WorldWideScience

Sample records for group feedback phase

  1. Fishualization: a group feedback display

    NARCIS (Netherlands)

    Schavemaker, J.G.M.; Boertjes, E.M.; Koldijk, S.J.; Wiertz, L.; Verberne, S.; Sappelli, M.; Kaptein, A.M.

    2014-01-01

    In this contribution1 we present a novel psychological intervention that maps human computer activity to a group feedback device on the basis of a combination of various types of unobtrusive, low-level sensors. The goal is to enable employees to gain insights into their working habits, to reduce str

  2. Effects of Quasar Feedback in Galaxy Groups

    CERN Document Server

    Bhattacharya, Suman; Kosowsky, Arthur

    2007-01-01

    We study the effect of quasar feedback on distributions of baryons in galaxy groups using high-resolution numerical simulations. We use the entropy-conserving Gadget code that includes gas cooling and star formation, modified to include a physically-based model of quasar feedback. For a sample of ten galaxy group-sized dark matter halos with masses in the range of 1 to $5\\times 10^{13} M_{\\odot}/h$, star formation is suppressed by more than 30% in the inner regions due to the additional pressure support by quasar feedback, while gas is driven from the inner region towards the outer region of the halos. As a result, the average gas density is 20% lower in the inner region and 10% higher in the outer region in the simulation, compared to a similar simulation with no quasar feedback. Gas pressure is also higher in the outer region, while temperature and entropy are enhanced in the inner region. The total group gas fraction in the two simulations generally differs by less than 10%. We also find a small enhancemen...

  3. Sample-Clock Phase-Control Feedback

    Science.gov (United States)

    Quirk, Kevin J.; Gin, Jonathan W.; Nguyen, Danh H.; Nguyen, Huy

    2012-01-01

    To demodulate a communication signal, a receiver must recover and synchronize to the symbol timing of a received waveform. In a system that utilizes digital sampling, the fidelity of synchronization is limited by the time between the symbol boundary and closest sample time location. To reduce this error, one typically uses a sample clock in excess of the symbol rate in order to provide multiple samples per symbol, thereby lowering the error limit to a fraction of a symbol time. For systems with a large modulation bandwidth, the required sample clock rate is prohibitive due to current technological barriers and processing complexity. With precise control of the phase of the sample clock, one can sample the received signal at times arbitrarily close to the symbol boundary, thus obviating the need, from a synchronization perspective, for multiple samples per symbol. Sample-clock phase-control feedback was developed for use in the demodulation of an optical communication signal, where multi-GHz modulation bandwidths would require prohibitively large sample clock frequencies for rates in excess of the symbol rate. A custom mixedsignal (RF/digital) offset phase-locked loop circuit was developed to control the phase of the 6.4-GHz clock that samples the photon-counting detector output. The offset phase-locked loop is driven by a feedback mechanism that continuously corrects for variation in the symbol time due to motion between the transmitter and receiver as well as oscillator instability. This innovation will allow significant improvements in receiver throughput; for example, the throughput of a pulse-position modulation (PPM) with 16 slots can increase from 188 Mb/s to 1.5 Gb/s.

  4. Group Projects in Interior Design Studio Classes: Peer Feedback Benefits

    Science.gov (United States)

    Jurado, Juan A.

    2011-01-01

    Group projects have been shown to be effective for providing peer feedback in classrooms. While students in regular enrollment classes benefit from peer feedback, low-enrollment classes face many challenges. This study compares peer feedback effectiveness between two interior design studio classes with different design projects. In one class,…

  5. Group Projects in Interior Design Studio Classes: Peer Feedback Benefits

    Science.gov (United States)

    Jurado, Juan A.

    2011-01-01

    Group projects have been shown to be effective for providing peer feedback in classrooms. While students in regular enrollment classes benefit from peer feedback, low-enrollment classes face many challenges. This study compares peer feedback effectiveness between two interior design studio classes with different design projects. In one class,…

  6. An adaptive phase alignment algorithm for cartesian feedback loops

    Science.gov (United States)

    Gimeno-Martin, A.; Pardo-Martin, J.; Ortega-Gonzalez, F.

    2010-01-01

    An adaptive algorithm to correct phase misalignments in Cartesian feedback linearization loops for power amplifiers has been presented. It yields an error smaller than 0.035 rad between forward and feedback loop signals once convergence is reached. Because this algorithm enables a feedback system to process forward and feedback samples belonging to almost the same algorithm iteration, it is suitable to improve the performance not only of power amplifiers but also any other digital feedback system for communications systems and circuits such as all digital phase locked loops. Synchronizing forward and feedback paths of Cartesian feedback loops takes a small period of time after the system starts up. The phase alignment algorithm needs to converge before the feedback Cartesian loop can start its ideal behavior. However, once the steady state is reached, both paths can be considered synchronized, and the Cartesian feedback loop will only depend on the loop parameters (open-loop gain, loop bandwidth, etc.). It means that the linearization process will also depend only on these parameters since the misalignment effect disappears. Therefore, this algorithm relieves the power amplifier linearizer circuit design of any task required for solving phase misalignment effects inherent to Cartesian feedback systems. Furthermore, when a feedback Cartesian loop has to be designed, the designer can consider that forward and feedback paths are synchronized, since the phase alignment algorithm will do this task. This will reduce the simulation complexity. Then, all efforts are applied to determining the suitable loop parameters that will make the linearization process more efficient.

  7. Phase noise reduction by self-phase locking in semiconductor lasers using phase conjugate feedback

    DEFF Research Database (Denmark)

    Petersen, Lykke; Gliese, Ulrik Bo; Nielsen, Torben Nørskov

    1994-01-01

    A theoretical analysis of the behavior of the frequency/phase noise of semiconductor lasers with external phase conjugate feedback is presented. It is shown that the frequency noise is drastically reduced even for lasers with butt-coupled phase conjugate mirrors. In this laser system, the phase...

  8. Phase Model with Feedback Control for Power Grids

    CERN Document Server

    Matsuo, Tatsuma

    2013-01-01

    A phase model with feedback control is studied as a dynamical model of power grids. As an example, we study a model network corresponding to the power grid in the Kyushu region. The standard frequency is maintained by the mutual synchronization and the feedback control. Electric failures are induced by an overload. We propose a local feedback method in which the strength of feedback control is proportional to the magnitude of generators. We find that the electric failures do not occur until the utilization ratio is close to 1 under this feedback control. We also find that the temporal response for the time-varying input power is suppressed under this feedback control. We explain the mechanisms using the corresponding global feedback method.

  9. Phase Model with Feedback Control for Power Grids

    Science.gov (United States)

    Matsuo, Tatsuma; Sakaguchi, Hidetsugu

    2013-09-01

    A phase model with feedback control is studied as a dynamical model of power grids. As an example, we study a model network corresponding to the power grid in the Kyushu region. The standard frequency is maintained by the mutual synchronization and the feedback control. Electric failures are induced by an overload. We propose a local feedback method in which the strength of feedback control is proportional to the magnitude of generators. We find that the electric failures do not occur until the utilization ratio is close to 1 under this feedback control. We also find that the temporal response for the time-varying input power is suppressed under this feedback control. We explain the mechanisms using the corresponding global feedback method.

  10. Feedback in Group Psychotherapy for Eating disorders

    DEFF Research Database (Denmark)

    Davidsen, Annika Helgadóttir; Poulsen, Stig; Lindschou, Jane

    2017-01-01

    -generated allocation sequence concealed to the investigators. One-hundred and 59 adult participants, diagnosed with bulimia nervosa, binge eating disorder, or eating disorder not otherwise specified according to DSM-IV, were included. Eighty participants were allocated to the experimental group, and 79 participants...

  11. Intersubjectivity and narcissism in group psychotherapy: how feedback works.

    Science.gov (United States)

    Cohen, B D

    2000-04-01

    In group psychotherapy, inter-subjectivity is complicated by the number and quality of therapist-member, member-member, and member-group relations. Inter-member feedback structures the relational process. However, fears of narcissistic injury engender resistance to this form of engagement. The nature of the narcissistic belief system that motivates such resistance is discussed. Then, two models of feedback are presented: the cybernetic and the inter-subjective. In the cybernetic model, feedback is intended to inform recipients about themselves and to change their behavior accordingly. As such, this model is consistent with narcissistic beliefs in the power of others' perceptions to control one's being, identity, or value. The inter-subjective model focuses, instead, on what feedback tells recipients about their donors' worlds. This model and some of its parameters are exemplified clinically.

  12. A uniform phase noise QVCO with a feedback current source

    Institute of Scientific and Technical Information of China (English)

    Zhou Chunyuan; Zhang Lei; Qian He

    2012-01-01

    A novel integrated quadrature voltage controlled oscillator (QVCO) with a feedback current source is presented in this paper.Benefiting from the current adjusting function of the feedback current source,the proposed QVCO exhibits a uniform phase noise over the entire tuning range.This QVCO is implemented in 65-nm CMOS technology.The measurement results show that it draws less than 3-mA average current from a 1.2-V supply and the phase noise is less than -110 dBc/Hz @1MHz offset over the entire tuning range.The fluctuation of phase noise @l MHz offset from the center frequency of 2 84-GHz to 3.27-GHz is less than 1 dBc/Hz,which validates the correctness of the proposed current source feedback technique.

  13. Self-control of feedback during motor learning: accounting for the absolute amount of feedback using a yoked group with self-control over feedback.

    Science.gov (United States)

    Hansen, Steve; Pfeiffer, Jacob; Patterson, Jae Todd

    2011-01-01

    A traditional control group yoked to a group that self-controls their reception of feedback receives feedback in the same relative and absolute manner. This traditional control group typically does not learn the task as well as the self-control group. Although the groups are matched for the amount of feedback they receive, the information is provided on trials in which the individual may not request feedback if he or she were provided the opportunity. Similarly, individuals may not receive feedback on trials for which it would be a beneficial learning experience. Subsequently, the mismatch between the provision of feedback and the potential learning opportunity leads to a decrement in retention. The present study was designed to examine motor learning for a yoked group with the same absolute amount of feedback, but who could self-control when they received feedback. Increased mental processing of error detection and correction was expected for the participants in the yoked self-control group because of their choice to employ a limited resource in the form of a decreasing amount of feedback opportunities. Participants in the yoked with self-control group committed fewer errors than the self-control group in retention and the traditional yoked group in both the retention and time transfer blocks. The results suggest that the yoked with self-control group was able to produce efficient learning effects and can be a viable control group for further motor learning studies.

  14. Adaptive group testing as channel coding with feedback

    CERN Document Server

    Aldridge, Matthew

    2012-01-01

    Group testing is the combinatorial problem of identifying the defective items in a population by grouping items into test pools. Recently, nonadaptive group testing - where all the test pools must be decided on at the start - has been studied from an information theory point of view. Using techniques from channel coding, upper and lower bounds have been given on the number of tests required to accurately recover the defective set, even when the test outcomes can be noisy. In this paper, we give the first information theoretic result on adaptive group testing - where the outcome of previous tests can influence the makeup of future tests. We show that adaptive testing does not help much, as the number of tests required obeys the same lower bound as nonadaptive testing. Our proof uses similar techniques to the proof that feedback does not improve channel capacity.

  15. Feedback.

    Science.gov (United States)

    Richardson, Barbara K

    2004-12-01

    The emergency department provides a rich environment for diverse patient encounters, rapid clinical decision making, and opportunities to hone procedural skills. Well-prepared faculty can utilize this environment to teach residents and medical students and gain institutional recognition for their incomparable role and teamwork. Giving effective feedback is an essential skill for all teaching faculty. Feedback is ongoing appraisal of performance based on direct observation aimed at changing or sustaining a behavior. Tips from the literature and the author's experience are reviewed to provide formats for feedback, review of objectives, and elements of professionalism and how to deal with poorly performing students. Although the following examples pertain to medical student education, these techniques are applicable to the education of all adult learners, including residents and colleagues. Specific examples of redirection and reflection are offered, and pitfalls are reviewed. Suggestions for streamlining verbal and written feedback and obtaining feedback from others in a fast-paced environment are given. Ideas for further individual and group faculty development are presented.

  16. Evidence for AGN Feedback in Galaxy Clusters and Groups

    Directory of Open Access Journals (Sweden)

    Myriam Gitti

    2012-01-01

    Full Text Available The current generation of flagship X-ray missions, Chandra and XMM-Newton, has changed our understanding of the so-called “cool-core” galaxy clusters and groups. Instead of the initial idea that the thermal gas is cooling and flowing toward the center, the new picture envisages a complex dynamical evolution of the intracluster medium (ICM regulated by the radiative cooling and the nongravitational heating from the active galactic nucleus (AGN. Understanding the physics of the hot gas and its interplay with the relativistic plasma ejected by the AGN is key for understanding the growth and evolution of galaxies and their central black holes, the history of star formation, and the formation of large-scale structures. It has thus become clear that the feedback from the central black hole must be taken into account in any model of galaxy evolution. In this paper, we draw a qualitative picture of the current knowledge of the effects of the AGN feedback on the ICM by summarizing the recent results in this field.

  17. Evidence for AGN Feedback in Galaxy Clusters and Groups

    CERN Document Server

    Gitti, Myriam; McNamara, Brian R

    2011-01-01

    The current generation of flagship X-ray missions, Chandra and XMM-Newton, has changed our understanding of the so-called "cool core" galaxy clusters and groups. Instead of the initial idea that the thermal gas is cooling and flowing toward the center, the new picture envisages a complex dynamical evolution of the intra-cluster medium (ICM) regulated by the radiative cooling and the nongravitational heating from the active galactic nucleus (AGN). Understanding the physics of the hot gas and its interplay with the relativistic plasma ejected by the AGN is key for understanding the growth and evolution of galaxies and their central black holes, the history of star formation, and the formation of large-scale structures. It has thus become clear that the feedback from the central black hole must be taken into account in any model of galaxy evolution. In this paper, we draw a qualitative picture of the current knowledge of the effects of the AGN feedback on the ICM by summarizing the recent results in this field.

  18. Towards a robust phase locked loop tune feedback system

    CERN Document Server

    Jones, R; Luo, Y

    2005-01-01

    Attempts to introduce a reliable tune feedback loop at RHIC (BNL) [1] have been thwarted by two main problems, namely transition crossing and betatron coupling. The problem of transition crossing is a dynamic range problem, resulting from the increase in the revolution content of the observed signal as the bunch length becomes short and from the fast orbit changes that occur during transition. The dynamic range issue is being addressed by the development of a baseband tune measurement system [2] as part of the US LHC Accelerator Research Program (US-LARP). This paper will focus on the second problem, showing how a phase locked loop (PLL) tune measurement system can be used to continuously measure global betatron coupling, and in so doing allow for robust tune measurement and feedback in the presence of coupling.

  19. Feedback versus no feedback in improving patient outcome in group psychotherapy for eating disorders (F-EAT)

    DEFF Research Database (Denmark)

    Davidsen, Annika Helgadóttir; Poulsen, Stig Bernt; Waaddegaard, Mette

    2014-01-01

    or control group at a ratio of 1:1. The experimental group will receive standard treatment (systemic and narrative group psychotherapy) with feedback intervention, whereas the control group will receive standard treatment only. The participants are diagnosed with bulimia nervosa binge eating disorder...

  20. Effects of longitudinal small-group learning on delivery and receipt of communication skills feedback.

    Science.gov (United States)

    Chou, Calvin L; Masters, Dylan E; Chang, Anna; Kruidering, Marieke; Hauer, Karen E

    2013-11-01

    Although feedback is a critical component of learning, recent data suggest that learners may discount feedback they receive. The emotional threat inherent in feedback can contribute to its ineffectiveness, particularly for sensitive topics like communication skills. Longitudinal relationships among peers may increase their sense of safety and soften the perceived threat of feedback to allow students to give, receive and potentially more effectively incorporate feedback. We studied the effects of prior shared learning experiences among medical students in the delivery and receipt of feedback on clinical (communication) skills. During a formative clinical skills examination, we divided Year 3 students at a US medical school into two subgroups comprising, respectively, small-group classmates from a 2-year longitudinal pre-clerkship clinical skills course (with prior peer-learning relationships), and peers with no prior shared small-group coursework. Students in both subgroups observed peers in a simulated clinical case and then provided feedback, which was videotaped, transcribed and coded. Feedback recipients also completed a survey on their perceptions of the feedback. Students valued the feedback they received and intended to enact it, regardless of whether they had prior peer-learning relationships. Coding of feedback revealed high specificity. Feedback providers who had prior peer-learning relationships with recipients provided more specific corrective feedback on communication skills than those with no such relationships (p = 0.014); there was no significant difference between subgroups in the provision of reinforcing feedback on communication skills. Year 3 medical student peers can deliver specific feedback on clinical skills; prior peer-learning relationships in pre-clerkship clinical skills courses enrich the provision of specific corrective feedback about communication skills. Feedback between peers with pre-existing peer-learning relationships represents

  1. Feedback versus no feedback in improving patient outcome in group psychotherapy for eating disorders (F-EAT)

    DEFF Research Database (Denmark)

    Davidsen, Annika Helgadóttir; Poulsen, Stig Bernt; Waaddegaard, Mette

    2014-01-01

    , or an eating disorder not otherwise specified, according to the DSM-IV. In the experimental group feedback to the participants, based on the Outcome Rating Scale (ORS) and the Group Session Rating Scale (GSRS), is actively added to standard treatment. The ORS assesses areas of life functioning known to change...... If the results will confirm the hypothesis, this trial will support feedback as a way to improve group treatment attendance for outpatients with eating disorders. Trial registration: ClinicalTrials.gov identifier: NCT01693237...

  2. Scaffolding Group Explanation and Feedback with Handheld Technology: Impact on Students' Mathematics Learning

    Science.gov (United States)

    Roschelle, Jeremy; Rafanan, Ken; Bhanot, Ruchi; Estrella, Gucci; Penuel, Bill; Nussbaum, Miguel; Claro, Susana

    2010-01-01

    Based on strong research literatures, we conjectured that social processing of feedback by cooperating in a small group setting--with social incentives to ask questions, give explanations and discuss disagreements--would increase learning. We compared group and individual feedback, using two technologies: (1) Technology-mediated, Peer-Assisted…

  3. Scaffolding Group Explanation and Feedback with Handheld Technology: Impact on Students' Mathematics Learning

    Science.gov (United States)

    Roschelle, Jeremy; Rafanan, Ken; Bhanot, Ruchi; Estrella, Gucci; Penuel, Bill; Nussbaum, Miguel; Claro, Susana

    2010-01-01

    Based on strong research literatures, we conjectured that social processing of feedback by cooperating in a small group setting--with social incentives to ask questions, give explanations and discuss disagreements--would increase learning. We compared group and individual feedback, using two technologies: (1) Technology-mediated, Peer-Assisted…

  4. Temperature feedback control for long-term carrier-envelope phase locking

    Science.gov (United States)

    Chang, Zenghu [Manhattan, KS; Yun, Chenxia [Manhattan, KS; Chen, Shouyuan [Manhattan, KS; Wang, He [Manhattan, KS; Chini, Michael [Manhattan, KS

    2012-07-24

    A feedback control module for stabilizing a carrier-envelope phase of an output of a laser oscillator system comprises a first photodetector, a second photodetector, a phase stabilizer, an optical modulator, and a thermal control element. The first photodetector may generate a first feedback signal corresponding to a first portion of a laser beam from an oscillator. The second photodetector may generate a second feedback signal corresponding to a second portion of the laser beam filtered by a low-pass filter. The phase stabilizer may divide the frequency of the first feedback signal by a factor and generate an error signal corresponding to the difference between the frequency-divided first feedback signal and the second feedback signal. The optical modulator may modulate the laser beam within the oscillator corresponding to the error signal. The thermal control unit may change the temperature of the oscillator corresponding to a signal operable to control the optical modulator.

  5. Self-controlled concurrent feedback facilitates the learning of the final approach phase in a fixed-base flight simulator.

    Science.gov (United States)

    Huet, Michaël; Jacobs, David M; Camachon, Cyril; Goulon, Cedric; Montagne, Gilles

    2009-12-01

    This study (a) compares the effectiveness of different types of feedback for novices who learn to land a virtual aircraft in a fixed-base flight simulator and (b) analyzes the informational variables that learners come to use after practice. An extensive body of research exists concerning the informational variables that allow successful landing. In contrast, few studies have examined how the attention of pilots can be directed toward these sources of information. In this study, 15 participants were asked to land a virtual Cessna 172 on 245 trials while trying to follow the glide-slope area as accurately as possible. Three groups of participants practiced under different feedback conditions: with self-controlled concurrent feedback (the self-controlled group), with imposed concurrent feedback (the yoked group), or without concurrent feedback (the control group). The self-controlled group outperformed the yoked group, which in turn outperformed the control group. Removing or manipulating specific sources of information during transfer tests had different effects for different individuals. However, removing the cockpit from the visual scene had a detrimental effect on the performance of the majority of the participants. Self-controlled concurrent feedback helps learners to more quickly attune to the informational variables that allow them to control the aircraft during the approach phase. Knowledge concerning feedback schedules can be used for the design of optimal practice methods for student pilots, and knowledge about the informational variables used by expert performers has implications for the design of cockpits and runways that facilitate the detection of these variables.

  6. The Hot and Energetic Universe: AGN feedback in galaxy clusters and groups

    CERN Document Server

    Croston, J H; Heinz, S; Hardcastle, M J; Zhuravleva, I; Bîrzan, L; Bower, R G; Brüggen, M; Churazov, E; Edge, A C; Ettori, S; Fabian, A C; Finoguenov, A; Kaastra, J; Gaspari, M; Gitti, M; Nulsen, P E J; McNamara, B R; Pointecouteau, E; Ponman, T J; Pratt, G W; Rafferty, D A; Reiprich, T H; Sijacki, D; Worrall, D M; Kraft, R P; McCarthy, I; Wise, M

    2013-01-01

    Mechanical feedback via Active Galactic Nuclei (AGN) jets in the centres of galaxy groups and clusters is a crucial ingredient in current models of galaxy formation and cluster evolution. Jet feedback is believed to regulate gas cooling and thus star formation in the most massive galaxies, but a robust physical understanding of this feedback mode is currently lacking. The large collecting area, excellent spectral resolution and high spatial resolution of Athena+ will provide the breakthrough diagnostic ability necessary to develop this understanding, via: (1) the first kinematic measurements on relevant spatial scales of the hot gas in galaxy, group and cluster haloes as it absorbs the impact of AGN jets, and (2) vastly improved ability to map thermodynamic conditions on scales well-matched to the jets, lobes and gas disturbances produced by them. Athena+ will therefore determine for the first time how jet energy is dissipated and distributed in group and cluster gas, and how a feedback loop operates in group...

  7. Group Contribution Methods for Phase Equilibrium Calculations.

    Science.gov (United States)

    Gmehling, Jürgen; Constantinescu, Dana; Schmid, Bastian

    2015-01-01

    The development and design of chemical processes are carried out by solving the balance equations of a mathematical model for sections of or the whole chemical plant with the help of process simulators. For process simulation, besides kinetic data for the chemical reaction, various pure component and mixture properties are required. Because of the great importance of separation processes for a chemical plant in particular, a reliable knowledge of the phase equilibrium behavior is required. The phase equilibrium behavior can be calculated with the help of modern equations of state or g(E)-models using only binary parameters. But unfortunately, only a very small part of the experimental data for fitting the required binary model parameters is available, so very often these models cannot be applied directly. To solve this problem, powerful predictive thermodynamic models have been developed. Group contribution methods allow the prediction of the required phase equilibrium data using only a limited number of group interaction parameters. A prerequisite for fitting the required group interaction parameters is a comprehensive database. That is why for the development of powerful group contribution methods almost all published pure component properties, phase equilibrium data, excess properties, etc., were stored in computerized form in the Dortmund Data Bank. In this review, the present status, weaknesses, advantages and disadvantages, possible applications, and typical results of the different group contribution methods for the calculation of phase equilibria are presented.

  8. On The Use of A Phase Modulation Method for Decorrelation in Acoustic Feedback Cancellation

    DEFF Research Database (Denmark)

    Guo, Meng; Jensen, Søren Holdt; Jensen, Jesper

    2012-01-01

    of decorrelation. In this work, we study a subband phase modulation method, which was originally proposed for decorrelation in multichannel acoustic echo cancellation systems. We determine if this method is effective for decorrelation in acoustic feedback cancellation systems by comparing it to a structurally...... similar frequency shifting decorrelation method. We show that the phase modulation method is suitable for decorrelation in a hearing aid acoustic feedback cancellation system, although the frequency shifting method is in general slightly more effective....

  9. Feedback stabilization of the Cahn-Hilliard type system for phase separation

    Science.gov (United States)

    Barbu, Viorel; Colli, Pierluigi; Gilardi, Gianni; Marinoschi, Gabriela

    2017-02-01

    This article is concerned with the internal feedback stabilization of the phase field system of Cahn-Hilliard type, modeling the phase separation in a binary mixture. Under suitable assumptions on an arbitrarily fixed stationary solution, we construct via spectral separation arguments a feedback controller having its support in an arbitrary open subset of the space domain, such that the closed loop nonlinear system exponentially reaches the prescribed stationary solution. This feedback controller has a finite dimensional structure in the state space of solutions. In particular, every constant stationary solution is admissible.

  10. Computer Assisted Feedback of Non-Intellectual Factors as a Means of Improving Small Group Instruction. Final Report.

    Science.gov (United States)

    Hill, Richard J.

    How feedback affects small-group processes and group outcomes and how these outcomes vary with computer-assisted or experimenter-assisted modes of supplying feedback were investigated. Feedback theory was conceptualized through a work-emotionality framework. Theoretical constructs were operationalized through the use of Boyd's three-channel mode…

  11. Plant-soil feedbacks: role of plant functional group and plant traits

    NARCIS (Netherlands)

    Cortois, R.; Schröder-Georgi, T.; Weigelt, A.; van der Putten, W.H.; De Deyn, G.B.

    2016-01-01

    Plant-soil feedback (PSF), plant trait and functional group concepts advanced our understanding of plant community dynamics, but how they are interlinked is poorly known. To test how plant functional groups (FGs: graminoids, small herbs, tall herbs, legumes) and plant traits relate to PSF, we grew 4

  12. Motivational Effects of Feedback and Goal-Setting on Group Performance.

    Science.gov (United States)

    Watson, Carol

    In studies examining the impact of performance information on motivation, both feedback and goal setting have been found to improve performance. To explore the generalizability of E. A. Locke's (1968) theory of task motivation to groups, 180 male masters of business administration (MBA) students were randomly organized into 60 three-person groups.…

  13. Analysis of Feedback processes in Online Group Interaction: a methodological model

    Directory of Open Access Journals (Sweden)

    Anna Espasa

    2013-06-01

    Full Text Available The aim of this article is to present a methodological model to analyze students' group interaction to improve their essays in online learning environments, based on asynchronous and written communication. In these environments teacher and student scaffolds for discussion are essential to promote interaction. One of these scaffolds can be the feedback. Research on feedback processes has predominantly focused on feedback design rather than on how students utilize feedback to improve learning. This methodological model fills this gap contributing to analyse the implementation of the feedback processes while students discuss collaboratively in a specific case of writing assignments. A review of different methodological models was carried out to define a framework adjusted to the analysis of the relationship of written and asynchronous group interaction, and students' activity and changes incorporated into the final text. The model proposed includes the following dimensions: 1 student participation 2 nature of student learning and 3 quality of student learning. The main contribution of this article is to present the methodological model and also to ascertain the model's operativity regarding how students incorporate such feedback into their essays.

  14. CAN AGN FEEDBACK BREAK THE SELF-SIMILARITY OF GALAXIES, GROUPS, AND CLUSTERS?

    Energy Technology Data Exchange (ETDEWEB)

    Gaspari, M. [Max Planck Institute for Astrophysics, Karl-Schwarzschild-Strasse 1, D-85741 Garching (Germany); Brighenti, F. [Astronomy Department, University of Bologna, Via Ranzani 1, I-40127 Bologna (Italy); Temi, P. [Astrophysics Branch, NASA/Ames Research Center, MS 245-6, Moffett Field, CA 94035 (United States); Ettori, S., E-mail: mgaspari@mpa-garching.mpg.de [INAF, Osservatorio Astronomico di Bologna, Via Ranzani 1, I-40127 Bologna (Italy)

    2014-03-01

    It is commonly thought that active galactic nucleus (AGN) feedback can break the self-similar scaling relations of galaxies, groups, and clusters. Using high-resolution three-dimensional hydrodynamic simulations, we isolate the impact of AGN feedback on the L {sub x}-T {sub x} relation, testing the two archetypal and common regimes, self-regulated mechanical feedback and a quasar thermal blast. We find that AGN feedback has severe difficulty in breaking the relation in a consistent way. The similarity breaking is directly linked to the gas evacuation within R {sub 500}, while the central cooling times are inversely proportional to the core density. Breaking self-similarity thus implies breaking the cool core, morphing all systems to non-cool-core objects, which is in clear contradiction with the observed data populated by several cool-core systems. Self-regulated feedback, which quenches cooling flows and preserves cool cores, prevents dramatic evacuation and similarity breaking at any scale; the relation scatter is also limited. The impulsive thermal blast can break the core-included L {sub x}-T {sub x} at T {sub 500} ≲ 1 keV, but substantially empties and overheats the halo, generating a perennial non-cool-core group, as experienced by cosmological simulations. Even with partial evacuation, massive systems remain overheated. We show that the action of purely AGN feedback is to lower the luminosity and heat the gas, perpendicular to the fit.

  15. Group support system and explanatory feedback: An experimental study of mitigating halo effect

    Directory of Open Access Journals (Sweden)

    Intiyas Utami

    2015-12-01

    Full Text Available Comprehensive assessment potentially leads to halo effect that will affect accuracy of auditors decision-making process. Biased initial audit decision will potentially influence final audit decision. It is there-fore necessary to mitigate halo effect that is the consequence of auditors good impression on clients initial condition. This re-search aims to empirically show that halo effect can be mitigated by explanatory feedback and Group Support System (GSS. The researchers experimentally mani-pulate explanatory feedback and GSS using online web-site. The subjects are stu-dents who have already taken auditing courses. The results show that: 1 explanato-ry feedback can mitigate halo effect so that audit decision will be more accurate 2 GSS can also mitigate halo effect 3 explanatory feedback and GSS are the best me-thods to mitigate halo effect.

  16. [Solid phase techniques in blood group serology].

    Science.gov (United States)

    Uthemann, H; Sturmfels, L; Lenhard, V

    1993-06-01

    As alternatives to hemagglutination, solid-phase red blood cell adherence assays are of increasing importance. The adaptation of the new techniques to microplates offers several advantages over hemagglutination. Using microplates the assays may be processed semiautomatically, and the results can be read spectrophotometrically and interpreted by a personal computer. In this paper, different red blood cell adherence assays for AB0 grouping, Rh typing, Rh phenotyping, antibody screening and identification, as well as crossmatching will be described.

  17. Pitfalls and feedback when constructing topological pressure-temperature phase diagrams

    Science.gov (United States)

    Ceolin, R.; Toscani, S.; Rietveld, Ivo B.; Barrio, M.; Tamarit, J. Ll.

    2017-04-01

    The stability hierarchy between different phases of a chemical compound can be accurately reproduced in a topological phase diagram. This type of phase diagrams may appear to be the result of simple extrapolations, however, experimental complications quickly increase in the case of crystalline trimorphism (and higher order polymorphism). To ensure the accurate positioning of stable phase domains, a topological phase diagram needs to be consistent. This paper gives an example of how thermodynamic feedback can be used in the topological construction of phase diagrams to ensure overall consistency in a phase diagram based on the case of piracetam crystalline trimorphism.

  18. Real-time optical signal processors employing optical feedback: amplitude and phase control.

    Science.gov (United States)

    Gallagher, N C

    1976-04-01

    The development of real-time coherent optical signal processors has increased the appeal of optical computing techniques in signal processing applications. A major limitation of these real-time systems is the. fact that the optical processing material is generally of a phase-only type. The result is that the spatial filters synthesized with these systems must be either phase-only filters or amplitude-only filters. The main concern of this paper is the application of optical feedback techniques to obtain simultaneous and independent amplitude and phase control of the light passing through the system. It is shown that optical feedback techniques may be employed with phase-only spatial filters to obtain this amplitude and phase control. The feedback system with phase-only filters is compared with other feedback systems that employ combinations of phase-only and amplitude-only filters; it is found that the phase-only system is substantially more flexible than the other two systems investigated.

  19. Stability of the single-mode output of a laser diode array with phase conjugate feedback

    DEFF Research Database (Denmark)

    Juul Jensen, S.; Løbel, M.; Petersen, P.M.

    2000-01-01

    The stability of the output of a single-mode laser diode array with frequency selective phase conjugate feedback has been investigated experimentally. Both the long-term stability of the laser output and the sensitivity to feedback generated by external reflection of the output beam are examined....... The output power and the center wavelength are found to be extremely stable in a 100 h stability measurement. External feedback of the output beam into the laser is seen to decrease both the spatial and the temporal coherence of the output significantly. We outline an approach to obtain a stable single...

  20. Melonic phase transition in group field theory

    CERN Document Server

    Baratin, Aristide; Oriti, Daniele; Ryan, James P; Smerlak, Matteo

    2013-01-01

    Group field theories have recently been shown to admit a 1/N expansion dominated by so-called `melonic graphs', dual to triangulated spheres. In this note, we deepen the analysis of this melonic sector. We obtain a combinatorial formula for the melonic amplitudes in terms of a graph polynomial related to a higher dimensional generalization of the Kirchhoff tree-matrix theorem. Simple bounds on these amplitudes show the existence of a phase transition driven by melonic interaction processes. We restrict our study to the Boulatov-Ooguri models, which describe topological BF theories and are the basis for the construction of four dimensional models of quantum gravity.

  1. Chaotic Feedback Loops within Decision Making Groups: Towards an Integration of Chaos Theory and Cybernetics.

    Science.gov (United States)

    Keaten, James A.

    This paper offers a model that integrates chaos theory and cybernetics, which can be used to describe the structure of decision making within small groups. The paper begins with an overview of cybernetics and chaos. Definitional characteristics of cybernetics are reviewed along with salient constructs, such as goal-seeking, feedback, feedback…

  2. Change in quality management in diabetes care groups and outpatient clinics after feedback and tailored support

    NARCIS (Netherlands)

    Campmans-Kuijpers, Marjo J.; Baan, Caroline A.; Lemmens, Lidwien C.; Rutten, Guy E.

    2015-01-01

    OBJECTIVE: To assess the change in level of diabetes quality management in primary care groups and outpatient clinics after feedback and tailored support. RESEARCH DESIGN AND METHODS: This before-and-after study with a 1-year follow-up surveyed qualitymanagers on six domains of quality management. Q

  3. Change in quality management in diabetes care groups and outpatient clinics after feedback and tailored support

    NARCIS (Netherlands)

    Campmans-Kuijpers, Marjo J.; Baan, Caroline A.; Lemmens, Lidwien C.; Rutten, Guy E.

    2015-01-01

    OBJECTIVE: To assess the change in level of diabetes quality management in primary care groups and outpatient clinics after feedback and tailored support. RESEARCH DESIGN AND METHODS: This before-and-after study with a 1-year follow-up surveyed qualitymanagers on six domains of quality management.

  4. Distribution of Feedback among Teacher and Students in Online Collaborative Learning in Small Groups

    Science.gov (United States)

    Coll, Cesar; Rochera, Maria Jose; de Gispert, Ines; Diaz-Barriga, Frida

    2013-01-01

    This study explores the characteristics and distribution of the feedback provided by the participants (a teacher and her students) in an activity organized inside a collaborative online learning environment. We analyse 853 submissions made by two groups of graduate students and their teacher (N1 = 629 & N2 = 224) involved in the collaborative…

  5. Mechanical Feedback from Active Galactic Nuclei in Galaxies, Groups, and Clusters

    CERN Document Server

    McNamara, B R

    2012-01-01

    The radiative cooling timescales at the centers of hot atmospheres surrounding elliptical galaxies, groups, and clusters are much shorter than their ages. Therefore, hot atmospheres are expected to cool and to form stars. Cold gas and star formation are observed in central cluster galaxies but at levels below those expected from an unimpeded cooling flow. X-ray observations have shown that wholesale cooling is being offset by mechanical heating from radio active galactic nuclei. Feedback is widely considered to be an important and perhaps unavoidable consequence of the evolution of galaxies and supermassive black holes. We show that cooling X-ray atmospheres and the ensuing star formation and nuclear activity are probably coupled to a self-regulated feedback loop. While the energetics are now reasonably well understood, other aspects of feedback are not. We highlight the problems of atmospheric heating and transport processes, accretion, and nuclear activity, and we discuss the potential role of black hole sp...

  6. On Group Phase Quantization and Its Physical Characteristics

    Institute of Scientific and Technical Information of China (English)

    DU Bao-Qiang; ZHOU Wei; YU Jian-Guo; DONG Shao-Feng

    2011-01-01

    The physical characteristics of phase quantum are further revealed, based on the proposition of concepts of the greatest common factor frequency, the least common multiple period, quantized phase shift resolution and equivalent phase comparison frequency. Then the problem of phase comparison between different frequency signals is certified in detail. Using the basic principle of phase comparison between different frequencies and the variation law of group phase difference, a point of view on group phase quantization is presented. Group phase quantum is not only an indivisible individual of group phase, but also a basic unit composing group phase difference. It is equal to the equivalent phase comparison period of phase comparison between different frequencies in size. Experimental results show not only a high measurement resolution of 10-12/s in frequency measurement based on group phase quantum, but also a super-high locked phase precision of 10-13/s in active H atomic clock.%@@ The physical characteristics of phase quantum are further revealed,based on the proposition of concepts of the greatest common factor frequency,the least common multiple period,quantized phase shift resolution and equivalent phase comparison frequency.Then the problem of phase comparison between different frequency signals is certified in detail.Using the basic principle of phase comparison between different frequencies and the variation law of group phase difference,a point of view on group phase quantization is presented.Group phase quantum is not only an indivisible individual of group phase,but also a basic unit composing group phase difference.It is equal to the equivalent phase comparison period of phase comparison between different frequencies in size.Experimental results show not only a high measurement resolution of 10-12 /s in frequency measurement based on group phase quantum,but also a super-high locked phase precision of 10-13/s in active H atomic clock.

  7. Ab initio quantum-enhanced optical phase estimation using real-time feedback control

    DEFF Research Database (Denmark)

    Berni, Adriano; Gehring, Tobias; Nielsen, Bo Melholt

    2015-01-01

    as demonstrated in a variety of different optical systems(3-8). Most of these accounts, however, deal with the measurement of a very small shift of an already known phase, which is in stark contrast to ab initio phase estimation where the initial phase is unknown(9-12). Here, we report on the realization...... of a quantum-enhanced and fully deterministic ab initio phase estimation protocol based on real-time feedback control. Using robust squeezed states of light combined with a real-time Bayesian adaptive estimation algorithm, we demonstrate deterministic phase estimation with a precision beyond the quantum shot...

  8. Midterm peer feedback in problem-based learning groups: the effect on individual contributions and achievement.

    Science.gov (United States)

    Kamp, Rachelle J A; van Berkel, Henk J M; Popeijus, Herman E; Leppink, Jimmie; Schmidt, Henk G; Dolmans, Diana H J M

    2014-03-01

    Even though peer process feedback is an often used tool to enhance the effectiveness of collaborative learning environments like PBL, the conditions under which it is best facilitated still need to be investigated. Therefore, this study investigated the effects of individual versus shared reflection and goal setting on students' individual contributions to the group and their academic achievement. In addition, the influence of prior knowledge on the effectiveness of peer feedback was studied. In this pretest-intervention-posttest study 242 first year students were divided into three conditions: condition 1 (individual reflection and goal setting), condition 2 (individual and shared reflection and goal setting), and condition 3 (control group). Results indicated that the quality of individual contributions to the tutorial group did not improve after receiving the peer feedback, nor did it differ between the three conditions. With regard to academic achievement, only males in conditions 1 and 2 showed better academic achievement compared with condition 3. However, there was no difference between both ways of reflection and goal setting with regard to achievement, indicating that both ways are equally effective. Nevertheless, it is still too early to conclude that peer feedback combined with reflection and goal setting is not effective in enhancing students' individual contributions. Students only had a limited number of opportunities to improve their contributions. Therefore, future research should investigate whether an increase in number of tutorial group meetings can enhance the effectiveness of peer feedback. In addition, the effect of quality of reflection and goal setting could be taken into consideration in future research.

  9. Using Relevance Feedback to Distinguish the Changes in EEG During Different Absence Seizure Phases.

    Science.gov (United States)

    Li, Jing; Liu, Xianzeng; Ouyang, Gaoxiang

    2016-07-01

    We carried out a series of statistical experiments to explore the utility of using relevance feedback on electroencephalogram (EEG) data to distinguish between different activity states in human absence epilepsy. EEG recordings from 10 patients with absence epilepsy are sampled, filtered, selected, and dissected from seizure-free, preseizure, and seizure phases. A total of 112 two-second 19-channel EEG epochs from 10 patients were selected from each phase. For each epoch, multiscale permutation entropy of the EEG data was calculated. The feature dimensionality was reduced by linear discriminant analysis to obtain a more discriminative and compact representation. Finally, a relevance feedback technique, that is, direct biased discriminant analysis, was applied to 68 randomly selected queries over nine iterations. This study is a first attempt to apply the statistical analysis of relevance feedback to the distinction of different EEG activity states in absence epilepsy. The average precision in the top 10 returned results was 97.5%, and the standard deviation suggested that embedding relevance feedback can effectively distinguish different seizure phases in absence epilepsy. The experimental results indicate that relevance feedback may be an effective tool for the prediction of different activity states in human absence epilepsy. The simultaneous analysis of multichannel EEG signals provides a powerful tool for the exploration of abnormal electrical brain activity in patients with epilepsy.

  10. The seasonally changing cloud feedbacks contribution to the ENSO seasonal phase-locking

    Science.gov (United States)

    Dommenget, Dietmar; Yu, Yanshan

    2016-12-01

    ENSO variability has a seasonal phase-locking, with SST anomalies on average decreasing during the beginning of the year and SST anomalies increasing during the second half of the year. As a result of this, the ENSO SST variability is smallest in April and the so call `spring barrier' exists in the predictability of ENSO. In this study we analysis how the seasonal phase-locking of surface short wave radiation associated with cloud cover feedbacks contribute to this phenomenon. We base our analysis on observations and simplified climate model simulations. At the beginning of the year, the warmer mean SST in the eastern equatorial Pacific leads to deeper clouds whose anomalous variability are positively correlated with the underlying SST anomalies. These observations highlight a strong negative surface short wave radiation feedback at the beginning of the year in the eastern Pacific (NINO3 region). This supports the observed seasonal phase-locking of ENSO SST variability. This relation also exists in model simulations of the linear recharge oscillator and in the slab ocean model coupled to a fully complex atmospheric GCM. The Slab ocean simulation has seasonal phase-locking similar to observed mostly caused by similar seasonal changing cloud feedbacks as observed. In the linear recharge oscillator simulations seasonal phase-locking is also similar to observed, but is not just related to seasonal changing cloud feedbacks, but is also related to changes in the sensitivity of the zonal wind stress and to a lesser extent to seasonally change sensitivities to the thermocline depth. In summary this study has shown that the seasonal phase-locking, as observed and simulated, is linked to seasonally changing cloud feedbacks.

  11. Possibilities for transverse feedback phase adjustment by means of digital filters

    Science.gov (United States)

    Kotzian, G.

    2017-07-01

    In transverse feedback systems a phase adjustment is generally required to convert a beam position signal from a pick-up into a momentum correction signal used by a transverse kicker. In this paper we outline several possibilities for phase adjustments using only single pickups or the vector combination of two pick-ups. Analytical expressions are given as a function of the fractional tune and the betatron phase advance between the pick-up location and the kicker. The shortest possible digital filter is formulated, including a notch for closed orbit suppression and a free parameter to adjust for betatron phase. We introduce a novel, fully parametrized digital filter with the feature to be insensitive to variations in fractional tune. Examples are given for the SPS transverse feedback system and compared with measurements.

  12. Change in quality management in diabetes care groups and outpatient clinics after feedback and tailored support.

    Science.gov (United States)

    Campmans-Kuijpers, Marjo J; Baan, Caroline A; Lemmens, Lidwien C; Rutten, Guy E

    2015-02-01

    To assess the change in level of diabetes quality management in primary care groups and outpatient clinics after feedback and tailored support. This before-and-after study with a 1-year follow-up surveyed quality managers on six domains of quality management. Questionnaires measured organization of care, multidisciplinary teamwork, patient centeredness, performance results, quality improvement policy, and management strategies (score range 0-100%). Based on the scores, responders received feedback and a benchmark and were granted access to a toolbox of quality improvement instruments. If requested, additional support in improving quality management was available, consisting of an elucidating phone call or a visit from an experienced consultant. After 1 year, the level of quality management was measured again. Of the initially 60 participating care groups, 51 completed the study. The total quality management score improved from 59.8% (95% CI 57.0-62.6%) to 65.1% (62.8-67.5%; P teamwork improved (P = 0.001). Measuring quality management and providing feedback and a benchmark improves the level of quality management in care groups but not in outpatient clinics. The questionnaires might also be a useful asset for other diabetes care groups, such as Accountable Care Organizations. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  13. Phase-locked laser diode interferometer: high-speed feedback control system.

    Science.gov (United States)

    Suzuki, T; Sasaki, O; Higuchi, K; Maruyama, T

    1991-09-01

    We have previously proposed a phase-locked laser diode interferometer. In that previous interferometer, however, there was substantial room for improvement in the reduction of measurement time. This reduction is achieved by using a different process for generation of the feedback signal in which the output of a chargecoupled device image sensor is used effectively. We analyze the feedback control system of the interferometer as a discrete-time system and discuss the characteristics of the interferometer. It is shown that the measurement time is much shorter than that of the interferometer proposed previously.

  14. Modeling Discontinuous Phase Transitions in Gel Membranes: Focus on Hysteresis and Feedback Mechanisms

    Science.gov (United States)

    Kuksenok, Olga

    Feedback mechanisms are vital in a number of processes in biological systems. For example, feedback loops play an essential role during a limb development in mammals and are responsible for the asymmetric cell division to constrain the growth in plants to the specific regions. An integration of well-controlled feedback loops into the fully synthetic materials is an important step in designing a range of biomimetic functionalities. Herein, we focus on hydrogels functionalized with light-sensitive trisodium salt of copper chlorophyllin and study discontinuous phase transitions in these systems. Prior experimental studies had shown that illumination of these functionalized gels results in their heating and in discontinuous, first order phase transition upon the variation in temperature. Herein, we develop the first computational model for these gels; the framework of the model is based on the gel Lattice Spring Model, in this work we account for the gel heating under the illumination. The results of our simulations are in a good agreement with prior experimental studies. We focus on pattern development during the volume phase transitions in membranes of various thicknesses and show that one can effectively utilize light intensity to remotely control feedback loops in these systems.

  15. Low-level feedback control for the phase regulation of CLIC Drive Beam Klystrons

    CERN Document Server

    AUTHOR|(SzGeCERN)752526

    2015-01-01

    The requirement of luminosity loss below 1% raises tight tolerances for the phase and power stability of the CLIC drive beam (DB) klystrons and consequently for the high voltage pulse ripple of the modulators. A low-level RF (LLRF) feedback system needs to be developed and combined with the modulator in order to guarantee the phase and amplitude tolerances. To this aim, three feedback control strategies were investigated, i) Proportional Integral (PI) controller, ii) Linear Quadratic Integral Regulator (LQI) and iii) Model Predictive Controller (MPC). The klystron, as well as the incident phase noise were modelled and used for the design and evaluation of the controllers. First simulation results are presented along with future steps and directions.

  16. Central gas entropy excess as direct evidence for AGN feedback in galaxy groups and clusters

    Institute of Scientific and Technical Information of China (English)

    Yu Wang; Hai-Guang Xu; Jun-Hua Gu; Li-Yi Gu; Jing-Ying Wang; Zhong-Li Zhang

    2010-01-01

    By analyzing Chandra X-ray data of a sample of 21 galaxy groups and 19galaxy clusters,we find that in 31 sample systems there exists a significant central(R ≤10h-171 kpc)gas entropy excess(△K0),which corresponds to(=)0.1-0.5 keV per gas particle,beyond the power-law model that best fits the radial entropy profile of the outer regions.We also find a distinct correlation between the central entropy excess△K0 and K-band luminosity LK of the central dominating galaxies(CDGs),which is scaled as △K0 ∝ L1.6±0.4K,where LK is tightly associated with the mass of the supermassive black hole hosted in the CDG.In fact,if an effective mass-to-energy conversion-efficiency of 0.02 is assumed for the accretion process,the cumulative AGN feedback EAGNfeedback(=)ηMBHC2 yields an extra heating of(=)0.5-17.0keV per particle,which feedback is sufficient to explain the central entropy excess.In most cases,the AGN contribution can compensate the radiative loss of the X-ray gas within the cooling radius((=)0.002-2.2 keV per particle),and apparently exceeds the energy required to cause the scaling relations to deviate from the self-similar predictions((=)0.2-1.0 keV per particle).In contrast to the AGN feedback,the extra heating provided by supernova explosions accounts for(=)0.01-0.08 keV per particle in groups and is almost negligible in clusters.Therefore,the observed correlation between ΔK0 and LK can be considered as direct evidence for AGN feedback in galaxy groups and clusters.

  17. Feedback versus no feedback to improve patient outcome in group psychotherapy for eating disorders (F-EAT): A randomized clinical trial

    DEFF Research Database (Denmark)

    Davidsen, Annika Helgadóttir; Waaddegaard, Mette; Poulsen, Stig Bernt

    of continuous feedback on adherence and outcome in group psychotherapy. Methods/design: The trial is set up in a randomized design for outpatients diagnosed with bulimia nervosa, binge eating disorder, or eating disorder not otherwise specified (DSM-IV). They are allocated 1:1 to the experimental group...

  18. Output Feedback Control for Couple-Group Consensus of Multiagent Systems

    Directory of Open Access Journals (Sweden)

    Huanyu Zhao

    2014-01-01

    Full Text Available This paper deals with the couple-group consensus problem for multiagent systems via output feedback control. Both continuous- and discrete-time cases are considered. The consensus problems are converted into the stability problem of the error systems by the system transformation. We obtain two necessary and sufficient conditions of couple-group consensus in different forms for each case. Two different algorithms are used to design the control gains for continuous- and discrete-time case, respectively. Finally, simulation examples are given to show the effectiveness of the proposed results.

