -0.453, P<0.001; b* = -0.447, P<0.001, respectively.The %HAA and %LAA values computed using 3D-cHRCT were significantly correlated with DLco and may be important quantitative parameters for both IP and emphysema.
Antioxidant Properties of Kynurenines: Density Functional Theory Calculations
2016-01-01
Kynurenines, the main products of tryptophan catabolism, possess both prooxidant and anioxidant effects. Having multiple neuroactive properties, kynurenines are implicated in the development of neurological and cognitive disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Autoxidation of 3-hydroxykynurenine (3HOK) and its derivatives, 3-hydroxyanthranilic acid (3HAA) and xanthommatin (XAN), leads to the hyperproduction of reactive oxygen species (ROS) which damage cell structures. At the same time, 3HOK and 3HAA have been shown to be powerful ROS scavengers. Their ability to quench free radicals is believed to result from the presence of the aromatic hydroxyl group which is able to easily abstract an electron and H-atom. In this study, the redox properties for kynurenines and several natural and synthetic antioxidants have been calculated at different levels of density functional theory in the gas phase and water solution. Hydroxyl bond dissociation enthalpy (BDE) and ionization potential (IP) for 3HOK and 3HAA appear to be lower than for xanthurenic acid (XAA), several phenolic antioxidants, and ascorbic acid. BDE and IP for the compounds with aromatic hydroxyl group are lower than for their precursors without hydroxyl group. The reaction rate for H donation to *O-atom of phenoxyl radical (Ph-O*) and methyl peroxy radical (Met-OO*) decreases in the following rankings: 3HOK ~ 3HAA > XAAOXO > XAAENOL. The enthalpy absolute value for Met-OO* addition to the aromatic ring of the antioxidant radical increases in the following rankings: 3HAA* < 3HOK* < XAAOXO* < XAAENOL*. Thus, the high free radical scavenging activity of 3HAA and 3HOK can be explained by the easiness of H-atom abstraction and transfer to O-atom of the free radical, rather than by Met-OO* addition to the kynurenine radical. PMID:27861556
Potentially bioavailable natural organic carbon and hydrolyzable amino acids in aquifer sediments
Thomas, Lashun K.; Widdowson, Mark A.; Novak, John T.; Chapelle, Francis H.; Benner, Ronald; Kaiser, Karl
2012-01-01
This study evaluated the relationship between concentrations of operationally defined potentially bioavailable organic -carbon (PBOC) and hydrolyzable amino acids (HAAs) in sediments collected from a diverse range of chloroethene--contaminated sites. Concentrations of PBOC and HAA were measured using aquifer sediment samples collected at six selected study sites. Average concentrations of total HAA and PBOC ranged from 1.96 ± 1.53 to 20.1 ± 25.6 mg/kg and 4.72 ± 0.72 to 443 ± 65.4 mg/kg, respectively. Results demonstrated a statistically significant positive relationship between concentrations of PBOC and total HAA present in the aquifer sediment (p amino acids are known to be readily biodegradable carbon compounds, this relationship suggests that the sequential chemical extraction procedure used to measure PBOC is a useful indicator of bioavailable carbon in aquifer sediments. This, in turn, is consistent with the interpretation that PBOC measurements can be used for estimating the amount of natural organic carbon available for driving the reductive dechlorination of chloroethenes in groundwater systems.
Nie, Xuebiao; Liu, Wenjun; Zhang, Liping; Liu, Qing
2017-06-01
The genotoxicity of drinking water treated with 6 disinfection methods and the effects of disinfection conditions were investigated using the umu-test. The pretreatment procedure of samples for the umu-test was optimized for drinking water analysis. The results of the umu-test were in good correlation with those of the Ames-test. The genotoxicity and production of haloacetic acids (HAAs) were the highest for chlorinated samples. UV+chloramination is the safest disinfection method from the aspects of genotoxicity, HAA production and inactivation effects. For chloramination, the effects of the mass ratio of Cl 2 to N of chloramine on genotoxicity were also studied. The changes of genotoxicity were different from those of HAA production, which implied that HAA production cannot represent the genotoxic potential of water. The genotoxicity per chlorine decay of chlorination and chloramination had similar trends, indicating that the reaction of organic matters and chlorine made a great contribution to the genotoxicity. The results of this study are of engineering significance for optimizing the operation of waterworks. Copyright © 2016. Published by Elsevier B.V.
Meie esimesed naisfotograafid / Annika Haas
Haas, Annika, 1974-
2016-01-01
Tallinna fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kuraatorid Betty Ester-Väljaots, Merili Reinpalu, kunstnik Lilian Juhkam. Eesti naisfotograafide Anna Kuke ja Evi Lembergi eluloolisi andmeid, nende looming
Meie esimesed naisfotograafid / Annika Haas
Haas, Annika, 1974-
2015-01-01
Eesti naisfotograafid Hilja Riet ja Lydia Tarem. Fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kus tutvustatakse Hilja Rieti, Lydia Taremi, Anna Kuke ja Evi Lembergi loomingut. Näituse kuraatorid Betty Ester-Väljaots, Merili Reinpalu
Breast cancer, heterocyclic aromatic amines from meat and N-acetyltransferase 2 genotype.
Delfino, R J; Sinha, R; Smith, C; West, J; White, E; Lin, H J; Liao, S Y; Gim, J S; Ma, H L; Butler, J; Anton-Culver, H
2000-04-01
Breast cancer risk has been hypothesized to increase with exposure to heterocyclic aromatic amines (HAAs) formed from cooking meat at high temperature. HAAs require enzymatic activation to bind to DNA and initiate carcinogenesis. N-acetyltransferase 2 (NAT2) enzyme activity may play a role, its rate determined by a polymorphic gene. We examined the effect of NAT2 genetic polymorphisms on breast cancer risk from exposure to meat by cooking method, doneness and estimated HAA [2-amino-1-methyl-6-phenylimidazole[4,5-b]pyridine (PhIP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) and 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (DiMeIQx)] intake. Women were recruited with suspicious breast masses and questionnaire data were collected prior to biopsy to blind subjects and interviewers to diagnoses. For 114 cases with breast cancer and 280 controls with benign breast disease, NAT2 genotype was determined using allele-specific PCR amplification to detect slow acetylator mutations. HAAs were estimated from interview data on meat type, cooking method and doneness, combined with a quantitative HAA database. Logistic regression models controlled for known risk factors, first including all controls, then 108 with no or low risk (normal breast or no hyperplasia) and finally 149 with high risk (hyperplasia, atypical hyperplasia, complex fibroadenomas). Meat effects were examined within NAT2 strata to assess interactions. We found no association between NAT2 and breast cancer. These Californian women ate more white than red meat (control median 46 versus 8 g/day). There were no significant associations of breast cancer with red meat for any doneness. White meat was significantly protective (>67 versus chicken, including well done, pan fried and barbecued chicken. MeIQx and DiMeIQx were not associated with breast cancer. A protective effect of PhIP was confounded after controlling for well done chicken. Results were unchanged using low or high risk controls or dropping
Chen, Xin; Zhang, Dong; Lu, Yin-hao; Zheng, Wei-wei; Wu, Yu-xin; Wei, Xiao; Tian, Da-jun; Wang, Xia; Zhang, Hao; Guo, Shuai; Jiang, Song-hui; Qu, Wei-dong
2010-10-01
To investigate the pollutant levels of regulated disinfection by-products trihalomethanes (THMs) and haloacetic acids (HAAs) in raw water from the Huangpu River, the Yangtze River and different treatment processes and finished water, and to explore the changes tendency in transmission and distribution pipeline network. A total of 65 ml water samples with two replicates were collected from different raw water, corresponding treatment processes, finished water and six national surveillance points in main network of transmission and distribution, water source for A water plant and B, C water plant was the Huangpu River and the Yangtze River, respectively. Regulated THMs and HAAs above water samples were detected by gas chromatography. The total trihalomethanes (THM(4)) concentration in different treatment processes of A water plant was ND-9.64 µg/L, dichlorobromomethane was the highest (6.43 µg/L). The THM(4) concentration in B and C water plant was ND to 38.06 µg/L, dibromochloromethane (12.24 µg/L) and bromoform (14.07 µg/L) were the highest in the B and the C water plant respectively. In addition to trichloroacetic acid in A water plant from the raw water, the other HAAs came from different treatment processes. The total haloacetic acids (HAA(6)) concentration of different treated processes in A water plant was 3.21 - 22.97 µg/L, mobromoacetic acid (10.40 µg/L) was the highest. Dibromoacetic acid was the highest both in B (8.25 µg/L) and C (8.84 µg/L) water plant, HAA(6) concentration was ND to 27.18 µg/L. The highest and the lowest concentration of THM(4) were found from the main distribution network of C and A water plant respectively, but the concentration of HAA(6) in the main water pipes network of A water plant was the highest, and the lowest in C water plant. The THMs concentration was 21.11 - 31.18 µg/L in C water plant and 6.72 - 8.51 µg/L in A water plant. The concentration of HAA(6) was 25.02 - 37.31 µg/L in A water plant and 18.69 - 23
Directory of Open Access Journals (Sweden)
Chin-Fu Cheng
2012-01-01
Full Text Available Hemagglutinating proteins (HAPs were purified from Poker-chip Venus (Meretrix lusoria and Corbicula clam (Corbicula fluminea using gel-filtration chromatography on a Sephacryl S-300 column. The molecular weights of the HAPs obtained from Poker-chip Venus and Corbicula clam were 358 kDa and 380 kDa, respectively. Purified HAP from Poker-chip Venus yielded two subunits with molecular weights of 26 kDa and 29 kDa. However, only one HAP subunit was purified from Corbicula clam, and its molecular weight was 32 kDa. The two Poker-chip Venus HAPs possessed hemagglutinating ability (HAA for erythrocytes of some vertebrate animal species, especially tilapia. Moreover, HAA of the HAP purified from Poker-chip Venus was higher than that of the HAP of Corbicula clam. Furthermore, Poker-chip Venus HAPs possessed better HAA at a pH higher than 7.0. When the temperature was at 4°C–10°C or the salinity was less than 0.5‰, the two Poker-chip Venus HAPs possessed better HAA compared with that of Corbicula clam.
Halogenating reaction activity of aromatic organic compounds during disinfection of drinking water
International Nuclear Information System (INIS)
Guo Gaimei; Chen Xiaodong
2009-01-01
The halogenating reactions of five aromatic organic compounds (AOCs) with aqueous chlorine (HOCl/OCl - ) and aqueous bromine (HOBr/OBr - ) were studied with an aim to compare the formation properties of haloacetic acids (HAAs) for the corresponding chlorination or bromination reactions of AOCs, respectively. The experiment results indicated that the HAAs substitution efficiency for the bromination reactions of AOCs was greater than that for the chlorination reactions, and the formation of HAAs had a strong dependence on the chemical structure of AOCs. The chlorination or bromination reaction activities for the AOCs with electron donating functional groups were higher than that for them with electron withdrawing functional groups. The kinetic experiments indicated that the reactions of aqueous bromine with phenol were faster than those of aqueous chlorine with phenol and the halogen consumption exhibited rapid initial and slower consumption stages for the reactions of phenol with aqueous chlorine and bromine, respectively. In addition, the HAAs production for the chlorination reaction of phenol decreased with the increase of pH. These conclusions could provide the valuable information for the effective control of the disinfection by-products during drinking water treatment operation
Method of analysis of populations exposure and radio coverage of GSM and UMTS mobile phone networks
International Nuclear Information System (INIS)
Gaudaire, Francois; Noe, Nicolas; Dufour, Jean Benoit; De Seze, Rene; Cagnon, Patrice; Selmaoui, Brahim; Mauger, Samuel; Thuroczy, Georges; Mazet, Paul
2012-01-01
We present a description and preliminary results of a large-scale project (COMOP) started in 2009 by the Ministry for Ecology, Sustainable Development and Energy and the National Agency of Frequencies (ANFR). This work is collaborative between the government, municipalities, associations, network operators and agencies. This project concerns GSM and UMTS mobile phone networks. Sixteen voluntary pilot communes were selected to carry out the experiments. This work is based on numerical modeling methods associated with various innovative measurement campaigns. It consists of: - determination of current status of exposure to radiofrequency electromagnetic fields emitted by base station antennas by modeling and measurements. - investigations on reducing this exposure while assessing the impact of parallel territorial coverage and quality of service of mobile networks. This study has established a comprehensive scientific realization of human exposure to radio-frequencies from base station antennas. These results constitute an innovative approach and are relevant in terms of dialogue in the current debate about positioning of base stations. (authors)
Family Reintegration Following Guard Deployment
2010-09-20
Somalia Peacekeepers. Journal of Consulting and Clinical Psychology, 72(5), 909-913. Haas DM . Pazdernik LA. Olsen CH. A cross-sectional survey of the...relationship between partner deployment and stress in pregnancy during wartime. Haas DM . Pazdernik LA. Partner deployment and stress in pregnant...Identify 3-5 key words relating to the proposal. (Required) I used MESH Headings instead of the CRISP Thesaurus for key
Separation of beryllium and mercury from lithium chloride solution by gaseous extraction
International Nuclear Information System (INIS)
Sevast'yanov, A.I.; Chepovol, V.I.
1989-01-01
The possibility is shown of extracting beryllium and mercury by acetylacetone (HAA) from lithium chloride solution by passing argon through the solution and the optimum conditions have been determined. The dependence of the degree of extraction and the distribution coefficients on various parameters of the liquid phase are presented, viz. the initial pH value, the lithium chloride concentration, and the initial HAA content
Prieto-Blanco, M C; Alpendurada, M F; López-Mahía, P; Muniategui-Lorenzo, S; Prada-Rodríguez, D; Machado, S; Gonçalves, C
2012-05-30
Haloacetic acids (HAAs) are organic pollutants originated from the drinking water disinfection process, which ought to be controlled and minimized. In this work a method for monitoring haloacetic acids (HAAs) in water samples is proposed, which can be used in quality control laboratories using the techniques most frequently available. Among its main advantages we may highlight its automated character, including minimal steps of sample preparation, and above all, its improved selectivity and sensitivity in the analysis of real samples. Five haloacetic acids (HAA5) were analyzed using solid-phase extraction (SPE) combined with ion-pair liquid chromatography and tandem mass spectrometry. For the optimization of the chromatographic separation, two amines (triethylamine, TEA and dibutylamine, DBA) as ion pair reagents were compared, and a better selectivity and sensitivity was obtained using DBA, especially for monohaloacetic acids. SPE conditions were optimized using different polymeric adsorbents. The electrospray source parameters were studied for maximum precursor ion accumulation, while the collision cell energy of the triple quadrupole mass spectrometer was adjusted for optimum fragmentation. Precursor ions detected were deprotonated, dimeric and decarboxylated ions. The major product ions formed were: ionized halogen atom (chloride and bromide) and decarboxylated ions. After enrichment of the HAAs in Lichrolut EN adsorbent, the limits of detection obtained by LC-MS/MS analysis (between 0.04 and 0.3 ng mL(-1)) were comparable to those obtained by GC-MS after derivatization. Linearity with good correlation coefficients was obtained over two orders of magnitude irrespective of the compound. Adequate recoveries were achieved (60-102%), and the repeatability and intermediate precision were in the range of 2.4-6.6% and 3.8-14.8%, respectively. In order to demonstrate the usefulness of the method for routine HAAs monitoring, different types of water samples were
Embolization of Isolated Hypogastric Artery Aneurysm: A Case Report and a Review of the Literature
International Nuclear Information System (INIS)
Medici, Lorenzo de; Bucci, Federico; Nesi, Fabrizio; Rabitti, Giorgio
2006-01-01
A 75-year-old man with arterial hypertension, coronary artery disease, and myocardial infarction was referred to our service because of an asymptomatic hypogastric artery aneurysm (HAA) detected by a routine compued tomography (CT) scan. As shown on the angio-CT the maximum transverse diameter (m.t.d.) of the HAA was 47 mm. There were no symptoms of distal embolization or compression on the pelvic structures. We performed the successful complete thrombosis of the aneurysm using vascular plugs via a controlateral femoral approach. The control angiogram was satisfactory and there were no intraoperative complications. A CT-angiography done 4 months after the procedure showed no signs of refilling of the aneurysm sac. This case illustrates some possible advantages of vascular plugs in the treatment of isolated HAA
GRAPHICAL DETERMINATION OF DISSOCIATION CONSTANT ...
African Journals Online (AJOL)
DR. AMINU
conform to the general equation of straight – line graph; y = mx + c, where y = pH, m = slope, x = log. [HA]/[A] and C = intercept = pKa. Thus the pKa is obtained as the intercept of the graph of pH versus – log [HA]/[A] as shown in Figures 1,2 and 3 for glycine, alanine and valine respectively. The values obtained were 9.87 ...
Sack, Coralynn S; Doney, Brent C; Podolanczuk, Anna J; Hooper, Laura G; Seixas, Noah S; Hoffman, Eric A; Kawut, Steven M; Vedal, Sverre; Raghu, Ganesh; Barr, R Graham; Lederer, David J; Kaufman, Joel D
2017-10-15
The impact of a broad range of occupational exposures on subclinical interstitial lung disease (ILD) has not been studied. To determine whether occupational exposures to vapors, gas, dust, and fumes (VGDF) are associated with high-attenuation areas (HAA) and interstitial lung abnormalities (ILA), which are quantitative and qualitative computed tomography (CT)-based measurements of subclinical ILD, respectively. We performed analyses of participants enrolled in MESA (Multi-Ethnic Study of Atherosclerosis), a population-based cohort aged 45-84 years at recruitment. HAA was measured at baseline and on serial cardiac CT scans in 5,702 participants. ILA was ascertained in a subset of 2,312 participants who underwent full-lung CT scanning at 10-year follow-up. Occupational exposures were assessed by self-reported VGDF exposure and by job-exposure matrix (JEM). Linear mixed models and logistic regression were used to determine whether occupational exposures were associated with log-transformed HAA and ILA. Models were adjusted for age, sex, race/ethnicity, education, employment status, tobacco use, and scanner technology. Each JEM score increment in VGDF exposure was associated with 2.64% greater HAA (95% confidence interval [CI], 1.23-4.19%). Self-reported vapors/gas exposure was associated with an increased odds of ILA among those currently employed (1.76-fold; 95% CI, 1.09-2.84) and those less than 65 years old (1.97-fold; 95% CI, 1.16-3.35). There was no consistent evidence that occupational exposures were associated with progression of HAA over the follow-up period. JEM-assigned and self-reported exposures to VGDF were associated with measurements of subclinical ILD in community-dwelling adults.
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-01-15
On October 17, 2010, on request of those Swiss government institutions responsible for the disposal of radioactive wastes, the National Co-operative for the Disposal of Radioactive Waste (NAGRA) presented its project concerning geological sites for the foreseen disposal of radioactive wastes to the Federal Authorities. According to the present disposal concept, two types of repository are foreseen: one for highly radioactive wastes (HAA) and the other for low radioactive and intermediate-level radioactive wastes (SMA). If a site fulfils the necessary conditions for both HAA as well as for SMA, a combined site for both types of waste may be chosen. As a qualified control authority in Switzerland, the Federal Nuclear Safety Inspectorate (ENSI) has to examine the quality of the NAGRA proposals from the point of view of the nuclear safety of the sites. The project for deep underground waste disposal first defines the process and the criteria according to which sites for the geological storage of all types of radioactive wastes in Switzerland have to be chosen. The choice is based on the actual knowledge of Swiss geology. After dividing the wastes into SMA and HAA, some large-scale areas are to be identified according to their suitability from the geological and tectonic points of view. NAGRA's division of waste into SMA and HAA is based on calculations of the long-term safety for a broad range of different rock types and geological situations and takes the different properties of all waste types into account. As a conclusion, a small portion of SMA has to be stored with {alpha}-toxic wastes in the HAA repository. The estimation of the total volume of wastes to be stored is based on 60 years of operation of the actual nuclear power plants, augmented with the wastes from possible replacement plants with a total power of 5 GW{sub e} during a further 60 years. The safety concept of the repository is based on passive systems using technical and natural barriers. The
Energy Technology Data Exchange (ETDEWEB)
Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes, E-mail: mercedes.gallego@uco.es
2015-06-01
In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was
International Nuclear Information System (INIS)
Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes
2015-01-01
In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was
2011-12-01
Silberg , David J. Haas w ^m^e^ä^ Approved for Public Release; distribution is unlimited. f REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188...PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Eric Silberg , David Haas 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 99-2-5300-010-12 17...THIS PAGE UNCLASSIFIED 17. LIMITATION OF ABSTRACT UL 18. NUMBER OF PAGES 2 7 19a. NAME OF RESPONSIBLE PERSON Eric Silberg 19b. TELEPHONE
DEFF Research Database (Denmark)
Rodriguez De Turco, Elena B; Jackson, Fannie R; DeCoster, Mark A
2002-01-01
The lipid mediators generated by phospholipases A(2) (PLA(2)), free arachidonic acid (AA), eicosanoids, and platelet-activating factor, modulate neuronal activity; when overproduced, some of them become potent neurotoxins. We have shown, using primary cortical neuron cultures, that glutamate...... and secretory PLA(2) (sPLA(2)) from bee venom (bv sPLA(2)) and Taipan snake venom (OS2) elicit synergy in inducing neuronal cell death. Low concentrations of sPLA(2) are selective ligands of cell-surface sPLA(2) receptors. We investigated which neuronal arachidonoyl phospholipids are targeted by glutamate......) and in minor changes in other phospholipids. A similar profile, although of greater magnitude, was observed 20 hr posttreatment. Glutamate (80 microM) induced much less mobilization of (3)H-AA than did sPLA(2) and resulted in a threefold greater degradation of (3)H-AA PE than of (3)H-AA PC by 20 hr...
Dietary exposure to heterocyclic amines in a Chinese population.
Wong, Kin-Yoke; Su, Jin; Knize, Mark G; Koh, Woon-Puay; Seow, Adeline
2005-01-01
Heterocyclic aromatic amines (HAAs) formed in meat during high-temperature cooking have been associated with risk of colorectal and breast cancer. Incidence of these cancers is increasing in Singapore, a country with 77% ethnic Chinese. The purpose of this study was to estimate HAA levels in the Chinese diet and individual levels of exposure to these compounds because little is known. Twenty-five samples (each pooled from three sources) of meat and fish, cooked as commonly consumed, were analyzed by high-performance liquid chromatography for concentrations (ng/g) of 2-amino-3-methylimidazo[4,5-f]quinoline, 2-amino-3, 4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3, 4,8-trimethylimidazo[4,5-f]quinoxaline (4,8-DiMeIQx), 2- amino-3,7,8-trimethylimidazo[4,5-f]quinoxaline, 2-amino -1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine, and 2- amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Dietary meat consumption data (g/day), including meat type and cooking method, were gathered from food-frequency questionnaires completed by 497 randomly sampled Chinese men and women aged 20-59 yr. PhIP, MeIQx, and 4,8-DiMeIQx were the most abundant HAAs detected. Total HAA concentrations ranged from roasted pork had the highest levels. The estimated mean daily exposure to HAA was 49.95 ng/day (P10 14.0 ng/day, P90 95.8 ng/day); this was 50% higher among younger (20-39 yr) compared with older individuals. Seven specific meat-cooking method combinations contributed 90.1% of this intake, namely, pan-fried fish, pork, and chicken, deep-fried chicken as well as fish, roasted/barbecued pork, and grilled minced beef.
Parvez, Shahid; Frost, Kali; Sundararajan, Madhura
2017-05-20
In the absence of shorter term disinfectant byproducts (DBPs) data on regulated Trihalomethanes (THMs) and Haloacetic acids (HAAs), epidemiologists and risk assessors have used long-term annual compliance (LRAA) or quarterly (QA) data to evaluate the association between DBP exposure and adverse birth outcomes, which resulted in inconclusive findings. Therefore, we evaluated the reliability of using long-term LRAA and QA data as an indirect measure for short-term exposure. Short-term residential tap water samples were collected in peak DBP months (May-August) in a community water system with five separate treatment stations and were sourced from surface or groundwater. Samples were analyzed for THMs and HAAs per the EPA (U.S. Environmental Protection Agency) standard methods (524.2 and 552.2). The measured levels of total THMs and HAAs were compared temporally and spatially with LRAA and QA data, which showed significant differences ( p water stations showed higher levels than LRAA or QA. Significant numbers of samples in surface water stations exceeded regulatory permissible limits: 27% had excessive THMs and 35% had excessive HAAs. Trichloromethane, trichloroacetic acid, and dichloroacetic acid were the major drivers of variability. This study suggests that LRAA and QA data are not good proxies of short-term exposure. Further investigation is needed to determine if other drinking water systems show consistent findings for improved regulation.
de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M
2014-04-21
A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.
Gibis, Monika; Weiss, Jochen
2017-08-15
Microcrystalline cellulose (MCC) or carboxymethyl cellulose (CMC) can be used as fat replacers; both are nondigestible fibers. As water-holding compounds, the impact of added CMC or MCC was studied concerning the formation of heterocyclic amines (HAAs). Low-fat patties with 0.5-3% MCC/CMC were prepared using 90% of beef and 10% of an aqueous fiber dispersion and were determined for HAA-levels after grilling. The HAAs in patties containing CMC(MCC) were found in the following concentrations; MeIQx (2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline) 0.6-2.7 (0.9-3.3)ng/g, 4,8-DiMeIQx (2-Amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline) n.d.-1.5 (n.d.-2.2)ng/g and PhIP (2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine) 0.03-0.3 (0.06-0.2)ng/g. The patties clearly contained lower HAA-levels with increasing addition of CMC or MCC. A continuous increase of the concentrations of comutagenic harman was observed (CMC: 1.2-13.2; MCC: 5.2-11.4ng/g) for increasing levels of fibers and a slight decrease of the content of norharman for MCC (0.5-1.6ng/g). No clear tendency was found for norharman using CMC (0.3-1.1ng/g). Copyright © 2017 Elsevier Ltd. All rights reserved.
Prospects for Closer Israeli-NATO Cooperation
2015-09-01
Actions and Arab Perceptions.” In The Middle East and the United States, 5th ed., edited by David W. Lesch and Mark L. Haas, 177–96. Boulder, CO...Ibid. 110 David W. Lesch, Mark L. Haas, eds., The Middle East and the United States, 5th ed. (Boulder, CO, Westview Press, 2014), 2 21 beginning...to Israel in 2005, NATO Secretary General Jaap de Hoop Scheffer stated, “the interplay of Middle Eastern and transatlantic security is becoming
International Nuclear Information System (INIS)
Tan, Connieal; Wang, Yiru; Deng, Zhuo; Xu, Na; Song, Xinhong; Liu, Haihong; Rong, Mingcong; Chen, Xi
2014-01-01
We report on a preconcentration disk for the determination of trace amounts of heterocyclic aromatic amines (HAAs) in the groups of quinoline and quinoxaline congeners as possible human carcinogens. The disk is based on nanocomposite (NC) prepared from graphene oxide as the precursor and from gold nanoparticles that act as building blocks to form a three-dimensional NC. If deposited in the sampling valve of a HPLC system, the material displays excellent extraction capability for HAAs owing to its large surface and π-π stacking interaction. Following an optimization of the extraction parameters, the method was successfully applied to the simultaneous determination of polar HAAs in meat samples with detection limit of 0.09 to 0.16 ng g −1 and recoveries of 69.5 to 122.7 %. The disk was used in more than 150 subsequent preconcentration cycles without obvious loss of the absorption capability. The results reveal that this new NC represents an excellent sorbent for purposes of preconcentration. (author)
Andra, Syam S; Makris, Konstantinos C; Botsaris, George; Charisiadis, Pantelis; Kalyvas, Harris; Costa, Costas N
2014-02-15
Changes in disinfectant type could trigger a cascade of reactions releasing pipe-anchored metals/metalloids into finished water. However, the effect of pre-formed disinfection by-products on the release of sorbed contaminants (arsenic-As in particular) from drinking water distribution system pipe scales remains unexplored. A bench-scale study using a factorial experimental design was performed to evaluate the independent and interaction effects of trihalomethanes (TTHM) and haloacetic acids (HAA) on arsenic (As) release from either scales-only or scale-biofilm conglomerates (SBC) both anchored on asbestos/cement pipe coupons. A model biofilm (Pseudomonas aeruginosa) was allowed to grow on select pipe coupons prior experimentation. Either TTHM or HAA individual dosing did not promote As release from either scales only or SBC, detecting water. In the case of scales-only coupons, the combination of the highest spike level of TTHM and HAA significantly (pwater in pipe networks remains to be investigated in the field. Copyright © 2013 Elsevier B.V. All rights reserved.
Effect of structural disorder on quantum oscillations in graphite
Energy Technology Data Exchange (ETDEWEB)
Camargo, B. C., E-mail: b.c-camargo@yahoo.com.br; Kopelevich, Y. [Instituto de Fisica Gleb Wataghin, Universidade Estadual de Campinas, Unicamp 13083-970, Campinas, São Paulo (Brazil); Usher, A.; Hubbard, S. B. [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)
2016-01-18
We have studied the effect of structural disorder on the de Haas van Alphen and Shubnikov de Haas quantum oscillations measured in natural, Kish, and highly oriented pyrolytic graphite samples at temperatures down to 30 mK and at magnetic fields up to 14 T. The measurements were performed on different samples characterized by means of x-ray diffractometry, transmission electron microscopy, and atomic-force microscopy techniques. Our results reveal a correlation between the amplitude of quantum oscillations and the sample surface roughness.
Aerosol behaviour modeling and measurements
Energy Technology Data Exchange (ETDEWEB)
Gieseke, J A; Reed, L D [Batelle Memorial Institute, Columbus, OH (United States)
1977-01-01
Aerosol behavior within Liquid Metal Fast Breeder Reactor (LMFBR) containments is of critical importance since most of the radioactive species are expected to be associated with particulate forms and the mass of radiologically significant material leaked to the ambient atmosphere is directly related to the aerosol concentration airborne within the containment. Mathematical models describing the behavior of aerosols in closed environments, besides providing a direct means of assessing the importance of specific assumptions regarding accident sequences, will also serve as the basic tool with which to predict the consequences of various postulated accident situations. Consequently, considerable efforts have been recently directed toward the development of accurate and physically realistic theoretical aerosol behavior models. These models have accounted for various mechanisms affecting agglomeration rates of airborne particulate matter as well as particle removal rates from closed systems. In all cases, spatial variations within containments have been neglected and a well-mixed control volume has been assumed. Examples of existing computer codes formulated from the mathematical aerosol behavior models are the Brookhaven National Laboratory TRAP code, the PARDISEKO-II and PARDISEKO-III codes developed at Karlsruhe Nuclear Research Center, and the HAA-2, HAA-3, and HAA-3B codes developed by Atomics International. Because of their attractive short computation times, the HAA-3 and HAA-3B codes have been used extensively for safety analyses and are attractive candidates with which to demonstrate order of magnitude estimates of the effects of various physical assumptions. Therefore, the HAA-3B code was used as the nucleus upon which changes have been made to account for various physical mechanisms which are expected to be present in postulated accident situations and the latest of the resulting codes has been termed the HAARM-2 code. It is the primary purpose of the HAARM
Features of Hepatitis in Hepatitis-associated Aplastic Anemia: Clinical and Histopathologic Study.
Patel, Kalyani R; Bertuch, Alison; Sasa, Ghadir S; Himes, Ryan W; Wu, Hao
2017-01-01
Hepatitis-associated aplastic anemia (HAA) is a rare variant of aplastic anemia in which patients present with severe pancytopenia after an episode of acute hepatitis. The marrow failure is often rapid, severe, and usually fatal if untreated. The preceding hepatitis is largely under-studied. Retrospective study of the clinical and histopathologic features of hepatitis in pediatric patients who subsequently developed aplastic anemia and comparison with consecutive cases of acute liver failure and random cases of autoimmune hepatitis during the same time frame. All 7 patients of HAA had significant elevations in aminotransferases and conjugated hyperbilirubinemia at initial presentation. Echoing liver function indices, cholestatic hepatitis with sinusoidal obstruction-type endothelial injury was seen histomorphologically. Autoimmune hepatitis serology such as anti-F-actin, anti-liver/kidney microsome, and hypergammaglobulinemia was negative in all patients. Five of 7 patients (71.4%) had, however, elevated antinuclear antibody, all with a speckled pattern. Hepatitis virus serology was negative in all patients. By immunohistochemical staining, the lobular CD8/CD4 lymphocyte ratio was markedly elevated in all of the initial samples with significant reduction in this ratio (P = 0.03) in 3 patients post treatment (ursodiol, antibiotics, and/or immunosuppressive therapy). Hepatitis preceding HAA is characterized by marked elevation of aminotransferases, conjugated hyperbilirubinemia, elevated antinuclear antibody with a speckled pattern, cholestatic hepatitis with sinusoidal obstruction morphology, and CD8 dominant lobular infiltrates. The present study suggests HAA may result from cytotoxic T-cell-mediated sinusoidal endothelial and hepatocytic injury.
The isolation of beryllium and mercury from lithium chloride solution by means of gas extraction
International Nuclear Information System (INIS)
Sevast'yanov, A.I.; Chepovoj, V.I.
1988-01-01
The possibility and optimal conditions of beryllium and mercury extraction using acetylacetone (HAA) from lithium chloride solution by argon blowing through the solution are determined. Dependences of extraction degrees and distribution coefficients on different parameters of liquid phase: initial pH value, lithium chloride concentration and initial content of HAA, are presented. The degree of beryllium extraction reaches the maximum at liquid phase pH of 4.4-5.25 and concentration of lithium chloride of 8.5 mol/l. Distribution coefficient changes in inverse proportion to the extraction degree
Removal of haloacetic acids from swimming pool water by reverse osmosis and nanofiltration.
Yang, Linyan; She, Qianhong; Wan, Man Pun; Wang, Rong; Chang, Victor W-C; Tang, Chuyang Y
2017-06-01
Recent studies report high concentrations of haloacetic acids (HAAs), a prevalent class of toxic disinfection by-products, in swimming pool water (SPW). We investigated the removal of 9 HAAs by four commercial reverse osmosis (RO) and nanofiltration (NF) membranes. Under typical SPW conditions (pH 7.5 and 50 mM ionic strength), HAA rejections were >60% for NF270 with molecular weight cut-off (MWCO) equal to 266 Da and equal or higher than 90% for XLE, NF90 and SB50 with MWCOs of 96, 118 and 152 Da, respectively, as a result of the combined effects of size exclusion and charge repulsion. We further included 7 neutral hydrophilic surrogates as molecular probes to resolve the rejection mechanisms. In the absence of strong electrostatic interaction (e.g., pH 3.5), the rejection data of HAAs and surrogates by various membranes fall onto an identical size-exclusion (SE) curve when plotted against the relative-size parameter, i.e., the ratio of molecular radius over membrane pore radius. The independence of this SE curve on molecular structures and membrane properties reveals that the relative-size parameter is a more fundamental SE descriptor compared to molecular weight. An effective molecular size with the Stokes radius accounting for size exclusion and the Debye length accounting for electrostatic interaction was further used to evaluate the rejection. The current study provides valuable insights on the rejection of trace contaminants by RO/NF membranes. Copyright © 2017. Published by Elsevier Ltd.
Wu, Shimin; Anumol, Tarun; Gandhi, Jay; Snyder, Shane A
2017-03-03
The addition of oxidants for disinfecting water can lead to the formation of potentially carcinogenic compounds referred to as disinfection byproducts (DBPs). Haloacetic acids (HAAs) are one of the most widely detected DBPs in US water utilities and some of them are regulated by the US Environmental Protection Agency (USEPA). The present study developed a method to analyze all the compounds in the USEPA method 557 (nine HAAs, bromate and dalapon) plus four potentially more toxic iodinated HAAs in water by coupling ion chromatography with tandem mass spectrometry (IC-MS/MS). This aqueous direct injection method has significant advantages over traditional GC methods, which require a derivatization and sample extraction that are laborious, time-consuming, and can negatively impact reproducibility. The method developed in this study requires half the time of the current USEPA method 557 on IC-MS/MS while including more compounds and achieving sub-μg/L level method detection limits (MDLs) for all 15 target analytes. The single laboratory lowest concentration minimum reporting level (LCMRL) has also been determined in reagent water, which ranged from 0.011 to 0.62μg/L for the analytes. The mean recoveries of the analytes during matrix spike recovery tests were 77-125% in finished drinking water and 81-112% in surface water. This method was then applied to untreated, chlorinated, and chloraminated groundwater and surface water samples. Bromate and 9 HAAs were detected at different levels in some of these samples. Copyright © 2017 Elsevier B.V. All rights reserved.
Flexible Airspace Management (FAM) Research 2010 Human-in-the-Loop Simulation
Lee, Paul U.; Brasil, Connie; Homola, Jeffrey; Kessell, Angela; Prevot, Thomas; Smith, Nancy
2011-01-01
A human-in-the-Ioop (HITL) simulation was conducted to assess potential user and system benefits of Flexible Airspace Management (FAM) concept, as well as designing role definitions, procedures, and tools to support the FAM operations in the mid-term High Altitude Airspace (HAA) environment. The study evaluated the benefits and feasibility of flexible airspace reconfiguration in response to traffic overload caused by weather deviations, and compared them to those in a baseline condition without the airspace reconfiguration. The test airspace consisted of either four sectors in one Area of Specialization or seven sectors across two Areas. The test airspace was assumed to be at or above FL340 and fully equipped Vvith data communications (Data Comm). Other assumptions were consistent with those of the HAA concept. Overall, results showed that FAM operations with multiple Traffic Management Coordinators, Area Supervisors, and controllers worked remarkably well. The results showed both user and system benefits, some of which include the increased throughput, decreased flight distance, more manageable sector loads, and better utilized airspace. Also, the roles, procedures, airspace designs, and tools were all very well received. Airspace configuration options that resulted from a combination of algorithm-generated airspace configurations with manual modifications were well acceptec and posed little difficuIty and/or workload during airspace reconfiguration process. The results suggest a positive impact of FAM operations in HAA. Further investigation would be needed to evaluate if the benefits and feasibility would extend in either non-HAA or mixed equipage environment.
Seltskond : [fotod] / tekst ja fotod Annika Haas
2008-01-01
8. dets. esitles Helle Michelson Eesti Lastekirjanduse Keskuses mälestusteraamatut "Lehitsetud leheküljed: Meenutusi elust ja lastekirjandusest" (Tallinn : Tänapäev, 2008) Kohal viibisid lastekirjanikud Ellen Niit, Jaak Urmet jt.
USA kiidetud noise-rock Eestis / Annika Haas
Haas, Annika
2008-01-01
Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel ja annab kaks kontserti - 13. nov. Tallinnas klubis Tapper ja 15. nov. Tartus klubis Trehv)
Seltskond : [fotod] / tekst ja fotod Annika Haas
2008-01-01
29. mail tutvustasid autorid oma lasteraamatuid Eesti Lastekirjanduse Keskuses: Kass, Kristiina. Petra lood. [Tallinn] : Tänapäev, 2008 ; Vainola, Kätlin. Mia, Konrad ja avanevad uksed : [jutustus] / pildid joonistanud Toomas Pääsuke. [Tallinn] : Tänapäev, 2008 ; Saarna, Meelike. Mattias ja mamma. [Tallinn] : Tänapäev, 2008
Magneto-transporte em sistemas semicondutores com gas de eletrons bidimensional
Alvaro Guedes Soares
1994-01-01
Resumo: O objetivo básico deste trabalho foi a implantação de técnicas de magneto-transporte em heteroestruturas semicondutoras que apresentam gás de elétron bidimensional (2-DEG), particularmente, o Efeito Shubnikov-de Haas (SdH) e Efeito Hall Quântico (QHE). Neste sentido foi realizada a recuperação de uma bobina supercondutora (criostato e sistema de controle) que permite medidas em campo magnético de até 14 Tesla. Medidas de oscilações Shubnikov-de Haas e Efeito Hall Quântico foram fei...
Disinfection By-Product Exposures and the Risk of Specific Cardiac Birth Defects
Wright, J. Michael; Evans, Amanda; Kaufman, John A.; Rivera-Núñez, Zorimar; Narotsky, Michael G.
2016-01-01
Background: Epidemiological studies suggest that women exposed to disinfection by-products (DBPs) have an increased risk of delivering babies with cardiovascular defects (CVDs). Objective: We examined nine CVDs in relation to categorical DBP exposures including bromoform, chloroform, dibromochloromethane (DBCM), bromodichloromethane (BDCM), monobromoacetic acid (MBAA), dichloroacetic acid (DCAA), trichloroacetic acid (TCAA), and summary DBP measures (HAA5, THMBr, THM4, and DBP9). Methods: We calculated adjusted odds ratios (aORs) in a case–control study of birth defects in Massachusetts with complete quarterly 1999–2004 trihalomethane (THM) and haloacetic acid (HAA) data. We randomly matched 10 controls each to 904 CVD cases based on week of conception. Weight-averaged aggregate first-trimester DBP exposures were assigned to individuals based on residence at birth. Results: We detected associations for tetralogy of Fallot and the upper exposure categories for TCAA, DCAA, and HAA5 (aOR range, 3.34–6.51) including positive exposure–response relationships for DCAA and HAA5. aORs consistent in magnitude were detected between atrial septal defects and bromoform (aOR = 1.56; 95% CI: 1.01, 2.43), as well as DBCM, chloroform, and THM4 (aOR range, 1.26–1.67). Ventricular septal defects (VSDs) were associated with the highest bromoform (aOR = 1.85; 95% CI: 1.20, 2.83), MBAA (aOR = 1.81; 95% CI: 0.85, 3.84), and DBCM (aOR = 1.54; 95% CI: 1.00, 2.37) exposure categories. Conclusions: To our knowledge, this is the first birth defect study to develop multi-DBP adjusted regression models as well as the first CVD study to evaluate HAA exposures and the second to evaluate bromoform exposures. Our findings, therefore, inform exposure specificity for the consistent associations previously reported between THM4 and CVDs including VSDs. Citation: Wright JM, Evans A, Kaufman JA, Rivera-Núñez Z, Narotsky MG. 2017. Disinfection by-product exposures and the risk of specific
Melo, A; Faria, M A; Pinto, E; Mansilha, C; Ferreira, I M P L V O
2016-10-01
Water disinfection plays a crucial role in water safety but it is also a matter of concern as the use of disinfectants promotes the formation of disinfection by-products (DBPs). Haloacetic acids (HAAs) are one of the major classes of DBPs since they are frequently found in treated water, are ubiquitous, pervasive and have high water solubility, so a great concern emerged about their formation, occurrence and toxicity. Exposure to HAAs is influenced by consumption patterns and diet of individuals thus their bioavailability is an important parameter to the overall toxicity. In the current study the bioacessibility of the most representative HAAs (chloroacetic acid - MCAA, bromoacetic acid - MBAA, dichloroacetic acid - DCAA, dibromoacetic acid - DBAA, and trichloroacetic acid - TCAA) after simulated in vitro digestion (SIVD) in tap water and transport across Caco-2 monolayers was evaluated. Compounds were monitored in 8 points throughout the digestion phases by an optimized LC-MS/MS methodology. MCAA and MBAA were not bioaccessible after SIVD whereas DCAA, DBAA and TCAA are highly bioaccessible (85 ± 4%, 97 ± 4% and 106 ± 7% respectively). Concerning transport assays, DCAA and DBAA were highly permeable throughout the Caco-2 monolayer (apparent permeability and calculated fraction absorbed of 13.62 × 10(-6) cm/s and 90% for DCAA; and 8.82 × 10(-6) cm/s and 84% for DBAA), whereas TCAA showed no relevant permeability. The present results may contribute to efficient risk analysis studies concerning HAAs oral exposure from tap water taking into account the different biological behaviour of these chemically similar substances. Copyright © 2016 Elsevier Ltd. All rights reserved.
Antioxidant activity of rice plants sprayed with herbicides
Directory of Open Access Journals (Sweden)
Marcos André Nohatto
2016-03-01
Full Text Available Understanding the physiological defense behavior of plants subjected to herbicide application may help to identify products with higher or lower capacity to cause oxidative stress in crops. This study aimed at evaluating the effect of herbicides in the antioxidant activity of rice plants. The experimental design was completely randomized, with six replications. Treatments consisted of the herbicides bentazon (photosystem II inhibitor; 960 g ha-1, penoxsulam (acetolactate synthase inhibitor; 60 g ha-1, cyhalofop-butyl (acetyl coenzyme-A carboxylase inhibitor; 315 g ha-1 and a control. After the herbicides application, samples of rice shoots were collected at 12, 24, 48 and 96 hours after application (HAA. The components evaluated were hydrogen peroxide (H2O2, lipid peroxidation and activity of the antioxidant enzymes superoxide dismutase (SOD and catalase (CAT. Bentazon (up to 24 HAA and penoxsulam (48 and 96 HAA reduced the CAT activity. Moreover, these herbicides increased the levels of H2O2, lipid peroxidation and SOD activity, indicating a condition of oxidative stress in rice plants. The cyhalofop-butyl herbicide did not alter the antioxidant activity, showing that it causes less stress to the crop.
Advanced oxidation processes of decomposing dichloroacetic acid and trichloroacetic acid in water
Institute of Scientific and Technical Information of China (English)
WANG Kun-ping; GUO Jin-song; YANG Min; JUNJI Hirotsuji; DENG Rong-sen; LIU Wei
2008-01-01
We studied the decomposition of two haloacetic acids (HAAs), dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), in water by single oxidants ozone (O3) and ultraviolet radiation (UV) and the advanced oxidation processes (AOPs) constituted by the combinations of O3/UV, H2O2/UV, O3 /H2O2, and O3/H2O2/UV. The concentrations of HAAs were analyzed at specified time intervals to track their decomposition. Except for O3 and UV, the four combined oxidation processes remarkably enhance the decomposition of DCAA and TCAA owing to the generated very reactive hydroxyl radicals. The fastest decomposition process is O3/H2O2/UV, closely followed by O3/UV. DCAA is much easier to decompose than TCAA. The kinetics of HAA decomposition by O3/UV can be described well by a pseudo first-order reaction model under a constant initial dissolved O3 concentration and fixed UV radiation. Humic acids and HCO3- in the reaction system both decrease the decomposition rate constants for DCAA and TCAA. The amount of H2O2 accumulates in the presence of humic acids in the O3/UV process.
Mallik, Prabhat K; Shi, Hua; Pande, Jayanti
2017-09-16
The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.
Reductive dehalogenation of haloacetic acids by hemoglobin-loaded carbon nanotube electrode.
Li, Yu-Ping; Cao, Hong-Bin; Zhang, Yi
2007-01-01
Hemoglobin (Hb) was immobilized on carbon nanotube (CNT) electrode to catalyze the dehalogenation of haloacetic acids (HAAs). FTIR and UV measurements were performed to investigate the activity-keep of Hb after immobilization on CNT. The electrocatalytic behaviors of the Hb-loaded electrode for the dehalogenation of HAAs were studied by cyclic voltammmetry and constant-potential electrolysis technique. An Hb-loaded packed-bed flow reactor was also constructed for bioelectrocatalytic dehalogenation of HAAs. The results showed that Hb retained its nature, the essential features of its native secondary structure, and its biocatalytic activity after immobilization on CNT. Chloroacetic acids and bromoacetic acids could be dehalogenated completely with Hb catalysis through a stepwise dehalogenation process at -0.400V (vs. saturated calomel electrode (SCE)) and -0.200V (vs. SCE), respectively. The removal of 10.5mM trichloroacetic acid and dichloroacetic acid is ca. 97% and 63%, respectively, with electrolysis for 300min at -0.400V (vs. SCE) using the Hb-loaded packed-bed flow reactor, and almost 100% of tribromoacetic acid and dibromoacetic acid was removed with electrolysis for 40min at -0.200V (vs. SCE). The average current efficiency of Hb-catalytic dehalogenation almost reaches 100%.
Rosa, M; Lucchi, P; Mariani, L; Caprioglio, A
2012-09-01
The purpose of this study was to evaluate the effectiveness of Haas RPE anchored on deciduous teeth in the early mixed dentition, for inducing the spontaneous correction of permanent incisor's crossbite, without compliance, without post bite-plane and no involvement of the permanent teeth. The sample group comprised 50 consecutive patients (mean age 8y 5m, SD 2y 1m), 31 males, 19 females. They showed a cross-bite affecting one or more permanent incisors, for a total of 70 teeth. The patients were treated with Haas RPE appliance anchored on second deciduous molars and bonded on deciduous canines. No direct forces were applied on the permanent teeth. Anterior crossbite self-corrected 'spontaneously' in 84% of the cases. Lateral incisors had a higher rate of self-correction than central incisors. All hyper-divergent subjects showed a spontaneous crossbite self-correction. The early maxillary expansion by Haas RPE anchored on deciduous teeth is an efficient and effective procedure to induce the anterior crossbite self-correction in the early mixed dentition without the need of a bite-plane, no involvement of the permanent teeth and without compliance.
International Nuclear Information System (INIS)
Debbah, Merouane; Matthes, Ruediger; Isabelle Deltour; Veyret, Bernard; Mann, Simon; Van Rongen, Eric; Laurent, L.; Celli, Bernard; Wiedemann, Peter; Ravazzani, P.; Rowley, Jack; Wiart, Joe
2012-12-01
This 2012 edition of the annual meeting devoted to the electromagnetic waves and to their interactions with the human being was the occasion to tackle the problem of RF waves under various aspects: technological, biological, epidemiological, societal, risk management. This document gathers the available presentations (slides) given during the meeting and dealing with: 1 - Green Small Cell Flexible Networks (Debbah, M.); 2 - Electromagnetic Fields - The ICNIRP View (Matthes, R.); 3 - IARC Research Actions on Radio-frequencies (Deltour, I.); 4 - Research activity worldwide on mobile telephony and health/Review of international research on RF bio-effects (Veyret, B.); 5 - HPA Research on RF Exposures (Mann, S.); 6 - The Dutch research programme 'Electromagnetic Fields and Health' (Van Rongen, E.); 7 - National Programme 'Occupational and environmental health and safety' of ANSES (Laurent, L.); 8 - ANFR and public exposure to radioelectric waves (Celli, B.); 9 - EMF exposure and risk perception: Challenges and needs of the next decade (Wiedemann, P.); 10 - The EFHRAN project: an European experience of EMF Health Risk Assessment (Ravazzani, P.); 11 - Mobile Networks: Exposure Levels (Rowley, J.); 12 - Lexnet, low EMF exposure future networks (Wiart, J.)