  19. The influence of extratropical cloud phase and amount feedbacks on climate sensitivity

    Science.gov (United States)

    Frey, William R.; Kay, Jennifer E.

    2017-07-01

    Global coupled climate models have large long-standing cloud and radiation biases, calling into question their ability to simulate climate and climate change. This study assesses the impact of reducing shortwave radiation biases on climate sensitivity within the Community Earth System Model (CESM). The model is modified by increasing supercooled cloud liquid to better match absorbed shortwave radiation observations over the Southern Ocean while tuning to reduce a compensating tropical shortwave bias. With a thermodynamic mixed-layer ocean, equilibrium warming in response to doubled CO2 increases from 4.1 K in the control to 5.6 K in the modified model. This 1.5 K increase in equilibrium climate sensitivity is caused by changes in two extratropical shortwave cloud feedbacks. First, reduced conversion of cloud ice to liquid at high southern latitudes decreases the magnitude of a negative cloud phase feedback. Second, warming is amplified in the mid-latitudes by a larger positive shortwave cloud feedback. The positive cloud feedback, usually associated with the subtropics, arises when sea surface warming increases the moisture gradient between the boundary layer and free troposphere. The increased moisture gradient enhances the effectiveness of mixing to dry the boundary layer, which decreases cloud amount and optical depth. When a full-depth ocean with dynamics and thermodynamics is included, ocean heat uptake preferentially cools the mid-latitude Southern Ocean, partially inhibiting the positive cloud feedback and slowing warming. Overall, the results highlight strong connections between Southern Ocean mixed-phase cloud partitioning, cloud feedbacks, and ocean heat uptake in a climate forced by greenhouse gas changes.

  20. Understanding EFL Students' Participation in Group Peer Feedback of L2 Writing: A Case Study from an Activity Theory Perspective

    Science.gov (United States)

    Yu, Shulin; Lee, Icy

    2015-01-01

    While the last three decades have witnessed a growing body of research on peer feedback in first language (L1) and second language (L2) writing, research about students' motives for participating in group peer feedback has remained underexplored. In order to fill this important gap, this case study, guided by the constructs of activity and motive…

  1. Noise-Induced Phase Locking and Frequency Mixing in an Optical Bistable System with Delayed Feedback

    Science.gov (United States)

    Misono, Masatoshi; Miyakawa, Kenji

    2011-11-01

    The interplay between stochastic resonance (SR) and coherence resonance (CR) is experimentally studied in an optical bistable system with a time-delayed feedback loop. We demonstrate that the phase of the noise-induced motion is locked to that of the periodic input when the ratio of their frequencies is a simple rational number. We also demonstrate that the interplay between SR and CR generates frequency-mixed modes, and that the efficiency of frequency mixing is enhanced by the optimum noise.

  2. Exploratory study of the characteristics of feedback in the reflective dialogue group given to medical students in a clinical clerkship

    Directory of Open Access Journals (Sweden)

    Chin-Chen Wen

    2015-02-01

    Full Text Available Purpose: Structured narrative reflective writing combined with guided feedback is an efficient teaching method for enhancing medical students’ reflective capacity. However, what kinds of feedback offered and reflection presented in a reflective group remain unclear. The aim of this study was to investigate the characteristics of feedback in a reflective dialogue group. Methods: Fifth-year medical students on a monthly interval rotation at the pediatric department of a medical center in eastern Taiwan during the 2012 academic year completed their reflective writing regarding patient and family psychosocial issues, and were subsequently debriefed in a 2-h group discussion session to receive feedback from a clinical tutor and peers. Content analysis was conducted to explore the characteristics of feedback and reflection presented in the reflective dialogue. The evaluative questionnaire regarding the benefits of reflection with others was administrated following the group session. Results: Forty students participated in five reflective groups and 108 psychosocial issues were discussed and identified. The tutor played an initiating role in the group discussion by providing six equal feedback types involving exploring new knowledge, initiating advanced discussion, highlighting the issues, and encouraging the students. The students provided eight types of feedback that involved a substantial deep discussion on psychosocial issues and action plans based on the complex interactive ecological network of clinical encounters. Each student attained 1.25 times the depth or breadth of reflection after receiving feedback and experienced the benefits of reflection with others. Conclusion: Through structured narrative reflective writing combined with pluralistic group discussion with a tutor and peers, the medical students had time to think deeply and broadly about psychosocial issues among patients and their family members. Facilitative feedback providing new

  3. Exploratory study of the characteristics of feedback in the reflective dialogue group given to medical students in a clinical clerkship

    Science.gov (United States)

    Wen, Chin-Chen; Lin, Meei-Ju; Lin, Chi-Wei; Chu, Shao-Yin

    2015-01-01

    Purpose Structured narrative reflective writing combined with guided feedback is an efficient teaching method for enhancing medical students’ reflective capacity. However, what kinds of feedback offered and reflection presented in a reflective group remain unclear. The aim of this study was to investigate the characteristics of feedback in a reflective dialogue group. Methods Fifth-year medical students on a monthly interval rotation at the pediatric department of a medical center in eastern Taiwan during the 2012 academic year completed their reflective writing regarding patient and family psychosocial issues, and were subsequently debriefed in a 2-h group discussion session to receive feedback from a clinical tutor and peers. Content analysis was conducted to explore the characteristics of feedback and reflection presented in the reflective dialogue. The evaluative questionnaire regarding the benefits of reflection with others was administrated following the group session. Results Forty students participated in five reflective groups and 108 psychosocial issues were discussed and identified. The tutor played an initiating role in the group discussion by providing six equal feedback types involving exploring new knowledge, initiating advanced discussion, highlighting the issues, and encouraging the students. The students provided eight types of feedback that involved a substantial deep discussion on psychosocial issues and action plans based on the complex interactive ecological network of clinical encounters. Each student attained 1.25 times the depth or breadth of reflection after receiving feedback and experienced the benefits of reflection with others. Conclusion Through structured narrative reflective writing combined with pluralistic group discussion with a tutor and peers, the medical students had time to think deeply and broadly about psychosocial issues among patients and their family members. Facilitative feedback providing new knowledge, deeper

  4. Enhancement of modal feedback in unstable resonators using mirrors with a phase step.

    Science.gov (United States)

    Piché, M; Cantin, D

    1991-08-01

    Numerical calculations using the Prony method have shown that the feedback coefficient in unstable laser resonators can be increased by factors of as much as 5 over the geometrical value using a mirror with a phase step at its center. A phase shift of close to pi over an area of an equivalent Fresnel number of 0.5 leads to minimum output losses. Experiments with a TEA CO(2) laser confirm the prediction. The results can be attributed to a cancellation of the output wave by destructive interference, which confines the laser beam around the resonator axis.

  5. Feedback Control System for Antenna Phase Difference in the LHCD Experiments

    Institute of Scientific and Technical Information of China (English)

    Jiang Min; Kuang Guangli; Shan Jiafang; Lin Jian'an; Kong Jun; HT-7 Team

    2005-01-01

    It is well accepted that lower hybrid current drive (LHCD) is the most efficient method for non-inductive current drive in fusion devices and the effect of the current drive is dependent on not only microwave power but also its grill phase shift. This paper presents a new kind of feedback control system for antenna phase difference in LHCD experiments. In this high-speed control system, a lot of new technologies and methods are incorporated. The results of the experiments show a very good agreement with the system design.

  6. Microwave oscillator with reduced phase noise by negative feedback incorporating microwave signals with suppressed carrier

    Science.gov (United States)

    Dick, G. J.; Saunders, J.

    1989-01-01

    Oscillator configurations which reduce the effect of 1/f noise sources for both direct feedback and stabilized local oscillator (STALO) circuits are developed and analyzed. By appropriate use of carrier suppression, a small signal is generated which suffers no loss of loop phase information or signal-to-noise ratio. This small signal can be amplified without degradation by multiplicative amplifier noise, and can be detected without saturation of the detector. Together with recent advances in microwave resonator Qs, these circuit improvements will make possible lower phase noise than can be presently achieved without the use of cryogenic devices.

  7. A statistical analysis of the Two Dimensional XMM-Newton Group Survey: The impact of feedback on group properties

    CERN Document Server

    Johnson, Ria; Finoguenov, Alexis

    2009-01-01

    (abridged) We present a statistical analysis of 28 nearby galaxy groups from the Two-Dimensional XMM-Newton Group Survey (2dXGS). We focus on entropy and the role of feedback, dividing the sample into cool core (CC) and non cool core (NCC) systems, the first time the latter have been studied in detail in the group regime. The coolest groups have steeper entropy profiles than the warmest systems, and NCC groups have higher central entropy and exhibit more scatter than their CC counterparts. We compare the entropy distribution of the gas in each system to the expected theoretical distribution ignoring non-gravitational processes. In all cases, the observed maximum entropy far exceeds that expected theoretically, and simple models for modifications of the theoretical entropy distribution perform poorly. Applying initial pre-heating, followed by radiative cooling, generally fails to match the low entropy behaviour, and only performs well when the difference between the maximum entropy of the observed and theoreti...

  8. Stimulus-locked responses of two phase oscillators coupled with delayed feedback

    Science.gov (United States)

    Krachkovskyi, Valerii; Popovych, Oleksandr V.; Tass, Peter A.

    2006-06-01

    For a system of two phase oscillators coupled with delayed self-feedback we study the impact of pulsatile stimulation administered to both oscillators. This system models the dynamics of two coupled phase-locked loops (PLLs) with a finite internal delay within each loop. The delayed self-feedback leads to a rich variety of dynamical regimes, ranging from phase-locked and periodically modulated synchronized states to chaotic phase synchronization and desynchronization. Remarkably, for large coupling strength the two PLLs are completely desynchronized. We study stimulus-locked responses emerging in the different dynamical regimes. Simple phase resets may be followed by a response clustering, which is intimately connected with long poststimulus resynchronization. Intriguingly, a maximal perturbation (i.e., maximal response clustering and maximal resynchronization time) occurs, if the system gets trapped at a stable manifold of an unstable saddle fixed point due to appropriately calibrated stimulus. Also, single stimuli with suitable parameters can shift the system from a stable synchronized state to a stable desynchronized state or vice versa. Our result show that appropriately calibrated single pulse stimuli may cause pronounced transient and/or long-lasting changes of the oscillators’ dynamics. Pulse stimulation may, hence, constitute an effective approach for the control of coupled oscillators, which might be relevant to both physical and medical applications.

  9. Stimulus-locked responses of two phase oscillators coupled with delayed feedback.

    Science.gov (United States)

    Krachkovskyi, Valerii; Popovych, Oleksandr V; Tass, Peter A

    2006-06-01

    For a system of two phase oscillators coupled with delayed self-feedback we study the impact of pulsatile stimulation administered to both oscillators. This system models the dynamics of two coupled phase-locked loops (PLLs) with a finite internal delay within each loop. The delayed self-feedback leads to a rich variety of dynamical regimes, ranging from phase-locked and periodically modulated synchronized states to chaotic phase synchronization and desynchronization. Remarkably, for large coupling strength the two PLLs are completely desynchronized. We study stimulus-locked responses emerging in the different dynamical regimes. Simple phase resets may be followed by a response clustering, which is intimately connected with long poststimulus resynchronization. Intriguingly, a maximal perturbation (i.e., maximal response clustering and maximal resynchronization time) occurs, if the system gets trapped at a stable manifold of an unstable saddle fixed point due to appropriately calibrated stimulus. Also, single stimuli with suitable parameters can shift the system from a stable synchronized state to a stable desynchronized state or vice versa. Our result show that appropriately calibrated single pulse stimuli may cause pronounced transient and/or long-lasting changes of the oscillators' dynamics. Pulse stimulation may, hence, constitute an effective approach for the control of coupled oscillators, which might be relevant to both physical and medical applications.

  10. Supervisor Feedback.

    Science.gov (United States)

    Hayman, Marilyn J.

    1981-01-01

    Investigated the effectiveness of supervisor feedback in contributing to learning counseling skills. Counselor trainees (N=64) were assigned to supervisor feedback, no supervisor feedback, or control groups for three training sessions. Results indicated counseling skills were learned best by students with no supervisor feedback but self and peer…

  11. Feedbacks from Focus Group Meeting on Training and Implementation of Building Energy Codes in China

    Energy Technology Data Exchange (ETDEWEB)

    Shui, Bin; Lin , Haiyan; Song, Bo; Halverson, Mark A.; Evans, Meredydd; Zhu, Xiaojiao

    2011-01-01

    A focus group meeting is a very effective quality research approach to collect information on a specific project. Through focus group meetings at both Changchun and Ningbo in August 2010, the project team gained a more complete understandings of key stakeholders (such as their education level), their training needs and expectations, key factors influencing their decision making, and incurred implementation difficulties. In addition, the meeting helped the project team (especially PNNL) improve its understanding of the implementation status of building energy codes in other regions (such as small cities and counties neighboring to urban areas, small townships and rural areas distant from urban areas). The collected feedbacks will serve as important input not only for better design of training materials and the development of an on-line training website, but also for development of follow-up projects to promote building energy codes in China.

  12. The Additive Impact of Group and Individual Publicly Displayed Feedback: Examining Individual Response Patterns and Response Generalization in a Safe-Driving Occupational Intervention

    Science.gov (United States)

    Ludwig, Timothy D.; Geller, E. Scott; Clarke, Steven W.

    2010-01-01

    Additive effects of publicly posting individual feedback following group goal-setting and feedback were evaluated. The turn-signal use of pizza deliverers was studied in a multiple baseline design across two pizza stores. After baseline observations, pizza deliverers voted on a group turn-signal goal and then received 4 weeks of group feedback on…

  13. APC/C and SCFcyclin F Constitute a Reciprocal Feedback Circuit Controlling S-Phase Entry

    Directory of Open Access Journals (Sweden)

    Rajarshi Choudhury

    2016-09-01

    Full Text Available The anaphase promoting complex/cyclosome (APC/C is an ubiquitin ligase and core component of the cell-cycle oscillator. During G1 phase, APC/C binds to its substrate receptor Cdh1 and APC/CCdh1 plays an important role in restricting S-phase entry and maintaining genome integrity. We describe a reciprocal feedback circuit between APC/C and a second ubiquitin ligase, the SCF (Skp1-Cul1-F box. We show that cyclin F, a cell-cycle-regulated substrate receptor (F-box protein for the SCF, is targeted for degradation by APC/C. Furthermore, we establish that Cdh1 is itself a substrate of SCFcyclin F. Cyclin F loss impairs Cdh1 degradation and delays S-phase entry, and this delay is reversed by simultaneous removal of Cdh1. These data indicate that the coordinated, temporal ordering of cyclin F and Cdh1 degradation, organized in a double-negative feedback loop, represents a fundamental aspect of cell-cycle control. This mutual antagonism could be a feature of other oscillating systems.

  14. Development of a Digital Control for the Phase Contrast Imaging Alignment Feedback System

    Science.gov (United States)

    Hirata, M.; Marinoni, A.; Rost, J. C.; Davis, E. M.; Porkolab, M.

    2016-10-01

    The Phase Contrast Imaging diagnostic is an internal reference interferometer that images density fluctuations on a 32-element linear detector array. Since proper operation of the system requires accurate alignment of a CO2 laser beam on a phase plate, beam motion due to vibrations of the DIII-D vessel need to be compensated up to 1 kHz. The feedback network controlling the steering mirrors currently uses a linear analog controller, but a digital controller can provide improved stability performance and flexibility. A prototype was developed using an Arduino Due, a low-cost microcontroller, to assess performance capabilities. Digital control parameters will be developed based on the measured frequency and phase response of the physical components. Finally, testing of the digital feedback system and the required revisions will be done to achieve successful performance. This upgrade to the linear analog controller is expected to be used routinely on similar diagnostics in fusion devices, especially in view of restricted access to the machine hall. Work supported in part by the US Department of Energy under DE-FG02-94ER54235, DE-FC02-04ER54698, and the Science Undergraduate Laboratory Internships Program (SULI).

  15. Sinusoidal phase-modulating fiber-optic interferometer fringe with a feedback control system.

    Science.gov (United States)

    Lv, Changrong; Duan, Fajie; Bo, En; Duan, Xiaojie; Feng, Fan; Fu, Xiao

    2014-09-20

    A displacement measurement system using a fiber-optic interferometer fringe projector with a feedback control system is presented and demonstrated. The system utilizes the integrating bucket method to detect the desired phase or the displacement and Fresnel reflection signal to realize measurement of the disturbance and feed it back to the modulated signal of the laser at the same time. The continuous signal truly reflects the error information, as the output light and reflected light share the same optical path. Practical experiments validate the feasibility of this method.

  16. AGN Feedback in Galaxy Groups: the Delicate Touch of Self-Regulated Outflows

    CERN Document Server

    Gaspari, M; D'Ercole, A; Melioli, C

    2011-01-01

    AGN heating, through massive subrelativistic outflows, might be the key to solve the long-lasting `cooling flow problem' in cosmological systems. In a previous paper, we showed that cold accretion feedback and, to a lesser degree, Bondi self-regulated models are in fact able to quench cooling rates for several Gyr, at the same time preserving the mainc ool core features, like observed density and temperature profiles. Is it true also for lighter systems, such as galaxy groups? The answer is globally yes, although with remarkable differences. Adopting a modified version of the AMR code FLASH 3.2, we found that successful 3D simulations with cold and Bondi models are almost convergent in the galaxy group environment, with mechanical efficiencies in the range 5.e-4 - 1.e-3 and 5.e-2 - 1.e-1, respectively. The evolutionary storyline of galaxy groups is dominated by a quasi-continuous gentle injection with sub-Eddington outflows (with mechanical power and velocity around 1.e44 erg/s and 1.e4 km/s). The cold and hy...

  17. A laterally-coupled distributed feedback laser with equivalent quarter-wave phase shift.

    Science.gov (United States)

    Li, Jingsi; Cheng, Julian

    2013-11-04

    We report the first laterally-coupled distributed feedback (LC-DFB) laser with a quarter-wave equivalent phase shift (EPS) realized by interference lithography (IL) and conventional photolithography. A specially designed sampled grating is fabricated on both sidewalls of a ridge waveguide to provide a quarter-wave EPS at the center of the cavity. The resulting laser exhibits stable single-mode lasing operation over a wide range of injection currents, with a side mode suppression ratio (SMSR) of 41.1 dB. This provides a practical, low-cost method to fabricate quarter-wave phase shifted DFB lasers with high performance without any epitaxial regrowth or the use of electron-beam lithography, thereby simplifying the fabrication of DFB lasers with stable and precise wavelengths, as single devices or as arrays in photonic integrated circuits.

  18. Fast photonic information processing using semiconductor lasers with delayed optical feedback: role of phase dynamics.

    Science.gov (United States)

    Nguimdo, Romain Modeste; Verschaffelt, Guy; Danckaert, Jan; Van der Sande, Guy

    2014-04-01

    Semiconductor lasers subject to delayed optical feedback have recently shown great potential in solving computationally hard tasks. By optically implementing a neuro-inspired computational scheme, called reservoir computing, based on the transient response to optical data injection, high processing speeds have been demonstrated. While previous efforts have focused on signal bandwidths limited by the semiconductor laser's relaxation oscillation frequency, we demonstrate numerically that the much faster phase response makes significantly higher processing speeds attainable. Moreover, this also leads to shorter external cavity lengths facilitating future on-chip implementations. We numerically benchmark our system on a chaotic time-series prediction task considering two different feedback configurations. The results show that a prediction error below 4% can be obtained when the data is processed at 0.25 GSamples/s. In addition, our insight into the phase dynamics of optical injection in a semiconductor laser also provides a clear understanding of the system performance at different pump current levels, even below solitary laser threshold. Considering spontaneous emission noise and noise in the readout layer, we obtain good prediction performance at fast processing speeds for realistic values of the noise strength.

  19. A temperature-based feedback control system for electromagnetic phased-array hyperthermia: theory and simulation.

    Science.gov (United States)

    Kowalski, M E; Jin, J M

    2003-03-07

    A hybrid proportional-integral-in-time and cost-minimizing-in-space feedback control system for electromagnetic, deep regional hyperthermia is proposed. The unique features of this controller are that (1) it uses temperature, not specific absorption rate, as the criterion for selecting the relative phases and amplitudes with which to drive the electromagnetic phased-array used for hyperthermia and (2) it requires on-line computations that are all deterministic in duration. The former feature, in addition to optimizing the treatment directly on the basis of a clinically relevant quantity, also allows the controller to sense and react to time- and temperature-dependent changes in local blood perfusion rates and other factors that can significantly impact the temperature distribution quality of the delivered treatment. The latter feature makes it feasible to implement the scheme on-line in a real-time feedback control loop. This is in sharp contrast to other temperature optimization techniques proposed in the literature that generally involve an iterative approximation that cannot be guaranteed to terminate in a fixed amount of computational time. An example of its application is presented to illustrate the properties and demonstrate the capability of the controller to sense and compensate for local, time-dependent changes in blood perfusion rates.

  20. Group Contingencies, Randomization of Reinforcers, and Criteria for Reinforcement, Self-Monitoring, and Peer Feedback on Reducing Inappropriate Classroom Behavior

    Science.gov (United States)

    Coogan, Brenda Anne; Kehle, Thomas J.; Bray, Melissa A.; Chafouleas, Sandra M.

    2007-01-01

    Considerable research has demonstrated the effectiveness of interdependent and unknown dependent group contingencies on reducing inappropriate classroom behavior. Several investigators have focused on the addition of self-monitoring and peer feedback to these interdependent and unknown dependent group contingencies in order to further improve…

  1. Online User Feedback in Early Phases of the Design Process: Lessons Learnt from Four Design Cases

    Directory of Open Access Journals (Sweden)

    Asbjørn Følstad

    2010-01-01

    Full Text Available Online user feedback, collected by means of internet survey tools, is a promising approach to obtain early user feedback on concepts and early prototypes. In this study, the collection and utilization of online user feedback was investigated in four design cases: all master student projects for industry clients involving seven student designers. A total of 272 user participants provided quantitative feedback. Half of these also provided qualitative feedback. One third of the qualitative feedback was perceived as useful by the student designers. The main usefulness of the feedback was related to strategic concept decisions rather than the interaction design of the early prototype. Lessons learnt are provided.

  2. Self-Other Agreement in Multisource Feedback: The Influence of Doctor and Rater Group Characteristics

    Science.gov (United States)

    Roberts, Martin J.; Campbell, John L.; Richards, Suzanne H.; Wright, Christine

    2013-01-01

    Introduction: Multisource feedback (MSF) ratings provided by patients and colleagues are often poorly correlated with doctors' self-assessments. Doctors' reactions to feedback depend on its agreement with their own perceptions, but factors influencing self-other agreement in doctors' MSF ratings have received little attention. We aimed to identify…

  3. Self-Other Agreement in Multisource Feedback: The Influence of Doctor and Rater Group Characteristics

    Science.gov (United States)

    Roberts, Martin J.; Campbell, John L.; Richards, Suzanne H.; Wright, Christine

    2013-01-01

    Introduction: Multisource feedback (MSF) ratings provided by patients and colleagues are often poorly correlated with doctors' self-assessments. Doctors' reactions to feedback depend on its agreement with their own perceptions, but factors influencing self-other agreement in doctors' MSF ratings have received little attention. We aimed to identify…

  4. Phase detector and phase feedback for a single bunch in a two-bunch damping ring for the SLAC Linear Collider

    Energy Technology Data Exchange (ETDEWEB)

    Schwarz, H.D.; Judkins, J.G.

    1987-03-01

    The synchronous phase of a bunch of positrons or electrons being damped in a SLAC Linear Collider (SLC) damping ring is dependent on beam intensity. Injection for alternate bunches into the SLC linac from the damping rings should occur at a constant phase. A phase detector was developed allowing the measurement of phase of a single-stored bunch in the presence of a second bunch in reference to the phase of the linac. The single-bunch phase is derived from beam position monitor signals using a switching scheme to separate the two bunches circulating in each damping ring. The hardware is described including feedback loops to stabilize the extraction phase.

  5. Group theoretical construction of planar noncommutative phase spaces

    Energy Technology Data Exchange (ETDEWEB)

    Ngendakumana, Ancille, E-mail: nancille@yahoo.fr; Todjihoundé, Leonard, E-mail: leonardt@imsp.uac.org [Institut de Mathématiques et des Sciences Physiques (IMSP), Porto-Novo (Benin); Nzotungicimpaye, Joachim, E-mail: kimpaye@kie.ac.rw [Kigali Institute of Education (KIE), Kigali (Rwanda)

    2014-01-15

    Noncommutative phase spaces are generated and classified in the framework of centrally extended anisotropic planar kinematical Lie groups as well as in the framework of noncentrally abelian extended planar absolute time Lie groups. Through these constructions the coordinates of the phase spaces do not commute due to the presence of naturally introduced fields giving rise to minimal couplings. By symplectic realizations methods, physical interpretations of generators coming from the obtained structures are given.

  6. Using standardized patient with immediate feedback and group discussion to teach interpersonal and communication skills to advanced practice nursing students.

    Science.gov (United States)

    Lin, Esther Ching-Lan; Chen, Shiah-Lian; Chao, Shu-Yuan; Chen, Yueh-Chih

    2013-06-01

    Interpersonal and communication skills (IPCS) are essential for advanced practice nursing (APN) in our increasingly complex healthcare system. The Standardized Patient (SP) is a promising innovative pedagogy in medical and healthcare education; however, its effectiveness for teaching IPCS to graduate nursing students remains unclear. We examined the effectiveness of using SP with SP feedback and group discussion to teach IPCS in graduate nursing education. Randomized-controlled study. First-year APN students in Taiwan. Participants were randomly assigned to the experimental (SP assessments with SP feedback and group discussion) or control (SP assessments only) group. There were two outcome indicators: IPCS and student learning satisfaction (SLS). The IPCS were assessed before and after the study in interviews with the SPs. SLS was measured when the study ended. All participants expressed high SLS (94.44%) and showed significant (p ≤ 0.025) improvements on IPCS total scores, interviewing, and counseling. However, there were no significant differences between groups. Qualitative feedback from encounters with SPs is described. Using SPs to teach IPCS to APN students produced a high SLS. The students learned and significantly improved their IPCS by interviewing SPs, but future studies are needed to confirm the effectiveness of SP feedback and group discussions. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Entropy amplification from energy feedback in simulated galaxy groups and clusters

    CERN Document Server

    Borgani, S; Kay, S T; Ponman, T J; Springel, V; Tozzi, P; Voit, G M

    2005-01-01

    We use hydrodynamical simulations of galaxy clusters and groups to study the effect of pre-heating on the entropy structure of the ICM. Our simulations account for non-gravitational heating of the gas either by imposing a minimum entropy floor at redshift z=3, or by considering feedback by galactic winds powered by supernova (SN) energy. In the adiabatic simulations we find that the entropy is increased out to the external regions as a consequence of the transition from clumpy to smooth accretion induced by extra heating. This result is in line with the predictions of the semi-analytical model by Voit et al. However, the introduction of radiative cooling substantially reduces this entropy amplification effect. While galactic winds of increasing strength are effective in regulating star formation, they have a negligible effect on the entropy profile of cluster-sized halos. Only in models where the action of the winds is complemented with diffuse heating corresponding to a pre-collapse entropy do we find a siza...

  8. Feedback control of an interacting Bose-Einstein condensate using phase-contrast imaging

    CERN Document Server

    Szigeti, Stuart S; Carvalho, Andre R R; Hope, Joseph J

    2010-01-01

    The linewidth of an atom laser is limited by density fluctuations in the Bose-Einstein condensate (BEC) from which the atom laser beam is outcoupled. In this paper we show that a stable spatial mode for an interacting BEC can be generated using a realistic control scheme that includes the effects of the measurement backaction. This model extends the feedback theory, based on a phase-contrast imaging setup, presented in \\cite{Szigeti:2009}. In particular, it is applicable to a BEC with large interatomic interactions and solves the problem of inadequacy of the mean-field (coherent state) approximation by utilising a fixed number state approximation. Our numerical analysis shows the control to be more effective for a condensate with a large nonlinearity.

  9. Feedback control of an interacting Bose-Einstein condensate using phase-contrast imaging

    Science.gov (United States)

    Szigeti, S. S.; Hush, M. R.; Carvalho, A. R. R.; Hope, J. J.

    2010-10-01

    The linewidth of an atom laser is limited by density fluctuations in the Bose-Einstein condensate (BEC) from which the atom laser beam is outcoupled. In this paper we show that a stable spatial mode for an interacting BEC can be generated using a realistic control scheme that includes the effects of the measurement backaction. This model extends the feedback theory, based on a phase-contrast imaging setup, presented by Szigeti, Hush, Carvalho, and Hope [Phys. Rev. APLRAAN1050-294710.1103/PhysRevA.80.013614 80, 013614 (2009)]. In particular, it is applicable to a BEC with large interatomic interactions and solves the problem of inadequacy of the mean-field (coherent state) approximation by utilizing a fixed number state approximation. Our numerical analysis shows the control to be more effective for a condensate with a large nonlinearity.

  10. X-ray Cavities in Galaxy Groups and Clusters: Central Gas Entropy Excess as Direct Evidence for AGN Feedback

    Indian Academy of Sciences (India)

    Yu Wang

    2011-03-01

    Observations of X-ray jets and cavities in clusters of galaxies observed by Chandra are briefly reviewed. A recent study on the excess of central gas entropy, which can be considered as direct evidence for AGN feedback in galaxy groups and clusters is presented. An expanded account of this study has been presented in RAA (Wang et al. 2010).

  11. Group awareness of social and cognitive performance in a CSCL environment: Effects of a peer feedback and reflection tool

    NARCIS (Netherlands)

    Phielix, Chris; Prins, Frans; Kirschner, Paul A.; Erkens, Gijsbert; Jaspers, Jos

    2010-01-01

    Phielix, C., Prins, F. J., Kirschner, P. A., Erkens, G., & Jaspers, J. (2011). Group awareness of social and cognitive performance in a CSCL environment: Effects of a peer feedback and reflection tool. Computers in Human Behavior, 27(3), 1087-1102. doi:10.1016/j.chb.2010.06.024

  12. Assessing the effects of positive feedback and reinforcement in the introduction phase of an ergonomic intervention.

    Science.gov (United States)

    Brandenburg, David L; Mirka, Gary A

    2005-01-01

    Resistance to change is common in ergonomic interventions, often resulting in negative consequences when the intervention's effectiveness is studied. A lab-based study assessed the effects of positive reinforcement during the intervention process. On Day 1 all participants performed a simple screw-driving task that placed stress on the cervicobrachial region through static loading. On Day 2 a control group received basic information about ergonomics and then performed the task using an ergonomic intervention that has been shown to reduce loading on these muscle groups. The experimental group received the same basic information but also received positive reinforcement while performing the task with the ergonomic intervention. Subjective task assessment surveys and body-part discomfort surveys were administered, and these, along with speed of performance, were assessed in both groups. The results showed a significantly (p positive subjective impression of the intervention for the feedback group than for the control group (29%-57% improvement) with no real changes in either the performance or discomfort levels. Applications of this research include improving workers' acceptance of ergonomic interventions in industrial and other settings. The reinforcement technique evaluated in this paper has yielded consistently positive effects in our ongoing ergonomic intervention research.

  13. Interest groups, the Lesotho Highlands Water Project Phase 1 and ...

    African Journals Online (AJOL)

    attempts to influence public policy and their representation ... concept 'interest group', while in the third I investigate inter- ... groups will play certain roles within this arena and articulate ... Formally organised; have other social functions; part of a governmental ..... social problems that are likely to occur during Phase 1B and.

  14. A phase plane graph based model of the ovulatory cycle lacking the "positive feedback" phenomenon

    Directory of Open Access Journals (Sweden)

    Kurbel Sven

    2012-08-01

    Full Text Available Abstract When hormones during the ovulatory cycle are shown in phase plane graphs, reported FSH and estrogen values form a specific pattern that resembles the leaning “&" symbol, while LH and progesterone (Pg values form a "boomerang" shape. Graphs in this paper were made using data reported by Stricker et al. [Clin Chem Lab Med 2006;44:883–887]. These patterns were used to construct a simplistic model of the ovulatory cycle without the conventional "positive feedback" phenomenon. The model is based on few well-established relations: hypothalamic GnRH secretion is increased under estrogen exposure during two weeks that start before the ovulatory surge and lasts till lutheolysis. the pituitary GnRH receptors are so prone to downregulation through ligand binding that this must be important for their function. in several estrogen target tissue progesterone receptor (PgR expression depends on previous estrogen binding to functional estrogen receptors (ER, while Pg binding to the expressed PgRs reduces both ER and PgR expression. Some key features of the presented model are here listed: High GnRH secretion induced by the recovered estrogen exposure starts in the late follicular phase and lasts till lutheolysis. The LH and FSH surges start due to combination of accumulated pituitary GnRH receptors and increased GnRH secretion. The surges quickly end due to partial downregulation of the pituitary GnRH receptors (64% reduction of the follicular phase pituitary GnRH receptors is needed to explain the reported LH drop after the surge. A strong increase in the lutheal Pg blood level, despite modest decline in LH levels, is explained as delayed expression of pituitary PgRs. Postponed pituitary PgRs expression enforces a negative feedback loop between Pg levels and LH secretions not before the mid lutheal phase. Lutheolysis is explained as a consequence of Pg binding to hypothalamic and pituitary PgRs that reduces local ER expression. When hypothalamic

  15. The effect of peer-group size on the delivery of feedback in basic life support refresher training: a cluster randomized controlled trial.

    Science.gov (United States)

    Cho, Youngsuk; Je, Sangmo; Yoon, Yoo Sang; Roh, Hye Rin; Chang, Chulho; Kang, Hyunggoo; Lim, Taeho

    2016-07-04

    Students are largely providing feedback to one another when instructor facilitates peer feedback rather than teaching in group training. The number of students in a group affect the learning of students in the group training. We aimed to investigate whether a larger group size increases students' test scores on a post-training test with peer feedback facilitated by instructor after video-guided basic life support (BLS) refresher training. Students' one-rescuer adult BLS skills were assessed by a 2-min checklist-based test 1 year after the initial training. A cluster randomized controlled trial was conducted to evaluate the effect of student number in a group on BLS refresher training. Participants included 115 final-year medical students undergoing their emergency medicine clerkship. The median number of students was 8 in the large groups and 4 in the standard group. The primary outcome was to examine group differences in post-training test scores after video-guided BLS training. Secondary outcomes included the feedback time, number of feedback topics, and results of end-of-training evaluation questionnaires. Scores on the post-training test increased over three consecutive tests with instructor-led peer feedback, but not differ between large and standard groups. The feedback time was longer and number of feedback topics generated by students were higher in standard groups compared to large groups on the first and second tests. The end-of-training questionnaire revealed that the students in large groups preferred the smaller group size compared to their actual group size. In this BLS refresher training, the instructor-led group feedback increased the test score after tutorial video-guided BLS learning, irrespective of the group size. A smaller group size allowed more participations in peer feedback.

  16. Improved synthetic-heterodyne Michelson interferometer vibrometer using phase and gain control feedback.

    Science.gov (United States)

    Galeti, José Henrique; Kitano, Cláudio; Connelly, Michael J

    2015-12-10

    Synthetic-heterodyne demodulation is a useful technique for dynamic displacement and velocity measurement using interferometric sensors as it can provide an output signal which is immune to interferometric drift. With the advent of cost effective, high-speed real-time signal processing systems and software, processing of the complex signals encountered in interferometry has become more feasible. In conventional synthetic-heterodyne demodulation schemes, to obtain the dynamic displacement or vibration of the object under test requires knowledge of the interferometer visibility and also the argument of two Bessel functions. In this paper, a new synthetic-heterodyne demodulation method is described leading to an expression for the dynamic displacement and velocity of the object under test that is significantly less sensitive to the received optical power. In addition, the application of two independent phase and gain feedback loops is used to compensate for the nonideal gain and phase response of the anti-aliasing filter required for the signal acquisition of the received wideband interferometer signal. The efficacy of the improved system is demonstrated by measuring the displacement sensitivity frequency response and linearity of a Piezoelectric Mirror-Shifter (PMS) over a range of 200 Hz-9 kHz. In addition, the system is used to measure the response of the PMS to triangular and impulse type stimuli. The experimental results show excellent agreement with measurements taken using two independent industry standard calibration methods.

  17. A Group-Period Phase Comparison Method Based on Equivalent Phase Comparison Frequency

    Institute of Scientific and Technical Information of China (English)

    DU Bao-Qiang; ZHOU Wei; DONG Shao-Feng; ZHOU Hai-Niu

    2009-01-01

    Based on the principle of equivalent phase comparison frequency, we propose a group-period phase comparison method. This method can be used to reveal the inherent relations between periodic signals and the change laws of the phase difference. If these laws are applied in the processing of the mutual relations between frequency signals, phase comparison can be accomplished without frequency normalization. Experimental results show that the method can enhance the measurement resolution to 10-13/s in the time domain.

  18. Background field functional renormalization group for absorbing state phase transitions.

    Science.gov (United States)

    Buchhold, Michael; Diehl, Sebastian

    2016-07-01

    We present a functional renormalization group approach for the active to inactive phase transition in directed percolation-type systems, in which the transition is approached from the active, finite density phase. By expanding the effective potential for the density field around its minimum, we obtain a background field action functional, which serves as a starting point for the functional renormalization group approach. Due to the presence of the background field, the corresponding nonperturbative flow equations yield remarkably good estimates for the critical exponents of the directed percolation universality class, even in low dimensions.

  19. Implementation and Impact of an Automated Group Monitoring and Feedback System to Promote Hand Hygiene Among Health Care Personnel

    Science.gov (United States)

    Conway, Laurie J.; Riley, Linda; Saiman, Lisa; Cohen, Bevin; Alper, Paul; Larson, Elaine L.

    2015-01-01

    Article-at-a-Glance Background Despite substantial evidence to support the effectiveness of hand hygiene for preventing health care–associated infections, hand hygiene practice is often inadequate. Hand hygiene product dispensers that can electronically capture hand hygiene events have the potential to improve hand hygiene performance. A study on an automated group monitoring and feedback system was implemented from January 2012 through March 2013 at a 140-bed community hospital. Methods An electronic system that monitors the use of sanitizer and soap but does not identify individual health care personnel was used to calculate hand hygiene events per patient-hour for each of eight inpatient units and hand hygiene events per patient-visit for the six outpatient units. Hand hygiene was monitored but feedback was not provided during a six-month baseline period and three-month rollout period. During the rollout, focus groups were conducted to determine preferences for feedback frequency and format. During the six-month intervention period, graphical reports were e-mailed monthly to all managers and administrators, and focus groups were repeated. Results After the feedback began, hand hygiene increased on average by 0.17 events/patient-hour in inpatient units (interquartile range = 0.14, p = .008). In outpatient units, hand hygiene performance did not change significantly. A variety of challenges were encountered, including obtaining accurate census and staffing data, engendering confidence in the system, disseminating information in the reports, and using the data to drive improvement. Conclusions Feedback via an automated system was associated with improved hand hygiene performance in the short term. PMID:25252389

  20. Midterm Peer Feedback in Problem-Based Learning Groups: The Effect on Individual Contributions and Achievement

    Science.gov (United States)

    Kamp, Rachelle J. A.; van Berkel, Henk J. M.; Popeijus, Herman E.; Leppink, Jimmie; Schmidt, Henk G.; Dolmans, Diana H. J. M.

    2014-01-01

    Even though peer process feedback is an often used tool to enhance the effectiveness of collaborative learning environments like PBL, the conditions under which it is best facilitated still need to be investigated. Therefore, this study investigated the effects of individual versus shared reflection and goal setting on students' individual…

  1. Midterm Peer Feedback in Problem-Based Learning Groups: The Effect on Individual Contributions and Achievement

    Science.gov (United States)

    Kamp, Rachelle J. A.; van Berkel, Henk J. M.; Popeijus, Herman E.; Leppink, Jimmie; Schmidt, Henk G.; Dolmans, Diana H. J. M.

    2014-01-01

    Even though peer process feedback is an often used tool to enhance the effectiveness of collaborative learning environments like PBL, the conditions under which it is best facilitated still need to be investigated. Therefore, this study investigated the effects of individual versus shared reflection and goal setting on students' individual…

  2. Chaos crisis and bistability of self-pulsing dynamics in a laser diode with phase-conjugate feedback

    Energy Technology Data Exchange (ETDEWEB)

    Virte, Martin; Karsaklian Dal Bosco, Andreas; Wolfersberger, Delphine; Sciamanna, Marc [Supelec, OPTEL Research Group, Laboratoire Materiaux Optiques, Photonique et Systemes, EA-4423, 2 rue Edouard Belin, F-57070 Metz (France)

    2011-10-15

    A laser diode subject to a phase-conjugate optical feedback can exhibit rich nonlinear dynamics and chaos. We report here on two bifurcation mechanisms that appear when increasing the amount of light being fed back to the laser. First, we report on a full suppression of chaos from a crisis induced by a saddle-node bifurcation on self-pulsing, so-called external-cavity-mode solutions (ECMs). Second, the feedback-dependent torus and saddle-node bifurcations on ECMs may be responsible for large regions of bistability between ECMs of different and high (beyond gigahertz) frequencies.

  3. Performance comparisons between passive-phase conjugation and decision-feedback equalizer for underwater acoustic communications

    Science.gov (United States)

    Yang, T. C.

    2004-05-01

    Passive-phase conjugation (PPC) uses passive time reversal to remove intersymbol interferences (ISI) for acoustic communications in a multipath environment. It is based on the theory of signal propagation in a waveguide, which says that the Green function (or the impulse response function) convolved with its time-reversed conjugate, summed over a large aperture vertical array of receivers is a delta function in space and time. A decision feedback equalizer (DFE) uses a nonlinear filter to remove ISI based on the minimum mean square errors (MSE) between the estimated and the true (or decision) symbols. These two approaches are motivated by different principles. In this paper, we analyze both using a common framework, illustrating the commonality and differences, pro and con between the two methods, and compare their performances in realistic ocean environments. The performance measures are MSE, output signal-to-noise ratio and bit error rate (BER) as a function of the number of receivers. For a small number of receivers, DFE outperforms PPC in all measures. As the number of receivers increases the BER for both processors approaches zero, but at a different rate. The results are supported by both simulated and real data. [Work supported by ONR.

  4. Absolute frequency synthesis of pulsed coherent light waves through phase-modulation active optical feedback.

    Science.gov (United States)

    Shimizu, K; Horiguchi, T; Koyamada, Y

    1996-11-15

    A novel method for the broadband absolute frequency synthesis of pulsed coherent lightwaves is demonstrated. It is based on pulse recirculation around an active optical feedback ring containing a delay-line fiber, an external phase modulator, an acousto-optic frequency shifter (AOFS), and a high-finesse Fabry-Perot étalon. The modulation frequency F(M) and the frequency shift F(AO) that are due to AOFS are designed so that their sum or difference equals the free-spectral range of the étalon and F(AO) is set at larger than the half-width at full maximum of its resonant peaks. If one of the peak frequencies is tuned to the frequency of the initial pulse, the frequency of the recirculating pulse jumps to the next peak for each round trip. In the experiment the absolute frequency is synthesized over a frequency span of 700 GHz around the initial stabilized frequency of the master laser.

  5. Linear permeability evolution of expanding conduits due to feedback between flow and fast phase change

    Science.gov (United States)

    Wang, Lichun; Cardenas, M. Bayani

    2017-05-01

    Conduits are ubiquitous and critical pathways for many fluids relevant for geophysical processes such as magma, water, and gases. Predicting flow through conduits is challenging when the conduit geometry coevolves with the flow. We theoretically show that the permeability (k) of a conduit whose walls are eroding due to fast phase change increases linearly with time because of a self-reinforcing mechanism. This simple result is surprising given complex feedbacks between flow, transport, and phase change. The theory is congruent with previous experimental observations of fracture dissolution in calcite. Supporting computational fracture dissolution experiments showed that k only slightly increases until the dissolution front reaches the narrowest conduit constriction, after which the linear evolution of k manifests. The theory holds across multiple scales and a broad range of Peclet and Damkohler numbers and thus advances the prediction of dynamic mass fluxes through expanding conduits in various geologic and environmental settings.Plain Language SummaryGeological conduits are ubiquitous present in the subsurface. In many situations, these conduits may enlarge through time due to erosion of its walls by dissolution and melting. This leads to strongly coupled flow and reactive transport processes where the flow dictates the wall's erosion and vice versa. As the conduit expands, so does its permeability and thus flow. Thus, predicting fluid flow and relevant transport processes through expanding conduits is challenging. In this study, we presented a theory for the linear time dependence of permeability for expanding conduits. The theory is congruent with previous observations from fracture dissolution in calcite. An additional series of our own computational experiments also aligns with the theory. The theory will be of interest to geoscientists and engineers in many fields such as hydrology, glaciology, and petroleum engineering, to name a few.

  6. Solving the Christoffel equation: Phase and group velocities

    Science.gov (United States)

    Jaeken, Jan W.; Cottenier, Stefaan

    2016-10-01

    We provide christoffel, a Python tool for calculating direction-dependent phase velocities, polarization vectors, group velocities, power flow angles and enhancement factors based on the stiffness tensor of a solid. It is built in a modular way to allow for efficient and flexible calculations, and the freedom to select and combine results as desired. All derivatives are calculated analytically, which circumvents possible numerical sampling problems. GNUPlot scripts are provided for convenient visualization.

  7. Phase analysis of sunspot group numbers on both solar hemispheres

    Institute of Scientific and Technical Information of China (English)

    Lin-Hua Deng; Zhong-Quan Qu; Xiao-Li Yan; Kai-Rang Wang

    2013-01-01

    Cross-correlation analysis and wavelet transform methods are proposed to investigate the phase relationship between the monthly sunspot group numbers in the solar northern and southern hemispheres.It is found that (1) the monthly sunspot group numbers in the northern hemisphere begin two months earlier than those in the southern one,which should lead to phase asynchrony between them but with a slight effect; (2) the Schwabe cycle length for the monthly sunspot group numbers in the two hemispheres obviously differs from each other,and the mean Schwabe cycle length of the monthly sunspot group numbers in the northern hemisphere is slightly larger than that in the southern one; (3) the monthly sunspot group numbers in the northern hemisphere precede those in the southern hemisphere during the years of about 1874-1927,after which,the southern hemisphere leads the northern hemisphere in the years 1928-1964,and then the northern hemisphere leads in time till the present.

  8. Sideband locking of a single-section semiconductor distributed-feedback laser in an optical phase-lock loop.

    Science.gov (United States)

    Satyan, Naresh; Vasilyev, Arseny; Liang, Wei; Rakuljic, George; Yariv, Amnon

    2009-11-01

    The bandwidth and performance of optical phase-lock loops (OPLLs) using single-section semiconductor lasers (SCLs) are severely limited by the nonuniform frequency modulation response of the lasers. It is demonstrated that this restriction is eliminated by the sideband locking of a single-section distributed-feedback SCL to a master laser in a heterodyne OPLL, thus enabling a delay-limited loop bandwidth. The lineshape of the phase-locked SCL output is characterized using a delayed self-heterodyne measurement.

  9. Radio galaxy feedback in X-ray selected groups from COSMOS: the effect on the ICM

    CERN Document Server

    Giodini, S; Finoguenov, A; Boehringer, H; Birzan, L; Zamorani, G; Oklopcic, A; Pierini, D; Pratt, G W; Schinnerer, E; Massey, R; Koekemoer, A M; Salvato, M; Sanders, D B; Kartaltepe, J S; Thompson, D

    2010-01-01

    We quantify the importance of the mechanical energy released by radio-galaxies inside galaxy groups. We use scaling relations to estimate the mechanical energy released by 16 radio-AGN located inside X-ray detected galaxy groups in the COSMOS field. By comparing this energy output to the host groups' gravitational binding energy, we find that radio galaxies produce sufficient energy to unbind a significant fraction of the intra-group medium. This unbinding effect is negligible in massive galaxy clusters with deeper potential wells. Our results correctly reproduce the breaking of self-similarity observed in the scaling relation between entropy and temperature for galaxy groups.

  10. XY-sliding phases - mirage of the Renormalization Group

    Science.gov (United States)

    Vayl, Steven; Kuklov, Anatoly; Oganesyan, Vadim

    The so called sliding XY phases in layered systems are predicted to occur if the one loop renormalization group (RG) flow renders the interlayer Josephson coupling irrelevant, while each layer still features broken U(1) symmetry. In other words, such a layered system remains essentially two-dimensional despite the presence of inter-layer Josephson coupling. We have analyzed numerically a layered system consisting of groups of asymmetric layers where the RG analysis predicts sliding phases to occur. Monte Carlo simulations of such a system have been conducted in the dual representation by Worm Algorithm in terms of the closed loops of J-currents for layer sizes varying from 4 ×4 to 640 ×640 and the number of layers - from 2 to 40. The resulting flow of the inter-layer XY-stiffness has been found to be inconsistent with the RG prediction and fully consistent with the behavior of the 3D standard XY model where the bare inter-layer Josephson coupling is much smaller than the intra-layer stiffness. This result emphasizes the importance of the compactness of the U(1) variable for 2D to 3D transformation. This work was supported by the NSF Grant PHY1314469.

  11. Effects of video-feedback on the communication, clinical competence and motivational interviewing skills of practice nurses: a pre-test posttest control group study.

    Science.gov (United States)

    Noordman, Janneke; van der Weijden, Trudy; van Dulmen, Sandra

    2014-10-01

    To examine the effects of individual video-feedback on the generic communication skills, clinical competence (i.e. adherence to practice guidelines) and motivational interviewing skills of experienced practice nurses working in primary care. Continuing professional education may be necessary to refresh and reflect on the communication and motivational interviewing skills of experienced primary care practice nurses. A video-feedback method was designed to improve these skills. Pre-test/posttest control group design. Seventeen Dutch practice nurses and 325 patients participated between June 2010-June 2011. Nurse-patient consultations were videotaped at two moments (T0 and T1), with an interval of 3-6 months. The videotaped consultations were rated using two protocols: the Maastrichtse Anamnese en Advies Scorelijst met globale items (MAAS-global) and the Behaviour Change Counselling Index. Before the recordings, nurses were allocated to a control or video-feedback group. Nurses allocated to the video-feedback group received video-feedback between T0 and T1. Data were analysed using multilevel linear or logistic regression. Nurses who received video-feedback appeared to pay significantly more attention to patients' request for help, their physical examination and gave significantly more understandable information. With respect to motivational interviewing, nurses who received video-feedback appeared to pay more attention to 'agenda setting and permission seeking' during their consultations. Video-feedback is a potentially effective method to improve practice nurses' generic communication skills. Although a single video-feedback session does not seem sufficient to increase all motivational interviewing skills, significant improvement in some specific skills was found. Nurses' clinical competences were not altered after feedback due to already high standards. © 2014 John Wiley & Sons Ltd.