Ni, Weijuan; McNaughton, Lynn; LeMaster, David M; Sinha, Rashmi; Turesky, Robert J
2008-01-09
The concentrations of heterocyclic aromatic amines (HAAs) were determined, by liquid chromatography-electrospray ionization/tandem mass spectrometry (LC-ESI-MS/MS), in 26 samples of beef, pork, and chicken cooked to various levels of doneness. The HAAs identified were 2-amino-3-methylimidazo[4,5- f]quinoline, 2-amino-1-methylimidazo[4,5- b]quinoline, 2-amino-1-methylimidazo[4,5- g]quinoxaline (I gQx), 2-amino-3-methylimidazo[4,5- f]quinoxaline, 2-amino-1,7-dimethylimidazo[4,5- g]quinoxaline (7-MeI gQx), 2-amino-3,8-dimethylimidazo[4,5- f]quinoxaline, 2-amino-1,6-dimethyl-furo[3,2- e]imidazo[4,5- b]pyridine, 2-amino-1,6,7-trimethylimidazo[4,5- g]quinoxaline, 2-amino-3,4,8-trimethylimidazo[4,5- f]quinoxaline, 2-amino-1,7,9-trimethylimidazo[4,5- g]quinoxaline, 2-amino-1-methyl-6-phenylimidazo[4,5- b]pyridine (PhIP), 2-amino-9 H-pyrido[2,3- b]indole, and 2-amino-3-methyl-9 H-pyrido[2,3- b]indole. The concentrations of these compounds ranged from chicken (up to 305 microg/kg), broiled bacon (16 microg/kg), and pan-fried bacon (4.9 microg/kg). 7-MeI gQx was the most abundant HAA formed in very well done pan-fried beef and steak, and in beef gravy, at concentrations up to 30 microg/kg. Several other linear tricyclic ring HAAs containing the I gQx skeleton are formed at concentrations in cooked meats that are relatively high in comparison to the concentrations of their angular tricyclic ring isomers, the latter of which are known experimental animal carcinogens and potential human carcinogens. The toxicological properties of these recently discovered I gQx derivatives warrant further investigation and assessment.
Wynes, Jacob; Lamm, Bradley M; Andrade, Bijan J; Malay, D Scot
2016-01-01
We used preoperative radiographic and intraoperative anatomic measurements to predict and achieve, respectively, the precise amount of capital fragment lateral translation required to restore anatomic balance to the first metatarsophalangeal joint. Correlation was used to relate the amount of capital fragment translation and operative reduction of the first intermetatarsal angle (IMA), hallux abductus angle (HAA), tibial sesamoid position (TSP), metatarsus adductus angle, and first metatarsal length. The mean capital fragment lateral translation was 5.54 ± 1.64 mm, and the mean radiographic reductions included a first IMA of 5.04° ± 2.85°, an HAA of 9.39° ± 8.38°, and a TSP of 1.38 ± 0.9. These changes were statistically (p < .001) and clinically (≥32.55%) significant. The mean reduction of the metatarsus adductus angle was 0.66° ± 4.44° and that for the first metatarsal length was 0.33 ± 7.27 mm, and neither of these were statistically (p = .5876 and 0.1247, respectively) or clinically (≤3.5%) significant. Pairwise correlations between the amount of lateral translation of the capital fragment and the first IMA, HAA, and TSP values were moderately positive and statistically significant (r = 0.4412, p = .0166; r = 0.5391, p = .0025; and r = 0.3729, p = .0463; respectively). In contrast, the correlation with metatarsus adductus and the first metatarsal shortening were weak and not statistically significant (r = 0.2296, p = .2308 and r = -0.2394, p = .2109, respectively). The results of our study indicate that predicted preoperative and executed intraoperative lateral translation of the capital fragment correlates with statistically and clinically significant reductions in the first IMA, HAA, and TSP. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.
Yang, Xue; Li, Yunliang; Li, Suyun; Oladejo, Ayobami Olayemi; Wang, Yucheng; Huang, Shanfen; Zhou, Cunshan; Wang, Yang; Mao, Li; Zhang, Yanyan; Ma, Haile; Ye, Xiaofei
2017-09-01
The effects of ultrasonic frequency mode, power density, pretreatment time and other parameters under low power density on the degree of hydrolysis (DH) of defatted wheat germ protein (DWGP) and angiotensin-I-converting enzyme (ACE) inhibitory activity of DWGP hydrolysate were studied in this research. Ultraviolet-visible (UV-Vis) spectra, free sulfhydryl (SH), disulfide bond (SS), surface hydrophobicity and hydrophobic protein content of ultrasound-pretreated protein and hydrophobic amino acid (HAA) content of alcalase-hydrolysate of DWGP were measured under optimized ultrasonic condition. The ultrasonic frequency mode with dual-fixed frequency combination of 28/40kHz showed higher ACE inhibitory activity of DWGP hydrolysate compared with that of other ultrasound frequency modes and all the ultrasonic frequency combinations involving in 28kHz showed higher ACE inhibitory activity. Under the dual-fixed frequency ultrasound mode of 28/40kHz, ultrasonic power density of 60W/L, pretreatment time of 70min, temperature of 60°C and substrate concentration of 60g/L, the ACE inhibitory activity of DWGP hydrolysate was the highest with its value of 74.75% (increased by 62.30% compared to control). However, all the ultrasonic pretreatment did not increase the DH of DWGP significantly (p>0.05). The changes in UV-Vis spectra, SH and SS groups, surface hydrophobicity and hydrophobic protein content indicated that the structure of DWGP unfolded after ultrasound pretreatment. The HAA content of hydrolysate from the pretreated DWGP increased significantly (p<0.05). The results proved that ultrasound pretreatment loosed the protein structure and exposed more HAA residues of protein to be attacked easily by alcalase. This resulted in the increase in the HAA content which related to the ACE inhibitory activity. Copyright © 2017 Elsevier B.V. All rights reserved.
Maya-Meraz, Irma O; Espino-Díaz, Miguel; Molina-Corral, Francisco J; González-Aguilar, Gustavo A; Jacobo-Cuellar, Juan L; Sepulveda, David R; Olivas, Guadalupe I
2014-11-01
One of the main quality parameters in apples is aroma, its main precursors are fatty acids (FA) and amino acids (AA). In this study, alginate edible coatings were used as carriers of linoleic acid or isoleucine to serve as precursors for the production of aroma in cut apples. Apple wedges were immersed in a CaCl2 solution and coated with one of the following formulations: alginate solution (Alg-Ca), Alg-Ca-low-level linoleic acid (0.61 g/Lt), (LFA), Alg-Ca-high-level linoleic acid (2.44 g/L; HFA), Alg-Ca-low-level isoleucine (0.61 g/L; LAA), and Alg-Ca-high-level isoleucine (2.44 g/L; HAA). Apple wedges were stored at 3 °C and 85% relative humidity for 21 d and key volatiles were studied during storage. Addition of precursors, mainly isoleucine, showed to increase the production of some key volatiles on coated fresh-cut apples during storage. The concentration of 2-methyl-1-butanol was 4 times higher from day 12 to day 21 in HAA, while 2-methyl butyl acetate increased from day 12 to day 21 in HAA. After 21 d, HAA-apples presented a 40-fold value of 2-methyl-butyl acetate, compared to Alg-Ca cut apples. Values of hexanal increased during cut apple storage when the coating carried linoleic acid, mainly on HFA, from 3 to 12 d. The ability of apples to metabolize AA and FA depends on the concentration of precursors, but also depends on key enzymes, previous apple storage, among others. Further studies should be done to better clarify the behavior of fresh-cut apples as living tissue to metabolize precursors contained in edible coatings for the production of volatiles. © 2014 Institute of Food Technologists®
International Nuclear Information System (INIS)
Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Le Hegarat, Ludovic; Aninat, Caroline; Robin, Marie-Anne; Guguen-Guillouzo, Christiane
2010-01-01
Human exposure to heterocyclic aromatic amines (HAA) usually occurs through mixtures rather than individual compounds. However, the toxic effects and related mechanisms of co-exposure to HAA in humans remain unknown. We compared the effects of two of the most common HAA, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), individually or in combination, in the metabolically competent human hepatoma HepaRG cells. Various endpoints were measured including cytotoxicity, apoptosis, oxidative stress and DNA damage by the comet assay. Moreover, the effects of PhIP and/or MeIQx on mRNA expression and activities of enzymes involved in their activation and detoxification pathways were evaluated. After a 24 h treatment, PhIP and MeIQx, individually and in combination, exerted differential effects on apoptosis, oxidative stress, DNA damage and cytochrome P450 (CYP) activities. Only PhIP induced DNA damage. It was also a stronger inducer of CYP1A1 and CYP1B1 expression and activity than MeIQx. In contrast, only MeIQx exposure resulted in a significant induction of CYP1A2 activity. The combination of PhIP with MeIQx induced an oxidative stress and showed synergistic effects on apoptosis. However, PhIP-induced genotoxicity was abolished by a co-exposure with MeIQx. Such an inhibitory effect could be explained by a significant decrease in CYP1A2 activity which is responsible for PhIP genotoxicity. Our findings highlight the need to investigate interactions between HAA when assessing risks for human health and provide new insights in the mechanisms of interaction between PhIP and MeIQx.
Observation of Rashba zero-field spin splitting in a strained germanium 2D hole gas
International Nuclear Information System (INIS)
Morrison, C.; Rhead, S. D.; Foronda, J.; Leadley, D. R.; Myronov, M.; Wiśniewski, P.
2014-01-01
We report the observation, through Shubnikov-de Haas oscillations in the magnetoresistance, of spin splitting caused by the Rashba spin-orbit interaction in a strained Ge quantum well epitaxially grown on a standard Si(001) substrate. The Shubnikov-de Haas oscillations display a beating pattern due to the spin split Landau levels. The spin-orbit parameter and Rashba spin-splitting energy are found to be 1.0 × 10 −28 eVm 3 and 1.4 meV, respectively. This energy is comparable to 2D electron gases in III-V semiconductors, but substantially larger than in Si, and illustrates the suitability of Ge for modulated hole spin transport devices.
Disinfection byproduct formation in drinking water sources: A case study of Yuqiao reservoir.
Zhai, Hongyan; He, Xizhen; Zhang, Yan; Du, Tingting; Adeleye, Adeyemi S; Li, Yao
2017-08-01
This study investigated the potential formation of disinfection byproducts (DBPs) during chlorination and chloramination of 20 water samples collected from different points of Yuqiao reservoir in Tianjin, China. The concentrations of dissolved organic matter and ammonia decreased downstream the reservoir, while the specific UV absorbance (SUVA: the ratio of UV 254 to dissolved organic carbon) increased [from 0.67 L/(mg*m) upstream to 3.58 L/(mg*m) downstream]. The raw water quality played an important role in the formation of DBPs. During chlorination, haloacetic acids (HAAs) were the major DBPs formed in most of the water samples, followed by trihalomethanes (THMs). CHCl 3 and CHCl 2 Br were the major THM species, while trichloroacetic acid (TCAA) and dichloroacetic acid (DCAA) were the major HAA species. Chloramination, on the other hand, generally resulted in lower concentrations of THMs (CHCl 3 ), HAAs (TCAA and DCAA), and haloacetonitriles (HANs). All the species of DBPs formed had positive correlations with the SUVA values, and HANs had the highest one (R 2 = 0.8). The correlation coefficients between the analogous DBP yields and the SUVA values in chlorinated samples were close to those in chloraminated samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Chiavelli Lucas U.R.
2016-01-01
Full Text Available Usually, water treatment plants employ chlorine or sodium hypochlorite during the disinfection process, ensuring that there are not any pathogenic microorganisms in water. However, chlorine might react with natural organic matter and lead to formation of potentially carcinogenic by-products regarding human health, such as haloacetic acids (HAAs. Several countries regulate the levels of these acids in drinking water. Therefore, their concentrations must be monitored with the greatest accuracy as possible. In order to achieve this goal, a method through gas chromatography coupled with mass spectrometry (GC-MS was validated and applied to the determination of HAAs in samples of water destined to the public water service provision from the city of Maringá, Paraná State, Brazil. Measurements between two periods have close recovery values, indicating that the method has good accuracy during the same day. The limits of detection (LOD and quantification (LOQ were satisfactory, with LOD 0.42 μg L-1 and LOQ 1.40 μg L-1 for dichloro-acetic acid (DCAA analysis. Recovery values obtained for the nine haloace-tics acids (HAA9 corresponded to 69.9-107.3 % for samples. The repeatability performed for two periods presented close relative standard deviation (RSD values, indicating that the method has good accuracy during the same day.
Akiyama, Megumi; Matsui, Yoshihiko; Kido, Junki; Matsushita, Taku; Shirasaki, Nobutaka
2018-06-01
The probability distributions of total potential doses of disinfection byproducts and volatile organic compounds via ingestion, inhalation, and dermal exposure were estimated with Monte Carlo simulations, after conducting physiologically based pharmacokinetic model simulations to takes into account the differences in availability between the three exposures. If the criterion that the 95th percentile estimate equals the TDI (tolerable daily intake) is regarded as protecting the majority of a population, the drinking water criteria would be 140 (trichloromethane), 66 (bromodichloromethane), 157 (dibromochloromethane), 203 (tribromomethane), 140 (dichloroacetic acid), 78 (trichloroacetic acid), 6.55 (trichloroethylene, TCE), and 22 μg/L (perchloroethylene). The TCE criterion was lower than the Japanese Drinking Water Quality Standard (10 μg/L). The latter would allow the intake of 20% of the population to exceed the TDI. Indirect inhalation via evaporation from water, especially in bathrooms, was the major route of exposure to compounds other than haloacetic acids (HAAs) and accounted for 1.2-9 liter-equivalents/day for the median-exposure subpopulation. The ingestion of food was a major indirect route of exposure to HAAs. Contributions of direct water intake were not very different for trihalomethanes (30-45% of TDIs) and HAAs (45-52% of TDIs). Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
G K Singh
2017-01-01
Full Text Available Approximately, 140 million people worldwide live permanently at high altitudes (HAs and approximately another 40 million people travel to HA area (HAA every year for reasons of occupation, sports or recreation. In India, whole of Ladakh region, part of Northwest Kashmir, Northern part of Sikkim and Tenga valley of Arunachal are considered inhabited areas of HAA. The low quantity of oxygen, high exposure of ultraviolet (UV light, very low humidity, extreme subzero temperature in winter, high wind velocity, make this region difficult for lowlanders as well as for tourists. Acute mountain sickness, HA pulmonary edema, HA cerebral edema, and thromboembolic conditions are known to occur in HA. However, enough knowledge has not been shared on dermatoses peculiar to this region. Xerosis, UV-related skin disorders (tanning, photomelanosis, acute and chronic sunburn, polymorphic light eruption, chronic actinic dermatitis, actinic cheilitis, etc., cold injuries (frostbite, chilblains, acrocyanosis, erythrocyanosis, etc. nail changes (koilonychias, airborne contact dermatitis, insect bite reaction, and skin carcinoma (basal cell carcinomas, squamous cell carcinomas, and also rarely malignant melanoma are the dermatoses seen in HAAs. Early diagnosis and knowledge of HA dermatoses may prevent serious consequences of disease and improve the quality of life for the visitors as well as for native of the place.
Directory of Open Access Journals (Sweden)
Molnar Jelena J.
2012-01-01
Full Text Available This paper investigates the influence of different matrices (groundwater a realistic natural matrix and commercial humic acid solution a synthetic matrix on the nature and content of haloacetic acid (HAA precursors in ozonized water (0.4 to 3.0 mg O3/mg DOC; pH 6. Natural organic matter (NOM characterization of the natural matrix showed it was largely of hydrophobic character (65% fulvic and 14% humic acids, with the hydrophilic fractions HPIA and HPI-NA at 12% and 9%, respectively. At approximately the same dissolved organic carbon (DOC content of the investigated matrices (~10 mg /L, a greater degree of hydrophobicity was seen in the humic acid solution than in the natural matrix, resulting in a higher content of HAA precursors (559 ± 21 μg/L in the synthetic matrix compared to 309 ± 15 μg/L in the natural matrix. By applying different ozone doses (0.4 to 3.0 mg O3/mg DOC, the DOC content of the studied matrices was reduced by 6-22%, with a maximum process efficacy being achieved with 3.0 mg O3/mg DOC. Ozonation also lead to changes in the NOM structure, i.e. complete oxidation of the humic acid fractions in both investigated matrices. After oxidation, hydrophilic structures dominate the natural water matrix (65%, whereas the synthetic matrix has an equal distribution of hydrophobic and hydrophilic fractions (~50%. Changes in the content and structure of NOM during ozonation resulted in the reduction of the total HAA precursors content (63-85%, using 3.0 mg O3/mg DOC. Detailed analysis of the reactivity of the residual HAA precursor materials shows that ozonation using 3.0 mg O3/mg DOC reduced the reactivity of the NOM fractions in comparison to the raw water. By contrast, HAA precursor material present in the commercial HA solution was transformed after ozonation into other reactive compounds, i.e. precursors which originated from the fulvic acid and hydrophilic fractions. The results of the laboratory testing indicate that the
Pathak, Khyatiben V; Chiu, Ting-Lan; Amin, Elizabeth Ambrose; Turesky, Robert J
2016-03-21
Arylamines (AAs) and heterocyclic aromatic amines (HAAs) are structurally related carcinogens formed during the combustion of tobacco or cooking of meat. They undergo cytochrome P450 mediated N-hydroxylation to form metabolites which bind to DNA and lead to mutations. The N-hydroxylated metabolites of many AAs also can undergo a co-oxidation reaction with oxy-hemolgobin (HbO2) to form methemoglobin (met-Hb) and the arylnitroso intermediates, which react with the β-Cys(93) chain of Hb to form Hb-arylsulfinamide adducts. The biochemistry of arylamine metabolism has been exploited to biomonitor certain AAs through their Hb arylsulfinamide adducts in humans. We examined the reactivity of HbO2 with the N-hydroxylated metabolites of 4-aminobiphenyl (ABP, HONH-ABP), aniline (ANL, HONH-ANL), and the HAAs 2-amino-9H-pyrido[2,3-b]indole (AαC, HONH-AαC), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP, HONH-PhIP), and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx, HONH-MeIQx). HONH-ABP, HO-ANL, and HONH-AαC induced methemoglobinemia and formed Hb sulfinamide adducts. However, HONH-MeIQx and HONH-PhIP did not react with the oxy-heme complex, and met-Hb formation and chemical modification of the β-Cys(93) residue were negligible. Molecular modeling studies showed that the distances between the H-ON-AA or H-ON-HAA substrates and the oxy-heme complex of HbO2 were too far away to induce methemoglobinemia. Different conformational changes in flexible helical and loop regions around the heme pocket induced by the H-ON-AA or H-ON-HAAs may explain the different proclivities of these chemicals to induce methemoglobinemia. Hb-Cys(93β) sulfinamide and sulfonamide adducts of ABP, ANL, and AαC were identified, by Orbitrap MS, following the proteolysis of Hb with trypsin, Glu-C, or Lys-C. Hb sulfinamide and sulfonamide adducts of ABP were identified in the blood of mice exposed to ABP, by Orbitrap MS. This is the first report of the identification of intact Hb
Aasta pressifotod žürii perspektiivist / Annika Haas
Haas, Annika, 1974-
2015-01-01
Konkursist "Aasta pressifoto", pressifotograafide igapäevatööst. "Aasta pressifoto 2014" peapreemia pälvis Dmitri Kotjuhi "Noored suusatajad", portreefoto kategooria võitis Renee Altrovi "Eesti Vabariigi president", uudisfoto kategooria Margus Ansu "Klassijuhataja tunnid", olemusfoto kategooria Priit Simsoni "Kaotatud sõda"
Estimating the temporal evolution of Alzheimer's disease pathology with autopsy data.
Royall, Donald R; Palmer, Raymond F
2012-01-01
The temporal growth of Alzheimer's disease (AD) neuropathology cannot be easily determined because autopsy data are available only after death. We combined autopsy data from 471 participants in the Honolulu-Asia Aging Study (HAAS) into latent factor measures of neurofibrillary tangle and neuritic plaque counts. These were associated with intercept and slope parameters from a latent growth curve (LGC) model of 9-year change in cognitive test performance in 3244 autopsied and non-autopsied HAAS participants. Change in cognition fully mediated the association between baseline cognitive performance and AD lesions counts. The mediation effect of cognitive change on both AD lesion models effectively dates them within the period of cognitive surveillance. Additional analyses could lead to an improved understanding of lesion propagation in AD.
Presidential Green Chemistry Challenge: 1996 Designing Greener Chemicals Award
Presidential Green Chemistry Challenge 1996 award winner, Rohm and Haas, developed Sea-Nine, a marine antifoulant to control plants and animals on ship hulls. Sea-Nine replaces persistent, toxic organotin antifoulants.
Li, Shujiao; Lin, Hang; Qu, Cheng; Tang, Yuping; Shen, Juan; Li, Weixia; Yue, Shijun; Kai, Jun; Shang, Guanxiong; Zhu, Zhenhua; Zhang, Changbin; Liu, Pei; Yan, Hui; Zhang, Li; Qian, Li; Qian, Dawei; Duan, Jin-ao
2015-07-21
The compatibility of Angelicae Sinensis Radix (Danggui) and Carthami Flos (Honghua), a famous herb pair Gui-Hong, can produce synergistic and complementary hematinic effects. Our previous studies have indicated that Gui-Hong has therapeutic potential treatment in hemolytic and aplastic anemia (HAA). The present study aimed to investigate the hematinic effects of Danggui, Honghua and Gui-Hong on HAA rats induced by acetyl phenylhydrazine (APH) and cyclophosphamide (CP) and to explore the underlying hematinic regulation mechanisms. Rats were divided into 5 groups, and drugs were administered by oral gavage one time each day for continuous 7 days from the experiment began. Urine and plasma were analyzed by ultra-high-performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS). Partial least-squares discriminate analysis (PLS-DA) models were built to evaluate the therapeutic effects of Danggui, Honghua and Gui-Hong. Pearson correlation matrix analysis method was used to discover the correlations between potential biomarkers and biochemical indicators of HAA rats. Seven potential biomarkers contribute to the separation of model group and control group were tentatively identified. The levels of l-kynurenine, phenylalanine, nicotinic acid and sphingosine increased significantly (Pmetabonomics method is a promising tool in the efficacy and mechanism research of traditional Chinese medicines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kolpa, R.; Smith, K.
1993-07-01
This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA
Energy Technology Data Exchange (ETDEWEB)
Kolpa, R.; Smith, K.
1993-07-01
This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA.
Le Roux, Julien; Gallard, Hervé
2011-01-01
Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N
de Fusarium isolé du fruit de tomate (Solanum lycopersicum L ...
African Journals Online (AJOL)
Dina
A phytopathogenic fungus Fusarium F-02 is isolated from rotten tomato fruit. ..... between Trichoderma harzianum and Pythium ultimum”. .... [31] - HAAS, and C. KEEL, “Regulation of antibiotic production in root-colonizing Pseudomonas spp.
Kolmekesi ühest Peipsi-äärsest asjast / Tiit Lepp
Lepp, Tiit
2007-01-01
Annika Haasi, Birgit Püve ja Age Petersoni fotonäitus "Prichudie, Revisited" Peipsiääre valla inimestest ja elust-olust kunstikeskuses AmbulARToorium Tartumaaal. Kommenteerinud Annika Haas, Birgit Püve, Age Peterson
Requirements on the provisional safety analyses and technical comparison of safety measures
International Nuclear Information System (INIS)
2010-04-01
The concept of a Geological Underground Repository (SGT) was adopted by the Swiss Federal Council on April 2 nd , 2008. It fixes the goals and the safety technical criteria as well as the procedures for the choice of the site for an underground repository. Those responsible for waste management evaluate possible site regions according to the present status of geological knowledge and based on the safety criteria defined in SGT as well as on technical feasibility. In a first step, they propose geological repository sites for high level (HAA) and for low and intermediate level (SMA) radioactive wastes and justify their choice in a report delivered to the Swiss Federal Office of Energy. The Swiss Federal Council reviews the choices presented and, in the case of positive evaluation, approves them and considers them as an initial orientation. In a second step, based on the possible sites according to step 1, the waste management institution responsible has to reduce the repositories chosen for HAA and SMA by taking into account safety aspects, technical feasibility as well as space planning and socio-economical aspects. In making this choice, safety aspects have the highest priority. The criteria used for the evaluation in the first step have to be defined using provisional quantitative safety analyses. On the basis of the whole appraisal, including space planning and socio-economical aspects, those responsible for waste management propose at least two repository sites for HAA- and SMA-waste. Their selection is then reviewed by the authorities and, in the case of a positive assesment, the selection is taken as an intermediate result. The remaining sites are further studied to examine site choice and the delivery of a request for a design license. If necessary, the requested geological knowledge has to be confirmed by new investigations. Based on the results of the choosing process and a positive evaluation by the safety authorities, the Swiss Federal Council has to
Tahir, Muhammad; Schwingenschlö gl, Udo
2013-01-01
We show that the surface states of magnetic topological insulators realize an activated behavior and Shubnikov de Haas oscillations. Applying an external magnetic field perpendicular to the surface of the topological insulator in the presence
National Research Council Canada - National Science Library
Fritts, David C
2008-01-01
... for which significant wave and turbulence activity may pose an operational or functional risk. The specific goal for MDA purposes was to create a forecasting methodology for turbulence activity at the expected High Altitude Airship (HAA...
Ere täht Britta / Britta Vahur ; interv. Jüri Muttika
Vahur, Britta, 1984-
2006-01-01
Rubriigis "elu ühes päevas" TV 3 uues telesarjas "Helena" peaosalist kehastav Britta Vahur endast. Lisaks sarja stsenaristi Marko Lillemägi kirjutatud "Seriaalikangelanna Helena Haas (23)", mis kirjeldab seriaali Helena päeva
Sinha, R; Rothman, N; Brown, E D; Salmon, C P; Knize, M G; Swanson, C A; Rossi, S C; Mark, S D; Levander, O A; Felton, J S
1995-10-15
Heterocyclic aromatic amines (HAAs) are mutagenic and carcinogenic compounds found in meats cooked at high temperatures. Although chicken is consumed in large quantities in the United States, there is little information on its HAA content. The objective of this study was to measure the five predominant HAAs (IQ, MeIQ, MeIQx, DiMeIQx, and PhIP) in chicken cooked by various methods to different degrees of doneness. Chicken breasts were panfried, oven-broiled, or grilled/barbecued. Whole chickens were roasted or stewed. Skinless, boneless chicken breasts were cooked to three degrees of doneness: just until done, well done, or very well done. High levels of PhIP (ranging from 12 to 480 ng/g cooked meat) were found in chicken breasts when panfried, oven-broiled, and grilled/barbecued but not in while roasted or stewed chicken. PhIP concentration increased in skinless, boneless chicken breast with longer cooking time, higher internal temperature, and greater degree of surface browning. PhIP concentration was also high in chicken breasts cooked with skin and bones. MeIQx and DiMeIQx levels increased with the degree of doneness, whereas IQ and MeIQ were not detectable in any of these chicken samples. Certain cooking methods produce PhIP, a known colon and breast carcinogen in rodents and possibly a human carcinogen, at substantially higher levels in chicken than has been reported previously in red meat.
Energy Technology Data Exchange (ETDEWEB)
Varanusupakul, Pakorn [Chromatography and Separation Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand)], E-mail: pakorn.v@chula.ac.th; Vora-adisak, Narongchai; Pulpoka, Bancha [Chromatography and Separation Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand)
2007-08-15
An alternative method for gas chromatographic determination of haloacetic acids (HAAs) in water using direct derivatization followed by hollow fiber membrane liquid-phase microextraction (HF-LPME) has been developed. The method has improved the sample preparation step according to the conventional US EPA Method 552.2 by combining the derivatization and the extraction into one step prior to determination by gas chromatography electron captured detector (GC-ECD). The HAAs were derivatized with acidic methanol into their methyl esters and simultaneously extracted with supported liquid hollow fiber membrane in headspace mode. The derivatization was attempted directly in water sample without sample evaporation. The HF-LPME was performed using 1-octanol as the extracting solvent at 55 deg. C for 60 min with 20% Na{sub 2}SO{sub 4}. The linear calibration curves were observed for the concentrations ranging from 1 to 300 {mu}g L{sup -1} with the correlation coefficients (R{sup 2}) being greater than 0.99. The method detection limits of most analytes were below 1 {mu}g L{sup -1} except DCAA and MCAA that were 2 and 18 {mu}g L{sup -1}, respectively. The recoveries from spiked concentration ranged from 97 to 109% with %R.S.D. less than 12%. The method was applied for determination of HAAs in drinking water and tap water samples. The method offers an easy one step high sample throughput sample preparation for gas chromatographic determination of haloacetic acids as well as other contaminants in water.
Arnold, Mayara; Batista, Jacimaria; Dickenson, Eric; Gerrity, Daniel
2018-07-01
The purpose of this research was to investigate the impacts of ozone dose and empty bed contact time (EBCT) in ozone-biofiltration systems on disinfection byproduct (DBP) formation potential. The data were used to evaluate the possibility of using DBP formation potential as an alternative guideline for total organic carbon (TOC) removal in potable reuse applications. A pilot-scale ozone-biofiltration system was operated with O 3 /TOC ratios ranging from 0.1 to 2.25 and EBCTs ranging from 2 to 20 min. The biofiltration columns contained anthracite or biological activated carbon (BAC). Bench-scale chlorination was performed using the uniform formation conditions (UFC) approach, and quenched samples were analyzed for total trihalomethanes (TTHMs) and regulated haloacetic acids (HAA5s). The data demonstrated that ozone-biofiltration achieved TOC removals ranging from ∼10 to 30%, depending on operational conditions, but biofiltration without ozone generally achieved <10% TOC removal. UFC testing demonstrated that ozone alone was efficient in transforming bulk organic matter and reducing DBP formation potential by 10-30%. The synergistic combination of ozone and biofiltration achieved average overall reductions in TTHM and HAA5 formation potential of 26% and 51%, respectively. Finally, a maximum TOC concentration of 2.0 mg/L was identified as a recommended treatment target for reliable compliance with TTHM and HAA5 regulations for potable reuse systems in the United States. Copyright © 2018 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Varanusupakul, Pakorn; Vora-adisak, Narongchai; Pulpoka, Bancha
2007-01-01
An alternative method for gas chromatographic determination of haloacetic acids (HAAs) in water using direct derivatization followed by hollow fiber membrane liquid-phase microextraction (HF-LPME) has been developed. The method has improved the sample preparation step according to the conventional US EPA Method 552.2 by combining the derivatization and the extraction into one step prior to determination by gas chromatography electron captured detector (GC-ECD). The HAAs were derivatized with acidic methanol into their methyl esters and simultaneously extracted with supported liquid hollow fiber membrane in headspace mode. The derivatization was attempted directly in water sample without sample evaporation. The HF-LPME was performed using 1-octanol as the extracting solvent at 55 deg. C for 60 min with 20% Na 2 SO 4 . The linear calibration curves were observed for the concentrations ranging from 1 to 300 μg L -1 with the correlation coefficients (R 2 ) being greater than 0.99. The method detection limits of most analytes were below 1 μg L -1 except DCAA and MCAA that were 2 and 18 μg L -1 , respectively. The recoveries from spiked concentration ranged from 97 to 109% with %R.S.D. less than 12%. The method was applied for determination of HAAs in drinking water and tap water samples. The method offers an easy one step high sample throughput sample preparation for gas chromatographic determination of haloacetic acids as well as other contaminants in water
Bilateral cross-bite treated by repeated rapid maxillary expansions: a 17-year follow-up case.
Cozzani, M; Mazzotta, L; Caprioglio, A
2014-07-01
The objective of this paper is to show the clinical results after the repeated application of a Haas expander for rapid maxillary expansion (RME) anchored onto deciduous teeth in a 7-year-old patient that presented bilateral cross-bite, superior crowding and no space for permanent lateral incisors eruption. A first Haas expander was applied to the patient. She was told to activate it once a day, each activation was equal to 0.20 mm. After the first RME, the bilateral cross-bite was solved but still there was not enough space for lateral incisor eruption. A second and then a third Haas expander were applied, with the same activation protocol as the first one, in order to gain space in the anterior region and to achieve proper eruption of the lateral incisors. The patient was then treated with fixed appliances. At debonding the patient presented well aligned arch-forms: space for lateral incisor eruption was gained and superior crowding was solved. Bilateral cross-bite was also corrected. She was seen again 10 years and 17 years after expansions: she showed no relapse and presented a good functional occlusion that had remained stable, and an aesthetically pleasant smile, however she exhibited gingival recessions. Repeated rapid maxillary expansion, anchored onto deciduous teeth, performed in early mixed dentition represents a safe and successful treatment to correct severe bilateral cross- bites and to create space for maxillary incisor eruption.
[Presidendipaar Ingrid ja Arnold Rüütel] / Annika Haas
Haas, Annika
2007-01-01
President Arnold Rüütel ja Ingrid Rüütel Briti suursaadiku Nigel Haywoodi lahkumispeol Tallinna Teaduste Akadeemia peasaalis. Foto allkiri: Presidendipaar Ingrid ja Arnold Rüütel kuulavad Briti suursaadiku Nigel Haywoodi kiidulaulu Eesti kiire arengu aadressil
Kirju ja vastuoluline "Wien Modern 2007" / Saale Kareda
Kareda, Saale, 1968-
2008-01-01
Festivalist "Wien Modern 2007", festivali peaheliloojad Georg Friedrich Haas ja Luciano Berio. Pikemalt G. F. Haasi muusikast ja festivali kontsertidest. Frank Schefferi filmide retrospektiivist, pikemalt filmist "Helicopter String Quartet" - helilooja Karlheinz Stockhausenist. Järgneb nr. 3, lk. 67-75
Quantum magnetotransport properties of topological insulators under strain
Tahir, M.; Schwingenschlö gl, Udo
2012-01-01
scattering in the first Born approximation. We also calculate the Hall conductivity using the Kubo formalism. Evidence for the beating of Shubnikov–de Haas oscillations is found from the temperature and magnetic field dependence of the collisional and Hall
1987-04-01
facilities. BBN is developing a series of increasingly sophisticated natural language understanding systems which will serve as an integrated interface...Haas, A.R. A Syntactic Theory of Belief and Action. Artificial Intelligence. 1986. Forthcoming. [6] Hinrichs, E. Temporale Anaphora im Englischen
The haloacetic acids (HAA) are a family of chemicals that are drinking water disinfection byproducts. We previously reported that bromo- and chloro-acetic acids alter embryonic development when mouse conceptuses are directly exposed to these xenobiotics in whole embryo culture. C...
Directory of Open Access Journals (Sweden)
Caio Ferraz Campos
2013-03-01
Full Text Available The objective of this work was to evaluate conditions the effectiveness of acetolactate synthase (ALS and protoporphyrinogen oxidase (PROTOX inhibitors in the Bidens pilosa control under two water deficit conditions, as well as to determine the action under the content of soluble carbohydrates and protein and free amino acids of weed. The experimental design was randomized completely design, with four replications, with the treatments setup in a factorial scheme 4x2, with four herbicides (fomesafen lactofen, chlorimuron-ethyl and imazethapyr, and two soil water conditions (-0.5 MPa and –0.01MPa. At 7, 14, 21 and 28 days after application (DAA, was assessed visually control efficiency of herbicides. For the determination of organic solutes plants were collected at 24, 48, 72 and 96 hours after application (HAA, except for the amino acids were analyzed 48, 72 e 96 HAA. Herbicides fomesafen and lactofen were efficient to control E. heterophylla, while the ALS inhibitors (chlorimuron-ethyl e imazethapyr provided an unsatisfactory control. Water deficit altered the efficiency of herbicides, mainly chlorimuronethyl. Lactofen provided a smaller content of soluble carbohydrates, in the same way, the protein ranged in the 72 HAA, the lower value observed for imazethapyr e lactofen respectively. Herbicide lactofen increased the concentration of free amino acids, while the imposition of water deficit caused an increase in soluble carbohydrate content.O estudo teve como objetivo avaliar a eficiência de herbicidas inibidores da acetolactato sintase (ALS e protoporfirinogênio oxidase (PROTOX no controle de Euphorbia heterophylla sob duas condições hídricas, bem como determinar a ação destes sob o conteúdo de carboidratos e proteínas solúveis e aminoácidos livres da planta daninha. O delineamento experimental utilizado foi inteiramente casualizado, com quatro repetições, com os tratamentos dispostos em esquema fatorial 4x2, sendo quatro
2011-06-01
This report presents the replication of an MTI study conducted in 2001 by Peter Haas and Richard Werbel.1 That research, itself a continuation of an earlier project completed in 2000, included an analysis of transportation tax elections in 11 urban a...
DEFF Research Database (Denmark)
Hansen, Kamilla Marie Speht; Willach, Sarah; Antoniou, Maria
2012-01-01
This study investigated the formation and predicted toxicity of different groups of disinfection byproducts (DBPs) from human exudates in relation to chlorination of pool water at different pH values. Specifically, the formation of the DBP groups trihalomethanes (THMs), haloacetic acids (HAAs......), haloacetonitriles (HANs) and trichloramine (NCl3), resulting from the chlorination of body fluid analog, were investigated at 6.0 ≤ pH ≤ 8.0. Either the initial concentration of active chorine or free chlorine was kept constant in the tested pH range. THM formation was reduced by decreasing pH but HAN, and NCl3...... formation was investigated and found to follow the same pH dependency as without bromide present, with the overall DBP formation increasing, except for HAAs. Estimation of genotoxicity and cytotoxicity of the chlorinated human exudates showed that among the quantified DBP groups, HAN formation were...
Soladoye, O P; Shand, P; Dugan, M E R; Gariépy, C; Aalhus, J L; Estévez, M; Juárez, M
2017-09-01
This study aimed to examine the influence of cooking methods and pre-determined refrigerated storage days on the production of lipid oxidation (TBARS), protein oxidation (PROTOX) and heterocyclic aromatic amines (HAA) in bacon. Forty-four pork bellies selected from pigs varying in breed, sex and diets to introduce variability in composition were processed as bacon. Sliced-bacon was stored at 4°C either for 2 or 28days and these storage groups were cooked either with microwave or frying pan. Microwave led to significantly higher PROTOX (P0.05) by the cooking methods and storage times. Similarly, the fatty acid composition of pork belly did not significantly influence the production of HAA, TBARS and PROTOX produced in bacon during cooking. Overall, microwave cooking had lesser impact on the production of carcinogenic compounds in bacon with only minor impact on sensory attributes. Copyright © 2017. Published by Elsevier Ltd.
Liu, Chao; Croue, Jean-Philippe
2015-01-01
Previous studies showed that significant bromate (BrO3-) can be formed via the CuO-catalyzed disproportionation of hypobromous acid (HOBr) pathway. In this study, the influence of CuO on the formation of BrO3- and halogenated disinfection byproducts (DBPs) (e.g., trihalomethanes, THMs and haloacetic acids, HAAs) during chlorination of six dissolved organic matter (DOM) isolates was investigated. Only in the presence of slow reacting DOM (from treated Colorado River water, i.e., CRW-BF-HPO), significant BrO3- formation is observed, which competes with bromination of DOM (i.e., THM and HAA formation). Reactions between HOBr and 12 model compounds in the presence of CuO indicates that CuO-catalyzed HOBr disproportionation is completely inhibited by fast reacting phenols, while it predominates in the presence of practically unreactive compounds (acetone, butanol, propionic, and butyric acids). In the presence of slow reacting di- and tri-carboxylic acids (oxalic, malonic, succinic, and citric acids), BrO3- formation varies, depending on its competition with bromoform and dibromoacetic acid formation (i.e., bromination pathway). The latter pathway can be enhanced by CuO due to the activation of HOBr. Therefore, increasing CuO dose (0-0.2 g L-1) in a reaction system containing chlorine, bromide, and CRW-BF-HPO enhances the formation of BrO3-, total THMs and HAAs. Factors including pH and initial reactant concentrations influence the DBP formation. These novel findings have implications for elevated DBP formation during transportation of chlorinated waters in copper-containing distribution systems.
Liu, Chao
2015-12-02
Previous studies showed that significant bromate (BrO3-) can be formed via the CuO-catalyzed disproportionation of hypobromous acid (HOBr) pathway. In this study, the influence of CuO on the formation of BrO3- and halogenated disinfection byproducts (DBPs) (e.g., trihalomethanes, THMs and haloacetic acids, HAAs) during chlorination of six dissolved organic matter (DOM) isolates was investigated. Only in the presence of slow reacting DOM (from treated Colorado River water, i.e., CRW-BF-HPO), significant BrO3- formation is observed, which competes with bromination of DOM (i.e., THM and HAA formation). Reactions between HOBr and 12 model compounds in the presence of CuO indicates that CuO-catalyzed HOBr disproportionation is completely inhibited by fast reacting phenols, while it predominates in the presence of practically unreactive compounds (acetone, butanol, propionic, and butyric acids). In the presence of slow reacting di- and tri-carboxylic acids (oxalic, malonic, succinic, and citric acids), BrO3- formation varies, depending on its competition with bromoform and dibromoacetic acid formation (i.e., bromination pathway). The latter pathway can be enhanced by CuO due to the activation of HOBr. Therefore, increasing CuO dose (0-0.2 g L-1) in a reaction system containing chlorine, bromide, and CRW-BF-HPO enhances the formation of BrO3-, total THMs and HAAs. Factors including pH and initial reactant concentrations influence the DBP formation. These novel findings have implications for elevated DBP formation during transportation of chlorinated waters in copper-containing distribution systems.
International Nuclear Information System (INIS)
Ambrosch, K.-E.
1985-01-01
Lead salts are small gap semiconductors that are used for infrared detectors and lasers. PbMnTe and PbEuTe are semimagnetic semiconductors. Magnetotransport properties of epitaxial films and epitaxial heterostructures (PbTe / PbSnTe) are investigated. Epitaxial films of PbSnTe, PbMnTe and PbEuTe have been used for Shubnikov de Haas - experiments in tilted magnetic fields. This method allows the quantitative determination of the electric carrier distribution with respect to the crystal directions. The nonequal distribution is caused by strain effects that are more important for PbMnTe than for PbSnTe and PbEuTe. Magnetoresistance experiments show a deviation from cubic symmetry that leads to the same results for the carrier distribution as the Shubnikov de Haas effect. Magnetoresistance experiments performed with PbTe / PbSnTe heterostructures show no megnetoresistance if the magnetic field is in plane with the layers. The difference of the magnetoresistance for single films and heterostructures is explained by 'quasitwodimensional' carriers. Shubnikov de Haas experiments performed on heterostructures as a function of the tilt angle of the magnetic field show different behaviour compared to that of single films. Using additional information about effective masses and strain it was possible to distinguish between 'two-' and 'threedimensional' electronic systems. The distribution of carriers in single films and heterostructures has been determined by means of magnetotransport experiments. The results are explained by strain effects of the crystal lattice. In addition heterostructures show a 'quasitwodimensional' behaviour caused by interaction of their layers. (Author)
Directory of Open Access Journals (Sweden)
Aiwu Zhang
2015-12-01
Full Text Available The complexity of the single linear hyperspectral pushbroom imaging based on a high altitude airship (HAA without a three-axis stabilized platform is much more than that based on the spaceborne and airborne. Due to the effects of air pressure, temperature and airflow, the large pitch and roll angles tend to appear frequently that create pushbroom images highly characterized with severe geometric distortions. Thus, the in-flight calibration procedure is not appropriate to apply to the single linear pushbroom sensors on HAA having no three-axis stabilized platform. In order to address this problem, a new ground-based boresight calibration method is proposed. Firstly, a coordinate’s transformation model is developed for direct georeferencing (DG of the linear imaging sensor, and then the linear error equation is derived from it by using the Taylor expansion formula. Secondly, the boresight misalignments are worked out by using iterative least squares method with few ground control points (GCPs and ground-based side-scanning experiments. The proposed method is demonstrated by three sets of experiments: (i the stability and reliability of the method is verified through simulation-based experiments; (ii the boresight calibration is performed using ground-based experiments; and (iii the validation is done by applying on the orthorectification of the real hyperspectral pushbroom images from a HAA Earth observation payload system developed by our research team—“LanTianHao”. The test results show that the proposed boresight calibration approach significantly improves the quality of georeferencing by reducing the geometric distortions caused by boresight misalignments to the minimum level.
Approximation Properties for Groups and von Neumann Algebras
DEFF Research Database (Denmark)
Knudby, Søren
The main topic of the thesis is approximation properties for locally compact groups with applications to operator algebras. In order to study the relationship between weak amenability and the Haagerup property, the weak Haagerup property and the weak Haagerup constant are introduced. The weak Haa...
Structural Causes and Cyber Effects: Why International Order is Inevitable in Cyberspace
2014-01-01
articles in the same work by Ernst Haas, Donald J. Puchala and Raymond F. Hopkins, Oran R. Young, Arthur A. Stein, Robert Keohane , Robert Jervis, John...Gerard Ruggie, and Krasner. 33. Robert O. Keohane , After Hegemony: Cooperation and Discord in the World Political Economy (Princeton: Princeton
KOPÁČKOVÁ, Stanislava
2016-01-01
This thesis focuses on the work of the Čapeks Brothers and monitors their premonition of a coming destruction, the World War II. It consists of two parts theoretical and practical. The practical part presents poster set freely interpreting a Hugo Haas film The White Disease.
The aims of the current study were to investigate the presence of carcinogenic and mutagenic heterocyclic aromatic amines (HAAs) in chicken burgers (CBs) and chicken nuggets (CNs) purchased from fast food restaurants and the effects of green tea extract addition (GTE) to the covering material as wel...
Quantum Effects in Inverse Opal Structures
Bleiweiss, Michael; Datta, Timir; Lungu, Anca; Yin, Ming; Iqbal, Zafar; Palm, Eric; Brandt, Bruce
2002-03-01
Properties of bismuth inverse opals and carbon opal replicas were studied. The bismuth nanostructures were fabricated by pressure infiltration into porous artificial opal, while the carbon opal replicas were created via CVD. These structures form a regular three-dimensional network in which the bismuth and carbon regions percolate in all directions between the close packed spheres of SiO_2. The sizes of the conducting regions are of the order of tens of nanometers. Static susceptibility of the bismuth inverse opal showed clear deHaas-vanAlphen oscillations. Transport measurements, including Hall, were done using standard ac four and six probe techniques in fields up to 17 T* and temperatures between 4.2 and 200 K. Observations of Shubnikov-deHaas oscillations in magnetoresistance, one-dimensional weak localization, quantum Hall and other effects will be discussed. *Performed at the National High Magnetic Field Lab (NHMFL) FSU, Tallahassee, FL. This work was partially supported by grants from DARPA-nanothermoelectrics, NASA-EPSCOR and the USC nanocenter.
Cardador, Maria Jose; Gallego, Mercedes
2012-01-25
Chloroacetic, bromoacetic, and iodoacetic acids can be found in alcoholic beverages when they are used as preservatives/stabilizers or as disinfectants. As they are toxic components, their addition is not permitted under European Union and U.S. regulations. To date, no sensitive methods are available, and those proposed are very laborious. This paper describes a sensitive and straightforward method for the determination of the three monohalogenated acetic acids (m-HAAs) in wines and beers using static headspace extraction coupled with gas chromatography-mass spectrometry. Prior to extraction, the target analytes were esterified to increase their volatility, and all parameters related to the extraction/methylation process were optimized to achieve high efficiency (>90%). The study examined the influence both of the ethanol concentration on the headspace partitioning and of the primary acids present in wine on the derivatization reaction of the m-HAAs. The proposed method allows the determination of these compounds at microgram per liter levels in alcoholic beverages.
Singleton, J; Hayes, W; Schlüter, J A
2003-01-01
The apparent quasiparticle scattering rates in high-quality crystals of the quasi-two-dimensional superconductor kappa-(BEDT-TTF) sub 2 Cu(NCS) sub 2 are studied using the Shubnikov-de Haas effect and megahertz penetration-depth experiments. The width of the superconducting transition observed in the megahertz experiments, taken in conjunction with the field dependence of the Shubnikov-de Haas oscillations, gives evidence that the broadening of the Landau levels is primarily caused by spatial inhomogeneities. This indicates a quasiparticle lifetime for the Landau states >> 3 ps. The megahertz data can also be used to derive an apparent scattering time (0.14- 0.56 ps) from the skin depth. This is much shorter than the Landau-state lifetime, in strong contrast to the expectations of Landau Fermi-liquid theory. The simplest explanation for the data is that only a fraction of the crystal contributes to the metallic conductivity, an observation which may be related to the recently observed 'glassy' transition in k...
Kramer, D.A.
2007-01-01
Seawater and natural brines accounted for about 52 percent of U.S. magnesium compounds production in 2006. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from sea-water by Premier Chemicals in Florida; from well brines in Michigan by Martin Marietta and Rohm and Haas; and from magnesite in Nevada by Premier Chemicals. Intrepid Potash-Wendover and Great Salt Lake Minerals recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from brucite by Applied Chemical Magnesias in Texas, from seawater by SPI Pharma in Delaware and Premier Chemicals in Florida, and by Martin Marietta and Rohm and Haas from their operations mentioned above. About 59 percent of the magnesium compounds consumed in the United States was used for refractories that are used mainly to line steelmaking furnaces. The remaining 41 percent was consumed in agricultural, chemical, construction, environmental and industrial applications.
Mechanical control over valley magnetotransport in strained graphene
Energy Technology Data Exchange (ETDEWEB)
Ma, Ning, E-mail: maning@stu.xjtu.edu.cn [Department of Physics, MOE Key Laboratory of Advanced Transducers and Intelligent Control System, Taiyuan University of Technology, Taiyuan 030024 (China); Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Zhang, Shengli, E-mail: zhangsl@mail.xjtu.edu.cn [Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Liu, Daqing, E-mail: liudq@cczu.edu.cn [School of Mathematics and Physics, Changzhou University, Changzhou 213164 (China)
2016-05-06
Recent experiments report that the graphene exhibits Landau levels (LLs) that form in the presence of a uniform strain pseudomagnetic field with magnitudes up to hundreds of tesla. We further reveal that the strain removes the valley degeneracy in LLs, and leads to a significant valley polarization with inversion symmetry broken. This accordingly gives rise to the well separated valley Hall plateaus and Shubnikov–de Haas oscillations. These effects are absent in strainless graphene, and can be used to generate and detect valley polarization by mechanical means, forming the basis for the new paradigm “valleytronics” applications. - Highlights: • We explore the mechanical strain effects on the valley magnetotransport in graphene. • We analytically derive the dc collisional and Hall conductivities under strain. • The strain removes the valley degeneracy in Landau levels. • The strain causes a significant valley polarization with inversion symmetry broken. • The strain leads to the well separated valley Hall and Shubnikov–de Haas effects.
Pasqualone, Antonella; Gambacorta, Giuseppe; Summo, Carmine; Caponio, Francesco; Di Miceli, Giuseppe; Flagella, Zina; Marrese, Pier Paolo; Piro, Gabriella; Perrotta, Carla; De Bellis, Luigi; Lenucci, Marcello Salvatore
2016-12-15
A study was carried out to produce functional pasta by adding bran aqueous extract (BW) and bran oleoresin (BO) obtained using ultrasound and supercritical CO2, respectively, or a powdery lyophilized tomato matrix (LT). The bioactive compounds, hydrophilic and lipophilic antioxidant activity (HAA and LAA) in vitro, were evaluated. BW supplementation did not improve antioxidant activity, whilst LT pasta showed unconventional taste and odor. BO pasta had good levels of tocochromanols (2551μg/100g pasta f.w.) and carotenoids (40.2μg/100g pasta f.w.), and the highest HAA and LAA. The oleoresin altered starch swelling and gluten network, as evidenced by scanning electron microscopy, therefore BO pasta had structural characteristics poor compared with the control (4.8% vs. 3.2% cooking loss), although this difference did not affect significantly overall sensory judgment (74 vs. 79 for BO and control, respectively). BO supplementation was most effective for increasing antioxidant activity without jeopardizing pasta quality. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bioremediation of petroleum wastes from the refining of lubricant oils
International Nuclear Information System (INIS)
Prince, M.; Sambasivam, Y.
1993-01-01
The results of an initial feasibility study on the bioremediation of sludge are presented. The sludge used in the study was taken from a site containing waste produced during the refining of lubricant oils to which sulfuric acid had been added. The effectiveness of bioremediation was examined using shake flask experiments with indigenous and other bacteria sources and nutrient supplementation. The initial results show limited effectiveness of biological treatment at conditions employing indigenous bacteria and low (2%) sludge concentrations in Bushnell-Haas media. In addition, the indigenous bacteria were seen to degrade the polycyclic aromatic hydrocarbons naphthalene, penanthrene and pyrene which are present at some locations at the site. No apparent degradation of material was seen using conditions of high (30%) sludge concentrations in Bushnell-Haas medium under a variety of conditions. In addition, nutrients were rapidly depleted at these sludge concentrations, with the exception of sulfates which were produced when high sludge concentrations were used. 23 refs., 8 figs., 3 tabs
2011-07-13
... NWRs CCP'' in the subject line of the message. Fax: Attn: Dan Haas, Planning Team Leader, (509) 546... fills an important role in the management of mallards, northern pintails, and tundra swans during.... An extensive system of managed and unmanaged wetlands fills an important role in the management of...
Haas, Harald
2016-08-01
The humble household light bulb - once a simple source of illumination - could soon be transformed into the backbone of a revolutionary new wireless communications network based on visible light. Harald Haas explains how this “LiFi” system works and how it could shape our increasingly data-driven world
Reduction of Aromatic and Heterocyclic Aromatic N-Hydroxylamines by Human Cytochrome P450 2S1
Wang, Kai; Guengerich, F. Peter
2013-01-01
Many aromatic amines and heterocyclic aromatic amines (HAAs) are known carcinogens for animals and there is also strong evidence for some in human cancer. The activation of these compounds, including some arylamine drugs, involves N-hydroxylation, usually by cytochrome P450 enzymes (P450) in Family 1 (1A2, 1A1, and 1B1). We previously demonstrated that the bioactivation product of the anti-cancer agent 2-(4-amino-3-methylphenyl)-5-fluorobenzothiazole (5F 203), an N-hydroxylamine, can be reduced by P450 2S1 to its amine precursor under anaerobic conditions and, to a lesser extent, under aerobic conditions (Wang, K., and Guengerich, F. P. (2012) Chem. Res. Toxicol. 25, 1740–1751). In the present study, we tested the hypothesis that P450 2S1 is involved in the reductive biotransformation of known carcinogenic aromatic amines and HAAs. The N-hydroxylamines of 4-aminobiphenyl (4-ABP), 2-naphthylamine (2-NA), and 2-aminofluorene (2-AF) were synthesized and found to be reduced by P450 2S1 under both anaerobic and aerobic conditions. The formation of amines due to P450 2S1 reduction also occurred under aerobic conditions but was less apparent because the competitive disproportionation reactions (of the N-hydroxylamines) also yielded amines. Further, some nitroso and nitro derivatives of the arylamines could also be reduced by P450 2S1. None of the amines tested were oxidized by P450 2S1. These results suggest that P450 2S1 may be involved in the reductive detoxication of several of the activated products of carcinogenic aromatic amines and HAAs. PMID:23682735
Hallux abductus interphalangeus in normal feet, early-stage hallux limitus, and hallux valgus.
Castillo-Lopez, Jose M; Ramos-Ortega, Javier; Reina-Bueno, Maria; Domínguez-Maldonado, Gabriel; Palomo-Toucedo, Inmaculada C; Munuera, Pedro V
2014-03-01
Excessive deviation of the distal phalanx in abduction frequently occurs in advanced stages of hallux rigidus but not in hallux valgus. Therefore, theoretically there should be no significant differences in the hallux interphalangeal angle (HIPA) between individuals with normal feet, those with hallux valgus, and those with mild hallux limitus. The objective of the present study was thus to determine if significant differences in HIPA exist in the early stages of hallux valgus or hallux limitus deformities. The hallux interphalangeal angle was measured in three groups of participants: a control group with normal feet (45 participants), a hallux valgus group (49 participants), and a hallux limitus group (48 participants). Both of the pathologies were at an early stage. A dorsoplantar radiograph under weightbearing conditions was taken for each individual, and measurements (HIPA and hallux abductus angle [HAA]) were taken using AutoCAD (Autodesk Inc, San Rafael, California) software. Intergroup comparisons of HIPA, and correlations between HIPA, HAA, and hallux dorsiflexion were calculated. The comparisons revealed no significant differences in the values of HIPA between any of the groups (15.2 ± 5.9 degrees in the control group, 15.5 ± 3.9 degrees in the hallux valgus group, and 16.15 ± 4.3 in the hallux limitus group; P = 0.634). The Pearson correlation coefficients in particular showed no correlation between hallux dorsiflexion, HAA, and HIPA. For the study participants, there were similar deviations of the distal phalanx of the hallux with respect to the proximal phalanx in normal feet and in feet with the early stages of the hallux limitus and hallux valgus deformities.
International Nuclear Information System (INIS)
Bezdecny, Steven A.; Karmaus, Peer; Roth, Robert A.; Ganey, Patricia E.
2007-01-01
Polychlorinated biphenyls (PCBs) are ubiquitous, persistent environmental contaminants that affect a number of cellular systems, including neutrophils. Among the effects caused by the noncoplanar PCB 2,2',4,4'-tetrachlorobiphenyl (2244-TCB) in granulocytic HL-60 cells are increases in superoxide anion production, activation of phospholipase A 2 with subsequent release of arachidonic acid (AA) and upregulation of the inflammatory gene cyclooxygenase-2 (COX-2). The objective of this study was to determine the signal transduction pathways involved in the upregulation of COX-2 by 2244-TCB. Treatment of HL-60 cells with 2244-TCB led to increased expression of COX-2 mRNA. This increase was prevented by the transcriptional inhibitor actinomycin D in cells pretreated with 2244-TCB for 10 min. The increase in COX-2 mRNA was associated with release of 3 H-AA, phosphorylation of p38 and extracellular signal-regulated kinase (ERK) mitogen-activated protein (MAP) kinases, increased levels of nuclear NF-κB and increased superoxide anion production. Bromoenol lactone, an inhibitor of the calcium-independent phospholipase A 2 , reduced 3 H-AA release but had no effect on COX-2 mRNA, protein or activity. Pretreatment with SB-202190 or SB-203580, inhibitors of the p38 MAP kinase pathway, prevented the 2244-TCB-mediated induction of COX-2 and phosphorylation of p38 and ERK MAP kinases. These inhibitors did not alter 3 H-AA release. Treatment with PD 98059 or U 0126, inhibitors of the MAP/ERK (MEK) pathway, prevented the 2244-TCB-mediated activation of ERK but had no effect on COX-2 induction or p38 phosphorylation. 2244-TCB treatment did not affect c-Jun N-terminal kinase (JNK) phosphorylation. 2244-TCB exposure increased the amount of nuclear NF-κB. This increase was prevented by pretreatment with p38 MAP kinase inhibitors, but not by pretreatment with MEK inhibitors. Pretreatment with inhibitors of NF-κB prevented the 2244-TCB-mediated induction of COX-2 mRNA. 2244-TCB
Indriarini et al., Afr., J. Infect. Dis. (2018) 12(S): 127-132 https://doi ...
African Journals Online (AJOL)
Desi
2017-10-27
Oct 27, 2017 ... Diaz R, Kremer K, De Haas PE. (1998). Molecular Epidemiology of Tuberculosis in Cuba outside of Havana,. July 1994 – June 1995: Utility of Spoligotyping Versus IS6110 Restriction Fragmen Length Polymorphism. International Journal of Tuberculosis and Lung Disease; 2: 743-750. 9. Elias D, Akuffo H, ...
Ayurgenomics: Understanding human individuality through ...
Indian Academy of Sciences (India)
mitali
Knowledge. VATA. PITTA. KAPHA. Stratification of Healthy based on prakriti. Axes of variation in Prakriti. EGLN1-HIF axis in. HAA/HAPE/asthma. Hypoxia responsiveness. (EGLN1 –HIF1-vWF). Hypoxia axis differentially regulated in VADU cohort. Hypoxia and Hemostasis axes linked through Prakriti. VWF levels also differ.
Effects on insect growth regulators on the hairy rose beetle, Tropinota squalida (Col., Scarabeidae)
Czech Academy of Sciences Publication Activity Database
Hussein, Hany; Dimetry, N.; Zidan, Z.; Iss-hak, R. R.; Sehnal, František
2005-01-01
Roč. 129, č.3 (2005), s. 142-148 ISSN 0931-2048 Grant - others:Rohm and Haas Insecticidal Research Laboratories(US) RH-2485; Zoecon Corporation(US) ZR-512S Institutional research plan: CEZ:AV0Z50070508 Keywords : Epicometis * Tropinota * azadirachtin Subject RIV: ED - Physiology Impact factor: 0.703, year: 2005
Directory of Open Access Journals (Sweden)
Guy Mitsuyuki Tsumanuma
2010-07-01
Full Text Available O fungo Phakopsora pachyrhizi Sydow & Sydow representa grande ameaça à sojicultura nas principais regiões produtoras do mundo, onde significativas perdas foram relatadas. Na quantificação de danos causados, muitas são as variáveis a serem estudadas, como área abaixo da curva de progresso da doença (AACPD, absorção de luz da área foliar sadia (HAA e duração da área foliar sadia (HAD, além das curvas de progresso da doença. Neste trabalho, objetivou-se verificar a influência de diferentes herbicidas e fungicidas no progresso da doença, bem como suas implicações nas variáveis referentes à área foliar sadia e à produtividade da cultura. Os tratamentos testados em duas cultivares ('MG/BR46 Conquista' e 'BRS Valiosa RR' foram: 1. Testemunha; 2. Testemunha com herbicidas; 3. Herbicidas e pyraclostrobin (V4 + pyraclostrobin + epoxiconazole (R2 e R5.1; 4. Herbicidas e pyraclostrobin (V4 + epoxiconazole (R2 e R5.1; e 5. Herbicidas (V4 + pyraclostrobin + epoxiconazole (R2 e R5.1. Os herbicidas utilizados em 'MG/BR-46 Conquista' foram sethoxydim, bentazon e chlorimuron-ethyl, sendo utilizado glyphosate na 'BRS Valiosa RR'. O modelo logístico foi o que melhor se adequou à severidade média das avaliações e à curva de progresso da doença. Para o terço inferior, posição do dossel mais propícia à doença, o modelo logístico com taxa variável foi o que mais se ajustou aos dados. A pulverização de pyraclostrobin + epoxiconazole reduziu a taxa de desenvolvimento de P. pachyrhizi em relação à epoxiconazole. A utilização da mistura influenciou as variáveis AACPD, HAA e HAD, sendo estas consideradas apropriadas para a quantificação dos danos provocados pela ferrugem asiática. Na 'MG/BR-46 Conquista', a ação dos herbicidas afetaram temporariamente a área foliar, atingindo indiretamente as variáveis HAA e HAD.Phakopsora pachyrhizi Sydow & Sydow is the worst threat for soybean crop in the most important growing
Exploring Professional Identity Development in Alcohol and Drug Counselors in the 21st Century
Simmons, Lori; Haas, Deborah; Massella, John; Young, Jared; Toth, Paul
2017-01-01
Professional identity development is an emerging area for alcohol and drug counselors. Few studies have investigated professional identity in alcohol and drug counselors (Ogborne, Braun, & Schmidt, 2001; Massella, Simons, Young, Haas, & Toth 2013). The goal of the current study is to add to this area of research. A total of 1,333 certified…
African Journals Online (AJOL)
Demetris AJ, Drachenberg CB, Gibson IW, Grimm. PC, Haas M, Lerut E, Liapis H, Mannon RB, Marcus. PB, Mengel M, Mihatsch MJ, Nankivell BJ, Nickeleit. V, Papadimitriou JC, Platt JL, Randhawa P, Roberts. I, Salinas-Madriga L, Salomon DR, Seron D, Sheaff. M, Weening JJ. Banff'05 Meeting Report: differential diagnosis ...
Shedding light on DOC release by benthic primary producers and its consumption by bioeroding sponges
Mueller, B.
2015-01-01
DOM is increasingly recognized for its important role in the element cycling and the generalecosystem functioning of tropical coral reefs (e.g., Rohwer and Youle 2010; Barott and Rohwer2012; De Goeij et al. 2013; Haas et al. 2013b). The DOM pool on coral reefs is mainly fueled bythe DOM release of
Reactivities of N-acetylgalactosamine-specific lectins with human IgA1 proteins
DEFF Research Database (Denmark)
Moore, J.S.; Kulhavy, R.; Tomana, M.
2007-01-01
, VV reacted with sugars of both IgA subclasses and IgG, indicating that it also recognized N-linked glycans without GalNAc. Furthermore, HAA and HPA from several manufacturers differed in their ability to bind various IgA1 myeloma proteins and other GalNAc-containing glycoproteins in ELISA and Western...
Breakdown of the quantum Hall effect in InAs/AlSb quantum wells due to counterflowing edge channels
Wees, B.J. van; Meijer, G.I.; Kuipers, J.J.; Klapwijk, T.M.; Graaf, W. van de; Borghs, G.
1995-01-01
We investigated magnetotransport in the two-dimensional electron gas (2DEG) present in InAs/AlSb quantum wells. The filling factor Ng underneath a gate electrode was reduced relative to the bulk filling factor Nb. For Ng
Weiss, W. J.; Becker, W.; Schindler, S.
2012-12-01
The United States Environmental Protection Agency's 2006 Stage 2 Disinfectant / Disinfection Byproduct Rule (DBPR) for finished drinking waters is intended to reduce overall DBP levels by limiting the levels of total trihalomethanes (TTHM) and five of the haloacetic acids (HAA5). Under Stage 2, maximum contaminant levels (MCLs), 80 μg/L for TTHM and 60 μg/L for HAA5, are based on a locational running annual average for individual sites instead of as the system-wide quarterly running annual average of the Stage 1 DBPR. This means compliance will have to be met at sampling locations of peak TTHM and HAA5 concentrations rather than an average across the entire system. Compliance monitoring under the Stage 2 DBPR began on April 1, 2012. The New York City (NYC) Department of Environmental Protection (DEP) began evaluating potential impacts of the Stage 2 DBPR on NYC's unfiltered water supply in 2002 by monitoring TTHM and HAA5 levels at various locations throughout the distribution system. Initial monitoring indicated that HAA5 levels could be of concern in the future, with the potential to intermittently violate the Stage 2 DBPR at specific locations, particularly those with high water age. Because of the uncertainty regarding the long-term prospect for compliance, DEP evaluated alternatives to ensure compliance, including operational changes (reducing chlorine dose, changing flow configurations to minimize water age, altering pH, altering source water withdrawals); changing the residual disinfectant from free chlorine to chloramines; and engineered treatment alternatives. This paper will discuss the potential for using DEP's Operations Support Tool (OST) and enhanced reservoir monitoring to support optimization of source water withdrawals to minimize finished water DBP levels. The OST is a state-of-the-art decision support system (DSS) to provide computational and predictive support for water supply operations and planning. It incorporates a water supply system
Radioactive waste management in Switzerland
International Nuclear Information System (INIS)
Hugi, M.
2011-01-01
The Federal Nuclear Safety Inspectorate ENSI is the Supervisory Authority for Nuclear Safety and Security of Swiss Nuclear Facilities. The responsibilities include the evaluation and operational monitoring of the existing five Swiss nuclear power plants, the radioactive waste disposals and the nuclear research facilities. The supervisory area includes project planning, operational issues, and decommissioning of plants. ENSI supervises the formation, handling and storage of radioactive waste, the work on deep geological disposal and the transport of radioactive materials. The disposal of radioactive waste is regulated by the Swiss Nuclear Energy Act (2005) and the Nuclear Energy Ordinance (2005). The protection of humans and the environment must be guaranteed permanently. Waste disposal must be carried out in the own country by deep geological repositories. The licensing procedure for the disposal facilities is concentrated at the federal level, the cooperation of the location canton, neighboring cantons and the neighboring countries is ensured. The general license for the deep geological repository is subject to an optional referendum. The polluter pays principle applies to the disposal of radioactive waste. The waste producers are legally obliged to dispose of them and have founded the National Cooperative for the Storage of Radioactive Waste (Nagra). The federal government is responsible for waste from medicine, industry and research (MIF). The Federal Council approved the waste management certificate for low and intermediate level waste (SMA) in 1988. High-level-waste (HAA) and long-live-intermediate-level-waste (LMA), where approved in 2006. Nagra's disposal concept envisages two separate deep geological repositories for SMA and HAA / LMA in a suitable, tectonically stable, low-permeability rock formation. If a site meets both the SMA and HAA / LMA storage requirements, the selection process may result in a common location for all radioactive waste. Until the
Kim, Sangyub; Guo, Jingshu; O’Sullivan, M. Gerald; Gallaher, Daniel D.; Turesky, Robert J.
2015-01-01
Considerable evidence suggests that environmental factors, including diet and cigarette smoke, are involved in the pathogenesis of colon cancer. Carcinogenic nitroso compounds (NOC), such as N-nitrosodimethylamine (NDMA), are present in tobacco and processed red meat, and NOC have been implicated in colon cancer. Azoxymethane (AOM), commonly used for experimental colon carcinogenesis, is an isomer of NDMA, and it produces the same DNA adducts as does NDMA. Heterocyclic aromatic amines (HAAs) formed during the combustion of tobacco and high-temperature cooking of meats are also associated with an elevated risk of colon cancer. The most abundant carcinogenic HAA formed in tobacco smoke is 2-amino-9H-pyrido[2,3-b]indole (AαC), whereas 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ) is the most potent carcinogenic HAA formed during the cooking of meat and fish. However, the comparative tumor-initiating potential of AαC, MeIQ, and AOM is unknown. In this report, we evaluate the formation of DNA adducts as a measure of genotoxicity, and the induction of colonic aberrant crypt foci (ACF) and dysplastic ACF, as an early measure of carcinogenic potency of these compounds in the colon of male A/J mice. Both AαC and AOM induced a greater number of DNA adducts than MeIQ in the liver and colon. AOM induced a greater number of ACF and dysplastic ACF than either AαC or MeIQ. Conversely, based on adduct levels, MeIQ-DNA adducts were more potent than AαC- and AOM-DNA adducts at inducing ACF. Long-term feeding studies are required to relate levels of DNA adducts, induction of ACF, and colon cancer by these colon genotoxicants. PMID:26734915
Directory of Open Access Journals (Sweden)
Chake Keerqin
2017-03-01
Full Text Available Broilers that have early access to feed have been shown to have enhanced immune system and gut development and heightened resilience against necrotic enteritis (NE. This study examined the effect of early feeding a high amino acid density diet on performance of broilers under a sub-clinical NE challenge model. Ross 308 broilers (n = 576 were assigned to a 2 × 2 × 2 factorial design with 2 feeding regimes (feed access either within 6 h post-hatch or after 48 h post-hatch, 2 diets (control diet or the control diet with an additional 10% digestible amino acids [HAA] and either presence or absence of NE challenge. Oral administrations of Eimeria species (d 9 and a field strain of Clostridium perfringens (d 14 were used to induce NE. Broiler performance was analysed at d 13, 23, 30 and 35. Intestinal lesion score and bacterial count were analysed on d 16. The NE challenge reduced overall bird performance and induced severe intestinal lesions, without causing notable mortality. At d 23 bird weight was significantly lower (P < 0.001 in the challenged birds compared with the unchallenged birds, but by d 30 the challenged birds had recovered and challenge no longer had an impact on bird performance. Birds fed the HAA diet had greater body weight by d 35 and heightened Lactobacillus content in the ileum at d 16 (P < 0.05. Birds that were fed the HAA diet after a period of fasting performed better in terms of feed conversion ratio (FCR under challenge. The findings from this study suggest there are beneficial effects of feeding high amino acid diets to birds in response to external stresses, such as post-hatch fasting and subclinical NE.
Determination of haloacetic acids in water by ion chromatography--method development.
Lopez-Avila, V; Liu, Y; Charan, C
1999-01-01
The microextraction/ion chromatographic (IC) method developed in this study involves extraction of 9 haloacetic acids (HAAs) from aqueous samples (acidified with sulfuric acid to a pH of copper sulfate pentahydrate and sodium sulfate) with methyl tert-butyl ether (MTBE), back extraction into reagent water, and analysis by IC with conductivity detection. The separation column consists of an Ion Pac AG-11 (2 mm id x 50 mm length) guard column and an Ion Pac AS-11 (2 mm id x 250 mm length) analytical column, and the concentration column is a 4 mm id x 35 mm length Dionex TAC-LP column. Use of the 2 mm id Dionex AS-11 column improved detection limits especially for trichloracetic acid (TCAA), bromodichloroacetic acid (BDCAA), dibromochloroacetic acid (DBCAA), and tribromoacetic acid (TBAA). The peak interfering with BCAA elutes at the same retention time as nitrate; however, we have not confirmed the presence of nitrate. Stability studies indicate that HAAs are stable in water for at least 8 days when preserved with ammonium chloride at 100 mg/L and stored at 4 degrees C in the dark. At day 30, recoveries were still high (e.g., 92.1-106%) for dichloroacetic acid (DCAA), BCAA, dibromoacetic acid (DBAA), trichloroacetic acid (TCAA), BDCAA, and DBCAA. However, recoveries of monochloroacetic acid (MCAA), monobromoacetic acid (MBAA), and TBAA were only 54.6, 56.8, and 66.8%, respectively. Stability studies of HAAs in H2SO4-saturated MTBE indicate that all compounds except TBAA are stable for 48 h when stored at 4 degrees C in the dark. TBAA recoveries dropped to 47.1% after 6 h of storage and no TBAA was detected after 48 h of storage. The method described here is only preliminary and was tested in only one laboratory. Additional research is needed to improve method performance.
Multi-terminal transport measurements of MoS2 using a van der Waals heterostructure device platform
DEFF Research Database (Denmark)
Cui, Xu; Lee, Gwan-Hyoung; Kim, Young Duck
2015-01-01
in performance, including a record-high Hall mobility reaching 34,000 cm2 V-1 s-1 for six-layer MoS2 at low temperature, confirming that low-temperature performance in previous studies was limited by extrinsic interfacial impurities rather than bulk defects in the MoS2. We also observed Shubnikov-de Haas...
40 CFR 141.622 - Subpart V monitoring plan.
2010-07-01
... procedures; and (iv) Monitoring plans for any other systems in the combined distribution system if the State... current distribution system locations with expected high TTHM or HAA5 levels. The State may also require modifications in your monitoring plan. If you are a subpart H system serving > 3,300 people, you must submit a...
2003-12-01
Application to Land-Cover Change in the Brazilian Amazon ,” Remote Sensing of Environment, vol 52, pp 137-154. Anderson, G.L., J.D. Hanson, and R.H. Haas...FORTRAN, Cambridge University Press. Price, K.P., D. A. Pyke,and L. Mendes. 1992. “Shrub Dieback in a Semiarid Ecosystem; The Integration of Remote
de Haas–van Alphen effect and Fermi surface properties of single-crystal CrB.sub.2./sub..
Czech Academy of Sciences Publication Activity Database
Brasse, M.; Chioncel, L.; Kuneš, Jan; Bauer, A.; Regnat, A.; Blum, C.G.F.; Wurmehl, S.; Pfleiderer, C.; Wilde, M.A.; Grundler, D.
2013-01-01
Roč. 88, č. 15 (2013), "155138-1"-"155138-7" ISSN 1098-0121 Institutional support: RVO:68378271 Keywords : CrB 2 * de Haas -van Alphen effect * non-collinear magnetic order Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.664, year: 2013 http://link. aps .org/doi/10.1103/PhysRevB.88.155138
Aoki, H; Endo, M; Nakayama, M; Takei, H; Kimura, N; Kunii, S; Terashima, T; Uji, S; Matsumoto, T
2002-01-01
We report our recent developments of experimental systems for measuring the de Haas-van Alphen (dHvA) effect under hydrostatic and uniaxial pressures. The dHvA effect of CeB sub 6 has been studied under both hydrostatic and uniaxial pressures and the effects of the pressures on the electronic structure are discussed.
Fermi Surface and Antiferromagnetism in Europium Metal
DEFF Research Database (Denmark)
Andersen, O. Krogh; Loucks, T. L.
1968-01-01
of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...
Waltman, Michael S.
2018-01-01
Whereas hate is defined as extreme negative feelings for others because of some aspect of their identity (Perry, 2001; Waltman & Haas, 2011), hate speech is discourse devoted to the vilification of the other's identity (Waltman, 2015; Waltman & Mattheis, 2017). It is an attempt to vandalize the other's identity to such an extent that the…
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
In > 0 and ≲ 6 K the resistivity shows an anomalous magnetic-history dependence together with an unusual relaxation behavior. In the isothermal resistivity Shubnikov–de Haas (SdH) oscillations, arising from a low-density system of mobile As-4 holes, with a frequency of 25 T have been recorded. From the - and ...
Roy, B C; Sedgewick, G; Aalhus, J L; Basarab, J A; Bruce, H L
2015-12-01
Increased meat toughness with animal age has been attributed to mature trivalent collagen cross-link formation. Intramuscular trivalent collagen cross-link content may be decreased by reducing animal age at slaughter and/or inducing muscle re-modeling with growth promotants. This hypothesis was tested in m. gluteus medius (GM) and m. semitendinosus (ST) from 112 beef steers finished at either 12 to 13 (rapid growth) or 18 to 20 (slow growth) months of age. Hereford-Aberdeen Angus (HAA) or Charolais-Red Angus (CRA) steers were randomly assigned to receive implants (IMP), ractopamine (RAC), both IMP and RAC, or none (control). RAC decreased pyridinoline (mol/mol collagen) and IMP increased Ehrlich chromogen (EC) (mol/mol collagen) in the GM. In the ST, RAC increased EC (mol/mol collagen) but decreased EC (nmol/g raw muscle) in slow growing CRA steers. Also, IMP increased ST pyridinoline (nmol/g raw muscle) of slow-growing HAA steers. Results indicated alteration of perimysium collagen cross-links content in muscle in response to growth promotants. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Mishra, Manna Kumari [Solid State Physics Laboratory, Lucknow Road, Timarpur, Delhi-110054 (India); Netaji Subhas Institute of Technology, Dwarka, New Delhi-110078 (India); Sharma, Rajesh K., E-mail: rksharma@sspl.drdo.in; Manchanda, Rachna; Bag, Rajesh K.; Muralidharan, Rangarajan [Solid State Physics Laboratory, Lucknow Road, Timarpur, Delhi-110054 (India); Thakur, Om Prakash [Netaji Subhas Institute of Technology, Dwarka, New Delhi-110078 (India)
2014-09-15
Magnetotransport in two distinct AlGaN/GaN HEMT structures grown by Molecular Beam Epitaxy (MBE) on Fe-doped templates is investigated using Shubnikov de-Haas Oscillations in the temperature range of 1.8–6 K and multicarrier fitting in the temperature range of 1.8–300 K. The temperature dependence of the two dimensional electron gas mobility is extracted from simultaneous multicarrier fitting of transverse and longitudinal resistivity as a function of magnetic field and the data is utilized to estimate contribution of interface roughness to the mobility and the corresponding transport lifetime. The quantum scattering time obtained from the analysis of Shubnikov de Haas Oscillations in transverse magnetoresistance along with the transport lifetime time were used to estimate interface roughness amplitude and lateral correlation length. The results indicate that the insertion of AlN over layer deposited prior to the growth of GaN base layer on Fe doped GaN templates for forming HEMT structures reduced the parallel conduction but resulted in an increase in interface roughness.
Directory of Open Access Journals (Sweden)
Ieva Švagždytė
2015-03-01
Full Text Available The article reviews the influence of cutting rates on macrogeometry deflection of milling complex form products and turning an outside surface. For that purpose, one of the most popular aluminium alloys 6082 has been chosen. A ball nose mill of 8 mm in diameter has been milled employing CNC vertical centre HAAS MINI MILL and applying CNC lathe HAAS ST 20 for turning. Measurements have been carried out using coordinate measuring machine DEA micro-hite DCC, applying the probe sphere of 3mm in diameter and the probe equipped with a needle. A deviation of the surface profile from tangent to therophore parabola has been investigated. The determinants R2 of the obtained regressive equation have disclosed that the depth of the cut has the biggest influence on macrogeometry deflections, whereas feed rate has a slighter influence and cutting speed has no radical influence. For the turning process, the depth of the cut has the strongest influence on circularity while cilindrisity has been mainly affected by cutting speed.
International Nuclear Information System (INIS)
Mishra, Manna Kumari; Sharma, Rajesh K.; Manchanda, Rachna; Bag, Rajesh K.; Muralidharan, Rangarajan; Thakur, Om Prakash
2014-01-01
Magnetotransport in two distinct AlGaN/GaN HEMT structures grown by Molecular Beam Epitaxy (MBE) on Fe-doped templates is investigated using Shubnikov de-Haas Oscillations in the temperature range of 1.8–6 K and multicarrier fitting in the temperature range of 1.8–300 K. The temperature dependence of the two dimensional electron gas mobility is extracted from simultaneous multicarrier fitting of transverse and longitudinal resistivity as a function of magnetic field and the data is utilized to estimate contribution of interface roughness to the mobility and the corresponding transport lifetime. The quantum scattering time obtained from the analysis of Shubnikov de Haas Oscillations in transverse magnetoresistance along with the transport lifetime time were used to estimate interface roughness amplitude and lateral correlation length. The results indicate that the insertion of AlN over layer deposited prior to the growth of GaN base layer on Fe doped GaN templates for forming HEMT structures reduced the parallel conduction but resulted in an increase in interface roughness
ABCOVE program: preliminary results of tests AB5 and AB6
International Nuclear Information System (INIS)
Hilliard, R.K.; Muhlestein, L.D.
1984-01-01
A program for aerosol behavior code validation and evaluation (ABCOVE) is in progress in the United States. Purpose of the ABCOVE program is to provide a basis for judging the adequacy of existing aerosol behavior computer codes to describe inherent aerosol behavior in containment buildings during postulated breeder reactor accidents. The program involves pretest calculations by code developers and users, large-scale confirmatory tests in the 850-m 3 containment vessel of the Containment Systems Test Facility (CSTF), and blind post-test analyses and comparisons with experimental data. Two ABCOVE tests have been performed in the CSTF to date. In the first test, a single-species aerosol was used, with the aerosol being generated by spraying sodium at a high rate into an air atmosphere. In the second test, the experimental conditions simulated an accident environment in which a fission product aerosol, NaI, was released in the presence of a sodium fire. Pretest computer code predictions were made by seven organizations using eight computer codes (HAA-3, HAA-4, HAARM-3, SOFIA, QUICK, QUICKM, MAEROS, and CONTAIN)
International Nuclear Information System (INIS)
Nangalama, A.W.
1989-01-01
In order to understand the role of glucocorticoids in the regulation of gonadotropin release by the pituitary gland, the short-term effects of cortisol perifusion (1.5 h to 8 hrs) on GnRH-induced LH secretion were investigated. To determine the biochemical mechanism(s) by which cortisol can act to modulate GnRH-induced LH release, the interactions of cortisol and arachidonic acid in GnRH-stimulated LH release were examined. Cortisol perifusion for 1.5 hr had no effect on GnRH-induced LH release, but longer treatment periods (4 hr-8 hrs) significantly reduced GnRH-stimulated LH release (4.0 hr, p -4 M AA was administered for 20 min before a 10 min, 10 -10 M GnRH pulse. Like cortisol, chloroquine also failed to inhibit AA-induced LH release. Perifusion with 10 -6 M cortisol for 6.0 hours significantly (p 3 ]AA release 24% below the basal (100%) [ 3 H]AA secretion. Reduction of [ 3 H]AA release was accompanied by decreased GnRH-stimulated LH secretion
Electrons at the monkey saddle: A multicritical Lifshitz point
Shtyk, A.; Goldstein, G.; Chamon, C.
2017-01-01
We consider two-dimensional interacting electrons at a monkey saddle with dispersion ∝px3-3 pxpy2 . Such a dispersion naturally arises at the multicritical Lifshitz point when three Van Hove saddles merge in an elliptical umbilic elementary catastrophe, which we show can be realized in biased bilayer graphene. A multicritical Lifshitz point of this kind can be identified by its signature Landau level behavior Em∝(Bm ) 3 /2 and related oscillations in thermodynamic and transport properties, such as de Haas-Van Alphen and Shubnikov-de Haas oscillations, whose period triples as the system crosses the singularity. We show, in the case of a single monkey saddle, that the noninteracting electron fixed point is unstable to interactions under the renormalization-group flow, developing either a superconducting instability or non-Fermi-liquid features. Biased bilayer graphene, where there are two non-nested monkey saddles at the K and K' points, exhibits an interplay of competing many-body instabilities, namely, s -wave superconductivity, ferromagnetism, and spin- and charge-density waves.
Carpenter, Kurt D.; Kraus, Tamara E.C.; Goldman, Jami H.; Saraceno, John Franco; Downing, Bryan D.; Bergamaschi, Brian A.; McGhee, Gordon; Triplett, Tracy
2013-01-01
This study characterized the amount and quality of organic matter in the Clackamas River, Oregon, to gain an understanding of sources that contribute to the formation of chlorinated and brominated disinfection by-products (DBPs), focusing on regulated DBPs in treated drinking water from two direct-filtration treatment plants that together serve approximately 100,000 customers. The central hypothesis guiding this study was that natural organic matter leaching out of the forested watershed, in-stream growth of benthic algae, and phytoplankton blooms in the reservoirs contribute different and varying proportions of organic carbon to the river. Differences in the amount and composition of carbon derived from each source affects the types and concentrations of DBP precursors entering the treatment plants and, as a result, yield varying DBP concentrations and species in finished water. The two classes of DBPs analyzed in this study-trihalomethanes (THMs) and haloacetic acids (HAAs)-form from precursors within the dissolved and particulate pools of organic matter present in source water. The five principal objectives of the study were to (1) describe the seasonal quantity and character of organic matter in the Clackamas River; (2) relate the amount and composition of organic matter to the formation of DBPs; (3) evaluate sources of DBP precursors in the watershed; (4) assess the use of optical measurements, including in-situ fluorescence, for estimating dissolved organic carbon (DOC) concentrations and DBP formation; and (5) assess the removal of DBP precursors during treatment by conducting treatability "jar-test" experiments at one of the treatment plants. Data collection consisted of (1) monthly sampling of source and finished water at two drinking-water treatment plants; (2) event-based sampling in the mainstem, tributaries, and North Fork Reservoir; and (3) in-situ continuous monitoring of fluorescent dissolved organic matter (FDOM), turbidity, chlorophyll-a, and
1960-02-24
fellow inmost respectable trousers and with his hair cut in the "hatf-bbx" ./polubokg/ style. And the dandified lad seldom appears to be a quite...8217v\\:’.’ In H. DementyeVs story, «% Roads,.» the character of Feliks Petunia evideSly^Haa not wprS out, in our opinion; he: is^an architect who
Verstedeliking, Suid-Afrikaanse letterkundes en die kultuurteks
African Journals Online (AJOL)
“cultural text” is further employed as a theoretical instrument. The identification of repeating sets of representation is central to the demarcation of a “cultural text about ...... 2. die groot figure, baarde dae-oud,. 3. met krae opgeslaan, die wind is koud,. 4. en mompel oor die weer in Afrikaans;. 5. die koppe stug asof haas suf ...
IMF toetab Eesti maksureformi / Andris Feldmanis, Kertu Ruus
Feldmanis, Andris, 1982-
2004-01-01
Rahvusvahelise Valuutafondi (IMF) Eesti missiooni juht Richard Haas tutvustab äsjailmunud IMF-i raportis esitatud hinnangut Eesti majanduse hetkeseisu kohta ja võimalikke järgneva 15 aasta makroohtusid, sh jooksevkonto puudujääki ja laenamise kiiret kasvu. Rahandusminister Taavi Veskimägi ja Eesti Panga presidendi Vahur Krafti kommentaarid. Diagramm: Eesti laenukoormuse kasv kiireim
Oma ninast kaugemal: Aasia ja Euroopa fotokunsti võrdlusi / Annika Haas
Haas, Annika, 1974-
2016-01-01
Rahvusvahelisest portreefotovõistlusest "Kuala Lumpur International Photo Awards 2016" (KLPA 2016). Saksa fotokunstnikest Kathrin Tschirnerist ja Heiko Tiemannist, Jaapani fotokunstnikust Mayumi Suzukist, Jeemeni-Bosnia-Ameerika päritolu fotokunstnikust Alia Alist, Malaisia fotokunstnikest Eiffel Chongist ja Nadirah Zakariyast
Paris Photo 2015 / Kristel Schwede, Annika Haas, Laura Põld, Piret Frey
2015-01-01
Rahvusvaheline fotomess "Paris Photo 2015" 12. kuni 15. novembrini Pariisi messihallis Grand Palais. Eestit esindasid messil oma loominguga Jaanus Samma, Sigrid Viir, Krista Mölder (Temnikova & Kasela galerii)
Organic sponges for cost-effective CVOC abatement. Final report, September 1992--April 1994
International Nuclear Information System (INIS)
Flanagan, W.P.; Grade, M.M.; Horney, D.P.; Mackenzie, P.D.; Salvo, J.J.; Sivavec, T.M.; Stephens, M.L.
1994-07-01
Air contaminated with CVOCs (chlorinated volatile organic compounds) arise from air stripping of ground water or from soil and dual phase vapor extraction. A research program was undertaken to develop sorbents better than activated carbon for remediation. Two such sorbents were found: Dow's XUS polymer and Rohm and Haas' Ambersorb 563 (carbonaceous). Opportunities exist to further develop sorption and biodegradation technologies
40 CFR 141.623 - Reduced monitoring.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Reduced monitoring. 141.623 Section....623 Reduced monitoring. (a) You may reduce monitoring to the level specified in the table in this paragraph (a) any time the LRAA is ≤0.040 mg/L for TTHM and ≤0.030 mg/L for HAA5 at all monitoring locations...
Organic sponges for cost-effective CVOC abatement. Final report, September 1992--April 1994
Energy Technology Data Exchange (ETDEWEB)
Flanagan, W.P.; Grade, M.M.; Horney, D.P.; Mackenzie, P.D.; Salvo, J.J.; Sivavec, T.M.; Stephens, M.L.
1994-07-01
Air contaminated with CVOCs (chlorinated volatile organic compounds) arise from air stripping of ground water or from soil and dual phase vapor extraction. A research program was undertaken to develop sorbents better than activated carbon for remediation. Two such sorbents were found: Dow`s XUS polymer and Rohm and Haas` Ambersorb 563 (carbonaceous). Opportunities exist to further develop sorption and biodegradation technologies.
Plesiophysa guadeloupensis ("Fischer" Mazé, 1883
Directory of Open Access Journals (Sweden)
W Lobato Paraense
2003-06-01
Full Text Available A description is presented of the shell and anatomic characters of the planorbid mollusk Plesiophysa guadeloupensis ("Fischer" Mazé, 1883, based on topotypic specimens from a pond in Borricaud (Grande Terre, Guadeloupe. Comparison with previous descriptions of nominal species of Plesiophysa points to its identity with P. ornata (Haas, 1938, of which it is a senior synonym.
International Nuclear Information System (INIS)
Nakamura, Ai; Takeuchi, Tetsuya; Tatetsu, Yasutomi; Maehira, Takahiro; Hedo, Masato; Nakama, Takao; Ōnuki, Yoshichika; Harima, Hisatomo
2015-01-01
The electronic states in EuBi 3 and EuPd 3 are known to be Eu-divalent and Eu- trivalent, respectively, from the previous studies using polycrystal samples. In the present study, we succeeded in growing high-quality single crystals, and carried out the de Haas-van Alphen (dHvA) measurements and energy band calculations to clarify the Fermi surface properties
Comparison between different bio-treatments of a hydrocarbon ...
African Journals Online (AJOL)
Ramya
2011-10-31
Oct 31, 2011 ... As cost is a critical issue, it is also important to determine ... studies. A modified minimal salts nutrient solution based on. Bushnell Haas medium ... used was an Alltech EC-5 (30 m × 0.25 mm with 0.25 µm film thickness), with helium ... Fungal ITS genes were amplified using a nested PCR approach. The first ...
Uniaxial Pressure Effect on the SdH Oscillations in Heavy-Fermion Semimetal CeRu4Sb12
International Nuclear Information System (INIS)
Saha, S. R.; Kobayashi, M.; Sugawara, H.; Namiki, T.; Abe, K.; Aoki, Y.; Sato, H.
2003-01-01
We report the first successful Shubnikov-de Haas (SdH) experiment under uniaxial pressure in the anomalous heavy-fermion semimetal CeRu 4 Sb 12 . The nature of the quantum oscillations in the magnetoresistance is found to be significantly sensitive to uniaxial pressure. The results reveal that the nearly spherical Fermi surface elongates along the direction of the uniaxial pressure. (author)
Arachidonic acid metabolism in fibroblasts derived from canine myocardium
International Nuclear Information System (INIS)
Weber, D.R.; Prescott, S.M.
1986-01-01
Canine fibroblasts from normal or healing infarcted myocardium were grown in culture. The cells were morphologically indistinguishable, but the doubling time of cells from healing myocardium was 39.6 +/- 3.5 hr whereas that of normals was 24 +/- 3.7 (n=5, p 3 H]arachidonate (AA) into phospholipids. Calcium ionophore A23187 (10 μM) caused release and metabolism of [ 3 H] AA. A23187 or AA (10μM) induced production of 6-keto PGF1α, PGE2, and a hydroxy metabolite of AA. RIA of 6-keto PGF1α showed that subconfluent cells from healing myocardium produced 1202 +/- 354 pg/mg protein whereas that of normals was 551 +/- 222 (n=7, p 3 H]AA released but did not metabolize [ 3 H]AA. In coincubations, fibroblasts incorporated myocyte-derived AA. Subsequent stimulation of the fibroblasts with A23187 induced the synthesis of 6-keto PGF1α, PGE2 and a hydroxy metabolite. The fibroblast content of healing myocardium was 35-1000 times that of normal tissue (n=7). Thus even a moderate change in AA metabolism, amplified by the AA released from deteriorating myocytes, may be a significant physiologic or pathologic event
Energy Technology Data Exchange (ETDEWEB)
Morrison, C., E-mail: c.morrison.2@warwick.ac.uk; Casteleiro, C.; Leadley, D. R.; Myronov, M. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)
2016-09-05
The complex quantum transport of a strained Ge quantum well (QW) modulation doped heterostructure with two types of mobile carriers has been observed. The two dimensional hole gas (2DHG) in the Ge QW exhibits an exceptionally high mobility of 780 000 cm{sup 2}/Vs at temperatures below 10 K. Through analysis of Shubnikov de-Haas oscillations in the magnetoresistance of this 2DHG below 2 K, the hole effective mass is found to be 0.065 m{sub 0}. Anomalous conductance peaks are observed at higher fields which deviate from standard Shubnikov de-Haas and quantum Hall effect behaviour due to conduction via multiple carrier types. Despite this complex behaviour, analysis using a transport model with two conductive channels explains this behaviour and allows key physical parameters such as the carrier effective mass, transport, and quantum lifetimes and conductivity of the electrically active layers to be extracted. This finding is important for electronic device applications, since inclusion of highly doped interlayers which are electrically active, for enhancement of, for example, room temperature carrier mobility, does not prevent analysis of quantum transport in a QW.
Salmon, C P; Knize, M G; Felton, J S; Zhao, B; Seow, A
2006-04-01
Chicken and fish samples prepared by 42 Singapore Chinese in their homes were obtained. Researchers were present to collect data on raw sample weight, cooking time, maximum cooking surface temperature, and cooked sample weight. Each participant prepared one pan-fried fish sample and two pan-fried chicken samples, one marinated, one not marinated. The cooked samples were analyzed for five heterocyclic aromatic amine (HAA) mutagens, including MeIQx (2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline); 4,8-DiMeIQx (2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline); 7,8-DiMeIQx (2-amino-3,7,8-trimethylimidazo[4,5-f]quinoxaline); PhIP (2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine), and IFP (2-amino-(1,6-dimethylfuro[3,2-e]imidazo[4,5-b])pyridine). A paired Student's t-test showed that marinated chicken had lower concentrations of PhIP (pchicken, and also that weight loss due to cooking was less in marinated chicken than in non-marinated chicken (pchicken (pchicken (pchicken (pchicken (pchicken (p<0.05). This study provides new information on HAA content in the Singapore Chinese diet.
Tracing disinfection byproducts in full-scale desalination plants
Le Roux, Julien
2015-03-01
The aim of this study was to assess the formation and the behavior of halogenated byproducts (regulated THMs and HAAs, as well as nitrogenous, brominated and iodinated DBPs including the emerging iodo-THMs) along the treatment train of full-scale desalination plants. One thermal multi-stage flash distillation (MSF) plant and two reverse osmosis (RO) plants located on the Red Sea coast of Saudi Arabia. DBPs formed during the prechlorination step were efficiently removed along the treatment processes (MSF or RO). Desalination plants fed with good seawater quality and using intermittent chlorine injection did not show high DBP formation and discharge. One RO plant with a lower raw water quality and using continuous chlorination at the intake formed more DBPs. In this plant, some non-regulated DBPs (e.g., dibromoacetonitrile and iodo-THMs) reached the product water in low concentrations (< 1.5 μg/L). Regulated THMs and HAAs were far below their maximum contamination levels set by the US Environmental Protection Agency. Substantial amounts of DBPs are disposed to the sea; low concentrations of DBPs were indeed detected in the water on shore of the desalination plants.
Magnetic properties of anyonic systems in a normal phase
International Nuclear Information System (INIS)
Aronov, I.E.; Naftulin, S.A.
1992-08-01
We apply the concept of fractional statistics to the two-dimensional conductors. The effective Lagrangian of an external magnetic field in anyon medium at finite temperature and density is presented. The diamagnetic response to the external field is studied at temperatures above T c (i.e. in the normal phase) for various values of external parameters. Oscillations of both thermodynamic (the de Haas - van Alphen effect) and kinetic (the Shubnikov - de Haas effect) quantities are re-examined. Numerous peculiarities arise from the fact that anyon systems possess a non-zero ''statistical'' flux Φ (which is known to be a manifestation of the spontaneous parity breakdown). The cyclotron resonance is suggested as a direct test on possible parity violation (which is the key point of anyonics). The cyclotron mass dependences on external parameters reported in a series of experimental articles (H. Kublbeck and J.P. Kotthaus, Phys. Rev. Lett. 35, 1019 (1975); G. Abstreiter, J.P. Kotthaus, J.F. Koch and G. Dorda, Phys. Rev. B14, 2480 (1976)) may be attributed to an unusual behaviour or magnetic permeability in anyon medium. (author). 20 refs, 2 figs
Morrison, C.; Casteleiro, C.; Leadley, D. R.; Myronov, M.
2016-09-01
The complex quantum transport of a strained Ge quantum well (QW) modulation doped heterostructure with two types of mobile carriers has been observed. The two dimensional hole gas (2DHG) in the Ge QW exhibits an exceptionally high mobility of 780 000 cm2/Vs at temperatures below 10 K. Through analysis of Shubnikov de-Haas oscillations in the magnetoresistance of this 2DHG below 2 K, the hole effective mass is found to be 0.065 m0. Anomalous conductance peaks are observed at higher fields which deviate from standard Shubnikov de-Haas and quantum Hall effect behaviour due to conduction via multiple carrier types. Despite this complex behaviour, analysis using a transport model with two conductive channels explains this behaviour and allows key physical parameters such as the carrier effective mass, transport, and quantum lifetimes and conductivity of the electrically active layers to be extracted. This finding is important for electronic device applications, since inclusion of highly doped interlayers which are electrically active, for enhancement of, for example, room temperature carrier mobility, does not prevent analysis of quantum transport in a QW.
2014-12-26
Colour Deficiency standard. Previous process control experience across participants was not required to participate in the study and resulted in...tracking dual-task performance. Psychological Research, 61 (1), 71-81. Chen, J. Y., Haas, E. C., & Barnes, M. J. (2007, November). Human Performance...Spelke, E. S. (1980). Dividing Attention Without Alternation or Automaticity . Journal of Experimental Psychology : General, 109 (1), 98-117. Ishihara, S
Directory of Open Access Journals (Sweden)
P. M. Robbertse
1965-03-01
Full Text Available Ons leef in ’n tyd van ongeëwenaarde ontwikkeling en spesialisasie. A1 m eer w ord van deskundiges op verskillende terreine gebruik gemaak om die toekom s op haas elke fase van die lewe te beplan. So sterk is die behoefte aan beplanning dat in die R.S.A. onlangs ’n D epartem ent van Beplanning ingestel is.
Electron magnetotransport in GaAs/AlGaAs superlattices with weak and strong inter-well coupling
Czech Academy of Sciences Publication Activity Database
Smrčka, Ludvík; Goncharuk, Natalya; Svoboda, Pavel; Vašek, Petr; Krupko, Yuriy; Wegscheider, W.
2008-01-01
Roč. 39, 3-4 (2008), s. 411-413 ISSN 0026-2692 R&D Projects: GA MŠk LC510; GA AV ČR KAN400100652 Grant - others:EC(XE) RITA -CT-2003-505474 Institutional research plan: CEZ:AV0Z10100521 Keywords : superlattice * Fermi surface * magnetoresistance * Hall effect * Shubnikov-de Haas oscillations Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.859, year: 2008
Assessment of air and water contamination by disinfection by-products at 41 indoor swimming pools.
Tardif, Robert; Catto, Cyril; Haddad, Sami; Simard, Sabrina; Rodriguez, Manuel
2016-07-01
This study was aimed at assessing the profiles (occurrence and speciation) of disinfection by-product (DBP) contamination in air and water of a group of 41 public indoor swimming pools in Québec (Canada). The contaminants measured in the water included the traditional DBPs [i.e., four trihalomethanes (THMs), six haloacetic acids (HAAs)] but also several emergent DBPs [i.e., halonitriles, halonitromethanes, haloketones and nitrosodimethylamine (NDMA)]. Those measured in the air comprised THMs and chloramines (CAMs). Overall, extremely variable DBP levels were found from one pool to another (both quantitatively and in terms of speciation). For instance, in water, among the four THMs, chloroform was usually the most abundant compound (37.9±25.7µg/L). Nevertheless, the sum of the three other brominated THMs represented more than 25% of total THMs at almost half the facilities visited (19 cases). In 13 of them, the levels of brominated THMs (66±24.2µg/L) even greatly outweighed the levels of chloroform (15.2±6.31µg/L). Much higher levels of HAAs (294.8±157.6µg/L) were observed, with a consistent preponderance of brominated HAAs in the swimming pools with more brominated THMs. NDMA levels which were measured in a subset of 8 pools ranged between 2.8ng/L and 105ng/L. With respect to air, chloroform was still the most abundant THM globally (119.4±74.2µg/m(3)) but significant levels of brominated THMs were also observed in various cases, particularly in the previously evoked group of 13 swimming pools with preponderant levels of brominated THMs in water. CAM levels (0.23±0.15mg/m(3)) varied highly, ranging from not detected to 0.56mg/m(3). Overall, the levels were generally relatively high compared to current guidelines or reference values from several countries, and they point to a relatively atypical presence of brominated compounds, and to significant levels of emergent DBPs for which health risk is less documented. Copyright © 2016 Elsevier Inc. All rights
International Nuclear Information System (INIS)
Shen, J.X.; Ossau, W.; Fischer, F.; Waag, A.; Landwehr, G.