  12. On The Use of A Phase Modulation Method for Decorrelation in Acoustic Feedback Cancellation

    DEFF Research Database (Denmark)

    Guo, Meng; Jensen, Søren Holdt; Jensen, Jesper

    2012-01-01

    A major problem in using an adaptive filter in acoustic feedback cancellation systems is that the loudspeaker signal is correlated with the signals entering the microphones of the audio system, leading to biased filter estimates. One possible solution for reducing this problem is by means...

  13. Exploring the trustworthiness and reliability of focus groups for obtaining useful feedback for evaluation of academic programs.

    Science.gov (United States)

    Rauf, Ayesha; Baig, Lubna; Jaffery, Tara; Shafi, Riffat

    2014-01-01

    At Shifa College of Medicine, evaluation is an integral part of the curriculum. We used focus groups as a tool to obtain in-depth information regarding students' experience with the new integrated, system- based curriculum. The purpose of this study was to explore the usefulness of focus groups in identifying important issues for curriculum improvement and to explore the trustworthiness and representativeness of data obtained through this strategy. In 2012, we used focus groups to seek feedback from students regarding their experience with the integrated curriculum. One course of each of the three preclinical years was selected for this purpose. Three parallel focus groups were conducted for each selected course. Each focus group was audio recorded, and the moderator and a volunteer student took additional notes during the session. The audio recordings were transcribed and data obtained from the three sources were analyzed, coded, and categorized independently by three investigators. Both manifest and latent themes were identified, using an inductive approach. Final agreement on themes was reached by comparison of the independently done thematic analysis by the three researchers. Reliability of data was established by comparing responses from the three parallel focus groups of each course. Trustworthiness of inferences was ensured by multiple coding, audit trail and member checking with focus group participants who reviewed the themes for validity. Most of the data on students' perceptions of their courses from each of the parallel groups were in agreement: Similar themes were seen within groups of the same class as well as across the three preclinical years. Focus groups can be a useful tool for collecting trustworthy and reliable information through a process that promotes interaction among student participants. They can support quantitative data from students and be used to support curriculum reform.

  14. APC/C and SCF(cyclin F) Constitute a Reciprocal Feedback Circuit Controlling S-Phase Entry.

    Science.gov (United States)

    Choudhury, Rajarshi; Bonacci, Thomas; Arceci, Anthony; Lahiri, Debojyoti; Mills, Christine A; Kernan, Jennifer L; Branigan, Timothy B; DeCaprio, James A; Burke, Daniel J; Emanuele, Michael J

    2016-09-20

    The anaphase promoting complex/cyclosome (APC/C) is an ubiquitin ligase and core component of the cell-cycle oscillator. During G1 phase, APC/C binds to its substrate receptor Cdh1 and APC/C(Cdh1) plays an important role in restricting S-phase entry and maintaining genome integrity. We describe a reciprocal feedback circuit between APC/C and a second ubiquitin ligase, the SCF (Skp1-Cul1-F box). We show that cyclin F, a cell-cycle-regulated substrate receptor (F-box protein) for the SCF, is targeted for degradation by APC/C. Furthermore, we establish that Cdh1 is itself a substrate of SCF(cyclin F). Cyclin F loss impairs Cdh1 degradation and delays S-phase entry, and this delay is reversed by simultaneous removal of Cdh1. These data indicate that the coordinated, temporal ordering of cyclin F and Cdh1 degradation, organized in a double-negative feedback loop, represents a fundamental aspect of cell-cycle control. This mutual antagonism could be a feature of other oscillating systems.

  15. The Lifetime of FRIIs in Groups and Clusters: Implications for Radio-Mode Feedback

    CERN Document Server

    Bird, Jonathan C; Kaiser, Christian R

    2007-01-01

    We determine the maximum lifetime t_max of 58 FRII radio jets found in 29 central group galaxies from cross correlation of the Berlind SDSS group catalog with the VLA FIRST survey. Mock catalogs of FRII sources were produced to match the selection criteria of FIRST and the redshift distribution of our parent sample, while an analytical model was used to calculate source sizes and luminosities. The maximum lifetime of FRII jets was then determined via a comparison of the observed and model projected length distributions. We estimate the average FRII lifetime is 1.2x10^7 years and the duty cycle is ~7x10^8 years. Degeneracies between t_max and the model parameters: jet power distribution, axial ratio, energy injection index, and ambient density introduce at most a factor of two uncertainty in our lifetime estimate. The radio active galactic nuclei (AGN) fraction in central group galaxies was calculated as a function of several group and host galaxy properties. We find greater group galaxy number, redder central...

  16. Superfluid phase transition with activated velocity fluctuations: Renormalization group approach.

    Science.gov (United States)

    Dančo, Michal; Hnatič, Michal; Komarova, Marina V; Lučivjanský, Tomáš; Nalimov, Mikhail Yu

    2016-01-01

    A quantum field model that incorporates Bose-condensed systems near their phase transition into a superfluid phase and velocity fluctuations is proposed. The stochastic Navier-Stokes equation is used for a generation of the velocity fluctuations. As such this model generalizes model F of critical dynamics. The field-theoretic action is derived using the Martin-Siggia-Rose formalism and path integral approach. The regime of equilibrium fluctuations is analyzed within the perturbative renormalization group method. The double (ε,δ)-expansion scheme is employed, where ε is a deviation from space dimension 4 and δ describes scaling of velocity fluctuations. The renormalization procedure is performed to the leading order. The main corollary gained from the analysis of the thermal equilibrium regime suggests that one-loop calculations of the presented models are not sufficient to make a definite conclusion about the stability of fixed points. We also show that critical exponents are drastically changed as a result of the turbulent background and critical fluctuations are in fact destroyed by the developed turbulence fluctuations. The scaling exponent of effective viscosity is calculated and agrees with expected value 4/3.

  17. Identifying clinical learning needs using structured group feedback: first year evaluation of pre-registration nursing and midwifery degree programmes.

    Science.gov (United States)

    Frazer, Kate; Connolly, Michael; Naughton, Corina; Kow, Veronica

    2014-07-01

    Facilitating and supporting clinical learning for student nurses and midwives are essential within their practice environments. Clinical placements provide unique opportunities in preparation for future roles. Understanding the experiences of first year student nurses and midwives following clinical exposures and examining the clinical facilitators and barriers can assist in maintaining and developing clinical supports. The study used a structured group feedback approach with a convenience sample of 223 first year nursing and midwifery students in one Irish university in April 2011 to ascertain feedback on the clinical aspects of their degree programme. Approximately 200 students participated in the process. Two key clinical issues were identified by students: facilitating clinical learning and learning experiences and needs. Positive learning environments, supportive staff and increased opportunities for reflection were important issues for first year students. The role of supportive mentoring staff in clinical practice is essential to enhance student learning. Students value reflection in practice and require more opportunities to engage during placements. More collaborative approaches are required to ensure evolving and adapting practice environments can accommodate student learning. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Collision avoidance ZEM/ZEV optimal feedback guidance for powered descent phase of landing on Mars

    Science.gov (United States)

    Zhang, Yao; Guo, Yanning; Ma, Guangfu; Zeng, Tianyi

    2017-03-01

    A novel zero-effort-miss (ZEM)/zero-effort-velocity (ZEV) optimal feedback guidance is proposed in order to rule out the possibility of Martian surface collision caused by the classical ZEM/ZEV optimal feedback guidance. The main approach is to add a collision avoidance term, which has self-adjustment capacity to ensure the near fuel optimality. Its main improvement is that it can not only successfully avoid collisions with the thruster constraint but also guarantee the near fuel optimality, and both of them are pivotal performances in Mars landing missions. Simulations are made to show the effectiveness of the proposed guidance and the parameters effects are simulated as well to analyze the properties of the proposed guidance.

  19. Analysis of Feedback Processes in Online Group Interaction: A Methodological Model

    Science.gov (United States)

    Espasa, Anna; Guasch, Teresa; Alvarez, Ibis M.

    2013-01-01

    The aim of this article is to present a methodological model to analyze students' group interaction to improve their essays in online learning environments, based on asynchronous and written communication. In these environments teacher and student scaffolds for discussion are essential to promote interaction. One of these scaffolds can be the…

  20. Rotation Modes Stability Analysis and Phase Compensation for Magnetically Suspended Flywheel Systems with Cross Feedback Controller and Time Delay

    Directory of Open Access Journals (Sweden)

    Yuan Ren

    2016-01-01

    Full Text Available This paper analyzes the effects of time delay on the stability of the rotation modes for the magnetically suspended flywheel (MSFW with strong gyroscopic effects. A multi-input multioutput system is converted into a single-input single-output control system with complex coefficient by variable reconstruction, and the stability equivalence of the systems before and after variable reconstruction is proven. For the rotation modes, the stability limits and corresponding vibration frequencies are found as a function of nondimensional magnetic stiffness and damping and nondimensional parameters of rotor speed and time delay. Additionally, the relationship between cross feedback control system stability and time delay is investigated. And an effective phase compensation method based on cross-channel is further presented. Simulation and experimental results are presented to demonstrate the correctness of the stability analysis method and the superiority of the phase compensation strategy.

  1. Personalised normative feedback for preventing alcohol misuse in university students: Solomon three-group randomised controlled trial.

    Directory of Open Access Journals (Sweden)

    Maria T Moreira

    Full Text Available BACKGROUND: Young people tend to over-estimate peer group drinking levels. Personalised normative feedback (PNF aims to correct this misperception by providing information about personal drinking levels and patterns compared with norms in similar aged peer groups. PNF is intended to raise motivation for behaviour change and has been highlighted for alcohol misuse prevention by the British Government Behavioural Insight Team. The objective of the trial was to assess the effectiveness of PNF with college students for the prevention of alcohol misuse. METHODOLOGY: Solomon three-group randomised controlled trial. 1751 students, from 22 British Universities, allocated to a PNF group, a normal control group, or a delayed measurement control group to allow assessment of any measurement effects. PNF was provided by email. Participants completed online questionnaires at baseline, 6- and 12-months (only 12-months for the delayed measurement controls. Drinking behaviour measures were (i alcohol disorders; (ii frequency; (iii typical quantity, (iv weekly consumption; (v alcohol-related problems; (vi perceived drinking norms; and (vii positive alcohol expectancies. Analyses focused on high-risk drinkers, as well as all students, because of research evidence for the prevention paradox in student drinkers. PRINCIPAL FINDINGS: Follow-up rates were low, with only 50% and 40% responding at 6- and 12-months, respectively, though comparable to similar European studies. We found no evidence for any systematic attrition bias. Overall, statistical analyses with the high risk sub-sample, and for all students, showed no significant effects of the intervention, at either time-point, in a completed case analysis and a multiple imputation analysis. CONCLUSIONS: We found no evidence for the effectiveness of PNF for the prevention of alcohol misuse and alcohol-related problems in a UK student population. REGISTRATION: Controlled-Trials.com ISRCTN30784467.

  2. A Saturated Output Feedback Controller for the Three Phase Voltage Sourced Reversible Boost Type Rectifier

    NARCIS (Netherlands)

    Escobar, Gerardo; Ortega, Romeo; Schaft, Arjan J. van der

    1998-01-01

    In this article, we present a saturating controller to regulate the output voltage load in a three phase Boost type rectifier. The controller only needs the output voltage signal to be implemented. Moreover, by forcing the inductance currents to track desired suitable sinusoidal signals in phase wit

  3. Combining a leadership course and multi-source feedback has no effect on leadership skills of leaders in postgraduate medical education. An intervention study with a control group

    DEFF Research Database (Denmark)

    Malling, Bente Vigh; Mortensen, Lene; Bonderup, Thomas

    2009-01-01

    BACKGROUND: Leadership courses and multi-source feedback are widely used developmental tools for leaders in health care. On this background we aimed to study the additional effect of a leadership course following a multi-source feedback procedure compared to multi-source feedback alone especially...... regarding development of leadership skills over time. METHODS: Study participants were consultants responsible for postgraduate medical education at clinical departments. STUDY DESIGN: pre-post measures with an intervention and control group. The intervention was participation in a seven-day leadership...... course. Scores of multi-source feedback from the consultants responsible for education and respondents (heads of department, consultants and doctors in specialist training) were collected before and one year after the intervention and analysed using Mann-Whitney's U-test and Multivariate analysis...

  4. We're All in This Together Now: Group Performance Feedback to Increase Classroom Team Data Collection

    Science.gov (United States)

    Pellecchia, Melanie; Connell, James E.; Eisenhart, Donald; Kane, Meghan; Schoener, Christine; Turkel, Kimberly; Riley, Megan; Mandell, David S.

    2011-01-01

    This study's primary goal was to evaluate the use of performance feedback procedures delivered to a classroom team to increase daily data collection. Performance feedback (PFB) was delivered to four classroom teams responsible for the daily collection of data representing student performance during prescribed instructional activities. Using a…

  5. We're All in This Together Now: Group Performance Feedback to Increase Classroom Team Data Collection

    Science.gov (United States)

    Pellecchia, Melanie; Connell, James E.; Eisenhart, Donald; Kane, Meghan; Schoener, Christine; Turkel, Kimberly; Riley, Megan; Mandell, David S.

    2011-01-01

    This study's primary goal was to evaluate the use of performance feedback procedures delivered to a classroom team to increase daily data collection. Performance feedback (PFB) was delivered to four classroom teams responsible for the daily collection of data representing student performance during prescribed instructional activities. Using a…

  6. Cavity-induced phase stability to decelerate a fast molecular beam via feedback-controlled time-varying optical pumps

    CERN Document Server

    Lan, Zhihao

    2014-01-01

    We have identified a novel phase stability mechanism from the intracavity field-induced self-organization of a fast-moving molecular beam into travelling molecular packets in the bad cavity regime, which is then used to decelerate the molecular packets by feedback-controlled time-varying laser pumps to the cavity. We first applied the linear stability analysis to derive an expression for this self-organization in the adiabatic limit and show that the self-organization of the beam leads to the formation of travelling molecular packets, which in turn function as a dynamic Bragg grating, thus modulating periodically the intracavity field by superradiant scattering of the pump photons. The modulation encodes the position information of the molecular packets into the output of the intracavity field instantaneously. We then applied time-varying laser pumps that are automatically switched by the output of the intracavity field to slow down the molecular packets via a feedback mechanism and found that most of the mol...

  7. Fast island phase identification for tearing mode feedback control on J-TEXT tokamak

    Science.gov (United States)

    Rao, B.; Li, D.; Hu, F. R.; Ding, Y. H.; Hu, Q. M.; Jin, H.

    2016-11-01

    A new method to control the tearing mode (TM) in tokamaks has been proposed [Q. Hu and Q. Yu, Nucl. Fusion 56, 034001 (5pp.) (2016)], according to which, the external resonant magnetic perturbation needs to be applied in certain magnetic island phase regions. Therefore, it is very important to identify the helical phase of magnetic islands in real time. The TM in tokamak plasmas is normally rotating and carries magnetic oscillations, which are known as Mirnov oscillations and can be detected by Mirnov probes. When the O-point or X-point of the magnetic island passes through the probe, the signal will experience a zero-crossing. A poloidal Mirnov probe array and a corresponding island phase identification method are presented. A field-programmable gate array is used to provide the magnetic island helical phase in real time by using multichannel zero crossing detection. This system has been developed on the J-TEXT tokamak and works well. This paper introduces the establishment of the fast magnetic island phase identifying system.

  8. Phase space picture of quantum mechanics group theoretical approach

    CERN Document Server

    Kim, Y S

    1991-01-01

    This book covers the theory and applications of the Wigner phase space distribution function and its symmetry properties. The book explains why the phase space picture of quantum mechanics is needed, in addition to the conventional Schrödinger or Heisenberg picture. It is shown that the uncertainty relation can be represented more accurately in this picture. In addition, the phase space picture is shown to be the natural representation of quantum mechanics for modern optics and relativistic quantum mechanics of extended objects.

  9. Quantitative feedback theory and zero phase error tracking control combined robust control for radar truck leveling simulator

    Institute of Scientific and Technical Information of China (English)

    LING; Xuan; LI; Xiao-hui; ZHU; Yu-quan; FENG; Tian-lin

    2009-01-01

    Radar leveling system is the key equipment for improving the radar mobility and survival capability. A combined quantitative feedback theory(QFT)controller is designed for the radar truck leveling simulator in this paper, which suffers from strong nonlinearities and system parameter uncertainties. QFT can reduce the plant uncertainties and stabilize the system, but it fails to obtain high-precision tracking. This drawback can be solved by a robust QFT control scheme based on zero phase error tracking control(ZPETC)compensation. The combined controller not only possesses high robustness, but greatly improves the system performance. To verify the effectiveness and the potential of the proposed controller, a series of experiments have been carried out. Experimental results have demonstrated its robustness against a large range of parameters variation and high tracking precision performance, as well as its capability of restraining the load coupling among channels. The combined QFT controller can drive the radar truck leveling platform accurately, quickly and stably.

  10. Feedback phase correction of Bessel beams in confocal line light-sheet microscopy: a simulation study.

    Science.gov (United States)

    Moosavi, S Hoda; Gohn-Kreuz, Cristian; Rohrbach, Alexander

    2013-08-10

    Confocal line detection has been shown to improve contrast in light-sheet-based microscopy especially when illuminating the sample by Bessel beams. Besides their self-reconstructing capability, the stability in propagation direction of Bessel beams allows to block the unwanted emission light from the Bessel beam's ring system. However, due to phase aberrations induced especially at the border of the specimen, Bessel beams may not propagate along lines parallel to the slit detector. Here we present a concept of how to correct the phase of each incident Bessel beam such that the efficiency of confocal line detection is improved by up to 200%-300%. The applicability of the method is verified by the results obtained from numerical simulations based on the beam propagation method.

  11. Characteristics of phase-averaged equations for modulated wave groups

    NARCIS (Netherlands)

    Klopman, G.; Petit, H.A.H.; Battjes, J.A.

    2000-01-01

    The project concerns the influence of long waves on coastal morphology. The modelling of the combined motion of the long waves and short waves in the horizontal plane is done by phase-averaging over the short wave motion and using intra-wave modelling for the long waves, see e.g. Roelvink (1993). Th

  12. Locking phenomenon of polarization flipping in He-Ne laser with a phase anisotropy feedback cavity.

    Science.gov (United States)

    Chen, Wenxue; Zhang, Shulian; Long, Xingwu

    2012-03-01

    In this article, the locking phenomenon of polarization flipping is reported. A model that integrates the model of the equivalent cavity of a Fabry-Perot interferometer and Lamb's semiclassical theory is built to explain the locking phenomenon. On the basis of analysis of the model, a method is proposed to release the locking of polarization flipping. After solving the problem of lock-in, the system in this paper can be used to measure small stress of the optical component and phase retardation of the birefringence component.

  13. PEBB Feedback Control Low Library. Volume 1: Three-Phase Inverter Control Algorithms

    Science.gov (United States)

    1999-01-01

    ship propulsion electrical loads are powered from a common set of prime movers. Presently, the current generation of PEBB-like devices include high-power, fast-switching, high-bandwidth dc-dc converters and dc-ac inverters. This report summarized the algorithms required to control a conventional three-phase inverter. First, implementation issues regarding the Sine-Triangle Pulse-Width-Modulation and Space-Vector Modulation are presented with an emphasis placed on digital realizations. Then, two current control schemes are documented via analysis, design example, and

  14. Feed-back control of 2/1 locked mode phase: experiment on DIII-D and modeling for ITER

    Science.gov (United States)

    Choi, W.; Olofsson, K. E. J.; Sweeney, R.; Volpe, F. A.

    2016-10-01

    A model has been developed for ITER to predict the dynamics of saturated m / n = 2/1 tearing modes subject to various torques. The modes, with finite moment of inertia, are modeled as surface currents interacting with error fields, applied magnetic perturbations generated by internal and external non-axisymmetric coils, the vacuum vessel, and the first wall. Using this model, a feed-back controller has been designed to control the phase of locked modes. As predicted by simulation, experimental results on DIII-D show a simple fixed-gain controller can impose a desired constant phase or entrain the mode at a desired constant frequency (e.g. 20 Hz). For a given current in the control coils, a maximum entrainment frequency exists and is dependent on island width. The performance of such a controller in ITER is hereby simulated. The controller is expected to be useful in assisting island suppression with electron cyclotron current drive, as well as to prevent large amplitude locked modes and possible disruption. This work was supported in part by the US Department of Energy under DE-SC0008520.

  15. Volunteer feedback and perceptions after participation in a phase I, first-in-human Ebola vaccine trial: An anonymous survey

    Science.gov (United States)

    Dayer, Julie-Anne; Siegrist, Claire-Anne; Huttner, Angela

    2017-01-01

    The continued participation of volunteers in clinical trials is crucial to advances in healthcare. Few data are available regarding the satisfaction and impressions of healthy volunteers after participation in phase I trials, many of which lead to unexpected adverse events. We report feedback from over 100 adult volunteers who took part in a first-in-human trial conducted in a high-income country testing an experimental Ebola vaccine causing significant reactogenicity, as well as unexpected arthritis in one fifth of participants. The anonymous, internet-based satisfaction survey was sent by email to all participants upon their completion of this one-year trial; it asked 24 questions concerning volunteers’ motivations, impressions of the trial experience, and overall satisfaction. Answers were summarized using descriptive statistics. Of the 115 trial participants, 103 (90%) filled out the survey. Fifty-five respondents (53%) were male. Thirty-five respondents (34%) were healthcare workers, many of whom would deploy to Ebola-affected countries. All respondents cited scientific advancement as their chief motivation for participation, while 100/103 (97%) and 61/103 (59%) reported additional “humanitarian reasons” and potential protection from Ebolavirus, respectively. Although investigators had documented adverse events in 97% of trial participants, only 74 of 103 respondents (72%) recalled experiencing an adverse event. All reported an overall positive experience, and 93/103 (90%) a willingness to participate in future trials. Given the high level of satisfaction, no significant associations could be detected between trial experiences and satisfaction, even among respondents reporting adverse events lasting weeks or months. Despite considerable reactogenicity and unexpected vaccine-related arthritis, all survey respondents reported overall satisfaction. While this trial’s context was unique, the positive feedback is likely due at least in part to the intense

  16. Feedback on video recorded consultations in medical teaching: why students loathe and love it – a focus-group based qualitative study

    Directory of Open Access Journals (Sweden)

    Baerheim Anders

    2005-07-01

    Full Text Available Abstract Background Feedback on videotaped consultations is a useful way to enhance consultation skills among medical students. The method is becoming increasingly common, but is still not widely implemented in medical education. One obstacle might be that many students seem to consider this educational approach a stressful experience and are reluctant to participate. In order to improve the process and make it more acceptable to the participants, we wanted to identify possible problems experienced by students when making and receiving feedback on their video taped consultations. Methods Nineteen of 75 students at the University of Bergen, Norway, participating in a consultation course in their final term of medical school underwent focus group interviews immediately following a video-based feedback session. The material was audio-taped, transcribed, and analysed by phenomenological qualitative analysis. Results The study uncovered that some students experienced emotional distress before the start of the course. They were apprehensive and lacking in confidence, expressing fear about exposing lack of skills and competence in front of each other. The video evaluation session and feedback process were evaluated positively however, and they found that their worries had been exaggerated. The video evaluation process also seemed to help strengthen the students' self esteem and self-confidence, and they welcomed this. Conclusion Our study provides insight regarding the vulnerability of students receiving feedback from videotaped consultations and their need for reassurance and support in the process, and demonstrates the importance of carefully considering the design and execution of such educational programs.

  17. Extended Group Contribution Model for Polyfunctional Phase Equilibria

    DEFF Research Database (Denmark)

    Abildskov, Jens

    -liquid equilibria from data on binary mixtures, composed of structurally simple molecules with a single functional group. More complex is the situation with mixtures composed of structurally more complicated molecules or molecules with more than one functional group. The UNIFAC method is extended to handle...... polyfunctional group situations, based on additional information on molecular structure. The extension involves the addition of second-order correction terms to the existing equation. In this way the current first-order formulation is retained. The second-order concept is developed for mixture properties based....... In chapter 4 parameters are estimated for the first-order UNIFAC model, based on which parameters are estimated for one of the second-order models described in chapter 3. The parameter estimation is based on measured binary data on around 4000 systems, covering 11 C-, H- and O-containing functional groups...

  18. The Fossil Phase in the Life of a Galaxy Group

    CERN Document Server

    von Benda-Beckmann, Alexander M; Gottloeber, Stefan; Hoeft, Matthias; Khalatyan, Arman; Klypin, Anatoly; Mueller, Volker

    2007-01-01

    We investigate the origin and evolution of fossil groups in a concordance LCDM cosmological simulation. We consider haloes with masses between $(1-5)\\times10^{13} \\hMsun$ and study the physical mechanisms that lead to the formation of the large gap in magnitude between the brightest and the second most bright group member, which is typical for these fossil systems. Fossil groups are found to have high dark matter concentrations, which we can relate to their early formation time. The large magnitude-gaps arise after the groups have build up half of their final mass, due to merging of massive group members. We show that the existence of fossil systems is primarily driven by the relatively early infall of massive satellites, and that we do not find a strong environmental dependence for these systems. In addition, we find tentative evidence for fossil group satellites falling in on orbits with typically lower angular momentum, which might lead to a more efficient merger onto the host. We find a population of grou...

  19. Audio Feedback -- Better Feedback?

    Science.gov (United States)

    Voelkel, Susanne; Mello, Luciane V.

    2014-01-01

    National Student Survey (NSS) results show that many students are dissatisfied with the amount and quality of feedback they get for their work. This study reports on two case studies in which we tried to address these issues by introducing audio feedback to one undergraduate (UG) and one postgraduate (PG) class, respectively. In case study one…

  20. Phases and Patterns of Group Development in Virtual Learning Teams

    Science.gov (United States)

    Yoon, Seung Won; Johnson, Scott D.

    2008-01-01

    With the advancement of Internet communication technologies, distributed work groups have great potential for remote collaboration and use of collective knowledge. Adopting the Complex Adaptive System (CAS) perspective (McGrath, Arrow, & Berdhal, "Personal Soc Psychol Rev" 4 (2000) 95), which views virtual learning teams as an adaptive and…

  1. The Reliability of Multisource Feedback in Competency-Based Assessment Programs: The Effects of Multiple Occasions and Assessor Groups

    NARCIS (Netherlands)

    Moonen-van Loon, J.M.; Overeem, K.; Govaerts, M.J.; Verhoeven, B.H.; Vleuten, C.P.M. van der; Driessen, E.W.

    2015-01-01

    PURPOSE: Residency programs around the world use multisource feedback (MSF) to evaluate learners' performance. Studies of the reliability of MSF show mixed results. This study aimed to identify the reliability of MSF as practiced across occasions with varying numbers of assessors from different prof

  2. Business Activity Monitoring: Real-Time Group Goals and Feedback Using an Overhead Scoreboard in a Distribution Center

    Science.gov (United States)

    Goomas, David T.; Smith, Stuart M.; Ludwig, Timothy D.

    2011-01-01

    Companies operating large industrial settings often find delivering timely and accurate feedback to employees to be one of the toughest challenges they face in implementing performance management programs. In this report, an overhead scoreboard at a retailer's distribution center informed teams of order selectors as to how many tasks were…

  3. Feedback actions of estradiol on GnRH secretion during the follicular phase of the estrous cycle.

    Science.gov (United States)

    Karsch, F J; Evans, N P

    1996-01-01

    The pattern of GnRH secretion during the follicular phase of the estrous cycle of sheep is characterized by an initial marked change in episodic secretion (increased frequency and decreased amplitude) followed by a massive and sustained discharge-the preovulatory GnRH surge. Studies employing a physiological model for the follicular phase have revealed that estradiol has profound and complex feedback effects on GnRH release during the preovulatory period. These include both quantitative effects on pulses (stimulation of frequency, inhibition of amplitude) and qualitative effects (altering pulse shape, stimulating interpulse secretion), in addition to inducing a preovulatory GnRH surge. In stimulating the surge, estradiol causes a highly characteristic change in the minute-to-minute pattern of GnRH in hypophyseal portal blood. Initially, a strictly episodic pattern gives way to one in which GnRH is consistently elevated between pulses. Then, following enhancement of both pulsatile and interpulse components, GnRh becomes extremely high and variable for the majority of the surge. From this point, a regular and well organized pulse pattern is not apparent. The characteristic time course of GnRH at surge onset provides insight into possible mechanistic changes in the GnRH neurosecretory system. Such changes include quantitative and qualitative alterations in the pulse generating mechanism, recruitment of a surge specific population of GnRH neurones, morphologic alterations in GnRH neurones and neighboring cells, and changes in efficiency or route of delivery of GnRH from its site of release to the portal vasculature. These possibilities, while untested and speculative, provide a conceptual framework for future research.

  4. Double-negative feedback between S-phase cyclin-CDK and CKI generates abruptness in the G1/S switch

    Directory of Open Access Journals (Sweden)

    Rainis eVenta

    2012-12-01

    Full Text Available The G1/S transition is a crucial decision point in the cell cycle. At G1/S, there is an abrupt switch from a state of high CDK inhibitor (CKI levels and low S-phase CDK activity to a state of high S-phase CDK activity and degraded CKI. In budding yeast, this transition is triggered by phosphorylation of the Cdk1 inhibitor Sic1 at multiple sites by G1-phase CDK (Cln1,2-Cdk1 and S-phase CDK (Clb5,6-Cdk1 complexes. Using mathematical modeling we demonstrate that the mechanistic basis for the abruptness and irreversibility of the G1/S transition is the highly specific phosphorylation of Sic1 by S-phase CDK complex. This switch is generated by a double negative feedback loop in which S-CDK1 phosphorylates Sic1, thus targeting it for destruction, and thereby liberating further S-CDK1 from the inhibitory Sic1-S-CDK1 complex. Our model predicts that the abruptness of the switch depends upon a strong binding affinity within the Sic1-S-CDK inhibitory complex. In vitro phosphorylation analysis using purified yeast proteins revealed that free Clb5-Cdk1 can create positive feedback by phosphorylating Sic1 that is bound in the inhibitory complex, and that Sic1 inhibits Clb5-Cdk1 with a sub-nanomolar inhibition constant. Our model also predicts that if the G1-phase CDK complex is too efficient at targeting Sic1 for destruction, then G1/S becomes a smooth and readily reversible transition. We propose that the optimal role for the G1-phase CDK in the switch would not be to act as a kinase activity directly responsible for abrupt degradation of CKI, but rather to act as a priming signal that initiates a positive feedback loop driven by emerging free S-phase CDK.

  5. Effects of auditory feedback during gait training on hemiplegic patients' weight bearing and dynamic balance ability.

    Science.gov (United States)

    Ki, Kyong-Il; Kim, Mi-Sun; Moon, Young; Choi, Jong-Duk

    2015-04-01

    [Purpose] This study examined the effects of auditory feedback during gait on the weight bearing of patients with hemiplegia resulting from a stroke. [Subjects] Thirty hemiplegic patients participated in this experiment and they were randomly allocated to an experimental group and a control group. [Methods] Both groups received neuro-developmental treatment for four weeks and the experimental group additionally received auditory feedback during gait training. In order to examine auditory feedback effects on weight bearing during gait, a motion analysis system GAITRite was used to measure the duration of the stance phase and single limb stance phase of the subjects. [Results] The experimental group showed statistically significant improvements in the duration of the stance phase and single limb stance phase of the paretic side and the results of the Timed Up and Go Test after the training. [Conclusion] Auditory feedback during gait training significantly improved the duration of the stance phase and single limb stance phase of hemiplegic stroke patients.

  6. High-Resolution Group Quantization Phase Processing Method in Radio Frequency Measurement Range.

    Science.gov (United States)

    Du, Baoqing; Feng, Dazheng; Tang, Yaohua; Geng, Xin; Zhang, Duo; Cai, Chaofeng; Wan, Maoquan; Yang, Zhigang

    2016-07-08

    Aiming at the more complex frequency translation, the longer response time and the limited measurement precision in the traditional phase processing, a high-resolution phase processing method by group quantization higher than 100 fs level is proposed in radio frequency measurement range. First, the phase quantization is used as a step value to quantize every phase difference in a group by using the fixed phase relationships between different frequencies signals. The group quantization is formed by the results of the quantized phase difference. In the light of frequency drift mainly caused by phase noise of measurement device, a regular phase shift of the group quantization is produced, which results in the phase coincidence of two comparing signals which obtain high-resolution measurement. Second, in order to achieve the best coincidences pulse, a subtle delay is initiatively used to reduce the width of the coincidences fuzzy area according to the transmission characteristics of the coincidences in the specific medium. Third, a series of feature coincidences pulses of fuzzy area can be captured by logic gate to achieve the best phase coincidences information for the improvement of the measurement precision. The method provides a novel way to precise time and frequency measurement.

  7. Facilitated patient experience feedback can improve nursing care: a pilot study for a phase III cluster randomised controlled trial

    Science.gov (United States)

    2013-01-01

    Background England’s extensive NHS patient survey programme has not fulfilled government promises of widespread improvements in patients’ experiences, and media reports of poor nursing care in NHS hospitals are increasingly common. Impediments to the surveys’ impact on the quality of nursing care may include: the fact that they are not ward-specific, so nurses claim “that doesn’t happen on my ward”; nurses’ scepticism about the relevance of patient feedback to their practice; and lack of prompt communication of results. The surveys’ impact could be increased by: conducting ward-specific surveys; returning results to ward staff more quickly; including patients’ written comments in reports; and offering nurses an opportunity to discuss the feedback. Very few randomised trials have been conducted to test the effectiveness of patient feedback on quality improvement and there have been few, if any, published trials of ward-specific patient surveys. Methods Over two years, postal surveys of recent inpatients were conducted at four-monthly intervals in 18 wards in two NHS Trusts in England. Wards were randomly allocated to Basic Feedback (ward-specific printed patient survey results including patients’ written comments sent to nurses by letter); Feedback Plus (in addition to printed results, ward meetings to discuss results and plan improvements) or Control (no active feedback of survey results). Patient survey responses to questions about nursing care were used to compute wards’ average Nursing Care Scores at each interval. Nurses’ reactions to the patient feedback were recorded. Results Conducting ward-level surveys and delivering ward-specific results was feasible. Ward meetings were effective for engaging nurses and challenging scepticism and patients’ written comments stimulated interest. 4,236 (47%) patients returned questionnaires. Nursing Care Scores improved more for Feedback Plus than Basic Feedback or Control (difference between

  8. A Brief Investigation of Adaptive Decision Feedback Equalization for Digital HF Links Employing PSK (Phase Shift Keying) Modulation.

    Science.gov (United States)

    2014-09-26

    INVESTIGATION OF ADAPTIVE DECISION FEEDBACK EQUALIZATION FOR DIGITAL HF LINKS EMPLOYING PSKK MODULATION B.E. Sawyer Mission Research Corporation P.O. Drawer 719...IF THE ADDRESSEE IS NO LONGER EMPLOYED BY YOUR ORGANIZATION. 4.’I 4,D % ,=..- ..: O4.’ UNCLASSIFIED SECURITY CLASSIFICATION OF THIS PAGE (When Data...Rot FEEDBACK EQUAL Z FOR IGITAL HF LINKS TcnclRpr PERFORMING ORG. REPORT NUMBERMRC-R-801- 7, AUTHORf,, 8. CONTRACT OR GRANT NUMBER(-) Blair E

  9. Hybrid wide-band, low-phase-noise scheme for Raman lasers in atom interferometry by integrating an acousto-optic modulator and a feedback loop.

    Science.gov (United States)

    Wang, Kai; Yao, Zhanwei; Li, Runbing; Lu, Sibin; Chen, Xi; Wang, Jin; Zhan, Mingsheng

    2016-02-10

    We report a hybrid scheme for phase-coherent Raman lasers with low phase noise in a wide frequency range. In this scheme, a pair of Raman lasers with a frequency difference of 3.04 GHz is generated by the ±1-order diffracted lights of an acousto-optic modulator (1.52 GHz), where a feedback loop is simultaneously applied for suppressing the phase noise. The beat width of the Raman lasers is narrower than 3 Hz. In the low-frequency range, the phase noise of the Raman lasers is suppressed by 35 dB with the feedback. The phase noise is less than -109  dBc/Hz in the high-frequency range. The sensitivity of an atom gyroscope employing the hybrid Raman lasers can be implicitly improved 10 times. Due to the better high-frequency response, the sensitivity is not limited by the durations of Raman pulses. This work is important for improving the performance of atom-interferometer-based measurements.

  10. Imbalance of group velocities for amplitude and phase pulses propagating in a resonant atomic medium

    Science.gov (United States)

    Basalaev, M. Yu.; Taichenachev, A. V.; Yudin, V. I.

    2016-11-01

    The dynamics of light pulses with amplitude and phase modulations is investigated for a medium of resonant two-level atoms. It is shown that the pulse-like variations of the phase can be also described in terms of group velocity. It is found that in the nonlinear regime of atom-field interaction, the group velocities of amplitude and phase pulses can have a large imbalance. Namely, amplitude pulses travel at a velocity less than c , whereas the group velocity of phase pulses is greater than the velocity of light in free space or it is even negative. The predicted imbalance of the group velocities can be important in the case of chirped pulses propagating in a resonant medium.

  11. The deconfinement phase transition in Yang-Mills theory with general Lie group G

    CERN Document Server

    Holland, K; Wiese, U J

    2004-01-01

    We present numerical results for the deconfinement phase transition in Sp(2) and Sp(3) Yang-Mills theories in (2+1)-D and (3+1)-D. We then make a conjecture on the order of this phase transition in Yang-Mills theories with general Lie groups G = SU(N), SO(N), Sp(N) and with exceptional groups G = G(2), F(4), E(6), E(7), E(8).

  12. Evaluating a Web-Based Health Risk Assessment With Tailored Feedback: What Does an Expert Focus Group Yield Compared to a Web-Based End-User Survey?

    Science.gov (United States)

    Vosbergen, Sandra; Mahieu, Guy R; Laan, Eva K; Kraaijenhagen, Roderik A; Jaspers, Monique WM

    2014-01-01

    Background Increasingly, Web-based health applications are developed for the prevention and management of chronic diseases. However, their reach and utilization is often disappointing. Qualitative evaluations post-implementation can be used to inform the optimization process and ultimately enhance their adoption. In current practice, such evaluations are mainly performed with end-user surveys. However, a review approach by experts in a focus group may be easier to administer and might provide similar results. Objective The aim of this study was to assess whether industrial design engineers in a focus group would address the same issues as end users in a Web-based survey when evaluating a commercial Web-based health risk assessment (HRA) with tailored feedback. Methods Seven Dutch companies used the HRA as part of their corporate health management strategy. Employees using the HRA (N=2289) and 10 independent industrial designers were invited to participate in the study. The HRA consisted of four components: (1) an electronic health questionnaire, (2) biometric measurements, (3) laboratory evaluation, and (4) individually tailored feedback generated by decision support software. After participating in the HRA as end users, both end users and designers evaluated the program. End users completed an evaluation questionnaire that included a free-text field. Designers participated in a focus group discussion. Constructs from user satisfaction and technology acceptance theories were used to categorize and compare the remarks from both evaluations. Results We assessed and qualitatively analyzed 294 remarks of 189 end users and 337 remarks of 6 industrial designers, pertaining to 295 issues in total. Of those, 137 issues were addressed in the end-user survey and 148 issues in the designer focus group. Only 7.3% (10/137) of the issues addressed in the survey were also addressed in the focus group. End users made more remarks about the usefulness of the HRA and prior

  13. Experience feedback on the hydraulic unit swiveling provisions; Retour d`experience sur la pivoterie des groupes hydrauliques

    Energy Technology Data Exchange (ETDEWEB)

    Vialettes, J.M.; Claveirolle, P.; Francois, E.

    1997-01-01

    EDF`s 1300 hydraulic machines are highly diverse, ranging from 100 kW to 300 MW, and have been built over a period of almost one century; this diversity can also be found in the swiveling technologies that have been used, and many ancient designs still exist. The most frequently found swivel and bearing types are described, emphasizing their respective weaknesses; their protection systems (level, temperature, vibration control) and start-up and shutdown adapted procedures, are also presented. A feedback experience and analysis of significant incidents are presented, and the main causes of seizure are discussed. The various control methods concerning hydraulic circuits, bearing surfaces, edge and babbitt adhesion, are reviewed and control criterions for pad lining processes are presented

  14. Waste area Grouping 2 Phase I remedial investigation: Sediment and Cesium-137 transport modeling report

    Energy Technology Data Exchange (ETDEWEB)

    Clapp, R.B.; Bao, Y.S.; Moore, T.D.; Brenkert, A.L.; Purucker, S.T.; Reece, D.K.; Burgoa, B.B.

    1996-06-01

    This report is one of five reports issued in 1996 that provide follow-up information to the Phase I Remedial Investigation (RI) Report for Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL). The five reports address areas of concern that may present immediate risk to public health at the Clinch River and ecological risk within WAG 2 at ORNL. A sixth report, on groundwater, in the series documenting WAG 2 RI Phase I results were part of project activities conducted in FY 1996. The five reports that complete activities conducted as part of Phase I of the Remedial Investigation (RI) for WAG 2 are as follows: (1) Waste Area Grouping 2, Phase I Task Data Report: Seep Data Assessment, (2) Waste Area Grouping 2, Phase I Task Data Report: Tributaries Data Assessment, (3) Waste Area Grouping 2, Phase I Task Data Report: Ecological Risk Assessment, (4) Waste Area Grouping 2, Phase I Task Data Report: Human Health Risk Assessment, (5) Waste Area Grouping 2, Phase I Task Data Report: Sediment and {sup 137}Cs Transport Modeling In December 1990, the Remedial Investigation Plan for Waste Area Grouping 2 at Oak Ridge National Laboratory was issued (ORNL 1990). The WAG 2 RI Plan was structured with a short-term component to be conducted while upgradient WAGs are investigated and remediated, and a long-term component that will complete the RI process for WAG 2 following remediation of upgradient WAGs. RI activities for the short-term component were initiated with the approval of the Environmental Protection Agency, Region IV (EPA), and the Tennessee Department of Environment and Conservation (TDEC). This report presents the results of an investigation of the risk associated with possible future releases of {sup 137}Cs due to an extreme flood. The results are based on field measurements made during storms and computer model simulations.

  15. Quantum field theory and phase transitions: universality and renormalization group; Theorie quantique des champs et transitions de phase: universalite et groupe de renormalisation

    Energy Technology Data Exchange (ETDEWEB)

    Zinn-Justin, J

    2003-08-01

    In the quantum field theory the problem of infinite values has been solved empirically through a method called renormalization, this method is satisfying only in the framework of renormalization group. It is in the domain of statistical physics and continuous phase transitions that these issues are the easiest to discuss. Within the framework of a course in theoretical physics the author introduces the notions of continuous limits and universality in stochastic systems operating with a high number of freedom degrees. It is shown that quasi-Gaussian and mean field approximation are unable to describe phase transitions in a satisfying manner. A new concept is required: it is the notion of renormalization group whose fixed points allow us to understand universality beyond mean field. The renormalization group implies the idea that long distance correlations near the transition temperature might be described by a statistical field theory that is a quantum field in imaginary time. Various forms of renormalization group equations are presented and solved in particular boundary limits, namely for fields with high numbers of components near the dimensions 4 and 2. The particular case of exact renormalization group is also introduced. (A.C.)

  16. A small-scale dynamo in feedback-dominated galaxies as the origin of cosmic magnetic fields - I. The kinematic phase

    Science.gov (United States)

    Rieder, Michael; Teyssier, Romain

    2016-04-01

    The origin and evolution of magnetic fields in the Universe is still an open question. Their observations in galaxies suggest strong magnetic fields already at high redshift as well as at present time. However, neither primordial magnetic fields nor battery processes can account for such high field strengths, which implies the presence of a dynamo process with rapid growth rates in high-redshift galaxies and subsequent maintenance against decay. We investigate the particular role played by feedback mechanisms in creating strong fluid turbulence, allowing for a magnetic dynamo to emerge. Performing magnetohydrodynamic simulations of isolated cooling gas haloes, we compare the magnetic field evolution for various initial field topologies and various stellar feedback mechanisms. We find that feedback can indeed drive strong gas turbulence and dynamo action. We see typical properties of Kolmogorov turbulence with a k-5/3 kinetic energy spectrum, as well as a small-scale dynamo, with a k3/2 magnetic energy spectrum predicted by Kazantsev dynamo theory. We also investigate simulations with a final quiescent phase. As turbulence decreases, the galactic fountain settles into a thin, rotationally supported disc. The magnetic field develops a large-scale well-ordered structure with even symmetry, which is in good agreement with magnetic field observations of nearby spirals. Our findings suggest that weak initial seed fields were first amplified by a small-scale dynamo during a violent feedback-dominated early phase in the galaxy formation history, followed by a more quiescent evolution, where the fields have slowly decayed or were maintained via large-scale dynamo action.

  17. Stable microwave generation in a dual-phase-shifted Al2O3:Yb3+ distributed-feedback waveguide laser

    NARCIS (Netherlands)

    Bernhardi, Edward; van Wolferen, Hendricus A.G.M.; Worhoff, Kerstin; de Ridder, R.M.; Pollnau, Markus

    A dual-wavelength distributed-feedback channel waveguide laser in ytterbium-doped aluminum oxide was used to create a microwave beat signal at ~15 GHz, with a frequency stability of ±2.5 MHz and a power stability of ±0.35 dB.

  18. Stable microwave generation in a dual-phase-shifted $Al_2O_3:Yb^{3+}$ distributed-feedback waveguide laser

    NARCIS (Netherlands)

    Bernhardi, E.H.; Wolferen, van H.A.G.M.; Wörhoff, K.; Ridder, de R.M.; Pollnau, M.

    2012-01-01

    A dual-wavelength distributed-feedback channel waveguide laser in ytterbium-doped aluminum oxide was used to create a microwave beat signal at ~15 GHz, with a frequency stability of ±2.5 MHz and a power stability of ±0.35 dB.

  19. Students’ expectations of feedback given on draft writing

    Directory of Open Access Journals (Sweden)

    Zach Simpson

    2011-09-01

    Full Text Available Academic writing is the primary means of assessing university students and feedback (oral or written responses on writing can contribute significantly to student learning and success (Ferris, 2003; Hyland & Hyland, 2006. This study explores students’ expectations of feedback on draft writing. The research design was two-pronged. The initial quantitative aspect employed a questionnaire which students completed after receiving feedback from Writing Centre consultants who aim to give developmental feedback. A subsequent phase involved focus groups with volunteer students. This mixed methods design allowed for greater depth of understanding as the qualitative findings extended the quantitative results. The study concludes that students expect feedback to be understandable, encouraging and to focus on both positive and negative aspects of their writing. Importantly, students expect feedback to ‘unpack’ the conventions of academic literacy while still encouraging independence and originality.

  20. Influence of self-controlled feedback on learning a serial motor skill.

    Science.gov (United States)

    Lim, Soowoen; Ali, Asif; Kim, Wonchan; Kim, Jingu; Choi, Sungmook; Radlo, Steven J

    2015-04-01

    Self-controlled feedback on a variety of tasks are well established as effective means of facilitating motor skill learning. This study assessed the effects of self-controlled feedback on the performance of a serial motor skill. The task was to learn the sequence of 18 movements that make up the Taekwondo Poomsae Taegeuk first, which is the first beginner's practice form learned in this martial art. Twenty-four novice female participants (M age=27.2 yr., SD=1.8) were divided into two groups. All participants performed 16 trials in 4 blocks of the acquisition phase and 20 hr. later, 8 trials in 2 blocks of the retention phase. The self-controlled feedback group had significantly higher performance compared to the yoked-feedback group with regard to acquisition and retention. The results of this study may contribute to the literature regarding feedback by extending the usefulness of self-controlled feedback for learning a serial skill.

  1. Exploring the trustworthiness and reliability of focus groups for obtaining useful feedback for evaluation of academic programs

    National Research Council Canada - National Science Library

    Rauf, Ayesha; Baig, Lubna; Jaffery, Tara; Shafi, Riffat

    2014-01-01

    At Shifa College of Medicine, evaluation is an integral part of the curriculum. We used focus groups as a tool to obtain in-depth information regarding students' experience with the new integrated, system- based curriculum...

  2. Phase structure analysis of CP(N-1) model using Tensor renormalization group

    CERN Document Server

    Kawauchi, Hikaru

    2016-01-01

    The phase structure of the lattice CP($N-1$) model in two dimensions is analyzed by the tensor renormalization group (TRG) method. We focus on the case $N=2$ and compare the numerical result of the TRG method with that of the strong-coupling analysis in the presence of the $\\theta$ term and investigate the nature of the phase transition at $\\theta=\\pi$.

  3. PHOTOINDUCED HOLOGRAPHIC PHASE GRATINGS BURIED IN AZOBENZENE SIDE-CHAIN POLYMER FILMS WITH A CHIRAL GROUP

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    An optically active polymer (PM1) containing azobenzene moieties with a chiral group (s-2-methyl-butyl) was synthesized by homopolymerization of monomer, 4-[2-(methacryloyloxy)ethyloxy]-4'-(s-2-methyl-1-butyloxycarbonyl)azobenzene, using the free radical polymerization method. The polymer dissolved in tetrahydrofuran (THF) could be easily processed into high optical quality films. The optical anisotropy of the polymer films was investigated by polarizing optical microscopy (POM). The experimental results showed that irradiation with a circularly polarized beam could align the orientation of the molecules in the polymer films. Moreover, the holographic phase gratings of photo-induced polymer films were detected by atomic force microscopy (AFM) and POM. In comparison with polymer containing no chiral group, it was found from the preliminary measurement of the photo-induced holographic phase gratings that PM1 containing a chiral group could form holographic phase gratings buried in the films.