1995-01-01
Oscillations of photoluminescence properties in external magnetic fields are investigated in CdTe modulation doped quantum wells. The oscillatory behaviour of the luminescence intensity, the line width and the g factor is due to many-body effects in the 2-dimensional electron gas. The oscillation of photoluminescence intensity can be easily used as optically detected Shubnikov de Haas effect to determine the electron concentration in quantum wells without contacts. (author)
2011-09-01
magnetometer as the sensor, and the ACS controller. The magnetic control approach of NPSAT1 relies on favorable moments of inertia by optimum equipment...parallel with the HAAS rotational axis. To cancel the earth’s rotational effects, the turntable was tilted at -36.4° (accounts for the geocentric ...this initialization. 108 a. Gyro Bias Calibration from Three-Axis Magnetometer Measurements Reference [35] presents a real-time approach for gyro
Asymmetric Power Balance and Its Implications for Regionalism in South Asia
2015-03-01
constitutes an ideal grouping for economic integration.16 The political dimensions are mainly overshadowed with security concerns among member states...United States’ to the North American Free Trade Agreement ( NAFTA ).39 The region’s geo-politics strongly suggest that India is the best candidate for...dynamics in South Asia. Many scholars have put forth their view on what constitutes regional cooperation and integration. E.B. Haas defines the
Designing Robust and Resilient Tactical MANETs
2014-09-25
0. doi: B. Tan , J. Ni, R. Srikant. Q-CSMA: Queue-Length-Based CSMA/CA Algorithms for Achieving Maximum Throughput and Low Delay in Wireless Networks...INFOCOM 2012 Mini-Conference. 01-JAN-12, . : , J. Katz , Y. Lindell. Aggregate Message Authentication Codes, RSA 2008 . 01-JAN-08, . : , J. Ni, Bo Tan ...Haas, Yih-Chun Hu, Nicola Laurenti. Low-Cost Mitigation of Privacy Loss due to Radiometric Identification, Eighth ACM International Workshop on
The Effects of Designated Pollutants on Plants
1978-11-01
Persea americana Mill. Haas and Bacon Barley Hordeum vulgare L. CM 67 Bean Phaseolus vulgaris L. Pinto, U.I. III Briza Briza maxima L. Ornamental...Tagetes patula L. French dwarf double goldie Marigold Tagetes erecta L. American ,Senator Dirksen Petunia Petunia hybrida Vilm. White cascade Radish...Probit analysis of five plant species: citrus seedlings, lemon, orange,, grape, French marigold, American marigold. Probit scale is the probability that a
Electron Gas Dynamic Conductivity Tensor on the Nanotube Surface in Magnetic Field
Directory of Open Access Journals (Sweden)
A. M. Ermolaev
2011-01-01
Full Text Available Kubo formula was derived for the electron gas conductivity tensor on the nanotube surface in longitudinal magnetic field considering spatial and time dispersion. Components of the degenerate and nondegenerate electron gas conductivity tensor were calculated. The study has showed that under high electron density, the conductivity undergoes oscillations of de Haas-van Alphen and Aharonov-Bohm types with the density of electrons and magnetic field changes.
APLASTIC ANEMIA AND VIRAL HEPATITIS
Directory of Open Access Journals (Sweden)
Laura Cudillo
2009-11-01
Liver histology is characterized by T cell infiltrating the parenchyma as reported in acute hepatitis. Recently in HAA it has been demonstrated intrahepatic and blood lymphocytes with T cell repertoire similar to that of confirmed viral acute hepatitis. The expanded T cell clones return to a normal distribution after response to immunosuppressive treatment, suggesting the antigen or T cell clearance. Therapeutic options are the same as acquired aplastic anemia.
Putin's security policy in the past, present and future / Marcel de Haas
Haas, Marcel de
2004-01-01
Venemaa julgeolekupoliitika analüüs. Analüüsi aluseks on 2000. aastal välja töötatud Venemaa riiklik julgeolekukontseptsioon, sõjaline doktriin ja Vene föderatsiooni välispoliitiline kontseptsioon ning 2003. a. avaldatud Venemaa Föderatsiooni sõjalise kaitsevõime arendamise peamised prioriteedid. Tabel
Latimer, Caitlin S; Keene, C Dirk; Flanagan, Margaret E; Hemmy, Laura S; Lim, Kelvin O; White, Lon R; Montine, Kathleen S; Montine, Thomas J
2017-06-01
Two population-based studies key to advancing knowledge of brain aging are the Honolulu-Asia Aging Study (HAAS) and the Nun Study. Harmonization of their neuropathologic data allows cross comparison, with findings common to both studies likely generalizable, while distinct observations may point to aging brain changes that are dependent on sex, ethnicity, environment, or lifestyle factors. Here, we expanded the neuropathologic evaluation of these 2 studies using revised NIA-Alzheimer's Association guidelines and compared directly the neuropathologic features of resistance and apparent cognitive resilience. There were significant differences in prevalence of Alzheimer disease neuropathologic change, small vessel vascular brain injury, and Lewy body disease between these 2 studies, suggesting that sex, ethnicity, and lifestyle factors may significantly influence resistance to developing brain injury with age. In contrast, hippocampal sclerosis prevalence was very similar, but skewed to poorer cognitive performance, suggesting that hippocampal sclerosis could act sequentially with other diseases to impair cognitive function. Strikingly, despite these observed differences, the proportion of individuals resistant to all 4 diseases of brain or displaying apparent cognitive resilience was virtually identical between HAAS and Nun Study participants. Future in vivo validation of these results awaits comprehensive biomarkers of these 4 brain diseases. © 2017 American Association of Neuropathologists, Inc. All rights reserved.
Real-time discriminatory sensors for water contamination events :LDRD 52595 final report.
Energy Technology Data Exchange (ETDEWEB)
Borek, Theodore Thaddeus III (; ); Carrejo-Simpkins, Kimberly; Wheeler, David Roger; Adkins, Douglas Ray; Robinson, Alex Lockwood; Irwin, Adriane Nadine; Lewis, Patrick Raymond; Goodin, Andrew M.; Shelmidine, Gregory J.; Dirk, Shawn M.; Chambers, William Clayton; Mowry, Curtis Dale (1722 Micro-Total-Analytical Systems); Showalter, Steven Kedrick
2005-10-01
The gas-phase {mu}ChemLab{trademark} developed by Sandia can detect volatile organics and semi-volatiles organics via gas phase sampling . The goal of this three year Laboratory Directed Research and Development (LDRD) project was to adapt the components and concepts used by the {mu}ChemLab{trademark} system towards the analysis of water-borne chemicals of current concern. In essence, interfacing the gas-phase {mu}ChemLab{trademark} with water to bring the significant prior investment of Sandia and the advantages of microfabrication and portable analysis to a whole new world of important analytes. These include both chemical weapons agents and their hydrolysis products and disinfection by-products such as Trihalomethanes (THMs) and haloacetic acids (HAAs). THMs and HAAs are currently regulated by EPA due to health issues, yet water utilities do not have rapid on-site methods of detection that would allow them to adjust their processes quickly; protecting consumers, meeting water quality standards, and obeying regulations more easily and with greater confidence. This report documents the results, unique hardware and devices, and methods designed during the project toward the goal stated above. It also presents and discusses the portable field system to measure THMs developed in the course of this project.
Carvalho, Nayane Chagas; Guedes, Simone Alves Garcez; Albuquerque-Júnior, Ricardo Luiz Cavalcanti; de Albuquerque, Diana Santana; de Souza Araújo, Adriano Antunes; Paranhos, Luiz Renato; Camargo, Samira Esteves Afonso; Ribeiro, Maria Amália Gonzaga
2018-01-01
This study aims to evaluate, in vitro, the effect of Aloe vera associated with endodontic medication, with or without laser photobiomodulation (FTL) irradiation in FP6 human pulp fibroblasts. The materials were divided into eight groups: CTR - control; CL - FTL alone; AA - Aloe vera with distilled water; AL - Aloe vera with distilled water and FTL; HA - calcium hydroxide P.A. with distilled water; HL - calcium hydroxide P.A. with distilled water and FTL; HAA - calcium hydroxide P.A. with Aloe vera and distilled water; HAL - calcium hydroxide P.A. with Aloe vera, distilled water, and FTL. The cytotoxicity was evaluated by MTT assay at 24, 48, and 72h and the genotoxicity by micronucleus test assay. This study was performed in triplicate. Data obtained in both tests were statistically analyzed by ANOVA and Tukey's tests (p≤0.05). Group AA presented high genotoxicity and low cytotoxicity. After 24, 48, and 72h, the group HAA significantly reduced the cell viability. Interaction with FTL showed slightly increase cell viability after 24 and 48h in groups CL and HL (pAloe vera allowed higher cell viability in human pulp fibroblasts in the presence of calcium hydroxide or with FTL separately, but genotoxicity increased in these associations. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Lindelof, P.E.; Bruus, H.; Taboryski, R.; Soerensen, C.B.
1989-01-01
An inverted and a normal GaAs/AlGaAs interface grown back to back in a socalled selectively doped double heterostructure (SD DH) has been studied in magnetic fields up to 12 tesla and at temperatures down to 0.3 K. The longitudinal resistance goes to zero at minima of the Shubnikov-de Haas oscillations. The Hall resistivity is found to exhibit the quantum Hall effect. By etching the surface of the double heterostructure wafer we create an unbalance in the density of electrons in the two parallel two-dimensional electronic sheets. Although we in this way create only a modest change in the electron densities, we observe a significant change in the Shubnikov-de Haas oscillations, which can be interpreted as a beat between the oscillations of two electron layers with different densities. At the same time we observe a significant variation of the width of the quantum Hall steps. The most astonishing feature of our results is a clear quantum Hall plateou at 1/2 filling in each of the two parallel layers observed at temperatures below 1 K at a magnetic field above 10 T. Weak localization was also studied and such experiments are consistent with two parallel and independent two-dimensional electronic layers. (orig.)
A Model for the Interfacial Kinetics of Phospholipase D Activity on Long-Chain Lipids
2013-07-01
7506–7513. 18. Zografi, G., R. Verger, and G. H. de Haas. 1971. Kinetic analysis of the hydrolysis of lecithin monolayers by phospholipase A. Chem...ChemBioChem. 9:2853–2859. 54. Albrecht, O., H. Gruler, and E. Sackmann. 1981. Pressure-composition phase diagrams of cholesterol/ lecithin , cholesterol...phosphatidic acid, and lecithin /phosphatidic acid fixed monolayers: a Langmuit film balance study. J. Colloid Interface Sci. 79:319–338. 55. Morris, A
Hakala, Inkeri
2014-01-01
Tutkielma tarkastelee nuorten kuluttajien kodinsisustukseen ja puuhuonekaluihin liittämiä merkityksiä saksalaisessa ja suomalaisessa kontekstissa. Aihetta lähestytään maun ja elämäntyylin sekä kuluttajien tavarasuhteen näkökulmasta. Tutkimuksen aineisto koostuu Saksassa ja Suomessa huonekaluliikkeissä ja -messuilla kerätystä havainnoin-timateriaalista sekä 23–34 -vuotiaille kuluttajille tehdystä 22 teemahaastattelusta. Havainnointiaineistoa on käytetty tutkimuskontekstin hahmottamisessa. Haas...
Diversity, Replication, Pathogenicity and Cell Biology of Crimean Congo Hemorrhagic Fever Virus
2010-10-01
1990. Hen egg white lysozyme expressed in, and secreted from, Aspergillus niger is correctly processed and folded. Biotechnology (New York) 8:741–745. 7...in bunyavirus-infected cells. J. Virol. 41:643–648. 18. Garry, C. E., and R. F. Garry. 2004. Proteomics computational analyses suggest that the...2005). Proteomic identification of proteins conjugated to ISG15 in mouse and human cells. Biochem. Biophys. Res. Commun. 336, 496–506. Haas, A.L
Directory of Open Access Journals (Sweden)
T.T. Cloete
2012-11-01
Full Text Available N.P. van Wyk Louw het ’n kort gedig van net twee verse geskryf. Sintakties is albei verse onvoltooid. Vers 1 is aan die begin van die gedig sintakties oop en vers 2 is aan die einde van die koeplet sintakties onvoltooi. Hierdie oop plekke aan die begin en einde van die koeplet laat die leser toe om die gedig in ’n haas eindelose aantal gedigte te vermenigvuldig.
Oscillating Magnetoresistance in Graphene p-n Junctions at Intermediate Magnetic Fields.
Overweg, Hiske; Eggimann, Hannah; Liu, Ming-Hao; Varlet, Anastasia; Eich, Marius; Simonet, Pauline; Lee, Yongjin; Watanabe, Kenji; Taniguchi, Takashi; Richter, Klaus; Fal'ko, Vladimir I; Ensslin, Klaus; Ihn, Thomas
2017-05-10
We report on the observation of magnetoresistance oscillations in graphene p-n junctions. The oscillations have been observed for six samples, consisting of single-layer and bilayer graphene, and persist up to temperatures of 30 K, where standard Shubnikov-de Haas oscillations are no longer discernible. The oscillatory magnetoresistance can be reproduced by tight-binding simulations. We attribute this phenomenon to the modulated densities of states in the n- and p-regions.
Aeroacoustics of Flight Vehicles: Theory and Practice. Volume 2. Noise Control
1991-08-01
noisiness, Localization and Precedence The ability to determine the location of sound sources is one of the major benefits of having a binaural hearing... binaural hearing is commonly called the Haas. or precedence, effect (ref. 16). This refers to the ability to hear as a single acoustic event the...propellers are operated at slightly different rpm values, beating interference between the two sources occurs, and the noise level in the cabin rises and
Bovine trypanosomosis prevalence at the edge of Hluhluwe-iMfolozi Park, KwaZulu-Natal, South Africa
Directory of Open Access Journals (Sweden)
Lundi Ntantiso
2014-09-01
Full Text Available The northern KwaZulu-Natal (NKZN region of South Africa is the southern limit of the African tsetse belt. Entomological information on Glossina brevipalpis and Glossina austeni was generated following the outbreak of trypanosomosis in cattle in 1990. However, these data have not been supported by parallel studies on epidemiology of the disease and therefore there has been no control policy in place. This study presented the first intensive investigations to address the epidemiology of trypanosomosis in NKZN. Tsetse abundance, trypanosome herd average prevalence (HAP, herd average anaemia (HAA and herd average packed cell volume (HA-PCV were investigated at three communal diptanks located at the edge of Hluhluwe-iMfolozi Park by monthly sampling from June 2006 – November 2007. Seasonal trypanosome surveys were conducted at seven other communal diptanks. Glossina brevipalpis prevalence was high at two of the diptanks, Mvutshini and Ekuphindisweni, but low at Ocilwane, whilst G. austeni was only collected from Mvutshini. This high and low tsetse challenge presented different disease scenarios. Cattle at Mvutshini and Ekuphindisweni had the highest HAP of 12.3% and 8.9% respectively, both significantly different (p = 0.001 from the HAP obtained from cattle at Ocilwane (2.9%. These two cattle herds also had the highest HAA, 27.7% and 33.4% respectively, whilst cattle at Ocilwane had the lowest, 11.1% (p = 0.001. Conversely, cattle at Ocilwane had the highest HA-PCV, ranging between 29.0% and 32.0%, whilst cattle at Mvutshini and Ekuphindisweni had the lowest HA-PCV (24.0% – 29.0%. By combining the data from the three diptanks (1318 observations, 62.0% of the infected cattle were found anaemic, compared to 20.0% in the uninfected group. Trypanosome seasonal surveys showed that cattle at all the seven diptanks were infected with trypanosomes; mean HAP, HAA and HA-PCV of 10.2%, 46.6% and 23.7%, respectively. This study generated information on the
David Shoenberg and the beauty of quantum oscillations
Pudalov, V. M.
2011-01-01
The quantum oscillation effect was discovered in Leiden in 1930, by W. J. de Haas and P. M. van Alphen when measuring magnetization, and by L. W. Shubnikov and de Haas when measuring magnetoresistance. Studying single crystals of bismuth, they observed oscillatory variations in the magnetization and magnetoresistance with magnetic field. Shoenberg, whose first research in Cambridge had been on bismuth, found that much stronger oscillations are observed when a bismuth sample is cooled to liquid helium temperature rather than liquid hydrogen, which had been used by de Haas. In 1938 Shoenberg went from Cambridge to Moscow to study these oscillations at Kapitza's Institute where liquid helium was available at that time. In 1947, J. Marcus observed similar oscillations in zinc and that persuaded Schoenberg to return to this research. After that, the dHvA effect became one of his main research topics. In particular, he developed techniques for quantitative measurement of this effect in many metals. A theoretical explanation of quantum oscillations was given by L. Onsager in 1952, and an analytical quantitative theory by I. M. Lifshitz and A. M. Kosevich in 1955. These theoretical advances seemed to provide a comprehensive description of the effect. Since then, quantum oscillations have been widely used as a tool for measuring Fermi surface extremal cross-sections and all-angle electron scattering times. In his pioneering experiments of the 1960's, Shoenberg revealed the richness and deep essence of the quantum oscillation effect and showed how the beauty of the effect is disclosed under nonlinear conditions imposed by interactions in the system under study. It was quite surprising that "magnetic interaction" conditions could cause the apparently weak quantum oscillation effect to have such strong consequences as breaking the sample into magnetic (now called "Shoenberg") domains and forming an inhomogeneous magnetic state. With his contributions to the field of quantum
David Schoenberg and the beauty of quantum oscillations
International Nuclear Information System (INIS)
Pudalov, V.M.
2012-01-01
The quantum oscillation effect was discovered in Leiden, in 1930, by W.J. de Haas and P.M. van Alphen in magnetization measurement, and by L.W. Shubnikov and de Haas - in magnetoresistance. Studying single crystals of bismuth, they observed oscillatory variations of magnetization and magnetoresistance with magnetic field. Shoenberg, whose first research in Cambridge had been on bismuth, found that much stronger oscillations are observed when a bismuth sample is cooled to liquid helium rather than to liquid hydrogen, which had been used by de Haas. In 1938 Shoenberg came from Cambridge to Moscow to study these oscillations at Kapitza Institute where liquid helium was available at that time. In 1947, J. Marcus observed similar oscillations in zinc, that persuaded Shoenberg to return to this research, and, since then, the dHvA effect had been one of his main research topic. In particular, he developed techniques for quantitative measurements of the effect in many metals. Theoretical explanation of quantum oscillations was given by L. Onsager in 1952, and the analytical quantitative theory by I.M. Lifshitz and A.M. Kosevich in 1955. These theoretical advancements seemed to provide a comprehensive description of the effect. Since then, quantum oscillations were commonly considered as a tool for measuring Fermi surface extremal cross-sections and all-angle electron scattering times. However, in his pioneering experiments in 1960s, Shoenberg revealed the richness and deep essence of the quantum oscillation effect and showed how the beauty of the effect is disclosed under nonlinear conditions imposed by interactions in the system under study. It was quite unexpected, that under 'magnetic interaction' conditions, the apparently weak effect of quantum oscillations may lead to such strong consequences as breaking the sample into magnetic (now called 'Shoenberg') domains and the formation of an inhomogeneous magnetic state. Owing to his contribution to the field of quantum
Energy Technology Data Exchange (ETDEWEB)
Shen, J.X.; Ossau, W.; Fischer, F.; Waag, A.; Landwehr, G. [Physikalisches Institut der Uniwersitaet Wuerzburg, Wuerzburg (Germany)
1995-12-31
Oscillations of photoluminescence properties in external magnetic fields are investigated in CdTe modulation doped quantum wells. The oscillatory behaviour of the luminescence intensity, the line width and the g factor is due to many-body effects in the 2-dimensional electron gas. The oscillation of photoluminescence intensity can be easily used as optically detected Shubnikov de Haas effect to determine the electron concentration in quantum wells without contacts. (author). 5 refs, 3 figs, 1 tab.
Study and isolation of aerobic hydrocarbon-degrading bacteria from Cuban shorelines
Barrios-San Martín, Yaima; Acosta, Silvia; Sánchez, Ayixon; Toledo, Antonio; González, Francisca; García, Regla M
2012-01-01
The isolation of aerobic marine bacteria able to degrade hydrocarbons represents a promising alternative for the decontamination of oceanic and coastal environments. In the present work, twelve water and sediment samples from the Felton coastline in the Province of Holguín were collected and screened with Bushnell-Haas medium supplemented with light crude oil or with seawater supplemented with yeast extract and crude oil as a carbon source, obtaining twenty seven and six bacterial isolates re...
International Nuclear Information System (INIS)
Schlottmann, P.
1988-01-01
This paper discusses Ce-impurities in LaB 6 and LaAL 2 , critical behavior of ferromagnetic Heisenberg chains; integrable SU(2)---invariant model; soluble narrow-band model with possible relevance to heavy-fermions and resonating valence bonds, soluble variant of the two-impurity Anderson model; De Haas-van Alphen effect in the Anderson lattice for large orbital degeneracy; interactions mediated by spin-fluctuations in He 3 ; mixed-valence and heavy-fermion systems and high-temperature superconductivity
American social sciences and Europeanization: theories of integration in the early 1950s
Anderson, Flora McIntyre
2017-01-01
This thesis seeks to investigate the influence of American intellectual trends, namely structural functionalism, on the first fifteen years of Europeanization after the end of World War Two. In particular, it examines the role played by German intellectual refugees in the development of neofunctionalist theories of integration that accompanied American policymaking in this era by focusing on the work of Karl Deutsch and Ernst Haas in the 1940s and 1950s. It analyses their account of the condi...
Analytic eclecticism: Not perfect, but indispensable
Sil, Rudra; Katzenstein, Peter
2010-01-01
Following the pragmatist bent of our conceptualization of analytic eclecticism, we view the four excellent commentaries offered above as a welcome opportunity to engage in open-minded dialogue and to clarify certain defining attributes of eclectic scholarship. Two commentaries are offered by Andrew Bennett and Peter Haas, who are sympathetic critics of our work: They accept our premise that research confined to paradigms has built-in limits, but then offer some frank assessments of the challe...
Emotions and Consumer Behavior
Andrade, Eduardo; Gururangan, Kapil; Iantorno, Stefano; Feng, Harvey; Cherone, Jennifer; Sawant, Manali; Neogi, Sushrita; Bhat, Prashant; Lukus, Alan
2012-01-01
Professor Eduardo Andrade received his Ph.D. in Marketing from the University of Florida in 2004 before coming to theHaas School of Business. He studies the impact of emotions on consumer decision making. One of his studies publishedin 2009 shifted the concept of emotions from transient effects to long-term processes and his recent work is movinginto the burgeoning field of decision neuroscience, which uses neuroscience tools to study economic decision-making.When Berkeley Scientific Journal ...
Tilintarkastusasiakkaan riskiluokittelu ja väärinkäytökset
Hieturi, Jonna
2013-01-01
Tilintarkastusasiakkaan riskiluokittelu on koko tilintarkastuksen ajan jatkuva prosessi. Riskiluokittelu alkaa toimeksiantosopimuksen solmimisesta ja päättyy tilintarkastuskertomuksen luovuttamiseen. Kyseisen luokittelun avulla yritetään vähentää riskiä mahdollisista väärinkäytöksistä. Erilaisia riskejä ovat väärinkäytösriskit, olennaisen virheellisyyden riskeihin lukeutuvat toiminta- ja kontrolliriski sekä merkittävät riskit. Yhdessä HTM-tilintarkastaja Jorma Nuutisen kanssa toteutimme haas...
A new method for measuring the amplitude of de Haas-van Alphen oscillations
International Nuclear Information System (INIS)
Wilde, J. de; Meredith, D.J.
1975-01-01
Quantum (dHvA) oscillations in the diamagnetic susceptibility of a metal at low temperatures are usually studied by a torque balance or by the field modulation technique of Shoenberg and Stiles. A new method of measuring dHvA amplitudes in indium using a superconducting flux transformer and a ferrite core flux gate magnetometer is reported. The magnitude of the magnetization is typically 10 -6 T at 1K which is considerably greater than the minimum detectable signal of the magnetometer, and shielding the sensor from the magnetizing field of up to 4T is the main experimental problem. (Auth.)
Haas, Anni
2016-01-01
Krediidilepingutest, milles intressimäär moodustub baasintressimäära ja intressimarginaali summast. Intressimakse negatiivse väärtuse tähendusest laenuandja ja laenusaaja suhte jaoks. Intressiarvestusest lepingu tõlgendamisel
Fermi surface changes in dilute magnesium alloys: a pseudopotential band structure model
International Nuclear Information System (INIS)
Fung, W.K.
1976-01-01
The de Haas-van Alphen effect has been used to study the Fermi surface of pure magnesium and its dilute alloys containing lithium and indium. The quantum oscillations in magnetization were detected by means of a torque magnetometer in magnetic field up to 36 kilogauss and temperature range of 4.2 0 to 1.7 0 K. The results provide information on the effects of lithium and indium solutes on the Fermi surface of magnesium in changes of extremal cross sections and effective masses as well as the relaxation times associated with the orbits. The nonlocal pseudopotential model proposed by Kimball, Stark and Mueller has been fitted to the Fermi surface of magnesium and extended to include the dilute alloys, fitting all the observed de Haas-van Alphen frequencies with an accuracy of better than 1 percent. A modified rigid band interpretation including both Fermi energy and local band edge changes computed from the model, gives an overall satisfactory description of the observed frequency shifts. With the pseudo-wavefunctions provided by the nonlocal model, the relaxation times in terms of Dingle temperatures for several orbits have been predicted using Sorbello's multiple-plane-wave phase shift model. The calculation with phase shifts obtained from a model potential yields a greater anisotropy than has been observed experimentally, while a two-parameter phase shift model provides a good fit to the experimental results
Neuropathologic comorbidity and cognitive impairment in the Nun and Honolulu-Asia Aging Studies.
White, Lon R; Edland, Steven D; Hemmy, Laura S; Montine, Kathleen S; Zarow, Chris; Sonnen, Joshua A; Uyehara-Lock, Jane H; Gelber, Rebecca P; Ross, G Webster; Petrovitch, Helen; Masaki, Kamal H; Lim, Kelvin O; Launer, Lenore J; Montine, Thomas J
2016-03-15
To examine frequencies and relationships of 5 common neuropathologic abnormalities identified at autopsy with late-life cognitive impairment and dementia in 2 different autopsy panels. The Nun Study (NS) and the Honolulu-Asia Aging Study (HAAS) are population-based investigations of brain aging that included repeated cognitive assessments and comprehensive brain autopsies. The neuropathologic abnormalities assessed were Alzheimer disease (AD) neuropathologic changes, neocortical Lewy bodies (LBs), hippocampal sclerosis, microinfarcts, and low brain weight. Associations with screening tests for cognitive impairment were examined. Neuropathologic abnormalities occurred at levels ranging from 9.7% to 43%, and were independently associated with cognitive impairment in both studies. Neocortical LBs and AD changes were more frequent among the predominantly Caucasian NS women, while microinfarcts were more common in the Japanese American HAAS men. Comorbidity was usual and very strongly associated with cognitive impairment. Apparent cognitive resilience (no cognitive impairment despite Braak stage V) was strongly associated with minimal or no comorbid abnormalities, with fewer neocortical AD lesions, and weakly with longer interval between final testing and autopsy. Total burden of comorbid neuropathologic abnormalities, rather than any single lesion type, was the most relevant determinant of cognitive impairment in both cohorts, often despite clinical diagnosis of only AD. These findings emphasize challenges to dementia pathogenesis and intervention research and to accurate diagnoses during life. © 2016 American Academy of Neurology.
Directory of Open Access Journals (Sweden)
Alessandro Ugolini
2016-01-01
Full Text Available Abstract Background The purpose of this controlled study was to investigate indirect effects on mandibular arch dimensions, 1 year after rapid palatal expansion (RPE therapy. Methods Thirty-three patients in mixed dentition (mean age 8.8 years showing unilateral posterior crossbite and maxillary deficiency were treated with a RPE (Haas type cemented on the first permanent molars. Treatment protocol consisted of two turns per day until slight overcorrection of the molar transverse relationship occurred. The Haas expander was kept on the teeth as a passive retainer for an average of 6 months. Study models were taken prior (T1 and 15 months on average (T2 after expansion. A control group of 15 untreated subjects with maxillary deficiency (mean age 8.3 years was also recorded with a 12-month interval. Stone casts were digitized with a 3D scanner (3Shape, DK. Results In the treated group, both mandibular intermolar distance (+1.9 mm and mandibular molar angulation (+9° increased. Mandibular incisor angulation showed an increase of 1.9°. There was little effect on intercanine distance and canine angulation. Controls showed a reduction in transverse arch dimension and a decrease in molar and canine angulation values. Conclusions RPE protocol has indirect widening effects on the mandibular incisors and first molars.
Energy Technology Data Exchange (ETDEWEB)
Otto, Daniel
2015-07-01
In times of increasing global uncertainties, science takes a central position for policy decisions. According to Peter M. Haas, epistemic communities are able to influence the cooperative behavior of states through their consensual knowledge. This book critically examines this statement. As the case of the Framework Convention on Climate Change shows, the World Climate Council (IPCC) was not in a position to enforce its solution options in the intergovernmental negotiations, as these affected the individual convictions of the decision-makers. While Angela Merkel advocated an agreement, the US government under George W. Bush denied the existence of climate change. Decision-makers and their individual convictions must therefore have a greater significance in international politics. [German] In Zeiten zunehmender globaler Unsicherheiten nimmt die Wissenschaft fuer die Entscheidungen der Politik eine zentrale Stellung ein. Epistemic communities sind nach Peter M. Haas durch ihr konsensuales Wissen in der Lage, das Kooperationsverhalten von Staaten zu beeinflussen. Das vorliegende Buch prueft diese Aussage kritisch. Wie der Fall der Klimarahmenkonvention zeigt, war der Weltklimarat (IPCC) nicht in der Lage, seine Loesungsoptionen in den zwischenstaatlichen Verhandlungen durchzusetzen, da diesen die individuellen Ueberzeugungen der Entscheidungstraeger entgegenstanden. Waehrend Angela Merkel ein Abkommen befuerwortete, bestritt die US-Regierung unter George W. Bush die Existenz des Klimawandels. Entscheidungstraegern und ihren individuellen Ueberzeugungen muss daher in der internationalen Politik eine staerkere Bedeutung zukommen.
Directory of Open Access Journals (Sweden)
Carolina da Luz Baratieri
2014-10-01
Full Text Available The aim of this study was to assess by means of cone-beam computed tomography (CBCT scans the transverse effects on the nasomaxillary complex in patients submitted to rapid maxillary expansion (RME using Haas expander in comparison to untreated individuals. This prospective controlled clinical study assessed 30 subjects (18 boys and 12 girls with mixed dentition and during pubertal growth. The treated group was submitted to RME with Haas expander, retention for six months and a six-month follow-up after removal. The control group matched the treated group in terms of age and sex distribution. CBCT scans were taken at treatment onset and one year after the expander was activated. Maxillary first molars (U6 width, right and left U6 angulation, maxillary alveolar width, maxillary basal width, palatal alveolar width, palatal base width, right and left alveolar angulation, palatal area, nasal base width, nasal cavity width and inferior nasal cavity area on the posterior, middle and anterior coronal slices were measured with Dolphin Imaging Software(r 11.5, except for the first two variables which were performed only on the posterior slice. All transverse dimensions increased significantly (P 0.05. Results suggest that increase of molar, maxillary, palatal and nasal transverse dimensions was stable in comparison to the control group one year after treatment with RME.
International Nuclear Information System (INIS)
Weaver, B.J.; Holub, B.J.
1986-01-01
The relative release of arachidonic acid (AA) versus eicosapentaenoic acid (EPA) from platelet phospholipids may be important in accounting for the potential of dietary fish oil containing EPA to alter platelet reactivity. Human platelets enriched in EPA and prelabelled with [ 3 H]AA and [ 14 C]EPA were used to examine the relative losses of these fatty acids from platelet phospholipids upon stimulation. Washed dual-labelled platelets were incubated with and without thrombin in the presence of BW755C and in the presence and absence of trifluoperazine. The platelet lipids were extracted and the individual phospholipids as well as diacylglycerol (DG), phosphatidic acid (PA), etc. were separated by thin-layer chromatography and the radioactivity in each fraction determined. The [ 3 H]AA/[ 14 C]EPA dpm ratio for the loss in radioactivity from PC upon thrombin stimulation was similar to that for the PC in resting platelets. This suggests no marked selectivity in the degradation of AA versus EPA species of PC during platelet activation. The [ 3 H]/[ 14 C] ratios for the increased radioactivity in DG and PA upon thrombin stimulation were slightly higher than the ratio in PI from resting platelets suggesting only a minor preference for 1-acyl 2-arachidonoyl PI over 1-acyl 2-eicosapentaenoyl PI in the pathway from PI to DG to PA
Guilherme, Stéphanie; Rodriguez, Manuel J
2017-10-23
Among all the organic disinfection by-products (DBPs), only trihalomethanes (THMs) and haloacetic acids (HAAs) are regulated in drinking water, while most DBPs are not. Very little information exists on the occurrence of non-regulated DBPs, particularly in small water systems (SWS). Paradoxically, SWS are more vulnerable to DBPs because of a low capacity to implement adequate treatment technologies to remove DBP precursors. Since DBP analyses are expensive, usually SWS have difficulties to implement a rigorous characterization of these contaminants. The purpose of this study was to estimate non-regulated DBP levels in SWS from easy measurements of relevant parameters regularly monitored. Since no information on non-regulated DBPs in SWS was available, a sampling program was carried out in 25 SWS in two provinces of Canada. Five DBP families were investigated: THMs, HAAs, haloacetonitriles (HANs), halonitromethanes (HNMs), and haloketones (HKs). Multivariate linear mixed regression models were developed to estimate HAN, HK, and HNM levels from water quality characteristics in the water treatment plant, concentrations of regulated DBPs, and residual disinfectant levels. The models obtained have a good explanatory capacity since R 2 varies from 0.77 to 0.91 according to compounds and conditions for application (season and type of treatment). Model validation with an independent database suggested their ability for generalization in similar SWS in North America.
Piazza, Leonardo A; López, Daniela; Silva, Mariana P; López Rivilli, Marisa J; Tourn, Mónica G; Cantero, Juan J; Scopel, Ana L
2018-03-01
The distribution and ultrastructure of capitate glandular trichomes (GTs) in Flourensia species (Asteraceae) have been recently elucidated, but their metabolic activity and potential biological function remain unexplored. Selective nonvolatile metabolites from isolated GTs were strikingly similar to those found on leaf surfaces. The phytotoxic allelochemical sesquiterpene (-)-hamanasic acid A ((-)-HAA) was the major constituent (ca. 40%) in GTs. Although GTs are quaternary ammonium compounds (QACs)-accumulating species, glycine betaine was not found in GTs; it was only present in the leaf mesophyll. Two (-)-HAA accompanying surface secreted products: compounds 4-hydroxyacetophenone (piceol; 1) and 2-hydroxy-5-methoxyacetophenone (2), which were isolated and fully characterized (GC/MS, NMR), were present in the volatiles found in GTs. The essential oils of fresh leaves revealed ca. 33% monoterpenes, 26% hydrocarbon- and 30% oxygenated sesquiterpenes, most of them related to cadinene and bisabolene derivatives. Present results suggest a main role of GTs in determining the volatile and nonvolatile composition of F. campestris leaves. Based on the known activities of the compounds identified, it can be suggested that GTs in F. campestris would play key ecological functions in plant-pathogen and plant-plant interactions. In addition, the strikingly high contribution of compounds derived from cadinene and bisabolene pathways, highlights the potential of this species as a source of high-valued bioproducts. © 2018 Wiley-VHCA AG, Zurich, Switzerland.
Saez Somolinos, Ángela; Imperial Ródenas, Juan; Gonzalez Guerrero, Manuel
2015-01-01
Symbiotic nitrogen fixation (SNF) carried out by the interaction rhizobia-legumes takes place in legume root nodules. Many of the enzymes involved in SNF are metalloproteins that obtain their metal cofactor from the host plant. Metals reach the nodule through the vasculature, where they are released in the apoplast on the infection/differentiation zone (zone II) of the nodule (Rodriguez-Haas et al., 2013). From there, these oligonutrients have to cross a number of membranes to be used for met...
Thermodynamics of partially confined Fermi gases at low temperature
International Nuclear Information System (INIS)
Toms, David J
2004-01-01
We examine the behaviour of non-interacting Fermi gases at low temperature. If there is a confining potential present the thermodynamic behaviour is altered from the familiar results for the unconfined gas. The role of de Haas-van Alphen type oscillations that are a consequence of the confining potential is considered. Attention is concentrated on the behaviour of the chemical potential and the specific heat. Results are compared and contrasted with those for an unconfined and a totally confined gas
Direct Fixed-Bed Biological Perchlorate Destruction Demonstration
2009-04-01
FXB effluent 1/2 hours Nitrate Depth wise sample ports 1/week On-site: In-line Hach NITRATAX nitrate probe daily using a Hach DR 890 colorimeter ...tank effluent 3/week On-site: Hach DR 890 Colorimeter TTHMs DBPFP5 tests 10 total DBPFP tests MWH HAA5 DBPFP tests 10 total DBPFP tests MWH FXB... Colorimeter FXB feed Daily 2 FXB effluent Daily Post-FXB effluent Daily pH Chlorine contact tank effluent Daily On-site: Hach pH probe Temperature
Band Structure and Fermi Surface of Cu2Sb by the LMTO Method
DEFF Research Database (Denmark)
Jan, J. P.; Skriver, Hans Lomholt
1977-01-01
The linear muffin-tin orbital (LMTO) method of bandstructure calculation has been applied to the simple tetragonal compound Cu2Sb. The d bands of Cu lie substantially below the Fermi level, and the Fermi surface is a recognizable distortion of the free-electron model. The Fermi surface has sheets......-orbit splitting, and of another closed sheet. Earlier de Haas-van Alphen results are explained semiquantitatively by the model, which also accounts for open orbits seen in high-field magnetoresistance experiments....
Magnetism, superconductivity and Fermi surfaces of plutonium compounds
International Nuclear Information System (INIS)
Haga, Y.; Aoki, D.; Yamagami, H.; Matsuda, T.D.; Nakajima, K.; Arai, Y.; Homma, Y.; Shiokawa, Y.; Yamamoto, E.; Nakamura, A.; Onuki, Y.
2007-01-01
Single crystals of plutonium compounds PuRhGa 5 and PuIn 3 are successfully grown. For PuRhGa 5 , anisotropy of the superconducting upper critical field was found and analyzed by the anisotropic mass model, consistent with quasi-two-dimensional electronic states predicted by band calculations. On the other hand, the de Haas-van Alphen oscillation was observed in PuIn 3 . By comparing with the band calculations, it is concluded that 5f electrons are itinerant in PuIn 3
APLASTIC ANEMIA AND VIRAL HEPATITIS
Directory of Open Access Journals (Sweden)
Laura Cudillo
2009-11-01
Full Text Available
Acquired aplastic anemia(aAA is a severe and rare disease, characterized by hematopoietic bone marrow failure and peripheral cytopenia. The pathophysiology is immune mediated in most cases, activated T1 lymphocytes have been identified as effector cells . The disease can be successfully treated with combined immunosuppressive therapy or allogeneic hematopoietic stem cell transplantation.
Hepatitis-associated aplastic anemia (HAA is a syndrome of bone marrow failure following the development of acute seronegative hepatitis. HAA syndrome most often affects young males who presented severe pancytopenia two to three months after an episode of acute hepatitis. The clinical course of hepatitis is more frequently benign but a fulminant severe course is also described. The bone marrow failure can be explosive and severe and it is usually fatal if untreated, no correlations have been observed between severity of hepatitis and AA.
In none of the studies a specific virus could be identified and most cases are seronegative for known hepatitis viruses. The clinical characteristics and response to immunotherapy indicate a central role for immune-mediated mechanism in the pathogenesis of HAA. The initial
Metastability of the phosphorus antisite defect in low-temperature InP
International Nuclear Information System (INIS)
Mikucki, J.; Baj, M.; Wasik, D.; Walukiewicz, W.; Bi, W. G.; Tu, C. W.
2000-01-01
We report on the transport properties of low-temperature (LT) InP/In x Ga 1-x As/InP heterostructures and LT InP thin films. Hall effect measurements performed at hydrostatic pressure up to 1.5 GPa and temperatures ranging from 4.2 K to 250 K on both types of samples as well as Shubnikov-de Haas experiments made on heterostructures clearly reveal the metastable character of phosphorus antisite defects present in LT InP layers. (c) 2000 The American Physical Society
Symbolism in European Integration
DEFF Research Database (Denmark)
Manners, Ian
2011-01-01
Ernst Haas observed over fifty years ago that ‘United Europe' is a resilient, adaptable, unifying, and yet unspecified symbol'. It is precisely this adaptability and ambiguity that has ensures the continuing importance of European studies as a means of understanding ‘the remarkable social...... of social transformation involved' (Calhoun 2003: 18). This article will consider the role of symbolism in European integration as part of answering Craig Calhoun's call for a means of transcending specific regimes of analysis in order to advance European studies....
Race/ethnicity and disease severity in IgA nephropathy
Directory of Open Access Journals (Sweden)
Chertow Glenn M
2004-09-01
Full Text Available Abstract Background Relatively few U.S.-based studies in chronic kidney disease have focused on Asian/Pacific Islanders. Clinical reports suggest that Asian/Pacific Islanders are more likely to be affected by IgA nephropathy (IgAN, and that the severity of disease is increased in these populations. Methods To explore whether these observations are borne out in a multi-ethnic, tertiary care renal pathology practice, we examined clinical and pathologic data on 298 patients with primary glomerular lesions (IgAN, focal segmental glomerulosclerosis, membranous nephropathy and minimal change disease at the University of California San Francisco Medical Center from November 1994 through May 2001. Pathologic assessment of native kidney biopsies with IgAN was conducted using Haas' classification system. Results Among individuals with IgAN (N = 149, 89 (60% were male, 57 (38% white, 53 (36% Asian/Pacific Islander, 29 (19% Hispanic, 4 (3% African American and 6 (4% were of other or unknown ethnicity. The mean age was 37 ± 14 years and median serum creatinine 1.7 mg/dL. Sixty-six patients (44% exhibited nephrotic range proteinuria at the time of kidney biopsy. The distributions of age, gender, mean serum creatinine, and presence or absence of nephrotic proteinuria and/or hypertension at the time of kidney biopsy were not significantly different among white, Hispanic, and Asian/Pacific Islander groups. Of the 124 native kidney biopsies with IgAN, 10 (8% cases were classified into Haas subclass I, 12 (10% subclass II, 23 (18% subclass III, 30 (25% subclass IV, and 49 (40% subclass V. The distribution of Haas subclass did not differ significantly by race/ethnicity. In comparison, among the random sample of patients with non-IgAN glomerular lesions (N = 149, 77 (52% patients were male, 51 (34% white, 42 (28% Asian/Pacific Islander, 25 (17% Hispanic, and 30 (20% were African American. Conclusions With the caveats of referral and biopsy biases, the race
Cheema, Waqas A; Manasfi, Tarek; Kaarsholm, Kamilla M S; Andersen, Henrik R; Boudenne, Jean-Luc
2017-12-01
Several brominated disinfection by-products (DBPs) are formed in chlorinated seawater pools, due to the high concentration of bromide in seawater. UV irradiation is increasingly employed in freshwater pools, because UV treatment photodegrades harmful chloramines. However, in freshwater pools it has been reported that post-UV chlorination promotes the formation of other DBPs. To date, UV-based processes have not been investigated for DBPs in seawater pools. In this study, the effects of UV, followed by chlorination, on the concentration of three groups of DBPs were investigated in laboratory batch experiments using a medium-pressure UV lamp. Chlorine consumption increased following post-UV chlorination, most likely because UV irradiation degraded organic matter in the pool samples to more chlorine-reactive organic matter. Haloacetic acid (HAA) concentrations decreased significantly, due to photo-degradation, but the concentrations of trihalomethanes (THMs) and haloacetonitriles (HANs) increased with post-UV chlorination. Bromine incorporation in HAAs was significantly higher in the control samples chlorinated without UV irradiation but decreased significantly with UV treatment. Bromine incorporation was promoted in THM and HAN after UV and chlorine treatment. Overall, the accumulated bromine incorporation level in DBPs remained essentially unchanged in comparison with the control samples. Toxicity estimates increased with single-dose UV and chlorination, mainly due to increased HAN concentrations. However, brominated HANs are known in the literature to degrade following further UV treatment. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kodavanti, P.R.; Ward, T. [Neurotoxicology Div., NHEERL/ORD, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Burka, T. [National Insts. of Environmental Health Sciences, Research Triangle Park, NC (United States); Ludewig, G.; Robertson, L. [The Univ. of Iowa Coll. of Public Health, Iowa City, IA (United States); Birnbaum, L. [Experimental Toxicology Div., NHEERL/ORD, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)
2004-09-15
Polybrominated diphenyl ethers (PBDEs) are used as flame-retardants in many types of consumer products such as electrical equipment, plastics, and building materials. PBDEs are structurally similar to dichlorodiphenyltrichloroethane (DDT) and polychlorinated biphenyls (PCBs). PBDEs are now ubiquitous; they can be found in air, water, fish, birds, marine mammals, and humans, and in many cases, they are increasing over time. In spite of their widespread occurrence in the environment, only limited information is available on the toxicology of PBDEs. Recent studies showed that PBDE exposure caused aberrations in spontaneous behavior and reduced learning and memory in mice these effects are similar to those seen after exposure to DDT or PCBs. However, the mode of action for this group of chemicals remains unclear. Previously, we demonstrated that PCBs, which are known to cause neurotoxic effects, affected intracellular signaling pathways including [{sup 3}H]arachidonic acid ([{sup 3}H]AA) release, calcium homeostasis, and translocation of protein kinase C (PKC). Regarding PBDEs, we have reported that PBDEs altered [{sup 3}H]AA release in neuronal cultures like PCBs. These signaling pathways have been associated with learning and memory, and the development of the nervous system. The objectives of the present study were to test: (a) whether biologically relevant PBDE congeners affected PKC translocation in neuronal cultures in a similar way to those of other organohalogens; (b) compare the potency and efficacy of PBDE congeners with their 14C-accumulation; and (c) understand the structure-activity relationships among PBDE congeners.
Chuang, Yi-Hsueh; Mitch, William A
2017-02-21
Ozonation followed by biological activated carbon (O 3 /BAC) is being considered as a key component of reverse osmosis-free advanced treatment trains for potable wastewater reuse. Using a laboratory-scale O 3 /BAC system treating two nitrified wastewater effluents, this study characterized the effect of different ozone dosages (0-1.0 mg O 3 /mg dissolved organic carbon) and BAC empty bed contact times (EBCT; 15-60 min) on the formation after chlorination or chloramination of 35 regulated and unregulated halogenated disinfection byproducts (DBPs), 8 N-nitrosamines, and bromate. DBP concentrations were remarkably similar between the two wastewaters across O 3 /BAC conditions. Ozonation increased bromate, TCNM, and N-nitrosodimethylamine, but ozonation was less significant for other DBPs. DBP formation generally decreased significantly with BAC treatment at 15 min EBCT, but little further reduction was observed at higher EBCT where low dissolved oxygen concentrations may have limited biological activity. The O 3 /BAC-treated wastewaters met regulatory levels for trihalomethanes (THMs), haloacetic acids (HAAs), and bromate, although N-nitrosodimethylamine exceeded the California Notification Level in one case. Regulated THMs and HAAs dominated by mass. When DBP concentrations were weighted by measures of their toxic potencies, unregulated haloacetonitriles, haloacetaldehydes, and haloacetamides dominated. Assuming toxicity is additive, the calculated DBP-associated toxicity of the O 3 /BAC-treated chloraminated effluents were comparable or slightly higher than those calculated in a recent evaluation of Full Advanced Treatment trains incorporating reverse osmosis.
Disinfection Methods for Swimming Pool Water: Byproduct Formation and Control
Directory of Open Access Journals (Sweden)
Huma Ilyas
2018-06-01
Full Text Available This paper presents a comprehensive and critical comparison of 10 disinfection methods of swimming pool water: chlorination, electrochemically generated mixed oxidants (EGMO, ultraviolet (UV irradiation, UV/chlorine, UV/hydrogen peroxide (H2O2, UV/H2O2/chlorine, ozone (O3/chlorine, O3/H2O2/chlorine, O3/UV and O3/UV/chlorine for the formation, control and elimination of potentially toxic disinfection byproducts (DBPs: trihalomethanes (THMs, haloacetic acids (HAAs, haloacetonitriles (HANs, trihaloacetaldehydes (THAs and chloramines (CAMs. The statistical comparison is carried out using data on 32 swimming pools accumulated from the reviewed studies. The results indicate that O3/UV and O3/UV/chlorine are the most promising methods, as the concentration of the studied DBPs (THMs and HANs with these methods was reduced considerably compared with chlorination, EGMO, UV irradiation, UV/chlorine and O3/chlorine. However, the concentration of the studied DBPs including HAAs and CAMs remained much higher with O3/chlorine compared with the limits set by the WHO for drinking water quality. Moreover, the enhancement in the formation of THMs, HANs and CH with UV/chlorine compared with UV irradiation and the increase in the level of HANs with O3/UV/chlorine compared with O3/UV indicate the complexity of the combined processes, which should be optimized to control the toxicity and improve the quality of swimming pool water.
Tailoring hospital marketing efforts to physicians' needs.
Mackay, J M; Lamb, C W
1988-12-01
Marketing has become widely recognized as an important component of hospital management (Kotler and Clarke 1987; Ludke, Curry, and Saywell 1983). Physicians are becoming recognized as an important target market that warrants more marketing attention than it has received in the past (Super 1987; Wotruba, Haas, and Hartman 1982). Some experts predict that hospitals will begin focusing more marketing attention on physicians and less on consumers (Super 1986). Much of this attention is likely to take the form of practice management assistance, such as computer-based information system support or consulting services. The survey results reported here are illustrative only of how one hospital addressed the problem of physician need assessment. Other potential target markets include physicians who admit patients only to competitor hospitals and physicians who admit to multiple hospitals. The market might be segmented by individual versus group practice, area of specialization, or possibly even physician practice life cycle stage (Wotruba, Haas, and Hartman 1982). The questions included on the survey and the survey format are likely to be situation-specific. The key is the process, not the procedure. It is important for hospital marketers to recognize that practice management assistance needs will vary among markets (Jensen 1987). Therefore, hospitals must carefully identify their target physician market(s) and survey them about their specific needs before developing and implementing new physician marketing programs. Only then can they be reasonably confident that their marketing programs match their customers' needs.
Peng, Lijuan; Turesky, Robert J.