  4. Group Lifting Structures For Multirate Filter Banks, II: Linear Phase Filter Banks

    Energy Technology Data Exchange (ETDEWEB)

    Brislawn, Christopher M [Los Alamos National Laboratory

    2008-01-01

    The theory of group lifting structures is applied to linear phase lifting factorizations for the two nontrivial classes of two-channel linear phase perfect reconstruction filter banks, the whole-and half-sample symmetric classes. Group lifting structures defined for the reversible and irreversible classes of whole-and half-sample symmetric filter banks are shown to satisfy the hypotheses of the uniqueness theorem for group lifting structures. It follows that linear phase lifting factorizations of whole-and half-sample symmetric filter banks are therefore independent of the factorization methods used to compute them. These results cover the specification of user-defined whole-sample symmetric filter banks in Part 2 of the ISO JPEG 2000 standard.

  5. Tensor renormalization group: Local magnetizations, correlation functions, and phase diagrams of systems with quenched randomness

    Science.gov (United States)

    Güven, Can; Hinczewski, Michael; Berker, A. Nihat

    2011-03-01

    The tensor renormalization-group method, developed by Levin and Nave, brings systematic improvability to the position-space renormalization-group method and yields essentially exact results for phase diagrams and entire thermodynamic functions. The method, previously used on systems with no quenched randomness, is extended in this study to systems with quenched randomness. Local magnetizations and correlation functions as a function of spin separation are calculated as tensor products subject to renormalization-group transformation. Phase diagrams are extracted from the long-distance behavior of the correlation functions. The approach is illustrated with the quenched bond-diluted Ising model on the triangular lattice. An accurate phase diagram is obtained in temperature and bond-dilution probability for the entire temperature range down to the percolation threshold at zero temperature. This research was supported by the Alexander von Humboldt Foundation, the Scientific and Technological Research Council of Turkey (TÜBITAK), and the Academy of Sciences of Turkey.

  6. Tensor renormalization group: local magnetizations, correlation functions, and phase diagrams of systems with quenched randomness.

    Science.gov (United States)

    Güven, Can; Hinczewski, Michael; Berker, A Nihat

    2010-11-01

    The tensor renormalization-group method, developed by Levin and Nave, brings systematic improvability to the position-space renormalization-group method and yields essentially exact results for phase diagrams and entire thermodynamic functions. The method, previously used on systems with no quenched randomness, is extended in this study to systems with quenched randomness. Local magnetizations and correlation functions as a function of spin separation are calculated as tensor products subject to renormalization-group transformation. Phase diagrams are extracted from the long-distance behavior of the correlation functions. The approach is illustrated with the quenched bond-diluted Ising model on the triangular lattice. An accurate phase diagram is obtained in temperature and bond-dilution probability for the entire temperature range down to the percolation threshold at zero temperature.

  7. Effective components of feedback from Routine Outcome Monitoring (ROM) in youth mental health care: Study protocol of a three-arm parallel-group randomized controlled trial

    NARCIS (Netherlands)

    Sonsbeek, A.M.S. van; Hutschemaekers, G.J.M.; Veerman, J.W.; Tiemens, B.G.

    2014-01-01

    Background: Routine Outcome Monitoring refers to regular measurements of clients' progress in clinical practice, aiming to evaluate and, if necessary, adapt treatment. Clients fill out questionnaires and clinicians receive feedback about the results. Studies concerning feedback in youth mental

  8. Altered Sensory Feedbacks in Pianist's Dystonia: the altered auditory feedback paradigm and the glove effect

    Directory of Open Access Journals (Sweden)

    Felicia Pei-Hsin Cheng

    2013-12-01

    Full Text Available Background: This study investigates the effect of altered auditory feedback (AAF in musician's dystonia (MD and discusses whether altered auditory feedback can be considered as a sensory trick in MD. Furthermore, the effect of AAF is compared with altered tactile feedback, which can serve as a sensory trick in several other forms of focal dystonia. Methods: The method is based on scale analysis (Jabusch et al. 2004. Experiment 1 employs synchronization paradigm: 12 MD patients and 25 healthy pianists had to repeatedly play C-major scales in synchrony with a metronome on a MIDI-piano with 3 auditory feedback conditions: 1. normal feedback; 2. no feedback; 3. constant delayed feedback. Experiment 2 employs synchronization-continuation paradigm: 12 MD patients and 12 healthy pianists had to repeatedly play C-major scales in two phases: first in synchrony with a metronome, secondly continue the established tempo without the metronome. There are 4 experimental conditions, among them 3 are the same altered auditory feedback as in Experiment 1 and 1 is related to altered tactile sensory input. The coefficient of variation of inter-onset intervals of the key depressions was calculated to evaluate fine motor control. Results: In both experiments, the healthy controls and the patients behaved very similarly. There is no difference in the regularity of playing between the two groups under any condition, and neither did AAF nor did altered tactile feedback have a beneficial effect on patients’ fine motor control. Conclusions: The results of the two experiments suggest that in the context of our experimental designs, AAF and altered tactile feedback play a minor role in motor coordination in patients with musicians' dystonia. We propose that altered auditory and tactile feedback do not serve as effective sensory tricks and may not temporarily reduce the symptoms of patients suffering from MD in this experimental context.

  9. PHASE STRUCTURE AND PROPERTIES OF EPOXY RESIN MODIFIED BY POLYSILOXANE BEARING PENDANT AMINO GROUPS

    Institute of Scientific and Technical Information of China (English)

    Bing Zhang; Xiang-luan Liu; Ying Huang

    2000-01-01

    Polysiloxane-modified epoxy resins were prepared through the reaction of epoxy resin with polydimethylsiloxanes bearing pendant N-(β-aminoethyl)-γ-aminopropyl groups. The morphology and properties of the cured epoxy resins modified by the polysiloxanes were investigated. It was found that the phase structure and properties of the cured epoxy resins depend mainly on the amino group content in the polydimethylsiloxane and the level of the modifier. The change of phase structure in the cured epoxy resin systems was responsible for the dramatic change in their mechanical and surface properties.

  10. Detecting concealed information from groups using a dynamic questioning approach: simultaneous skin conductance measurement and immediate feedback

    Directory of Open Access Journals (Sweden)

    Ewout H Meijer

    2013-02-01

    Full Text Available Lie detection procedures typically aim at determining the guilt or innocence of a single suspect. The Concealed Information Test (CIT, for example, has been shown to be highly successful in detecting the presence or absence of crime-related information in a suspect’s memory. Many of today’s security threats, however, do not come from individuals, but from organized groups such as criminal organizations or terrorist networks. In this study, we tested whether a plan of an upcoming mock terrorist attack could be extracted from a group of suspects using a dynamic questioning approach. One-hundred participants were tested in 20 groups of 5. Each group was asked to plan a mock terrorist attack based on a list of potential countries, cities and streets. Next, three questions referring to the country, city, and street were presented, each with 5 options. Skin conductance in all 5 members of the group was measured simultaneously during this presentation. The dynamic questioning approach entailed direct analysis of the data, and if the average skin conductance of the group to a certain option exceeded a threshold, this option was followed up. E.g., if the reaction to the option ‘Italy’ exceeded the threshold, this was followed up by presenting 5 cities in Italy. Results showed that in 19 of the 20 groups the country was correctly detected using this procedure. In 13 of these remaining 19 groups the city was correctly detected. In 7 of these 13, the street was also correctly detected. The question about the country resulted in no false positives (out of 20, the question about the city resulted in 2 false positives (out of 19, while the question about the streets resulted in 2 false positives (out of 13. Furthermore, the 2 false positives at the city level also yielded a false positive at the street level. Taken together these results indicate our dynamic questioning approach can help to unveil plans about a mock terrorist attack.

  11. Line group techniques in description of the structural phase transitions in some superconductors

    Science.gov (United States)

    Meszaros, CS.; Balint, A.; Bankuti, J.

    1995-01-01

    The main features of the theory of line groups, and their irreducible representations are briefly discussed, as well as the most important applications of them. A new approach in the general symmetry analysis of the modulated systems is presented. It is shown, that the line group formalism could be a very effective tool in the examination of the structural phase transitions in High Temperature SUperconductors. As an example, the material YBa2Cu3O(7-x) is discussed briefly.

  12. Measurement of the velocity of a quantum object: A role of phase and group velocities

    Science.gov (United States)

    Lapinski, Mikaila; Rostovtsev, Yuri V.

    2017-08-01

    We consider the motion of a quantum particle in a free space. Introducing an explicit measurement procedure for velocity, we demonstrate that the measured velocity is related to the group and phase velocities of the corresponding matter waves. We show that for long distances the measured velocity coincides with the matter wave group velocity. We discuss the possibilities to demonstrate these effects for the optical pulses in coherently driven media or for radiation propagating in waveguides.

  13. Narrow-linewidth chirped frequency comb from a frequency-shifted feedback Ti:sapphire laser seeded by a phase-modulated single-frequency fiber laser.

    Science.gov (United States)

    Brandl, Matthias F; Mücke, Oliver D

    2010-12-15

    Frequency-shifted feedback (FSF) lasers have emerged as powerful tools for precision distance metrology. At the output of a Michelson interferometer, the detected rf spectra of the FSF laser light contain a length-dependent heterodyne beat signal whose linewidth ultimately limits the achievable accuracy of length measurements. Here, we demonstrate a narrow-linewidth chirped frequency comb from an FSF Ti:sapphire ring laser seeded by a phase-modulated, ultra-low-phase-noise, single-frequency fiber laser. We experimentally investigate the influence of the seed laser linewidth on the resulting width and shape of the length-dependent rf beat signal. An ultranarrow heterodyne beat linewidth of <20 Hz is observed.

  14. ALLOYING-DRIVEN PHASE STABILITY IN GROUP-VB TRANSITION METALS UNDER COMPRESSION

    Energy Technology Data Exchange (ETDEWEB)

    Landa, A; Soderlind, P

    2011-04-11

    The change in phase stability of Group-VB (V, Nb, and Ta) transition metals due to pressure and alloying is explored by means of first-principles electronic-structure calculations. It is shown that under compression stabilization or destabilization of the ground-state body-centered cubic (bcc) phase of the metal is mainly dictated by the band-structure energy that correlates well with the position of the Kohn anomaly in the transverse acoustic phonon mode. The predicted position of the Kohn anomaly in V, Nb, and Ta is found to be in a good agreement with data from the inelastic x-ray or neutron scattering measurements. In the case of alloying the change in phase stability is defined by the interplay between the band-structure and Madelung energies. We show that band-structure effects determine phase stability when a particular Group-VB metal is alloyed with its nearest neighbors within the same d-transition series: the neighbor with less and more d electrons destabilize and stabilize the bcc phase, respectively. When V is alloyed with neighbors of a higher (4d- or 5d-) transition series, both electrostatic Madelung and band-structure energies stabilize the body-centered-cubic phase. The opposite effect (destabilization) happens when Nb or Ta is alloyed with neighbors of the 3d-transition series.

  15. An Investigation of the Effects of Three Post-writing Methods: Focused Feedback, Learner-oriented Focused Feedback, and No Feedback

    Directory of Open Access Journals (Sweden)

    Mozhgan Jamali

    2014-09-01

    Full Text Available There have been inconclusive results regarding the issue of feedback and no feedback to student compositions. The present study investigated potential differences in the effect, on writing accuracy, of focused meta-linguistic feedback, learner-oriented focused meta-linguistic feedback, and mere writing practice on overall accuracy in Iranian EFL writings. Because of dramatic student attrition and two failures in the data collection phase which was due to lack of student commitment to performing the tasks, the study involved three groups: a experimental A (33→9 who wrote on topics, received feedback, and kept edit logs and error tally sheets; b experimental B (33→7 who only received feedback; and c control (33→6 who merely wrote on topics. The results indicated that all the three methods are almost equally ineffective to accuracy improvement of student writings in the targeted areas, thus refuting claims for the effectiveness of both feedback and no feedback methods. Keywords: focused CF; meta-linguistic feedback; writing accuracy

  16. OPTICAL PHASE CONJUGATION RESPONSE OF PHOTOINDUCED POLYMER FILMS CONTAINING AZOBENZENE MOIETIES WITH CHIRAL GROUP

    Institute of Scientific and Technical Information of China (English)

    Ze-da Xu; Yong Zhang; Xing-he Fan; Xin-hua Wan; Qi-feng Zhou

    2002-01-01

    An optically active monomer containing azobenzene moieties with chiral group (s-2-methyl-butyl), 4-[2-(methacryloyloxy)ethyloxy]-4'-(s-2-methyl-1-butyloxycarbonyl) azobenzene (M1) was synthesized. Polymer (PM1) possessing optical phase conjugated response was obtained by homopolymerization of the optically active monomer (M1) using free radical polymerization. The polymer was very soluble in common solvents and good optical quality films could be easily fabricated by spin coating. The optical phase conjugated responses of the polymer PM1 were measured by degenerate four-wave mixing (DFWM). In comparison with polymer containing no chiral group, it was found from the preliminary measurement of photoisomeric change that optical phase conjugated response of the PM1 in the long-range order hexagonal symmetry microstructure could be easily controlled by choosing the appropriate polarization direction of the irradiating beams (514.5 nm) and the irradiating number, presumably due to the chiral group in the PM1 molecular structure. For the case of the polymer investigated here, a chiral group side chain was introduced to increase optical phase conjugated response intensity with different polarization directions of the irradiating beams, which aims originally at searching for a new photoactive material.

  17. Phase 2 trial design in neuro-oncology revisited: a report from the RANO group.

    Science.gov (United States)

    Galanis, Evanthia; Wu, Wenting; Cloughesy, Timothy; Lamborn, Kathleen; Mann, Bhupinder; Wen, Patrick Y; Reardon, David A; Wick, Wolfgang; Macdonald, David; Armstrong, Terri S; Weller, Michael; Vogelbaum, Michael; Colman, Howard; Sargent, Daniel J; van den Bent, Martin J; Gilbert, Mark; Chang, Susan

    2012-05-01

    Advances in the management of gliomas, including the approval of agents such as temozolomide and bevacizumab, have created an evolving therapeutic landscape in glioma treatment, thus affecting our ability to reliably use historical controls to comparatively assess the activity of new therapies. Furthermore, the increasing availability of novel, targeted agents--which are competing for a small patient population, in view of the low incidence of primary brain tumours--draws attention to the need to improve the efficiency of phase 2 clinical testing in neuro-oncology to expeditiously transition the most promising of these drugs or combinations to potentially practice-changing phase 3 trials. In this report from the Response Assessment in Neurooncology (RANO) group, we review phase 2 trial designs that can address these challenges and capitalise on scientific and clinical advances in brain tumour treatment in neuro-oncology to accelerate and optimise the selection of drugs deserving further testing in phase 3 trials. Although there is still a small role for single-arm and non-comparative phase 2 designs, emphasis is placed on the potential role that comparative randomised phase 2 designs--such as screening designs, selection designs, discontinuation designs, and adaptive designs, including seamless phase 2/3 designs--can have. The rational incorporation of these designs, as determined by the specific clinical setting and the trial's endpoints or goals, has the potential to substantially advance new drug development in neuro-oncology.

  18. A Very Deep Chandra Observation of the Galaxy Group NGC 5813: AGN Shocks, Feedback, and Outburst History

    CERN Document Server

    Randall, S W; Jones, C; Forman, W R; Bulbul, E; Clarke, T E; Kraft, R; Blanton, E L; David, L; Werner, N; Sun, M; Donahue, M; Giacintucci, S; Simionescu, A

    2015-01-01

    We present results from a very deep (650 ks) Chandra X-ray observation of the galaxy group NGC~5813, the deepest Chandra observation of a galaxy group to date. Earlier observations showed two pairs of cavities distributed roughly collinearly, with each pair associated with an elliptical shock front. The new observations confirm a third pair of outer cavities, collinear with the other pairs, and reveal an associated outer outburst shock at ~30 kpc. This system is therefore unique in exhibiting three cavity pairs, each associated with an unambiguous AGN outburst shock front. The implied mean kinetic power is roughly the same for each outburst, demonstrating that the average AGN kinetic luminosity can remain stable over long timescales (~50 Myr). The two older outbursts have larger, roughly equal total energies as compared with the youngest outburst, implying that the youngest outburst is ongoing. We find that the radiative cooling rate and the mean shock heating rate of the gas are well balanced at each shock f...

  19. Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis.

    Science.gov (United States)

    Cieślak, Jacek; Kauffman, Jon S; Kolodziejski, Michelle J; Lloyd, John R; Beaucage, Serge L

    2007-02-15

    The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text

  20. Real-time digital phase and gain adaptation method using feedback and arrangement using such a method

    NARCIS (Netherlands)

    Kokkeler, Andre B.J.

    2002-01-01

    Arrangement for real-time phase and gain adaptation as a function of frequency and gain adaptation as a function of amplitude of an input signal in relation to an output signal, the input signal having a first absolute phase and first power as a function of frequency, the output signal having a

  1. An Islanding Detection Method by Using Frequency Positive Feedback Based on FLL for Single-Phase Microgrid

    DEFF Research Database (Denmark)

    Sun, Qinfei; Guerrero, Josep M.; Jing, Tianjun

    2017-01-01

    An active islanding detection method based on Frequency-Locked Loop (FLL) for constant power controlled inverter in single-phase microgrid is proposed. This method generates a phase shift comparing the instantaneous frequency obtainedfrom FLL unit with the nominal frequency to modify the reference...

  2. Measuring Group Synchrony: A Cluster-Phase Method for Analyzing Multivariate Movement Time-Series

    Directory of Open Access Journals (Sweden)

    Michael eRichardson

    2012-10-01

    Full Text Available A new method for assessing group synchrony is introduced as being potentially useful for objectively determining degree of group cohesiveness or entitativity. The cluster-phase method of Frank and Richardson (2010 was used to analyze movement data from the rocking chair movements of six-member groups who rocked their chairs while seated in a circle facing the center. In some trials group members had no information about others’ movements (their eyes were shut or they had their eyes open and gazed at a marker in the center of the group. As predicted, the group level synchrony measure was able to distinguish between situations where synchrony would have been possible and situations where it would be impossible. Moreover, other aspects of the analysis illustrated how the cluster phase measures can be used to determine the type of patterning of group synchrony, and, when integrated with multi-level modeling, can be used to examine individual-level differences in synchrony and dyadic level synchrony as well.

  3. Adaptive-feedback spectral-phase control for interactions with transform-limited ultrashort high-power laser pulses.

    Science.gov (United States)

    Liu, Cheng; Zhang, Jun; Chen, Shouyuan; Golovin, Gregory; Banerjee, Sudeep; Zhao, Baozhen; Powers, Nathan; Ghebregziabher, Isaac; Umstadter, Donald

    2014-01-01

    Fourier-transform-limited light pulses were obtained at the laser-plasma interaction point of a 100-TW peak-power laser in vacuum. The spectral-phase distortion induced by the dispersion mismatching between the stretcher, compressor, and dispersive materials was fully compensated for by means of an adaptive closed-loop. The coherent temporal contrast on the sub-picosecond time scale was two orders of magnitude higher than that without adaptive control. This novel phase control capability enabled the experimental study of the dependence of laser wakefield acceleration on the spectral phase of intense laser light.

  4. How to be patient. The ability to wait for a reward depends on menstrual cycle phase and feedback-related activity.

    Directory of Open Access Journals (Sweden)

    Luise eReimers

    2014-12-01

    Full Text Available Dopamine (DA plays a major role in reinforcement learning with increases promoting reward sensitivity (Go learning while decreases facilitate the avoidance of negative outcomes (NoGo learning. This is also reflected in adaptations of response time: higher levels of DA enhance speeding up to get a reward, whereas lower levels favor slowing down. The steroid hormones estradiol and progesterone have been shown to modulate dopaminergic tone. Here, we tested fourteen women twice during their menstrual cycle, during the follicular (FP and the luteal phase (LP, applying functional magnetic resonance imaging while they performed a feedback learning task. Subsequent behavioral testing assessed response time preferences with a clock task, in which subjects had to explore the optimal response time (RT to maximize reward. In the FP subjects displayed a greater learning-related change of their RT than during the LP, when they were required to slow down. Final RTs in the slow condition were also predicted by feedback-related brain activation, but only in the FP. Increased activation of the inferior frontal junction and rostral cingulate zone was thereby predictive of slower and thus better adapted final RTs. Conversely, final RT was faster and less optimal for reward maximization if activation in the ventromedial prefrontal cortex was enhanced. These findings show that hormonal shifts across the menstrual cycle affect adaptation of response speed during reward acquisition with higher RT adjustment in the FP in the condition that requires slowing down. Since high estradiol levels during the FP increase synaptic DA levels, this conforms well to our hypothesis that estradiol supports Go learning at the expense of NoGo learning. Brain-behavior correlations further indicated that the compensatory capacity to counteract the follicular Go bias may be linked to the ability to more effectively monitor action outcomes and suppress bottom-up reward desiring during

  5. Many-body localization phase transition: A simplified strong-randomness approximate renormalization group

    Science.gov (United States)

    Zhang, Liangsheng; Zhao, Bo; Devakul, Trithep; Huse, David A.

    2016-06-01

    We present a simplified strong-randomness renormalization group (RG) that captures some aspects of the many-body localization (MBL) phase transition in generic disordered one-dimensional systems. This RG can be formulated analytically and is mathematically equivalent to a domain coarsening model that has been previously solved. The critical fixed-point distribution and critical exponents (that satisfy the Chayes inequality) are thus obtained analytically or to numerical precision. This reproduces some, but not all, of the qualitative features of the MBL phase transition that are indicated by previous numerical work and approximate RG studies: our RG might serve as a "zeroth-order" approximation for future RG studies. One interesting feature that we highlight is that the rare Griffiths regions are fractal. For thermal Griffiths regions within the MBL phase, this feature might be qualitatively correctly captured by our RG. If this is correct beyond our approximations, then these Griffiths effects are stronger than has been previously assumed.

  6. Influence of head group methylation on the phase behavior of lipid monolayers

    DEFF Research Database (Denmark)

    Brezesinski, G.; Bringezu, F.; Weidemann, G.

    1998-01-01

    per three tails exceeds that per head, an influence of the head group methylation on the monolayer structure is observed. The tilt angles at lower lateral pressures and the transition pressure to a hexagonal packing of upright oriented chains increase with increasing methylation degree. The transition...... from the NN tilted rectangular to this hexagonal phase is connected with a pressure region where the in-plane components Q(xy) of the two peaks coincide while the out-of-plane components Q(z) differ. This indicates an undistorted hexagonal in-plane lattice even for tilted chains. The area-pressure...... and X-ray measurements below 10 mN/m, can be explained by the formation of holes in the monolayer. Possibly the tilting of the triple-chain molecules leads to an orientational ordering of the head group dipoles and therefore to an electrostatic repulsion between condensed phase domains. (C) 1998...

  7. The Effects of Feedback as Interpersonal Reciprocities

    Science.gov (United States)

    Levenstein, Joseph; And Others

    1977-01-01

    Tests the hypothesis that a response to a given feedback statement will be its reciprocal. In Phase 1, a pool of feedback statements was written and scaled along dimensions of power (dominance-submission) and affect (affection-hostility). In Phase 2, these statements were used as the basis for giving feedback and replying to it. (Author)

  8. Internal character dictates phase transition dynamics between isolation and cohesive grouping

    CERN Document Server

    Manrique, Pedro D; Johnson, Neil F

    2015-01-01

    We show that accounting for internal character among interacting, heterogeneous entities generates rich phase transition behavior between isolation and cohesive dynamical grouping. Our analytical and numerical calculations reveal different critical points arising for different character-dependent grouping mechanisms. These critical points move in opposite directions as the population's diversity decreases. Our analytical theory helps explain why a particular class of universality is so common in the real world, despite fundamental differences in the underlying entities. Furthermore, it correctly predicts the non-monotonic temporal variation in connectivity observed recently in one such system.

  9. Line group techniques in description of the structural phase transitions in some superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Meszaros, C.; Bankuti, J. [Roland Eoetvoes Univ., Budapest (Hungary); Balint, A. [Univ. of Agricultural Sciences, Goedoello (Hungary)

    1994-12-31

    The main features of the theory of line groups, and their irreducible representations are briefly discussed, as well as the most important applications of them. A new approach in the general symmetry analysis of the modulated systems is presented. It is shown, that the line group formalism could be a very effective tool in the examination of the structural phase transitions in High Temperature Superconductors. As an example, the material YBa{sub 2}Cu{sub 3}O{sub 7-x} is discussed briefly.

  10. Death of an Arctic Mixed Phase Cloud: How Changes in the Arctic Environment Influence Cloud Properties and Cloud Radiative Feedbacks

    Science.gov (United States)

    Roesler, E. L.; Posselt, D. J.

    2012-12-01

    Arctic mixed phase stratocumulus clouds exert an important influence on the radiative budget over the Arctic ocean and sea ice. Field programs and numerical experiments have shown the properties of these clouds to be sensitive to changes in the surface properties, thermodynamic environment, and aerosols. While it is clear that Arctic mixed-phase clouds respond to changes in the Arctic environment, uncertainty remains as to how climate warming will affect the cloud micro- and macrophysical properties. This is in no small part due to the fact that there are nonlinear interactions between changes in atmospheric and surface properties and changes in cloud characteristics. In this study, large-eddy simulations are performed of an arctic mixed phase cloud observed during the Indirect and Semi-Direct Aerosol Campaign. A parameter-space-filling uncertainty quantification technique is used to rigorously explore how simulated arctic mixed phase clouds respond to changes in the properties of the environment. Specifically, the cloud ice and aerosol concentration, surface sensible and latent heat fluxes, and large scale temperature, water vapor, and vertical motion are systematically changed, and the properties of the resulting clouds are examined. It is found that Arctic mixed phase clouds exhibit four characteristic behaviors: stability, growth, decay, and dissipation. Sets of environmental and surface properties that lead to the emergence of each type of behavior are presented, and the implications for the response of Arctic clouds to changes in climate are explored.

  11. Conversation therapy with people with aphasia and conversation partners using video feedback: a group and case series investigation of changes in interaction.

    Directory of Open Access Journals (Sweden)

    Wendy Best

    2016-11-01

    Full Text Available Conversation therapies employing video for feedback and to facilitate outcome measurement are increasingly used with people with post-stroke aphasia and their conversation partners; however the evidence base for change in everyday interaction remains limited. We investigated the effect of Better Conversations with Aphasia, an intervention that is freely available online (https:// extend.ucl.ac.uk/. Eight people with chronic agrammatic aphasia, and their regular conversation partners participated in the tailored 8 week program involving significant video feedback. We explored changes in (i conversation facilitators (such as multi-modal turns by people with aphasia and (ii conversation barriers (such as use of test questions by conversation partners. The outcome of intervention was evaluated directly by measuring change in video-recorded everyday conversations. The study employed a pre-post design with multiple 5 minute samples of conversation before and after intervention, scored by trained raters blind to the point of data collection. Group level analysis showed no significant increase in conversation facilitators. There was, however, a significant reduction in the number of conversation barriers. The case series data revealed variability in conversation behaviors across occasions for the same dyad and between different dyads. Specifically, post-intervention there was a significant increase in facilitator behaviors for two dyads, a decrease for one and no significant change for five dyads. There was a significant decrease in barrier behaviors for five dyads and no significant change for three dyads. The reduction in barrier behaviors was considerable; on average change from over 8 to fewer than 3 barrier behaviors in 5 minutes conversation. The pre-post design has the limitation of no comparison group. However, change occurs in targeted conversational behaviors and in people with chronic aphasia and their partners. The findings suggest change

  12. Formativ Feedback

    DEFF Research Database (Denmark)

    Hyldahl, Kirsten Kofod

    Denne bog undersøger, hvordan lærere kan anvende feedback til at forbedre undervisningen i klasselokalet. I denne sammenhæng har John Hattie, professor ved Melbourne Universitet, udviklet en model for feedback, hvilken er baseret på synteser af meta-analyser. I 2009 udgav han bogen "Visible...

  13. The helical phase of chiral nematic liquid crystals as the Bianchi VII(0) group manifold

    CERN Document Server

    Gibbons, G W

    2011-01-01

    We show that the optical structure of the helical phase of a chiral nematic is naturally associated with the Bianchi VII(0) group manifold. The Joets-Ribotta metric governing propagation of the extraordinary rays is invariant under the simply transitive action of the universal cover of the three dimensional Euclidean group of two dimensions. Thus extraordinary light rays are geodesics of a left-invariant metric on this Bianchi type VII(0) group. We are able to solve by separation of variables both the wave equation and the Hamilton-Jacobi equation for this metric. The former reduces to Mathieu's equation and the later to the quadrantal pendulum equation. We further discuss Maxwell's equations for uniaxial optical materials where the configuration is invariant under a group action. The material is not assumed to be impedance matched, thus going beyond the usual scope of transformation optics. We show that for a chiral nematic in its helical phase Maxwell's equations reduce to a generalised Mathieu equation. Ou...

  14. Influence of the leaving group on the dynamics of a gas-phase SN2 reaction

    Science.gov (United States)

    Stei, Martin; Carrascosa, Eduardo; Kainz, Martin A.; Kelkar, Aditya H.; Meyer, Jennifer; Szabó, István; Czakó, Gábor; Wester, Roland

    2016-02-01

    In addition to the nucleophile and solvent, the leaving group has a significant influence on SN2 nucleophilic substitution reactions. Its role is frequently discussed with respect to reactivity, but its influence on the reaction dynamics remains unclear. Here, we uncover the influence of the leaving group on the gas-phase dynamics of SN2 reactions in a combined approach of crossed-beam imaging and dynamics simulations. We have studied the reaction F- + CH3Cl and compared it to F- + CH3I. For the two leaving groups, Cl and I, we find very similar structures and energetics, but the dynamics show qualitatively different features. Simple scaling of the leaving group mass does not explain these differences. Instead, the relevant impact parameters for the reaction mechanisms are found to be crucial and the differences are attributed to the relative orientation of the approaching reactants. This effect occurs on short timescales and may also prevail in solution-phase conditions.

  15. A laser feedback interferometer with an oscillating feedback mirror

    Institute of Scientific and Technical Information of China (English)

    Wang Zhi-Guo; Wang Fei; Xiao Guang-Zong

    2012-01-01

    A method is proposed to solve the problem of direction discrimination for laser feedback interferometers.By vibrating the feedback mirror with a small-amplitude and high-frequency sine wave,laser intensity is modulated accordingly.The modulation amplitude can be extracted using a phase sensitive detector (PSD).When the feedback mirror moves,the PSD output shows a quasi-sine waveform similar to a laser intensity interference fringe but with a phase difference of approximately ±π/2.If the movement direction of the feedback mirror changes,the phase difference sign reverses.Therefore,the laser feedback interferometer offers a potential application in displacement measurement with a resolution of 1/8 wavelength and in-time direction discrimination.Without using optical components such as polarization beam splitters and wave plates,the interferometer is very simple,easy to align,and less costly.

  16. Renormalization group evolution of neutrino parameters in presence of seesaw threshold effects and Majorana phases

    Directory of Open Access Journals (Sweden)

    Shivani Gupta

    2015-04-01

    Full Text Available We examine the renormalization group evolution (RGE for different mixing scenarios in the presence of seesaw threshold effects from high energy scale (GUT to the low electroweak (EW scale in the Standard Model (SM and Minimal Supersymmetric Standard Model (MSSM. We consider four mixing scenarios namely Tri–Bimaximal Mixing, Bimaximal Mixing, Hexagonal Mixing and Golden Ratio Mixing which come from different flavor symmetries at the GUT scale. We find that the Majorana phases play an important role in the RGE running of these mixing patterns along with the seesaw threshold corrections. We present a comparative study of the RGE of all these mixing scenarios both with and without Majorana CP phases when seesaw threshold corrections are taken into consideration. We find that in the absence of these Majorana phases both the RGE running and seesaw effects may lead to θ13<5° at low energies both in the SM and MSSM. However, if the Majorana phases are incorporated into the mixing matrix the running can be enhanced both in the SM and MSSM. Even by incorporating non-zero Majorana CP phases in the SM, we do not get θ13 in its present 3σ range. The current values of the two mass squared differences and mixing angles including θ13 can be produced in the MSSM case with tan⁡β=10 and non-zero Majorana CP phases at low energy. We also calculate the order of effective Majorana mass and Jarlskog Invariant for each scenario under consideration.

  17. Numerical renormalization group for impurity quantum phase transitions: structure of critical fixed points

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyun-Jung [Theoretische Physik III, Elektronische Korrelationen und Magnetismus, Institut fuer Physik, Universitaet Augsburg, D-86135 Augsburg (Germany); Bulla, Ralf [Theoretische Physik III, Elektronische Korrelationen und Magnetismus, Institut fuer Physik, Universitaet Augsburg, D-86135 Augsburg (Germany); Vojta, Matthias [Institut fuer Theorie der Kondensierten Materie, Universitaet Karlsruhe, D-76128 Karlsruhe (Germany)

    2005-11-02

    The numerical renormalization group method is used to investigate zero-temperature phase transitions in quantum impurity systems, in particular in the particle-hole symmetric soft-gap Anderson model. The model displays two stable phases whose fixed points can be built up of non-interacting single-particle states. In contrast, the quantum phase transitions turn out to be described by interacting fixed points, and their excitations cannot be described in terms of free particles. We show that the structure of the many-body spectrum of these critical fixed points can be understood using renormalized perturbation theory close to certain values of the bath exponents which play the role of critical dimensions. Contact is made with perturbative renormalization group calculations for the soft-gap Anderson and Kondo models. A complete description of the quantum critical many-particle spectra is achieved using suitable marginal operators; technically this can be understood as epsilon-expansion for full many-body spectra.

  18. Numerical renormalization group for impurity quantum phase transitions: structure of critical fixed points

    Science.gov (United States)

    Lee, Hyun-Jung; Bulla, Ralf; Vojta, Matthias

    2005-11-01

    The numerical renormalization group method is used to investigate zero-temperature phase transitions in quantum impurity systems, in particular in the particle-hole symmetric soft-gap Anderson model. The model displays two stable phases whose fixed points can be built up of non-interacting single-particle states. In contrast, the quantum phase transitions turn out to be described by interacting fixed points, and their excitations cannot be described in terms of free particles. We show that the structure of the many-body spectrum of these critical fixed points can be understood using renormalized perturbation theory close to certain values of the bath exponents which play the role of critical dimensions. Contact is made with perturbative renormalization group calculations for the soft-gap Anderson and Kondo models. A complete description of the quantum critical many-particle spectra is achieved using suitable marginal operators; technically this can be understood as epsilon-expansion for full many-body spectra.

  19. The effects of self-controlled video feedback on the learning of the basketball set shot

    Directory of Open Access Journals (Sweden)

    Christopher Adam Aiken

    2012-09-01

    Full Text Available Allowing learners to control some aspect of instructional support (e.g., augmented feedback appears to facilitate motor skill acquisition. No studies, however, have examined self-controlled (SC video feedback without the provision of additional attentional cueing. The purpose of this study was to extend previous SC research using video feedback about movement form for the basketball set shot without explicitly directing attention to specific aspects of the movement. The SC group requested video feedback of their performance following any trial during the acquisition phase. The yoked (YK group received feedback according to a schedule created by a SC counterpart. During acquisition participants were also allowed to view written instructional cues at any time. Results revealed that the SC group had significantly higher form scores during the transfer phase and utilized the instructional cues more frequently during acquisition. Post-training questionnaire responses indicated no preference for requesting or receiving feedback following good trials as reported by Chiviacowsky and Wulf (2002, 2005. The nature of the task was such that participants could have assigned both positive and negative evaluations to different aspects of the movement during the same trial. Thus, the lack of preferences along with the similarity in scores for feedback and no-feedback trials may simply have reflected this complexity. Importantly, however, the results indicated that SC video feedback conferred a learning benefit without the provision of explicit additional attentional cueing.

  20. Combining a leadership course and multi-source feedback has no effect on leadership skills of leaders in postgraduate medical education. An intervention study with a control group

    DEFF Research Database (Denmark)

    Malling, Bente Vigh; Mortensen, Lene; Bonderup, Thomas

    2009-01-01

    BACKGROUND: Leadership courses and multi-source feedback are widely used developmental tools for leaders in health care. On this background we aimed to study the additional effect of a leadership course following a multi-source feedback procedure compared to multi-source feedback alone especially...... not improve leadership skills of consultants responsible for education in clinical departments. Developing leadership skills takes time and the time frame of one year might have been too short to show improvement in leadership skills of consultants responsible for education. Further studies are needed...

  1. The Influence of Group Versus Individual Prenatal Care on Phase of Labor at Hospital Admission.

    Science.gov (United States)

    Tilden, Ellen L; Emeis, Cathy L; Caughey, Aaron B; Weinstein, Sarah R; Futernick, Sarah B; Lee, Christopher S

    2016-07-01

    Group prenatal care, an alternate model of prenatal care delivery, has been associated with various improved perinatal outcomes in comparison to standard, individual prenatal care. One important maternity care process measure that has not been explored among women who receive group prenatal care versus standard prenatal care is the phase of labor (latent vs active) at hospital admission. A retrospective case-control study was conducted comparing 150 women who selected group prenatal care with certified nurse-midwives (CNMs) versus 225 women who chose standard prenatal care with CNMs. Analyses performed included descriptive statistics to compare groups and multivariate regression to evaluate the contribution of key covariates potentially influencing outcomes. Propensity scores were calculated and included in regression models. Women within this sample who received group prenatal care were more likely to be in active labor (≥ 4 cm of cervical dilatation) at hospital admission (odds ratio [OR], 1.73; 95% confidence interval [CI], 1.03-2.99; P = .049) and were admitted to the hospital with significantly greater cervical dilatation (mean [standard deviation, SD] 5.7 [2.5] cm vs. 5.1 [2.3] cm, P = .005) compared with women who received standard prenatal care, controlling for potential confounding variables and propensity for group versus individual care selection. Group prenatal care may be an effective and safe intervention for decreasing latent labor hospital admission among low-risk women. Neither group prenatal care nor active labor hospital admission was associated with increased morbidity. © 2016 by the American College of Nurse-Midwives.

  2. Life Cycle Leadership Theory vs. Theory on the Phases of Small Group Discussion: Comparisons, Contrasts, and Examples.

    Science.gov (United States)

    Preston, Charles Thomas, Jr.

    The work of Paul Hersey and Kenneth Blanchard on life-cycle leadership was compared and contrasted to three studies on group phase theories. The studies on group phases were conducted by Robert Bales and Fred Strodtbeck in 1951, Thomas Scheidel and Laura Crowell in 1964, and B. Aubrey Fisher in 1970. The two theoretical approaches were found to…

  3. Operable Unit 3-13, Group 3, Other Surface Soils (Phase I) Remedial Action Report

    Energy Technology Data Exchange (ETDEWEB)

    L. Davison

    2007-07-31

    This Remedial Action Report summarizes activities undertaken to remediate the Operable Unit 3-13, Group 3, Other Surface Soils, Phase I sites at the Idaho Nuclear Technology and Engineering Center at the Idaho National Laboratory Site. The 10 sites addressed in this report were defined in the Operable Unit 3-13 Record of Decision and subsequent implementing documents. This report concludes that remediation requirements and cleanup goals established for these 10 sites have been accomplished and are hereafter considered No Action or No Further Action sites.

  4. Dimensionless groups for three-phase gravity drainage flow in porous media

    Energy Technology Data Exchange (ETDEWEB)

    Grattoni, C.A.; Jing, X.D. [T.H. Huxley School, Imperial College, Prince Consort Road, SW7 2AZ London (United Kingdom); Dawe, R.A. [Chemical Engineering Department, University of West Indies, St. Augustine (Trinidad and Tobago)

    2001-01-01

    The downward displacement of oil by gas (either through gas cap expansion or by gas injection) at the crest of the reservoir is an attractive method of oil recovery. The drainage of oil under gravity forces is a potentially efficient method as it can reduce the remaining oil saturation to below that obtained after waterflooding. This paper describes a series of experiments of gas invasion under gravity-dominated conditions with special attention to the effects of wettability and water saturation on three-phase flow. The experiments were performed in bead-pack models by spontaneous gas invasion at both low and high water saturations with a spreading oil. Different oil recovery rates were observed depending on the wettability of the beads and initial water saturation. At irreducible water saturation, the process appeared to be less efficient for the oil-wet conditions, while similar oil recoveries are observed for both oil-wet and water-wet media at residual oil saturation. Different recovery rates occur with different fluid morphology, which depend on the matrix wettability and the balance between gravity, viscous and capillary forces. The results have been analysed using dimensionless groups. The Bond (N{sub B}) and capillary numbers (N{sub C}) were modified to include the 3-phase effects of gas, oil and water. However, for these cases the Bond and capillary numbers alone were insufficient to fully describe the dynamics of oil recovery by gravity drainage. Therefore, a new dimensionless group combining the effects of gravity and viscous forces to capillary forces was defined as: N=N{sub B}+A({mu}{sub d}/{mu}{sub g})N{sub C}, where A is a scaling factor (in all our experiments A=-17225) and ({mu}{sub d}/{mu}{sub g}) is the viscosity ratio between the displaced and displacing phase. A linear relationship was found between this new group and the total recovery for all the scenarios tested. The slope was approximately 40 for three cases, i.e., water-wet case at

  5. Galaxies on FIRE (Feedback In Realistic Environments): Stellar Feedback Explains Cosmologically Inefficient Star Formation

    CERN Document Server

    Hopkins, Philip F; Onorbe, Jose; Faucher-Giguere, Claude-Andre; Quataert, Eliot; Murray, Norm; Bullock, James S

    2013-01-01

    We present a series of high-resolution cosmological simulations of galaxy formation to z=0, spanning halo masses ~10^8-10^13 M_sun, and stellar masses ~10^4-10^11. Our simulations include fully explicit treatment of both the multi-phase ISM (molecular through hot) and stellar feedback. The stellar feedback inputs (energy, momentum, mass, and metal fluxes) are taken directly from stellar population models. These sources of stellar feedback, with zero adjusted parameters, reproduce the observed relation between stellar and halo mass up to M_halo~10^12 M_sun (including dwarfs, satellites, MW-mass disks, and small groups). By extension, this leads to reasonable agreement with the stellar mass function for M_star6. We find that the M_star-M_halo relation is insensitive to numerical details, but is sensitive to the feedback physics. Simulations with only supernova feedback fail to reproduce the observed stellar masses, particularly in dwarf and high-redshift galaxies: radiative feedback (photo-heating and radiation...

  6. Plant–soil feedbacks

    NARCIS (Netherlands)

    Cortois, Roeland; Schröder-Georgi, Thomas; Weigelt, Alexandra; Putten, van der Wim H.; Deyn, De Gerlinde B.

    2016-01-01

    1. Plant–soil feedback (PSF), plant trait and functional group concepts advanced our understanding of plant community dynamics, but how they are interlinked is poorly known.
    2. To test how plant functional groups (FGs: graminoids, small herbs, tall herbs, legumes) and plant traits relate to PSF,

  7. A discrete single server queue with Markovian arrivals and phase type group services

    Directory of Open Access Journals (Sweden)

    Attahiru Sule Alfa

    1995-01-01

    Full Text Available We consider a single-server discrete queueing system in which arrivals occur according to a Markovian arrival process. Service is provided in groups of size no more than M customers. The service times are assumed to follow a discrete phase type distribution, whose representation may depend on the group size. Under a probabilistic service rule, which depends on the number of customers waiting in the queue, this system is studied as a Markov process. This type of queueing system is encountered in the operations of an automatic storage retrieval system. The steady-state probability vector is shown to be of (modified matrix-geometric type. Efficient algorithmic procedures for the computation of the rate matrix, steady-state probability vector, and some important system performance measures are developed. The steady-state waiting time distribution is derived explicitly. Some numerical examples are presented.

  8. A phase synchronization clustering algorithm for identifying interesting groups of genes from cell cycle expression data

    Directory of Open Access Journals (Sweden)

    Tcha Hong

    2008-01-01

    Full Text Available Abstract Background The previous studies of genome-wide expression patterns show that a certain percentage of genes are cell cycle regulated. The expression data has been analyzed in a number of different ways to identify cell cycle dependent genes. In this study, we pose the hypothesis that cell cycle dependent genes are considered as oscillating systems with a rhythm, i.e. systems producing response signals with period and frequency. Therefore, we are motivated to apply the theory of multivariate phase synchronization for clustering cell cycle specific genome-wide expression data. Results We propose the strategy to find groups of genes according to the specific biological process by analyzing cell cycle specific gene expression data. To evaluate the propose method, we use the modified Kuramoto model, which is a phase governing equation that provides the long-term dynamics of globally coupled oscillators. With this equation, we simulate two groups of expression signals, and the simulated signals from each group shares their own common rhythm. Then, the simulated expression data are mixed with randomly generated expression data to be used as input data set to the algorithm. Using these simulated expression data, it is shown that the algorithm is able to identify expression signals that are involved in the same oscillating process. We also evaluate the method with yeast cell cycle expression data. It is shown that the output clusters by the proposed algorithm include genes, which are closely associated with each other by sharing significant Gene Ontology terms of biological process and/or having relatively many known biological interactions. Therefore, the evaluation analysis indicates that the method is able to identify expression signals according to the specific biological process. Our evaluation analysis also indicates that some portion of output by the proposed algorithm is not obtainable by the traditional clustering algorithm with

  9. SYNTHESIS AND PHASE BEHAVIOR OF POLYURETHANES END-CAPPED WITH FLUORINATED PHOSPHATIDYLCHOLINE HEAD GROUPS

    Institute of Scientific and Technical Information of China (English)

    Dong-sheng Tan; Xiao-qing Zhang; Jian-chuan Wang; Jie-hua Li; Hong Tan; Qiang Fu

    2011-01-01

    A series of fluorinated phosphatidylcholine polyurethane macromolecular additives were synthesized by solution polymerization using methylenebis(phylene isocyanates) (MDI) and 1,4-butanediol (BDO) as hard segments,a new phoshporycholine,2-(2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9-hexadecafluoro-10-(2-hydroxyethoxy)decyloxy) ethyl phosphorycholine (HDFOPC) as end-capper,and four polydiols,poly(tetramethylene glycol)s (PTMG),polydimethylsiloxane (PDMS),poly(1,6-hexyl-1,5-pentylcarbonate) (PHPC) and poly(propylene glycol) (PPG) as soft segments,respectively.The chemical structures of the synthesized polyurethanes were characterized by 1H-NMR and FTIR.DSC and DMA were employed to study the phase behavior of these novel polyurethanes due to their great influences on the surface properties,and hence their interactions with bio-systems.The results showed that phase separation of the fluorinated phosphatidylcholine end-capped polyurethanes was increased in comparison with that of normal polyurethanes.The effect of fluorinated phosphatidylcholine end-capped groups on the phase behavior was further demonstrated by analyzing the degree of hydrogen-bonding between hard and soft segments.

  10. Effect of Vision Angle on the Phase Transition in a Flocking Behavior of Animal Groups

    CERN Document Server

    Nguyen, P The; Ngo, V Thanh

    2014-01-01

    The nature of the phase transition in a system of self-propelling particles has been extensively studied during the last few decades. A theoretical model was proposed by T. Vicsek, et. al. [Phys. Rev. Lett. 75, 1226 (1995)] with a simple rule for updating the direction of motion of each particle. Based on the Vicsek's model (VM) [1], in this work, we consider a group of animals as particles moving freely on a two-dimensional space. Due to the fact that the viewable area of animals depends on the species, we consider the motion of each individual within an angle $\\varphi=\\Phi/2$ ($\\Phi$ is called angle of view) of a circle centered at its position, of radius $R$. We obtained a phase diagram in the space ($\\varphi$, $\\eta_c$) with $\\eta_c$ being the critical noise. We show that, the phase transition exists only in the case of a wide view's angle $\\varphi \\geq 0.5\\pi$. The flocking of animals is perhaps a behavior of the species of prey only, but not the one of the predator. Our simulation results are in good ag...

  11. Renormalization-group theory for cooling first-order phase transitions in Potts models.

    Science.gov (United States)

    Liang, Ning; Zhong, Fan

    2017-03-01

    We develop a dynamic field-theoretic renormalization-group (RG) theory for cooling first-order phase transitions in the Potts model. It is suggested that the well-known imaginary fixed points of the q-state Potts model for q>10/3 in the RG theory are the origin of the dynamic scaling found recently from numerical simulations, apart from logarithmic corrections. This indicates that the real and imaginary fixed points of the Potts model are both physical and control the scalings of the continuous and discontinuous phase transitions, respectively, of the model. Our one-loop results for the scaling exponents are already not far away from the numerical results. Further, the scaling exponents depend on q only slightly, consistent with the numerical results. Therefore, the theory is believed to provide a natural explanation of the dynamic scaling including the scaling exponents and their scaling laws for various observables in the cooling first-order phase transition of the Potts model.

  12. Renormalization-group theory for cooling first-order phase transitions in Potts models

    Science.gov (United States)

    Liang, Ning; Zhong, Fan

    2017-03-01

    We develop a dynamic field-theoretic renormalization-group (RG) theory for cooling first-order phase transitions in the Potts model. It is suggested that the well-known imaginary fixed points of the q -state Potts model for q >10 /3 in the RG theory are the origin of the dynamic scaling found recently from numerical simulations, apart from logarithmic corrections. This indicates that the real and imaginary fixed points of the Potts model are both physical and control the scalings of the continuous and discontinuous phase transitions, respectively, of the model. Our one-loop results for the scaling exponents are already not far away from the numerical results. Further, the scaling exponents depend on q only slightly, consistent with the numerical results. Therefore, the theory is believed to provide a natural explanation of the dynamic scaling including the scaling exponents and their scaling laws for various observables in the cooling first-order phase transition of the Potts model.