2013-01-01
Aromatic amines and heterocyclic aromatic amines (HAAs) are a class of structurally related carcinogens that are formed during the combustion of tobacco or during the high temperature cooking of meats. These procarcinogens undergo metabolic activation by N-oxidation of the exocyclic amine group to produce N-hydroxylated metabolites, which are critical intermediates implicated in toxicity and DNA damage. The arylhydroxylamines and their oxidized arylnitroso derivatives can also react with cysteine (Cys) residues of glutathione or proteins to form, respectively, sulfenamide and sulfinamide adducts. However, sulfur-nitrogen linked adducted proteins are often difficult to detect because they are unstable and undergo hydrolysis during proteolytic digestion. Synthetic N-oxidized intermediates of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), a carcinogenic HAA produced in cooked meats, and 4-aminobiphenyl, a carcinogenic aromatic amine present in tobacco smoke were reacted with human serum albumin (SA) and formed labile sulfenamide or sulfinamide adducts at the Cys34 residue. Oxidation of the carcinogen-modified SA with m-chloroperoxybenzoic acid (m-CPBA) produced the arylsulfonamide adducts, which were stable to heat and the chemical reduction conditions employed to denature SA. The sulfonamide adducts of PhIP and 4-ABP were identified, by liquid chromatography/mass spectrometry, in proteolytic digests of denatured SA. Thus, selective oxidation of arylamine-modified SA produces stable arylsulfonamide-SA adducts, which may serve as biomarkers of these tobacco and dietary carcinogens. PMID:23240913
Delatolla, R; Séguin, C; Springthorpe, S; Gorman, E; Campbell, A; Douglas, I
2015-10-01
The goal of this study was to investigate the potential of biofiltration to reduce the formation potential of disinfection byproducts (DBPs). Particularly, the work investigates the effect of the duration of the filter cycle on the formation potential of total trihalomethanes (TTHM) and five species of haloacetic acids (HAA5), dissolved oxygen (DO), organic carbon, nitrogen and total phosphorous concentrations along with biofilm coverage of the filter media and biomass viability of the attached cells. The study was conducted on a full-scale biologically active filter, with anthracite and sand media, at the Britannia water treatment plant (WTP), located in Ottawa, Ontario, Canada. The formation potential of both TTHMs and HAA5s decreased due to biofiltration. However the lowest formation potentials for both groups of DBPs and or their precursors were observed immediately following a backwash event. Hence, the highest percent removal of DBPs was observed during the early stages of the biofiltration cycle, which suggests that a higher frequency of backwashing will reduce the formation of DBPs. Variable pressure scanning electron microscopy (VPSEM) analysis shows that biofilm coverage of anthracite and sand media increases as the filtration cycle progressed, while biomass viability analysis demonstrates that the percentage of cells attached to the anthracite and sand media also increases as the filtration cycle progresses. These results suggest that the development and growth of biofilm on the filters increases the DPB formation potential. Copyright © 2015 Elsevier Ltd. All rights reserved.
Heavy-fermion quasiparticles in UPt3
International Nuclear Information System (INIS)
Taillefer, L.; Lonzarich, G.G.
1988-01-01
The quasiparticle band structure of the heavy-fermion superconductor UPt 3 has been investigated by means of angle-resolved measurements of the de Haas--van Alphen effect. Most of the results are consistent with a model of five quasiparticle bands at the Fermi level corresponding to Fermi surfaces similar to those calculated by band theory. However, as inferred from the extremely high cyclotron masses, the quasiparticle bands are much flatter than the calculated ones. The nature of the observed quasiparticles and their relationship to thermodynamic properties are briefly considered
Magnetocapacitance of an electrically tunable silicene device
Tahir, M.
2012-09-26
Despite their structural similarity, the electronic properties of silicene are fundamentally different from those of well-known graphene due to the strong intrinsic spin orbit interaction and buckled structure of silicene. We address the magnetocapacitance of spin and valley polarized silicene in an external perpendicular magnetic field to clarify the interplay of the spin orbit interaction and the perpendicular electric field. We find that the band gap is electrically tunable and show that the magnetocapacitance exhibits beating at low and splitting of the Shubnikov de Haas oscillations at high magnetic field.
Singh, Rahul; Gangwar, Vinod K.; Daga, D. D.; Singh, Abhishek; Ghosh, A. K.; Kumar, Manoranjan; Lakhani, A.; Singh, Rajeev; Chatterjee, Sandip
2018-03-01
The magneto-transport properties of Bi2Se3-ySy were investigated. Magnetoresistance (MR) decreases with an increase in the S content, and finally, for 7% (i.e., y = 0.21) S doping, the magnetoresistance becomes negative. This negative MR is unusual as it is observed when a magnetic field is applied in the perpendicular direction to the plane of the sample. The magneto-transport behavior shows the Shubnikov-de Haas (SdH) oscillation, indicating the coexistence of surface and bulk states. The negative MR has been attributed to the non-trivial bulk conduction.
Particles in swimming pool filters – Does pH determine the DBP formation?
DEFF Research Database (Denmark)
Hansen, Kamilla Marie Speht; Willach, Sarah; Mosbæk, Hans
2012-01-01
The formation was investigated for different groups of disinfection byproducts (DBPs) during chlorination of filter particles from swimming pools at different pH-values and the toxicity was estimated. Specifically, the formation of the DBP group trihalomethanes (THMs), which is regulated in many...... or initial free chlorine concentrations the particles were chlorinated at different pH-values in the relevant range for swimming pools. THM and HAA formations were reduced by decreasing pH while HAN formation increased with decreasing pH. Based on the organic content the relative DBP formation from...
Dumas, Jean; Guyot, Hervé; Balaska, Hafid; Marcus, Jacques; Vignolles, David; Sheikin, Ilya; Audouard, Alain; Brossard, Luc; Schlenker, Claire
2004-04-01
Magnetic torque and magnetoresistance measurements have been performed in high magnetic field on the quasi-two-dimensional charge density wave (CDW) oxide bronze KMo 6O 17 . Several anomalies have been found below 28 T either on the torque or on the magnetoresistance data. They can be attributed predominantly to orbital effects. Magnetoresistance data obtained up to 55 T show that a transition takes place above 30 T. This transition may be due to the Pauli coupling. The new field-induced density wave state exhibits Shubnikov-de Haas (SdH) oscillations.
Energy Technology Data Exchange (ETDEWEB)
Dumas, Jean; Guyot, Herve; Balaska, Hafid; Marcus, Jacques; Vignolles, David; Sheikin, Ilya; Audouard, Alain; Brossard, Luc; Schlenker, Claire
2004-04-30
Magnetic torque and magnetoresistance measurements have been performed in high magnetic field on the quasi-two-dimensional charge density wave (CDW) oxide bronze KMo{sub 6}O{sub 17} . Several anomalies have been found below 28 T either on the torque or on the magnetoresistance data. They can be attributed predominantly to orbital effects. Magnetoresistance data obtained up to 55 T show that a transition takes place above 30 T. This transition may be due to the Pauli coupling. The new field-induced density wave state exhibits Shubnikov-de Haas (SdH) oscillations.
International Nuclear Information System (INIS)
Dumas, Jean; Guyot, Herve; Balaska, Hafid; Marcus, Jacques; Vignolles, David; Sheikin, Ilya; Audouard, Alain; Brossard, Luc; Schlenker, Claire
2004-01-01
Magnetic torque and magnetoresistance measurements have been performed in high magnetic field on the quasi-two-dimensional charge density wave (CDW) oxide bronze KMo 6 O 17 . Several anomalies have been found below 28 T either on the torque or on the magnetoresistance data. They can be attributed predominantly to orbital effects. Magnetoresistance data obtained up to 55 T show that a transition takes place above 30 T. This transition may be due to the Pauli coupling. The new field-induced density wave state exhibits Shubnikov-de Haas (SdH) oscillations
DOPRINOS SJEDINJENIH AMERIČKIH DRŽAVA UNIFIKACIJI MEĐUNARODNOG TRANSPORTNOG PRAVA
Vuković, Ante; Bodul, Dejan
2013-01-01
U radu se pokušava odgovoriti na pitanje koliko su Sjedinjene Američke Države, kroz stoljetnu povijest međunarodnih konvencija iz transportnog prava (počevši od Konvencije o međunarodnom prijevozu robe željeznicom, Bern, 1890. – CIM) zaista doprinosile unifikaciji međunarodnog prijevoznog prava. Prvi međunarodni ugovor globalnog značenja koji je SAD ratificirao bila je Međunarodna konvencija za izjednačavanje nekih pravila o teretnici, 1924. (Haaška pravila, 1924.) o prijevozu tereta morem – ...
Beating of magnetic oscillations in a graphene device probed by quantum capacitance
Tahir, M.; Schwingenschlö gl, Udo
2012-01-01
We report the quantum capacitance of a monolayergraphene device in an external perpendicular magnetic field including the effects of Rashba spin-orbit interaction(SOI). The SOI mixes the spin up and spin down states of neighbouring Landau levels into two (unequally spaced) energy branches. In order to investigate the role of the SOI for the electronic transport, we study the density of states to probe the quantum capacitance of monolayergraphene.SOIeffects on the quantum magnetic oscillations (Shubnikov de Haas and de Hass-van Alphen) are deduced from the quantum capacitance.
Velbloud uchem jehly 1926 a 1936 (filmové adaptace divadelní hry Františka Langera)
Čížkovská, Jana
2011-01-01
This Bachelor thesis focuses on two film adaptations of the play Camel through the eye of a needle by František Langer in Czech cinematography until 1936. These namely are the silent version directed by Karel Lamač, produced in 1926, and the sound version directed by Hugo Haas and Otakar Vávra in 1936. The first part of this work generally describes the original theatre play, its history, structure and developement of the main text. It shows, how successful this play was on Czech, European an...
Magnetocapacitance of an electrically tunable silicene device
Tahir, M.; Schwingenschlö gl, Udo
2012-01-01
Despite their structural similarity, the electronic properties of silicene are fundamentally different from those of well-known graphene due to the strong intrinsic spin orbit interaction and buckled structure of silicene. We address the magnetocapacitance of spin and valley polarized silicene in an external perpendicular magnetic field to clarify the interplay of the spin orbit interaction and the perpendicular electric field. We find that the band gap is electrically tunable and show that the magnetocapacitance exhibits beating at low and splitting of the Shubnikov de Haas oscillations at high magnetic field.
Beating of magnetic oscillations in a graphene device probed by quantum capacitance
Tahir, M.
2012-07-05
We report the quantum capacitance of a monolayergraphene device in an external perpendicular magnetic field including the effects of Rashba spin-orbit interaction(SOI). The SOI mixes the spin up and spin down states of neighbouring Landau levels into two (unequally spaced) energy branches. In order to investigate the role of the SOI for the electronic transport, we study the density of states to probe the quantum capacitance of monolayergraphene.SOIeffects on the quantum magnetic oscillations (Shubnikov de Haas and de Hass-van Alphen) are deduced from the quantum capacitance.
Band structure of semiconductors
Tsidilkovski, I M
2013-01-01
Band Structure of Semiconductors provides a review of the theoretical and experimental methods of investigating band structure and an analysis of the results of the developments in this field. The book presents the problems, methods, and applications in the study of band structure. Topics on the computational methods of band structure; band structures of important semiconducting materials; behavior of an electron in a perturbed periodic field; effective masses and g-factors for the most commonly encountered band structures; and the treatment of cyclotron resonance, Shubnikov-de Haas oscillatio
Portreefotograafia Oscarid. Kuidas neid küll jagada? / Annika Haas ; kommenteerinud Birgit Püve
Haas, Annika, 1974-
2016-01-01
Londoni rahvusliku portreegalerii (National Portrait Gallery) poolt 2003. aastal algatatud portreefotokonkursist Taylor Wessing Photographic Portrait Prize (TWPPP). 2015. aasta võidutöö: David Stewart "Viis tüdrukut"
Shi, Yanwei; Ling, Wencui; Qiang, Zhimin
2013-01-01
The effect of chlorine dioxide (ClO2) oxidation on the formation of disinfection by-products (DBPs) during sequential (ClO2 pre-oxidation for 30 min) and simultaneous disinfection processes with free chlorine (FC) or monochloramine (MCA) was investigated. The formation of DBPs from synthetic humic acid (HA) water and three natural surface waters containing low bromide levels (11-27 microg/L) was comparatively examined in the FC-based (single FC, sequential ClO2-FC, and simultaneous ClO2/FC) and MCA-based (single MCA, ClO2-MCA, and ClO2/MCA) disinfection processes. The results showed that much more DBPs were formed from the synthetic HA water than from the three natural surface waters with comparative levels of dissolved organic carbon. In the FC-based processes, ClO2 oxidation could reduce trihalomethanes (THMs) by 27-35% and haloacetic acids (HAAs) by 14-22% in the three natural surface waters, but increased THMs by 19% and HAAs by 31% in the synthetic HA water after an FC contact time of 48 h. In the MCA-based processes, similar trends were observed although DBPs were produced at a much lower level. There was an insignificant difference in DBPs formation between the sequential and simultaneous processes. The presence of a high level of bromide (320 microg/L) remarkably promoted the DBPs formation in the FC-based processes. Therefore, the simultaneous disinfection process of ClO2/MCA is recommended particularly for waters with a high bromide level.
Lawall, Holger; Matthiessen, Andreas; Hohmann, Volker; Bramlage, Peter; Haas, Sylvia; Schellong, Sebastian
2011-01-01
The degree of thromboprophylaxis in medical outpatients is low despite a substantial risk for venous thromboembolism (VTE). This may be attributable to difficulties in assessing risk. Assessment tools like the Haas' scorecard aid in determining the need for thromboprophylaxis. We aimed at evaluating how the use of this tool may aid physicians in appropriately using anticoagulants. This was an epidemiological, cross-sectional survey of acute medically ill patients with limited mobility treated by general practitioners and internists. Risk assessment for VTE by the treating physician was compared to calculated risk. Of 8,123 patients evaluated between August 2006 and April 2008, 7,271 fulfilled the in- and exclusion criteria. Mean age was 69.4 ± 13.6 years, and 45.2% were male. Of these 82.8% were high risk based on their acute medical condition, 37.9% based on their underlying chronic condition. Immobilisation, heart failure, pneumonia, age, obesity, and major varicosis were the most frequently encountered risk factors. The agreement between the Haas' scorecard and physician indicated risk was high. At least 94.1% of patients with high risk received adequate anticoagulation mostly as low molecular weight heparins for a mean duration of 15.1 ± 30.5 days. There is a substantial risk for VTE in medical outpatients. Using a simple structured scorecard resulted in an overall appropriate risk assessment and high degree of anticoagulation. The scorecard may provide a tool to improve the overall awareness for VTE risk in medical outpatients, substantially improving the degree of prophylaxis in a patient population with largely underestimated risk.
Analysis of commercial bouillons for trace levels of mutagens.
Stavric, B; Matula, T I; Klassen, R; Downie, R H
1993-12-01
A new method, developed specifically for the extraction of heterocyclic aromatic amine (HAA) type mutagens from different food matrices, was applied to various forms of commercially available bouillons. This procedure is based on liquid-liquid extraction of the sample at different pH values. Recovery and reproducibility of the procedure was determined by processing spiked samples using a mutagenicity bioassay technique as an endpoint. The mutagenicity was tested in the Salmonella/microsome assay using strain TA98 with metabolic activation. 22 bouillon samples in liquid, cube or powder forms from seven manufacturers were extracted and tested for potential mutagenicity. The mutagenic activity of these samples varied and ranged from non-detectable to about 1200 induced revertants per gram of solid material, with a median value of approximately 250 revertants/g. The mutagenic response appeared to be dependent on the source rather than the type or form of the product tested. A negative response was obtained from only one chicken bouillon, and the highest positive response was obtained from a beef bouillon in cube form. It appears that the average beef sample, regardless of form, has a higher mutagenic potency than chicken or chicken and turkey samples. Overall, the intake of mutagens from commercial bouillons (obtained as cubes, concentrates or dry mixes) to prepare one serving (as bouillon, soup, casseroles, etc.) is considerably less than that reported in the literature for one serving of fried beef or pork. The extractability and mutagenic characteristics of these samples indicate the presence of HAA-type mutagens. Work is in progress to identify the mutagenic factors in bouillons.
Is acne a sign of androgen excess disorder or not?
Uysal, Gulsum; Sahin, Yılmaz; Unluhizarci, Kursad; Ferahbas, Ayten; Uludag, Semih Zeki; Aygen, Ercan; Kelestimur, Fahrettin
2017-04-01
Acne is not solely a cosmetic problem. The clinical importance of acne in the estimation of androgen excess disorders is controversial. Recently, the Amsterdam ESHRE/ASRM-sponsored third PCOS Consensus Workshop Group suggested that acne is not commonly associated with hyperandrogenemia and therefore should not be regarded as evidence of hyperandrogenemia. Our aim was to investigate whether acne is a sign of androgen excess disorder or not. This is a cross sectional study that was performed in a university hospital involving 207 women, aged between 18 and 45 years, suffering mainly from acne. The women were assigned as polycystic ovary syndrome (PCOS), idiopathic hirsutism (IH), idiopathic hyperandrogenemia (IHA). Women with acne associated with any of the androgen excess disorders mentioned above were named as hyperandrogenemia associated acne (HAA). Women with acne but without hirsutism and hyperandrogenemia and having ovulatory cycles were named as "isolated acne". Serum luteinizing hormone, follicle stimulating hormone, estradiol, progesterone, 17-hydroxyprogesterone, dehydroepiandrosterone-sulfate (DHEAS), androstenedione, total testosterone and lipid levels were measured. Acne score was similar between the women with isolated acne and HAA. The most common cause for acne was PCOS and only 28% of the women had isolated acne. 114 (55%) women had at least one raised serum androgen level. In this study, 72% of acneic women had clinical and/or biochemical hyperandrogenemia. In contrast to the suggestion of ESHRE/ASRM-sponsored third PCOS Consensus Workshop Group, our data indicate that the presence of androgen excess disorders should be evaluated in women presenting with acne. Copyright © 2017 Elsevier B.V. All rights reserved.
Quasiparticle mass enhancement close to the quantum critical point in BaFe2(As(1-x)P(x))2.
Walmsley, P; Putzke, C; Malone, L; Guillamón, I; Vignolles, D; Proust, C; Badoux, S; Coldea, A I; Watson, M D; Kasahara, S; Mizukami, Y; Shibauchi, T; Matsuda, Y; Carrington, A
2013-06-21
We report a combined study of the specific heat and de Haas-van Alphen effect in the iron-pnictide superconductor BaFe2(As(1-x)P(x))2. Our data when combined with results for the magnetic penetration depth give compelling evidence for the existence of a quantum critical point close to x=0.30 which affects the majority of the Fermi surface by enhancing the quasiparticle mass. The results show that the sharp peak in the inverse superfluid density seen in this system results from a strong increase in the quasiparticle mass at the quantum critical point.
Magnetization of topological line-node semimetals
Mikitik, G. P.; Sharlai, Yu. V.
2018-02-01
Using an approximate expression for the Landau levels of the electrons located near a nodal line of a topological line-node semimetal, we obtain formulas for the magnetization of this semimetal at an arbitrary shape of its line. It is also shown that the dependence of the chemical potential on the magnetic field can be strong in these materials, and this dependence can essentially influence the de Haas-van Alphen oscillations. The obtained results are applied to the rhombohedral graphite, which is one of the line-node semimetals. For this material, we find temperature and magnetic field dependencies of its magnetic susceptibility.
Quantum capacitance in topological insulators under strain in a tilted magnetic field
Tahir, M.
2012-12-06
Topological insulators exhibit unique properties due to surface states of massless Dirac fermions with conserved time reversal symmetry. We consider the quantum capacitance under strain in an external tilted magnetic field and demonstrate a minimum at the charge neutrality point due to splitting of the zeroth Landau level. We also find beating in the Shubnikov de Haas oscillations due to strain, which originate from the topological helical states. Varying the tilting angle from perpendicular to parallel washes out these oscillations with a strain induced gap at the charge neutrality point. Our results explain recent quantum capacitance and transport experiments.
International Nuclear Information System (INIS)
Ho Park, Youn; Kim, Hyung-jun; Chang, Joonyeon; Hee Han, Suk; Eom, Jonghwa; Choi, Heon-Jin; Cheol Koo, Hyun
2013-01-01
The Rashba spin-orbit interaction effective field is always in the plane of the two-dimensional electron gas and perpendicular to the carrier wavevector but the direction of the Dresselhaus field depends on the crystal orientation. These two spin-orbit interaction parameters can be determined separately by measuring and analyzing the Shubnikov-de Haas oscillations for various crystal directions. In the InAs quantum well system investigated, the Dresselhaus term is just 5% of the Rashba term. The gate dependence of the oscillation patterns clearly shows that only the Rashba term is modulated by an external electric field
Influence of defect structure on magnetic and electronic properties of Hg1-x Crx Se and Hg1-x Cox Se
International Nuclear Information System (INIS)
Prozorovskij, V.D.; Reshidova, I.Yu.; Puzynya, A.I.; Paranchich, Yu.S.
1996-01-01
The results of experimental investigations of the Shubnikov-de Haas oscillations at superhigh frequencies, electron spin resonance, magnetic susceptibility, relaxation dielectric losses, and galvanomagnetic measurements in the Hg 1-x Cr x Se and Hg 1-x Co x Se single crystal samples are presented. Analysis of the results Hg 1-x Cr x Se and Hg 1-x Co x Se depend on the defect structure of the substance and the type of defects making this structure. The manifestation of critical phenomena in Hg 1-x Cr x Se also depends on the defect structure
Electronic States in Thorium under Pressure
DEFF Research Database (Denmark)
Skriver, Hans Lomholt; Jan, J. P.
1980-01-01
We have used the local-density formalism and the atomic-sphere approximation to calculate self-consistently the electronic properties of thorium at pressures up to 400 kbar. The derived equation of state agrees very well with static pressure experiments and shock data. Below the Fermi level (EF......) the electronic band structure is formed by 7s and 6d states while the bottom of a relatively broad 5f band is positioned 0.07 Ry above EF. The calculated extremal areas of the Fermi surface and their calculated pressure dependence agree with earlier calculations and with de Haas-van Alphen measurements...
Quantum Spin Stabilized Magnetic Levitation
Rusconi, C. C.; Pöchhacker, V.; Kustura, K.; Cirac, J. I.; Romero-Isart, O.
2017-10-01
We theoretically show that, despite Earnshaw's theorem, a nonrotating single magnetic domain nanoparticle can be stably levitated in an external static magnetic field. The stabilization relies on the quantum spin origin of magnetization, namely, the gyromagnetic effect. We predict the existence of two stable phases related to the Einstein-de Haas effect and the Larmor precession. At a stable point, we derive a quadratic Hamiltonian that describes the quantum fluctuations of the degrees of freedom of the system. We show that, in the absence of thermal fluctuations, the quantum state of the nanomagnet at the equilibrium point contains entanglement and squeezing.
Wang, Leizhi; Yin, Ming; Khan, Asif; Muhtadi, Sakib; Asif, Fatima; Choi, Eun Sang; Datta, Timir
2018-02-01
Charge transport in the wide-band-gap (Al ,In )N /GaN heterostructures with high carrier density approximately 2 ×1013 cm-2 is investigated over a large range of temperature (270 mK ≤T ≤280 K ) and magnetic field (0 ≤B ≤18 T ). We observe the first evidence of weak localization in the two-dimensional electron gas in this system. From the Shubnikov-de Haas (SdH) oscillations a relatively light effective mass of 0.23 me is determined. Furthermore, the linear dependence with temperature (T power and high-frequency electronics.
Quantum capacitance in topological insulators under strain in a tilted magnetic field
Tahir, M.; Schwingenschlö gl, Udo
2012-01-01
Topological insulators exhibit unique properties due to surface states of massless Dirac fermions with conserved time reversal symmetry. We consider the quantum capacitance under strain in an external tilted magnetic field and demonstrate a minimum at the charge neutrality point due to splitting of the zeroth Landau level. We also find beating in the Shubnikov de Haas oscillations due to strain, which originate from the topological helical states. Varying the tilting angle from perpendicular to parallel washes out these oscillations with a strain induced gap at the charge neutrality point. Our results explain recent quantum capacitance and transport experiments.
International Nuclear Information System (INIS)
Brasse, Matthias
2014-01-01
Torque magnetometry at low temperature is performed to investigate the magnetic properties of MnSi thin films, of a CrB 2 single crystal and of a two-dimensional electron system (2DESs) formed at the interface of MgZnO/ZnO. The magnetic anisotropy and phase diagram of MnSi as well as information on the electronic structure of CrB 2 are obtained. The MgZnO/ZnO 2DESs exhibits the de Haas-van Alphen effect and non-equilibrium currents which are analyzed in order to determine ground state properties and excited states, respectively.
High-pressure transport properties of CrB{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Regnat, Alexander; Becker, Julian; Spallek, Jan; Bauer, Andreas; Chacon, Alfonso; Ritz, Robert; Pfleiderer, Christian [Physik-Department, Technische Universitaet Muenchen, D-85748 Garching (Germany); Blum, Christian; Wurmehl, Sabine [Leibniz Institute for Solid State and Materials Research IFW, D-01171 Dresden (Germany)
2015-07-01
High quality single crystals of the itinerant antiferromagnet CrB{sub 2}, T{sub N} = 88 K, were grown by means of optical float zoning. Bulk, transport and de Haas-van Alphen measurements were carried out. Here, we present a comprehensive study of the high-pressure transport properties. Samples were investigated under hydrostatic, uniaxial and quasi-hydrostatic conditions. As a result we are able to attribute contradictory reports for the pressure dependence of T{sub N} to uniaxial strain. Perhaps most interestingly, we find a pronounced low temperature resistivity anomaly around 3 GPa in the quasi-hydrostatic case.
Comparison of skin staples with sutures for anastomosis of the small intestine in dogs.
Coolman, B R; Ehrhart, N; Pijanowski, G; Ehrhart, E J; Coolman, S L
2000-01-01
To develop a technique for approximation of end-to-end intestinal anastomoses by using a disposable skin stapler and to compare the stapling technique with an interrupted hand-sewn approximating end-to-end anastomosis of the canine jejunum. In vitro evaluation of the stapling technique, followed by an in vivo study of healing and clinical response in dogs. 18 mixed-breed adult dogs. The anastomotic technique was developed and tested in fresh canine jejunum. Fourteen stapled approximating anastomoses (SAA) and 14 hand-sewn approximating anastomoses (HAA) were performed in 6 cadavers under simulated surgical conditions. Anastomotic construction times, initial bursting strengths, initial lumen diameters, and gross appearance of the 2 techniques were compared. Healing and clinical response were evaluated in 12 purpose-bred dogs assigned to 2 groups of 6 animals each. Each dog had 1 SAA and 1 HAA performed in the jejunum, 50 cm apart. Six dogs were killed on postoperative day 4, and 6 dogs were killed on postoperative day 21. Anastomotic construction time, gross and histological healing, bursting strength, lumen diameter, and circumference were compared between techniques. Mean construction time for SAA was significantly faster than for HAA (P = .0001). None of the anastomoses leaked, and there were no major clinical complications in any dog. Bursting strengths were not significantly different at any time for the 2 techniques. Initial bursting strength was 31% to 35% of the normal jejunum. A nonsignificant decrease in bursting strength was observed by postoperative day 4 (26% to 28% of normal), and a significant increase in bursting strength was observed by postoperative day 21 (100% to 109% of normal). Neither technique decreased the initial lumen diameter. However, both techniques resulted in a similar degree of luminal stenosis as the anastomoses healed. Anastomotic lumen diameter was significantly decreased from normal in both groups at day 4 (86% to 88% of normal
Directory of Open Access Journals (Sweden)
Loreto Santa Marina
2010-08-01
Full Text Available Objetivos: Describir la concentración de trihalometanos (THM y ácidos haloacéticos (AHA del agua de consumo, valorar su variación espacio-temporal y estimar las ingestas individuales en el embarazo. Métodos: En los años 2006-2008 se analizó el agua en 33 puntos representativos de las redes de abastecimiento de los 25 municipios del área de estudio. Los hábitos de consumo de agua se obtuvieron mediante cuestionario. Resultados: La media (desviación estándar fue de 16,9µg/l (7,9 para el total de THM y de 10,9µg/l (4,9 para la suma de las concentraciones de cinco: monocloroacético, dicloroacético, tricloroacético, monobromoacético y dibromoacético (AHA5. Las concentraciones fueron menores en las aguas de manantial, sólo cloradas, que en las de embalse, sometidas a tratamiento completo de potabilización: 8,8µg/l frente a 19,1µg/l (pObjectives: To report trihalomethane (THM and haloacetic acid (HAA concentrations in drinking water, assess variations in these concentrations depending on source and over time, and estimate individual intake during pregnancy. Methods: Water taken from 33 representative points of the water supply network of the 25 municipalities in the study area was analyzed from 2006-2008. Water drinking habits were recorded using a questionnaire. Results: Mean total THM concentrations were 16.9µg/L (standard deviation, 7.9, while the mean value for the sum of concentrations of five HAA (monochloroacetic, dichloroacetic, tricholoroacetic, monobromoacetic, and dicromoacetic acids was 10.9µg/L (standard deviation, 4.9. Concentrations were lower in spring waters, which were only chlorinated, compared with dam waters, which were subject to a complete purification treatment: 8.8µg/L vs 19.1µg/L (p<0.01 and 8.2µg/L vs 11.7µg/L (p<0.01. Concentrations significantly increased with the number of deposits in the network and with their rechlorination and were higher in the summer and fall. Mean intakes of total THM and
Behrens, Beate; Baune, Matthias; Jungkeit, Janek; Tiso, Till; Blank, Lars M; Hayen, Heiko
2016-07-15
A method using high performance liquid chromatography coupled to charged-aerosol detection (HPLC-CAD) was developed for the quantification of rhamnolipid biosurfactants. Qualitative sample composition was determined by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). The relative quantification of different derivatives of rhamnolipids including di-rhamnolipids, mono-rhamnolipids, and their precursors 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs) differed for two compared LC-MS instruments and revealed instrument dependent responses. Our here reported HPLC-CAD method provides uniform response. An inverse gradient was applied for the absolute quantification of rhamnolipid congeners to account for the detector's dependency on the solvent composition. The CAD produces a uniform response not only for the analytes but also for structurally different (nonvolatile) compounds. It was demonstrated that n-dodecyl-β-d-maltoside or deoxycholic acid can be used as alternative standards. The method of HPLC-ultra violet (UV) detection after a derivatization of rhamnolipids and HAAs to their corresponding phenacyl esters confirmed the obtained results but required additional, laborious sample preparation steps. Sensitivity determined as limit of detection and limit of quantification for four mono-rhamnolipids was in the range of 0.3-1.0 and 1.2-2.0μg/mL, respectively, for HPLC-CAD and 0.4 and 1.5μg/mL, respectively, for HPLC-UV. Linearity for HPLC-CAD was at least 0.996 (R(2)) in the calibrated range of about 1-200μg/mL. Hence, the here presented HPLC-CAD method allows absolute quantification of rhamnolipids and derivatives. Copyright © 2016 Elsevier B.V. All rights reserved.
Direct Partial Oxidations Using Molecular Oxygen - Final Report
Energy Technology Data Exchange (ETDEWEB)
Kemp, Richard [Univ. of New Mexico, Albuquerque, NM (United States)
2017-11-01
In 2006, Richard A. Kemp (University of New Mexico) and Karen I. Goldberg (University of Washington) formed a team and began to investigate new strategies to accomplish direct selective aerobic oxidations, with a particular emphasis on the epoxidation of propylene and higher olefins. This DOE-BES funded project was renewed twice and concluded after a no-cost extension earlier this year. Multiple novel strategies involving homogeneous catalyst systems were initiated and investigated during the award. Important fundamental understanding and insight concerning requirements for promotion of aerobic olefin epoxidation was generated. During the tenure of this project, new knowledge was generated concerning the synthesis, characterization and aerobic reactivity of metal hydrides and hydroxides. Key results describing synthetic strategies and optimization of the preparation of mononuclear late metal hydrides were published. The team reported the first example of O2 insertion into a Pd-H bond, a reaction which had been proposed in the literature but never previously observed. Our experimental investigation of the mechanism was later followed by computational work, and a description of what is now referred to as the Hydrogen Atom Abstraction (HAA) pathway for this reaction has been widely accepted in the community. After investigation of many other late metal hydrides, both experimentally and computationally, the team put together a chapter that included a description of key contributing factors that allow reaction by the HAA mechanism. A brief sampling of other classic papers from our project include hydrogenolysis reactions of late metal hydroxide and alkoxide complexes, the synthesis of nickel-hydrides, and the involvement of hemilabile ligands in promoting new reaction pathways.
Fingerprinting the reactive toxicity pathways of 50 drinking water disinfection by-products.
Stalter, Daniel; O'Malley, Elissa; von Gunten, Urs; Escher, Beate I
2016-03-15
A set of nine in vitro cellular bioassays indicative of different stages of the cellular toxicity pathway was applied to 50 disinfection by-products (DBPs) to obtain a better understanding of the commonalities and differences in the molecular mechanisms of reactive toxicity of DBPs. An Eschericia coli test battery revealed reactivity towards proteins/peptides for 64% of the compounds. 98% activated the NRf2-mediated oxidative stress response and 68% induced an adaptive stress response to genotoxic effects as indicated by the activation of the tumor suppressor protein p53. All DBPs reactive towards DNA in the E. coli assay and activating p53 also induced oxidative stress, confirming earlier studies that the latter could trigger DBP's carcinogenicity. The energy of the lowest unoccupied molecular orbital ELUMO as reactivity descriptor was linearly correlated with oxidative stress induction for trihalomethanes (r(2)=0.98) and haloacetamides (r(2)=0.58), indicating that potency of these DBPs is connected to electrophilicity. However, the descriptive power was poor for haloacetic acids (HAAs) and haloacetonitriles (r(2) (0.80, indicating that HAAs' potency is connected to both, electrophilicity and speciation. Based on the activation of oxidative stress response and the soft electrophilic character of most tested DBPs we hypothesize that indirect genotoxicity-e.g., through oxidative stress induction and/or enzyme inhibition-is more plausible than direct DNA damage for most investigated DBPs. The results provide not only a mechanistic understanding of the cellular effects of DBPs but the effect concentrations may also serve to evaluate mixture effects of DBPs in water samples. Copyright © 2016 Elsevier Ltd. All rights reserved.
Angiostrongylus costaricensis infection in Martinique, Lesser Antilles, from 2000 to 2017
Directory of Open Access Journals (Sweden)
Dard Céline
2018-01-01
Full Text Available Human abdominal angiostrongyliasis (HAA is a parasitic disease caused by the accidental ingestion of the nematode Angiostrongylus costaricensis in its larval form. Human infection can lead to severe ischemic and inflammatory intestinal lesions, sometimes complicated by life-threatening ileal perforations. Only one case had been reported in Martinique, an Island in the French Antilles, in 1988. We retrospectively reviewed the medical charts of patients diagnosed with abdominal angiostrongyliasis at the University Hospital of Martinique between 2000 and 2017. The objectives of this study were to evaluate the incidence and perform a descriptive analysis of the clinical, biological, radiological, and histopathological features of HAA in Martinique. Two confirmed cases and two probable cases were identified in patients aged from 1 to 21 years during the 18-year period, with an estimated incidence of 0.2 cases per year (0.003 case/year/100.000 inhabitants (IC95% = 0.00–0.05. All patients presented with abdominal pain associated with high blood eosinophilia (median: 7.24 G/L [min 4.25; max 52.28 G/L]. Two developed ileal perforation and were managed by surgery, with diagnostic confirmation based on histopathological findings on surgical specimens. The other two cases were probable, with serum specimens reactive to Angiostrongylus sp. antigen in the absence of surgery. All cases improved without sequelae. The description of this case series highlights the need to increase awareness of this life-threatening disease in the medical community and to facilitate access to specific diagnostic tools in Martinique. Environmental and epidemiological studies are needed to broaden our knowledge of the burden of this disease.
Electronic properties of graphite
International Nuclear Information System (INIS)
Schneider, J.
2010-10-01
In this thesis, low-temperature magneto-transport (T ∼ 10 mK) and the de Haas-van Alphen effect of both natural graphite and highly oriented pyrolytic graphite (HOPG) are examined. In the first part, low field magneto-transport up to B = 11 T is discussed. A Fourier analysis of the background removed signal shows that the electric transport in graphite is governed by two types of charge carriers, electrons and holes. Their phase and frequency values are in agreement with the predictions of the SWM-model. The SWM-model is confirmed by detailed band structure calculations using the magnetic field Hamiltonian of graphite. The movement of the Fermi at B > 2 T is calculated self-consistently assuming that the sum of the electron and hole concentrations is constant. The second part of the thesis deals with high field magneto-transport of natural graphite in the magnetic field range 0 ≤ B ≤ 28 T. Both spin splitting of magneto-transport features in tilted field configuration and the onset of the charge density wave (CDW) phase for different temperatures with the magnetic field applied normal to the sample plane are discussed. Concerning the Zeeman effect, the SWM calculations including the Fermi energy movement require a g-factor of g* equal to 2.5 ± 0.1 to reproduce the spin spilt features. The measurements of the charge density wave state confirm that its onset magnetic field can be described by a Bardeen-Cooper-Schrieffer (BCS)-type formula. The measurements of the de Haas-van Alphen effect are in agreement with the results of the magneto-transport measurements at low field. (author)
Strain induced novel quantum magnetotransport properties of topological insulators
Energy Technology Data Exchange (ETDEWEB)
Ma, Ning, E-mail: maning@stu.xjtu.edu.cn [Department of Physics, Taiyuan University of Technology, Taiyuan 030024 (China); Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi’an Jiaotong University, Xi’an 710049 (China); Zhang, Shengli, E-mail: zhangsl@mail.xjtu.edu.cn [Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi’an Jiaotong University, Xi’an 710049 (China); Liu, Daqing, E-mail: liudq@cczu.edu.cn [School of Mathematics and Physics, Changzhou University, Changzhou 213164 (China)
2016-12-15
Recent theoretical and experimental researches have revealed that the strained bulk HgTe can be regarded as a three-dimensional topological insulator (TI). Motivated by this, we explore the strain effects on the transport properties of the HgTe surface states, which are modulated by a weak 1D in-plane electrostatic periodic potential in the presence of a perpendicular magnetic field. We analytically derive the zero frequency (dc) diffusion conductivity for the case of quasielastic scattering in the Kubo formalism, and find that, in strong magnetic field regime, the Shubnikov–de Haas oscillations are superimposed on top of the Weiss oscillations due to the electric modulation for null and finite strain. Furthermore, the strain is shown to remove the degeneracy in inversion symmetric Dirac cones on the top and bottom surfaces. This accordingly gives rise to the splitting and mixture of Landau levels, and the asymmetric spectrum of the dc conductivity. These phenomena, not known in a conventional 2D electron gas and even in a strainless TI and graphene, are a consequence of the anomalous spectrum of surface states in a fully stained TI. These results should be valuable for electronic and spintronic applications of TIs, and thus we fully expect to see them in the further experiment. - Highlights: • The strain removes the degeneracy in inversion symmetric Dirac cones. • The strain gives rise to the splitting and mixture of the Landau levels. • The strain leads to the asymmetric spectrum of the dc conductivity. • Shubnikov de Haas oscillations are shown to be superimposed on Weiss oscillations. • Interplay between strain and electric field causes different occupancy of TI states.
Laboratory Characterization Tests for Antimisting Fuel.
1987-03-01
Por hdi cal lv, clean wtith chromic acid to reTove traces r! rt c ,t r al e t 1t,’ t t I irt ft tf,(- viscomter C t! tC. ’o( +( .fl50( ,r,, .. , i:t...bath to bel ow 3.9o C. Bubbl e gaseous sul1fur dioxid’e (SO-) through rocetatdsul furic acid (S( 4 ,sp gr 1 .84-) into th, coo led mixture . (’out :oue...qeyce. .t d ’ŕ X oku.4 ict t ,Avenue., NW 3034 W! I. Mr. ,. Thris Meldrum Mr. James H. O’Mara Texdao Company Rohm and Haas P.O. Box 430 727
Choi, E. S.; Graf, D.; Brooks, J. S.; Yamada, J.; Tokumoto, M.
2004-04-01
We investigate the pressure-temperature phase diagram of β -(BDA-TTP){2}MCl{4} (M=Ga, Fe), which shows a metal-insulator (MI) transition around 120 K at ambient pressure. By applying pressure, the insulating phase is suppressed. When the pressure is higher than 5.5 kbar, the superconducting phase appears in both salts with Tc ˜ 3 K for M=Ga and 2.2 K for M=Fe. We also observed Shubnikov-de Haas (SdH) oscillations at high magnetic field in both salts, where the SdH frequencies are found to be very similar each other. Key words. organic superconductor, pressure, phase diagram.
Voltage-driven quantum oscillations in graphene
International Nuclear Information System (INIS)
Yampol'skii, V A; Savel'ev, S; Nori, Franco
2008-01-01
We predict unusual (for non-relativistic quantum mechanics) electron states in graphene, which are localized within a finite-width potential barrier. The density of localized states in the sufficiently high and/or wide graphene barrier exhibits a number of singularities at certain values of the energy. Such singularities provide quantum oscillations of both the transport (e.g. conductivity) and thermodynamic properties of graphene-when increasing the barrier height and/or width, similarly to the well-known Shubnikov-de-Haas (SdH) oscillations of conductivity in pure metals. However, here the SdH-like oscillations are driven by an electric field instead of the usual magnetically driven SdH-oscillations
Transmutation doping and lattice defects in degenerate InSb
International Nuclear Information System (INIS)
Gerstenberg, H.; Glaeser, W.
1990-01-01
n-type InSb single crystals were irradiated with thermal neutrons below T = 6 K. The Shubnikov-de Haas effect and the resistivity ρ(T = 4.6 K) were measured as a function of the neutron dose and the holding temperature of a subsequent annealing program. The results are discussed in terms of the transport scattering rate and the lifetime of the Landau-levels. They have to be interpreted by means of n-doping due to nuclear reactions and irradiation induced negatively charged defects. Almost complete annealing of the transport parameters can be achieved by heating the samples to T A = 400 K. (author)
Spin polarization of a non-magnetic high g-factor semiconductor at low magnetic field
International Nuclear Information System (INIS)
Lee, J.; Back, J.; Kim, K.H.; Kim, S.U.; Joo, S.; Rhie, K.; Hong, J.; Shin, K.; Lee, B.C.; Kim, T.
2007-01-01
We have studied the spin polarization of HgCdTe by measuring Shubnikov-de Haas oscillations. The magnetic field have been applied in parallel and perpendicular to the current. Relatively long spin relaxation time was observed since only spin conserved transition is allowed by selection rules. The electronic spin is completely polarized when the applied magnetic field is larger than 0.5 Tesla, which can be easily generated by micromagnets deposited on the surface of the specimen. Thus, the spin-manipulation such as spin up/down junction can be realized with this semiconductor. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Large and homogeneous mass enhancement in the rattling-induced superconductor KOs2O6
Terashima, Taichi; Kurita, Nobuyuki; Kiswandhi, Andhika; Choi, Eun-Sang; Brooks, James S.; Sato, Kota; Yamaura, Jun-ichi; Hiroi, Zenji; Harima, Hisatomo; Uji, Shinya
2012-05-01
We have determined the Fermi surface in KOs2O6 (Tc=9.6 K and Bc2˜32 T) via de Haas-van Alphen (dHvA) oscillation measurements and a band structure calculation. We find effective masses up to 26(1)me (me is the free electron mass), which are unusually heavy for compounds where the mass enhancement is mostly due to electron-phonon interactions. Orbit-resolved mass enhancement parameters λdHvA are large but fairly homogeneous, concentrated in the range 5-8. We discuss origins of the large homogeneous mass enhancement in terms of rattling motion of the K ions.
Bulk crystal growth and electronic characterization of the 3D Dirac semimetal Na3Bi
Directory of Open Access Journals (Sweden)
Satya K. Kushwaha
2015-04-01
Full Text Available High quality hexagon plate-like Na3Bi crystals with large (001 plane surfaces were grown from a molten Na flux. The freshly cleaved crystals were analyzed by low temperature scanning tunneling microscopy and angle-resolved photoemission spectroscopy, allowing for the characterization of the three-dimensional (3D Dirac semimetal (TDS behavior and the observation of the topological surface states. Landau levels were observed, and the energy-momentum relations exhibited a linear dispersion relationship, characteristic of the 3D TDS nature of Na3Bi. In transport measurements on Na3Bi crystals, the linear magnetoresistance and Shubnikov-de Haas quantum oscillations are observed for the first time.
International Nuclear Information System (INIS)
Wang, C M; Lei, X L
2014-01-01
We study dc-current effects on the magnetoresistance oscillation in a two-dimensional electron gas with Rashba spin-orbit coupling, using the balance-equation approach to nonlinear magnetotransport. In the weak current limit the magnetoresistance exhibits periodical Shubnikov-de Haas oscillation with changing Rashba coupling strength for a fixed magnetic field. At finite dc bias, the period of the oscillation halves when the interbranch contribution to resistivity dominates. With further increasing current density, the oscillatory resistivity exhibits phase inversion, i.e., magnetoresistivity minima (maxima) invert to maxima (minima) at certain values of the dc bias, which is due to the current-induced magnetoresistance oscillation. (paper)
Haas, Annika
2006-01-01
5. sept. toimus Tallinna Linnateatri 42. hooaja avamine, sai ülevaate teatri plaanidest ja toimus kohtumine Adolf Šapiroga. Uue hooaja plaanidesse kuulub ka töölepingu sõlmimine Tallinna Ülikooliga
Nowak, Adriana; Czyżowska, Agata; Huben, Krzysztof; Sójka, Michał; Kuberski, Sławomir; Otlewska, Anna; Śliżewska, Katarzyna
2016-06-01
Heterocyclic aromatic amines (HAAs) are carcinogens which are formed in meat cooked using high-temperature methods. The human gastrointestinal (GI) microbiota plays a crucial role in maintaining health in humans of different ages, and especially in the elderly. However, the GI microbiota, whose metabolism and composition changes with age, may also be responsible for the activation of mutagenic substances reaching the colon with diet. Probiotics and prebiotics are promising in terms of reducing the destructive effects of HAAs. The aim of the study was to determine if fecal microbiota derived from the feces of 27 volunteers: infants (up to 18 months), adults (aged 23-39 years), the sub-elderly (aged 64-65 years), and the elderly (aged 76-87 years), and the presence of probiotics or prebiotics, affected the transformation of IQ (2-amino-3-methylimidazo[4,5-f]quinoline) to 7-OH-IQ (2-amino-3,6-dihydro-3-methyl-7H-imidazo[4,5-f]quinoline-7-one). The compounds were identified using LC-MS(n), NMR, and FTIR. Their genotoxicity was compared in the comet assay. Individual strains capable of IQ transformation were also identified. 7-OH-IQ was detected in six persons (two children and four elderly individuals). The degree of IQ conversion ranged from 26% (4-month-old girl) to 94% (81-year-old woman) of the initial quantity. Four Enterococcus isolates: two Enterococcus faecium and two Enterococcus faecalis strains, as well as one Clostridium difficile strain (LOCK 1030, from the culture collection) converted IQ to 7-OH-IQ. The genotoxicity of samples containing 7-OH-IQ was even three times higher (P < 0.05) than those with IQ and was correlated with the degree of IQ conversion and 7-OH-IQ concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Procházka, Erik; Escher, Beate I; Plewa, Michael J; Leusch, Frederic D L
2015-10-19
The process of disinfecting drinking water inadvertently leads to the formation of numerous disinfection byproducts (DBPs). Some of these are mutagenic, genotoxic, teratogenic, and cytotoxic, as well as potentially carcinogenic both in vivo and in vitro. We investigated the in vitro biological activity of five DBPs: three monohaloacetic acids (monoHAAs) [chloroacetic acid (CAA), bromoacetic acid (BAA), and iodoacetic acid (IAA)] and two novel halobenzoquinones (HBQs) [2,6-dichloro-p-benzoquinone (DCBQ) and 2,6-dibromo-p-benzoquinone]. We focused particularly on cytotoxicity and induction of two adaptive stress response pathways: the oxidative stress responsive Nrf2/ARE and DNA-damage responsive p53 pathways. All five DBPs were cytotoxic to the Caco-2 cell line after a 4 h exposure, and all DBPs induced both of the adaptive stress response pathways, Nrf2/ARE and p53, in the micromolar range, as measured by two β-lactamase-based reporter gene assays. The decreasing order of potency for all three endpoints for the five DBPs was IAA ∼ BAA > DCBQ ∼ DBBQ > CAA. Induction of oxidative stress was previously proposed to be the molecular initiating event (MIE) for both classes of DBPs. However, comparing the levels of activation of the two pathways uncovered that the Nrf2/ARE pathway was the more sensitive endpoint for HAAs, whereas the p53 pathway was more sensitive in the case of HBQs. Therefore, the DNA damage-responsive p53 pathway may be an important piece of information to fill in a gap in the adverse outcome pathway framework for the assessment of HBQs. Finally, we cautiously compared the potential risk of the two novel HBQs using a benchmarking approach to that of the well-studied CAA, which suggested that their relative risk may be lower than that of BAA and IAA.
Kumar, N.; Voulgaris, G.; Warner, John C.
2011-01-01
Regional Ocean Modeling System (ROMS v 3.0), a three-dimensional numerical ocean model, was previously enhanced for shallow water applications by including wave-induced radiation stress forcing provided through coupling to wave propagation models (SWAN, REF/DIF). This enhancement made it suitable for surf zone applications as demonstrated using examples of obliquely incident waves on a planar beach and rip current formation in longshore bar trough morphology (Haas and Warner, 2009). In this contribution, we present an update to the coupled model which implements a wave roller model and also a modified method of the radiation stress term based on Mellor (2008, 2011a,b,in press) that includes a vertical distribution which better simulates non-conservative (i.e., wave breaking) processes and appears to be more appropriate for sigma coordinates in very shallow waters where wave breaking conditions dominate. The improvements of the modified model are shown through simulations of several cases that include: (a) obliquely incident spectral waves on a planar beach; (b) obliquely incident spectral waves on a natural barred beach (DUCK'94 experiment); (c) alongshore variable offshore wave forcing on a planar beach; (d) alongshore varying bathymetry with constant offshore wave forcing; and (e) nearshore barred morphology with rip-channels. Quantitative and qualitative comparisons to previous analytical, numerical, laboratory studies and field measurements show that the modified model replicates surf zone recirculation patterns (onshore drift at the surface and undertow at the bottom) more accurately than previous formulations based on radiation stress (Haas and Warner, 2009). The results of the model and test cases are further explored for identifying the forces operating in rip current development and the potential implication for sediment transport and rip channel development. Also, model analysis showed that rip current strength is higher when waves approach at angles of 5
Thin-plate spline analysis of the short- and long-term effects of rapid maxillary expansion.
Franchi, Lorenzo; Baccetti, Tiziano; Cameron, Christopher G; Kutcipal, Elizabeth A; McNamara, James A
2002-04-01
The aim of this study was to investigate the short- and long-term effects induced by rapid maxillary expansion (RME) on the shape of the maxillary and circummaxillary structures by means of thin-plate spline (TPS) analysis. The sample consisted of 42 patients who were compared with a control sample of 20 subjects. The treated subjects underwent Haas-type RME, followed by fixed appliance therapy. Postero-anterior (PA) cephalograms were analysed for each treated subject at T1 (pre-treatment), T2 (immediate post-expansion), and T3 (long-term observation), and were available at T1 and T3 for the control group (CG). The mean age at T1 was 11 years and 10 months for both groups. The mean chronological ages at T3 were 20 years, 6 months for the treated group (TG) and 17 years, 8 months for the control group. The study focused on shape changes in the maxillary, nasal, zygomatic, and orbital regions. TPS analysis revealed significant shape changes in the TG. They consisted of an upward and lateral displacement of the two halves of the naso-maxillary complex as a result of active expansion in the short-term, and normalization of maxillary shape in the transverse dimension in the long-term (the initial transverse deficiency of the maxilla in the treated group was eliminated by RME therapy both in the short- and long-term). At the end of the observation period, the nasal cavities were larger when compared with both their pre-expansion configuration and the final configuration in the controls. RME with the Haas appliance appears to be an efficient therapeutic means to induce permanent favourable changes in the shape of the naso-maxillary complex.