  13. Feedback Perceptions and Attribution by Secretarial Employees: Effects of Feedback-Content and Sender Characteristics

    Science.gov (United States)

    Raemdonck, Isabel; Strijbos, Jan-Willem

    2013-01-01

    Purpose: Theoretical explanations for the diverse reactive feedback from secretarial employees in different career phases are relatively unexplored. However, research examining age differences in the impact of feedback suggests that the effects of performance feedback may differ for employees in the early career phase and employees in the late…

  14. Development of a group contribution method to predict aqueous phase hydroxyl radical (HO*) reaction rate constants.

    Science.gov (United States)

    Minakata, Daisuke; Li, Ke; Westerhoff, Paul; Crittenden, John

    2009-08-15

    The hydroxyl radical (HO*) is a strong oxidant that reacts with electron-rich sites of organic compounds and initiates complex chain mechanisms. In order to help understand the reaction mechanisms, a rule-based model was previously developed to predict the reaction pathways. For a kinetic model, there is a need to develop a rate constant estimator that predicts the rate constants for a variety of organic compounds. In this study, a group contribution method (GCM) is developed to predict the aqueous phase HO* rate constants for the following reaction mechanisms: (1) H-atom abstraction, (2) HO* addition to alkenes, (3) HO* addition to aromatic compounds, and (4) HO* interaction with sulfur (S)-, nitrogen (N)-, or phosphorus (P)-atom-containing compounds. The GCM hypothesizes that an observed experimental rate constant for a given organic compound is the combined rate of all elementary reactions involving HO*, which can be estimated using the Arrhenius activation energy, E(a), and temperature. Each E(a) for those elementary reactions can be comprised of two parts: (1) a base part that includes a reactive bond in each reaction mechanism and (2) contributions from its neighboring functional groups. The GCM includes 66 group rate constants and 80 group contribution factors, which characterize each HO* reaction mechanism with steric effects of the chemical structure groups and impacts of the neighboring functional groups, respectively. Literature-reported experimental HO* rate constants for 310 and 124 compounds were used for calibration and prediction, respectively. The genetic algorithms were used to determine the group rate constants and group contribution factors. The group contribution factors for H-atom abstraction and HO* addition to the aromatic compounds were found to linearly correlate with the Taft constants, sigma*, and electrophilic substituent parameters, sigma+, respectively. The best calibrations for 83% (257 rate constants) and predictions for 62% (77

  15. Dissociation between active and observational learning from positive and negative feedback in Parkinsonism.

    Directory of Open Access Journals (Sweden)

    Stefan Kobza

    Full Text Available Feedback to both actively performed and observed behaviour allows adaptation of future actions. Positive feedback leads to increased activity of dopamine neurons in the substantia nigra, whereas dopamine neuron activity is decreased following negative feedback. Dopamine level reduction in unmedicated Parkinson's Disease patients has been shown to lead to a negative learning bias, i.e. enhanced learning from negative feedback. Recent findings suggest that the neural mechanisms of active and observational learning from feedback might differ, with the striatum playing a less prominent role in observational learning. Therefore, it was hypothesized that unmedicated Parkinson's Disease patients would show a negative learning bias only in active but not in observational learning. In a between-group design, 19 Parkinson's Disease patients and 40 healthy controls engaged in either an active or an observational probabilistic feedback-learning task. For both tasks, transfer phases aimed to assess the bias to learn better from positive or negative feedback. As expected, actively learning patients showed a negative learning bias, whereas controls learned better from positive feedback. In contrast, no difference between patients and controls emerged for observational learning, with both groups showing better learning from positive feedback. These findings add to neural models of reinforcement-learning by suggesting that dopamine-modulated input to the striatum plays a minor role in observational learning from feedback. Future research will have to elucidate the specific neural underpinnings of observational learning.

  16. Gas Phase Chromatography of some Group 4, 5, and 6 Halides

    Energy Technology Data Exchange (ETDEWEB)

    Sylwester, Eric Robert [Univ. of California, Berkeley, CA (United States)

    1998-10-01

    Gas phase chromatography using The Heavy Element Volatility Instrument (HEVI) and the On Line Gas Apparatus (OLGA III) was used to determine volatilities of ZrBr4, HfBr4, RfBr4, NbBr5, TaOBr3, HaCl5, WBr6, FrBr, and BiBr3. Short-lived isotopes of Zr, Hf, Rf, Nb, Ta, Ha, W, and Bi were produced via compound nucleus reactions at the 88-Inch Cyclotron at Lawrence Berkeley National Laboratory and transported to the experimental apparatus using a He gas transport system. The isotopes were halogenated, separated from the other reaction products, and their volatilities determined by isothermal gas phase chromatography. Adsorption Enthalpy (ΔHa) values for these compounds were calculated using a Monte Carlo simulation program modeling the gas phase chromatography column. All bromides showed lower volatility than molecules of similar molecular structures formed as chlorides, but followed similar trends by central element. Tantalum was observed to form the oxybromide, analogous to the formation of the oxychloride under the same conditions. For the group 4 elements, the following order in volatility and ΔHa was observed: RfBr4 > ZrBr4 > HfBr4. The ΔHa values determined for the group 4, 5, and 6 halides are in general agreement with other experimental data and theoretical predictions. Preliminary experiments were performed on Me-bromides. A new measurement of the half-life of 261Rf was performed. 261Rf was produced via the 248Cm(18O, 5n) reaction and observed with a half-life of 74-6+7 seconds, in excellent agreement with the previous measurement of 78-6+11 seconds. We recommend a new half-life of 75±7 seconds for 261Rf based on these two measurements. Preliminary studies in transforming HEVI from an isothermal (constant

  17. Feedback and Incentives

    DEFF Research Database (Denmark)

    Eriksson, Tor Viking; Poulsen, Anders; Villeval, Marie Claire

    2009-01-01

    This paper experimentally investigates the impact of different pay schemes and relative performance feedback policies on employee effort. We explore three feedback rules: no feedback on relative performance, feedback given halfway through the production period, and continuously updated feedback. ...

  18. TUNE FEEDBACK AT RHIC

    Energy Technology Data Exchange (ETDEWEB)

    CAMERON,P.; CERNIGLIA,P.; CONNOLLY,R.; CUPOLO,J.; DAWSON,W.C.; DEGEN,C.; DELLAPENNA,A.; DELONG,J.; DREES,A.; HUHN,A.; KESSELMAN,M.; MARUSIC,A.; OERTER,B.; MEAD,J.; SCHULTHEISS,C.; SIKORA,R.; VAN ZEIJTS,J.

    2001-06-18

    Preliminary phase-locked loop betatron tune measurement results were obtained during RHIC 2000 with a resonant Beam Position Monitor. These results suggested the possibility of incorporating PLL tune measurement into a tune feedback system for RHIC 2001. Tune feedback is useful in a superconducting accelerator, where the machine cycle time is long and inefficient acceleration due to resonance crossing is not comfortably tolerated. This is particularly true with the higher beam intensities planned for RHIC 2001. We present descriptions of a PLL tune measurement system implemented in the DSP/FPGA environment of a RHIC BPM electronics module and the feedback system into which the measurement is incorporated to regulate tune. In addition, we present results from the commissioning of this system during RHIC 2001.

  19. Phase-specific brain change of spatial working memory processing in genetic and ultra-high risk groups of schizophrenia.

    Science.gov (United States)

    Choi, Jung-Seok; Park, Ji-Young; Jung, Myung Hun; Jang, Joon Hwan; Kang, Do-Hyung; Jung, Wi Hoon; Han, Ji Yeon; Choi, Chi-Hoon; Hong, Kyung Sue; Kwon, Jun Soo

    2012-11-01

    Spatial working memory (WM) processing has 3 distinct phases: encoding, maintenance, and retrieval and its dysfunction is a core feature in schizophrenia. We examined phase-specific brain activations associated with spatial WM in first-degree relatives of schizophrenia (genetic high risk, GHR), ultra-high risk (UHR) subjects, patients with schizophrenia, and healthy controls. We used an event-related functional magnetic resonance imaging in 17 GHR subjects, 21 UHR subjects, 15 clinically stable patients with schizophrenia and 16 healthy controls, while subjects were performing a spatial delayed-response task. During the encoding phase, the GHR group showed increased activation in the fronto-parietal regions, whereas the UHR and schizophrenia groups showed significantly less activation in these regions than did the healthy control group. Especially, frontal activation was strongest in GHR subjects, followed by healthy controls, and occurred to a lesser degree in the UHR group, with the least activation occurring in the schizophrenia group. During the maintenance phase, the thalamus showed a differential activation, similar to frontal activation pattern during the encoding phase. During the retrieval phase, no prominent differential activations were found. Increased activations were observed in the superior temporal gyrus during the encoding and maintenance phases in the GHR, UHR, and schizophrenia groups relative to healthy controls. Our findings suggest that functional deficits associated with spatial WM processing emerge in the UHR before the onset of schizophrenia and compensatory neural processes exist in the GHR with genetic liability to schizophrenia.

  20. Phase transitions in Group III-V and II-VI semiconductors at high pressure

    Science.gov (United States)

    Yu, S. C.; Liu, C. Y.; Spain, I. L.; Skelton, E. F.

    1979-01-01

    The structures and transition pressures of Group III-V and II-VI semiconductors and of a pseudobinary system (Ga/x/In/1-x/Sb) have been investigated. Results indicate that GaP, InSb, GaSb, GaAs and possible AlP assume Metallic structures at high pressures; a tetragonal, beta-Sn-like structure is adopted by only InSb and GaSb. The rocksalt phase is preferred in InP, InAs, AlSb, ZnO and ZnS. The model of Van Vechten (1973) gives transition pressures which are in good agreement with measured values, but must be refined to account for the occurrence of the ionic rocksalt structure in some compounds. In addition, discrepancies between the theoretical scaling values for volume changes at the semiconductor-to-metal transitions are observed.

  1. Ordered phase of the O(N) model within the nonperturbative renormalization group.

    Science.gov (United States)

    Peláez, Marcela; Wschebor, Nicolás

    2016-10-01

    We analyze nonperturbative renormalization group flow equations for the ordered phase of Z_{2} and O(N) invariant scalar models. This is done within the well-known derivative expansion scheme. For its leading order [local potential approximation (LPA)], we show that not every regulator yields a smooth flow with a convex free energy and discuss for which regulators the flow becomes singular. Then we generalize the known exact solutions of smooth flows in the "internal" region of the potential and exploit these solutions to implement an improved numerical algorithm, which is much more stable than previous ones for N>1. After that, we study the flow equations at second order of the derivative expansion and analyze how and when the LPA results change. We also discuss the evolution of the field renormalization factors.

  2. Waste area Grouping 2 Phase I task data report: Human health risk assessment

    Energy Technology Data Exchange (ETDEWEB)

    Purucker, S.T.; Douthat, D.M.

    1996-06-01

    This report is one of five reports issued in 1996 that provide follow- up information to the Phase 1 Remedial Investigation (RI) Report for Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL). The five reports address areas of concern that could cause potential human health risk and ecological risk within WAG2 at ORNL. The purpose of this report is to present a summary of the human health risk assessment results based on the data collected for the WAG 2 Phase 1 RI. Estimates of risk are provided based on measured concentrations in the surface water, floodplain soil, and sediment of White Oak Creek, Melton Branch, and their tributaries. The human health risk assessment methodology used in this risk assessment is based on Risk Assessment Guidance for Superfund (RAGS). First, the data for the different media are elevated to determine usability for risk assessment. Second, through the process of selecting chemicals of potential concern (COPCs), contaminants to be considered in the risk assessment are identified for each assessment of exposure potential is performed, and exposure pathways are identified. Subsequently, exposure is estimated quantitatively, and the toxicity of each of the COPCs is determined. The results of these analyses are combined and summarized in a risk characterization.

  3. ABCDEFG IS - the principle of constructive feedback.

    Science.gov (United States)

    Bhattarai, M

    2007-01-01

    Feedback is an integral part of any learning experience. Constructive feedback is a powerful instrument and facilitates the learner's professional and personal development. "ABCDEFG IS", a mnemonic for the principles of constructive feedback, stands for Amount of the information, Benefit of the trainees, Change behaviour, Descriptive language, Environment, Focused, Group check, Interpretation check, and Sharing information. The eight important steps of feedback are: Ensure prior information, Collect data, Make appropriate meeting arrangement, Begin by encouraging self assessment by the trainee, Highlight areas where the trainee is doing well, Give feedback, Handle reaction maintaining the dignity and Plan actions. Communication and reflection also share many of the principles and steps of constructive feedback and giving regular feedback, thus, helps to improve communication and reflection. The feedback provider would be able to provide genuine feedback by following the appropriate steps and principles of constructive feedback and realize how important and rewarding its role is in teaching learning activities.

  4. Effects of video-feedback on the communication, clinical competence and motivational interviewing skills of practice nurses: a pre-test posttest control group study.

    NARCIS (Netherlands)

    Noordman, J.; Weijden, T. van der; Dulmen, S. van

    2014-01-01

    Aims: To examine the effects of individual video-feedback on the generic communication skills, clinical competence (i.e. adherence to practice guidelines) and motivational interviewing skills of experienced practice nurses working in primary care. Background: Continuing professional education may be

  5. Effects of video-feedback on the communication, clinical competence and motivational interviewing skills of practice nurses: a pre-test posttest control group study

    NARCIS (Netherlands)

    Noordman, J.; Weijden, T.T. van der; Dulmen, S. van

    2014-01-01

    AIMS: To examine the effects of individual video-feedback on the generic communication skills, clinical competence (i.e. adherence to practice guidelines) and motivational interviewing skills of experienced practice nurses working in primary care. BACKGROUND: Continuing professional education may be

  6. A small-scale dynamo in feedback-dominated galaxies as the origin of cosmic magnetic fields. I-the kinematic phase

    CERN Document Server

    Rieder, Michael

    2015-01-01

    Astrophysical dynamo theories provide various mechanisms for magnetic field amplification inside galaxies, where weak initial fields grow exponentially on various timescales. We investigate the particular role played by stellar feedback mechanisms in creating strong fluid turbulence, allowing for a magnetic dynamo to emerge. Performing magnetohydrodynamic simulations of isolated cooling halos, for both dwarf and Milky Way sized objects, we compare the magnetic field evolution for various initial field topologies and various stellar feedback mechanisms. We find that feedback can indeed drive strong gas turbulence which gives rise to a fast exponential magnetic field growth. Our simulations feature typical properties of Kolmogorov turbulence with a $k ^{-5/3}$ kinetic energy spectrum, as well as the characteristic properties of a small-scale dynamo, with a $k^{3/2}$ magnetic energy spectrum as predicted by Kazantsev dynamo theory. In these feedback-dominated galaxies, stellar feedback provides forcing on large ...

  7. Topological influence and excitations: decomposition formulas for calculating homotopy groups of symmetry broken phases

    CERN Document Server

    Higashikawa, Sho

    2016-01-01

    A symmetry broken phase of a system with internal degrees of freedom often features a complex order parameter, which generates a rich variety of topological excitations and topological influence between them, yet the very complexity of the order parameter makes it difficult to treat topological excitations and topological influence in a unified manner. To overcome this problem, we develop a general method to calculate homotopy groups and derive decomposition formulas which express homotopy groups of a quotient space $G/H$ in terms of those of the symmetry $G$ of the system and those of the remaining symmetry $H$ of the state. We apply these formulas to analyze a general monopole and a general three-dimensional skyrmion, and show that their textures are obtained through substitution of the corresponding $\\mathfrak{su}(2)$-subalgebra for the $\\mathfrak{su}(2)$-spin. We also show that a discrete symmetry of $H$ is necessary for the presence of topological influence and find the topological influence on a skyrmio...

  8. Encoding Curved Tetrahedra in Face Holonomies: Phase Space of Shapes from Group-Valued Moment Maps

    Science.gov (United States)

    Haggard, Hal M.; Han, Muxin; Riello, Aldo

    2016-08-01

    We present a generalization of Minkowski's classic theorem on the reconstruction of tetrahedra from algebraic data to homogeneously curved spaces. Euclidean notions such as the normal vector to a face are replaced by Levi-Civita holonomies around each of the tetrahedron's faces. This allows the reconstruction of both spherical and hyperbolic tetrahedra within a unified framework. A new type of hyperbolic simplex is introduced in order for all the sectors encoded in the algebraic data to be covered. Generalizing the phase space of shapes associated to flat tetrahedra leads to group valued moment maps and quasi-Poisson spaces. These discrete geometries provide a natural arena for considering the quantization of gravity including a cosmological constant. A concrete realization of this is provided by the relation with the spin-network states of loop quantum gravity. This work therefore provides a bottom-up justification for the emergence of deformed gauge symmetries and quantum groups in 3+1 dimensional covariant loop quantum gravity in the presence of a cosmological constant.

  9. Haptic feedback helps bipedal coordination.

    Science.gov (United States)

    Roelofsen, Eefje G J; Bosga, Jurjen; Rosenbaum, David A; Nijhuis-van der Sanden, Maria W G; Hullegie, Wim; van Cingel, Robert; Meulenbroek, Ruud G J

    2016-10-01

    The present study investigated whether special haptic or visual feedback would facilitate the coordination of in-phase, cyclical feet movements of different amplitudes. Seventeen healthy participants sat with their feet on sliding panels that were moved externally over the same or different amplitudes. The participants were asked to generate simultaneous knee flexion-extension movements, or to let their feet be dragged, resulting in reference foot displacements of 150 mm and experimental foot displacements of 150, 120, or 90 mm. Four types of feedback were given: (1) special haptic feedback, involving actively following the motions of the sliders manipulated by two confederates, (2) haptic feedback resulting from passive motion, (3) veridical visual feedback, and (4) enhanced visual feedback. Both with respect to amplitude assimilation effects, correlations and standard deviation of relative phase, the results showed that enhanced visual feedback did not facilitate bipedal independence, but haptic feedback with active movement did. Implications of the findings for movement rehabilitation contexts are discussed.

  10. The benefit of repetitive skills training and frequency of expert feedback in the early acquisition of procedural skills.

    Science.gov (United States)

    Bosse, Hans Martin; Mohr, Jonathan; Buss, Beate; Krautter, Markus; Weyrich, Peter; Herzog, Wolfgang; Jünger, Jana; Nikendei, Christoph

    2015-02-19

    Redundant training and feedback are crucial for successful acquisition of skills in simulation trainings. It is still unclear how or how much feedback should best be delivered to maximize its effect, and how learners' activity and feedback are optimally blended. To determine the influence of high- versus low-frequency expert feedback on the learning curve of students' clinical procedural skill acquisition in a prospective randomized study. N = 47 medical students were trained to insert a nasogastric tube in a mannequin, including structured feedback in the initial instruction phase at the beginning of the training (T1), and either additional repetitive feedback after each of their five subsequent repetitions (high-frequency feedback group, HFF group; N = 23) or additional feedback on just one occasion, after the fifth repetition only (low-frequency feedback group, LFF group; N = 24). We assessed a) task-specific clinical skill performance and b) global procedural performance (five items of the Integrated Procedural Performance Instrument (IPPI); on the basis of expert-rated videotapes at the beginning of the training (T1) and during the final, sixth trial (T2). The two study groups did not differ regarding their baseline data. The calculated ANOVA for task-specific clinical skill performance with the between-subject factor 'Group' (HFF vs. LFF) and within-subject factors 'Time' (T1 vs. T2) turned out not to be significant (p training (T2; p training (T2; p training.

  11. Renormalization Group and Phase Transitions in Spin, Gauge, and QCD Like Theories

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yuzhi [Univ. of Iowa, Iowa City, IA (United States)

    2013-08-01

    In this thesis, we study several different renormalization group (RG) methods, including the conventional Wilson renormalization group, Monte Carlo renormalization group (MCRG), exact renormalization group (ERG, or sometimes called functional RG), and tensor renormalization group (TRG).

  12. Waste Area Grouping 2 Remedial Investigation Phase 1 Seep Task data report: Contaminant source area assessment

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, D.S.

    1996-03-01

    This report presents the findings of the Waste Area Grouping (WAG) 2, Phase 1 Remedial Investigation (RI) Seep Task efforts during 1993 and 1994 at Oak Ridge National Laboratory (ORNL). The results presented here follow results form the first year of sampling, 1992, which are contained in the Phase 1 RI report for WAG 2 (DOE 1995a). The WAG 2 Seep Task efforts focused on contaminants in seeps, tributaries, and main streams within the White Oak Creek (WOC) watershed. This report is designed primarily as a reference for contaminants and a resource for guiding remedial decisions. Additional in-depth assessments of the Seep Task data may provide clearer understandings of contaminant transport from the different source areas in the WOC watershed. WAG 2 consists of WOC and its tributaries downstream of the ORNL main plant area, White Oak Lake, the White Oak Creek Embayment of the Clinch River, and the associated flood plains and subsurface environment. The WOC watershed encompasses ORNL and associated WAGs. WAG 2 acts as an integrator for contaminant releases from the contaminated sites at ORNL and as the conduit transporting contaminants to the Clinch River. The main objectives of the Seep Task were to identify and characterize seeps, tributaries and source areas that are responsible for the contaminant releases to the main streams in WAG 2 and to quantify their input to the total contaminant release from the watershed at White Oak Dam (WOD). Efforts focused on {sup 90}Sr, {sup 3}H, and {sup 137}Cs because these contaminants pose the greatest potential human health risk from water ingestion at WOD. Bimonthly sampling was conducted throughout the WOC watershed beginning in March 1993 and ending in August 1994. Samples were also collected for metals, anions, alkalinity, organics, and other radionuclides.

  13. Renormalization-Group Theory Study of Superfluidity and Phase Separation of Helium Mixtures Immersed in Jungle-Gym Aerogel

    Science.gov (United States)

    Lopatnikova, Anna; Berker, A. Nihat

    1997-03-01

    Superfluidity and phase separation in ^3He-^4He mixtures immersed in jungle-gym (non-random) aerogel are studied by renormalization-group theory.(Phys. Rev. B, in press (1996)) Phase diagrams are calculated for a variety of aerogel concentrations. Superfluidity at very low ^4He concentrations and a depressed tricritical temperature are found at the onset of superfluidity. A superfluid-superfluid phase separation, terminating at an isolated critical point, is found entirely within the superfluid phase. These phenomena, and trends with respect to aerogel concentration, are explained by the connectivity and tenuousness of jungle-gym aerogel.

  14. Hangzhou Jinjiang Group Shanxi Fusheng Aluminum Phase I 800,000 t/a Aluminum Oxide Project Started Operation

    Institute of Scientific and Technical Information of China (English)

    2014-01-01

    <正>On October 19,the Shanxi Province Pinglu County Phase I 800,000t/a Aluminum Oxide Project of Shanxi Fusheng Aluminum Co.,Ltd,a subordinate of Hangzhou Jinjiang Group,started operation.This is the fourth Aluminum oxide project constructed and operated by Jinjiang Group.

  15. Relationship between the types of binary alloy phase diagrams of VIII and IB group elements and the Mendeleev numbers

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The relationship between the types of binary alloy phase diagrams of Vlll and IB group elements and the Men deleev numbers was discussed for the first time using the Vlll and IB group elements as solvent metals (A) and the other elements as solute metals (B), basesd on their alloy phase diagram types. The Mendeleev numbers of the solvent metals and the solute metals were expressed as Ma and MB, respectively. A two-dimension map of MdMB was drawn. It is indicated that there is an oblique line in the map, which divides the binary alloy phase diagram types of solvent metals into two symmetry parts, the phase diagram types of the other elements with solvent metals located at the above or down of the line respectively, while on the line, AM= 0. The phase diagrams between the solvent metals basically are simple systems, mainly belong to the types of continues solid solution and the peritectic (about 40% for each type). The solvent metals can be divided into three groups: Co, Ir, Rh, Ni, Pt, and Pd as the first group; Ag, Au, and Cu as the second group;and Fe, Os, and Ru as the third group. The characteristics of the phase diagrams formed between the elements in each group were discussed. About 80% phase diagrams belong to complex systems and less than 20% belong to the simple systems. The regular variation of the chemical scale, the metallic radii of the atoms, the number of valence electrons, and the first ionization energy with the Mendeleev numbers and the crystal structure were introduced as well.

  16. Emergence of a Low Spin Phase in Group Field Theory Condensates

    CERN Document Server

    Gielen, Steffen

    2016-01-01

    Recent years have seen great progress towards deriving quantum cosmology models from the effective dynamics of condensate states in group field theory (GFT), where 'cosmology is the hydrodynamics of quantum gravity'; the classical Friedmann dynamics for homogeneous, isotropic universes, as well as loop quantum cosmology (LQC) corrections to general relativity have been shown to emerge from fundamental quantum gravity. We take one further step towards strengthening the link with LQC and show, in a rather wide class of GFT models for gravity coupled to a free massless scalar field and for generic initial conditions, that GFT condensates dynamically reach a low spin phase of many quanta of geometry, in which all but an exponentially small number of quanta are characterised by a single spin $j_0$ (i.e. by a constant volume per quantum). In one particular simple and natural case, this spin is the lowest one, $j_0=1/2$. The type of quantum state usually assumed in the derivation of LQC is hence derived from the qua...

  17. Frequencies of Blood Group Systems MNS, Diego, and Duffy and Clinical Phases of Carrion's Disease in Amazonas, Peru.

    Science.gov (United States)

    Acosta, Oscar; Solano, Luis; Escobar, Jorge; Fernandez, Miguel; Solano, Carlos; Fujita, Ricardo

    2014-01-01

    Carrion's disease (CD), is a human bartonellosis, that is, endemic in the Andes of Peru, Ecuador, and Colombia. Bartonella bacilliformis, a native hemotrophic bacteria, is the causative agent of CD, and the interaction with the host could have produced changes in the gene frequencies of erythrocyte antigens. The goal here is to investigate the relationship between allele frequencies of blood group systems MNS, Diego, and Duffy and the clinical phases of CD, within a genetic context. In this associative and analytical study, 76 individuals from Bagua Grande, the province of Utcubamba, and the department of Amazonas in Peru, were enrolled. Forty of them resided in Tomocho-Collicate-Vista Hermosa area (high prevalence of cases in chronic phase, verrucous, or eruptive phase, without previous acute phase). Thirty-six individuals were from the area of Miraflores (high prevalence of cases in acute phase only) and were evaluated for blood group systems MNS, Diego, and Duffy. This study constitutes one of the first attempts at evaluating the genetic factors and clinical phases of CD. No significant statistical differences (P > 0.05) between allele frequencies of blood groups MNS, Diego, and Duffy and the prevalence of chronic and acute phases were detected in the two areas of Amazonas, Peru.

  18. Unique Phase Behaviors in the Gemini Surfactant/EAN Binary System: The Role of the Hydroxyl Group.

    Science.gov (United States)

    Li, Qintang; Wang, Xudong; Yue, Xiu; Chen, Xiao

    2015-12-22

    The hydroxyl group in the spacer of a cationic Gemini surfactant (12-3OH-12) caused dramatic changes of the phase behaviors in a protic ionic liquid (EAN). Here, the effects of the hydroxyl group on micellization and lyotropic liquid crystal formation were investigated through the surface tension, small-angle X-ray scattering, polarized optical microscopy, and rheological measurements. With the hydroxyl group in the spacer, the critical micellization concentration of 12-3OH-12 was found to be lower than that of the homologue without hydroxyl (12-3-12) and the 12-3OH-12 molecules packed more densely at the air/EAN interface. It was then interesting to observe a coexistence of two separated phases at wide concentration and temperature ranges in this 12-3OH-12/EAN system. Such a micellar phase separation was rarely observed in the ionic surfactant binary system. With the increase of surfactant concentration, the reverse hexagonal and bicontinuous cubic phases appeared in sequence, whereas only a reverse hexagonal phase was found in 12-3-12/EAN system. But, the hexagonal phases formed with 12-3OH-12 exhibited lower viscoelasticity and thermostability than those observed in 12-3-12/EAN system. Such unique changes in phase behaviors of 12-3OH-12 were ascribed to their enhanced solvophilic interactions of 12-3OH-12 and relatively weak solvophobic interactions in EAN.

  19. The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Phillips, Lawrence R; Beaucage, Serge L

    2002-09-06

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  20. Phenotypic and molecular detection of Salmonella sp. on growing, rearing and production phases in a commercial group of laying hens

    Directory of Open Access Journals (Sweden)

    Dunya M.C. Moraes

    2016-06-01

    Full Text Available Abstract: This present study was developed with the objective of detect Salmonella sp. by conventional bacteriology and qPCR techniques in samples of flooring material from transport crates (meconium; raising environment (swab of cages and drinking fountains; cloacal swab; food and insects from growing, rearing and production phases in a commercial group of laying hens. A total of 864 samples were collected, among whom 248 originated from growing, 392 from rearing and 224 from production phase. Among the 864 samples, 2,8% where positives in bacteriologic technique and 15.3% in qPCR. Contamination was higher in growing and rearing phases and declined in production phase. Twenty four isolations of Salmonella where typified as Salmonella Agona (41.7%, Salmonella Livingstone (33.3%, Salmonella Cerro (16.7%, Salmonella Senftenberg (4.2% and Salmonella Schwarzengrund (4.2%. During growing phase Salmonella Livingstone was identified. These findings suggest vertical contamination in the group. During rearing and production phases, isolated materials belong to serovars Agona, Cerro, Senftenberg and Schwarzengrund, pointing to horizontal contamination. It is possible to conclude that both vertical and horizontal contaminations are important during the cycle of commercial egg production and contamination in rearing phase is higher than in growing and production phases.

  1. Relative Effects of Daily Feedback and Weekly Feedback on Customer Service Behavior at a Gas Station

    Science.gov (United States)

    So, Yongjoon; Lee, Kyehoon; Oah, Shezeen

    2013-01-01

    The relative effects of daily and weekly feedback on customer service behavior at a gas station were assessed using an ABC within-subjects design. Four critical service behaviors were identified and measured daily. After baseline (A), weekly feedback (B) was introduced, and daily feedback (C) was introduced in the next phase. The results indicated…

  2. Mechanism of phase splitting in two coupled groups of suprachiasmatic-nucleus neurons

    Science.gov (United States)

    Gu, Changgui; Wang, Jianxiong; Wang, Jiaxiang; Liu, Zonghua

    2011-04-01

    The phase-splitting behavior of coupled suprachiasmatic-nucleus neurons has been observed in many mammals, and its mechanism is still not completely understood. Based on our previous work [C. Gu, J. Wang, and Z. Liu, Phys. Rev. E JTBIAP1539-375510.1103/PhysRevE.80.03090480, 030904(R) (2009)] on the free-running periods of neurons in the suprachiasmatic nucleus, we present here a modified Goodwin oscillator model to explain the mechanism of phase splitting. In contrast to the previous phase model, the modified Goodwin oscillator model contains the information on both the phase and amplitude and, thus, can show more features than the purely phase model, including all three behaviors of synchronization, phase splitting, and amplitude death and the distributed periodicity in the regions of synchronization and phase splitting, etc. An analytic phase model is extracted from the modified Goodwin oscillator model to explain the dependence of periodicity on the parameters. Moreover, both the modified Goodwin oscillator model and the analytic phase model show that the ensemble frequency can be enhanced or reduced by the time delay.

  3. Effects of Concurrent and Delayed Visual Feedback on Motor Memory Consolidation.

    Science.gov (United States)

    Wang, Dangxiao; Li, Teng; Yang, Gaofeng; Zhang, Yuru

    2017-02-22

    In many domains, it's important to understand the ways in which humans learn and develop new motor skills effectively and efficiently. For example, in dental operations, the ability to apply a weak force with a required tolerance is a fundamental skill to ensure diagnostic and treatment outcome, but acquiring such a skill is a challenge for novices. In this paper, we focus on motor memory for producing normally applied force by a hand-held probe and we compare the effects of two feedback methods on motor memory consolidation. Fourteen participants were randomly assigned to two groups: a Concurrent Group and a Delayed Group. Participants in the Concurrent Group were trained to apply a target force with concurrent visual feedback, while those in the Delayed Group were trained with delayed visual feedback. The task included two phases: a Training/Testing Phase, and a Retention Phase. The results indicated that participants in the Delayed Group obtained more effective learning outcomes and better retention effects. These findings provide a new perspective to explore the relationship between feedback methods and the cognitive process of motor skill learning, and open a new way to train motor skill using more effective methods than the traditional concurrent feedback approaches.

  4. Effects of self-control and instructor-control feedback on motor learning in individuals with cerebral palsy.

    Science.gov (United States)

    Hemayattalab, Rasool

    2014-11-01

    In this study we investigated the effects of "self-control and instructor-control feedback" on motor learning in individuals with cerebral palsy (CP). For this reason 22 boy students with CP type I (12.26±3.11 years of age) were chosen. They were put into self-control feedback, instructor-control feedback and control groups. All participants practiced dart throwing skill for 5 sessions (4 blocks of 5 trails each session). The self-control group received knowledge of results (KR) feedback for half of their trials whenever they wanted. The instructor-control group received KR feedback after half of both their good and bad trails. The control group received no feedback for any trails. The acquisition test was run immediately at the end of each practice session (the last block) and the retention and transfer tests were run 24h following the acquisition phase. Analyses of variance with repeated measures and Post hoc tests were used to analyze the data. According to the results of this study, individuals with CP have the ability of acquiring and retaining a new motor skill. Also, it was found that self-control feedback is effective than instructor-control feedback on learning of a motor task in individuals with CP as in the average population. These findings show that rules regarding feedback also apply to people afflicted with CP. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Structural phase diagrams for the surface of a solid - A total-energy, renormalization-group approach

    Science.gov (United States)

    Ihm, J.; Lee, D. H.; Joannopoulos, J. D.; Xiong, J. J.

    1983-11-01

    Total-energy calculations based on microscopic electronic structure are combined with position-space renormalization-group calculations to predict the structural phase transitions of the Si(100) surface as a function of temperature. It is found that two distinct families of reconstructed geometries can exist on the surface, with independent phase transitions occurring within each. Two critical temperatures representing order-disorder transitions are calculated.

  6. Nomenclature of magnetic, incommensurate, composition-changed morphotropic, polytype, transient-structural and quasicrystalline phases undergoing phase transitions. II. Report of an IUCr Working Group on Phase Transition Nomenclature.

    Science.gov (United States)

    Tolédano, J C; Berry, R S; Brown, P J; Glazer, A M; Metselaar, R; Pandey, D; Perez-Mato, J M; Roth, R S; Abrahams, S C

    2001-09-01

    A general nomenclature applicable to the phases that form in any sequence of transitions in the solid state has been recommended by an IUCr Working Group [Acta Cryst. (1998). A54, 1028-1033]. The six-field notation of the first Report, hereafter I, was applied to the case of structural phase transitions, i.e. to transformations resulting from temperature and/or pressure changes between two crystalline (strictly periodic) phases involving modifications to the atomic arrangement. Extensive examples that illustrate the recommendations were provided. This second Report considers, within the framework of a similar six-field notation, the more complex nomenclature of transitions involving magnetic phases, incommensurate phases and transitions that occur as a function of composition change. Extension of the nomenclature to the case of phases with less clearly established relevance to standard schemes of transition in equilibrium systems, namely polytype phases, radiation-induced and other transient phases, quasicrystalline phases and their transitions is recommended more tentatively. A uniform notation for the translational periodicity, propagation vector or wavevector for magnetic and/or incommensurate substances is specified. The notation adopted for incommensurate phases, relying partly on the existence of an average structure, is also consistent with that for commensurate phases in a sequence. The sixth field of the nomenclature is used to emphasize the special features of polytypes and transient phases. As in I, illustrative examples are provided for each category of phase sequence.

  7. Single-Phase LLCL-Filter-based Grid-Tied Inverter with Low-Pass Filter Based Capacitor Current Feedback Active damper

    DEFF Research Database (Denmark)

    Liu, Yuan; Wu, Weimin; Li, Yun

    2016-01-01

    The capacitor-current-feedback active damping method is attractive for high-order-filter-based high power grid-tied inverter when the grid impedance varies within a wide range. In order to improve the system control bandwidth and attenuate the high order grid background harmonics by using the quasi....... In this paper, a low pass filter is proposed to be inserted in the capacitor current feedback loop op LLCL-filter based grid-tied inverter together with a digital proportional and differential compensator. The detailed theoretical analysis is given. For verification, simulations on a 2kW/220V/10kHz LLCL...

  8. Formation of Pickering emulsions stabilized via interaction between nanoparticles dispersed in aqueous phase and polymer end groups dissolved in oil phase.

    Science.gov (United States)

    Okada, Masahiro; Maeda, Hayata; Fujii, Syuji; Nakamura, Yoshinobu; Furuzono, Tsutomu

    2012-06-26

    The influence of end groups of a polymer dissolved in an oil phase on the formation of a Pickering-type hydroxyapatite (HAp) nanoparticle-stabilized emulsion and on the morphology of HAp nanoparticle-coated microspheres prepared by evaporating solvent from the emulsion was investigated. Polystyrene (PS) molecules with varying end groups and molecular weights were used as model polymers. Although HAp nanoparticles alone could not function as a particulate emulsifier for stabilizing dichloromethane (oil) droplets, oil droplets could be stabilized with the aid of carboxyl end groups of the polymers dissolved in the oil phase. Lower-molecular-weight PS molecules containing carboxyl end groups formed small droplets and deflated microspheres, due to the higher concentration of carboxyl groups on the droplet/microsphere surface and hence stronger adsorption of the nanoparticles at the water/oil interface. In addition, Pickering-type suspension polymerization of styrene droplets stabilized by PS molecules containing carboxyl end groups successfully led to the formation of spherical HAp-coated microspheres.

  9. Signatures of AGN feedback

    Science.gov (United States)

    Wylezalek, Dominika; Zakamska, Nadia L.; MaNGA-GMOS Team

    2017-01-01

    Feedback from actively accreting SMBHs (Active Galactic Nuclei, AGN) is now widely considered to be the main driver in regulating the growth of massive galaxies. Observational proof for this scenario has, however, been hard to come by. Many attempts at finding a conclusive observational proof that AGN may be able to quench star formation and regulate the host galaxies' growth have shown that this problem is highly complex.I will present results from several projects that focus on understanding the power, reach and impact of feedback processes exerted by AGN. I will describe recent efforts in our group of relating feedback signatures to the specific star formation rate in their host galaxies, where our results are consistent with the AGN having a `negative' impact through feedback on the galaxies' star formation history (Wylezalek+2016a,b). Furthermore, I will show that powerful AGN-driven winds can be easily hidden and not be apparent in the integrated spectrum of the galaxy. This implies that large IFU surveys, such as the SDSS-IV MaNGA survey, might uncover many previously unknown AGN and outflows that are potentially very relevant for understanding the role of AGN in galaxy evolution (Wylezalek+2016c)!

  10. The effects of the personality traits and positive and negative feedback on the perceived self-efficacy

    Directory of Open Access Journals (Sweden)

    Smederevac-Stokić Snežana

    2004-01-01

    Full Text Available The main purpose of this study was to determine the relation between the self-efficacy, feedback and personality traits. The participants were 114 psychology students attending their first and third year from the University of Novi Sad. In the first part of the research, all subjects completed The NEO-PI-R (Costa and McCrae, 1992.. In the second phase the subjects were asked to create a short measurement scale. Before and after this task, as well as after the given feedback, the students completed The Self-efficacy Questionnaire (Terry, 1995. The feedback was the criterion to divide subjects into three groups: the first group received the positive, the second negative, and third group received no feedback. Criteria variables in the MANCOVA (repeated measures were the estimated success, difficulty and ability to perform the task in the three stages of measurement. Predictor variables were the type of the feedback and the personality traits, as covariates. The results suggest that before feedback, the impact of traits on the self-efficacy was significant. But after received feedback, self-efficacy was related to the type of received feedback only. These results showed that self-efficacy was significantly influenced both by personality traits and feedback context.

  11. CGILS: Results from the first phase of an international project to understand the physical mechanisms of low cloud feedbacks in single column models

    NARCIS (Netherlands)

    Zhang, M.; Bretherton, C.S.; Blossey, P.N.; Austin, P.H.; Bacmeister, J.T.; Bony, S.; Brient, F.; Cheedela, S.K.; Cheng, A.; Del Genio, A.D.; De Roode, S.R.; Endo, S.; Franklin, C.N.; Golaz, J.C.; Hannay, C.; Heus, T.; Isotta, F.A.; Dufresne, J.L.; Kang, I.S.; Kawai, H.; Köhler, M.; Larson, V.E.; Liu, Y.; Lock, A.P.; Lohmann, U.; Khairoutdinov, M.F.; Molod, A.M.; Neggers, R.A.J.; Rasch, P.; Sandu, I.; Senkbeil, R.; Siebesma, A.P.; Siegenthaler-Le Drian, C.; Stevens, B.; Suarez, M.J.; Xu, K.M.; Von Salzen, K.; Webb, M.J.; Wolf, A.; Zhao, M.

    2013-01-01

    CGILS—the CFMIP-GASS Intercomparison of Large Eddy Models (LESs) and single column models (SCMs)—investigates the mechanisms of cloud feedback in SCMs and LESs under idealized climate change perturbation. This paper describes the CGILS results from 15 SCMs and 8 LES models. Three cloud regimes over

  12. Optical generation of microwave signals with a dual-phase-shifted Al2O3:Yb3+ distributed-feedback laser

    NARCIS (Netherlands)

    Bernhardi, E.H.; Khan, M.R.H.; Roeloffzen, C.G.H.; Wolferen, van H.A.G.M.; Wörhoff, K.; Ridder, de R.M.; Pollnau, M.

    2012-01-01

    We demonstrate the optical generation of stable microwave signals from a dual-wavelength distributed-feedback waveguide laser in ytterbium-doped alumina. The microwave beat signal was produced at ~15 GHz with a frequency stability of ±2.5 MHz.

  13. The coupling of thermochemistry and phase diagrams for group III-V semiconductor systems. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, T.J.

    1998-07-21

    The project was directed at linking the thermochemical properties of III-V compound semiconductors systems with the reported phase diagrams. The solid-liquid phase equilibrium problem was formulated and three approaches to calculating the reduced standard state chemical potential were identified and values were calculated. In addition, thermochemical values for critical properties were measured using solid state electrochemical techniques. These values, along with the standard state chemical potentials and other available thermochemical and phase diagram data, were combined with a critical assessment of selected III-V systems. This work was culminated with a comprehensive assessment of all the III-V binary systems. A novel aspect of the experimental part of this project was the demonstration of the use of a liquid encapsulate to measure component activities by a solid state emf technique in liquid III-V systems that exhibit high vapor pressures at the measurement temperature.

  14. Full Static Output Feedback Equivalence

    Directory of Open Access Journals (Sweden)

    Aristotle G. Yannakoudakis

    2013-01-01

    Full Text Available We present a constructive solution to the problem of full output feedback equivalence, of linear, minimal, time-invariant systems. The equivalence relation on the set of systems is transformed to another on the set of invertible block Bezout/Hankel matrices using the isotropy subgroups of the full state feedback group and the full output injection group. The transformation achieving equivalence is calculated solving linear systems of equations. We give a polynomial version of the results proving that two systems are full output feedback equivalent, if and only if they have the same family of generalized Bezoutians. We present a new set of output feedback invariant polynomials that generalize the breakaway polynomial of scalar systems.

  15. The 2-(N-formyl-N-methyl)aminoethyl group as a potential phosphate/thiophosphate protecting group in solid-phase oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Grajkowski, A; Wilk, A; Chmielewski, M K; Phillips, L R; Beaucage, S L

    2001-05-03

    [reaction in text] The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.

  16. Etoposide in malignant pleural mesothelioma : Two phase II trials of the EORTC Lung Cancer Cooperative Group

    NARCIS (Netherlands)

    Sahmoud, T; Postmus, PE; van Pottelsberghe, C; Mattson, K; Tammilehto, L; Splinter, TAW; Planting, AST; Sutedja, T; van Pawel, J; van Zandwijk, N; Baas, P; Roozendaal, KJ; Schrijver, M; Kirkpatrick, A; Van Glabbeke, M; Ardizzoni, A; Giaccone, G

    1997-01-01

    Intravenous and oral etoposide (VP 16-213) were tested in two sequential phase II trials in chemotherapy-naive patients with malignant pleural mesothelioma. In the first trial, etoposide was given intravenously (i.v.) at a dose of 150 mg/m(2) on days 1, 3 and 5 every 3 weeks. The second trial invest

  17. Etude et simulation des groupes convertisseurs-machines synchrones a six phases

    Science.gov (United States)

    Doyon, Jean-Francois

    Since many years, multiphase (n > 3) machines represent a growing research interest in the electrical machines domain. This type of machine can be used for many systems like automotive electrical traction, electric ship propulsion, wind farms or high-power industrial applications. Above all multiphase machines, the six phases wounded rotor synchronous machine brings a huge interest. Subsequently, using that kind of machine in any application requires a good understanding of the machine model and its respective converters. Hence, simulation represents a great way to study the behaviour and design of such applications that uses six phases wounded rotor synchronous machines. The present research concerns the study and simulation of six phase synchronous machinesconverters systems. From this project resulted the implementation of the six phases wound rotor salient pole synchronous machine in the Demos library of Matlab SimPowerSytems. In terms of study, a six phase machine electric drive is designed as well as a six phase machine implementation in a type 4 wind farm. The modeling of the six phase synchronous machine is fully detailed for the electrical part and the mechanical part. Then, the voltage source inverter electric drive with hysteresis control is conceived. Simulations of torque control, speed control and degraded mode of the machine are executed. The results illustrate the electric drive efficiency. This is followed by the type 4 wind turbine application of the machine. The wind farm is connected to a 120 kV grid, where a voltage drop fault appears at the 120 kV bar for a duration of six 60 Hz cycles. The results show a good operation of the regulators during the fault. This application is also subjected to a degraded mode, where results illustrate once again a good system regulation. Also, for the electric drive and the wind farm applications, a comparative study is made for the use of an asymmetrical versus symmetrical winding configuration of the machine

  18. Effect of phase transition on quantum transport in group-IV two-dimensional U-shape device

    Energy Technology Data Exchange (ETDEWEB)

    Sadi, Mohammad Abdullah; Gupta, Gaurav, E-mail: a0089293@nus.edu.sg; Liang, Gengchiau [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 117576 (Singapore)

    2014-10-21

    The effect of phase-transition from the quantum-spin-hall to the band-insulator phase on the transport through a three-terminal U-shape spin-separator has been computationally investigated via non-equilibrium green function formalism. Two-dimensional group-IV elements have been comprehensively appraised as the device material. The device separates the unpolarized current injected at the source-terminal into nearly 100% spin-polarized currents of the opposite polarities at the two drain terminals. The phase-transition activated by the electric-field orthogonal to the device is shown to extensively influence the current magnitude and its spin-polarization, and the effect is stronger for materials with smaller intrinsic spin-orbit coupling. Moreover, the device length and the area under field are shown to critically affect the device characteristics on phase change. It is shown that the same device can be operated as a spin-filter by inducing phase-transition selectively in the channel. The results are important for designing spin-devices from Group-IV monolayers.

  19. Evaluation of a Two-Phase Experimental Study of a Small Group ("MultiLit") Reading Intervention for Older Low-Progress Readers

    Science.gov (United States)

    Buckingham, Jennifer; Beaman-Wheldall, Robyn; Wheldall, Kevin

    2014-01-01

    The study reported here examined the efficacy of a small group (Tier 2 in a three-tier Response to Intervention model) literacy intervention for older low-progress readers (in Years 3-6). This article focuses on the second phase of a two-phase, crossover randomized control trial involving 26 students. In Phase 1, the experimental group (E1)…

  20. Novel chiral stationary phases based on peptoid combining a quinine/quinidine moiety through a C9-position carbamate group.

    Science.gov (United States)

    Wu, Haibo; Wang, Dongqiang; Song, Guangjun; Ke, Yanxiong; Liang, Xinmiao

    2014-04-01

    By connecting a quinine or quinidine moiety to the peptoid chain through the C9-position carbamate group, we synthesized two new chiral selectors. After immobilizing them onto 3-mercaptopropyl-modified silica gel, two novel chiral stationary phases were prepared. With neutral, acid, and basic chiral compounds as analytes, we evaluated these two stationary phases and compared their chromatographic performance with chiral columns based on quinine tert-butyl carbamate and the previous peptoid. From the resolution of neutral and basic analytes under normal-phase mode, it was found that the new stationary phases exhibited much better enantioselectivity than the quinine tert-butyl carbamate column; the peptoid moiety played an important role in enantiorecognition, which controlled the elution orders of enantiomers; the assisting role of the cinchona alkaloid moieties was observed in some separations. Under acid polar organic phase mode, it was proved that cinchona alkaloid moieties introduced excellent enantiorecognitions for chiral acid compounds; in some separations, the peptoid moiety affected enantioseparations as well. Overall, chiral moieties with specific enantioselectivity were demonstrated to improve the performance of peptoid chiral stationary phase efficiently.

  1. Collective irrationality and positive feedback.

    Directory of Open Access Journals (Sweden)

    Stamatios C Nicolis

    Full Text Available Recent experiments on ants and slime moulds have assessed the degree to which they make rational decisions when presented with a number of alternative food sources or shelter. Ants and slime moulds are just two examples of a wide range of species and biological processes that use positive feedback mechanisms to reach decisions. Here we use a generic, experimentally validated model of positive feedback between group members to show that the probability of taking the best of options depends crucially on the strength of feedback. We show how the probability of choosing the best option can be maximized by applying an optimal feedback strength. Importantly, this optimal value depends on the number of options, so that when we change the number of options the preference of the group changes, producing apparent "irrationalities". We thus reinterpret the idea that collectives show "rational" or "irrational" preferences as being a necessary consequence of the use of positive feedback. We argue that positive feedback is a heuristic which often produces fast and accurate group decision-making, but is always susceptible to apparent irrationality when studied under particular experimental conditions.

  2. Frequent external focus feedback enhances motor learning

    Directory of Open Access Journals (Sweden)

    Gabriele eWulf

    2010-11-01

    Full Text Available The present study examined the hypothesis that feedback inducing an external focus of attention enhances motor learning if it is provided frequently (i.e., 100% rather than less frequently. Children (10-12 year olds practiced a soccer throw-in task and were provided feedback about movement form. The feedback statements, provided either after every (100% or every third (33% practice trial, were similar in content but induced either an internal focus (body-movement related or external focus (movement-effect related. The results demonstrated that learning of the movement form was enhanced by external-focus feedback after every trial (100% relative to external-focus feedback after every third trial (33% or internal-focus feedback (100%, 33%, as demonstrated by immediate and delayed transfer tests without feedback. There was no difference between the two internal-focus feedback groups. These findings indicate that the attentional focus induced by feedback is an important factor in determining the effectiveness of different feedback frequencies. We argue that the informational properties of feedback cannot sufficiently account for these and related findings, and suggest that the attentional role of feedback be given greater consideration in future studies.

  3. The role of European Federation of Clinical Chemistry and Laboratory Medicine Working Group for Preanalytical Phase in standardization and harmonization of the preanalytical phase in Europe

    DEFF Research Database (Denmark)

    Cornes, Michael P; Church, Stephen; van Dongen-Lases, Edmée;

    2016-01-01

    and Laboratory Medicine Working Group for Preanalytical Phase (EFLM WG-PRE) was established to lead in standardization and harmonization of preanalytical policies and practices at a European level. One of the key activities of the WG-PRE is the organization of the biennial EFLM-BD conference on the preanalytical......Patient safety is a leading challenge in healthcare and from the laboratory perspective it is now well established that preanalytical errors are the major contributor to the overall rate of diagnostic and therapeutic errors. To address this, the European Federation of Clinical Chemistry...... summarises the work that has and will be done in these areas. The goal of this initiative is to ensure the EFLM WG-PRE produces work that meets the needs of the European laboratory medicine community. Progress made in the identified areas will be updated at the next preanalytical phase conference and show...