Directory of Open Access Journals (Sweden)
Francesco Bonsante
Full Text Available Early aggressive parenteral nutrition (PN, consisting of caloric and nitrogen intake soon after birth, is currently proposed for the premature baby. Some electrolyte disturbances, such as hypophosphatemia and hypercalcemia, considered unusual in early life, were recently described while using this PN approach. We hypothesize that, due to its impact on cell metabolism, the initial amino acid (AA amount may specifically influence the metabolism of phosphorus, and consequently of calcium. We aim to evaluate the influence of AA intake on calcium-phosphorus metabolism, and to create a calculation tool to estimate phosphorus needs.Prospective observational study. Phosphate and calcium plasma concentrations and calcium balance were evaluated daily during the first week of life in very preterm infants, and their relationship with nutrition was studied. For this purpose, infants were divided into three groups: high, medium and low AA intake (HAA, MAA, LAA. A calculation formula to assess phosphorus needs was elaborated, with a theoretical model based on AA and calcium intake, and the cumulative deficit of phosphate intake was estimated.154 infants were included. Hypophosphatemia (12.5% and hypercalcemia (9.8% were more frequent in the HAA than in the MAA (4.6% and 4.8% and in the LAA group (0% and 1.9%; both p<0.001.Calcium-phosphorus homeostasis was influenced by the early AA intake. We propose to consider phosphorus and calcium imbalances as being part of a syndrome, related to incomplete provision of nutrients after the abrupt discontinuation of the placental nutrition at birth (PI-ReFeeding syndrome. We provide a simple tool to calculate the optimal phosphate intake. The early introduction of AA in the PN soon after birth might be completed by an early intake of phosphorus, since AA and phosphorus are (along with potassium the main determinants of cellular growth.
Mutinelli, Sabrina; Manfredi, Mario; Guiducci, Antonio; Denotti, Gloria; Cozzani, Mauro
2015-01-01
Anchorage onto permanent dentition is a common procedure in rapid maxillary expansion. However, replacing first permanent molars with the second deciduous molars seems to be an option to reduce some negative side effects during orthodontic treatment. The purpose of this study was to evaluate the dental effect of rapid maxillary expansion with anchorage exclusively onto deciduous teeth performed in the first period of transition. Twenty patients with a lateral cross-bite treated exclusively by a Haas expander in early mixed dentition were retrospectively analyzed before treatment, at appliance removal, and at 21 months out of retention. The sagittal and transverse dimensions, together with the inter-canine arch and irregularity index, were digitally measured on scanned images of dental casts. The patients were compared with three balanced control groups (in total, 60 individuals) matched for gender. Two control groups had the same canine dental class as the treated group at T1, were in the inter-transitional period, and either had or lacked a lateral cross-bite. The last control group was comprised of adolescents in permanent dentition with a dental class I. The statistical analysis was performed by means of repeated-measures ANOVA for paired data and one-way ANOVA, the Kruskal-Wallis test, and the Mann-Whitney test for independent measures (α-level p dentition), the dental arch dimensions of treated patients were similar to those of adolescents with a dental class I and significantly wider than those of patients with a lateral cross-bite. Also, the anterior irregularity index was lower among patients who had undergone expansion treatments than in all untreated study participants. The Haas expander anchored to the deciduous teeth is effective in increasing the dental arch width in patients with a lateral cross-bite. The dimensions of the dental arch were modified earlier toward the values of the permanent dentition.
International Nuclear Information System (INIS)
Yu Lisheng; Liu Hongxun; Zhang Bei; Wang Shumin
1986-03-01
GaAs-Alsub(x)Gasub(1-x)As heterojunction was grown by liquid phase epitaxy at low growth temperature 650-700 deg. C. The series resistance of heterojunction with DH laser structure was measured. Doping properties of Mg in GaAs and Alsub(x)Gasub(1-x)As were investigated. It is found that impurity concentration of Mg as high as 10 18 cm -3 can be doped easily. The Shubnikov-de-Haas oscillation was observed in GaAs-N Alsub(0.35)Gasub(0.65)As heterointerface. It is demonstrated that in these heterointerfaces there exists 2DEG with some contribution from 3D electron of N-AlGaAs layer. (author)
Quantum oscillation evidence for a topological semimetal phase in ZrSnTe
Hu, Jin; Zhu, Yanglin; Gui, Xin; Graf, David; Tang, Zhijie; Xie, Weiwei; Mao, Zhiqiang
2018-04-01
The layered WHM-type (W =Zr /Hf /La , H =Si /Ge /Sn /Sb , M =S /Se /Te ) materials represent a large family of topological semimetals, which provides an excellent platform to study the evolution of topological semimetal state with the fine tuning of spin-orbit coupling and structural dimensionality for various combinations of W , H , and M elements. In this work, through high field de Haas-van Alphen (dHvA) quantum oscillation studies, we have found evidence for the predicted topological nontrivial bands in ZrSnTe. Furthermore, from the angular dependence of quantum oscillation frequency, we have revealed the three-dimensional Fermi surface topologies of this layered material owing to strong interlayer coupling.
Transport properties of diazonium functionalized graphene: chiral two-dimensional hole gases
International Nuclear Information System (INIS)
Huang Ping; Jing Long; Zhu Huarui; Gao Xueyun
2012-01-01
The electric transport properties of diazonium functionalized graphene (DFG) were investigated. The temperature dependence of the resistivity (ρ-T) and the Shubnikov-de Haas oscillation of the DFG revealed two-dimensional hole gas (2DHG) behaviors. The DFGs exhibited unusual weak localization behaviors in which both inelastic and chirality-breaking elastic scattering processes should be taken into account, meaning that graphene chirality was maintained. Because of the giant decrease in the diffusion coefficient, the scattering rates remained relatively low in the presence of suppression of the scattering lengths. The decreases of both the mean free path and the Fermi velocity were responsible for the suppression of the diffusion coefficient and hence the charge mobility. (paper)
International Nuclear Information System (INIS)
Otto, Daniel
2015-01-01
In times of increasing global uncertainties, science takes a central position for policy decisions. According to Peter M. Haas, epistemic communities are able to influence the cooperative behavior of states through their consensual knowledge. This book critically examines this statement. As the case of the Framework Convention on Climate Change shows, the World Climate Council (IPCC) was not in a position to enforce its solution options in the intergovernmental negotiations, as these affected the individual convictions of the decision-makers. While Angela Merkel advocated an agreement, the US government under George W. Bush denied the existence of climate change. Decision-makers and their individual convictions must therefore have a greater significance in international politics. [de
Temperature Dependent Magnetoresistance of CeCu2Si2 up to 60 T [Proposal: P14728
Energy Technology Data Exchange (ETDEWEB)
Stritzinger, Laurel Elaine Winter [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Lai, Y. [Florida State Univ., Tallahassee, FL (United States); Mcdonald, Ross David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Baumbach, R. E. [Florida State Univ., Tallahassee, FL (United States)
2017-03-23
We recently investigated the chemical substitution series CeCu2Si2-xPx, for x = 0, 0.01, and 0.14, using a contactless tunnel diode oscillator technique. These measurements revealed previously unreported Shubnikov-de Haas oscillations above 45 T with an unusual temperature dependence that could potentially be explained by a high magnetic field transition. To investigate this possible transition, magnetoresistance measurements were desired. However, initial magnetoresistance measurements on CeCu2Si2 showed poor signal-to-noise due to the small value of the sample's resistivity. To overcome this obstacle, we performed micro-structuring of a single crystal specimen to increase the sample's resistance.
Directory of Open Access Journals (Sweden)
E. A. Venter
1964-03-01
Full Text Available Die geweldige oplewing van die Christelike wetenskaps- gedagte in ons geeslose tyd, is ongetwyfeld ’n haas onverklaar- bare verskynsel. Dwarsdeur die eeue het Christene ook wetenskap beoefen saam met ongelowiges, maar dit was eers in ons leeftyd dat die principia van die Christelike religie ook vrugbaar gemaak is vir die wetenskapsbeoefening. In hierdie verband sal die name van Dooyeweerd, Vollenhoven, Stoker e.a. steeds met eer vermeld word. Natuurlik het belydende Christene ook voorheen wel deeglik saamgewerk aan die gebou van die wetenskap. Die intieme verband tussen religie, wysbegeerte en wetenskaps beoefening is toe egter nog nie suiwer ingesien nie. Uit hier die tydperk dateer die arbeid van sir Isaac Newton.
Optical spectroscopy and Fermi surface studies of BiTeCl and BiTeBr
Martin, Catalin; Suslov, A. V.; Buvaev, S.; Hebard, A. F.; Bugnon, Philippe; Berger, Helmuth; Magrez, Arnaud; Tanner, D. B.
2014-03-01
The observation of a large bulk Rashba effect in the non-centrosymmetric semiconductors BiTeX(X=Cl, Br, I) has stimulated the interest in these sys- tems, as promising candidates for studying spin related phenomena and for the realization of spin devices. Here we present a comparative study of the electronic properties of BiTeCl and BiTeBr, determined from temperature dependent infrared spectroscopy and Shubnikov-de Haas oscillations. In par- ticular, we compare the angle dependence of quantum oscillations between the two compounds and discuss possible differences between the topology of their Fermi surfaces. Supported by NSF Cooperative Agreement DMR-1157490 to the National High Magnetic Field Laboratory.
Spin-orbit interaction in a dual gated InAs/GaSb quantum well
Beukman, Arjan J. A.; de Vries, Folkert K.; van Veen, Jasper; Skolasinski, Rafal; Wimmer, Michael; Qu, Fanming; de Vries, David T.; Nguyen, Binh-Minh; Yi, Wei; Kiselev, Andrey A.; Sokolich, Marko; Manfra, Michael J.; Nichele, Fabrizio; Marcus, Charles M.; Kouwenhoven, Leo P.
2017-12-01
The spin-orbit interaction is investigated in a dual gated InAs/GaSb quantum well. Using an electric field, the quantum well can be tuned between a single-carrier regime with exclusively electrons as carriers and a two-carrier regime where electrons and holes coexist. The spin-orbit interaction in both regimes manifests itself as a beating in the Shubnikov-de Haas oscillations. In the single-carrier regime the linear Dresselhaus strength is characterized by β =28.5 meV Å and the Rashba coefficient α is tuned from 75 to 53 meV Å by changing the electric field. In the two-carrier regime a quenching of the spin splitting is observed and attributed to a crossing of spin bands.
Directory of Open Access Journals (Sweden)
Amr Abd-EL-Mooti EL-Hanafy
2017-01-01
Full Text Available A total of 15 fungal isolates were obtained from oil-contaminated sites near the Red Sea in the Yanbu region. Based on the preliminary DCPIP (2,6-dichlorophenolindophenol assay, three isolates showed promising oil degrading ability. The next-generation sequencing of the ITS-I and ITS-II internal transcribed spacer regions assigned the isolates to Aspergillus and Penicillium. Among these three strains, Y2 (Aspergillus oryzae was the most efficient, degrading about 99% of the crude oil. The degradation rates were corroborated using spectrophotometric and gas chromatography–mass spectrometry analyses after two weeks of cultivation in Bushnell–Haas medium. All the three strains proved to be potent oil-degrading strains and, hence, can be utilized to degrade oil contaminants.
Tuning the electrical transport of type II Weyl semimetal WTe2 nanodevices by Mo doping
Fu, Dongzhi; Pan, Xingchen; Bai, Zhanbin; Fei, Fucong; Umana-Membreno, Gilberto A.; Song, Honglian; Wang, Xuelin; Wang, Baigeng; Song, Fengqi
2018-04-01
We fabricated nanodevices from MoxW1-xTe2 (x = 0, 0.07, 0.35), and conducted a systematic comparative study of their electrical transport. Magnetoresistance measurements show that Mo doping can significantly suppress mobility and magnetoresistance. The results for the analysis of the two band model show that doping with Mo does not break the carrier balance. Through analysis of Shubnikov-de Haas oscillations, we found that Mo doping also has a strong suppressive effect on the quantum oscillation of the sample, and the higher the ratio of Mo, the fewer pockets were observed in our experiments. Furthermore, the effective mass of electron and hole increases gradually with increasing Mo ratio, while the corresponding quantum mobility decreases rapidly.
CEF-scheme of a semimetal Ce3Sn7
International Nuclear Information System (INIS)
Okuda, Yusuke; Yamamoto, Takeshi; Honda, Daisuke; Shishido, Hiroaki; Galatanu, Andrei; Haga, Yoshinori; Matsuda, Tatsuma D.; Takeuchi, Tetsuya; Kindo, Koichi; Sugiyama, Kiyohiro; Settai, Rikio; O-bar nuki, Yoshichika
2005-01-01
We measured the magnetic susceptibility and magnetization of an antiferromagnet Ce 3 Sn 7 with the orthorhombic crystal structure. The experimental data are found to be well explained on the basis of the crystalline electric field (CEF) 4f-scheme under the assumption that two Ce atoms in the 2(a) site possess a magnetic moment of 0.36μ B /Ce and one Ce atom in the 4(i) site possesses no magnetic moment as in a valence fluctuating compound CeSn 3 , which was previously proposed by Bonnet et al. Furthermore, we carried out the de Haas-van Alphen experiment. The detected Fermi surfaces are many in number but are extremely small in volume, indicating that Ce 3 Sn 7 is a semimetal
Quantum oscillation and nontrivial transport in the Dirac semimetal Cd_3As_2 nanodevice
International Nuclear Information System (INIS)
Pan, Haiyang; Wei, Zhongxia; Zhao, Bo; Song, Fengqi; Wang, Baigeng; Zhang, Kang; Gao, Ming; Wang, Xuefeng; Zhang, Rong; Wang, Jue; Han, Min; Pi, Li
2016-01-01
Here, we report on the Shubnikov-de Haas oscillation in high-quality Cd_3As_2 nanowires grown by a chemical vapor deposition approach. The dominant transport of topological Dirac fermions is evident by the nontrivial Berry phase in the Landau Fan diagram. The quantum oscillations rise at a small field of 2 T and preserves up to 100 K, revealing a sizeable Landau level gap and a device mobility of 2138 cm"2" V"−"1" s"−"1. The angle-variable oscillations indicate the isotropy of the bulk Dirac transport. The large estimated mean free path makes the Cd_3As_2 nanowire a promising platform for the one-dimensional transport of Dirac semimetals.
The Fermi surface of a superconductor: OsB{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Hebbache, M. [Laboratoire Materiaux et Phenomenes Quantiques, Universite Paris 7 - CNRS, UMR 7162, Paris (France)
2009-07-15
Osmium diboride has been known for some time as a low compressibility material and a superhard material. It is suitable for hard coating applications. It is also a superconductor below 2.1 K. Using first-principles calculations, the author investigated the geometry of its Fermi surface (FS) and calculated the related physical quantities. The theoretical results are used to predict the frequencies of the Shubnikov-de Haas quantum oscillations. Comparison with recent measurements of the magneto-resistance oscillations in osmium diboride is made. The picture shows the FS of OsB{sub 2} consisting of three sheets: a pair of two nested ellipsoidal surfaces and a corrugated tubular surface. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Directory of Open Access Journals (Sweden)
Manik Goyal
2018-02-01
Full Text Available Low-temperature magnetotransport studies are reported for (112Cd3As2 films grown on (111CdTe by molecular beam epitaxy as a function of the Cd3As2 film thickness. All films show Shubnikov-de Haas oscillations. An even-integer quantum Hall effect is observed for films thinner than 70 nm. For the thinnest films, the bulk is gapped and transport at low temperatures occurs only via the gapless, two-dimensional states. The lowest Landau level is reached at ∼10 T, and the longitudinal resistance nearly vanishes at the plateaus in the Hall resistance. The results are discussed in the context of the current theoretical understanding of topological surface states in three-dimensional Dirac semimetals.
Nishimura, K.; Kakihana, M.; Nakamura, A.; Aoki, D.; Harima, H.; Hedo, M.; Nakama, T.; Ōnuki, Y.
2018-05-01
We grew high-quality single crystals of AuSb2 with the pyrite (FeS2)-type cubic structure by the Bridgman method and studied the Fermi surface properties by the de Haas-van Alphen (dHvA) experiment and the full potential LAPW band calculation. The Fermi surfaces of AuSb2 are found to be similar to those of NiSbS and PdBiSe with the ullmannite (NiSbS)-type cubic chiral structure because the crystal structures are similar each other and the number of valence electrons is the same between two different compounds. Note that each Fermi surface splits into two Fermi surfaces in NiSbS and PdBiSe, reflecting the non-centrosymmetric crystal structure.
Xia, Qineng; Xia, Yinjiang; Xi, Jinxu; Liu, Xiaohui; Zhang, Yongguang; Guo, Yong; Wang, Yanqin
2017-02-22
A one-pot method for the selective production of high-grade diesel-range alkanes from biomass-derived furfural and 2-methylfuran (2-MF) was developed by combining the hydroxyalkylation/alkylation (HAA) condensation of furfural with 2-MF and the subsequent hydrodeoxygenation (HDO) over a multifunctional Pd/NbOPO 4 catalyst. The effects of various reaction conditions as well as a variety of solid-acid catalysts and metal-loaded NbOPO 4 catalysts were systematically investigated to optimize the reaction conditions for both reactions. Under the optimal reaction conditions up to 89.1 % total yield of diesel-range alkanes was obtained from furfural and 2-MF by this one-pot method. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Magneto-transport characterization of e-beam-induced damage in GaAs-AlGaAs heterostructures
International Nuclear Information System (INIS)
Fink, T.; Smith, D.D.; Braddock, W.D.
1989-01-01
This paper reports the effect of electron irradiation as a function of energy on the 2D EG transport properties of high electron mobility transistor (HEMT) structures at liquid helium temperature measured. High mobility HEMT structures were molecular beam epitaxy (MBE) grown with a 2D EG channel approximately 850 angstrom below the surface. A Cambridge EBMF 10.5 was used for electron irradiation with electron energies between 2.5 and 20 keV. The HEMT structures were fabricated into Hall bar geometry. Damage is assessed by changes in the 2D EG concentrations, as determined from Shubnikov-de Haas (SdH) oscillations in a magnetic field from 0 to 8.5 Telsa, and changes in the zero field Hall mobilities
Two-Dimensional Dirac Fermions in a Topological Insulator: Transport in the Quantum Limit
Energy Technology Data Exchange (ETDEWEB)
Analytis, J.G.; /SIMES, Stanford /SLAC /Stanford U., Geballe Lab /Stanford U., Appl. Phys. Dept.; McDonald, R.D.; /Los Alamos; Riggs, S.C.; /Natl. High Mag. Field Lab.; Chu, J.-H.; /SIMES, Stanford /SLAC /Stanford U., Geballe Lab /Stanford U., Appl. Phys. Dept.; Boebinger, G.S.; /Natl. High Mag. Field Lab.; Fisher, I.R.; /SIMES, Stanford /SLAC /Stanford U., Geballe Lab /Stanford U., Appl. Phys. Dept.
2011-08-12
Pulsed magnetic fields of up to 55T are used to investigate the transport properties of the topological insulator Bi{sub 2}Se{sub 3} in the extreme quantum limit. For samples with a bulk carrier density of n = 2.9 x 10{sup 16} cm{sup -3}, the lowest Landau level of the bulk 3D Fermi surface is reached by a field of 4T. For fields well beyond this limit, Shubnikov-de Haas oscillations arising from quantization of the 2D surface state are observed, with the {nu} = 1 Landau level attained by a field of {approx} 35T. These measurements reveal the presence of additional oscillations which occur at fields corresponding to simple rational fractions of the integer Landau indices.
Observation of two distinct magnetic states in ZrZn2 via the dHvA effect under pressure
International Nuclear Information System (INIS)
Kimura, N.; Endo, M.; Isshiki, T.; Ochiai, A.; Aoki, H.; Terashima, T.; Uji, S.; Matsumoto, T.; Lonzarich, G.G.
2005-01-01
We have found an anomaly in magnetic field dependence of the de Haas-van Alphen (dHvA) frequency of ZrZn 2 . Pressure dependence of this anomaly suggests an existence of two distinct ferromagnetic states and then a 'nested' phase diagram similar to that of UGe 2 . The Stoner exchange parameter and the exchange splitting energy are 400 and 66meV, respectively, which are derived from comparing the field dependence of the dHvA frequency difference with the magnetization. The two parameters do not change in both the low and slightly higher average moment states, suggesting that the phase transition between these states is ascribed to the change in the difference of majority and minority spin carrier densities
Parallel magnetotransport in multiple quantum well structures
International Nuclear Information System (INIS)
Sheregii, E.M.; Ploch, D.; Marchewka, M.; Tomaka, G.; Kolek, A.; Stadler, A.; Mleczko, K.; Strupinski, W.; Jasik, A.; Jakiela, R.
2004-01-01
The results of investigations of parallel magnetotransport in AlGaAs/GaAs and InGaAs/InAlAs/InP multiple quantum wells structures (MQW's) are presented in this paper. The MQW's were obtained by metalorganic vapour phase epitaxy with different shapes of QW, numbers of QW and levels of doping. The magnetotransport measurements were performed in wide region of temperatures (0.5-300 K) and at high magnetic fields up to 30 T (B is perpendicular and current is parallel to the plane of the QW). Three types of observed effects are analyzed: quantum Hall effect and Shubnikov-de Haas oscillations at low temperatures (0.5-6 K) as well as magnetophonon resonance at higher temperatures (77-300 K)
Exotic behaviours in the Pr-based filled skutterudites
International Nuclear Information System (INIS)
Sato, H; Sugawara, H; Namiki, T; Saha, S R; Osaki, S; Matsuda, T D; Aoki, Y; Inada, Y; Shishido, H; Settai, R; Onuki, Y
2003-01-01
The exotic features of the Pr-based filled skutterudites are reviewed based on the electronic transport properties, specific heat and de Haas-van Alphen experiments, putting the emphasis on PrFe 4 P 12 and PrOs 4 Sb 12 . As references, the experiments on the related La- and Ce-filled skutterudites are also examined and discussed. Compared to their La reference compounds, the Fermi surface is very similar in PrOs 4 Sb 12 , suggesting the well localized character of 4f electrons, while it looks largely different in PrFe 4 P 12 . For the cyclotron effective mass, both PrFe 4 P 12 and PrOs 4 Sb 12 exhibit a strong enhancement, in reasonable agreement with the large specific heat coefficient
Tahir, Muhammad
2013-05-01
We show that the surface states of magnetic topological insulators realize an activated behavior and Shubnikov de Haas oscillations. Applying an external magnetic field perpendicular to the surface of the topological insulator in the presence of Zeeman interaction, we investigate the opening of a gap at the Dirac point, making the surface Dirac fermions massive, and the effects on the transport properties. Analytical expressions are derived for the collisional conductivity for elastic impurity scattering in the first Born approximation. We also calculate the Hall conductivity using the Kubo formalism. Evidence for a transition from gapless to gapped surface states at n = 0 and activated transport is found from the temperature and magnetic-field dependence of the collisional and Hall conductivities. © Copyright EPLA, 2013.
Tuning the magnetoresistance of ultrathin WTe2 sheets by electrostatic gating.
Na, Junhong; Hoyer, Alexander; Schoop, Leslie; Weber, Daniel; Lotsch, Bettina V; Burghard, Marko; Kern, Klaus
2016-11-10
The semimetallic, two-dimensional layered transition metal dichalcogenide WTe 2 has raised considerable interest due to its huge, non-saturating magnetoresistance. While for the origin of this effect, a close-to-ideal balance of electrons and holes has been put forward, the carrier concentration dependence of the magnetoresistance remains to be clarified. Here, we present a detailed study of the magnetotransport behaviour of ultrathin, mechanically exfoliated WTe 2 sheets as a function of electrostatic back gating. The carrier concentration and mobility, determined using the two band model and analysis of the Shubnikov-de Haas oscillations, indicate enhanced surface scattering for the thinnest sheets. By the back gate action, the magnetoresistance could be tuned by up to ∼100% for a ∼13 nm-thick WTe 2 sheet.
Energy Technology Data Exchange (ETDEWEB)
Schroeder, Winfried; Holy, Marcel; Pesch, Roland [University of Vechta, Chair of Landscape Ecology, P.O.B. 1553, Vechta (Germany); Harmens, Harry [Environment Centre Wales, Centre for Ecology and Hydrology, Bangor, Gwynedd (United Kingdom); Fagerli, Hilde [Norwegian Meteorological Institute, Meteorological Synthesizing Centre-West of EMEP, P.O. Box 43-Blindern, Oslo (Norway)
2011-12-15
territory a nationwide mean of 18.1 kg/ ha/a (standard deviation: 3.49 kg/ ha/a) could be derived from the resulting map.
Angular momentum of phonons and its application to single-spin relaxation
Nakane, Jotaro J.; Kohno, Hiroshi
2018-05-01
We reexamine the relaxation process of a single spin embedded in an elastic medium, a problem studied recently by Garanin and Chudnovsky (GC) [Phys. Rev. B 92, 024421 (2015), 10.1103/PhysRevB.92.024421] from the viewpoint of angular-momentum transfer. Using Noether's theorem, we identify two distinct angular momenta of the medium, one Newtonian discussed by GC and the other field-theoretical, both of which consist of an orbital part and a spin part. For both angular momenta, we found that the orbital part is as essential as the spin part in the relaxation process. In particular, the angular-momentum transfer from the (real) spin to the Newtonian orbital part may be considered as an incipient rotation that leads to the Einstein-de Haas effect.
Nori, F.; Merlin, R.; Haas, S.; Sandvick, A.; Dagotto, E.
1996-03-01
We calculate(F. Nori, R.Merlin, S. Haas, A.W. Sandvik, and E. Dagotto, Physical Review Letters) 75, 553 (1995). the Raman spectrum of the two-dimensional (2D) spin-1/2 Heisenberg antiferromagnet by exact diagonalization and quantum Monte Carlo techniques on clusters of up to 144 sites. On a 16-site cluster, we consider the phonon-magnon interaction which leads to random fluctuations of the exchange integral. Results are in good agreement with experiments on various high-Tc precursors, such as La_2CuO4 and YBa_2Cu_3O_6.2. In particular, our calculations reproduce the broad lineshape of the two-magnon peak, the asymmetry about its maximum, the existence of spectral weight at high energies, and the observation of nominally forbidden A_1g scattering.
Exchange enhancement of the electron g-factor in a two-dimensional semimetal in HgTe quantum wells
Energy Technology Data Exchange (ETDEWEB)
Bovkun, L. S., E-mail: bovkun@ipmras.ru; Krishtopenko, S. S.; Zholudev, M. S.; Ikonnikov, A. V.; Spirin, K. E. [Russian Academy of Sciences, Institute for Physics of Microstructures (Russian Federation); Dvoretsky, S. A.; Mikhailov, N. N. [Russian Academy of Sciences, Rzhanov Institute of Semiconductor Physics, Siberian Branch (Russian Federation); Teppe, F.; Knap, W. [Universite Montpellier II, Laboratoire Charles Coulomb (L2C), UMR CNRS 5221, GIS-TERALAB (France); Gavrilenko, V. I. [Russian Academy of Sciences, Institute for Physics of Microstructures (Russian Federation)
2015-12-15
The exchange enhancement of the electron g-factor in perpendicular magnetic fields to 12 T in HgTe/CdHgTe quantum wells 20 nm wide with a semimetal band structure is studied. The electron effective mass and g-factor at the Fermi level are determined by analyzing the temperature dependence of the amplitude of Shubnikov–de Haas oscillation in weak fields and near odd Landau-level filling factors ν ≤ 9. The experimental values are compared with theoretical calculations performed in the one-electron approximation using the eight-band kp Hamiltonian. The found dependence of g-factor enhancement on the electron concentration is explained by changes in the contributions of hole- and electron-like states to exchange corrections to the Landau-level energies in the conduction band.
Itinerant 5f electrons and the Fermi surface properties in neptunium compounds
International Nuclear Information System (INIS)
Aoki, D.; Yamagami, H.; Homma, Y.; Sakai, H.; Ikeda, S.; Shiokawa, Y.; Yamamoto, E.; Nakamura, A.; Haga, Y.; Settai, R.; Onuki, Y.
2007-01-01
We grew high-quality single crystals of NpGe 3 , NpIn 3 , NpCoGa 5 , NpRhGa 5 and NpFe 4 P 12 by the flux method, and measured the de Haas-van Alphen (dHvA) effect, magnetic susceptibility and resistivity. The results of dHvA experiments in NpGe 3 , NpCoGa 5 and NpRhGa 5 were well explained by the energy band calculation based on the 5f-itinerant model, while the topology of Fermi surfaces in NpIn 3 is similar to those of LaIn 3 , implying the 5f-localized nature of NpIn 3 . The skutterudite compound NpFe 4 P 12 is a low carrier system with the 5f 3 configuration
Improvement of Drill Performance in Metal Cutting Using MoST Solid Lubricant Coatings
Institute of Scientific and Technical Information of China (English)
N.R. Thomas; D.G. Teer; S. Yang; S. Hickman
2004-01-01
Coated tools are widely used in today's metal cutting industries and have significantly improved machining productivity through reducing operation costs and time. This paper presents the results of a systematic study of the performance of HSS drills coated with CrTiAlN and drills with a top solid lubricant coating of MoSTTM. The tests were performed on a Haas vertical machining centre under wet and dry cutting conditions to machine through holes in medium carbon steel workpieces. The feed force and torque were recorded throughout some of the tests using a force dynamometer,while the tool wear was monitored and measured. It was found that MoSTTM coatings even under accelerated conditions improve the tool life significantly based on their unique properties and very low friction.
Fermi-surface topology of the heavy-fermion system Ce2PtIn8
Klotz, J.; Götze, K.; Green, E. L.; Demuer, A.; Shishido, H.; Ishida, T.; Harima, H.; Wosnitza, J.; Sheikin, I.
2018-04-01
Ce2PtIn8 is a recently discovered heavy-fermion system structurally related to the well-studied superconductor CeCoIn5. Here we report on low-temperature de Haas-van Alphen-effect measurements in high magnetic fields in Ce2PtIn8 and Pr2PtIn8 . In addition, we performed band-structure calculations for localized and itinerant Ce-4 f electrons in Ce2PtIn8 . Comparison with the experimental data of Ce2PtIn8 and of the 4 f -localized Pr2PtIn8 suggests the itinerant character of the Ce-4 f electrons. This conclusion is further supported by the observation of effective masses in Ce2PtIn8 , which are strongly enhanced with up to 26 bare electron masses.
Magnetic response of certain curved graphitic geometries
International Nuclear Information System (INIS)
Wang, L.; Davids, P.S.; Saxena, A.; Bishop, A.R.
1992-01-01
The quasi-particle energy spectra associated with some members of buckyfamily (curved graphitic geometries), in particular C 50 , C 60 , C 70 and related fullerenes as well as coaxial helical microtubules of graphite, are obtained analytically within the mean-field approximation. These energy spectra are then used to calculate various response functions. Specifically, we calculate the specific heat, magnetization and magnetic susceptibility in the presence of an external magnetic field at low temperatures. For a single microtubule an extra peak superimposed on the first de Haas van Alphen (dHvA) oscillation in magnetic susceptibility is found in the 50--170 Tesla range depending on the radius which is possibly accessible in special (explosive flux compression) experiments. Finally, we point to important potential applications of these novel mesoscopic structures in nanotechnology
Rusconi, C. C.; Pöchhacker, V.; Cirac, J. I.; Romero-Isart, O.
2017-10-01
We theoretically study the levitation of a single magnetic domain nanosphere in an external static magnetic field. We show that, apart from the stability provided by the mechanical rotation of the nanomagnet (as in the classical Levitron), the quantum spin origin of its magnetization provides two additional mechanisms to stably levitate the system. Despite the Earnshaw theorem, such stable phases are present even in the absence of mechanical rotation. For large magnetic fields, the Larmor precession of the quantum magnetic moment stabilizes the system in full analogy with magnetic trapping of a neutral atom. For low magnetic fields, the magnetic anisotropy stabilizes the system via the Einstein-de Haas effect. These results are obtained with a linear stability analysis of a single magnetic domain rigid nanosphere with uniaxial anisotropy in a Ioffe-Pritchard magnetic field.
Fermi surfaces of YRu2Si2 and LaRu2Si2
International Nuclear Information System (INIS)
Settai, R.; Ikezawa, H.; Toshima, H.; Takashita, M.; Ebihara, T.; Sugawara, H.; Kimura, T.; Motoki, K.; Onuki, Y.
1995-01-01
We have measured the de Haas-van Alphen effect of YRu 2 Si 2 and LaRu 2 Si 2 to clarify the Fermi surfaces and cyclotron masses. Main hole-Fermi surfaces of both compounds with a distorted ellipsoid shape are similar, occupying about half of the Brillouin zone. The small hole-Fermi surfaces with the shape of a rugby ball are three in number for LaRu 2 Si 2 , and one for YRu 2 Si 2 . An electron-Fermi surface consists of a doughnut like shape for LaRu 2 Si 2 , while a cylinder along the [001] direction and a multiply-connected shape exist for YRu 2 Si 2 . The cyclotron masses of YRu 2 Si 2 are a little larger than those of LaRu 2 Si 2 . ((orig.))
Electron Mobilities and Effective Masses in InGaAs/InAlAs HEMT Structures with High In Content
Yuzeeva, N. A.; Sorokoumova, A. V.; Lunin, R. A.; Oveshnikov, L. N.; Galiev, G. B.; Klimov, E. A.; Lavruchin, D. V.; Kulbachinskii, V. A.
2016-12-01
InxGa_{1-{x}}As/InyAl_{1-{y}}As HEMT structures {δ}-doped by Si were grown by molecular beam epitaxy on InP substrate. We investigated the influence of the In content on the electron mobilities and effective masses in dimensionally quantized subbands. The electron effective masses were determined by the temperature dependence of the amplitude of the Shubnikov-de Haas effect at 1.6 and 4.2 K. We found that the more the In content in quantum well (QW), the less the electron effective masses. The mobilities are higher in HEMT structures with wider and deeper QW. The energy band diagrams were calculated by using Vegard's law for basic parameters. The calculated band diagrams are in a good agreement with the experimental data of photoluminescence spectra.
The Method for Assessing and Forecasting Value of Knowledge in SMEs – Research Results
Directory of Open Access Journals (Sweden)
Justyna Patalas-Maliszewska
2010-10-01
Full Text Available Decisions by SMEs regarding knowledge development are made at a strategic level (Haas-Edersheim, 2007. Related to knowledge management are approaches to "measure" knowledge, where literature distinguishes between qualitative and quantitative methods of valuating intellectual capital. Although there is a quite range of such methods to build an intellectual capital reporting system, none of them is really widely recognized. This work presents a method enabling assessing the effectiveness of investing in human resources, taking into consideration existing methods. The method presented is focusing on SMEs (taking into consideration their importance for, especially, regional development. It consists of four parts: an SME reference model, an indicator matrix to assess investments into knowledge, innovation indicators, and the GMDH algorithm for decision making. The method presented is exemplified by a case study including 10 companies.
Characterization of GaAs and hetero-structures of GaAs-(AlGa)As films, by Hall effect
International Nuclear Information System (INIS)
Diniz, R.P.
1989-08-01
Hall effect measurements were performed on a series of semiconductor gallium arsenide (GaAs) films, intentionally or unitentionally doped, grown by molecular beam epitaxy (MBE). These measurements made possible both the evaluation of the films quality and the calibration of the dopants (Si and Be) effusion cells on the growing machine. Measurements on modulation doped single interface heterostructures also grown by MBE followed. The two dimensional electron gas in the heterostructures shows low temperature high mobility. The application of a strong magnetic field perpendicular to the plane of the gas eliminated its degrees of freedom completely and permitted the observation of Schubnikov-deHaas oscillations and integer quantum Hall effect. During the work we have deviced and developed apparatus in order to make ohmic contacts and perform litography to semiconductors. (author) [pt
Ideue, T.; Checkelsky, J. G.; Bahramy, M. S.; Murakawa, H.; Kaneko, Y.; Nagaosa, N.; Tokura, Y.
2014-10-01
BiTeI is a polar semiconductor with gigantic Rashba spin-split bands in bulk. We have investigated the effect of pressure on the electronic structure of this material via magnetotransport. Periods of Shubunikov-de Haas (SdH) oscillations originating from the spin-split outer Fermi surface and inner Fermi surface show disparate responses to pressure, while the carrier number derived from the Hall effect is unchanged with pressure. The associated parameters which characterize the spin-split band structure are strongly dependent on pressure, reflecting the pressure-induced band deformation. We find the SdH oscillations and transport response are consistent with the theoretically proposed pressure-induced band deformation leading to a topological phase transition. Our analysis suggests the critical pressure for the quantum phase transition near Pc=3.5 GPa.
Micromechanical ``Trampoline'' Magnetometers for Use in Pulsed Magnetic Fields Exceeding 60 Tesla
Balakirev, F. F.; Boebinger, G. S.; Aksyuk, V.; Gammel, P. L.; Haddon, R. C.; Bishop, D. J.
1998-03-01
We present the design, construction, and operation of a novel magnetometer for use in intense pulsed magnetic fields. The magnetometer consists of a silicon micromachined "trampoline" to which the sample is attached. The small size of the device (typically 400 microns on a side) gives a fast mechanical response (10,000 to 50,000 Hz) and extremely high sensitivity (10-11 Am^2, corresponding to 10-13 Am^2/Hz^(1/2)). The device is robust against electrical and mechanical noise and requires no special vibration isolation from the pulsed magnet. As a demonstration, we present data taken in a 60 tesla pulsed magnetic field which show clear de Haas-van Alphen oscillations in a one microgram sample of the organic superconductor K-(BEDT-TTF)_2Cu(NCS)_2.
Drastic Pressure Effect on the Extremely Large Magnetoresistance in WTe2: Quantum Oscillation Study.
Cai, P L; Hu, J; He, L P; Pan, J; Hong, X C; Zhang, Z; Zhang, J; Wei, J; Mao, Z Q; Li, S Y
2015-07-31
The quantum oscillations of the magnetoresistance under ambient and high pressure have been studied for WTe2 single crystals, in which extremely large magnetoresistance was discovered recently. By analyzing the Shubnikov-de Haas oscillations, four Fermi surfaces are identified, and two of them are found to persist to high pressure. The sizes of these two pockets are comparable, but show increasing difference with pressure. At 0.3 K and in 14.5 T, the magnetoresistance decreases drastically from 1.25×10(5)% under ambient pressure to 7.47×10(3)% under 23.6 kbar, which is likely caused by the relative change of Fermi surfaces. These results support the scenario that the perfect balance between the electron and hole populations is the origin of the extremely large magnetoresistance in WTe2.
Density and shape factor of sodium aerosol. Final report, October 1, 1975--January 31, 1977
International Nuclear Information System (INIS)
Hinds, W.; Mallove, E.; First, M.W.
1977-04-01
Measurements were made of effective density, size distribution and dynamic shape factor for sodium fire aerosol particles using centrifugal separation and scanning electron microscopy. The aerosols were formed by burning one pound of sodium in a 90 m 3 air filled chamber at initial relative humidities from 16% to 53%. The aerosol particles were primarily sodium carbonate with water of hydration or adsorbed water. Twenty-nine samples of aerosols aged from 34-376 minutes gave an average value of effective density of 0.61 gm/cm 3 with relative standard deviation of 22%. This corresponds to a Stokes' correction factor, α, as used in the HAA-3 Code of 0.27. For the conditions of this study no clear trends were observed for effective density with relative humidity, age, or aerodynamic diameter
Marcel de Haas, Russia’s Foreign Security Policy in the 21st Century – Putin, Medvedev and Beyond.
Directory of Open Access Journals (Sweden)
Isabelle Facon
2011-03-01
Full Text Available Specialists of Russian military and defense policy are familiar with Marcel De Haas’s prolific and in-depth publications on sometimes fairly technical issues. This book, with its broader outlook aimed at providing an overall understanding of Russian security policy in the 2000s, is the product of Dr. De Haas’s years as a Senior Research Fellow at the Clingendael Institute (The Hague. In many ways, it constitutes a follow-on to the author’s previous book– Russian Security Policy and Air Power...
International Nuclear Information System (INIS)
Crabtree, G.W.; Johanson, W.R.; Campbell, S.A.; Dye, D.H.; Karim, D.P.; Ketterson, J.B.
1980-01-01
Examples are given which demonstrate the power and versatility of the dHvA effect in studying electronic behavior in metals. In transition metals the parametrization schemes give a very complete and consistent picture of the k-dependent and surface averaged electronic properties. Because the one-electron behavior is fairly well known, the many body contribution to the Fermi velocity can be isolated and its detailed anisotropy can be displayed. This kind of information is directly relevant to the calculation of electron-phonon interaction effects and cannot be derived by any other means
DEFF Research Database (Denmark)
Lohan, Silke; Spielmann, Malte; Doelken, Sandra C
2014-01-01
Laurin-Sandrow syndrome (LSS) is a rare autosomal dominant disorder characterized by polysyndactyly of hands and/or feet, mirror image duplication of the feet, nasal defects, and loss of identity between fibula and tibia. The genetic basis of LSS is currently unknown. LSS shows phenotypic overlap...
Lv, Yang-Yang; Zhang, Bin-Bin; Li, Xiao; Zhang, Kai-Wen; Li, Xiang-Bing; Yao, Shu-Hua; Chen, Y. B.; Zhou, Jian; Zhang, Shan-Tao; Lu, Ming-Hui; Li, Shao-Chun; Chen, Yan-Feng
2018-03-01
The study of ZrT e5 crystals is revived because of the recent theoretical prediction of topological phase in bulk ZrT e5 . However, the current conclusions for the topological character of bulk ZrT e5 are quite contradictory. To resolve this puzzle, we here identify the Berry phase on both b - and c planes of high-quality ZrT e5 crystals by the Shubnikov-de-Hass (SdH) oscillation under tilted magnetic field at 2 K. The angle-dependent SdH oscillation frequency, both on b - and c planes of ZrT e5 , demonstrates the two-dimensional feature. However, phase analysis of SdH verifies that a nontrivial π-Berry phase is observed in the c -plane SdH oscillation, but not in the b -plane one. Compared to bulk Fermi surface predicted by the first-principle calculation, the two-dimensional-like behavior of SdH oscillation measured at b plane comes from the bulk electron. Based on these analyses, it is suggested that bulk ZrT e5 at low temperature (˜2 K) belongs to a weak topological insulator, rather than Dirac semimetal or strong topological insulator as reported previously.
The life, science and times of Lev Vasilevich Shubnikov pioneer of Soviet cryogenics
Reinders, L J
2018-01-01
This book describes the life, times and science of the Soviet physicist Lev Vasilevich Shubnikov (1901-1937). From 1926 to 1930 Shubnikov worked in Leiden where he was the co-discoverer of the Shubnikov-De Haas effect. After his return to the Soviet Union he founded in Kharkov in Ukraine the first low-temperature laboratory in the Soviet Union, which in a very short time became the foremost physics institute in the country and among other things led to the discovery of type-II superconductivity. In August 1937 Shubnikov, together with many of his colleagues, was arrested and shot early in November 1937. This gripping story gives deep insights into the pioneering work of Soviet physicists before the Second World War, as well as providing much previously unpublished information about their brutal treatment at the hands of the Stalinist regime.
Quantum capacitance of an ultrathin topological insulator film in a magnetic field
Tahir, M.; Sabeeh, K.; Schwingenschlö gl, Udo
2013-01-01
We present a theoretical study of the quantum magnetocapacitance of an ultrathin topological insulator film in an external magnetic field. The study is undertaken to investigate the interplay of the Zeeman interaction with the hybridization between the upper and lower surfaces of the thin film. Determining the density of states, we find that the electron-hole symmetry is broken when the Zeeman and hybridization energies are varied relative to each other. This leads to a change in the character of the magnetocapacitance at the charge neutrality point. We further show that in the presence of both Zeeman interaction and hybridization the magnetocapacitance exhibits beating at low and splitting of the Shubnikov de Haas oscillations at high perpendicular magnetic field. In addition, we address the crossover from perpendicular to parallel magnetic field and find consistency with recent experimental data.
International Nuclear Information System (INIS)
Haga, Yoshinori; Sakai, Hironori; Kambe, Shinsaku
2007-01-01
Recent advances in the understanding of the 5f-relevant electronic states and unconventional superconducting properties are reviewed in actinide compounds of UPd 2 Al 3 . UPt 3 , URu 2 Si 2 , UGe 2 , and PuRhGa 5 . These are based on the experimental results carried out on high-quality single crystal samples, including transuranium compounds, which were grown by using combined techniques. The paring state and the gap structure of these superconductors are discussed, especially for the corresponding Fermi surfaces which were clarified by the de Haas-van Alphen experiment and the energy band calculations. A detailed systematic study using the NQR/NMR spectroscopy reveals the d-wave superconductivity in PuRhGa 5 and the difference of magnetic excitations due to the difference of ground states in U-, Np-, and Pu-based AnTGa 5 (T: transition metal) compounds. (author)
International Nuclear Information System (INIS)
Veiros, L.F.; Canadell, E.
1994-01-01
Tight-binding band structure calculations for the room temperature structure of BEDT-TTF 4 [Hg 2 Cl 6 ]-PhCl show the existence of closed electron and hole Fermi surfaces, in agreement with the 2D metallic conductivity of this salt. It is shown that these closed Fermi surfaces result from the hybridization of two hidden 1D Fermi surfaces. However, our study also shows that a transition associated with either a usual or a hidden nesting type mechanism is unlikely. This explains why this salt retains its metallic properties without any resistivity anomaly down to 1.3 K. Our study suggests that BEDT-TTF 4 [Hg 2 Cl 6 ]-PhCl is somewhat anisotropic 2D semimetal and should exhibit Shubnikov-de Haas oscillations corresponding to a cross-sectional area of approximately 13% of the first Brillouin zone. (orig.)
Pressure-dependent ground states and fermiology in β- ( BDA-TTP ) 2 M Cl4 ( M=Fe,Ga )
Choi, E. S.; Graf, D.; Brooks, J. S.; Yamada, J.; Akutsu, H.; Kikuchi, K.; Tokumoto, M.
2004-07-01
We have investigated pressure- and magnetic-field-dependent electrical transport properties in the charge transfer salts β-(BDA-TTP)2MCl4(M=Fe,Ga) , both of which show a metal-insulator (MI) transition around 120K at ambient pressure. The zero field temperature-pressure phase diagrams of the two compounds are quite similar; the MI transition temperature decreases with pressure, and superconductivity is observed in both the magnetic and non-magnetic compounds above ˜4.5kbar . Likewise, Shubnikov-de Haas effect measurements show nearly identical Fermi surfaces. These similarities suggest that the magnetic interaction J between the conduction electrons and the magnetic moments in β-(BDA-TTP)2FeCl4 is small. Nevertheless, magnetoresistance measurements show remarkable differences and reveal that magnetic interactions with the conduction electrons are still effective in M=Fe compounds.
How open innovation can help you cope in lean times.
Chesbrough, Henry W; Garman, Andrew R
2009-12-01
A recession often forces you to cut R&D as you refocus on your core. But innovation need not go by the wayside. By placing certain assets and projects outside your walls, you can actually preserve opportunities for future growth while you shore up the fortress. Chesbrough, of Haas School of Business, and Garman, of New Venture Partners, identify five strategic moves that open the door to innovation by, ironically, letting it out of the house. Some inside-out moves permit outside firms to invest in and develop your projects; others call for spinning off projects as separate ventures that still allow you to retain some equity. Whatever the specific approach, you can meet the inherent cultural and organizational challenges of inside-out open innovation by approaching it holistically and placing it under the leadership of senior executives in strategic roles.
Theoretical reconsideration of antiferromagnetic Fermi surfaces in URu2Si2
International Nuclear Information System (INIS)
Yamagami, Hiroshi
2011-01-01
In an itinerant 5f-band model, the antiferromagnetic (AFM) Fermi surfaces of URu 2 Si 2 are reconsidered using a relativistic LAPW method within a local spin-density approximation, especially taking into account the lattice parameters dependent on pressures. The reduction of the z-coordinate of the Si sites results in the effect of flattening the Ru-Si layers of URu 2 Si 2 crystal structure, thus weakening a hybridization/mixing between the U-5f and Ru-4d states in the band structure. Consequently the 5f bands around the Fermi level are more flat in the dispersion with decreasing the z-coordinate, thus producing three closed Fermi surfaces like 'curing-stone', 'rugby-ball' and 'ball'. The origins of de Haas-van Alphen branches can be qualitatively interpreted from the obtained AFM Fermi surfaces.
Electron-electron interaction in Multiple Quantum Wells
Zybert, M.; Marchewka, M.; Tomaka, G.; Sheregii, E. M.
2012-07-01
The complex investigation of the magneto-transport effects in structures containing multiple quantum well (MQWs) based on the GaAs/AlGaAs-heterostructures has been performed. The MQWs investigated have different electron densities in QWs. The parameters of 2DEG in MQWs were determined from the data of the Integer Quantum Hall Effect (IQHE) and Shubnikov-de Haas oscillations (SdH) observed at low temperatures (0.6-4.2 K). The method of calculation of the electron states energies in MQWs has been developed which is based on the splitting of these states due to the exchange interaction (SAS-splitting, see D. Płoch et al., Phys. Rev. B 79 (2009) 195434) including the screening of this interaction. The IQHE and SdH observed in these multilayer structures with the third degree of freedom for electrons are interpreted from this.
Weakly Interacting Symmetric and Anti-Symmetric States in the Bilayer Systems
Marchewka, M.; Sheregii, E. M.; Tralle, I.; Tomaka, G.; Ploch, D.
We have studied the parallel magneto-transport in DQW-structures of two different potential shapes: quasi-rectangular and quasi-triangular. The quantum beats effect was observed in Shubnikov-de Haas (SdH) oscillations for both types of the DQW structures in perpendicular magnetic filed arrangement. We developed a special scheme for the Landau levels energies calculation by means of which we carried out the necessary simulations of beating effect. In order to obtain the agreement between our experimental data and the results of simulations, we introduced two different quasi-Fermi levels which characterize symmetric and anti-symmetric states in DQWs. The existence of two different quasi Fermi-Levels simply means, that one can treat two sub-systems (charge carriers characterized by symmetric and anti-symmetric wave functions) as weakly interacting and having their own rate of establishing the equilibrium state.
Energy Technology Data Exchange (ETDEWEB)
Jurkovic, M.J.; Li, L.K.; Turk, B.; Wang, W.I.; Syed, S.; Simonian, D.; Stormer, H.L.
2000-07-01
Growth of high-quality AlGaN/GaN heterostructures on sapphire by ammonia gas-source molecular beam epitaxy is reported. Incorporation of a thin AlN layer grown at low temperature within the GaN buffer is shown to result in enhanced electrical and structural characteristics for subsequently grown heterostructures. AlGaN/GaN structures exhibiting reduced background doping and enhanced Hall mobilities (2100, 10310 and 12200 cm{sup 2}/Vs with carrier sheet densities of 6.1 x 10{sup 12} cm{sup {minus}2}, and 5.8 x 10{sup 12} cm{sup {minus}2} at 300 K, 77 K, and 0.3 K, respectively) correlate with dislocation filtering in the thin AlN layer. Magnetotransport measurements at 0.3 K reveal well-resolved Shubnikov-de Haas oscillations starting at 3 T.