  4. KEKB bunch feedback systems

    Energy Technology Data Exchange (ETDEWEB)

    Tobiyama, M.; Kikutani, E. [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan)

    1996-08-01

    Design and the present status of the bunch by bunch feedback systems for KEKB rings are shown. The detection of the bunch oscillation are made with the phase detection for longitudinal plane, the AM/PM method for transverse plane. Two GHz component of the bunch signal which is extracted with an analog FIR filter is used for the detection. Hardware two-tap FIR filter systems to shift the phase of the oscillation by 90deg will be used for the longitudinal signal processing. The same system will be used with no filtering but with only digital delay for transverse system. The candidate for the kicker and the required maximum power are also estimated. (author)

  5. Diazonium modification of porous graphitic carbon with catechol and amide groups for hydrophilic interaction and attenuated reversed phase liquid chromatography.

    Science.gov (United States)

    Iverson, Chad D; Zhang, Ya; Lucy, Charles A

    2015-11-27

    Porous graphitic carbon (PGC) is an increasingly popular and attractive phase for HPLC on account of its chemical and thermal stability, and its unique separation mechanism. However, native PGC is strongly hydrophobic and in some instances excessively retentive. As part of our effort to build a library of hydrophilic covalently modified PGC phases, we functionalized PGC with catechol and amide groups by means of aryl diazonium chemistry to produce two new phases. Successful grafting was confirmed by X-ray photoelectron spectroscopy (XPS). Under HILIC conditions, the Catechol-PGC showed up to 5-fold increased retention relative to unmodified PGC and selectivity that differed from four other HILIC phases. Under reversed phase conditions, the Amide-PGC reduced the retentivity of PGC by almost 90%. The chromatographic performance of Catechol-PGC and Amide-PGC is demonstrated by separations of nucleobases, nucleosides, phenols, alkaline pharmaceuticals, and performance enhancing stimulants. These compounds had retention factors (k) ranging from 0.5 to 13.

  6. Detecting local heterogeneity and ionization ability in the head group region of different lipidic phases using modified fluorescent probes

    Science.gov (United States)

    Abou-Zied, Osama K.; Zahid, N. Idayu; Khyasudeen, M. Faisal; Giera, David S.; Thimm, Julian C.; Hashim, Rauzah

    2015-01-01

    Local heterogeneity in lipid self-assembly is important for executing the cellular membrane functions. In this work, we chemically modified 2-(2′-hydroxyphenyl)benzoxazole (HBO) and attached a C8 alkyl chain in two different locations to probe the microscopic environment of four lipidic phases of dodecyl β-maltoside. The fluorescence change in HBO and the new probes (HBO-1 and HBO-2) shows that in all phases (micellar, hexagonal, cubic and lamellar) three HBO tautomeric species (solvated syn-enol, anionic, and closed syn-keto) are stable. The formation of multi tautomers reflects the heterogeneity of the lipidic phases. The results indicate that HBO and HBO-1 reside in a similar location within the head group region, whereas HBO-2 is slightly pushed away from the sugar-dominated area. The stability of the solvated syn-enol tautomer is due to the formation of a hydrogen bond between the OH group of the HBO moiety and an adjacent oxygen atom of a sugar unit. The detected HBO anions was proposed to be a consequence of this solvation effect where a hydrogen ion abstraction by the sugar units is enhanced. Our results point to a degree of local heterogeneity and ionization ability in the head group region as a consequence of the sugar amphoterism. PMID:25731606

  7. Detecting local heterogeneity and ionization ability in the head group region of different lipidic phases using modified fluorescent probes.

    Science.gov (United States)

    Abou-Zied, Osama K; Zahid, N Idayu; Khyasudeen, M Faisal; Giera, David S; Thimm, Julian C; Hashim, Rauzah

    2015-03-03

    Local heterogeneity in lipid self-assembly is important for executing the cellular membrane functions. In this work, we chemically modified 2-(2'-hydroxyphenyl)benzoxazole (HBO) and attached a C8 alkyl chain in two different locations to probe the microscopic environment of four lipidic phases of dodecyl β-maltoside. The fluorescence change in HBO and the new probes (HBO-1 and HBO-2) shows that in all phases (micellar, hexagonal, cubic and lamellar) three HBO tautomeric species (solvated syn-enol, anionic, and closed syn-keto) are stable. The formation of multi tautomers reflects the heterogeneity of the lipidic phases. The results indicate that HBO and HBO-1 reside in a similar location within the head group region, whereas HBO-2 is slightly pushed away from the sugar-dominated area. The stability of the solvated syn-enol tautomer is due to the formation of a hydrogen bond between the OH group of the HBO moiety and an adjacent oxygen atom of a sugar unit. The detected HBO anions was proposed to be a consequence of this solvation effect where a hydrogen ion abstraction by the sugar units is enhanced. Our results point to a degree of local heterogeneity and ionization ability in the head group region as a consequence of the sugar amphoterism.

  8. Renormalization group improved computation of correlation functions in theories with nontrivial phase diagram

    DEFF Research Database (Denmark)

    Codello, Alessandro; Tonero, Alberto

    2016-01-01

    the momentum modes that contribute to it according to their renormalization group (RG) relevance, i.e. we weight each mode according to the value of the running couplings at that scale. In this way, we are able to encode in a loop computation the information regarding the RG trajectory along which we...

  9. The Renormalization Group, Entropy, Thermodynamic Phase Transitions and Order in Quantum Field Theory

    CERN Document Server

    Pérez-Mercader, J

    1993-01-01

    We define an entropy for a quantum field theory by combining quantum fluctuations, scaling and the maximum entropy concept. This entropy has different behavior in asymptotically free and non--asymptotically free theories. We find that the transition between the two regimes (from the asymptotically free to the non--asymptotically free) takes place via a continuous phase transition. For asymptotically free theories there exist regimes where the ``temperatures" are negative. In asymptotically free theories there exist maser--like states mostly in the infrared; furthermore, as one goes into the ultraviolet and more matter states contribute to quantum processes, the quantum field system can shed entropy and cause the formation of thermodynamically stable {\\it entropy--ordered} states. It is shown how the known heavier quarks can be thus described.

  10. Breaking phase focused wave group loads on offshore wind turbine monopiles

    DEFF Research Database (Denmark)

    Ghadirian, Amin; Bredmose, Henrik; Dixen, M.

    2016-01-01

    OceanWave3D-OpenFOAM solver, against measurements of focused wave group impacts on a monopile. The focused 2D and 3D wave groups are reproduced and the free surface elevation and the in-line forces are compared to the experimental results. In addition, the pressure distribution on the monopile...... is examined at the time of maximum force and discussed in terms of shape and magnitude. Relative pressure time series are also compared between the simulations and experiments and detailed pressure fields for a 2D and 3D impact are discussed in terms of impact type. In general a good match for free surface...... elevation, in-line force and wave-induced pressures is found....

  11. Modeling the production of intergalactic light in the pre-collapse phase of galaxy groups

    OpenAIRE

    Solanes, Jose M.; Darriba, Laura; Collaboration, for the IDILICO

    2012-01-01

    This paper reports one recent result from a set of pre-virialized galaxy group simulations that are being used in an investigation of measurement techniques for the quantity of intragroup light (IGL). We present evidence that the binding energy of the stellar material stripped from the galaxies is essentially uncorrelated with the local mass density. This suggests that IGL detection methods based on the distribution of luminosity perform poorly in detecting the unbound stars.

  12. Effectiveness of Simultaneous Prompting in Small Group: The Opportunity of Acquiring Non-Target Skills through Observational Learning and Instructive Feedback

    Science.gov (United States)

    Gursel, Oguz; Tekin-Iftar, Elif; Bozkurt, Funda

    2006-01-01

    A multiple probe study across behaviors, replicated across students, assessed the effectiveness of simultaneous prompting (SP) in a small group teaching arrangement on teaching (a) to show the provinces, rivers, and border countries of Turkey on a map and (b) to expressively identify the names of the symbols which are usually used in math.…

  13. hsphase: an R package for pedigree reconstruction, detection of recombination events, phasing and imputation of half-sib family groups

    Science.gov (United States)

    2014-01-01

    Background Identification of recombination events and which chromosomal segments contributed to an individual is useful for a number of applications in genomic analyses including haplotyping, imputation, signatures of selection, and improved estimates of relationship and probability of identity by descent. Genotypic data on half-sib family groups are widely available in livestock genomics. This structure makes it possible to identify recombination events accurately even with only a few individuals and it lends itself well to a range of applications such as parentage assignment and pedigree verification. Results Here we present hsphase, an R package that exploits the genetic structure found in half-sib livestock data to identify and count recombination events, impute and phase un-genotyped sires and phase its offspring. The package also allows reconstruction of family groups (pedigree inference), identification of pedigree errors and parentage assignment. Additional functions in the package allow identification of genomic mapping errors, imputation of paternal high density genotypes from low density genotypes, evaluation of phasing results either from hsphase or from other phasing programs. Various diagnostic plotting functions permit rapid visual inspection of results and evaluation of datasets. Conclusion The hsphase package provides a suite of functions for analysis and visualization of genomic structures in half-sib family groups implemented in the widely used R programming environment. Low level functions were implemented in C++ and parallelized to improve performance. hsphase was primarily designed for use with high density SNP array data but it is fast enough to run directly on sequence data once they become more widely available. The package is available (GPL 3) from the Comprehensive R Archive Network (CRAN) or from http://www-personal.une.edu.au/~cgondro2/hsphase.htm. PMID:24906803

  14. PEER FEEDBACK ON LANGUAGE FORM IN TELECOLLABORATION

    Directory of Open Access Journals (Sweden)

    Paige Ware

    2008-02-01

    Full Text Available We performed a two-phase, year-long research project that explored the impact of peer feedback on language development. We investigated specifically how and when post-secondary learners of English and Spanish provide corrective feedback on their partners' use of the target language in weekly asynchronous discussions by assigning them to one of two conditions: e-tutoring, in which students were asked to provide peer feedback on any linguistic form they perceived as incorrect; and e-partnering, in which students were not required to provide peer feedback but could do so on their own initiative. We examined the frequency and type of language use by coding the feedback for language-related episodes (Swain & Lapkin, 1998 and for feedback strategies (Ros i Solé & Truman, 2005. The findings indicate that students in both conditions preferred an inclusion of feedback on form as part of their exchange, but such feedback only occurred when explicitly required in the e-tutoring condition. Pedagogical implications include the need to situate peer feedback on form within current models of telecollaboration and to assist students in using feedback strategies such as reformulations, which do not rely on a deep understanding of the target or native language grammar.

  15. Breaking phase focused wave group loads on offshore wind turbine monopiles

    Science.gov (United States)

    Ghadirian, A.; Bredmose, H.; Dixen, M.

    2016-09-01

    The current method for calculating extreme wave loads on offshore wind turbine structures is based on engineering models for non-breaking regular waves. The present article has the aim of validating previously developed models at DTU, namely the OceanWave3D potential flow wave model and a coupled OceanWave3D-OpenFOAM solver, against measurements of focused wave group impacts on a monopile. The focused 2D and 3D wave groups are reproduced and the free surface elevation and the in-line forces are compared to the experimental results. In addition, the pressure distribution on the monopile is examined at the time of maximum force and discussed in terms of shape and magnitude. Relative pressure time series are also compared between the simulations and experiments and detailed pressure fields for a 2D and 3D impact are discussed in terms of impact type. In general a good match for free surface elevation, in-line force and wave-induced pressures is found.

  16. Effects of group-velocity mismatch and cubicquintic nonlinearity on cross-phase modulation instability in optical fibers

    Institute of Scientific and Technical Information of China (English)

    Xianqiong Zhong; Anping Xiang

    2007-01-01

    @@ The synthetic effects of group-velocity mismatch and cubic-quintic nonlinearity on cross-phase modulation induced modulation instability in loss single-mode optical fibers have been numerically investigated. The results show that the quintic nonlinearity plays a role similar to the case of neglecting the group-velocity mismatch in modifying the modulation instability, namely, the positive and negative quintic nonlinearities can still enhance and weaken the modulation instability, respectively. The group-velocity mismatch can considerably change the gain spectrum of modulation instability in terms of its shape, peak value, and position. In the normal dispersion regime, with the increase of the group-velocity mismatch parameter,the gain spectrum widens and then narrows, shifts to higher frequencies, and the peak value gets higher before approaching a saturable value. In the abnormal dispersion regime, two separated spectra may occur when the group-velocity mismatch is taken into account. With the increase of the group-velocity mismatch parameter, the peak value of the gain spectrum gets higher and shorter before tending to a saturable value for the first and second spectral regimes, respectively.

  17. Phase behavior of semifluorinated catanionic mixtures: head group dependence and spontaneous formation of vesicles.

    Science.gov (United States)

    Blanco, Elena; Olsson, Ulf; Ruso, Juan M; Schulz, Pablo C; Prieto, Gerardo; Sarmiento, Félix

    2009-03-15

    Hexadecyltrimethylammonium bromide (C(16)TAB)-sodium perfluorooctanoate (C(8)FONa) and hexadecylpyridynium bromide (C(16)PyB)-C(8)FONa catanionic semifluorinated mixtures have been studied by conductivity, dynamic light scattering (DLS), cryo-transmission electron microscopy (cryo-TEM) and polarizing microscopy. The regular solution theory, applicable for a limited fluorinated molar ratio, does not predict long-range electrostatic interactions. The results are consistent with the fact that in the hydrogenated-rich region the interaction is attractive in both catanionic mixtures. The systems containing pyridinium headgroups were of the stronger interaction. A transition from micelles was found in both mixtures as a function of fluorinated molar ratio. Special attention was devoted to the effect of the head group in the system properties. The information related with the mean vesicle radius measured by DLS was compared with the vesicle size distribution as well as the elastic properties of the bilayer measured with cryo-TEM.

  18. A group-based approach to stabilisation and symptom management in a phased treatment model for refugees and asylum seekers

    Directory of Open Access Journals (Sweden)

    Mary E. A. Robertson

    2013-12-01

    Full Text Available Background: Traumatised asylum seekers and refugees may present with significant and complex mental health problems as a result of prolonged, extreme, and multiple traumatic events. This is further complicated by ongoing complex social circumstances. Concepts: In our work at the Traumatic Stress Clinic (TSC, the understanding afforded by the concept of complex posttraumatic stress disorder (PTSD together with the related notion of a phased treatment model, provides a useful framework for organising our work with this population. Clinical Applications: An explication of complex PTSD as it applies to our client group is presented, followed by a description of our phased treatment model and an outline of the core principles, which guide our clinical approach. Our symptom management and stabilisation groups have been developed and refined over time and draw on techniques from a variety of cognitive behavioural therapies. These are described in some detail with illustrative clinical case vignettes. Conclusion: This paper concludes with some reflections on the challenges inherent to working with this complex client group.

  19. Group and phase velocities from deterministic and ambient sources measured during the AlpArray-EASI experiment

    Science.gov (United States)

    Kolínský, Petr; Zigone, Dimitri; Fuchs, Florian; Bianchi, Irene; Qorbani, Ehsan; Apoloner, Maria-Theresia; Bokelmann, Götz; AlpArray-EASI Working Group

    2016-04-01

    The Eastern Alpine Seismic Investigation (EASI) was a complementary experiment to the AlpArray project. EASI was composed of 55 broadband seismic stations deployed in a winding swath of 540 km length along longitude 13.350 E from the Czech-German border to the Adriatic Sea. Average north-south inter-station distance was 10 km, the distance of each station to either side of the central line was 6 km. Such a dense linear network allows for surface wave dispersion measurements by both deterministic and ambient noise sources along the same paths. During the experiment (July 2014 - August 2015), three earthquakes ML = 2.6, 2.9 and 4.2 occurred in Austria and Northern Italy only several kilometers off the swath. We measure Rayleigh and Love wave group velocities between the source and a single station for the recorded earthquakes, as well as phase velocities between selected pairs of stations using the standard two-station method. We also calculate cross-correlations of ambient noise between selected pairs of stations and we determine the corresponding group velocity dispersion curves. We propose a comparison of phase velocities between two stations measured from earthquakes with group velocities obtained from cross-correlations for the same station pairs. We also compare group velocities measured at single station using earthquakes, which occurred along the swath, with group velocities measured from cross-correlations. That way we analyze velocities of both deterministic and ambient noise reconstructed surface waves propagating along the same path. We invert the resulting dispersion curves for 1D shear wave velocity profiles with depth and we compile a quasi-2D velocity model along the EASI swath.

  20. Pulsed feedback defers cellular differentiation.

    Directory of Open Access Journals (Sweden)

    Joe H Levine

    2012-01-01

    Full Text Available Environmental signals induce diverse cellular differentiation programs. In certain systems, cells defer differentiation for extended time periods after the signal appears, proliferating through multiple rounds of cell division before committing to a new fate. How can cells set a deferral time much longer than the cell cycle? Here we study Bacillus subtilis cells that respond to sudden nutrient limitation with multiple rounds of growth and division before differentiating into spores. A well-characterized genetic circuit controls the concentration and phosphorylation of the master regulator Spo0A, which rises to a critical concentration to initiate sporulation. However, it remains unclear how this circuit enables cells to defer sporulation for multiple cell cycles. Using quantitative time-lapse fluorescence microscopy of Spo0A dynamics in individual cells, we observed pulses of Spo0A phosphorylation at a characteristic cell cycle phase. Pulse amplitudes grew systematically and cell-autonomously over multiple cell cycles leading up to sporulation. This pulse growth required a key positive feedback loop involving the sporulation kinases, without which the deferral of sporulation became ultrasensitive to kinase expression. Thus, deferral is controlled by a pulsed positive feedback loop in which kinase expression is activated by pulses of Spo0A phosphorylation. This pulsed positive feedback architecture provides a more robust mechanism for setting deferral times than constitutive kinase expression. Finally, using mathematical modeling, we show how pulsing and time delays together enable "polyphasic" positive feedback, in which different parts of a feedback loop are active at different times. Polyphasic feedback can enable more accurate tuning of long deferral times. Together, these results suggest that Bacillus subtilis uses a pulsed positive feedback loop to implement a "timer" that operates over timescales much longer than a cell cycle.

  1. Electro-optic prism-pair setup for efficient high bandwidth isochronous CEP phase shift or group delay generation

    Science.gov (United States)

    Gobert, Olivier; Mennerat, Gabriel; Cornaggia, Christian; Lupinski, Dominique; Perdrix, Michel; Guillaumet, Delphine; Lepetit, Fabien; Oksenhendler, Thomas; Comte, Michel

    2016-05-01

    We report the experimental demonstration of an electro-optic prism pair pure carrier-envelope phase (CEP) shifter at low voltage (shift of 1 rad for a voltage of 90 V, applied to a crystal of 5 mm aperture). Validating our mathematical model, the experiments prove that this set-up which uses two rubidium titanyl phosphate (RTP) crystals, can be used either as an efficient high bandwidth CEP shifter without modifying the group delay of an ultrashort pulse (isochronous CEP shifter) or alternatively as a group delay generator with quasi-constant CEP (Pure Group Delay generator). These two configurations which correspond to specific geometries are characterized by spectral interferometry with a 800 nm mode-locked Ti:sapphire laser. The results are in very good agreement with the model. In the pure group delay mode, a group delay of 2.3 fs is obtained at 1000 V/cm without significant CEP shift. In the isochronous mode, a shift of 5.5 rad at 1000 V/cm is generated without significant delay. The applied voltage is also lowered by a factor of nearly three in this configuration, compared to the case of an RTP rectangular slab of the same total length.

  2. Solution-phase-peptide synthesis via the group-assisted purification (GAP) chemistry without using chromatography and recrystallization.

    Science.gov (United States)

    Wu, Jianbin; An, Guanghui; Lin, Siqi; Xie, Jianbo; Zhou, Wei; Sun, Hao; Pan, Yi; Li, Guigen

    2014-02-01

    The solution phase synthesis of N-protected amino acids and peptides has been achieved through the Group-Assisted Purification (GAP) chemistry by avoiding disadvantages of other methods in regard to the difficult scale-up, expenses of solid and soluble polymers, etc. The GAP synthesis can reduce the use of solvents, silica gels, energy and manpower. In addition, the GAP auxiliary can be conveniently recovered for re-use and is environmentally friendly and benign, and substantially reduces waste production in academic labs and industry.

  3. AWESoMe: A code for the calculation of phase and group velocities of acoustic waves in homogeneous solids

    Science.gov (United States)

    Muñoz-Santiburcio, Daniel; Hernández-Laguna, Alfonso; Soto, Juan I.

    2015-07-01

    We present AWESoMe, an implementation of a method for the evaluation of acoustic wave velocities in homogeneous solid media. The code computes the phase and group velocities for all the possible propagation directions, as well as some related parameters such as the polarization vectors, the power flow angle and the enhancement factor. The code is conveniently interfaced with GNUPLOT, thus offering immediate visualization of the results. AWESoMe is open-source software, available under the GNU General Public License v3.

  4. Normative Feedback Effects on Learning a Timing Task

    Science.gov (United States)

    Wulf, Gabriele; Chiviacowsky, Suzete; Lewthwaite, Rebecca

    2010-01-01

    This study investigated the influence of normative feedback on learning a sequential timing task. In addition to feedback about their performance per trial, two groups of participants received bogus normative feedback about a peer group's average block-to-block improvement after each block of 10 trials. Scores indicated either greater (better…

  5. Feedback effect on flute dynamics in a mirror machine

    Science.gov (United States)

    Be'Ery, Ilan; Seemann, Omri

    2015-11-01

    Active feedback techniques may stabilize the flute instability in mirror traps and make them viable candidates for fusion machines. A fast feedback with optical sensors and electrical actuators was implemented in a table-top mirror machine and used to study several aspects of feedback stabilization. For a cold, dense plasma the feedback reduces dramatically the flute amplitude of the first two mode. For higher temperature plasma, a significant increase of plasma density due to feedback stabilization is also demonstrated. The effect of changing feedback gain and phase has some interesting feature such as asymmetry with respect to positive and negative phase shifts and non-monotonic dependence of flute amplitude on feedback gain. These effects are explained using simplified analytic model of the flute and feedback.

  6. Encoding Curved Tetrahedra in Face Holonomies: a Phase Space of Shapes from Group-Valued Moment Maps

    CERN Document Server

    Haggard, Hal M; Riello, Aldo

    2015-01-01

    We present a generalization of Minkowski's classic theorem on the reconstruction of tetrahedra from algebraic data to homogeneously curved spaces. Euclidean notions such as the normal vector to a face are replaced by Levi-Civita holonomies around each of the tetrahedron's faces. This allows the reconstruction of both spherical and hyperbolic tetrahedra within a unified framework. A new type of hyperbolic simplex is introduced in order for all the sectors encoded in the algebraic data to be covered. Generalizing the phase space of shapes associated to flat tetrahedra leads to group valued moment maps and quasi-Poisson spaces. These discrete geometries provide a natural arena for considering the quantization of gravity including a cosmological constant. A concrete realization of this is provided by the relation with the spin-network states of loop quantum gravity. This work therefore provides a bottom-up justification for the emergence of deformed gauge symmetries and quantum groups in 3+1 dimensional covariant...

  7. Enhanced Retention of Chelating Reagents in Octadecylsilyl Silica Phase by Interaction with Residual Silanol Groups in Solid Phase Extraction of Divalent Metal Ions.

    Science.gov (United States)

    Ohmuro, Satoshi; Fujii, Kan; Yasui, Takashi; Takada, Kazutake; Yuchi, Akio; Kokusen, Hisao

    2016-01-01

    Solid-phase extraction (SPE) of divalent metal ions with a lipophilic and potentially divalent hexadentate chelating reagent (H2L), with which octadecylsilyl silica (ODS), was impregnated with was studied to gain more insight into and develop the potential of this methodology. This is the first time to demonstrate that this reagent as well as other common nitrogen-containing reagents were retained both by adsorption due to hydrogen bonding between nitrogen atoms of the reagent and residual silanol groups in the ODS phase and by simple distribution into the hydrophobic space. An appreciably large amount of this reagent could be retained by the adsorption mechanism even with a relatively thin loading solution. The divalent metal ions of Mn(2+), Co(2+) and Zn(2+) were extracted as 1:1 neutral complexes ([ML]), while Ni(2+) and Cu(2+) as ion-pairs of 1:1 cationic complex ([MHL](+)) with anion in SPE with H2L. The extractability and selectivity were substantially the same as that in liquid-liquid extraction.

  8. Fault Tolerant Feedback Control

    DEFF Research Database (Denmark)

    Stoustrup, Jakob; Niemann, H.

    2001-01-01

    An architecture for fault tolerant feedback controllers based on the Youla parameterization is suggested. It is shown that the Youla parameterization will give a residual vector directly in connection with the fault diagnosis part of the fault tolerant feedback controller. It turns out...... that there is a separation be-tween the feedback controller and the fault tolerant part. The closed loop feedback properties are handled by the nominal feedback controller and the fault tolerant part is handled by the design of the Youla parameter. The design of the fault tolerant part will not affect the design...... of the nominal feedback con-troller....

  9. Medical Student Perceptions of Feedback and Feedback Behaviors Within the Context of the "Educational Alliance".

    Science.gov (United States)

    Bowen, Lucy; Marshall, Michelle; Murdoch-Eaton, Deborah

    2017-09-01

    Using the "educational alliance" as a conceptual framework, the authors explored medical students' beliefs about feedback and how their feedback behaviors reflect their perceptions. Five focus groups (four to six medical students each) at one UK medical school in 2015 were used to capture and elucidate learners' feedback perceptions and behaviors within the context of the learner-educator relationship. A map of key feedback opportunities across the program was used as a tool for exploring student engagement with the feedback process. Qualitative data were analyzed using an approach based on grounded theory principles. Three learner feedback behaviors emerged: recognizing, using, and seeking feedback. Five core themes influencing these behaviors were generated: learner beliefs, attitudes, and perceptions; relationships; teacher attributes; mode of feedback; and learning culture. Conceptual models illustrating the relationships between the themes and each behavior were developed. Learning culture influenced all three behaviors with a wide context of influences. Ensuring that feedback leads to improved performance requires more than training educators in best practices. The conceptual models support the educational alliance framework and illustrate the context and complexity of learning culture surrounding the educational relationship, learner, and feedback exchange. The educational alliance approach is underpinned by a mutual understanding of purpose and responsibility. Enhancing learners' feedback literacy skills seems to be the key aspect of the educational alliance in need of attention. Empowering learners to recognize, seek, and use feedback received within diverse learning cultures is essential.

  10. Incident Management Organization succession planning stakeholder feedback

    Science.gov (United States)

    Anne E. Black

    2013-01-01

    This report presents complete results of a 2011 stakeholder feedback effort conducted for the National Wildfire Coordination Group (NWCG) Executive Board concerning how best to organize and manage national wildland fire Incident Management Teams in the future to meet the needs of the public, agencies, fire service and Team members. Feedback was collected from 858...

  11. Online Instructor's Use of Audio Feedback to Increase Social Presence and Student Satisfaction

    Science.gov (United States)

    Portolese Dias, Laura; Trumpy, Robert

    2014-01-01

    This study investigates the impact of written group feedback, versus audio feedback, based upon four student satisfaction measures in the online classroom environment. Undergraduate students in the control group were provided both individual written feedback and group written feedback, while undergraduate students in the experimental treatment…

  12. Output stages inside a negative feedback loop: application to a low-voltage three-phase DC-AC converter for educational purposes

    CERN Document Server

    Llopis, Francisco

    2013-01-01

    The circuit presented in this paper aims at providing three 40 Vpp 50Hz AC voltages sources with 120-degree phase separation between them. This is a fully analogue circuit that uses standard, low-cost electronic components without resorting to a microcontroller as previously proposed by Shirvasar et al [1]. This circuit may serve as a basis for a low-voltage 3P-AC power supply that students may safely use to realize experiments, i.e. about the principles and applications of three-phase AC power lines, without the risk of electric shocks.

  13. Experiment on the phase congruency of distributed feedback optical fiber laser hydrophones%分布反馈光纤激光水听器相位一致性的测试方法

    Institute of Scientific and Technical Information of China (English)

    宋晓燕; 张文涛; 何俊; 李芳; 刘育梁

    2011-01-01

    在传统压电水听器相位一致性测试的基础上提出了分布反馈(DFB)光纤激光水听器相位一致性的测试方法,并搭建了测试系统.采用偏振无关的非平衡迈克尔逊干涉仪和归一化的相位载波(PGC)解调方案,解调出光纤激光水听器感受的水声信号,并与参考压电水听器作对比,使用高精度相位检测器将两信号转化为相位差信号:重复测量第二支光纤激光水听器:将两个相位差值作比较即可得到光纤激光水听器的相位一致性.实验证明了测试系统的稳定性;同时对光纤激光水听器的相位一致性进行了测试和分析,证明了光纤激光水听器具有很高的相位一致性.%A method of detecting the phase congruency of distributed feedback (DFB) optical fiber laser hydrophones was proposed based on detection system of traditional piezoelectric hydrophones, and the phase congruency detection system was set up.A polarization-insensitive unbalanced Michelson fiber interferometer was employed to transfer the frequency shifts to the phase shifts of the interferometer.After converting the output optical signal of the interferometer to electric signal, a normalized phase generated carrier (PGC) demodulation technique was used to demodulate the acoustic signal.Then the demodulated signal and the signal of the reference piezoelectric hydrophone were input into a high-resolution digital phase detector to get the phase difference.Repeat the above steps with another optical fiber laser hydrophone and compare the two results, the phase congruency between the two optical fiber laser hydrophones would be calculated.Corresponding experiments show the reliability of the phase congruency detection system and the high phase congruency between optical fiber laser hydrophones.

  14. System Design as a Three-Phase Dual-Loop (TPDL) Process: Types of Knowledge-Applied Sources of Feedback, and Student Development as Independent Learners

    Science.gov (United States)

    Barak, Moshe

    2010-01-01

    This study aimed at exploring how high school students deal with designing an information system, for example, for a small business or a medical clinic, the extent to which students develop as independent learners while working on their projects, and the factors that help or hinder fostering students' design skills. The three-phase dual-loop…

  15. Rateless feedback codes

    DEFF Research Database (Denmark)

    Sørensen, Jesper Hemming; Koike-Akino, Toshiaki; Orlik, Philip

    2012-01-01

    This paper proposes a concept called rateless feedback coding. We redesign the existing LT and Raptor codes, by introducing new degree distributions for the case when a few feedback opportunities are available. We show that incorporating feedback to LT codes can significantly decrease both...... the coding overhead and the encoding/decoding complexity. Moreover, we show that, at the price of a slight increase in the coding overhead, linear complexity is achieved with Raptor feedback coding....

  16. Preventing Feedback Fizzle

    Science.gov (United States)

    Brookhart, Susan M.

    2012-01-01

    Feedback is certainly about saying or writing helpful, learning-focused comments. But that is only part of it. What happens beforehand? What happens afterward? Feedback that is helpful and learning-focused fits into a context. Before a teacher gives feedback, students need to know the learning target so they have a purpose for using the feedback…

  17. Developing Sustainable Feedback Practices

    Science.gov (United States)

    Carless, David; Salter, Diane; Yang, Min; Lam, Joy

    2011-01-01

    Feedback is central to the development of student learning, but within the constraints of modularized learning in higher education it is increasingly difficult to handle effectively. This article makes a case for sustainable feedback as a contribution to the reconceptualization of feedback processes. The data derive from the Student Assessment and…

  18. Geometry of mixed states and degeneracy structure of geometric phases for multi-level quantum systems. A unitary group approach

    CERN Document Server

    Ercolessi, E; Morandi, G; Mukunda, N

    2001-01-01

    We analyze the geometric aspects of unitary evolution of general states for a multilevel quantum system by exploiting the structure of coadjoint orbits in the unitary group Lie algebra. Using the same method in the case of SU(3) we study the effect of degeneracies on geometric phases for three-level systems. This is shown to lead to a highly nontrivial generalization of the result for two-level systems in which degeneracy results in a "monopole" structure in parameter space. The rich structures that arise are related to the geometry of adjoint orbits in SU(3). The limiting case of a two-level degeneracy in a three-level system is shown to lead to the known monopole structure.

  19. A phase II trial of CPT-11 in recurrent squamous carcinoma of the cervix: a gynecologic oncology group study.

    Science.gov (United States)

    Look, K Y; Blessing, J A; Levenback, C; Kohler, M; Chafe, W; Roman, L D

    1998-09-01

    To determine the response rate and associated toxicity of weekly CPT-11 in squamous carcinoma of the cervix. From October 1994 to May 1996, the Gynecologic Oncology Group (GOG) conducted a Phase II trial in patients with recurrent squamous cervix carcinoma. The schedule employed weekly x4 intravenous CPT-11 at 125 mg/m2 followed with a 2-week rest, to be repeated until disease progression or unacceptable toxicity. Eligibility criteria were a GOG performance status of 0-2, adequate bone marrow reserve, adequate liver function, and serum creatinine OFFis schedule of CPT-11 exhibits modest activity with moderate toxicity in patients with recurrent squamous carcinoma of the cervix. Copyright 1998 Academic Press.

  20. Frequency and phase synchronization in large groups: Low dimensional description of synchronized clapping, firefly flashing, and cricket chirping

    Science.gov (United States)

    Ott, Edward; Antonsen, Thomas M.

    2017-05-01

    A common observation is that large groups of oscillatory biological units often have the ability to synchronize. A paradigmatic model of such behavior is provided by the Kuramoto model, which achieves synchronization through coupling of the phase dynamics of individual oscillators, while each oscillator maintains a different constant inherent natural frequency. Here we consider the biologically likely possibility that the oscillatory units may be capable of enhancing their synchronization ability by adaptive frequency dynamics. We propose a simple augmentation of the Kuramoto model which does this. We also show that, by the use of a previously developed technique [Ott and Antonsen, Chaos 18, 037113 (2008)], it is possible to reduce the resulting dynamics to a lower dimensional system for the macroscopic evolution of the oscillator ensemble. By employing this reduction, we investigate the dynamics of our system, finding a characteristic hysteretic behavior and enhancement of the quality of the achieved synchronization.

  1. AWESOME 1.1: A code for the calculation of phase and group velocities of acoustic waves in homogeneous solids

    Science.gov (United States)

    Muñoz-Santiburcio, Daniel; Hernández-Laguna, Alfonso

    2017-08-01

    We present an improved version of the code AWESOME, capable of computing phase and group velocities, power flow angles and enhancement factors of acoustic waves in homogeneous solids. In this version, some algorithms are improved and the code provides a better estimation of the enhancement factor compared to the previous version. In addition, we include a quadruple-precision version of the code, which even though using the same numerical approach as the double-precision version, is able to calculate the exact values of the enhancement factor. The standard, double-precision version of the code has been interfaced and merged with the development version of CRYSTAL and will be available as part of its next stable release. Finally, we have improved the scripts for visualizing the results, which now are compatible with GNUPLOT 5.X.X, including new scripts for the visualization of the normal and ray surfaces.

  2. Self-controlled feedback facilitates motor learning in both high and low activity individuals

    Directory of Open Access Journals (Sweden)

    Jeffrey T. Fairbrother

    2012-08-01

    Full Text Available The purpose of this study was to determine if high and low activity individuals differed in terms of the effects of self-controlled feedback on the performance and learning of a movement skill. The task consisted of a blindfolded beanbag toss using the non-preferred arm. Participants were pre-screened according to their physical activity level using the International Physical Activity Questionnaire. An equal number of high activity (HA and low activity (LA participants were assigned to self-control (SC and yoked (YK feedback conditions, creating four groups: Self-Control High Activity (SC-HA; Self-Control Low Activity (SC-LA; Yoked High Activity (YK-HA; and Yoked Low Activity (YK-LA. SC condition participants were provided feedback whenever they requested it, while YK condition participants received feedback according to a schedule created by their SC counterpart. Results indicated that the SC condition was more accurate than the YK condition during acquisition and transfer phases, and the HA condition was more accurate than the LA condition during all phases of the experiment. A post-training questionnaire indicated that participants in the SC condition asked for feedback mostly after what they perceived to be good trials; those in the YK condition indicated that they would have preferred to receive feedback after good trials. This study provided further support for the advantages of self-controlled feedback when learning motor skills, additionally showing benefits for both active and less active individuals. The results suggested that the provision of self-controlled feedback to less active learners may be a potential avenue to teaching motor skills necessary to engage in greater amounts of physical activity.

  3. ELECTRICAL RESISTANCE IMAGING OF TWO-PHASE FLOW WITH A MESH GROUPING TECHNIQUE BASED ON PARTICLE SWARM OPTIMIZATION

    Directory of Open Access Journals (Sweden)

    BO AN LEE

    2014-02-01

    Full Text Available An electrical resistance tomography (ERT technique combining the particle swarm optimization (PSO algorithm with the Gauss-Newton method is applied to the visualization of two-phase flows. In the ERT, the electrical conductivity distribution, namely the conductivity values of pixels (numerical meshes comprising the domain in the context of a numerical image reconstruction algorithm, is estimated with the known injected currents through the electrodes attached on the domain boundary and the measured potentials on those electrodes. In spite of many favorable characteristics of ERT such as no radiation, low cost, and high temporal resolution compared to other tomography techniques, one of the major drawbacks of ERT is low spatial resolution due to the inherent ill-posedness of conventional image reconstruction algorithms. In fact, the number of known data is much less than that of the unknowns (meshes. Recalling that binary mixtures like two-phase flows consist of only two substances with distinct electrical conductivities, this work adopts the PSO algorithm for mesh grouping to reduce the number of unknowns. In order to verify the enhanced performance of the proposed method, several numerical tests are performed. The comparison between the proposed algorithm and conventional Gauss-Newton method shows significant improvements in the quality of reconstructed images.

  4. Dynamic fabric phase sorptive extraction for a group of pharmaceuticals and personal care products from environmental waters.

    Science.gov (United States)

    Lakade, Sameer S; Borrull, Francesc; Furton, Kenneth G; Kabir, Abuzar; Marcé, Rosa Maria; Fontanals, Núria

    2016-07-22

    This paper describes for the first time the use of a new extraction technique, based on fabric phase sorptive extraction (FPSE). This new mode proposes the extraction of the analytes in dynamic mode in order to reduce the extraction time. Dynamic fabric phase sorptive extraction (DFPSE) followed by liquid chromatography-tandem mass spectrometry was evaluated for the extraction of a group of pharmaceuticals and personal care products (PPCPs) from environmental water samples. Different parameters affecting the extraction were optimized and best conditions were achieved when 50mL of sample at pH 3 was passed through 3 disks and analytes retained were eluted with 10mL of ethyl acetate. The recoveries were higher than 60% for most of compounds with the exception of the most polar ones (between 8% and 38%). The analytical method was validated with environmental samples such as river water and effluent and influent wastewater, and good performance was obtained. The analysis of samples revealed the presence of some PPCPs at low ngL(-1) concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Quantum feedback channels

    CERN Document Server

    Bowen, G

    2002-01-01

    In classical information theory the capacity of a noisy communication channel cannot be increased by the use of feedback. In quantum information theory the no-cloning theorem means that noiseless copying and feedback of quantum information cannot be achieved. In this paper, quantum feedback is defined as the unlimited use of a noiseless quantum channel from receiver to sender. Given such quantum feedback, it is shown to provide no increase in the entanglement-assisted capacities of a noisy quantum channel, in direct analogy to the classical case. It is also shown that in various cases of non-assisted capacities, feedback can increase the capacity of many quantum channels.

  6. Positive and negative feedback learning and associated dopamine and serotonin transporter binding after methamphetamine.

    Science.gov (United States)

    Stolyarova, Alexandra; O'Dell, Steve J; Marshall, John F; Izquierdo, Alicia

    2014-09-01

    Learning from mistakes and prospectively adjusting behavior in response to reward feedback is an important facet of performance monitoring. Dopamine (DA) pathways play an important role in feedback learning and a growing literature has also emerged on the importance of serotonin (5HT) in reward learning, particularly during punishment or reward omission (negative feedback). Cognitive impairments resulting from psychostimulant exposure may arise from altered patterns in feedback learning, which in turn may be modulated by DA and 5HT transmission. We analyzed long-term, off-drug changes in learning from positive and negative feedback and associated striatal DA transporter (DAT) and frontocortical 5HT transporter (SERT) binding in rats pretreated with methamphetamine (mAMPH). Specifically, we assessed the reversal phase of pairwise visual discrimination learning in rats receiving single dose- (mAMPHsingle) vs. escalating-dose exposure (mAMPHescal). Using fine-grained trial-by-trial analyses, we found increased sensitivity to and reliance on positive feedback in mAMPH-pretreated animals, with the mAMPHsingle group showing more pronounced use of this type of feedback. In contrast, overall negative feedback sensitivity was not altered following any mAMPH treatment. In addition to validating the enduring effects of mAMPH on early reversal learning, we found more consecutive error commissions before the first correct response in mAMPH-pretreated rats. This behavioral rigidity was negatively correlated with subregional frontocortical SERT whereas positive feedback sensitivity negatively correlated with striatal DAT binding. These results provide new evidence for the overlapping, yet dissociable roles of DA and 5HT systems in overcoming perseveration and in learning new reward rules.

  7. Effect of pressure on bilayer phase behavior of N-methylated di-O-hexadecylphosphatidylethanolamines: relevance of head-group modification on the bilayer interdigitation.

    Science.gov (United States)

    Goto, Masaki; Aoki, Yuya; Tamai, Nobutake; Matsuki, Hitoshi

    2017-03-30

    The phase transitions of N-methylated di-O-hexadecylphosphatidylethanolamines (DHPE, DH-N-methyl-PE (DHMePE) and DH-N,N-dimethyl-PE (DHMe2PE)) were observed by differential scanning calorimetry (DSC) and fluorometry under atmospheric pressure and by light-transmittance measurements under high pressure. The DSC thermograms showed that the N-methylated DHPE bilayers underwent the phase transition from the gel phase to the liquid crystalline (Lα) phase under atmospheric pressure. The gel phase was identified by fluorometry as the lamellar gel (Lβ) phase, and not interdigitated gel (LβI) phase. The gel/Lα transition temperature increased with pressure while decreased stepwise with increasing polar head-group size. This stepwise depression of the transition temperature may be caused by the inverse-proportional hydrogen-bonding capabilities of the head-group to the head-group size. The thermodynamic quantities of the gel/Lα transition were comparable for the N-methylated DHPE bilayers. The pressure-induced LβI phase was not found in these bilayers although the bilayer of di-O-hexadecylphosphatidylcholine (DHPC), which is a kind of N-methylated DHPEs, forms the LβI phase only by hydration under atmospheric pressure. Taking into account that the bilayers of diacyl-homologs of N-methylated DHPEs, N-methylated dipalmitoyl-PEs except for dipalmitoylphosphatidylcholine (DPPC), do not form the LβI phase in the whole pressure range investigated but the DPPC bilayer forms the LβI phase under high pressure, we can say that the interdigitation requires weaker interaction between large-sized head groups like the bulky choline group. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Data for improvement and clinical excellence: protocol for an audit with feedback intervention in long-term care

    Directory of Open Access Journals (Sweden)

    Schalm Corinne

    2010-10-01

    Full Text Available Abstract Background There is considerable evidence about the effectiveness of audit coupled with feedback, although few audit with feedback interventions have been conducted in long-term care (LTC settings to date. In general, the effects have been found to be modest at best, although in settings where there has been little history of audit and feedback, the effects may be greater, at least initially. The primary purpose of the Data for Improvement and Clinical Excellence (DICE Long-Term Care project is to assess the effects of an audit with feedback intervention delivered monthly over 13 months in four LTC facilities. The research questions we addressed are: 1. What effects do feedback reports have on processes and outcomes over time? 2. How do different provider groups in LTC and home care respond to feedback reports based on data targeted at improving quality of care? Methods/design The research team conducting this study comprises researchers and decision makers in continuing care in the province of Alberta, Canada. The intervention consists of monthly feedback reports in nine LTC units in four facilities in Edmonton, Alberta. Data for the feedback reports comes from the Resident Assessment Instrument Minimum Data Set (RAI version 2.0, a standardized instrument mandated for use in LTC facilities throughout Alberta. Feedback reports consist of one page, front and back, presenting both graphic and textual information. Reports are delivered to all staff working in the four LTC facilities. The primary evaluation uses a controlled interrupted time series design both adjusted and unadjusted for covariates. The concurrent process evaluation uses observation and self-report to assess uptake of the feedback reports. Following the project phase described in this protocol, a similar intervention will be conducted in home care settings in Alberta. Depending on project findings, if they are judged useful by decision makers participating in this research

  9. Situated Formative Feedback

    DEFF Research Database (Denmark)

    Lukassen, Niels Bech; Wahl, Christian; Sorensen, Elsebeth Korsgaard

    2016-01-01

    This study addresses the conceptual challenge of providing students with good quality feedback to enhance student learning in an online community of practice (COP). The aim of the study is to identify feedback mechanisms in a virtual learning environment (VLE) and to create a full formative...... feedback episode (FFE) through an online dialogue. The paper argues that dialogue is crucial for student learning and that feedback is not only something the teacher gives to the student. Viewing good quality feedback as social, situated, formative, emphasis is put on the establishment of dialogue. We...... refer to this type of feedback as, Situated Formative Feedback (SFF). As a basis for exploring, identifying and discussing relevant aspects of SFF the paper analyses qualitative data from a Moodle dialogue. Data are embedded in the qualitative analytic program Nvivo and are analysed with a system...

  10. Feedback and Incentives

    DEFF Research Database (Denmark)

    Eriksson, Tor Viking; Poulsen, Anders; Villeval, Marie Claire

    2009-01-01

    This paper experimentally investigates the impact of different pay schemes and relative performance feedback policies on employee effort. We explore three feedback rules: no feedback on relative performance, feedback given halfway through the production period, and continuously updated feedback. We...... use two pay schemes, a piece rate and a tournament. We find that overall feedback does not improve performance. In contrast to the piece-rate pay scheme there is some evidence of positive peer effects in tournaments since the underdogs almost never quit the competition even when lagging significantly...... behind, and front runners do not slack off. But in both pay schemes relative performance feedback reduces the quality of the low performers' work; we refer to this as a "negative quality peer effect"....

  11. Platinum-Group Minerals and Other Accessory Phases in Chromite Deposits of the Alapaevsk Ophiolite, Central Urals, Russia

    Directory of Open Access Journals (Sweden)

    Federica Zaccarini

    2016-10-01

    Full Text Available An electron microprobe study has been carried out on platinum-group minerals, accessory phases, and chromite in several chromite deposits of the Alapaevsk ophiolite (Central Urals, Russia namely the Bakanov Kluch, Kurmanovskoe, Lesnoe, 3-d Podyony Rudnik, Bol’shaya Kruglyshka, and Krest deposits. These deposits occur in partially to totally serpentinized peridotites. The microprobe data shows that the chromite composition varies from Cr-rich to Al-rich. Tiny platinum-group minerals (PGM, 1–10 µm in size, have been found in the chromitites. The most abundant PGM is laurite, accompanied by minor cuproiridsite and alloys in the system Os–Ir–Ru. A small grain (about 20 μm was found in the interstitial serpentine of the Bakanov Kluch chromitite, and its calculated stoichiometry corresponds to (Ni,Fe5P. Olivine, occurring in the silicate matrix or included in fresh chromite, has a mantle-compatible composition in terms of major and minor elements. Several inclusions of amphibole, Na-rich phlogopite, and clinopyroxene have been identified. The bimodal Cr–Al composition of chromite probably corresponds to a vertical distribution in the ophiolite sequence, implying formation of Cr-rich chromitites in the deep mantle, and Al-rich chromitites close to the Moho-transition zone, in a supra-subduction setting. The presence of abundant hydrous silicate inclusions, such as amphibole and phlogopite, suggests that the Alapaevsk chromitites crystallized as a result of the interaction between a melt enriched in fluids and peridotites. Laurite and cuproiridsite are considered to be magmatic in origin, i.e., entrapped as solid phases during the crystallization of chromite at high temperatures. The sulfur fugacity was relatively high to allow the precipitation of Ir-bearing sulfides, but below the Os–OsS2 buffer. The alloys in the system Os–Ir–Ru are classified as secondary PGM, i.e., formed at low temperature during the serpentinization process. The

  12. Oxytocin selectively facilitates learning with social feedback and increases activity and functional connectivity in emotional memory and reward processing regions.

    Science.gov (United States)

    Hu, Jiehui; Qi, Song; Becker, Benjamin; Luo, Lizhu; Gao, Shan; Gong, Qiyong; Hurlemann, René; Kendrick, Keith M

    2015-06-01

    In male Caucasian subjects, learning is facilitated by receipt of social compared with non-social feedback, and the neuropeptide oxytocin (OXT) facilitates this effect. In this study, we have first shown a cultural difference in that male Chinese subjects actually perform significantly worse in the same reinforcement associated learning task with social (emotional faces) compared with non-social feedback. Nevertheless, in two independent double-blind placebo (PLC) controlled between-subject design experiments we found OXT still selectively facilitated learning with social feedback. Similar to Caucasian subjects this OXT effect was strongest with feedback using female rather than male faces. One experiment performed in conjunction with functional magnetic resonance imaging showed that during the response, but not feedback phase of the task, OXT selectively increased activity in the amygdala, hippocampus, parahippocampal gyrus and putamen during the social feedback condition, and functional connectivity between the amygdala and insula and caudate. Therefore, OXT may be increasing the salience and reward value of anticipated social feedback. In the PLC group, response times and state anxiety scores during social feedback were associated with signal changes in these same regions but not in the OXT group. OXT may therefore have also facilitated learning by reducing anxiety in the social feedback condition. Overall our results provide the first evidence for cultural differences in social facilitation of learning per se, but a similar selective enhancement of learning with social feedback under OXT. This effect of OXT may be associated with enhanced responses and functional connectivity in emotional memory and reward processing regions.

  13. Selenol protecting groups in organic chemistry: special emphasis on selenocysteine Se-protection in solid phase peptide synthesis.

    Science.gov (United States)

    Flemer, Stevenson

    2011-04-18

    The appearance of selenium in organic synthesis is relatively rare, and thus examples in the literature pertaining to the masking of its considerable reactivity are similarly uncommon. Greene's Protecting Groups in Organic Synthesis, the standard reference for the state of the art in this arena, offers no entries for selenium protective methodology, in stark comparison to its mention of the great variety of protecting groups germane to its chalcogen cousin sulfur. This scarcity of Se-protection methods makes it no less interesting and pertinent toward the construction of selenium-containing organic systems which do indeed require the iterative blocking and de-blocking of selenol functionalities. A selenium-containing system which is especially relevant is selenocysteine, as its use in Solid Phase Peptide Synthesis requires extensive protection of its selenol side chain. This review will attempt to summarize the current state of understanding with regard to selenium protection protocol in organic synthesis. Moreover, it will provide a special emphasis on selenocysteine side chain protection, comprising both the breadth of functionality used for this purpose as well as methods of deprotection.

  14. Selenol Protecting Groups in Organic Chemistry: Special Emphasis on Selenocysteine Se-Protection in Solid Phase Peptide Synthesis

    Directory of Open Access Journals (Sweden)

    Stevenson Flemer Jr.

    2011-04-01

    Full Text Available The appearance of selenium in organic synthesis is relatively rare, and thus examples in the literature pertaining to the masking of its considerable reactivity are similarly uncommon. Greene's Protecting Groups in Organic Synthesis, the standard reference for the state of the art in this arena, offers no entries for selenium protective methodology, in stark comparison to its mention of the great variety of protecting groups germane to its chalcogen cousin sulfur. This scarcity of Se-protection methods makes it no less interesting and pertinent toward the construction of selenium-containing organic systems which do indeed require the iterative blocking and de-blocking of selenol functionalities. A selenium-containing system which is especially relevant is selenocysteine, as its use in Solid Phase Peptide Synthesis requires extensive protection of its selenol side chain. This review will attempt to summarize the current state of understanding with regard to selenium protection protocol in organic synthesis. Moreover, it will provide a special emphasis on selenocysteine side chain protection, comprising both the breadth of functionality used for this purpose as well as methods of deprotection.

  15. Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L

    2004-04-02

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.

  16. Grade One Peer and Teacher Feedback on Student Writing

    Science.gov (United States)

    Peterson, Shelley Stagg; Portier, Christine

    2014-01-01

    This article examines a grade one teacher's support for her students' writing development through formal peer and teacher feedback. The teacher modelled and provided examples of effective feedback and good writing in whole-class and small-group lessons and in her own one-on-one verbal feedback on student writing. She allocated time for the…

  17. Evaluation of a two-phase experimental study of a small group (“MultiLit” reading intervention for older low-progress readers

    Directory of Open Access Journals (Sweden)

    Jennifer Buckingham

    2014-12-01

    Full Text Available The study reported here examined the efficacy of a small group (Tier 2 in a three-tier Response to Intervention model literacy intervention for older low-progress readers (in Years 3–6. This article focuses on the second phase of a two-phase, crossover randomized control trial involving 26 students. In Phase 1, the experimental group (E1 received the 1 h literacy intervention daily for three school terms. The control group received regular classroom instruction. In Phase 2, the original control group received the intervention (E2. At the end of Phase 1, there was a statistically significant difference between groups and a large treatment effect on one of five measures—the Martin and Pratt Non-word Reading Test of phonological recoding. At the end of Phase 2, the large effect on phonological recoding was confirmed for the second experimental group, and there were also statistically significant differences with moderate or large effect sizes on four other measures—single word reading, fluency, passage reading accuracy, and comprehension.

  18. Three-phase Interstellar Medium in Galaxies Resolving Evolution with Star Formation and Supernova Feedback (TIGRESS): Algorithms, Fiducial Model, and Convergence

    Science.gov (United States)

    Kim, Chang-Goo; Ostriker, Eve C.

    2017-09-01

    We introduce TIGRESS, a novel framework for multi-physics numerical simulations of the star-forming interstellar medium (ISM) implemented in the Athena MHD code. The algorithms of TIGRESS are designed to spatially and temporally resolve key physical features, including: (1) the gravitational collapse and ongoing accretion of gas that leads to star formation in clusters; (2) the explosions of supernovae (SNe), both near their progenitor birth sites and from runaway OB stars, with time delays relative to star formation determined by population synthesis; (3) explicit evolution of SN remnants prior to the onset of cooling, which leads to the creation of the hot ISM; (4) photoelectric heating of the warm and cold phases of the ISM that tracks the time-dependent ambient FUV field from the young cluster population; (5) large-scale galactic differential rotation, which leads to epicyclic motion and shears out overdense structures, limiting large-scale gravitational collapse; (6) accurate evolution of magnetic fields, which can be important for vertical support of the ISM disk as well as angular momentum transport. We present tests of the newly implemented physics modules, and demonstrate application of TIGRESS in a fiducial model representing the solar neighborhood environment. We use a resolution study to demonstrate convergence and evaluate the minimum resolution {{Δ }}x required to correctly recover several ISM properties, including the star formation rate, wind mass-loss rate, disk scale height, turbulent and Alfvénic velocity dispersions, and volume fractions of warm and hot phases. For the solar neighborhood model, all these ISM properties are converged at {{Δ }}x≤slant 8 {pc}.

  19. Phase I remedial investigation report of Waste Area Grouping 2 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    Miller, D.E. [ed.

    1995-07-01

    This report presents the activities and findings of the first phase of a three-phase remedial investigation (RI) of Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, and updates the scope and strategy for WAG-2-related efforts. WAG 2 contains White Oak Creek (WOC) and its tributaries downstream of the ORNL main plant area, White Oak Lake, White Oak Creek Embayment on the Clinch River, and the associated floodplain and subsurface environment. Water, sediment, soil, and biota in WAG 2 are contaminated and continue to receive contaminants from upgradient WAGs. This report includes field activities completed through October 1992. The remediation of WAG 2 is scheduled to follow the cessation of contaminant input from hydrologically upgradient WAGs. While upgradient areas are being remediated, the strategy for WAG 2 is to conduct a long-term monitoring and investigation program that takes full advantage of WAG 2`s role as an integrator of contaminant fluxes from other ORNL WAGs and focuses on four key goals: (1) Implement, in concert with other programs, long-term, multimedia environmental monitoring and tracking of contaminants leaving other WAGs, entering WAG 2, and being transported off-site. (2) Provide a conceptual framework to integrate and develop information at the watershed-level for pathways and processes that are key to contaminant movement, and so support remedial efforts at ORNL. (3) Provide periodic updates of estimates of potential risk (both human health and ecological) associated with contaminants accumulating in and moving through WAG 2 to off-site areas. (4) Support the ORNL Environmental Restoration Program efforts to prioritize, remediate, and verify remedial effectiveness for contaminated sites at ORNL, through long-term monitoring and continually updated risk assessments.

  20. Phase I remedial investigation report of Waste Area Grouping 2 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    Miller, D.E. [ed.

    1995-07-01

    This report presents the activities and findings of the first phase of a three-phase remedial investigation (RI) of Waste Area Grouping (WAG) 2 at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, and updates the scope and strategy for WAG-2-related efforts. WAG 2 contains White Oak Creek (WOC) and its tributaries downstream of the ORNL main plant area, White Oak Lake, White Oak Creek Embayment on the Clinch River, and the associated floodplain and subsurface environment. Water, sediment, soil, and biota in WAG 2 are contaminated and continue to receive contaminants from upgradient WAGs. This report includes field activities completed through October 1992. The remediation of WAG 2 is scheduled to follow the cessation of contaminant input from hydrologically upgradient WAGs. While upgradient areas are being remediated, the strategy for WAG 2 is to conduct a long-term monitoring and investigation program that takes full advantage of WAG 2`s role as an integrator of contaminant fluxes from other ORNL WAGs and focuses on four key goals: (1) Implement, in concert with other programs, long-term, multimedia environmental monitoring and tracking of contaminants leaving other WAGs, entering WAG 2, and being transported off-site. (2) Provide a conceptual framework to integrate and develop information at the watershed-level for pathways and processes that are key to contaminant movement, and so support remedial efforts at ORNL. (3) Provide periodic updates of estimates of potential risk (both human health and ecological) associated with contaminants accumulating in and moving through WAG 2 to off-site areas. (4) Support the ORNL Environmental Restoration Program efforts to prioritize, remediate, and verify remedial effectiveness for contaminated sites at ORNL, through long-term monitoring and continually updated risk assessments.

  1. Stereotype threat engenders neural attentional bias toward negative feedback to undermine performance.

    Science.gov (United States)

    Forbes, Chad E; Leitner, Jordan B

    2014-10-01

    Stereotype threat, a situational pressure individuals experience when they fear confirming a negative group stereotype, engenders a cascade of physiological stress responses, negative appraisals, and performance monitoring processes that tax working memory resources necessary for optimal performance. Less is known, however, about how stereotype threat biases attentional processing in response to performance feedback, and how such attentional biases may undermine performance. Women received feedback on math problems in stereotype threatening compared to stereotype-neutral contexts while continuous EEG activity was recorded. Findings revealed that stereotype threatened women elicited larger midline P100 ERPs, increased phase locking between anterior cingulate cortex and dorsolateral prefrontal cortex (two regions integral for attentional processes), and increased power in left fusiform gyrus in response to negative feedback compared to positive feedback and women in stereotype-neutral contexts. Increased power in left fusiform gyrus in response to negative feedback predicted underperformance on the math task among stereotype threatened women only. Women in stereotype-neutral contexts exhibited the opposite trend. Findings suggest that in stereotype threatening contexts, neural networks integral for attention and working memory are biased toward negative, stereotype confirming feedback at very early speeds of information processing. This bias, in turn, plays a role in undermining performance. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Bimanual Coordination Learning with Different Augmented Feedback Modalities and Information Types.

    Science.gov (United States)

    Chiou, Shiau-Chuen; Chang, Erik Chihhung

    2016-01-01

    Previous studies have shown that bimanual coordination learning is more resistant to the removal of augmented feedback when acquired with auditory than with visual channel. However, it is unclear whether this differential "guidance effect" between feedback modalities is due to enhanced sensorimotor integration via the non-dominant auditory channel or strengthened linkage to kinesthetic information under rhythmic input. The current study aimed to examine how modalities (visual vs. auditory) and information types (continuous visuospatial vs. discrete rhythmic) of concurrent augmented feedback influence bimanual coordination learning. Participants either learned a 90°-out-of-phase pattern for three consecutive days with Lissajous feedback indicating the integrated position of both arms, or with visual or auditory rhythmic feedback reflecting the relative timing of the movement. The results showed diverse performance change after practice when the feedback was removed between Lissajous and the other two rhythmic groups, indicating that the guidance effect may be modulated by the type of information provided during practice. Moreover, significant performance improvement in the dual-task condition where the irregular rhythm counting task was applied as a secondary task also suggested that lower involvement of conscious control may result in better performance in bimanual coordination.

  3. Feedback is good or bad? Medical residents’ points of view on feedback in clinical education

    Directory of Open Access Journals (Sweden)

    LEILA BAZRAFKAN

    2013-04-01

    Full Text Available Introduction: Feedback is very important in education and can help quality in the training process and orient the trainees in clinical contexts. This study aimed to assess the residents’ points of view about feedback in clinical education at Shiraz University of Medical Sciences. Methods: The sample of this study included 170 medical residents attending medical workshops in Shiraz University of Medical Sciences. The residents filled a valid and reliable questionnaire containing 21 items on their perceptions of the feedback they got throughout the workshops. The data were analyzed using SPSS version 14. Results: The study revealed that residents, generally, have a positive perception of feedback in their training. The highest score belonged to the items such as “feedback was applicable to future work”, “feedback corrected my behavior”, “feedback worked as a motivation for education” and “feedback was specific in one subject”. Residents who had a negative feedback experience also increased their efforts to learn. The Surgery residents acquired the highest scores while radiology residents got the lowest. The difference between these groups was statistically significant (P = 0.000. Conclusion: The highest mean score belonged to internal medicine residents. This shows that residents believe that obstetrics & gynecology ward is a ward in which the formative assessment is much more powerful in comparison to the other three major wards. The surgery ward received the lowest score for formative assessment and this shows that the feedback in surgery ward is very low.

  4. Enhanced Negative Feedback Responses in Remitted Depression

    Science.gov (United States)

    Santesso, Diane L.; Steele, Katherine T.; Bogdan, Ryan; Holmes, Avram J.; Deveney, Christen M.; Meites, Tiffany M.; Pizzagalli, Diego A.

    2011-01-01

    Major depressive disorder (MDD) is characterized by hypersensitivity to negative feedback that might involve frontocingulate dysfunction. MDD subjects exhibit enhanced electrophysiological responses to negative internal (errors) and external (feedback) cues. Whether this dysfunction extends to remitted depressed (RD) subjects with a history of MDD is currently unknown. To address this issue, we examined the feedback-related negativity (FRN) in RD and control subjects using a probabilistic punishment learning task. Despite equivalent behavioral performance, RD subjects showed larger FRNs to negative feedback relative to controls; group differences remained after accounting for residual anxiety and depressive symptoms. The present findings suggest that abnormal responses to negative feedback extend to samples at increased risk for depressive episodes in the absence of current symptoms. PMID:18580576

  5. Self-Controlled Feedback in 10-Year-Old Children: Higher Feedback Frequencies Enhance Learning

    Science.gov (United States)

    Chiviacowsky, Suzete; Wulf, Gabriele; de Medeiros, Franklin Laroque; Kaefer, Angelica; Wally, Raquel

    2008-01-01

    The purpose of the present study was to examine whether learning in 10-year-old children--that is, the age group for which the Chiviacowsky et al. (2006) study found benefits of self-controlled knowledge of results (KR)--would differ depending on the frequency of feedback they chose. The authors surmised that a relatively high feedback frequency…

  6. RF feedback for KEKB

    Energy Technology Data Exchange (ETDEWEB)

    Ezura, Eizi; Yoshimoto, Shin-ichi; Akai, Kazunori [National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan)

    1996-08-01

    This paper describes the present status of the RF feedback development for the KEK B-Factory (KEKB). A preliminary experiment concerning the RF feedback using a parallel comb-filter was performed through a choke-mode cavity and a klystron. The RF feedback has been tested using the beam of the TRISTAN Main Ring, and has proved to be effective in damping the beam instability. (author)

  7. Neural cryptography with feedback

    Science.gov (United States)

    Ruttor, Andreas; Kinzel, Wolfgang; Shacham, Lanir; Kanter, Ido

    2004-04-01

    Neural cryptography is based on a competition between attractive and repulsive stochastic forces. A feedback mechanism is added to neural cryptography which increases the repulsive forces. Using numerical simulations and an analytic approach, the probability of a successful attack is calculated for different model parameters. Scaling laws are derived which show that feedback improves the security of the system. In addition, a network with feedback generates a pseudorandom bit sequence which can be used to encrypt and decrypt a secret message.

  8. Neural cryptography with feedback.

    Science.gov (United States)

    Ruttor, Andreas; Kinzel, Wolfgang; Shacham, Lanir; Kanter, Ido

    2004-04-01

    Neural cryptography is based on a competition between attractive and repulsive stochastic forces. A feedback mechanism is added to neural cryptography which increases the repulsive forces. Using numerical simulations and an analytic approach, the probability of a successful attack is calculated for different model parameters. Scaling laws are derived which show that feedback improves the security of the system. In addition, a network with feedback generates a pseudorandom bit sequence which can be used to encrypt and decrypt a secret message.

  9. Policy Feedback System (PFS)

    Data.gov (United States)

    Social Security Administration — The Policy Feedback System (PFS) is a web application developed by the Office of Disability Policy Management Information (ODPMI) team that gathers empirical data...

  10. Gas-phase formaldehyde adsorption isotherm studies on activated carbon: correlations of adsorption capacity to surface functional group density.

    Science.gov (United States)

    Carter, Ellison M; Katz, Lynn E; Speitel, Gerald E; Ramirez, David

    2011-08-01

    Formaldehyde (HCHO) adsorption isotherms were developed for the first time on three activated carbons representing one activated carbon fiber (ACF) cloth, one all-purpose granular activated carbon (GAC), and one GAC commercially promoted for gas-phase HCHO removal. The three activated carbons were evaluated for HCHO removal in the low-ppm(v) range and for water vapor adsorption from relative pressures of 0.1-0.9 at 26 °C where, according to the IUPAC isotherm classification system, the adsorption isotherms observed exhibited Type V behavior. A Type V adsorption isotherm model recently proposed by Qi and LeVan (Q-L) was selected to model the observed adsorption behavior because it reduces to a finite, nonzero limit at low partial pressures and it describes the entire range of adsorption considered in this study. The Q-L model was applied to a polar organic adsorbate to fit HCHO adsorption isotherms for the three activated carbons. The physical and chemical characteristics of the activated carbon surfaces were characterized using nitrogen adsorption isotherms, X-ray photoelectron spectroscopy (XPS), and Boehm titrations. At low concentrations, HCHO adsorption capacity was most strongly related to the density of basic surface functional groups (SFGs), while water vapor adsorption was most strongly influenced by the density of acidic SFGs.

  11. Low-energy effective interactions beyond the constrained random-phase approximation by the functional renormalization group

    Science.gov (United States)

    Kinza, Michael; Honerkamp, Carsten

    2015-07-01

    In the derivation of low-energy effective models for solids targeting the bands near the Fermi level, the constrained random-phase approximation (cRPA) has become an appreciated tool to compute the effective interactions. The Wick-ordered constrained functional renormalization group (cfRG) generalizes the cRPA approach by including all interaction channels in an unbiased way. Here we present applications of the cfRG to two simple multiband systems and compare the resulting effective interactions to the cRPA. First, we consider a multiband model for monolayer graphene, where we integrate out the σ bands to get an effective theory for π bands. It turns out that terms beyond cRPA are strongly suppressed by the different x y -plane reflection symmetry of the bands. In our model the cfRG corrections to cRPA become visible when one disturbs this symmetry difference slightly, however, without qualitative changes. This study shows that the embedding or layering of two-dimensional electronic systems can alter the effective interaction parameters beyond what is expected from screening considerations. The second example is a one-dimensional model for a diatomic system reminiscent of a CuO chain, where we consider an effective theory for Cu 3 d -like orbitals. Here the fRG data shows relevant and qualitative corrections compared to the cRPA results. We argue that the new interaction terms affect the magnetic properties of the low-energy model.

  12. Feedback Loop Gains and Feedback Behavior (1996)

    DEFF Research Database (Denmark)

    Kampmann, Christian Erik

    2012-01-01

    Linking feedback loops and system behavior is part of the foundation of system dynamics, yet the lack of formal tools has so far prevented a systematic application of the concept, except for very simple systems. Having such tools at their disposal would be a great help to analysts in understanding...... large, complicated simulation models. The paper applies tools from graph theory formally linking individual feedback loop strengths to the system eigenvalues. The significance of a link or a loop gain and an eigenvalue can be expressed in the eigenvalue elasticity, i.e., the relative change...... of an eigenvalue resulting from a relative change in the gain. The elasticities of individual links and loops may be found through simple matrix operations on the linearized system. Even though the number of feedback loops can grow rapidly with system size, reaching astronomical proportions even for modest systems...

  13. A Combination of Outcome and Process Feedback Enhances Performance in Simulations of Child Sexual Abuse Interviews Using Avatars

    Directory of Open Access Journals (Sweden)

    Francesco Pompedda

    2017-09-01

    Full Text Available Simulated interviews in alleged child sexual abuse (CSA cases with computer-generated avatars paired with feedback improve interview quality. In the current study, we aimed to understand better the effect of different types of feedback in this context. Feedback was divided into feedback regarding conclusions about what happened to the avatar (outcome feedback and feedback regarding the appropriateness of question-types used by the interviewer (process feedback. Forty-eight participants each interviewed four different avatars. Participants were divided into four groups (no feedback, outcome feedback, process feedback, and a combination of both feedback types. Compared to the control group, interview quality was generally improved in all the feedback groups on all outcome variables included. Combined feedback produced the strongest effect on increasing recommended questions and correct conclusions. For relevant and neutral details elicited by the interviewers, no statistically significant differences were found between feedback types. For wrong details, the combination of feedback produced the strongest effect, but this did not differ from the other two feedback groups. Nevertheless, process feedback produced a better result compared to outcome feedback. The present study replicated previous findings regarding the effect of feedback in improving interview quality, and provided new knowledge on feedback characteristics that maximize training effects. A combination of process and outcome feedback showed the strongest effect in enhancing training in simulated CSA interviews. Further research is, however, needed.

  14. Corrected Feedback: A Procedure to Enhance Recall of Informed Consent to Research among Substance Abusing Offenders.

    Science.gov (United States)

    Festinger, David S; Dugosh, Karen L; Croft, Jason R; Arabia, Patricia L; Marlowe, Douglas B

    2010-01-01

    This study examined the efficacy of corrected feedback for improving consent recall throughout the course of an ongoing longitudinal study. Participants (N = 135) were randomly assigned to either a corrected feedback or a no-feedback control condition. Participants completed a consent quiz 2-weeks after consenting to the host study and at months 1, 2, and 3. The corrected feedback group received corrections to erroneous responses and the no-feedback control group did not. The feedback group displayed significantly greater recall overall and in specific content areas (i.e., procedures, protections, risks/benefits). Results support the use of corrected feedback for improving consent recall.

  15. Stepwise positional-orientational order and the multicritical-multistructural global phase diagram of the s=3/2 Ising model from renormalization-group theory.

    Science.gov (United States)

    Yunus, Çağın; Renklioğlu, Başak; Keskin, Mustafa; Berker, A Nihat

    2016-06-01

    The spin-3/2 Ising model, with nearest-neighbor interactions only, is the prototypical system with two different ordering species, with concentrations regulated by a chemical potential. Its global phase diagram, obtained in d=3 by renormalization-group theory in the Migdal-Kadanoff approximation or equivalently as an exact solution of a d=3 hierarchical lattice, with flows subtended by 40 different fixed points, presents a very rich structure containing eight different ordered and disordered phases, with more than 14 different types of phase diagrams in temperature and chemical potential. It exhibits phases with orientational and/or positional order. It also exhibits quintuple phase transition reentrances. Universality of critical exponents is conserved across different renormalization-group flow basins via redundant fixed points. One of the phase diagrams contains a plastic crystal sequence, with positional and orientational ordering encountered consecutively as temperature is lowered. The global phase diagram also contains double critical points, first-order and critical lines between two ordered phases, critical end points, usual and unusual (inverted) bicritical points, tricritical points, multiple tetracritical points, and zero-temperature criticality and bicriticality. The four-state Potts permutation-symmetric subspace is contained in this model.

  16. Effects of Mechanical and Radiative Supernova Feedback on Subhalo Evolution

    Science.gov (United States)

    Quirk, Amanda; Choi, Ena; Ostriker, Jeremiah P.

    2017-01-01

    Using cosmological hydrodynamical simulations, we investigate the effects supernova feedback has on populations of subhalos at current redshift. A group of halos was run through two simulations, each with different feedback models. One had thermal feedback, and the other had mechanical and radiative feedback. We used a friend-of-friend halo finder on the output of these simulations to explore the stellar and dark matter subhalos created. The number of stellar subhalos created by the mechanical feedback simulation was significantly less than the number created by the thermal feedback model, especially at low mass. Thus, the mechanical feedback model created a number of stellar subhalos more consistent with observations. The mechanical feedback model also showed a presence of dark matter subhalos that lacked stellar particles, or dark subhalos. The results of this analysis can give insight to the Missing Satellite Problem.

  17. Effects of diaphragm breathing exercise and feedback breathing exercise on pulmonary function in healthy adults

    OpenAIRE

    Yong, Min-Sik; Lee, Hae-Yong; Lee, Yun-Seob

    2017-01-01

    [Purpose] The present study investigated effects of diaphragm breathing exercise and feedback breathing exercise on respiratory function. [Subjects and Methods] Thirty-one subjects were randomly assigned to two groups; the feedback breathing exercise group and the maneuver-diaphragm exercise group. The feedback breathing exercise group was asked to breathe with feedback breathing device, and the maneuver-diaphragm exercise group was asked to perform diaphragm respiration. Respiratory function...

  18. Feedback og interpersonel kommunikation

    DEFF Research Database (Denmark)

    Dindler, Camilla

    2016-01-01

    Som interpersonel kommunikationsform handler feedback om at observere, mærke og italesætte det, som handler om relationen mellem samtaleparterne mere end om samtaleemnet. Her er fokus på, hvad der siges og hvordan der kommunikeres sammen. Feedback er her ikke en korrigerende tilbagemelding til...

  19. "Feedback" For Instructioal Television.

    Science.gov (United States)

    Schramm, Wilbur

    A number of different methods have been used by instructional television (ITV) projects to obtain audience feedback, and some of these are now being used in the ITV system in El Salvador. We know that pretesting programs on a representative sample can bring considerable gains in learning. Another feedback source can be a classroom of pupils in the…

  20. The appearence of the resolved singular hypersurface {x_0}{x_1}-{{x_2}^n} =0 in the classical phase space of the Lie group SU(n)

    CERN Document Server

    Paul, S K; Paul, Samir K.; Sen, Siddhartha

    2002-01-01

    A classical phase space with a suitable symplectic structure is constructed together with functions which have Poisson brackets algebraically identical to the Lie algebra structure of the Lie group SU(n). In this phase space we show that the orbit of the generators corresponding to the simple roots of the Lie algebra give rise to fibres that are complex lines containing spheres. There are n-1 spheres on a fibre and they intersect in exactly the same way as the Cartan matrix of the Lie algebra. This classical phase space bundle,being compact,has a description as a variety.Our construction shows that the variety containing the intersecting spheres is exactly the one obtained by resolving the singularities of the variety {x_0}{x_1}-{{x_2}^n}=0 in {C^3}. A direct connection between this singular variety and the classical phase space corresponding to the Lie group SU(n) is thus established.

  1. Feedback i matematik

    DEFF Research Database (Denmark)

    Sortkær, Bent

    2017-01-01

    Feedback bliver i litteraturen igen og igen fremhævet som et af de mest effektive midler til at fremme elevers præstationer i skolen (Hartberg, Dobson, & Gran, 2012; Hattie & Timperley, 2007; Wiliam, 2015). Dette på trods af, at flere forskere påpeger, at feedback ikke altid er læringsfremmende...... (Hattie & Gan, 2011), og nogle endda viser, at feedback kan have en negativ virkning i forhold til præstationer (Kluger & DeNisi, 1996). Artiklen vil undersøge disse tilsyneladende modstridende resultater ved at stille spørgsmålet: Under hvilke forudsætninger virker feedback i matematik læringsfremmende......? Dette gøres ved at dykke ned i forskningslitteraturen omhandlende feedback ud fra en række temaer for på den måde at besvare ovenstående spørgsmål....

  2. Feedback and Incentives:

    DEFF Research Database (Denmark)

    Eriksson, Tor Viking; Poulsen, Anders; Villeval, Marie-Claire

    This paper experimentally investigates the impact of different pay and relative performance information policies on employee effort. We explore three information policies: No feedback about relative performance, feedback given halfway through the production period, and continuously updated feedback....... The pay schemes are a piece rate payment scheme and a winner-takes-all tournament. We find that, regardless of the pay scheme used, feedback does not improve performance. There are no significant peer effects in the piece-rate pay scheme. In contrast, in the tournament scheme we find some evidence...... of positive peer effects since the underdogs almost never quit the competition even when lagging significantly behind, and frontrunners do not slack off. Moreover, in both pay schemes information feedback reduces the quality of the low performers' work....

  3. Situated Formative Feedback

    DEFF Research Database (Denmark)

    Lukassen, Niels Bech; Wahl, Christian; Sorensen, Elsebeth Korsgaard

    2016-01-01

    feedback episode (FFE) through an online dialogue. The paper argues that dialogue is crucial for student learning and that feedback is not only something the teacher gives to the student. Viewing good quality feedback as social, situated, formative, emphasis is put on the establishment of dialogue. We...... refer to this type of feedback as, Situated Formative Feedback (SFF). As a basis for exploring, identifying and discussing relevant aspects of SFF the paper analyses qualitative data from a Moodle dialogue. Data are embedded in the qualitative analytic program Nvivo and are analysed with a system...... theoretical textual analysis method. Asynchronous written dialogue from an online master’s course at Aalborg University forms the empirical basis of the study. The findings suggests in general that students play an essential role in SFF and that students and educators are equal in the COP, but holds different...

  4. Trend in coral-algal phase shift in the Mandapam group of islands, Gulf of Mannar Marine Biosphere Reserve, India

    Science.gov (United States)

    Machendiranathan, M.; Senthilnathan, L.; Ranith, R.; Saravanakumar, A.; Thangaradjou, T.; Choudhry, S. B.; Sasamal, S. K.

    2016-12-01

    The present study revealed proliferation of macro-algae modifying coral reef ecosystems in a different manner due to diseases and sedimentations in the Mandapam group of islands in the Gulf of Mannar. Benthic surveys were conducted with major attack of seven coral reefs diseases with high sedimentation rate, nine species of fleshy macro-algae ( Turbinaria ornata, Turbinaria conaides, Caulerpa scalpelliformis, Caulerpa racemosa, Kappaphycus alvarezii, Padina gymnosphora, Sargassum wightii, Ulva reticulata and Calurpa lentillifera) proliferation against major corals life forms (Acropora branching, Acropora digitate, Acropora tabulate, coral massive, coral submassive, coral foliose and coral encrusting). The results confirm that diseased corals most favor to macro-algae growth (15.27%) rather than the sedimentation covered corals (8.24 %). In the degradation of coral life forms, massive corals were more highly damaged (7.05%) than any other forms. Within a short period of time (May to September), coral coverage shrank to 17.4% from 21.9%, macro-algae increased 23.51% and the average sedimentation rate attained 77.52 mg cm-2d-1 with persisting coral reef diseases of 17.59%. The Pearson correlation showed that the coral cover decreased with increasing macro-algae growth, which was statistically significant ( r = -0.774, n = 100, P < 0.0005). The proliferation of the various macro-algae C. scalpellifrmis, T. ornata, C. racemosa, T. conaides, U. reticulata, S. wightii, K. alvarezii, P. gymnosphora and C. lentillifera increased with percentages of 6.0, 5.8, 5.7, 4.9, 4.2, 3.7, 2.7 and 1.9, respectively. If this trend continues, the next generation of new recruit corals will undoubtedly lead to a phase shift in Gulf of Mannar corals.

  5. Trend in Coral-Algal Phase Shift in the Mandapam Group of Islands, Gulf of Mannar Marine Biosphere Reserve, India

    Institute of Scientific and Technical Information of China (English)

    M Machendiranathan; L Senthilnathan; R Ranith; A Saravanakumar; T Thangaradjou; S B Choudhry; S K Sasamal

    2016-01-01

    The present study revealed proliferation of macro-algae modifying coral reef ecosystems in a different manner due to diseases and sedimentations in the Mandapam group of islands in the Gulf of Mannar. Benthic surveys were conducted with major attack of seven coral reefs diseases with high sedimentation rate, nine species of fleshy macro-algae (Turbinaria ornata, Turbinaria conaides, Caulerpa scalpelliformis, Caulerpa racemosa, Kappaphycus alvarezii, Padina gymnosphora, Sargassum wightii, Ulva reticulata andCalurpa lentillifera) proliferation against major corals life forms (Acropora branching, Acropora digitate, Acropora tabulate, coral massive, coral submassive, coral foliose and coral encrusting). The results confirm that diseased corals most favor to macro-algae growth (15.27%) rather than the sedimentation covered corals (8.24 %). In the degradation of coral life forms, massive corals were more highly damaged (7.05%) than any other forms. Within a short period of time (May to September), coral coverage shrank to 17.4% from 21.9%, macro-algae increased 23.51% and the average sedimentation rate attained 77.52mgcm−2d−1 with per-sisting coral reef diseases of 17.59%. The Pearson correlation showed that the coral cover decreased with increasing macro-algae growth, which was statistically significant (r=−0.774,n=100,P<0.0005). The proliferation of the various macro-algaeC. scalpel-lifrmis, T.ornata, C. racemosa,T. conaides,U. reticulata, S. wightii, K. alvarezii,P. gymnosphoraand C. lentillifera increased with percentages of 6.0, 5.8, 5.7, 4.9, 4.2, 3.7, 2.7 and 1.9, respectively. If this trend continues, the next generation of new recruit corals will undoubtedly lead to a phase shift in Gulf of Mannar corals.

  6. Social provocation modulates decision making and feedback processing: Examining the trajectory of development in adolescent participants

    Directory of Open Access Journals (Sweden)

    Hannah L. Pincham

    2015-10-01

    Full Text Available Increasingly, research is turning to the ways in which social context impacts decision making and feedback processing in adolescents. The current study recorded electroencephalography to examine the trajectory of development across adolescence, with a focus on how social context impacts cognition and behaviour. To that end, younger (10–12 years and older (14–16 years adolescents played a modified Taylor Aggression Paradigm against two virtual opponents: a low-provoker and a high-provoker. During the task's decision phase (where participants select punishment for their opponent, we examined two event-related potentials: the N2 and the late positive potential (LPP. During the outcome phase (where participants experience win or loss feedback, we measured the feedback related negativity (FRN. Although N2 amplitudes did not vary with provocation, LPP amplitudes were enhanced under high provocation for the younger group, suggesting that emotional reactivity during the decision phase was heightened for early adolescents. During the outcome phase, the FRN was reduced following win outcomes under high provocation for both groups, suggesting that a highly provocative social opponent may influence the reward response. Collectively, the data argue that social context is an important factor modulating neural responses in adolescent behavioural and brain development.

  7. Theoretical Design of a Depolarized Interferometric Fiber-Optic Gyroscope (IFOG) on SMF-28 Single-Mode Standard Optical Fiber Based on Closed-Loop Sinusoidal Phase Modulation with Serrodyne Feedback Phase Modulation Using Simulation Tools for Tactical and Industrial Grade Applications.

    Science.gov (United States)

    Pérez, Ramón José; Álvarez, Ignacio; Enguita, José María

    2016-04-27

    This article presents, by means of computational simulation tools, a full analysis and design of an Interferometric Fiber-Optic Gyroscope (IFOG) prototype based on a closed-loop configuration with sinusoidal bias phase- modulation. The complete design of the different blocks, optical and electronic, is presented, including some novelties as the sinusoidal bias phase-modulation and the use of an integrator to generate the serrodyne phase-modulation signal. The paper includes detailed calculation of most parameter values, and the plots of the resulting signals obtained from simulation tools. The design is focused in the use of a standard single-mode optical fiber, allowing a cost competitive implementation compared to commercial IFOG, at the expense of reduced sensitivity. The design contains an IFOG model that accomplishes tactical and industrial grade applications (sensitivity ≤ 0.055 °/h). This design presents two important properties: (1) an optical subsystem with advanced conception: depolarization of the optical wave by means of Lyot depolarizers, which allows to use a sensing coil made by standard optical fiber, instead by polarization maintaining fiber, which supposes consequent cost savings and (2) a novel and simple electronic design that incorporates a linear analog integrator with reset in feedback chain, this integrator generating a serrodyne voltage-wave to apply to Phase-Modulator (PM), so that it will be obtained the interferometric phase cancellation. This particular feedback design with sawtooth-wave generated signal for a closed-loop configuration with sinusoidal bias phase modulation has not been reported till now in the scientific literature and supposes a considerable simplification with regard to previous designs based on similar configurations. The sensing coil consists of an 8 cm average diameter spool that contains 300 m of standard single-mode optical-fiber (SMF-28 type) realized by quadrupolar winding. The working wavelength will be

  8. Theoretical Design of a Depolarized Interferometric Fiber-Optic Gyroscope (IFOG) on SMF-28 Single-Mode Standard Optical Fiber Based on Closed-Loop Sinusoidal Phase Modulation with Serrodyne Feedback Phase Modulation Using Simulation Tools for Tactical and Industrial Grade Applications

    Science.gov (United States)

    Pérez, Ramón José; Álvarez, Ignacio; Enguita, José María

    2016-01-01

    This article presents, by means of computational simulation tools, a full analysis and design of an Interferometric Fiber-Optic Gyroscope (IFOG) prototype based on a closed-loop configuration with sinusoidal bias phase- modulation. The complete design of the different blocks, optical and electronic, is presented, including some novelties as the sinusoidal bias phase-modulation and the use of an integrator to generate the serrodyne phase-modulation signal. The paper includes detailed calculation of most parameter values, and the plots of the resulting signals obtained from simulation tools. The design is focused in the use of a standard single-mode optical fiber, allowing a cost competitive implementation compared to commercial IFOG, at the expense of reduced sensitivity. The design contains an IFOG model that accomplishes tactical and industrial grade applications (sensitivity ≤ 0.055 °/h). This design presents two important properties: (1) an optical subsystem with advanced conception: depolarization of the optical wave by means of Lyot depolarizers, which allows to use a sensing coil made by standard optical fiber, instead by polarization maintaining fiber, which supposes consequent cost savings and (2) a novel and simple electronic design that incorporates a linear analog integrator with reset in feedback chain, this integrator generating a serrodyne voltage-wave to apply to Phase-Modulator (PM), so that it will be obtained the interferometric phase cancellation. This particular feedback design with sawtooth-wave generated signal for a closed-loop configuration with sinusoidal bias phase modulation has not been reported till now in the scientific literature and supposes a considerable simplification with regard to previous designs based on similar configurations. The sensing coil consists of an 8 cm average diameter spool that contains 300 m of standard single-mode optical-fiber (SMF-28 type) realized by quadrupolar winding. The working wavelength will be

  9. Theoretical Design of a Depolarized Interferometric Fiber-Optic Gyroscope (IFOG on SMF-28 Single-Mode Standard Optical Fiber Based on Closed-Loop Sinusoidal Phase Modulation with Serrodyne Feedback Phase Modulation Using Simulation Tools for Tactical and Industrial Grade Applications

    Directory of Open Access Journals (Sweden)

    Ramón José Pérez

    2016-04-01

    Full Text Available This article presents, by means of computational simulation tools, a full analysis and design of an Interferometric Fiber-Optic Gyroscope (IFOG prototype based on a closed-loop configuration with sinusoidal bias phase- modulation. The complete design of the different blocks, optical and electronic, is presented, including some novelties as the sinusoidal bias phase-modulation and the use of an integrator to generate the serrodyne phase-modulation signal. The paper includes detailed calculation of most parameter values, and the plots of the resulting signals obtained from simulation tools. The design is focused in the use of a standard single-mode optical fiber, allowing a cost competitive implementation compared to commercial IFOG, at the expense of reduced sensitivity. The design contains an IFOG model that accomplishes tactical and industrial grade applications (sensitivity ≤ 0.055 °/h. This design presents two important properties: (1 an optical subsystem with advanced conception: depolarization of the optical wave by means of Lyot depolarizers, which allows to use a sensing coil made by standard optical fiber, instead by polarization maintaining fiber, which supposes consequent cost savings and (2 a novel and simple electronic design that incorporates a linear analog integrator with reset in feedback chain, this integrator generating a serrodyne voltage-wave to apply to Phase-Modulator (PM, so that it will be obtained the interferometric phase cancellation. This particular feedback design with sawtooth-wave generated signal for a closed-loop configuration with sinusoidal bias phase modulation has not been reported till now in the scientific literature and supposes a considerable simplification with regard to previous designs based on similar configurations. The sensing coil consists of an 8 cm average diameter spool that contains 300 m of standard single-mode optical-fiber (SMF-28 type realized by quadrupolar winding. The working

  10. Feedback valence affects auditory perceptual learning independently of feedback probability

    OpenAIRE

    Amitay, S.; Moore, D. R.; Molloy, K.; Halliday, L. F.

    2015-01-01

    Previous studies have suggested that negative feedback is more effective in driving learning than positive feedback. We investigated the effect on learning of providing varying amounts of negative and positive feedback while listeners attempted to discriminate between three identical tones; an impossible task that nevertheless produces robust learning. Four feedback conditions were compared during training: 90% positive feedback or 10% negative feedback informed the participants that they wer...

  11. AC Windings Groups the Three-Phase Based on the Winding and Research%基于三相交流绕组的布线与研究

    Institute of Scientific and Technical Information of China (English)

    王恒; 张扬; 万玉吉

    2015-01-01

    三相交流绕组是电机设计及电机维修人员必须掌握的技术环节。为了掌握其布线规律,从参数的设计→划分电流的瞬时方向→一相绕组最佳形式的确定→画三相布线图,形象直观地研究了三相交流绕组的形成过程。在画布线图的过程中,只要遵守布线图的四点原则,就能设计出最佳的三相交流绕组。%Three-phase AC windings groups which is technological link is grasped by machine maintenance personnel. In order to grasp the three-phase AC windings groups of winding discipline, from designing parameter,dividing the instantaneous direction of electric current, defining the best formation of one phase and drawing three-phase wiring diagram,it researches vividly the formal process of three-phase AC windings groups.In the process of painting wiring diagram,it can be designed best Three-Phase AC as follow four principles of wiring diagram.

  12. Control Scheme of Decoupled State Feedback Linearization of Single-Phase H-Bridge Cascaded STATCOM%单相H桥级联静止同步补偿器反馈线性化解耦控制

    Institute of Scientific and Technical Information of China (English)

    江道灼; 张振华

    2011-01-01

    单相H桥级联静止同步补偿器(static synchronous compemator,STATCOM)n7以快速补偿电力机车这种单相整流的波动性负荷所需的无功,但静止同步补偿器是一个强耦合、非线性系统,为对有功和无功进行解耦,引入反馈线性化方法,通过坐标变化和状态反馈,获得精确线性化模型,并使有功、无功完全解耦,设计完成闭环控制器。为保持H桥直流侧电容电压均衡,采用电压外环和独立均压控制相结合的方法,使电容电压维持在设定值。同时,采用载波相移正弦脉宽调制策略(carrier phase-shifted sinusoidal pulsewidth modulation,CPS—SPWM),在较低的器件开关频率下实现较高等效开关频率。数值仿真结果表明,本文采用控制策略正确有效,系统有功和无功功率可独立调节,动态性能良好,电容电压能稳定在设定值。%Electric locomotive is a kind of single-phase rectified and fluctuating load, and single-phase H-bridge cascaded static synchronous compensator (STATCOM), which is a strongly coupled nonlinear system, can be applied to electrical railway system to compensate reactive power. To decouple active and reactive power, through leading in feedback linearization method and by means of coordinate transformation and state feedback, active and reactive power are completely decoupled and an precise linearization model is attianed, and a closed-loop controller is developed. To keep capacitance voltage balancing at DC side of H-bridge, the outer voltage loop is combined with individual balancing control to make capacitance voltage keeping its set value. Meanwhile, adopting the strategy of carrier phase-shifted sinusoidal pulse-width modulation (CPS-SPWM), a higher equivalent switching frequency is implememted under lower device switching frequency. Numerical simulation results show that the proposed control strategy is correct and effect; active and reactive

  13. Feedback som tredjeordensiagttagelse

    Directory of Open Access Journals (Sweden)

    Ane Qvortrup

    2013-09-01

    Full Text Available Feedback tilskrives stor betydning for læring, men trods intensiv forskning på området synes det svært at fange, hvori feedbacks særlige potentiale består. I forsøgene på at gøre dette knyttes an til en række faktorer eller parametre, der fremhæves som centrale. En af disse faktorer er tid, hvor der kredses om forskellen mellem umiddelbar og forsinket feedback samt om fordele og ulemper ved hver af de to. I denne artikel knyttes der an til en forståelse af feedback som tredjeordensiagttagelse, og der sættes herfra fokus på, hvordan man i en praktisk undervisningssituation kan imødekomme tidsfaktoren knyttet til feedback. Med udgangspunkt i et undervisningsforløb på bachelorniveau, hvor der er arbejdet systematisk med feedback understøttet af Wikis, belyses det, hvordan et sådant arbejde synes at have potentiale for understøttelse af såvel læring som undervisning. En sådan teoretisk reflekteret belysning kan udgøre et refleksionsprogram for fremtidig planlægning af og løbende refleksion over undervisning.     The article investigates the effect of feedback on learning. Feedback has been shown to be one of the most powerful influences on achievement in education. But, in spite of much research on the matter, there is no agreement on how the special potential of feedback can be described, and consequently no agreement on what is good and bad feedback. This article sets out to rectify this omission by seeking a new theoretical framework that is sensitive to the complexity of the impact of feedback. The author propose a system theoretical frame and through its use identifies significant didactical issues. Although feedback is described as an internal, system-relative construction, when seen through a system theoretical lens different teaching environments create diverse conditions for feedback constructions. The final section of the paper explores this idea in relation to wikis.

  14. Feedback som tredjeordensiagttagelse

    Directory of Open Access Journals (Sweden)

    Ane Qvortrup

    2013-09-01

    Full Text Available Feedback tilskrives stor betydning for læring, men trods intensiv forskning på området synes det svært at fange, hvori feedbacks særlige potentiale består. I forsøgene på at gøre dette knyttes an til en række faktorer eller parametre, der fremhæves som centrale. En af disse faktorer er tid, hvor der kredses om forskellen mellem umiddelbar og forsinket feedback samt om fordele og ulemper ved hver af de to. I denne artikel knyttes der an til en forståelse af feedback som tredjeordensiagttagelse, og der sættes herfra fokus på, hvordan man i en praktisk undervisningssituation kan imødekomme tidsfaktoren knyttet til feedback. Med udgangspunkt i et undervisningsforløb på bachelorniveau, hvor der er arbejdet systematisk med feedback understøttet af Wikis, belyses det, hvordan et sådant arbejde synes at have potentiale for understøttelse af såvel læring som undervisning. En sådan teoretisk reflekteret belysning kan udgøre et refleksionsprogram for fremtidig planlægning af og løbende refleksion over undervisning.  The article investigates the effect of feedback on learning. Feedback has been shown to be one of the most powerful influences on achievement in education. But, in spite of much research on the matter, there is no agreement on how the special potential of feedback can be described, and consequently no agreement on what is good and bad feedback. This article sets out to rectify this omission by seeking a new theoretical framework that is sensitive to the complexity of the impact of feedback. The author propose a system theoretical frame and through its use identifies significant didactical issues. Although feedback is described as an internal, system-relative construction, when seen through a system theoretical lens different teaching environments create diverse conditions for feedback constructions. The final section of the paper explores this idea in relation to wikis.

  15. Strategies for effective feedback.

    Science.gov (United States)

    Kritek, Patricia A

    2015-04-01

    Provision of regular feedback to trainees on clinical performance by supervising providers is increasingly recognized as an essential component of undergraduate and graduate health sciences education; however, many individuals have not been formally trained in this pedagogical skill. At the bedside or in the clinic, effective performance feedback can be accomplished by following four key steps. Begin by setting expectations that incorporate the trainee's personal goals and external objectives. Delineate how and when you will provide feedback to the learner. Next, directly observe the trainee's performance. This can be challenging while engaged on a busy clinical service, but a focus on discrete activities or interactions (e.g., family meeting, intravascular volume assessment using bedside ultrasound, or obtaining informed consent) is helpful. The third step is to plan and prioritize the feedback session. Feedback is most effective when given in a timely fashion and delivered in a safe environment. Limit the issues addressed because learners often disengage if confronted with too many deficiencies. Finally, when delivering feedback, begin by listening to the trainee's self-evaluation and then take a balanced approach. Describe in detail what the trainee does well and discuss opportunities for improvement with emphasis on specific, modifiable behaviors. The feedback loop is completed with a plan for follow-up reassessment. Through the use of these relatively simple practices, both the trainee and teacher can have a more productive learning experience.

  16. Rheotaxis performance increases with group size in a coupled phase model with sensory noise. The effects of noise and group size on rheotaxis

    Science.gov (United States)

    Chicoli, A.; Bak-Coleman, J.; Coombs, S.; Paley, D. A.

    2015-12-01

    Many fish exhibit rheotaxis, a behavior in which fish orient themselves relative to flow. Rheotaxis confers many benefits, including energetic cost savings and interception of drifting prey. Despite the fact that most species of fish school during at least some portion of their life, little is known about the importance of rheotactic behavior to schooling fish and, conversely, how the presence of nearby conspecifics affects rheotactic behavior. Understanding how rheotaxis is modified by social factors is thus of ecological importance. Here we present a mathematical model in the form of an all-to-all, coupled-oscillator framework over the non-Euclidean space of fish orientations to model group rheotactic behavior. Individuals in the model measure the orientation of their neighbors and the flow direction relative to their own orientation. These measures are corrupted by sensory noise. We study the effect of sensory noise and group size on internal (i.e., within the school) and external (i.e., with the flow) disagreement in orientation. We find that under noisy environmental conditions, increased group size improves rheotaxis. Results of this study have implications for understanding animal behavior, as well as for potential applications in bio-inspired engineering.

  17. Language Trajectory through Corrective Feedback

    Directory of Open Access Journals (Sweden)

    S. Saber Alavi

    2016-08-01

    Full Text Available This quasi-experimental study was designed to investigate the effects of corrective feedback on SLA/EFL to determine the potential benefits of two different corrective feedback techniques, namely recasts and elicitation. The research hypotheses were: 1 Learners who are exposed to interactive focused task that requires CR will benefit more than those who are exposed to communicative activities only; 2 Elicitation will be more effective than recasts in leading to L2 development; Three intensive EFL classes in a language center in Songkhla province, Thailand were selected to participate in the study. Based on the study design, two class were assigned to the treatment conditions elicitation group and recasts group and the third was used as a control group. The treatment took place over a period of 9 meetings focusing on teaching third person singular –s morpheme and the provision of CF where it was necessary. The participants' knowledge of the intended syntantic point was tested before treatment and post tested after receiving the treatment. A multiple choice and focused-cloze reading grammar test was used in the pre-test and the post-test to evaluate the effects of the treatments on the learners' acquisition of third person singular morpheme. This classroom-based study showed that the two treatment groups benefited from CF strategies, but according to the study, elicitation group outperformed the recast one.

  18. Feedback og motivation

    DEFF Research Database (Denmark)

    Bjerresgaard, Helle

    2016-01-01

    Feedback til elever, som enten er gået midlertidigt i stå eller i værste tilfælde oplever sig selv magtesløse, skal hjælpe dem til at etablere en tro på, at de kan øve indflydelse på og være betydningsfulde for deres omgivelser. Feedback sættes ofte i forbindelse med ’læring’. I denne artikel...... påvirket af en målrettet, individuel feedback – eller manglen på samme....