Quantum capacitance of an ultrathin topological insulator film in a magnetic field
Tahir, M.
2013-02-12
We present a theoretical study of the quantum magnetocapacitance of an ultrathin topological insulator film in an external magnetic field. The study is undertaken to investigate the interplay of the Zeeman interaction with the hybridization between the upper and lower surfaces of the thin film. Determining the density of states, we find that the electron-hole symmetry is broken when the Zeeman and hybridization energies are varied relative to each other. This leads to a change in the character of the magnetocapacitance at the charge neutrality point. We further show that in the presence of both Zeeman interaction and hybridization the magnetocapacitance exhibits beating at low and splitting of the Shubnikov de Haas oscillations at high perpendicular magnetic field. In addition, we address the crossover from perpendicular to parallel magnetic field and find consistency with recent experimental data.
International Nuclear Information System (INIS)
Wampler, W.
1976-05-01
The physics of the dHvA effect is discussed and it is shown how it can be used to determine the Fermi surface geometry, the Fermi velocities and the local scattering rates. Dingle temperature measurements are discribed and discussed. Furthermore the way in which the samples were prepared is described. Also discussed are some aspects of the metallurgical behavior of hydrogen in copper which are relevant to the sample preparation such as solubility, diffusion, precipitation, and trapping at impurities. The experimental results are presented, and the local scattering rates are determined from the results. These are then compared with lifetimes from previously reported measurements on substitutional impurities in noble metals. The experimental results are found to be in excellent agreement with a recent calculation of the scattering rates for hydrogen in copper by Huisman and Weiss. The data is also analysed in terms of phase shifts using the Greens function theory of Holtzworth and Lee for scattering from interstitials. (HPOE) [de
2010-04-19
...., Diversified Contract Service, Inc. 639, and Logistics Management Services, Inc., Fenton, MO; Amended... Logistics Management Services, Inc. worked on-site at the Chrysler LLC, Fenton, Missouri plant (Logistics... Department is amending this certification to include workers leased from Logistics Management Services, Inc...
2010-04-19
.... Diversified Contract Service, Inc. 639, and Logistics Management Services, Inc. Fenton, MO; Amended... Logistics Management Services, Inc. worked on-site at the Chrysler LLC, Fenton, Missouri plant (Logistics... Department is amending this certification to include workers leased from Logistics Management Services, Inc...
Lemus Pérez, M F; Rodríguez Susa, M
2017-06-01
Exopolymeric substances (EPS) as an external matrix of biofilm could react with disinfectants in drinking water networks forming disinfection by-products (DBP). Based on an experimental setup using two chlorine conditions-biofilm 1 (2.6 ± 0.8 mgCl/L) and biofilm 2 (0.7 ± 0.2 mg Cl/L)-samples of biofilms were recovered during 9 campaigns and EPS were extracted. Analyses of SUVA, fluorescence and amino acid (AA) content were carried out on the EPS to observe variation over time and correlations with DBP formation potential (DBP fp ) after chlorination. SUVA values were under 2 L/mgC*m showing that both EPS were hydrophilic. Slightly higher SUVA in biofilm 2 with low variation over time was observed. Fluorescence showed that aromatic proteins and fulvic like substances were the principal components and increased in biofilm 1 over time. AA decreased with time, and higher values of alanine, threonine, proline and isoleucine were observed in biofilm 2. Based on general associations, the SUVA of biofilm 2 correlated well with chloroform (CF) (r = 0.80). Generally, in both biofilms, tryptophan-like substances were negatively correlated with DBP while humic acid-like substances correlated positively, but with low indexes (r = 0.3-0.6). Correlations of data from individual sampling increased the indices (r over 0.8), suggesting a temporal influence of other factors on DBP fp such as inorganics, filtered water and the structural composition of EPS. In biofilm 1, Br-haloacetic acids (Br-HAA), dibromoacetonitrile and bromochloro acetonitrile were inversely associated with arginine and valine, as were di and trichloropropanone to arginine. On the contrary, in biofilm 2, the following amino acids correlated positively with DBP: alanine with Br-HAA, alanine with CF, alanine with N-DBP (chloropicrin, di and tri-chloro acetonitrile), and valine with CF. As this is the first report about the relation between temporal variation of EPS and DBP fp of biofilms in two
Landau quantization and spin-momentum locking in topological Kondo insulators
Directory of Open Access Journals (Sweden)
P. Schlottmann
2016-05-01
Full Text Available SmB6 has been predicted to be a strong topological Kondo insulator and experimentally it has been confirmed that at low temperatures the electrical conductivity only takes place at the surfaces of the crystal. Quantum oscillations and ARPES measurements revealed several Dirac cones on the (001 and (101 surfaces of the crystal. We considered three types of surface Dirac cones with an additional parabolic dispersion and studied their Landau quantization and the expectation value of the spin of the electrons. The Landau quantization is quite similar in all three cases and would give rise to very similar de Haas-van Alphen oscillations. The spin-momentum locking, on the other hand, differs dramatically. Without the additional parabolic dispersion the spins are locked in the plane of the surface. The parabolic dispersion, however, produces a gradual canting of the spins out of the surface plane.
Decommissioning and disposal costs in Switzerland
International Nuclear Information System (INIS)
Zurkinden, Auguste
2003-01-01
Introduction Goal: Secure sufficient financial resources. Question: How much money is needed? Mean: Concrete plans for decommissioning and waste disposal. - It is the task of the operators to elaborate these plans and to evaluate the corresponding costs - Plans and costs are to be reviewed by the authorities Decommissioning Plans and Costs - Comprise decommissioning, dismantling and management (including disposal) of the waste. - New studies 2001 for each Swiss nuclear power plant (KKB 2 x 380 MWe, KKM 370 MWe, KKG 1020 MWe, KKL 1180 MWe). - Studies performed by NIS (D). - Last developments taken into account (Niederaichbach, Gundremmingen, Kahl). Decommissioning: Results and Review Results: Total cost estimates decreasing (billion CHF) 1994 1998 2001 13.7 13.1 11.8 Lower costs for spent fuel conditioning and BE/HAA/LMA repository (Opalinus Clay) Split in 2025: 5.6 bil. CHF paid by NPP 6.2 billion CHF in Fund Review: Concentrates on disposal, ongoing
Directory of Open Access Journals (Sweden)
Amr Abd-EL Mooti EL Hanafy
2016-01-01
Full Text Available Twenty-three crude-oil-degrading bacteria were isolated from oil-contaminated sites near the Red Sea. Based on a high growth rate on crude oil and on hydrocarbon degradation ability, four strains were selected from the 23 isolated strains for further study. These four strains were selected on the basis of dichlorophenolindophenol assay. The nucleotide sequences of the 16S rRNA gene showed that these isolated strains belonged to genus Pseudomonas and Nitratireductor. Among the four isolates, strains S5 (Pseudomonas sp., 95% and 4b (Nitratireductor sp., 70% were the most effective ones in degrading crude oil. Using a spectrophotometer and gas chromatography–mass spectrometry, degradation of more than 90% of the crude oil was observed after two weeks of cultivation in Bushnell–Haas medium. The results showed that these strains have the ability to degrade crude oil and may be used for environmental remediation.
Energy Technology Data Exchange (ETDEWEB)
Rupprecht, Benedikt; Wilde, Marc A.; Grundler, Dirk [Lehrstuhl fuer Physik funktionaler Schichtsysteme, TU Muenchen, James-Franck-Str. 1, D-85747 Garching b. M. (Germany); Heyn, Christian [Institute of Applied Physics, Jungiusstr. 11, D-20355 Hamburg (Germany); Hardtdegen, Hilde; Schaepers, Thomas [Institute for Bio- and Nanosystems (IBN-1), Research Centre Juelich GmbH, D-52425 Juelich (Germany); JARA Juelich-Aachen Research Alliance, Research Centre Juelich GmbH, D-52425 Juelich (Germany)
2011-07-01
The measurement of the magnetic susceptibility and the de Haas-van Alphen (dHvA) effect was proposed by Bychkov and Rashba in 1984 to study the spin-orbit interaction (SOI) in a structure inversion asymmetric heterostructure and the spin splitting experienced by a two-dimensional electron system (2DES). Micromechanical cantilever magnetometry recently allowed us to measure the magnetization M of asymmetric InGaAs/InP quantum wells. We observe the expected SOI-induced beating patterns in M in both nearly perpendicular and tilted magnetic fields B. Unexpectedly we find phase and frequency anomalies in M vs B which have not been predicted and not been found in magnetotransport experiments. We compare our experimental results with simulations considering SOI, Zeeman splitting and tilted fields. We show that the surprising phase and frequency anomalies go beyond the current theoretical understanding and remain to be clarified.
Bulk Fermi surface and electronic properties of Cu0.07Bi2Se3
Martin, C.; Craciun, V.; Miller, K. H.; Uzakbaiuly, B.; Buvaev, S.; Berger, H.; Hebard, A. F.; Tanner, D. B.
2013-05-01
The electronic properties of Cu0.07Bi2Se3 have been investigated using Shubnikov-de Haas and optical reflectance measurements. Quantum oscillations reveal a bulk, three-dimensional Fermi surface with anisotropy kFc/kFab≈ 2 and a modest increase in free-carrier concentration and in scattering rate with respect to the undoped Bi2Se3, also confirmed by reflectivity data. The effective mass is almost identical to that of Bi2Se3. Optical conductivity reveals a strong enhancement of the bound impurity bands with Cu addition, suggesting that a significant number of Cu atoms enter the interstitial sites between Bi and Se layers or may even substitute for Bi. This conclusion is also supported by x-ray diffraction measurements, where a significant increase of microstrain was found in Cu0.07Bi2Se3, compared to Bi2Se3.
Theoretical reconsideration of antiferromagnetic Fermi surfaces in URu{sub 2}Si{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Yamagami, Hiroshi, E-mail: yamagami@cc.kyoto-su.ac.jp [Department of Physics, Faculty of Science, Kyoto Sangyo University, Kyoto 603-8555 (Japan)
2011-01-01
In an itinerant 5f-band model, the antiferromagnetic (AFM) Fermi surfaces of URu{sub 2}Si{sub 2} are reconsidered using a relativistic LAPW method within a local spin-density approximation, especially taking into account the lattice parameters dependent on pressures. The reduction of the z-coordinate of the Si sites results in the effect of flattening the Ru-Si layers of URu{sub 2}Si{sub 2} crystal structure, thus weakening a hybridization/mixing between the U-5f and Ru-4d states in the band structure. Consequently the 5f bands around the Fermi level are more flat in the dispersion with decreasing the z-coordinate, thus producing three closed Fermi surfaces like 'curing-stone', 'rugby-ball' and 'ball'. The origins of de Haas-van Alphen branches can be qualitatively interpreted from the obtained AFM Fermi surfaces.
Quarterly Report for General Research January - February - March, 1950
Energy Technology Data Exchange (ETDEWEB)
Haring, M.M.
1950-04-01
The thermal conductivity of the gradient medium plays a very important part in the development of a calorimeter. It is a large factor in determining the sensitivity. The thermal conductivity apparatus was built primarily to find out why the measured sensitivities of the microcalorimeters were so much smaller than the calculated values. This question haa been resolved. The apparatus is now being used to study the thermal conductivity of Santocel, a granular insulating material produced by Monsanto Chemical Company. The Interesting fact is that though this material is in the solid phase it has a lower thermal conductivity than air. In a previous quarterly report approximate evidence was submitted to show that Santocel A has a lower conductivity than air at room temperatures. This result was worth verification, since this material would then prove useful in the construction of microcalorimeters. A verification is submitted in this report.
Magnetospectroscopy of symmetric and anti-symmetric states in double quantum wells
Marchewka, M.; Sheregii, E. M.; Tralle, I.; Ploch, D.; Tomaka, G.; Furdak, M.; Kolek, A.; Stadler, A.; Mleczko, K.; Zak, D.; Strupinski, W.; Jasik, A.; Jakiela, R.
2008-02-01
The experimental results obtained for magnetotransport in the InGaAs/InAlAs double quantum well (DQW) structures of two different shapes of wells are reported. A beating effect occurring in the Shubnikov-de Haas (SdH) oscillations was observed for both types of structures at low temperatures in the parallel transport when the magnetic field was perpendicular to the layers. An approach for the calculation of the Landau level energies for DQW structures was developed and then applied to the analysis and interpretation of the experimental data related to the beating effect. We also argue that in order to account for the observed magnetotransport phenomena (SdH and integer quantum Hall effect), one should introduce two different quasi-Fermi levels characterizing two electron subsystems regarding the symmetry properties of their states, symmetric and anti-symmetric ones, which are not mixed by electron-electron interaction.
Quantum magnetotransport properties of topological insulators under strain
Tahir, M.
2012-08-15
We present a detailed theoretical investigation of the quantum magnetotransport properties of topological insulators under strain. We consider an external magnetic field perpendicular to the surface of the topological insulator in the presence of strain induced by the substrate. The strain effects mix the lower and upper surface states of neighboring Landau levels into two unequally spaced energy branches. Analytical expressions are derived for the collisional conductivity for elastic impurity scattering in the first Born approximation. We also calculate the Hall conductivity using the Kubo formalism. Evidence for the beating of Shubnikov–de Haas oscillations is found from the temperature and magnetic field dependence of the collisional and Hall conductivities. In the regime of a strong magnetic field, the beating pattern is replaced by a splitting of the magnetoresistance peaks due to finite strain energy. These results are in excellent agreement with recent HgTe transport experiments.
Extremely large magnetoresistance and electronic structure of TmSb
Wang, Yi-Yan; Zhang, Hongyun; Lu, Xiao-Qin; Sun, Lin-Lin; Xu, Sheng; Lu, Zhong-Yi; Liu, Kai; Zhou, Shuyun; Xia, Tian-Long
2018-02-01
We report the magnetotransport properties and the electronic structure of TmSb. TmSb exhibits extremely large transverse magnetoresistance and Shubnikov-de Haas (SdH) oscillation at low temperature and high magnetic field. Interestingly, the split of Fermi surfaces induced by the nonsymmetric spin-orbit interaction has been observed from SdH oscillation. The analysis of the angle-dependent SdH oscillation illustrates the contribution of each Fermi surface to the conductivity. The electronic structure revealed by angle-resolved photoemission spectroscopy (ARPES) and first-principles calculations demonstrates a gap at the X point and the absence of band inversion. Combined with the trivial Berry phase extracted from SdH oscillation and the nearly equal concentrations of electron and hole from Hall measurements, it is suggested that TmSb is a topologically trivial semimetal and the observed XMR originates from the electron-hole compensation and high mobility.
Quasiparticles and Fermi liquid behaviour in an organic metal
Kiss, T.; Chainani, A.; Yamamoto, H.M.; Miyazaki, T.; Akimoto, T.; Shimojima, T.; Ishizaka, K.; Watanabe, S.; Chen, C.-T.; Fukaya, A.; Kato, R.; Shin, S.
2012-01-01
Many organic metals display exotic properties such as superconductivity, spin-charge separation and so on and have been described as quasi-one-dimensional Luttinger liquids. However, a genuine Fermi liquid behaviour with quasiparticles and Fermi surfaces have not been reported to date for any organic metal. Here, we report the experimental Fermi surface and band structure of an organic metal (BEDT-TTF)3Br(pBIB) obtained using angle-resolved photoelectron spectroscopy, and show its consistency with first-principles band structure calculations. Our results reveal a quasiparticle renormalization at low energy scales (effective mass m*=1.9 me) and ω2 dependence of the imaginary part of the self energy, limited by a kink at ~50 meV arising from coupling to molecular vibrations. The study unambiguously proves that (BEDT-TTF)3Br(pBIB) is a quasi-2D organic Fermi liquid with a Fermi surface consistent with Shubnikov-de Haas results. PMID:23011143
Energy Technology Data Exchange (ETDEWEB)
Ma, Ning, E-mail: maning@stu.xjtu.edu.cn [Department of Physics, MOE Key Laboratory of Advanced Transducers and Intelligent Control System, Taiyuan University of Technology, Taiyuan 030024 (China); Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Zhang, Shengli, E-mail: zhangsl@mail.xjtu.edu.cn [Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Liu, Daqing, E-mail: liudq@cczu.edu.cn [School of Mathematics and Physics, Changzhou University, Changzhou 213164 (China)
2016-10-14
Recent experiments reveal that the strained bulk HgTe can be regarded as a three-dimensional topological insulator (TI). We further explore the strain effects on magnetotransport in HgTe at magnetic field. We find that the substrate strain associated with the surface index of carriers, can remove the surfaces degeneracy in Landau levels. This accordingly induces the well separated surface quantum Hall plateaus and Shubnikov–de Haas oscillations. These results can be used to generate and detect surface polarization, not only in HgTe but also in a broad class of TIs, which would be very great news for electronic applications of TIs. - Highlights: • We explore the strain mediated magnetotransport in topological insulators. • We analytically derive the zero frequency magnetoconductivity. • The strain removes the surface degeneracy in Landau levels. • The strain gives rise to the splitting and mixture of Landau levels. • The strain leads to the surface asymmetric spectrum of conductivity.
Melrose, Sherri; Miller, Jean; Gordon, Kathryn; Janzen, Katherine J.
2012-01-01
This paper presents findings from a qualitative descriptive study that explored the professional socialization experiences of Licensed Practical Nurses (LPNs) who attended an online university to earn a Baccalaureate degree in nursing (BN), a prerequisite to writing the Canadian Registered Nurse (RN) qualifying exam. The project was framed from a constructivist worldview and Haas and Shaffir's theory of legitimation. Participants were 27 nurses in a Post-LPN to BN program who came from across Canada to complete required practicums. Data was collected from digital recordings of four focus groups held in different cities. Transcripts were analyzed for themes and confirmed with participants through member checking. Two overarching themes were identified and are presented to explain how these unique adult learners sought to legitimize their emerging identity as Registered Nurses (RNs). First, Post-LPN to BN students need little, if any, further legitimation to affirm their identities as “nurse.” Second, practicum interactions with instructors and new clinical experiences are key socializing agents. PMID:22548165
Mohanram, Rajamani; Jagtap, Chandrakant; Kumar, Pradeep
2016-04-15
Diverse marine bacterial species predominantly found in oil-polluted seawater produce diverse surface-active agents. Surface-active agents produced by bacteria are classified into two groups based on their molecular weights, namely biosurfactants and bioemulsifiers. In this study, surface-active agent-producing, oil-degrading marine bacteria were isolated using a modified Bushnell-Haas medium with high-speed diesel as a carbon source from three oil-polluted sites of Mumbai Harbor. Surface-active agent-producing bacterial strains were screened using nine widely used methods. The nineteen bacterial strains showed positive results for more than four surface-active agent screening methods; further, these strains were characterized using biochemical and nucleic acid sequencing methods. Based on the results, the organisms belonged to the genera Acinetobacter, Alcanivorax, Bacillus, Comamonas, Chryseomicrobium, Halomonas, Marinobacter, Nesterenkonia, Pseudomonas, and Serratia. The present study confirmed the prevalence of surface-active agent-producing bacteria in the oil-polluted waters of Mumbai Harbor. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hydrolysis studies of thorium using solvent extraction technique
International Nuclear Information System (INIS)
Engkvist, I.; Albinsson, Y.
1992-01-01
The Swedish concept for final disposal of spent nuclear fuel is focused on a repository in crystalline rock at a depth of 500 m. In order to calculate migration rates from such a repository, chemical speciation becomes important. A method for determining complexation of actinides and lanthanides with inorganic ligands using solvent extraction has been developed. The apparatus used is called AKUFVE and the used technique can measure distribution values in a two liquid phase system in the range 10 -5 to 10 5 , pH 1 to 11. Hydrolysis of thorium has been studied in 1 M NaClO 4 in inert atmosphere. Th-234 separated from U-238 was extracted with 0.01-1 M 2,4-pentanedione (HAa) in toluene. From extraction data, calculations of hydrolysis constants have been made, regarding hydroxide complexes as competing and nonextractable. As a result we conclude that the constant for tri- and tetrahydroxide complexes are overestimated. (orig.)
Liu, Zhiquan; Cui, Fuyi; Ma, Hua; Fan, Zhenqiang; Zhao, Zhiwei; Hou, Zhenling; Liu, Dongmei; Jia, Xuebin
2013-08-01
The potential water quality problems caused by the interaction between nitrobezene (NB) and Microcystis aeruginosa was investigated by studying the growth inhibition, the haloacetic acids formation potential (HAAFP) and the secretion of microcystin-LR (MC-LR). The results showed that NB can inhibit the growth of M. aeruginosa, and the value of EC50 increased with the increase of initial algal density. Although NB can hardly react with chlorine to form HAAs, the presence of NB can enhance the HAAFP productivity. The secretion of the intracellular MC-LR is constant under the steady experimental conditions. However, the presence of NB can reduce the MC-LR productivity of M. aeruginosa. Overall, the increased disinfection risk caused by the interaction has more important effect on the safety of drinking water quality than the benefit of the decreased MC-LR productivity, and should be serious considered when the water contained NB and M. aeruginosa is used as drinking water source. Copyright © 2013 Elsevier Ltd. All rights reserved.
Orgon, Casey Roy
Corrosion is the decomposition of metal and metal alloys which threatens the integrity of man-made structures. One of the more efficient methods of delaying the corrosion process in metals is by coatings. In this work, the durability of two polyester powder coatings were investigated for corrosion protection of AA-2024-T3. Polyester powder coatings crosslinked by either triglycidyl isocyanurate (TGIC) or beta-hydroxyalkyl amide (HAA) compounds were prepared and investigated for barrier protection of metal substrates by electrochemical impedance spectroscopy (EIS). Polyester-TGIC coatings were found to provide better long-term protection, which can be attributed to the increased mechanical strength and higher concentration of crosslinking in the coating films. Additionally, the polyester powder coatings, along with a fusion bonded epoxy (FBE) were investigated for their compatibility as a topcoat for magnesium-rich primers (MgRP). Under proper application conditions, powder topcoats were successfully applied to cured MgRP while corrosion protection mechanisms of each system were maintained.
The Role of Civil Society Organizations in Monitoring the Global AIDS Response.
Smith, Julia; Mallouris, Christoforos; Lee, Kelley; Alfvén, Tobias
2017-07-01
Civil society organizations (CSOs) are recognized as playing an exceptional role in the global AIDS response. However, there is little detailed research to date on how they contribute to specific governance functions. This article uses Haas' framework on global governance functions to map CSO's participation in the monitoring of global commitments to the AIDS response by institutions and states. Drawing on key informant interviews and primary documents, it focuses specifically on CSO participation in Global AIDS Response Progress Reporting and in Global Fund to Fight AIDS, Tuberculosis and Malaria processes. It argues that the AIDS response is unique within global health governance, in that CSOs fulfill both formal and informal monitoring functions, and considers the strengths and weaknesses of these contributions. It concludes that future global health governance arrangements should include provisions and resources for monitoring by CSOs because their participation creates more inclusive global health governance and contributes to strengthening commitments to human rights.
ALICE doffs hat to two companies
2007-01-01
During the fifth annual ALICE Industrial Awards ceremony, the ALICE Collaboration honoured two companies for their outstanding contributions to the construction of the experiment.For the past five years, the ALICE collaboration has been presenting its industrial partners with awards for meeting demanding or unusual requirements, for excellence in design or execution, for delivery on-time and on-budget and for outstanding cooperation. This year, on 9 March, ALICE presented awards to two companies for their exceptional performance. From left to right: Kees Oskamp (ALICE SSD), Arie de Haas (ALICE SSD), Gert-Jan Nooren (ALICE SSD), Shon Shmuel (FIBERNET), Yehuda Mor-Yosef (FIBERNET), Hans Boggild (ALICE), Jurgen Schukraft (ALICE Spokesperson), Catherine Decosse (ALICE) and Jean-Robert Lutz (ALICE SSD). FIBERNET Ltd., based in Yokneam, Israel, was rewarded for the excellent and timely assembly of the Silicon Strip Detector boards (SSD) of the Inner Tracking System with cable connections. Special low-mass cables, ...
Evaluation of air cleaning system concepts for emergency use in LMFBR plants
International Nuclear Information System (INIS)
Hilliard, R.K.; McCormack, J.D.; Postma, A.K.
1976-12-01
Nineteen different air cleaning concepts are arranged into twenty-four systems and evaluated for use as accident mitigating systems in LMFBR plants. Both single, low-leakage containment plants and once-through operation applicable to containment/confinement plants are considered. Plant characteristics affecting air cleaning requirements are defined for 1000 MW(e) plants and a sodium and radiological release term is postulated. The accident conditions under which the emergency air cleaning system (EACS) must function is established by use of SOFIRE-II and HAA-3B computer codes. Criteria are developed for evaluating the various systems and for assigning comparative ratings. The numerical ratings are combined with information on cost and development potential to arrive at recommendations for the most promising systems. The conclusion is made that reliable and effective systems are feasible for use as engineered safety features for LMFBR plants, but that development effort is required for all the air cleaning concepts evaluated
Ground state magnetization of conduction electrons in graphene with Zeeman effect
Energy Technology Data Exchange (ETDEWEB)
Escudero, F., E-mail: federico.escudero@uns.edu.ar [Departamento de Física, Universidad Nacional del Sur, Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Instituto de Física del Sur (IFISUR, UNS-CONICET), Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Ardenghi, J.S., E-mail: jsardenhi@gmail.com [Departamento de Física, Universidad Nacional del Sur, Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Instituto de Física del Sur (IFISUR, UNS-CONICET), Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Sourrouille, L., E-mail: lsourrouille@yahoo.es [Departamento de Física, Universidad Nacional del Sur, Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Instituto de Física del Sur (IFISUR, UNS-CONICET), Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Jasen, P., E-mail: pvjasen@uns.edu.ar [Departamento de Física, Universidad Nacional del Sur, Av. Alem 1253, B8000CPB Bahía Blanca (Argentina); Instituto de Física del Sur (IFISUR, UNS-CONICET), Av. Alem 1253, B8000CPB Bahía Blanca (Argentina)
2017-05-01
In this work we address the ground state magnetization in graphene, considering the Zeeman effect and taking into account the conduction electrons in the long wavelength approximation. We obtain analytical expressions for the magnetization at T=0 K, where the oscillations given by the de Haas van Alphen (dHvA) effect are present. We find that the Zeeman effect modifies the magnetization by introducing new peaks associated with the spin splitting of the Landau levels. These peaks are very small for typical carrier densities in graphene, but become more important for higher densities. The obtained results provide insight of the way in which the Zeeman effect modifies the magnetization, which can be useful to control and manipulate the spin degrees of freedom. - Highlights: • The magnetization has peaks whenever the last energy level changes discontinuously. • The peaks amplitude depends on the electron density. • The Zeeman effect introduces new peaks in the magnetization.
Low-temperature structure and Fermi surface of (La,Ce)TiGe{sub 3}
Energy Technology Data Exchange (ETDEWEB)
Foerster, Tobias; Grasemann, Jacob; Uhlarz, Marc; Wosnitza, Jochen [Dresden High Magnetic Field Laboratory (HLD), Helmholtz-Zentrum Dresden-Rossendorf, Dresden (Germany); Rosner, Helge; Stockert, Oliver [Max Planck Institute for Chemical Physics of Solids, Dresden (Germany); Kittler, Wolfram; Loehneysen, Hilbert von [Karlsruhe Institute of Technology, Karlsruhe (Germany); Fritsch, Veronika [Institut fuer Physik, Universitaet Augsburg, Augsburg (Germany)
2016-07-01
CeTiGe{sub 3} presents the rare case of a ferromagnetically (T{sub C} ∼ 14 K) ordered Kondo-lattice compound and is probably the first known example of an intermetallic hexagonal perovskite of the BaNiO{sub 3} structure type. LaTiGe{sub 3} may be used as its nonmagnetic reference, since both compounds crystallize in the same crystal structure. To clarify the interplay between structural, localized, and itinerant degrees of freedom an accurate knowledge of the electronic band structure is necessary. Here, we present a detailed electronic-structure study of both compounds applying full potential density functional calculations. Since the Ge's atomic position couples strongly to the band structure at the Fermi energy, a low-temperature, high-resolution structure refinement was made. We attempt to separate the influence of different parameters on the topology of the respective Fermi surfaces and will compare our results with de Haas-van Alphen measurements.
Study of irradiation defects in bismuth by electric transport measurements
International Nuclear Information System (INIS)
Le Goff, M.
1984-01-01
Pure monocrystalline bismuth is irradiated near 4K by electrons of different energies. Irradiation effects are measured by galvanomagnetic properties at low temperature. Frenkel pairs created during irradiation have a strong effect on carrier mobilities. The data are quantitatively analyzed assuming a rigid band model. After irradiation with 1 MeV electrons, each Frankel pair created corresponds to a total charge of 0.14 electrons. This result obtained by magnetoresistance and Hall effect is confirmed by Shubnikov-de Haas experiments. There is a linear variation between the excess carrier density (p-n) and the Frenkel pair concentration. The more important step of annealing is observed around 40-50 K. This step is attributed to interstitial migration. Resistivity presents a minimum at low temperature after irradiation with electrons of energy over 1.3 MeV. This is explained by virtual bound levels near the Fermi level. The Kondo effect bound to magnetic defects is discussed [fr
2008-09-01
34 0N mD " ’ H 0 WMaH MW0WN N m 1-4 ~ ~ ~ Hq H4- 4 4r4 H H H H H mN( OD.D o t-)(~(aHr(arC0~)N(HAa((NLH ri) H 0~~ W-- HHHHHH "HHH(m((N(N m 1-4CC’ C ) LA...34 0000000000000000000000000000 OO OO HH HH HHHHHH iH H r,cl NC14ONmO W. M~ W W WWMWWkD-4IDM V-Wr-M 0WW W -4r- - MM C ; a) 000000000000000000000000000 w N mNwom- o oo0...82174HNO.~O.LflWN(4LAO.OW.4 + 0 - HHHHHHHHH HHHHHH H 00 ~~~~~1 ~ ~ r 0;c A bIDH~.L ~C C 0’ M,IDO r- 0(1 M - H W 0 M* 0 ~H H H H H H4 H 0 MU C AW4W 00 D WV
High Magnetic Field in THz Plasma Wave Detection by High Electron Mobility Transistors
Sakowicz, M.; Łusakowski, J.; Karpierz, K.; Grynberg, M.; Valusis, G.
The role of gated and ungated two dimensional (2D) electron plasma in THz detection by high electron mobility transistors (HEMTs) was investigated. THz response of GaAs/AlGaAs and GaN/AlGaN HEMTs was measured at 4.4K in quantizing magnetic fields with a simultaneous modulation of the gate voltage UGS. This allowed us to measure both the detection signal, S, and its derivative dS/dUGS. Shubnikov - de-Haas oscillations (SdHO) of both S and dS/dUGS were observed. A comparison of SdHO observed in detection and magnetoresistance measurements allows us to associate unambiguously SdHO in S and dS/dUGS with the ungated and gated parts of the transistor channel, respectively. This allows us to conclude that the entire channel takes part in the detection process. Additionally, in the case of GaAlAs/GaAs HEMTs, a structure related to the cyclotron resonance transition was observed.
Fermi surfaces properties of AuAl2, AuGa2, and AuIn2 with the CaF2-type cubic structure
Nishimura, K.; Kakihana, M.; Suzuki, F.; Yara, T.; Hedo, M.; Nakama, T.; Ōnuki, Y.; Harima, H.
2018-05-01
We grew high-quality single crystals of AuAl2, AuGa2, and AuIn2 with the fluorite (CaF2)-type cubic structure and determined the Fermi surface properties by the de Haas-van Alphen (dHvA) experiments using full-potential LAPW bad calculations. The Fermi surface and optical properties for three compounds were once studied from an interest of colors because AuAl2 has a striking bright reddish-purple color, whereas AuGa2 and AuIn2 are, respectively, neutral and bluish. The detected dHvA frequencies in the present study are found to be in a wide range of (0.1-13)×107 Oe. The main dHvA branches for three compounds are in excellent agreement with the theoretical ones, but some dHvA branches with small dHvA frequencies are slightly deviated from the theoretical ones, especially in AuGa2 and AuIn2.
Directory of Open Access Journals (Sweden)
Sherri Melrose
2012-01-01
Full Text Available This paper presents findings from a qualitative descriptive study that explored the professional socialization experiences of Licensed Practical Nurses (LPNs who attended an online university to earn a Baccalaureate degree in nursing (BN, a prerequisite to writing the Canadian Registered Nurse (RN qualifying exam. The project was framed from a constructivist worldview and Haas and Shaffir’s theory of legitimation. Participants were 27 nurses in a Post-LPN to BN program who came from across Canada to complete required practicums. Data was collected from digital recordings of four focus groups held in different cities. Transcripts were analyzed for themes and confirmed with participants through member checking. Two overarching themes were identified and are presented to explain how these unique adult learners sought to legitimize their emerging identity as Registered Nurses (RNs. First, Post-LPN to BN students need little, if any, further legitimation to affirm their identities as “nurse.” Second, practicum interactions with instructors and new clinical experiences are key socializing agents.
Melrose, Sherri; Miller, Jean; Gordon, Kathryn; Janzen, Katherine J
2012-01-01
This paper presents findings from a qualitative descriptive study that explored the professional socialization experiences of Licensed Practical Nurses (LPNs) who attended an online university to earn a Baccalaureate degree in nursing (BN), a prerequisite to writing the Canadian Registered Nurse (RN) qualifying exam. The project was framed from a constructivist worldview and Haas and Shaffir's theory of legitimation. Participants were 27 nurses in a Post-LPN to BN program who came from across Canada to complete required practicums. Data was collected from digital recordings of four focus groups held in different cities. Transcripts were analyzed for themes and confirmed with participants through member checking. Two overarching themes were identified and are presented to explain how these unique adult learners sought to legitimize their emerging identity as Registered Nurses (RNs). First, Post-LPN to BN students need little, if any, further legitimation to affirm their identities as "nurse." Second, practicum interactions with instructors and new clinical experiences are key socializing agents.
DEFF Research Database (Denmark)
Thomas, S R; Davies, Michael Jonathan; Stocker, R
1998-01-01
by the consumption of ubiquinol-10 (CoQ10H2) and alpha-tocopherol (alpha-TOH), the accumulation of cholesteryl ester hydro(pero)xides, the loss of lysine (Lys) and tryptophan (Trp) residues, and the change in relative electrophoretic mobility. Exposure to ONOO- or SIN-1 resulted in rapid (... enrichment with the co-antioxidant CoQ10H2 decreased LDL lipid peroxidation induced by SIN-1. At oxidant-to-LDL ratios of >200:1, alpha-TOH enrichment decreased LDL lipid peroxidation for both SIN-1 and ONOO-. In contrast to lipid peroxidation, altering the alpha-TOH content of LDL did not affect Trp or Lys......-antioxidants ascorbate and 3-HAA prevented alpha-TOH consumption and lipid peroxidation. Exposure of human plasma to SIN-1 resulted in the loss of ascorbate followed by loss of CoQ10H2 and bilirubin. Lipid peroxidation was inhibited during this period, though proceeded as a radical-chain process after depletion...
Electronic structure of hcp transition metals
DEFF Research Database (Denmark)
Jepsen, O.; Andersen, O. Krogh; Mackintosh, A. R.
1975-01-01
Using the linear muffin-tin-orbital method described in the previous paper, we have calculated the electronic structures of the hcp transition metals, Zr, Hf, Ru, and Os. We show how the band structures of these metals may be synthesized from the sp and d bands, and illustrate the effects...... of hybridization, relativistic band shifts, and spin-orbit coupling by the example of Os. By making use of parameters derived from the muffin-tin potential, we discuss trends in the positions and widths of the energy bands, especially the d bands, as a function of the location in the periodic table. The densities...... of states of the four metals are presented, and the calculated heat capacities compared with experiment. The Fermi surfaces of both Ru and Os are found to be in excellent quantitative agreement with de Haas-van Alphen measurements, indicating that the calculated d-band position is misplaced by less than 10...
Hashimoto, Chikao; Sugimoto, Kazuhiro; Takahashi, Youhei; Kodomari, Mitsuo
2013-10-01
In the synthesis of dipeptides (Boc-AA(1)-AA(2)-OPac: AA(1) and AA(2) represent amino acids) protected by phenacyl (Pac) ester, amines and solid bases as the base for the conversion of the trifluoroacetic acid (TFA) salt of the amino component (TFA·H-AA(2)-OPac) into the corresponding free amino component (H-AA(2)-OPac) were examined. The synthesis of a dipeptide (Boc-Ala-Gly-OPac) using amines for the conversion afforded an unsatisfactory yield with by-products. On the other hand, the use of neutral alumina-supported Na(2) CO(3) (Na(2)CO(3) /n-Al(2)O(3)) as a solid base for the conversion provided the dipeptide in a quantitative yield without by-products. The application of Na(2)CO(3) /n-Al2 O3 to the synthesis of some dipeptides protected by Pac ester gave the desired peptides in excellent yields. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.
High electron mobility and large magnetoresistance in the half-Heusler semimetal LuPtBi
Hou, Zhipeng
2015-12-18
Materials with high carrier mobility showing large magnetoresistance (MR) have recently received much attention because of potential applications in future high-performance magnetoelectric devices. Here, we report on an electron-hole-compensated half-Heusler semimetal LuPtBi that exhibits an extremely high electron mobility of up to 79000cm2/Vs with a nonsaturating positive MR as large as 3200% at 2 K. Remarkably, the mobility at 300 K is found to exceed 10500cm2/Vs, which is among the highest values reported in three-dimensional bulk materials thus far. The clean Shubnikov–de Haas quantum oscillation observed at low temperatures and the first-principles calculations together indicate that the high electron mobility is due to a rather small effective carrier mass caused by the distinctive band structure of the crystal. Our findings provide a different approach for finding large, high-mobility MR materials by designing an appropriate Fermi surface topology starting from simple electron-hole-compensated semimetals.
High frequency response of open quantum dots
International Nuclear Information System (INIS)
Brunner, R.; Meisels, R.; Kuchar, F.; Ferry, D.; Elhassan, M.; Ishibashi, K.
2002-01-01
Full text: We investigate the response of the transport through open quantum dots to millimeterwave radiation (up to 55 GHz). In the low-field region ( 11 cm -2 and a mobility of 1.2 10 6 cm 2 /Vs. By applying a sufficiently negative voltage to the gates the 2DES is split into two regions connected only by a dot-like region (about 350 nm diameter) between them. The DC data exhibit backscattering peaks at fields of a few tenth of a Tesla. Shubnikovde- Haas (SdH) oscillations appear above 0.5 T. While the SdH oscillations show the usual temperature dependence, the backscattering peaks are temperature independent up to 2.5 K. The backscattering peak shows a reduction of 10 percent due to the millimeterwave irradiation. However, due to the temperature independence of this peak, this reduction cannot simply be attributed to electron heating. This conclusion is supported by the observation of a strong frequency dependence of the reduction of the peak height. (author)
Unexplained infertility: identification of anti sperm antibodies using radiometric immunoassay
International Nuclear Information System (INIS)
Megahed, Y.M.; Elnabarawy, F.; Hamada, T.; Ayiad, S.K.
1992-01-01
Several methods have been employed to measure anti sperm antibodies with variable sensitivity and specificity in serum and secretion of infertile patients. All of them are not precise means for identification of the presence of anti sperm antibodies for patients with unexplained infertility (Haas et al, 1980). Therefore, the modified radiolabelled anti globulin test, that has been used successfully to identify and quantitate the antibodies directed towards other human cell surfaces, was applied. A total number of 128 subjects in different groups were studied to quantitate the circulating anti sperm antibodies using the modified procedure. The present data revealed that the highest and the most significant incidence were found in the patients secretions (semen and cervical mucus) with unexplained infertility, as well as in the group of males with varicocele. Therefore it is greatly advisable to use the modified radiolabelled technique as a quantitative assay, which will be helpful in management of infertility in patients with unexplained and mediated infertility.3 tab., 4 fig
El Naschie's structures in the electrodynamics of polarizable media
International Nuclear Information System (INIS)
Agop, M.; Merches, I.; Enache, V.
2005-01-01
Using the concept of 'combined field', an electrodynamics of polarizable media on a fractal space-time is constructed. In this context, using the scale relativity theory, the permanent electric moment, the induced electric moment, the vacuum fluctuations, the paraelectrics, the diaelectrics, the electric Zeeman-type effect, the electric Einstein-de Haas-type effect, the electric Aharonov-Bohm-type effect, the superconductors in the 'combined field', the double layers as coherent structures, the magnetic Aharonov-Casher-type effect, are analyzed. Correspondence with the ε (∞) space-time is accomplished either by admitting an anomal electric Zeeman-type effect, or through a fractal string as in the case of a superconductor in 'combined field', or, by phase coherence of the electron-ion pairs from the electric double layers (El Naschie's coherence). Moreover, the electric double layer or multiple layer may be considered as two-dimensional projections of the same El Naschie's fractal strings (higher-dimensional strings in ε (∞) space-time)
Conduction electrons in acceptor-doped GaAs/GaAlAs heterostructures: a review
International Nuclear Information System (INIS)
Zawadzki, Wlodek; Raymond, Andre; Kubisa, Maciej
2016-01-01
We review magneto-optical and magneto-transport effects in GaAs/GaAlAs heterostructures doped in GaAlAs barriers with donors, providing two-dimensional (2D) electron gas (2DEG) in GaAs quantum wells (QWS), and additionally doped with smaller amounts of acceptors (mostly Be atoms) in the vicinity of 2DEG. One may also deal with residual acceptors (mostly C atoms). The behavior of such systems in the presence of a magnetic field differs appreciably from those doped in the vicinity of 2DEG with donors. Three subjects related to the acceptor-doped heterostructures are considered. First is the problem of bound states of conduction electrons confined to the vicinity of negatively charged acceptors by the joint effect of a QW and an external magnetic field parallel to the growth direction. A variational theory of such states is presented, demonstrating that an electron turning around a repulsive center has discrete energies above the corresponding Landau levels. Experimental evidence for the discrete electron energies comes from the work on interband photo-magneto-luminescence, intraband cyclotron resonance and quantum magneto-transport (the Quantum Hall and Shubnikov–de Haas effects). An electron rain-down effect at weak electric fields and a boil-off effect at strong electric fields are introduced. It is demonstrated, both theoretically and experimentally, that a negatively charged acceptor can localize more than one electron. The second subject describes experiment and theory of asymmetric quantized Hall and Shubnikov–de Haas plateaus in acceptor-doped GaAs/GaAlAs heterostructures. It is shown that the main features of the plateau asymmetry can be attributed to asymmetric density of Landau states in the presence of acceptors. However, at high magnetic fields, the rain-down effect is also at work. The third subject deals with the so-called disorder modes (DMs) in the cyclotron resonance of conduction electrons. The DMs originate from random distributions of
Energy Technology Data Exchange (ETDEWEB)
Windham, Gayle C., E-mail: gayle.windham@cdph.ca.gov [CA Department of Public Health, DEODC, 850 Marina Bay Pkwy, Bldg. P, Richmond, CA 94804 (United States); Pinney, Susan M. [University of Cincinnati College of Medicine, Cincinnati, OH 45267 (United States); Sjodin, Andreas [Centers for Disease Control and Prevention, Atlanta, GA 30341 (United States); Lum, Raymond [Impact Assessment Inc., San Diego, CA (United States); Jones, Richard S.; Needham, Larry L. [Centers for Disease Control and Prevention, Atlanta, GA 30341 (United States); Biro, Frank M. [University of Cincinnati College of Medicine, Cincinnati, OH 45267 (United States); Hiatt, Robert A. [University of California Medical School, San Francisco, CA (United States); Kushi, Lawrence H. [Kaiser Permanente Northern California, Oakland, CA 94612 (United States)
2010-04-15
Background: Levels of brominated flame retardants are increasing in US populations, yet little data are available on body burdens of these and other persistent hormonally active agents (HAAs) in school-aged children. Exposures to such chemicals may affect a number of health outcomes related to development and reproductive function. Objective: Determine the distribution of biomarkers of polybrominated diphenyl ethers (PBDEs), polychlorinated biphenyls (PCBs), and organo-chlorinated pesticides (OCPs), such as DDT/DDE, in children, and their variation by key descriptor variables. Methods: Ethnically diverse cohorts of girls 6-8 y old at baseline are being followed for growth and pubertal development in a multi-site, longitudinal study. Nearly 600 serum samples from the California and Ohio sites were analyzed for lipids, 35 PCB congeners, 11 PBDE congeners, and 9 OCPs. The biomarker distributions were examined and geometric means compared for selected analytes across categories of age, race, site, body mass index (BMI), parental education, maternal age at delivery, and breast feeding in adjusted models. Results: Six PBDE congeners were detected among greater than 70% of samples, with BDE-47 having the highest concentration (median 42.2, range 4.9-855 ng/g lipid). Girls in California had adjusted geometric mean (GM) PBDE levels significantly higher than girls in Ohio. Furthermore, Blacks had significantly higher adjusted GMs of all six PBDE congeners than Whites, and Hispanics had intermediate values. GMs tended to be lower among more obese girls, while other variables were not strongly associated. In contrast, GMs of the six PCB congeners most frequently detected were significantly lower among Blacks and Hispanics than Whites. PCBs and the three pesticides most frequently detected were also consistently lower among girls with high BMI, who were not breast-fed, whose mothers were younger, or whose care-givers (usually parents) were less educated. Girls in California had
International Nuclear Information System (INIS)
Windham, Gayle C.; Pinney, Susan M.; Sjodin, Andreas; Lum, Raymond; Jones, Richard S.; Needham, Larry L.; Biro, Frank M.; Hiatt, Robert A.; Kushi, Lawrence H.
2010-01-01
Background: Levels of brominated flame retardants are increasing in US populations, yet little data are available on body burdens of these and other persistent hormonally active agents (HAAs) in school-aged children. Exposures to such chemicals may affect a number of health outcomes related to development and reproductive function. Objective: Determine the distribution of biomarkers of polybrominated diphenyl ethers (PBDEs), polychlorinated biphenyls (PCBs), and organo-chlorinated pesticides (OCPs), such as DDT/DDE, in children, and their variation by key descriptor variables. Methods: Ethnically diverse cohorts of girls 6-8 y old at baseline are being followed for growth and pubertal development in a multi-site, longitudinal study. Nearly 600 serum samples from the California and Ohio sites were analyzed for lipids, 35 PCB congeners, 11 PBDE congeners, and 9 OCPs. The biomarker distributions were examined and geometric means compared for selected analytes across categories of age, race, site, body mass index (BMI), parental education, maternal age at delivery, and breast feeding in adjusted models. Results: Six PBDE congeners were detected among greater than 70% of samples, with BDE-47 having the highest concentration (median 42.2, range 4.9-855 ng/g lipid). Girls in California had adjusted geometric mean (GM) PBDE levels significantly higher than girls in Ohio. Furthermore, Blacks had significantly higher adjusted GMs of all six PBDE congeners than Whites, and Hispanics had intermediate values. GMs tended to be lower among more obese girls, while other variables were not strongly associated. In contrast, GMs of the six PCB congeners most frequently detected were significantly lower among Blacks and Hispanics than Whites. PCBs and the three pesticides most frequently detected were also consistently lower among girls with high BMI, who were not breast-fed, whose mothers were younger, or whose care-givers (usually parents) were less educated. Girls in California had
Spin-splitting in p-type Ge devices
Energy Technology Data Exchange (ETDEWEB)
Holmes, S. N., E-mail: s.holmes@crl.toshiba.co.uk; Newton, P. J.; Llandro, J.; Mansell, R.; Barnes, C. H. W. [Cavendish Laboratory, Department of Physics, University of Cambridge, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom); Morrison, C.; Myronov, M. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)
2016-08-28
Compressively strained Ge quantum well devices have a spin-splitting in applied magnetic field that is entirely consistent with a Zeeman effect in the heavy hole valence band. The spin orientation is determined by the biaxial strain in the quantum well with the relaxed SiGe buffer layers and is quantized in the growth direction perpendicular to the conducting channel. The measured spin-splitting in the resistivity ρ{sub xx} agrees with the predictions of the Zeeman Hamiltonian where the Shubnikov-deHaas effect exhibits a loss of even filling factor minima in the resistivity ρ{sub xx} with hole depletion from a gate field, increasing disorder or increasing temperature. There is no measurable Rashba spin-orbit coupling irrespective of the structural inversion asymmetry of the confining potential in low p-doped or undoped Ge quantum wells from a density of 6 × 10{sup 10} cm{sup −2} in depletion mode to 1.7 × 10{sup 11} cm{sup −2} in enhancement.
Electronic structure and thermoelectric properties of bismuth telluride and bismuth selenide
Mishra, S K; Jepsen, O
1997-01-01
The electronic structures of the two thermoelectric materials Bi sub 2 Te sub 3 and Bi sub 2 Se sub 3 are studied using density-functional theory with the spin - orbit interaction included. The electron states in the gap region and the chemical bonding can be described in terms of pp sigma interaction between the atomic p orbitals within the 'quintuple' layer. For Bi sub 2 Se sub 3 , we find both the valence-band maximum as well as the conduction-band minimum, each with a nearly isotropic effective mass, to occur at the zone centre in agreement with experimental results. For Bi sub 2 Te sub 3 , we find that the six valleys for the valence-band maximum are located in the mirror planes of the Brillouin zone and they have a highly anisotropic effective mass, leading to an agreement between the de Haas-van Alphen data for the p-doped samples and the calculated Fermi surface. The calculated conduction band, however, has only two minima, instead of the six minima indicated from earlier experiments. The calculated S...
Magnetic field mediated conductance oscillation in graphene p–n junctions
Cheng, Shu-Guang
2018-04-01
The electronic transport of graphene p–n junctions under perpendicular magnetic field is investigated in theory. Under low magnetic field, the transport is determined by the resonant tunneling of Landau levels and conductance versus magnetic field shows a Shubnikov–de Haas oscillation. At higher magnetic field, the p–n junction subjected to the quasi-classical regime and the formation of snake states results in periodical backscattering and transmission as magnetic field varies. The conductance oscillation pattern is mediated both by magnetic field and the carrier concentration on bipolar regions. For medium magnetic field between above two regimes, the combined contributions of resonant tunneling, snake states oscillation and Aharanov–Bohm interference induce irregular oscillation of conductance. At very high magnetic field, the system is subjected to quantum Hall regime. Under disorder, the quantum tunneling at low magnetic field is slightly affected and the oscillation of snake states at higher magnetic field is suppressed. In the quantum Hall regime, the conductance is a constant as predicted by the mixture rule.
Maehira, T; Ueda, K; Hasegawa, A
2003-01-01
In order to investigate electronic properties of recently discovered heavy fermion superconductors CeTIn sub 5 (T=Ir and Co), we employ the relativistic linear augmented-plane-wave (RLAPW) method to clarify the energy band structures and Fermi surfaces of those materials. The obtained energy bands mainly due to the large hybridization between Ce 4 f and In 5 p states well reproduce the Fermi surfaces consistent with the de Haas-van Alphen experimental results. However, when we attempt to understand magnetism and superconductively in CeTIn sub 5 from the microscopic viewpoint, the energy bands obtained in the RLAPW method are too complicated to analyze the system by further including electron correlations. Thus, it is necessary to prepare a more simplified model, keeping correctly the essential characters of the energy bands obtained in the band-structure calculation. For the purpose, we construct a tight-binding model for CeTIn sub 5 by including f-f and p-p hoppings as well as f-p hybridization, which are ex...
Two-Step Extraction of the Lower First Molar for Class III Treatment in Adult Patient.
Almeida, Kélei Cristina de Mathias; Paulin, Ricardo Fabris; Raveli, Taísa Barnabé; Raveli, Dirceu Barnabé; Santos-Pinto, Ary
2016-01-01
The aim of this article is to describe a case report of Class III malocclusion treatment with lower first molar extraction. The 27-year-old Caucasian male patient presented a symmetric face with a straight profile, hyperdivergent growth pattern, molar and cuspid Class III relation, and an anterior crossbite as well as a mild crowding on cuspids area, in both upper and lower arches and a tendency to posterior crossbite. The treatment was performed by the use of Haas expansion appliance followed by an initial alignment and leveling of the upper and lower arches with a fixed edgewise appliance, extraction of lower teeth aiming the correction of the incisors proclination and end the treatment with a Class I molar relationship. It resulted in a significant change in the patient's profile, dentoalveolar Class III correction, upper arch expansion, leveling and alignment of the upper and lower arches, and improvement of tipping of the upper and lowers incisors. In cases of a dentoalveolar compensation in well positioned bone bases the treatment with fixed appliances is an alternative and extraction of lower teeth is considered.
Carbon doped InAlAs/InGaAs/InAs heterostructures
Energy Technology Data Exchange (ETDEWEB)
Hirmer, Marika; Bougeard, Dominique; Schuh, Dieter [Institut fuer Experimentelle und Angewandte Physik, Universitaet Regensburg, D 93040 Regensburg (Germany); Wegscheider, Werner [Laboratorium fuer Festkoerperphysik, ETH Zuerich, 8093 Zuerich (Switzerland)
2011-07-01
InAlAs/InGaAs heterostructures with a high In content are promising candidates for spintronic applications such as spin-valve mesoscopic devices due to their large Lande g-factor (around 15 in InAs) and the large Rashba effect. Here, we present results on carbon doped InGaAs/InAlAs heterostructures with embedded InAs channel. We got a two-dimensional hole gas with a hole density of p = 1.06*10{sup 12} cm{sup -2} and a hole mobility of 7.26*10{sup 3} cm{sup 2}/Vs. Magnetotransport measurements on L-shaped Hall bars along [011], [01-1], [010] and [001] crystal directions exhibit well-developed Shubnikov-de-Haas oscillations and quantum Hall plateaus, indicating the high quality of the material. In the field range from minus 6T to 6T the longitudinal resistance is superimposed with a negative parabolic magnetoresistance background. The minimum of the longitudinal resistance at B = 0T decreases with increasing temperature, and hence, is a sign for weak antilocalization.
Aeenehvand, Saeed; Toudehrousta, Zahra; Kamankesh, Marzieh; Mashayekh, Morteza; Tavakoli, Hamid Reza; Mohammadi, Abdorreza
2016-01-01
This study developed an analytical method based on microwave-assisted extraction and dispersive liquid-liquid microextraction followed by high-performance liquid chromatography for the determination of three polar heterocyclic aromatic amines from hamburger patties. Effective parameters controlling the performance of the microextraction process, such as the type and volume of extraction and disperser solvents, microwave time, nature of alkaline aqueous solution, pH and salt amount, were optimized. The calibration graphs were linear in the range of 1-200 ng g(-1), with a coefficient of determination (R(2)) better than 0.9993. The relative standard deviations (RSD) for seven analyses were between 3.2% and 6.5%. The recoveries of those compounds in hamburger patties were from 90% to 105%. Detection limits were between 0.06 and 0.21 ng g(-1). A comparison of the proposed method with the existing literature demonstrates that it is a simple, rapid, highly selective and sensitive, and it gives good enrichment factors and detection limits for determining HAAs in real hamburger patties samples. Copyright © 2015 Elsevier Ltd. All rights reserved.
Spin-orbit coupling in InGaSb/InAlSb and InGaAs/InP 2DEGs
International Nuclear Information System (INIS)
Guzenko, Vitaliy A.; Schaepers, Thomas; Estevez, Sergio; Hardtdegen, Hilde; Akabori, Masashi; Sato, Taku; Suzuki, Toshi-kazu; Yamada, Syoji
2008-01-01
Spin-orbit interaction in high-mobility two-dimensional electron gases (2DEGs) formed in high indium content InGaAs-based and InGaSb-based quantum wells was studied. Magnetotransort measurements were performed at low temperatures in a wide range of magnetic field. Characteristic beating pattern in the Shubnikov-de Haas oscillations as well as the enhancement of magnetoconductance at B=0 T due to weak antilocalization (WAL) effect were observed. A comparison of the values of the Rashba spin-orbit coupling parameters estimated from analysis of the beatings with the ones obtained from the fit of the WAL curves showed a good agreement. A control over the strength of the Rashba coupling parameter in the InGaAs 2DEG was achieved by applying a gate voltage. We found that in particular range of the negative gate voltages no beatings can be observed anymore, whereas the weak antilocalization becomes more pronounced. Under such conditions analysis of the WAL is a reliable method to determine the strength of the spin-orbit interaction in 2DEGs
High-field study of the heavy-fermion material URu{sub 2}Si{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Scheerer, Gernot Werner; Knafo, William; Ballon, Geraldine; Jaudet, Cyril; Proust, Cyril; Vignolles, David [Laboratoire National des Champs Magnetiques Intenses, UPR 3228, CNRS- UJF-UPS-INSA, Toulouse (France); Aoki, Dai; Flouquet, Jacques [Institut Nanosciences et Cryogenie, SPSMS, CEA-Grenoble (France); Mari, Alain [Laboratoire de Chimie de Coordination, Toulouse (France)
2012-07-01
URu{sub 2}Si{sub 2} is known for its ''hidden-order'' state below T{sub 0} = 17.5 K, where the order parameter is still not identified. A magnetic field along the c-axis induces a cascade of low-temperature phase transitions between 35 and 39 T from the ''hidden order'' to a polarized paramagnetic state. We have performed electrical transport and magnetization measurements in pulsed magnetic fields on ultra clean URu{sub 2}Si{sub 2} samples. We established the H-T-phase diagram for H parallel c in extended scales up to 60 T and 60 K. The vanishing of a high-temperature crossover at around 40-50 K, presumably related to intersite electronic correlations, precedes the polarization of the magnetic moments, as well as the destabilization of the ''hidden-order'' phase. Strongly sample-quality dependent magnetoresistivity confirms the Fermi surface reconstructions in a high magnetic field along c and at T{sub 0}. Shubnikov-de Haas quantum oscillations are also presented.
Separation of top and bottom surface conduction in Bi2Te3 thin films
International Nuclear Information System (INIS)
Yu Xinxin; He Liang; Lang Murong; Jiang Wanjun; Kou Xufeng; Tang Jianshi; Huang Guan; Wang, Kang L; Xiu Faxian; Liao Zhiming; Zou Jin; Wang Yong; Zhang Peng
2013-01-01
Quantum spin Hall (QSH) systems are insulating in the bulk with gapless edges or surfaces that are topologically protected and immune to nonmagnetic impurities or geometric perturbations. Although the QSH effect has been realized in the HgTe/CdTe system, it has not been accomplished in normal 3D topological insulators. In this work, we demonstrate a separation of two surface conductions (top/bottom) in epitaxially grown Bi 2 Te 3 thin films through gate dependent Shubnikov–de Haas (SdH) oscillations. By sweeping the gate voltage, only the Fermi level of the top surface is tuned while that of the bottom surface remains unchanged due to strong electric field screening effects arising from the high dielectric constant of Bi 2 Te 3 . In addition, the bulk conduction can be modulated from n- to p-type with a varying gate bias. Our results on the surface control hence pave a way for the realization of QSH effect in topological insulators which requires a selective control of spin transports on the top/bottom surfaces. (paper)
Vorticity generation and evolution in shock-accelerated density-stratified interfaces
International Nuclear Information System (INIS)
Yang, X.; Chern, I.; Zabusky, N.J.; Samtaney, R.; Hawley, J.F.
1992-01-01
The results of direct numerical simulations of inviscid planar shock-accelerated density-stratified interfaces in two dimensions are presented and compared with shock tube experiments of Haas [(private communication, 1988)] and Sturtevant [in Shock Tubes and Waves, edited by H. Gronig (VCH, Berlin, 1987), p. 89] . Heavy-to-light (''slow/fast or s/f) and light-to-heavy (''fast/slow,'' or f/s) gas interfaces are examined and early-time impulsive vorticity deposition and the evolution of coherent vortex structures are emphasized and quantified. The present second-order Godunov scheme yields excellent agreement with shock-polar analyses at early time. A more physical vortex interpretation explains the commonly used (i.e., linear paradigm) designations of ''unstable'' and ''stable'' for the f/s and s/f interfaces, respectively. The later time events are Rayleigh--Taylor like and can be described in terms of the evolution of a vortex layer (large-scale translation and rotation): asymmetric tip vortex ''roll-up'' and ''binding;'' layer ''instability;'' convective mixing; and baroclinic vorticity generation from secondary shock--interface interactions
Energy Technology Data Exchange (ETDEWEB)
Celik, Ozlem; Tiras, Engin; Ardali, Sukru [Department of Physics, Faculty of Science, Anadolu University, Yunus Emre Campus, 26470 Eskisehir (Turkey); Lisesivdin, Sefer Bora [Department of Physics, Faculty of Science and Arts, Gazi University, Teknikokullar, 06500 Ankara (Turkey); Ozbay, Ekmel [Nanotechnology Research Center, Department of Physics, and Department of Electrical and Electronics Engineering, Bilkent University, Ankara (Turkey)
2011-05-15
Magnetoresistance and Hall resistance measurements have been used to investigate the electronic transport properties of AlGaN/GaN based HEMTs. The Shubnikov-de Haas (SdH) oscillations from magnetoresistance, is obtained by fitting the nonoscillatory component to a polynomial of second degree, and then subtracting it from the raw experimental data. It is shown that only first subband is occupied with electrons. The two-dimensional (2D) carrier density and the Fermi energy with respect to subband energy (E{sub F}-E{sub 1}) have been determined from the periods of the SdH oscillations. The in-plane effective mass (m*) and the quantum lifetime ({tau}{sub q}) of electrons have been obtained from the temperature and magnetic field dependencies of the SdH amplitude, respectively. The in-plane effective mass of 2D electrons is in the range between 0.19 m{sub 0} and 0.22 m{sub 0}. Our results for in-plane effective mass are in good agreement with those reported in the literature (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Cooper Pair Writing at the LaAlO3/ SrTiO 3 Interface
Cen, Cheng; Bogorin, Daniela F.; Bark, Chung Wung; Folkman, Chad M.; Eom, Chang-Beom; Levy, Jeremy
2011-03-01
Superconducting semiconductors offer unique ways to exert electrostatic control over macroscopic quantum phases. The recently demonstrated nanoscale control over conductivity at the LaAl O3 / SrTi O3 interface raises the question of whether nanoscale control over superconducting phases can be realized. Here we report low-temperature magnetotransport experiments on structures defined with nanoscale precision at the LaAl O3 / SrTi O3 interface. A quantum phase transition is observed that is associated with the formation of Cooper pairs, but a finite resistance is observed at the lowest temperatures. Higher mobility interfaces exhibit larger Ginsburg-Landau coherence lengths, a stronger suppression of pairing by magnetic field as well as Shubnikov-de Haas oscillations. Cooper pair localization, spin-orbit coupling, and finite-size effects may factor into an explanation for some of the unusual properties observed. The work is supported by Department of Energy and State of Florida, NSF (DMR-0906443 and DMR-0704022), DOE (DE-FG02-06ER46327) and the Fine Foundation.
Selective separation of indium by iminodiacetic acid chelating resin
International Nuclear Information System (INIS)
Fortes, M.C.B.; Benedetto, J.S.; Martins, A.H.
2007-01-01
- Indium can be recovered by treating residues, flue dusts, slags, and metallic intermediates in zinc smelting. This paper investigates the adsorption characteristics of indium and iron on an iminodiacetic acid chelating resin, Amberlite R IRC748 (Rohm and Haas Co.-USA). High concentrations of iron are always present in the aqueous feed solution of indium recovery. In addition, the chemical behaviour of iron in adsorptive systems is similar to that of indium. The metal concentrations in the aqueous solution were based on typical indium sulfate leach liquor obtained from zinc hydrometallurgical processing in a Brazilian plant. The ionic adsorption experiments were carried out by the continuous column method. Amberlite R IRC748 resin had a high affinity for indium under acidic conditions. Indium ions adsorbed onto the polymeric resin were eluted with a 0.5 mol/dm 3 sulphuric acid solution passed through the resin bed in the column. 99.5% pure indium sulfate aqueous solution was obtained using the iminodiacetic acid chelating resin Amberlite R IRC748. (author)
Urkude, Rajashri; Rawat, Rajeev; Palikundwar, Umesh
2018-04-01
In 3D topological insulators, achieving a genuine bulk-insulating state is an important topic of research. The material system (Bi,Sb)2(Te,Se)3 has been proposed as a topological insulator with high resistivity and low carrier concentration. Topological insulators are predicted to present interesting surface transport phenomena but their experimental studies have been hindered by metallic bulk conduction that overwhelms the surface transport. Here we present a study of the bulk-insulating properties of (Bi0.3Sb0.7)2Te3. We show that a high resistivity exceeding 1 Ωm as a result of variable-range hopping behavior of state and Shubnikov-de Haas oscillations as coming from the topological surface state. We have been able to clarify both the bulk and surface transport channels, establishing a comprehensive understanding of the transport properties in this material. Our results demonstrate that (Bi0.3Sb0.7)2Te3 is a good material for studying the surface quantum transport in a topological insulator.
Killing rate of colony count by hydrodynamic cavitation due to square multi-orifice plates
Dong, Zhiyong; Zhao, Wenqian
2018-02-01
Currently,in water supply engineering, the conventional technique of disinfection by chlorination is employed to kill pathogenic microorganisms in raw water. However, chlorine reacts with organic compounds in water and generates disinfection byproducts (DBPs), such as trihalomethanes (THMs), haloacetic acids (HAAs) etc. These byproducts are of carcinogenic, teratogenic and mutagenic effects, which seriously threaten human health. Hydrodynamic cavitation is a novel technique of drinking water disinfection without DBPs. Effects of orifice size, orifice number and orifice layout of multi-orifice plate, cavitation number, cavitation time and orifice velocity on killing pathogenic microorganisms by cavitation were investigated experimentally in a self-developed square multi-orifice plate-type hydrodynamic cavitation device. The experimental results showed that cavitation effects increased with decrease in orifice size and increase in orifice number, cavitation time and orifice velocity. Along with lowering in cavitation number, there was an increase in Reynolds shear stress,thus enhancing the killing rate of pathogenic microorganism in raw water. In addition, the killing rate by staggered orifice layout was greater than that by checkerboard-type orifice layout.
Magnetic thaw-down and boil-off due to magneto acceptors in 2DEG
International Nuclear Information System (INIS)
Chaubet, C.; Raymond, A.; Bisotto, I.; Harmand, J. C.; Kubisa, M.; Zawadzki, W.
2013-01-01
The Quantum Hall Effect (QHE) and Shubnikov-de Haas effect are investigated experimentally using n type modulation-doped GaAs/GaAlAs quantum wells (QWs) additionally doped in the well with beryllium acceptor atoms. It is presently shown that the localized magneto-acceptor (MA) states which possess discrete energies above the corresponding Landau levels (LLs) lead to two observable effects in magneto-transport: magnetic thaw-down and magnetic boil-off of 2D electrons. Both effects are related to the fact that electrons occupying the localized MA states cannot conduct. Thus in the thaw-down effect the electrons fall down from the MA states to the free Landau states. This leads to a shift of the Hall plateau towards higher magnetic fields as a consequence of an increase of the 2D electron density N S . In the boil-off effect the electrons are pushed from the free Landau states to the empty MA states under high enough Hall electric field. This process has an avalanche character leading to a dramatic increase of magneto-resistance, consequence of a decrease of N S
Use of weathered diesel oil as a low-cost raw material for biosurfactant production
Directory of Open Access Journals (Sweden)
A. P. Mariano
2008-06-01
Full Text Available This work aimed to investigate the capability of biosurfactant production by Staphylococcus hominis, Kocuria palustris and Pseudomonas aeruginosa LBI, using weathered diesel oil from a long-standing spillage as raw material. The effect of the culture media (Robert or Bushnell-Haas and of the carbon source (spilled diesel oil or commercial diesel oil on biosurfactant production was evaluated. Erlenmeyer flasks (250 mL containing the cell broth were agitated (240 rpm for 144 h at 27±2ºC. Biosurfactant production was monitored according to the De Nöuy ring method using a Krüss K6 tensiometer. Considering the possibility of intracellular storage of biosurfactant in the cell wall of the cultures S. hominis and K. palustris, experiments were also done applying ultrasound as a way to rupture the cells. For the conditions studied, the cultures did not indicate production of biosurfactants. Results obtained with a hydrocarbon biodegradability test based on the redox indicator 2,6-dichlorophenol indophenol showed that only the commercial diesel was biodegraded by the cultures.
Majorana zero modes in Dirac semimetal Josephson junctions
Li, Chuan; de Boer, Jorrit; de Ronde, Bob; Huang, Yingkai; Golden, Mark; Brinkman, Alexander
We have realized proximity-induced superconductivity in a Dirac semimetal and revealed the topological nature of the superconductivity by the observation of Majorana zero modes. As a Dirac semimetal, Bi0.97Sb0.03 is used, where a three-dimensional Dirac cone exists in the bulk due to an accidental touching between conduction and valence bands. Electronic transport measurements on Hall-bars fabricated out of Bi0.97Sb0.03 flakes consistently show negative magnetoresistance for magnetic fields parallel to the current, which is associated with the chiral anomaly. In perpendicular magnetic fields, we see Shubnikov-de Haas oscillations that indicate very low carrier densities. The low Fermi energy and protection against backscattering in our Dirac semimetal Josephson junctions provide favorable conditions for a large contribution of Majorana zero modes to the supercurrent. In radiofrequency irradiation experiments, we indeed observe these Majorana zero modes in Nb-Bi0.97Sb0.03-Nb Josephson junctions as a 4 π periodic contribution to the current-phase relation.
Energy Technology Data Exchange (ETDEWEB)
Poirier, W.
1997-11-07
The aim of this thesis is to study the coherent transport in semiconducting-superconducting junctions. The SnPb-GaAs system has been studied. It has been shown that the behaviour of this junction is controlled by the disordered area induced by the annealing of the connection near the interface. For a few resistant junction, a conductance anomaly under the gap has been observed and has been explained by a mesoscopic effect in the limit of the very high disorders. The conductance of more resistant junctions has only been bound to the properties of the very disordered area of the semiconductor. The part of the electron-electron interactions on the phase coherence length and on the conductance has been studied. The evolving of the correction of the conductance due to interactions in magnetic field has been followed. The effect of the spin degeneration suppression in CdTe and the GaAs sign inversion in Shubnikov de Haas oscillations rate has been observed. At last has been studied the transport properties of the quasi-unidimensional disordered insulators. (O.M.) 116 refs.
High magnetic field observation of the resonance donor states of S in InSb
International Nuclear Information System (INIS)
Porowski, S.; Konczewicz, L.; Kowalski, J.
1981-01-01
Electrical transport measurements in InSb heavily doped with sulfur (n approximately 5x10 18 cm -3 ) are performed. At T = 4.2 K the Hall coefficient and transverse magnetoresistivity are measured as a function of pressure up to 2100 MPa and magnetic field up to 18 T. At the highest pressure, a decrease of the frequency and a decrease of the damping of Shubnikov-de Haas oscillations are observed. These effects are explained as a result of the transfer of electrons from the conduction band to the resonance states of sulfur. At atmospheric pressure these states are 0.55 eV above the bottom of conduction band. In the lower pressure range, the experimental dependence of the effective Dingle temperature T*sub(D) = Tsub(D) + Tsub(i) can be explained by the model in which the scattering by ionized impurities and short-range potentials are taken into account. At the highest pressures a change of inhomogeneity of carrier concentration due to the transfer of electrons to the resonance states has to be considered. (author)
Hemofilia A adquirida Acquired hemophilia A
Directory of Open Access Journals (Sweden)
Delfina Almagro Vázquez
2010-12-01
Full Text Available La hemofilia A adquirida (HAA es un trastorno hemorrágico poco frecuente caracterizado por la presencia de autoanticuerpos contra el factor VIII (FVIII circulante. Aproximadamente en la mitad de los casos se ha observado un grupo heterogéneo de procesos patológicos que incluyen, entre otros, enfermedades autoinmunes y malignas y durante el embarazo, parto y puerperio. Las manifestaciones hemorrágicas son variables y fundamentalmente de tipo cutáneo mucoso. El diagnóstico se basa en el hallazgo en un paciente con manifestaciones hemorrágicas, prolongación del tiempo parcial de tromboplastina activado (TPTA, disminución de la actividad del FVIII y presencia de inhibidores del FVIII. El tratamiento de HAA incluye el control de las manifestaciones hemorrágicas y la supresión de la producción del anticuerpo. El concentrado de factor VIIa recombinante (FVIIar y el concentrado de complejo protrombínico (CCPA se consideran el tratamiento antihemorrágico de primera línea. Como terapéutica alternativa, en algunos casos puede utilizarse el concentrado de FVIII, la plasmaféresis y la inmunoadsorción extracorpórea. La prednisona sola o asociada con la ciclofosfamida, constituye el tratamiento inmunosupresor de primera línea. En pacientes refractarios puede administrarse como terapéutica de segunda línea, el rituximab (anti-CD20. Con la azatiopina, la ciclosporina, la vincristina y el micofenolato de mofetil, se han obtenido resultados variables.Acquired hemophilia A (AHA is an uncommon hemorrhagic disorder characterized by presence of autoantibodies to circulating factor VIII. Approximately in half of cases it is noted a heterogeneous group of pathological processes including among others, autoimmune and malignant diseases and during pregnancy, labor and puerperium. Hemorrhagic manifestations are variable and mainly of mucous cutaneous type. Diagnosis is based on the finding of a patient presenting with hemorrhagic manifestations
Isıl İşlem Uygulanmış Et ve Et Ürünlerinde Heterosiklik Aromatik Aminler
Directory of Open Access Journals (Sweden)
Fatih Öz
2015-02-01
Full Text Available 1977 yılında Japon bilim adamları, kızartılmış et ve balık ürünlerinden Heterosiklik Aromatik Amin (HAA olarak sınıflandırdıkları yüksek oranda toksik yeni bir grup bilesikler belirlemişlerdir. HAA’ler balık ve et gibi protein bakımından zengin gıdaların 150 °C’nin üzerindeki sıcaklıklarda pişirilmesi esnasında oluşan mutajenik ve/veya kanserojenik bileşiklerdir. Bu bileşikler aminoasitler ve karbonhidratlar ile kreatin veya kreatininin reaksiyon ürünleridir. Bu çalışmada HAA’lerin oluşumu, prekürsörleri, oluşum seviyelerinin azaltılması ve analiz metotları ile ilgili araştırmalar derlenmiştir. Gıda mutajenleri ile karşılaştırıldığında HAA’lerin aflatoksin B1 den 100 kat, benzo[a]pyrene den ise 2000 kat daha fazla mutajenik oldukları belirtilmiştir. Güçlü mutajen olan bu bileşikleri içeren gıdaların birçok ülkede yaygın olarak tüketilmesi ve epidemiyolojik çalışmaların bu tür gıdaları fazlaca tüketen ülkelerde kanser oranının çok daha yüksek olduğunu belirtmesinden dolayı konu dünya çapında büyük öneme sahiptir. Günümüze kadar, gıdalardan ve model sistemlerden 25’i aşkın HAA izole edilmiştir. HAA’ler genelde ısıl işlem uygulanmış et ve et ürünlerinde bulunurlar. HAA’lerin konsantrasyonları ısıl işlem gören ürünün tipi, pişirme sıcaklığı ve süresi, pişirme ekipman ve metodu, pH ve su aktivitesi gibi fiziksel faktörler ile karbonhidratlar, serbest aminoasitler ve kreatin gibi kimyasal faktörlere bağlıdır. Ayrıca, ısı ve kütle transferi, yağlar, yağ oksidasyonu ve antioksidanların HAA’lerin konsantrasyonuna etki ettiği saptanmıştır.
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-03-15
As a preliminary action ahead of Stage 2 in the Sectoral Plan 'Deep Geological Disposal' ('Sachplan Geologische Tiefenlager': SGT) the bodies in charge of the management of the radioactive wastes have to determine, together with the Swiss Federal Nuclear Safety Inspectorate (ENSI), which complementary investigations are needed for the provisional safety assessment of the foreseen repositories. In particular, comparisons between the different sites must be possible. If some doubts remain, new investigations have to be conducted. In SGT Stage 1 the National Cooperative for the Disposal of Radioactive Waste (NAGRA) stated that a time period of 100'000 years shall be considered for the storage of low- and intermediate-level radioactive wastes (SMA) and of 1 million years for the storage of high-level wastes (HAA). In SGT Stage 2, considerations about possible modifications of the biosphere during the considered time periods for SMA as well as for HAA have to be included. In what regards the host rock, ENSI declares that the dataset describing the Opalinus clay is sufficient for the site-specific safety analyses. What regards the Wellenberg site for a SMA repository, ENSI has earlier analysed the license request of the NAGRA. For the Mergel formations of the Helveticum, NAGRA conducted a complete safety analysis. ENSI considers the knowledge acquired for these rock types as sufficient for the technical safety comparisons in SGT Stage 2. The knowledge of the rock 'Brauner Dogger' is correct but some more information about the lithostratigraphy and the biostratigraphy is requested. The understanding of the effect of the rock density reduction on the hydraulic conductibility of Opalinus clay and Mergel formations is accurate enough for the comparisons in SGT Stage 2. For the 'Brauner Dogger', comparable data are missing, but the proposed thickness of 300 m of the host rock offers a sufficient protection against density reduction
International Nuclear Information System (INIS)
2011-03-01
As a preliminary action ahead of Stage 2 in the Sectoral Plan 'Deep Geological Disposal' ('Sachplan Geologische Tiefenlager': SGT) the bodies in charge of the management of the radioactive wastes have to determine, together with the Swiss Federal Nuclear Safety Inspectorate (ENSI), which complementary investigations are needed for the provisional safety assessment of the foreseen repositories. In particular, comparisons between the different sites must be possible. If some doubts remain, new investigations have to be conducted. In SGT Stage 1 the National Cooperative for the Disposal of Radioactive Waste (NAGRA) stated that a time period of 100'000 years shall be considered for the storage of low- and intermediate-level radioactive wastes (SMA) and of 1 million years for the storage of high-level wastes (HAA). In SGT Stage 2, considerations about possible modifications of the biosphere during the considered time periods for SMA as well as for HAA have to be included. In what regards the host rock, ENSI declares that the dataset describing the Opalinus clay is sufficient for the site-specific safety analyses. What regards the Wellenberg site for a SMA repository, ENSI has earlier analysed the license request of the NAGRA. For the Mergel formations of the Helveticum, NAGRA conducted a complete safety analysis. ENSI considers the knowledge acquired for these rock types as sufficient for the technical safety comparisons in SGT Stage 2. The knowledge of the rock 'Brauner Dogger' is correct but some more information about the lithostratigraphy and the biostratigraphy is requested. The understanding of the effect of the rock density reduction on the hydraulic conductibility of Opalinus clay and Mergel formations is accurate enough for the comparisons in SGT Stage 2. For the 'Brauner Dogger', comparable data are missing, but the proposed thickness of 300 m of the host rock offers a sufficient protection against density reduction effects. Concerning the behaviour of the
Rules for Phase Shifts of Quantum Oscillations in Topological Nodal-Line Semimetals
Li, Cequn; Wang, C. M.; Wan, Bo; Wan, Xiangang; Lu, Hai-Zhou; Xie, X. C.
2018-04-01
Nodal-line semimetals are topological semimetals in which band touchings form nodal lines or rings. Around a loop that encloses a nodal line, an electron can accumulate a nontrivial π Berry phase, so the phase shift in the Shubnikov-de Haas (SdH) oscillation may give a transport signature for the nodal-line semimetals. However, different experiments have reported contradictory phase shifts, in particular, in the WHM nodal-line semimetals (W =Zr /Hf , H =Si /Ge , M =S /Se /Te ). For a generic model of nodal-line semimetals, we present a systematic calculation for the SdH oscillation of resistivity under a magnetic field normal to the nodal-line plane. From the analytical result of the resistivity, we extract general rules to determine the phase shifts for arbitrary cases and apply them to ZrSiS and Cu3 PdN systems. Depending on the magnetic field directions, carrier types, and cross sections of the Fermi surface, the phase shift shows rich results, quite different from those for normal electrons and Weyl fermions. Our results may help explore transport signatures of topological nodal-line semimetals and can be generalized to other topological phases of matter.
Arnold, F.; Naumann, M.; Lühmann, Th.; Mackenzie, A. P.; Hassinger, E.
2018-02-01
Torque magnetometry is a key method to measure the magnetic anisotropy and quantum oscillations in metals. In order to resolve quantum oscillations in sub-millimeter sized samples, piezo-electric micro-cantilevers were introduced. In the case of strongly correlated metals with large Fermi surfaces and high cyclotron masses, magnetic torque resolving powers in excess of 104 are required at temperatures well below 1 K and magnetic fields beyond 10 T. Here, we present a new broadband read-out scheme for piezo-electric micro-cantilevers via Wheatstone-type resistance measurements in magnetic fields up to 15 T and temperatures down to 200 mK. By using a two-stage superconducting-quantum interference device as a null detector of a cold Wheatstone bridge, we were able to achieve a magnetic moment resolution of Δm = 4 × 10-15 J/T at maximal field and 700 mK, outperforming conventional magnetometers by at least one order of magnitude in this temperature and magnetic field range. Exemplary de Haas-van Alphen measurement of a newly grown delafossite, PdRhO2, was used to show the superior performance of our setup.
STUDIES ON THE FORMATION AND IONIZATION OF THE COMPOUNDS OF CASEIN WITH ALKALI
Greenberg, David M.; Schmidt, Carl L. A.
1924-01-01
1. The deposition of casein on a platinum anode which takes place on the passage of a direct current through solutions of alkali caseinates was quantitatively studied, and it was found that: (a) the amount of casein which is deposited is directly proportional to the current, i.e. it obeys Faraday's law; (b) the amount of casein deposited is inversely proportional (within the limits studied) to the amount of alkali which is combined with the casein. 2. A method of determining the transport numbers of proteins insoluble at their isoelectric point has been developed. 3. A titration method for determining the amount of alkali in a casein solution is given. 4. Data from the results of transference experiments on sodium caseinate, potassium caseinate, cesium caseinate, and rubidium caseinate solutions are given. It is shown that the data are best explained on the assumption that in these solutions the carriers of the current are alkali metal cations and casein anions. 5. On the basis of our transference results an explanation is given of the results which were obtained by Robertson and by Haas in their migration experiments. PMID:19872135
Large magnetoresistance and Fermi surface study of Sb2Se2Te single crystal
Shrestha, K.; Marinova, V.; Graf, D.; Lorenz, B.; Chu, C. W.
2017-09-01
We have studied the magnetotransport properties of a Sb2Se2Te single crystal. Magnetoresistance (MR) is maximum when the magnetic field is perpendicular to the sample surface and reaches a value of 1100% at B = 31 T with no sign of saturation. MR shows Shubnikov de Haas (SdH) oscillations above B = 15 T. The frequency spectrum of SdH oscillations consists of three distinct peaks at α = 32 T, β = 80 T, and γ = 117 T indicating the presence of three Fermi surface pockets. Among these frequencies, β is the prominent peak in the frequency spectrum of SdH oscillations measured at different tilt angles of the sample with respect to the magnetic field. From the angle dependence β and Berry phase calculations, we have confirmed the trivial topology of the β-pocket. The cyclotron masses of charge carriers, obtained by using the Lifshitz-Kosevich formula, are found to be mβ*=0.16mo and m γ*=0.63 mo for the β and γ bands, respectively. The Large MR of Sb2Se2Te is suitable for utilization in electronic instruments such as computer hard discs, high field magnetic sensors, and memory devices.
International Nuclear Information System (INIS)
Aoki, H.; Crabtree, G.; Joss, W.; Hulliger, F.
1985-01-01
A Fermi surface study of the ferromagnetic phase of CeSb is presented. The γ frequency branches arising from the electron surfaces at the X points, three separate frequency branches from the hole surfaces at the GAMMA point, and the low-frequency branch α have been observed. The effective mass ratios are low and range from approx.0.2 for the α branch to approx.1.0 for the high-frequency branch of γ. The low effective mass ratios suggest that the admixture of the conduction states with the f state is small. We have observed a drastic change in the appearance of the de Haas--van Alpen signal at the phase transition between the ferromagnetic and lower field antiferromagnetic phases: the low-frequency α oscillation suddenly disappears as the crystal enters the antiferromagnetic phase. By utilizing the change in the signal appearance, the transition field strength has been measured as a function of the field direction. The present experimental results particularly the origin of the α oscillation, are discussed in the light of the p-f mixing theory and recent band-structure calculations based on localized f orbitals
International Nuclear Information System (INIS)
Webb, James B.; Tang, H.; Bardwell, J. A.; Coleridge, P.
2001-01-01
Ammonia molecular-beam epitaxy has been used to grow high-quality epilayers of GaN and AlGaN/GaN heterostructure field-effect transistor (HFET) structures on insulating 4H-SiC. The growth process, which used a magnetron sputter epitaxy deposited buffer layer of AlN, has been described previously. Ex situ pretreatment of the SiC substrate was found to be unnecessary. For a single 2.0 μm thick silicon doped epilayer, a room temperature (RT) electron mobility of 500 cm2/Vs was measured at a carrier density of 6.6x10 16 cm -3 . For the HFET structure, a room temperature mobility of 1300 cm2/Vs at a sheet carrier density of 3.3x10 12 cm -2 was observed, increasing to 11000 cm2/Vs at 77 K. The surface morphology of the layers indicated a coalesced mesa structure similar to what we observed for growth on sapphire, but with a lower overall defect density and correspondingly larger grain size. The observation of well-resolved Shubnikov de Haas oscillations at fields as low as 3 T indicated a relatively smooth interface. [copyright] 2001 American Institute of Physics
Directory of Open Access Journals (Sweden)
Ellen Cristina Souza
Full Text Available ABSTRACT To select the best biosurfactant producer, Pseudomonas putida, Bacillus megatherium, Bacillus licheniformis and Bacillus subtilis were cultured in flasks on media with different salinity [low salinity (LS, Bushnell-Haas (BH and artificial sea water (SW media] supplemented or not with toluene as a model pollutant. Toluene inhibited the growth of all microorganisms and stimulated the biosurfactant production. B. subtilis exhibited the best performance, being able to lower the surface tension (ST in the LS medium to 65.5 mN/min in the absence of toluene, and to 46.5 mN/min in the BH medium in the presence of toluene, corresponding to ST reductions of 13.0 and 27.5 mN/m, respectively. Scaling up the process to a bench-scale fermentor, the best results were obtained in the LS medium, where B. subtilis was able to reduce the toluene concentration from 26.0 to 4.3 g/L within 12 h and ST by 17.2 mN/m within 18 h. The results of this study point out that B. subtilis is an interesting biosurfactant producer, which could be used in the bioremediation of toluene-contaminated water.
Study of two-dimensional hole gas at Si/SiGe/Si inverted interface
International Nuclear Information System (INIS)
Sadeghazdeh, M.A.; Mironov, O.A.; Parry, C.P.; Philips, P.J.; Parker, E.H.C.; Wahll, T.E.; Emeleus, C.J.
1998-01-01
We have studied the transport of two-dimensional hole gas (2DHG) at the inverted interface of a strained Si 0.8 Ge 0.2 quantum well. By application of bias voltage to a Schottky gate on top of this inverted heterostructure the 2DHG density n s can be controlled, in the range of (1.5-5.2)x10 11 cm -2 . At temperature T = 033 K, the Hall mobility is 4650 cm 2 V -1 s -1 at the maximum carrier density. For lower sheet densities (n s 11 cm -2 ) the system undergoes a transition from a weak to strongly localised phase of significantly reduced mobility. From low temperature Shubnikov-de Haas oscillation measurements we have extracted the hole effective masses m* = (0.25 → 0.28)m o and the ratio of transport to quantum lifetimes α = (0.92 → 0.85) for the corresponding carrier density change of n s = (5.2 → 2.5)x10 11 cm -2 . These results can be explained in terms of the abnormal movement of the hole wave function towards the interface with decreasing n s , short range interface roughness scattering. (author)
Mawrie, Alestin; Verma, Sonu; Ghosh, Tarun Kanti
2017-09-01
We investigate effect of k-cubic spin-orbit interaction on electrical and thermoelectric transport properties of two-dimensional fermionic systems. We obtain exact analytical expressions of the inverse relaxation time (IRT) and the Drude conductivity for long-range Coulomb and short-range delta scattering potentials. The IRT reveals that the scattering is completely suppressed along the three directions θ = (2n+1)π/3 with n=1,2,3. We also obtain analytical results of the thermopower and thermal conductivity at low temperature. The thermoelectric transport coefficients obey the Wiedemann-Franz law, even in the presence of k-cubic Rashba spin-orbit interaction (RSOI) at low temperature. In the presence of quantizing magnetic field, the signature of the RSOI is revealed through the appearance of the beating pattern in the Shubnikov-de Haas (SdH) oscillations of thermopower and thermal conductivity in low magnetic field regime. The empirical formulae for the SdH oscillation frequencies accurately describe the locations of the beating nodes. The beating pattern in magnetothermoelectric measurement can be used to extract the spin-orbit coupling constant. © 2017 IOP Publishing Ltd.
Mawrie, Alestin; Verma, Sonu; Kanti Ghosh, Tarun
2017-11-01
We investigate the effect of k-cubic spin-orbit interaction on the electrical and thermoelectric transport properties of two-dimensional fermionic systems. We obtain exact analytical expressions of the inverse relaxation time (IRT) and the Drude conductivity for long-range Coulomb and short-range delta scattering potentials. The IRT reveals that the scattering is completely suppressed along the three directions θ^\\prime = (2n+1)π/3 with n=1, 2, 3 . We also obtain analytical results of the thermopower and thermal conductivity at low temperature. The thermoelectric transport coefficients obey the Wiedemann-Franz law, even in the presence of k-cubic Rashba spin-orbit interaction (RSOI) at low temperature. In the presence of a quantizing magnetic field, the signature of the RSOI is revealed through the appearance of the beating pattern in the Shubnikov-de Haas (SdH) oscillations of thermopower and thermal conductivity in the low magnetic field regime. The empirical formulae for the SdH oscillation frequencies accurately describe the locations of the beating nodes. The beating pattern in magnetothermoelectric measurement can be used to extract the spin-orbit coupling constant.
Evolution of subband structure with gate-tuning at LaAlO3/SrTiO3 interfaces
Tang, Lucas; Smink, Sander; van Heeringen, Linde; Geessinck, Jaap; Rana, Abimanuya; Rastogi, Ankur; Maan, Jan Kees; Brinkman, Alexander; Zeitler, Uli; Hilgenkamp, Hans; McCollam, Alix
The outstanding characteristic of LaAlO3/SrTiO3 heterostructures is the formation of a high mobility 2D electron gas (2DEG) at the interface. The additional presence of superconductivity, magnetism and large spin-orbit coupling in these systems suggests that strong correlations play an important role in the electronic properties, in contrast to conventional semiconductor-based 2DEGs. Knowledge of the electronic bandstructure, and the interdependence of conduction electron density and properties is therefore essential for our understanding of these materials. We present new results of low temperature transport measurements in a high mobility LaAlO3/SrTiO3-based heterostructure, in magnetic fields up to 33 T. Shubnikov de-Haas oscillations are observed, revealing several subbands with different carrier densities. By application of an electric field in the back gate geometry, the Fermi level is tuned and thus we are able to map the smooth evolution of the subbands and their properties with carrier density. These results are in good agreement with recent theoretical work, such that we can disentangle the complex band structure, and quantify aspects such as Rashba spin-splitting and the mixing of orbital character.
Health promotion in South East Asia.
Mir, N S
1998-01-01
The countries of the South East Asia region, which includes Bangladesh, Bhutan, Pakistan, Korea, India, Indonesia, Maldives, Myanmar, Nepal, Sri Lanka, and Thailand, have undertaken a variety of strategies to address the health challenges in the region. The ever-growing pressure of population in the region has allowed rapid transmission of communicable diseases like malaria, tuberculosis (TB), leprosy, and HIV/AIDS. One of the innovative community-based health initiatives in response to this problem is Indonesia's Primary Health Care Project. This project aimed to develop a sustainable health infrastructure by training medical staff, coordinators, village cadres, midwives and those working for TB programs; provision of ongoing guidance and education in this area; and provision of medicines and funds. The project has pioneered a process towards positive changes. Another strategy is the collaboration of youth groups, island development committees, and health workers in Maldives which has led to the declaration of two islands (Madifushi and Haa Alif Berinmadhoo) as 'no smoking' islands. In addition, Sarvodaya has successfully developed a methodology to involve Buddhist monks in AIDS prevention and control through "the Buddhist approach to AIDS prevention in Sri Lanka."
Destruction of organic materials by pressurized microwave digestion
Energy Technology Data Exchange (ETDEWEB)
Schramel, P. (GSF - Research Center for Environment and Health, Inst. of Ecological Chemistry, Neuherberg (Germany)); Hasse, S. (GSF - Research Center for Environment and Health, Inst. of Ecological Chemistry, Neuherberg (Germany))
This paper describes the utility of pressurized microwave digestion (up to 85 bar) for a broad spectrum of organic materials (blood, urine, milk powder, tissues). The 'quality' of the sample solution was tested by the determination of Pb, Cd and Cu (additionally Ni and Co in some of the matrices) by anodic stripping voltammetry (DPASV) and Hydride Generation AAS (HAAS) for As. It is clearly shown that no universal 'cooking recipe' can be given. The necessary oxidation potential is very dependent on the type of organic matrix and therefore the use of acid combinations (HNO[sub 3]/HClO[sub 4]/H[sub 2]SO[sub 4]) is generally necessary to obtain adequate solution of the sample. In some cases the power of the microwave oven was not high enough to digest two samples simultaneoulsy. (Significant differences in the ease of solution are shown in the digestion of one or two samples). Some important improvements for sample preparation, such as moistening the powdered material with water and mixing well with the acid used before closing the digestion vessel etc., are also given. (orig.)
International Nuclear Information System (INIS)
Kulbachinskii, V. A.; Oveshnikov, L. N.; Lunin, R. A.; Yuzeeva, N. A.; Galiev, G. B.; Klimov, E. A.; Maltsev, P. P.
2015-01-01
HEMT structures with In 0.53 Ga 0.47 As quantum well are synthesized using molecular-beam epitaxy on InP substrates. The structures are double-side Si δ-doped so that two dimensionally-quantized subbands are occupied. The effect of the central InAs nanoinsert in the quantum well on the electron effective masses m* and mobilities in each subband is studied. For experimental determination of m*, the quantum μ q and transport μ t mobilities of the two-dimensional electron gas in each dimensionally-quantized subband, the Shubnikov-de Haas effect is measured at two temperatures of 4.2 and 8.4 K. The electron effective masses are determined by the temperature dependence of the oscillation amplitudes, separating the oscillations of each dimensionally-quantized subband. The Fourier spectra of oscillations are used to determine the electron mobilities μ q and μ t in each dimensionally-quantized subband. It is shown that m* decreases as the InAs-nanoinsert thickness d in the In 0.53 Ga 0.47 As quantum well and electron mobilities increase. The maximum electron mobility is observed at the insert thickness d = 3.4 nm
Magnetic thaw-down and boil-off due to magneto acceptors in 2DEG
Energy Technology Data Exchange (ETDEWEB)
Chaubet, C.; Raymond, A. [L2C UMR 5221, CNRS-Université Montpellier 2, Place E. Bataillon, 34090 Montpellier cedex 05 (France); Bisotto, I. [LNCMI, UPR 3228, CNRS-INSA-UJF-UPS, BP166, 38042 Grenoble, Cedex 9 (France); Harmand, J. C. [LPN, CNRS, route de Nozay, 91460 Marcoussis (France); Kubisa, M. [Institute of Physics, Wroclaw University of Technology, 50-370 Wroclaw (Poland); Zawadzki, W. [Institute of Physics, Polish Academy of Sciences, 02668 Warsaw (Poland)
2013-12-04
The Quantum Hall Effect (QHE) and Shubnikov-de Haas effect are investigated experimentally using n type modulation-doped GaAs/GaAlAs quantum wells (QWs) additionally doped in the well with beryllium acceptor atoms. It is presently shown that the localized magneto-acceptor (MA) states which possess discrete energies above the corresponding Landau levels (LLs) lead to two observable effects in magneto-transport: magnetic thaw-down and magnetic boil-off of 2D electrons. Both effects are related to the fact that electrons occupying the localized MA states cannot conduct. Thus in the thaw-down effect the electrons fall down from the MA states to the free Landau states. This leads to a shift of the Hall plateau towards higher magnetic fields as a consequence of an increase of the 2D electron density N{sub S}. In the boil-off effect the electrons are pushed from the free Landau states to the empty MA states under high enough Hall electric field. This process has an avalanche character leading to a dramatic increase of magneto-resistance, consequence of a decrease of N{sub S}.
Pfeifer, A; Neumann, H G
1986-09-01
trans-4-Acetylaminostilbene (trans-AAS) is acutely toxic in rats and lesions are produced specifically in the glandular stomach. Toxicity is slightly increased by pretreating the animals with phenobarbital (PB) and is completely prevented by pretreatment with methylcholanthrene (MC). The prostaglandin inhibitors, indomethacin and acetyl salicylic acid, do not reduce toxicity. The high efficiency of MC suggested that toxicity is caused by reactive metabolites. trans-[3H]-AAS was administered orally to untreated and to PB- or MC-pretreated female Wistar rats and target doses in different tissues were measured by means of covalent binding to proteins, RNA and DNA. Macromolecular binding in the target tissue of poisoned animals was significantly lower than in liver and kidney and comparable to other non-target tissues. Pretreatment with MC lowered macromolecular binding in all extrahepatic tissues but not in liver. These findings are not in line with tissue specific metabolic activation. The only unique property of the target tissue, glandular stomach, that we observed was a particular affinity for the systemically available parent compound. In the early phase of poisoning, tissue concentrations were exceedingly high and the stomach function was impaired.
Scattering times in the two-dimensional electron gas of AlxGa1-xN/AlN/GaN heterostructures
International Nuclear Information System (INIS)
Han Xiuxun; Honda, Yoshio; Narita, Tetsuo; Yamaguchi, Masahito; Sawaki, Nobuhiko; Tanaka, Tooru; Guo Qixin; Nishio, Mitsushiro
2009-01-01
Low-field Hall and Shubnikov-de Haas (SdH) measurements were performed on two-dimensional electron gas of Al 0.24 Ga 0.76 N/GaN and Al 0.24 Ga 0.76 N/AlN/GaN heterostructures at a low temperature. A dramatic improvement in electron mobility is observed in Al 0.24 Ga 0.76 N/AlN/GaN heterostructures with 1 and 2 nm thick AlN interlayers. A further increase in the AlN thickness degrades the transport behaviour. Transport and quantum scattering times were derived from the corresponding Hall mobility and the oscillatory part of the SdH signal. The ratio of the transport scattering time and the quantum scattering time increases from 3.87 in the heterostructure without the AlN interlayer to 14.34 with the 1 nm AlN interlayer and to 12.45 with the 2 nm AlN interlayer. A modified scattering calculation due to charged dislocation with a finite length suggests that dislocation related long-range scattering event tends to dominate both transport and quantum scattering times when a thin AlN interlayer is introduced.
Patel, Vilas; Jain, Siddharth; Madamwar, Datta
2012-03-01
Naphthalene degrading bacterial consortium (DV-AL) was developed by enrichment culture technique from sediment collected from the Alang-Sosiya ship breaking yard, Gujarat, India. The 16S rRNA gene based molecular analyzes revealed that the bacterial consortium (DV-AL) consisted of four strains namely, Achromobacter sp. BAB239, Pseudomonas sp. DV-AL2, Enterobacter sp. BAB240 and Pseudomonas sp. BAB241. Consortium DV-AL was able to degrade 1000 ppm of naphthalene in Bushnell Haas medium (BHM) containing peptone (0.1%) as co-substrate with an initial pH of 8.0 at 37°C under shaking conditions (150 rpm) within 24h. Maximum growth rate and naphthalene degradation rate were found to be 0.0389 h(-1) and 80 mg h(-1), respectively. Consortium DV-AL was able to utilize other aromatic and aliphatic hydrocarbons such as benzene, phenol, carbazole, petroleum oil, diesel fuel, and phenanthrene and 2-methyl naphthalene as sole carbon source. Consortium DV-AL was also efficient to degrade naphthalene in the presence of other pollutants such as petroleum hydrocarbons and heavy metals. Copyright © 2011 Elsevier Ltd. All rights reserved.
Interplay between dynamic screened f-f interaction and sk·sf interaction in Ce systems
International Nuclear Information System (INIS)
Lopez-Aguilar, F.; Costa-Quintana, J.; Sanchez-Lopez, M.M.
1997-01-01
Two complementary analyses for the electronic structure of Ce systems are given. The first is performed from the renormalized density of states (DOS) deduced from the interacting Green close-quote s functions. These Green close-quote s functions are obtained from a self-energy calculated from a multiband Hubbard Hamiltonian and using the random phase approximation to account for the dynamical f-f screened interactions. The resulting DOS presents agreements and discrepancies with the spectral data yielded by direct and inverse photoemission. The theoretical and experimental f widths next to the Fermi level imply f-electron masses that are in strong contradiction with those obtained from the heavy-fermion specific heat. We have carried out a second analysis that complements the first one, since it considers the spin-exchange between extended states and a spin-field that is completely excluded from the first calculation. By the marriage of the results obtained in the first calculation with those of the second analysis, we can relate the photoemission spectra and de Haas endash van Alphen masses with the measurements of the contribution of the low-energy quasiparticles to the specific heat and the magnetic susceptibility. copyright 1997 The American Physical Society
Rapid maxillary expansion in contemporary orthodontic literature
Directory of Open Access Journals (Sweden)
Sabrina Mutinelli
2016-01-01
Full Text Available We have reviewed our retrospective research about rapid maxillary expansion performed in the early mixed dentition to summarize the results of different studies regarding maxillary dental arch width variation and crowding improvement in light of contemporary literature. The aim is to define the effects of treatments followed until the end of dental arch growth. In all studies, a Haas expander anchored to the deciduous dentition was used. The samples consisted of treated patients with and without a lateral crossbite and homogeneous untreated individuals as controls. Two additional control groups of adolescents and adults in dental Class 1 were also compared. As a result of the analysis, rapid maxillary expansion with anchorage to the deciduous dentition was found to be effective in increasing transverse width in intermolar and intercanine areas, and the change was preserved until the full permanent dentition stage. When performed before maxillary lateral incisors have fully erupted, this procedure allows for a rapid increase in the arch length in the anterior area and consequently, in the space available for permanent incisors with a stable reduction in crowding over time.