  19. Phase equilibria modelling and zircon dating for Precambrian metapelites from Xinghuadukou Group in Lvlin Forest of Erguna Massif, NE China

    Science.gov (United States)

    Xu, Jiulei; Zheng, Changqing; Tajcmanova, Lucie; Zhong, Xin; Xu, Xuechun; Han, Xiaomeng; Wang, Zhaoyuan

    2017-04-01

    Xinghuadukou Group, the basement metamorphic complex of Erguna Massif in NE China, is considered to be Mesoproterozoic with Sm-Nd age of 1157±32 Ma. However, the new zircon data from these metamorphic supracrustal rocks in Lvlin Forest show that they formed in Neoproterozoic with the age of 800 Ma. Old zircon age with 2.5 Ga, 2.0 Ga and 1.8 Ga, indicate that the Erguna Massif had an affinity to both Columbia and Rodinia continents. Furthermore, we also present 500 Ma metamorphic age in micashists and 500 Ma age of adjacent granitoids that might have thermally influenced its surrounding. No detailed studies have been undertaken on the metamorphic evolution of the Xinghuadukou Complex. The typical paragneissic mineral assemblage of garnet sillimanite mica schist is Grt+Sil+Bt+Mus+Qtz±Kfs. (Zhou et al., 2011) proposed that the Xinghuadukou Complex appears to have undergone similar granulite facies metamorphic conditions based on the similarity of mineral assemblages to the Mashan Complex in the Jiamusi Massif, NE China. However, the new phase equilibria modelling result shows that these rocks are high amphibolite facies product with 650℃. We can easily find K-feldspar formed by partial melting due to the consuming of muscovite. Also the remaining muscovite is directly connected with a fluid channel in thin sections which indicate that the remaining muscovite formed from retrograde with the existence of fluid. The zoned garnet has low MgO and high CaO content in rims and high MgO and low CaO content in core. It seems that this garnet has high pressure and low temperature (HP-LT) in rims and low pressure and high temperature (LP-HT) in core which would point to an anti-clockwise metamorphic evolution. Zhou, J.B., Wilde, S.A., Zhang, X.Z., Zhao, G.C., Liu, F.L., Qiao, D.W., Ren, S.M. and Liu, J.H., 2011b. A> 1300km late Pan-African metamorphic belt in NE China: new evidence from the Xing'an block and its tectonic implications. Tectonophysics, 509(3): 280-292.

  20. Predicting the start and maximum amplitude of solar cycle 24 using similar phases and a cycle grouping

    Institute of Scientific and Technical Information of China (English)

    Jia-Long Wang; Wei-Guo Zong; Gui-Ming Le; Hai-Juan Zhao; Yun-Qiu Tang; Yang Zhang

    2009-01-01

    We find that the solar cycles 9, 11, and 20 are similar to cycle 23 in their respective descending phases. Using this similarity and the observed data of smoothed monthly mean sunspot numbers (SMSNs) available for the descending phase of cycle 23, we make a date calibration for the average time sequence made of the three descending phases of the three cycles, and predict the start of March or April 2008 for cycle 24. For the three cycles, we also find a linear correlation of the length of the descending phase of a cycle with the difference between the maximum epoch of this cycle and that of its next cycle.Using this relationship along with the known relationship between the rise-time and the maximum amplitude of a slowly rising solar cycle, we predict the maximum SMSN of cycle 24 of 100.2±7.5 to appear during the period from May to October 2012.

  1. The Effect of Giving Feedback to Students' Writing

    Directory of Open Access Journals (Sweden)

    Mochamad Zainuddin

    2004-01-01

    Full Text Available Although writing is as important as other skills such as listening, speaking, and reading, it needs more special attention. In order to write well, students need a long process to learn to write and they need continous feedback. The aim of this article is to know whether giving feedback to students' writing has a significant effect or not. Two groups of students, experimental and control, were involved. The compositions of the first group were given feedback, while those of the second group were not given feedback. The study shows that provision of feedback improves student's writing. In light of the result of the study, it is recommended that teachers provide feedback on students' writing.

  2. Adaptive noncolocated velocity feedback for vibration damping

    Science.gov (United States)

    Bayard, David S.; Spanos, John T.

    1990-01-01

    A method is proposed for adaptive noncolocated velocity feedback control of flexible structure vibrations. The approach, denoted as auto-tuning, is to drive the system into a sequence of controlled oscillations to provide accurate knowledge of the plant characteristics in the vicinity of the phase cross-over frequencies. An allpass phase notch filter cascade is used as the control architecture to phase stabilize each destabilizing mode in the plant transfer function. The allpass phase notch filter cascade is tuned precisely by the information extracted from the controlled oscillations.

  3. Instructor feedback versus no instructor feedback on performance in a laparoscopic virtual reality simulator

    DEFF Research Database (Denmark)

    Strandbygaard, Jeanett; Bjerrum, Flemming; Maagaard, Mathilde

    2013-01-01

    OBJECTIVE:: To investigate the impact of instructor feedback versus no instructor feedback when training a complex operational task on a laparoscopic virtual reality simulator. BACKGROUND:: Simulators are now widely accepted as a training tool, but there is insufficient knowledge about how much...... feedback is necessary, which is useful for sustainable implementation. METHODS:: A randomized trial complying with CONSORT Statement. All participants had to reach a predefined proficiency level for a complex operational task on a virtual reality simulator. The intervention group received standardized...... increases the efficiency when training a complex operational task on a virtual reality simulator; time and repetitions used to achieve a predefined proficiency level were significantly reduced in the group that received instructor feedback compared with the control group. Trial registration number: NCT...

  4. Instructor feedback versus no instructor feedback on performance in a laparoscopic virtual reality simulator

    DEFF Research Database (Denmark)

    Strandbygaard, Jeanett; Bjerrum, Flemming; Maagaard, Mathilde

    2013-01-01

    OBJECTIVE:: To investigate the impact of instructor feedback versus no instructor feedback when training a complex operational task on a laparoscopic virtual reality simulator. BACKGROUND:: Simulators are now widely accepted as a training tool, but there is insufficient knowledge about how much...... feedback is necessary, which is useful for sustainable implementation. METHODS:: A randomized trial complying with CONSORT Statement. All participants had to reach a predefined proficiency level for a complex operational task on a virtual reality simulator. The intervention group received standardized...... increases the efficiency when training a complex operational task on a virtual reality simulator; time and repetitions used to achieve a predefined proficiency level were significantly reduced in the group that received instructor feedback compared with the control group. Trial registration number: NCT...

  5. NAIP 2015 Imagery Feedback

    Data.gov (United States)

    Farm Service Agency, Department of Agriculture — The NAIP 2015 Imagery Feedback web application allows users to make comments and observations about the quality of the 2015 National Agriculture Imagery Program...

  6. NAIP 2014 Imagery Feedback

    Data.gov (United States)

    Farm Service Agency, Department of Agriculture — The NAIP 2014 Imagery Feedback map allows users to make comments and observations about the quality of the 2014 National Agriculture Imagery Program (NAIP)...

  7. Feedback in analog circuits

    CERN Document Server

    Ochoa, Agustin

    2016-01-01

    This book describes a consistent and direct methodology to the analysis and design of analog circuits with particular application to circuits containing feedback. The analysis and design of circuits containing feedback is generally presented by either following a series of examples where each circuit is simplified through the use of insight or experience (someone else’s), or a complete nodal-matrix analysis generating lots of algebra. Neither of these approaches leads to gaining insight into the design process easily. The author develops a systematic approach to circuit analysis, the Driving Point Impedance and Signal Flow Graphs (DPI/SFG) method that does not require a-priori insight to the circuit being considered and results in factored analysis supporting the design function. This approach enables designers to account fully for loading and the bi-directional nature of elements both in the feedback path and in the amplifier itself, properties many times assumed negligible and ignored. Feedback circuits a...

  8. The Value of Feedback in Decentralized Detection

    CERN Document Server

    Tay, Wee Peng

    2011-01-01

    We consider the decentralized binary hypothesis testing problem in networks with feedback, where some or all of the sensors have access to compressed summaries of other sensors' observations. We study certain two-message feedback architectures, in which every sensor sends two messages to a fusion center, with the second message based on full or partial knowledge of the first messages of the other sensors. We also study one-message feedback architectures, in which each sensor sends one message to a fusion center, with a group of sensors having full or partial knowledge of the messages from the sensors not in that group. Under either a Neyman-Pearson or a Bayesian formulation, we show that the asymptotically optimal (in the limit of a large number of sensors) detection performance (as quantified by error exponents) does not benefit from the feedback messages, if the fusion center remembers all sensor messages. However, feedback can improve the Bayesian detection performance in the one-message feedback architect...

  9. The dependence of phase change enthalpy on the pore structure and interfacial groups in hydrated salts/silica composites via sol-gel.

    Science.gov (United States)

    Wu, Yuping; Wang, Tao

    2015-06-15

    It was found that the procedures for incorporating hydrated salts into silica, including mixing with sol in an instant (S1 procedure), mixing with sol via drop by drop (S2 procedure) and mixing until the sol forming the gel (S3 procedure), had pronounced effects on the phase change enthalpy of hydrated salts/silica composite via sol-gel process. The discrepancy of phase change enthalpies of the composites with the same content of hydrated salts can be as high as 40 kJ/kg. To unveil the mechanism behind, the pore structure of silica matrix and interfacial functional groups were investigated extensively. It was revealed that different incorporation procedures resulted in distinct pore structure of silica matrix and different intensities of interfacial Si-OH groups. The S3 procedure was beneficial to induce the silica matrix with bigger pore size and fewer Si-OH groups. Consequently, the phase change enthalpy of the hydrated salts/silica composite prepared by this procedure was the highest because of its lower size confinement effects and weaker adsorption by Si-OH groups. This study will provide insight into the preparation of shape-stabilized phase change materials for thermal energy storage applications. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Evaluation of a Two-Phase Implementation of a Tier-2 (Small Group) Reading Intervention for Young Low-Progress Readers

    Science.gov (United States)

    Buckingham, Jennifer; Wheldall, Kevin; Beaman-Wheldall, Robyn

    2014-01-01

    In a response to intervention (RtI) model, reading is taught in increasingly intensive tiers of instruction. The aim of the study was to examine the efficacy of a Tier-2 (small group) literacy intervention for young struggling readers. This article focuses on the second phase of a randomised control trial involving 14 students in kindergarten as…

  11. Experimental researches of laser phase lock with dual-servo feedbacks based on the piezoelectric transducer and fiber electrooptic phase modulator%基于压电陶瓷与光纤电光调制器双通道伺服反馈的激光相位锁定实验研究∗

    Institute of Scientific and Technical Information of China (English)

    侯佳佳; 尹王保; 肖连团; 贾锁堂; 赵刚; 谭巍; 邱晓东; 贾梦源; 马维光; 张雷; 董磊; 冯晓霞

    2016-01-01

    Fiber laser can be used for fiber optic communications, laser cutting, industrial manufacture, defense security and many other fields because of its advantages of narrow output linewidth, good reproducibility, etc. However, due to nonlinear and thermal effects, only a limited output power of a single fiber can be obtained with a sharp attenuation of the output beam quality, which obstructs the applications of fiber lasers. Therefore, the research of expanding the power of a fiber laser source while maintaining its beam quality by combining coherent beam has become a hot subject at present. In this field, the performance of phase control of coherent laser beams is a key factor to influence the efficiency of combination. The phase-controlling methods mainly include stochastic parallel gradient descent control algorithm, dithering, and heterodyne detection. In this paper, based on the active phase lock technology, the traditional heterodyne detection method is improved by the use of a fiber electro-optic phase modulator (EOM) rather than an acousto-optic frequency shifter (AOFS) to avoid the complex designs of the RF driver and circuit, which makes the overall experimental setup simple and stable. Moreover, in order to achieve a stable and wide correction range of phase locking, two servo paths are designed by use of piezoelectric transducer (PZT) and EOM1 to correct the optical phase differences. Firstly, a single-frequency narrow-width fiber laser with its central wavelength of 1531 nm is split by a beam splitter to generate a signal and a reference beam, respectively. The reference beam is phase modulated by another EOM2 with a 15 MHz signal. The phase error signal is obtained by demodulating the detected heterodyne signal at the modulation frequency. After that the error signal is divided into two parts, and sent to two PID servos to control PZT and EOM1, respectively. The PZT, used in the slow feedback loop, eliminates the laser phase error induced by the ambient

  12. Feedback and rewards, part II: formal and informal feedback reviews.

    Science.gov (United States)

    Harolds, Jay

    2013-02-01

    There are 2 major classes of feedback. One class of feedback consists of the informal, numerous conversations between various people in the organization regarding the performance, behavior, and goals of an individual. Another class of feedback consists of formal reviews held once or twice a year between a supervisor and an individual. This article discusses both types of feedback.

  13. The Effects of Post-Observational Reflective Feedback Modes on Teaching Beliefs: Peer vs. Teacher-Mediated Feedback

    Directory of Open Access Journals (Sweden)

    İlknur Yüksel

    2011-01-01

    Full Text Available The aim of this study was to investigate whether the pre-service teachers’ language teaching beliefs changed as a result of two different post-observational reflective feedback modes; teacher mediated and peer feedback, during their teaching practice. For each post-observational feedback mode, two groups of eight Turkish pre-service language teachers attending to the final year at English Language Teaching Department at Anadolu University, totally 16 pre-service teachers participated in the study. The qualitative and quantitative data was collected at the beginning and end of the different feedback treatments from each group. The results indicated that the feedback modes on pre-service teachers’ teaching practice could influence their beliefs about teaching. Peer feedback had a potential to change the teachers’ beliefs through critical reflection skills that were fostered as a result of collaboration within the peer group.

  14. The response of nonlinear controlled system under an external excitation via time delay state feedback

    Directory of Open Access Journals (Sweden)

    A.M. Elnaggar

    2016-01-01

    Full Text Available An analysis of primary, superharmonic of order five, and subharmonic of order one-three resonances for non-linear s.d.o.f. system with two distinct time-delays under an external excitation is investigated. The method of multiple scales is used to determine two first order ordinary differential equations which describe the modulation of the amplitudes and the phases. Steady-state solutions and their stabilities in each resonance are studied. Numerical results are obtained by using the Software of Mathematica, which presented in a group of figures. The effect of the feedback gains and time-delays on the non-linear response of the system is discussed and it is found that: an appropriate feedback can enhance the control performance. A suitable choice of the feedback gains and time-delays can enlarge the critical force amplitude, and reduce the peak amplitude of the response (or peak amplitude of the free oscillation term for the case of primary resonance (superharmonic resonance. Furthermore, a proper feedback can eliminate saddle-node bifurcation, thereby eliminating jump and hysteresis phenomena taking place in the corresponding uncontrolled system. For subharmonic resonance, an adequate feedback can reduce the regions of subharmonic resonance response.

  15. The challenge of giving written thesis feedback to nursing students.

    Science.gov (United States)

    Tuvesson, Hanna; Borglin, Gunilla

    2014-11-01

    Providing effective written feedback on nursing student's assignments can be a challenging task for any assessor. Additionally, as the student groups tend to become larger, written feedback is likely to gain an overall more prominent position than verbal feedback. Lack of formal training or regular discussion in the teaching faculty about the skill set needed to provide written feedback could negatively affect the students' learning abilities. In this brief paper, we discuss written feedback practices, whilst using the Bachelor of Science in Nursing thesis as an example. Our aim is to highlight the importance of an informed understanding of the impact written feedback can have on students. Creating awareness about this can facilitate the development of more strategic and successful written feedback strategies. We end by offering examples of some relatively simple strategies for improving this practice.

  16. Going Full Circle With Teacher Feedback

    Directory of Open Access Journals (Sweden)

    Jo-Anne L. Manswell Butty

    2015-07-01

    Full Text Available Research on the evaluation of early childhood programs focuses mainly on its outcomes rather than its process with often little attention given to the role that feedback to teachers in pre-kindergarten (pre-k programs plays in the larger cycle of the evaluation process. This article provides a case example of a multiyear evaluation of community-based pre-k programs serving about 360 three- and four-year old children over a 5-year period in the District of Columbia. The Closing the Loop Evaluation Model proposed represents a responsive evaluation approach that illustrates the interconnected interactions between teacher feedback during the evaluation process and two supporting evaluation methodologies that emphasize social justice and utility. Findings from the case example highlight the responsive evaluation approach, feedback process, and ensuing conceptual and instrumental changes that occurred among stakeholders from whole-group feedback to small-group “report card” meetings with add-ons such as technical assistance, teacher-generated action plans, and teacher follow-up and feedback to close the evaluation loop. The authors discuss lessons learned about the evaluation process from the case example around aspects of feedback, including timing, audience, and function. Findings highlight the importance of feedback being timely and prompt, high quality in focus and content, non-punitive, collaborative, concise, and useful. The authors conclude that an evaluation process that includes teacher feedback, couched in social justice and utility, can have positive outcomes for all stakeholders and will likely lead to higher quality early childhood education programs.

  17. Peer feedback content and sender's competence level in academic writing revision tasks : Are they critical for feedback perceptions and efficiency?

    NARCIS (Netherlands)

    Strijbos, Jan-Willem; Narciss, Susanne; Duennebier, Katrin

    2010-01-01

    Peer-feedback content is a core component of peer assessment, but the impact of various contents of feedback is hardly studied. Participants in the study were 89 graduate students who were assigned to four experimental and a control group. Experimental groups received a scenario with concise general

  18. The Effect of Combination of Video Feedback and Audience Feedback on Social Anxiety: Preliminary Findings.

    Science.gov (United States)

    Chen, Junwen; Mak, Rebecca; Fujita, Satoko

    2015-09-01

    Although video feedback (VF) is shown to improve appraisals of social performance in socially anxious individuals, its impact on state anxiety during a social situation is mixed. The current study investigated the effect of combined video feedback and audience feedback (AF) on self-perceptions of performance and bodily sensations as well as state anxiety pertaining to a speech task. Forty-one socially anxious students were randomly allocated to combined video feedback with audience feedback (VF + AF), video feedback only (VF), audience feedback only (AF), or a control condition. Following a 3-min speech, participants in the VF + AF, VF, and AF conditions watched the videotape of their speech with cognitive preparation in the presence of three confederates who served as audience, and/or received feedback from the confederates, while the control group watched their videotaped speech without cognitive preparation. Both VF + AF and AF conditions improved distorted appraisal of performance and bodily sensations as well as state anxiety. The clinical implications of these findings are discussed.

  19. Phase I/II Study of Temozolomide Plus Nimustine Chemotherapy for Recurrent Malignant Gliomas: Kyoto Neuro-oncology Group

    Science.gov (United States)

    AOKI, Tomokazu; ARAKAWA, Yoshiki; UEBA, Tetsuya; ODA, Masashi; NISHIDA, Namiko; AKIYAMA, Yukinori; TSUKAHARA, Tetsuya; IWASAKI, Koichi; MIKUNI, Nobuhiro; MIYAMOTO, Susumu

    2017-01-01

    The objective of this phase I/II study was to examine the efficacy and toxicity profile of temozolomide (TMZ) plus nimustine (ACNU). Patients who had received a standard radiotherapy with one or two previous chemo-regimens were enrolled. In phase I, the maximum-tolerated dose (MTD) by TMZ (150 mg/m2/day) (Day 1–5) plus various doses of ACNU (30, 35, 40, 45 mg/m2/day) (Day 15) per 4 weeks was defined on a standard 3 + 3 design. In phase II, these therapeutic activity and safety of this regimen were evaluated. Forty-nine eligible patients were enrolled. The median age was 50 years-old. Eighty percent had a KPS of 70–100. Histologies were glioblastoma (73%), anaplastic astrocytoma (22%), anaplastic oligodendroglioma (4%). In phase I, 15 patients were treated at four cohorts by TMZ plus ACNU. MTD was TMZ (150 mg/m2) plus ACNU (40 mg/m2). In phase II, 40 patients were treated at the dose of cohort 3 (MTD). Thirty-five percent of patients experienced grade 3 or 4 toxicities, mainly hematologic. The overall response rate was 11% (4/37). Sixty-eight percent (25/37) had stable disease. Twenty-two percent (8/37) showed progression. Progression-free survival (PFS) rates at 6 and 12 months were 24% (95% CI, 12–35%) and 8% (95% CI, 4–15%). Median PFS was 13 months (95% CI, 9.2–17.2 months). Overall survival (OS) at 6 and 12 were 78% (95% CI, 67–89%) and 49% (95% CI, 33–57%). Median OS was 11.8 months (95% CI, 8.2–14.5 months). This phase I/II study showed a moderate toxicity in hematology and may has a promising efficacy in OS, without inferiority in PFS. PMID:27725524

  20. A Phase 1 Trial of Imetelstat in Children with Refractory or Recurrent Solid Tumors: A Children’s Oncology Group Phase 1 Consortium Study (ADVL1112)

    Science.gov (United States)

    Thompson, Patrick A.; Drissi, Rachid; Muscal, Jodi A.; Panditharatna, Eshini; Fouladi, Maryam; Ingle, Ashish M.; Ahern, Charlotte H.; Reid, Joel M.; Lin, Tong; Weigel, Brenda J.; Blaney, Susan M.

    2014-01-01

    Purpose Imetelstat is a covalently-lipidated 13-mer thiophosphoramidate oligonucleotide that acts as a potent specific inhibitor of telomerase. It binds with high affinity to the template region of the RNA component of human telomerase (hTERC ) and is a competitive inhibitor of telomerase enzymatic activity. The purpose of this study was to determine the recommended phase 2 dose of imetelstat in children with recurrent or refractory solid tumors. Experimental Design Imetelstat was administered intravenously over two hours on days 1 and 8, every 21 days. Dose levels of 225, 285, and 360 mg/m2 were evaluated, using the rolling-six design. Imetelstat pharmacokinetic and correlative biology studies were also performed during the first cycle. Results Twenty subjects were enrolled (median age 14 yrs; range 3–21). Seventeen were evaluable for toxicity. The most common toxicities were neutropenia, thrombocytopenia, and lymphopenia, with dose-limiting myelosuppression in two of six patients at 360 mg/m2. Pharmacokinetics were dose dependent with a lower clearance at the highest dose level. Telomerase inhibition was observed in peripheral blood mononuclear cells at 285 and 360 mg/m2. Two confirmed partial responses osteosarcoma (n=1) and Ewing sarcoma (n=1) were observed. Conclusions The recommended phase 2 dose of imetelstat given on days 1 and 8 of 21-day cycle is 285 mg/m2. PMID:24097866

  1. Nonlinear phase shifts of modulated light waves with slow and superluminal group delay in stimulated Brillouin scattering.

    Science.gov (United States)

    Arditi, Tal; Granot, Er'el; Sternklar, Shmuel

    2007-09-15

    Brillouin amplification with counterpropagating modulated pump and Stokes light leads to nonlinear modulation-phase shifts of the interacting intensity waves. This is due to a partial transformation of the nonmodulated light component at the input into modulated light at the output as a result of a mixing process with the counterpropagating modulated component of the pump and results in an advance or delay of the input modulation. This occurs for interactions over less than half of a modulation wavelength. Milliwatts of power in a kilometer of standard single-mode fiber give significant tunability of the modulation phase.

  2. Effects of a novel walking training program with postural correction and visual feedback on walking function in patients with post-stroke hemiparesis.

    Science.gov (United States)

    Won, Sang Hee; Kim, Jae Cheol; Oh, Duck-Won

    2015-08-01

    [Purpose] This study aimed to elucidate the effects of a novel walking training program with postural correction and visual feedback on walking function in patients with post-stroke hemiparesis. [Subjects] Sixteen subjects were randomly allocated to either the experimental group (EG) or the control group (CG), with eight subjects in each. [Methods] EG and CG subjects performed a 30-min treadmill walking training exercise twice daily for 2 weeks. EG subjects also underwent postural correction using elastic bands and received visual feedback during walking. The 10-m walk test was performed, and gait parameters were measured using a gait analysis system. [Results] All parameters showed significant main effects for the group factor and time-by-group interactions. Significant main effects for the time factor were found in the stride length and stance phase ratios. [Conclusion] The novel walking training program with postural correction and visual feedback may improve walking function in patients with post-stroke hemiparesis.

  3. Feedback and rewards, Part I: Introduction to effective feedback.

    Science.gov (United States)

    Harolds, Jay A

    2013-01-01

    This series of articles discusses conversations regarding feedback. Feedback can include input from numerous sources, including one's supervisor, peers, subordinates, suppliers, customers, patients, and/or society members. Effective feedback is very important to the operation of any organization and to the growth of the individual. However, feedback done poorly does not appear to be rare and can be highly destructive to all. A variety of tips on how to do feedback well are included in this article.

  4. A JASTRO study group report. A randomized phase III trial of hyperthermia in combination with radiotherapy for superficial tumors

    Energy Technology Data Exchange (ETDEWEB)

    Hiraoka, Masahiro; Nishimura, Yasumasa; Mitsumori, Michihide [Kyoto Univ. (Japan). Faculty of Medicine] [and others

    1998-06-01

    Result of study about local effect of hyperthermia in combination with radiotherapy for superficial tumors was reported. The irradiation was more than 90% isodose for lesion, and total dose was 60 Gy in cases with anamnesis and 40-50 Gy and without anamnesis at a rate of five times a week and 2 Gy at one time. Hyperthermia was carried out four times; once a week, at 42.5 degrees on tumor side edge, and for 40 minutes. Total 53 cases (neck lymph node metastasis 30 cases, relapse breast cancer 11, advanced breast cancer 1, other superficial tumor 11) were divided into 2 groups. Radiotherapy without hyperthermia (group R) was 27 cases, radiotherapy with hyperthermia (group H) was 26 cases. CR and CR+PR within 2 months after treatment were as follows: Group R: 50%, 85%, Group H: 64%, 100%. The CR+PR was superior in group H (p=0.0497). The CR at maximum effect after treatment was 65% of group R and 86% of group H (p=0.17). The local control rate after CR was not different in both groups. (K.H.)

  5. A study on the students feedback on the foundation course in first year MBBS curriculum

    Directory of Open Access Journals (Sweden)

    Srimathi T

    2014-07-01

    Full Text Available Aim of the Study: To study the students feedback on the short orientation course in first year MBBS curriculum, which was introduced in the institution as per the recommendations of Medical Council of India for the Foundation course. Methodology: 250 First year MBBS students were divided into 7 small groups of 35 to 36 each. They attended a short orientation course over a period of 8 days on a rotation basis. The skills taught include Stress and Time Management, language, communication, use of information technology, National health policies, Biohazard safety, Introduction to the preclinical subjects, Medical literature search, First Aid and Basic life support, Medical ethics and professionalism. The results were analyzed on the 8th day by student’s feedback and debate sessions. Results: Positive feedback of 88.5 to 98.5% was recorded regarding the objectives of the course, contents, presentation, future value of the course in the student’s career by a Questionnaire issued to the students. Remedial measures undertaken for negative Feedback. The course enabled self directed learning of the subjects. Conclusion: The Foundation Course at the beginning of the First phase of the course enables the First year students to acquire the basic knowledge and skills required for all the subsequent phases in MBBS course and later on their medical practice and career.

  6. Feedback: Now with Physics

    Science.gov (United States)

    Hopkins, Philip F.; Quataert, Eliot; Faucher-Giguere, Claude-Andre; Keres, Dusan; Wetzel, Andrew R.; Murray, Norman W.

    2017-01-01

    The most fundamental unsolved problems in galaxy formation revolve around "feedback" from massive stars and black holes. In the last few years, a new generation of theoretical models have emerged which combine new numerical methods and physics in an attempt to realistically model the diverse physics of the interstellar medium, star formation, and feedback from super-massive black holes and massive stars (winds, jets, SNe, and radiation). These mechanisms lead to 'self-regulated' galaxy and star formation, in which global correlations such as the Schmidt-Kennicutt law, the inefficiency of star formation, and the stellar mass function -- emerge naturally. Within galaxies, feedback regulates the structure of the interstellar medium, and many observed properties of the ISM, star formation, and galaxies can be understood as a fundamental consequence of super-sonic turbulence in a rapidly cooling, self-gravitating medium. But feedback also produces galactic super-winds that can dramatically alter the cosmological evolution of galaxies, change the nature of dark matter cores and ‘cusps’, and re-structure the circum-galactic and inter-galactic medium. These winds depend non-linearly on multiple feedback mechanisms in a way that explains why they have been so difficult to model in previous "sub-grid" approaches. This resolves long-standing problems in understanding even apparently "simple" galaxy properties like the mass-metallicity relation. Finally, I'll discuss where feedback fails, and where either additional, exotic physics, or new, previously-dismissed feedback mechanisms, may be needed to explain observations.

  7. Distributed Feedback Effects in Active Semiconductor Photonic Crystal Waveguides

    DEFF Research Database (Denmark)

    Chen, Yaohui; Mørk, Jesper

    2012-01-01

    We present a rigorous coupled-wave analysis of slow-light effects in active photonic crystal waveguides. The presence of active material leads to coherent distributed feedback effects that significantly alter the magnitude and phase of output fields.......We present a rigorous coupled-wave analysis of slow-light effects in active photonic crystal waveguides. The presence of active material leads to coherent distributed feedback effects that significantly alter the magnitude and phase of output fields....

  8. Comparison of three development approaches for Stationary Phase Optimised Selectivity Liquid Chromatography based screening methods Part II: A group of structural analogues (PDE-5 inhibitors in food supplements).

    Science.gov (United States)

    Deconinck, E; Ghijs, L; Kamugisha, A; Courselle, P

    2016-02-01

    Three approaches for the development of a screening method to detect adulterated dietary supplements, based on Stationary Phase Optimised Selectivity Liquid Chromatography were compared for their easiness/speed of development and the performance of the optimal method obtained. This comparison was performed for a heterogeneous group of molecules, i.e. slimming agents (Part I) and a group of structural analogues, i.e. PDE-5 inhibitors (Part II). The first approach makes use of primary runs at one isocratic level, the second of primary runs in gradient mode and the third of primary runs at three isocratic levels to calculate the optimal combination of segments of stationary phases. In each approach the selection of the stationary phase was followed by a gradient optimisation. For the PDE-5 inhibitors, the group of structural analogues, only the method obtained with the third approach was able to differentiate between all the molecules in the development set. Although not all molecules are baseline separated, the method allows the identification of the selected adulterants in dietary supplements using only diode array detection. Though, due to the mobile phases used, the method could also be coupled to mass spectrometry. The method was validated for its selectivity following the guidelines as described for the screening of pesticide residues and residues of veterinary medicines in food.

  9. Phases and Changes: Using I Ching as a Source of Generative Metaphors in Teaching Small Group Discussion.

    Science.gov (United States)

    Holt, G. Richard; Chang, Hui-Ching

    1992-01-01

    This essay describes the use of I Ching hexagrams as a focus to improve the ability of college student groups to evolve creative solutions and improve decision-making skills. The philosophy of I Ching is briefly explained, and examples are given of hexagram interpretations which are applicable to group discussion and problem solving. (DB)

  10. developing skills of giving and receiving feedbacks between ...

    African Journals Online (AJOL)

    User

    One of the strategies to improve quality of teaching and learning at training institutes could be by developing the skill of giving and receiving feedbacks among the individuals involved in the training .... the two groups; one group of students and.

  11. Feedback control of quantum system

    Institute of Scientific and Technical Information of China (English)

    DONG Dao-yi; CHEN Zong-hai; ZHANG Chen-bin; CHEN Chun-lin

    2006-01-01

    Feedback is a significant strategy for the control of quantum system.Information acquisition is the greatest difficulty in quantum feedback applications.After discussing several basic methods for information acquisition,we review three kinds of quantum feedback control strategies:quantum feedback control with measurement,coherent quantum feedback,and quantum feedback control based on cloning and recognition.The first feedback strategy can effectively acquire information,but it destroys the coherence in feedback loop.On the contrary,coherent quantum feedback does not destroy the coherence,but the capability of information acquisition is limited.However,the third feedback scheme gives a compromise between information acquisition and measurement disturbance.

  12. Chemically modified polymeric resins for solid-phase extraction and group separation prior to analysis by liquid or gas chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, L.W.

    1993-07-01

    Polystyrene divinylbenzene was modified by acetyl, sulfonic acid, and quaternary ammonium groups. A resin functionalized with an acetyl group was impregnated in a PTFE membrane and used to extract and concentrate phenolic compounds from aqueous samples. The acetyl group created a surface easily wetted, making it an efficient adsorbent for polar compounds in water. The membrane stabilized the resin bed. Partially sulfonated high surface area resins are used to extract and group separate an aqueous mixture of neutral and basic organics; the bases are adsorbed electrostatically to the sulfonic acid groups, while the neutraons are adsorbed hydrophobically. A two-step elution is then used to separate the two fractions. A partially functionalized anion exchange resin is used to separate organic acids and phenols from neutrals in a similar way. Carboxylic acids are analyzed by HPLC and phenols by GC.

  13. Strategies in probabilistic feedback learning in Parkinson patients OFF medication.

    Science.gov (United States)

    Bellebaum, C; Kobza, S; Ferrea, S; Schnitzler, A; Pollok, B; Südmeyer, M

    2016-04-21

    Studies on classification learning suggested that altered dopamine function in Parkinson's Disease (PD) specifically affects learning from feedback. In patients OFF medication, enhanced learning from negative feedback has been described. This learning bias was not seen in observational learning from feedback, indicating different neural mechanisms for this type of learning. The present study aimed to compare the acquisition of stimulus-response-outcome associations in PD patients OFF medication and healthy control subjects in active and observational learning. 16 PD patients OFF medication and 16 controls were examined with three parallel learning tasks each, two feedback-based (active and observational) and one non-feedback-based paired associates task. No acquisition deficit was seen in the patients for any of the tasks. More detailed analyses on the learning strategies did, however, reveal that the patients showed more lose-shift responses during active feedback learning than controls, and that lose-shift and win-stay responses more strongly determined performance accuracy in patients than controls. For observational feedback learning, the performance of both groups correlated similarly with the performance in non-feedback-based paired associates learning and with the accuracy of observed performance. Also, patients and controls showed comparable evidence of feedback processing in observational learning. In active feedback learning, PD patients use alternative learning strategies than healthy controls. Analyses on observational learning did not yield differences between patients and controls, adding to recent evidence of a differential role of the human striatum in active and observational learning from feedback.

  14. Learning without knowing: subliminal visual feedback facilitates ballistic motor learning

    DEFF Research Database (Denmark)

    Lundbye-Jensen, Jesper; Leukel, Christian; Nielsen, Jens Bo

    by subconscious (subliminal) augmented visual feedback on motor performance. To test this, 45 subjects participated in the experiment, which involved learning of a ballistic task. The task was to execute simple ankle plantar flexion movements as quickly as possible within 200 ms and to continuously improve...... ballistic rate of force development (RFD) throughout a series of 40 trials. Following each trial subjects were provided visual augmented feedback on their performance in the form of dots presented on a monitor. The y-axis amplitude of the dots represented the obtained RFD. Participants were individually...... received supraliminal as compared to subliminal feedback. In the 0 ms feedback group motor performance increased only slightly indicating an important role of augmented feedback in learning the ballistic task. In the two groups who received subliminal feedback none of the subjects were able to tell what...

  15. Comparing the effects of positive and negative feedback in information-integration category learning.

    Science.gov (United States)

    Freedberg, Michael; Glass, Brian; Filoteo, J Vincent; Hazeltine, Eliot; Maddox, W Todd

    2017-01-01

    Categorical learning is dependent on feedback. Here, we compare how positive and negative feedback affect information-integration (II) category learning. Ashby and O'Brien (2007) demonstrated that both positive and negative feedback are required to solve II category problems when feedback was not guaranteed on each trial, and reported no differences between positive-only and negative-only feedback in terms of their effectiveness. We followed up on these findings and conducted 3 experiments in which participants completed 2,400 II categorization trials across three days under 1 of 3 conditions: positive feedback only (PFB), negative feedback only (NFB), or both types of feedback (CP; control partial). An adaptive algorithm controlled the amount of feedback given to each group so that feedback was nearly equated. Using different feedback control procedures, Experiments 1 and 2 demonstrated that participants in the NFB and CP group were able to engage II learning strategies, whereas the PFB group was not. Additionally, the NFB group was able to achieve significantly higher accuracy than the PFB group by Day 3. Experiment 3 revealed that these differences remained even when we equated the information received on feedback trials. Thus, negative feedback appears significantly more effective for learning II category structures. This suggests that the human implicit learning system may be capable of learning in the absence of positive feedback.

  16. A Superbubble Feedback Model for Galaxy Simulations

    CERN Document Server

    Keller, B W; Benincasa, S M; Couchman, H M P

    2014-01-01

    We present a new stellar feedback model that reproduces superbubbles. Superbubbles from clustered young stars evolve quite differently to individual supernovae and are substantially more efficient at generating gas motions. The essential new components of the model are thermal conduction, sub-grid evaporation and a sub-grid multi-phase treatment for cases where the simulation mass resolution is insufficient to model the early stages of the superbubble. The multi-phase stage is short compared to superbubble lifetimes. Thermal conduction physically regulates the hot gas mass without requiring a free parameter. Accurately following the hot component naturally avoids overcooling. Prior approaches tend to heat too much mass, leaving the hot ISM below $10^6$ K and susceptible to rapid cooling unless ad-hoc fixes were used. The hot phase also allows feedback energy to correctly accumulate from multiple, clustered sources, including stellar winds and supernovae. We employ high-resolution simulations of a single star ...

  17. Global climate feedbacks

    Energy Technology Data Exchange (ETDEWEB)

    Manowitz, B.

    1990-10-01

    The important physical, chemical, and biological events that affect global climate change occur on a mesoscale -- requiring high spatial resolution for their analysis. The Department of Energy has formulated two major initiatives under the US Global Change Program: ARM (Atmospheric Radiation Measurements), and CHAMMP (Computer Hardware Advanced Mathematics and Model Physics). ARM is designed to use ground and air-craft based observations to document profiles of atmospheric composition, clouds, and radiative fluxes. With research and models of important physical processes, ARM will delineate the relationships between trace gases, aerosol and cloud structure, and radiative transfer in the atmosphere, and will improve the parameterization of global circulation models. The present GCMs do not model important feedbacks, including those from clouds, oceans, and land processes. The purpose of this workshop is to identify such potential feedbacks, to evaluate the uncertainties in the feedback processes (and, if possible, to parameterize the feedback processes so that they can be treated in a GCM), and to recommend research programs that will reduce the uncertainties in important feedback processes. Individual reports are processed separately for the data bases.

  18. Alterations in oxidant/antioxidant balance, high-mobility group box 1 protein and acute phase response in cross-bred suckling piglets suffering from rotaviral enteritis.

    Science.gov (United States)

    Kumar De, Ujjwal; Mukherjee, Reena; Nandi, Sukdeb; Patel, Bhimnere Hanumatnagouda Manjunatha; Dimri, Umesh; Ravishankar, Chintu; Verma, Ashok Kumar

    2014-10-01

    Rotaviral enteritis has emerged as a major cause of morbidity and mortality in piglets during their post-natal life. The present study was carried out to examine high-mobility group box 1 (HMGB1) protein, acute phase response and oxidative stress indices in the serum of suckling piglets suffering from enteritis with or without association of porcine group A rotavirus infection. The present investigation utilized 23 clinical cases with signs of acute enteritis and 12 more healthy piglets of a similar age group as control animals. Out of 23 enteritis cases, 12 cases were found to be positive for porcine group A rotavirus infection as confirmed by reverse transcription-polymerase chain reaction (RT-PCR) using specific primers for group A rotavirus, and the rest were found negative. The acute enteritis cases in piglets were associated with an elevated level of HMGB1 protein and serum haptoglobin and ceruloplasmin suggestive of an acute phase response. Among the oxidative stress indices, the concentrations of malondialdehyde (MDA) and nitric oxide (NO) in serum were significantly increased. A pronounced drop of total antioxidant capacity and the activity of antioxidant enzymes such as catalase and superoxide dismutase in the serum of piglets suffering from acute enteritis compared to healthy ones were also noticed. The alterations in HMGB1 protein, acute phase response and oxidative stress indices were more pronounced in cases with the involvement of porcine rotavirus as compared to rotavirus-negative cases. It is concluded that HMGB1 protein, markers of oxidative stress and acute phase proteins might play an important role in the aetiopathogenesis of porcine diarrhoea caused by rotavirus and might be true markers in diagnosing the conditions leading to the extension of the prompt and effective therapeutic care.

  19. Supercritical Phase Equilibria Modeling of Glyceride Mixtures and Carbon Dioxide Using the Group Contribution EoS

    Directory of Open Access Journals (Sweden)

    Tiziana Fornari

    2011-01-01

    Experimental data was obtained in a countercurrent packed extraction column at pressures ranging from 16 to 25 MPa and temperatures from 313 to 368 K. The GC-EoS model was applied in a completely predictive manner to simulate the phase equilibria behavior of the multistage separation process. The chemical analysis of the glyceride mixture allowed a significant simplification of its complex composition and thus, a simple and satisfactory simulation of the supercritical extraction process was achieved.

  20. AGN feedback in elliptical galaxies: numerical simulations

    CERN Document Server

    Ciotti, L

    2011-01-01

    The importance of feedback (radiative and mechanical) from massive black holes at the centers of elliptical galaxies is not in doubt, given the well established relation among black hole mass and galaxy optical luminosity. Here, with the aid of high-resolution hydrodynamical simulations, we discuss how this feedback affects the hot ISM of isolated elliptical galaxies of different mass. The cooling and heating functions include photoionization plus Compton heating, the radiative transport equations are solved, and the mechanical feedback due to the nuclear wind is also described on a physical basis; star formation is considered. In the medium-high mass galaxies the resulting evolution is highly unsteady. At early times major accretion episodes caused by cooling flows in the recycled gas produced by stellar evolution trigger AGN flaring: relaxation instabilities occur so that duty cycles are small enough to account for the very small fraction of massive ellipticals observed to be in the QSO-phase, when the accr...

  1. Selenol Protecting Groups in Organic Chemistry: Special Emphasis on Selenocysteine Se-Protection in Solid Phase Peptide Synthesis

    OpenAIRE

    Stevenson Flemer Jr.

    2011-01-01

    The appearance of selenium in organic synthesis is relatively rare, and thus examples in the literature pertaining to the masking of its considerable reactivity are similarly uncommon. Greene's Protecting Groups in Organic Synthesis, the standard reference for the state of the art in this arena, offers no entries for selenium protective methodology, in stark comparison to its mention of the great variety of protecting groups germane to its chalcogen cousin sulfur. This scarcity of Se-protecti...

  2. Impact of tissue atrophy on high-pass filtered MRI signal phase-based assessment in large-scale group-comparison studies: A simulation study

    Science.gov (United States)

    Schweser, Ferdinand; Dwyer, Michael G.; Deistung, Andreas; Reichenbach, Jürgen R.; Zivadinov, Robert

    2013-10-01

    The assessment of abnormal accumulation of tissue iron in the basal ganglia nuclei and in white matter plaques using the gradient echo magnetic resonance signal phase has become a research focus in many neurodegenerative diseases such as multiple sclerosis or Parkinson’s disease. A common and natural approach is to calculate the mean high-pass-filtered phase of previously delineated brain structures. Unfortunately, the interpretation of such an analysis requires caution: in this paper we demonstrate that regional gray matter atrophy, which is concomitant with many neurodegenerative diseases, may itself directly result in a phase shift seemingly indicative of increased iron concentration even without any real change in the tissue iron concentration. Although this effect is relatively small results of large-scale group comparisons may be driven by anatomical changes rather than by changes of the iron concentration.

  3. Discussion on Connection Group of Three-phase Transformer%浅谈三相变压器的连接组别

    Institute of Scientific and Technical Information of China (English)

    于红

    2013-01-01

    三相变压器的联结组是三相变压器的难点问题之一,通过三相变压器绕组的联结,进一步的说明了三相变压器的联结组及其简单的判定方法---时钟序数表示法,最后对标准联结组进行了详细的说明。%The connection symbol is one of the difficult problems of three-phase transformer, through the connection of the three-phase transformer winding, the paper further illustrates the connection symbol and simple methods---clock ordinal notation of three-phase transformer, finally carries on the detailed instructions for standard connection group.

  4. Climate forcings and feedbacks

    Science.gov (United States)

    Hansen, James

    1993-01-01

    Global temperature has increased significantly during the past century. Understanding the causes of observed global temperature change is impossible in the absence of adequate monitoring of changes in global climate forcings and radiative feedbacks. Climate forcings are changes imposed on the planet's energy balance, such as change of incoming sunlight or a human-induced change of surface properties due to deforestation. Radiative feedbacks are radiative changes induced by climate change, such as alteration of cloud properties or the extent of sea ice. Monitoring of global climate forcings and feedbacks, if sufficiently precise and long-term, can provide a very strong constraint on interpretation of observed temperature change. Such monitoring is essential to eliminate uncertainties about the relative importance of various climate change mechanisms including tropospheric sulfate aerosols from burning of coal and oil smoke from slash and burn agriculture, changes of solar irradiance changes of several greenhouse gases, and many other mechanisms. The considerable variability of observed temperature, together with evidence that a substantial portion of this variability is unforced indicates that observations of climate forcings and feedbacks must be continued for decades. Since the climate system responds to the time integral of the forcing, a further requirement is that the observations be carried out continuously. However, precise observations of forcings and feedbacks will also be able to provide valuable conclusions on shorter time scales. For example, knowledge of the climate forcing by increasing CFC's relative to the forcing by changing ozone is important to policymakers, as is information on the forcing by CO2 relative to the forcing by sulfate aerosols. It will also be possible to obtain valuable tests of climate models on short time scales, if there is precise monitoring of all forcings and feedbacks during and after events such as a large volcanic eruption

  5. Testing AGN feedback models in galaxy evolution

    Science.gov (United States)

    Shin, Min-Su

    Galaxy formation and evolution have been one of the most challenging problems in astrophysics. A single galaxy has various components (stars, atomic and molecular gas, a supermassive black hole, and dark matter) and has interacted with its cosmic environment throughout its history. A key issue in understanding galaxy evolution is to find the dominant physical processes in the interactions between the components of a galaxy and between a galaxy and its environment. AGN feedback has been proposed as a key process to suppress late star formation in massive elliptical galaxies and as a general consequence of galaxy mergers and interactions. In this thesis, I investigate feedback effects from active galactic nuclei (AGN) using a new simulation code and data from the Sloan Digital Sky Survey. In the first chapter, I test purely mechanical AGN feedback models via a nuclear wind around the central SMBH in elliptical galaxies by comparing simulation results to four well-defined observational constraints: the mass ratio between the SMBH and its host galaxy, the lifetime of the quasar phase, the X-ray luminosity from the hot interstellar medium, and the mass fraction of young stars. Even though purely mechanical AGN feedback is commonly assumed in cosmological simulations, I find that it is inadequate, and cannot reproduce all four observational constraints simultaneously. This result suggests that both mechanical and radiative feedback modes are important physical processes. In the second chapter, I simulate the coevolution of the SMBH and its host galaxy under different environments, represented by different amounts of gas stripping. Though the connection between environment and galaxy evolution has been well-studied, environmental effects on the growth of the SMBH have not been answered yet. I find that strong gas stripping, which satellite galaxies might experience, highly suppresses SMBH mass accretion and AGN activity. Moreover, the suppression of the SMBH growth is

  6. Early treatment with intravenous metoprolol for suspected acute myocardial infarction: a phase IV United States trial. Phase IV Metoprolol in Myocardial Infarction Study Group.

    Science.gov (United States)

    Antman, E M; Dupont, W D; Bonalsky, J; Califf, R M; Corwin, S; Fink, L; Hansen, D E; Kawanishi, D T; Kronenberg, M W; McKay, C R

    1989-05-01

    Recent randomized clinical trials have shown that total mortality and cardiovascular mortality are reduced by the early intravenous administration of beta-blockers to patients suspected of suffering from acute myocardial infarction. These trials were conducted on patients meeting strict entry criteria. In order to assess this therapy when applied to a broader range of myocardial infarction patients, we performed a Phase IV study of metoprolol in acute myocardial infarction. The study was designed to test whether early (less than 8 hours from onset of chest pain) intervention by practicing physicians with open label intravenous metoprolol for cases of suspected acute myocardial infarction achieved mortality results similar to those obtained in large randomized clinical trials. We studied 3824 patients treated by 741 physicians representing a broad spectrum of clinical practice in the United States. Seventy-two percent of the patients entered into the study had confirmed myocardial infarction (39% anterior, 39% inferior, 22% other locations) and 85% of all individuals treated tolerated the full intravenous dose of 15 mg of metoprolol. The 15 day total mortality and cardiovascular mortality rates were 4.9% and 4.5%; 90 day mortality rates were 6.9 and 5.9%. Patients with anterior infarctions had a significantly greater cumulative mortality rate than patients with other types of infarctions. Marked bradycardia (heart rate less than 45 beats per minute) in the first 8 hours post treatment occurred in 4.7% cases and hypotension (systolic blood pressure less than 90 mm Hg) occurred in 9.8% of cases. When compared with the results of the Göteborg and MIAMI trials of metoprolol, it appears that there is no appreciable increase in mortality or morbidity when metoprolol is used in the community practice of acute coronary care.

  7. Galaxy Formation and SN Feedback

    CERN Document Server

    Tissera, P B; White, S D M; Springel, V

    2006-01-01

    We present a Supernova (SN) feedback model that succeeds at describing the chemical and energetic effects of SN explosions in galaxy formation simulations. This new SN model has been coupled to GADGET-2 and works within a new multiphase scheme which allows the description of a co-spatial mixture of cold and hot interstellar medium phases. No ad hoc scale-dependent parameters are associated to these SN and multiphase models making them particularly suited to studies of galaxy formation in a cosmological framework. Our SN model succeeds not only in setting a self-regulated star formation activity in galaxies but in triggering collimated chemical-enriched galactic winds. The effects of winds vary with the virial mass of the systems so that the smaller the galaxy, the larger the fraction of swept away gas and the stronger the decrease in its star formation activity. The fact that the fraction of ejected metals exceeds 60 per cent regardless of mass, suggests that SN feedback can be the responsible mechanism of th...

  8. Operable Unit 3-13, Group 3, Other Surface Soils Remediation Sets 4-6 (Phase II) Remedial Design/Remedial Action Work Plan

    Energy Technology Data Exchange (ETDEWEB)

    D. E. Shanklin

    2006-06-01

    This Remedial Design/Remedial Action Work Plan provides the framework for defining the remedial design requirements, preparing the design documentation, and defining the remedial actions for Waste Area Group 3, Operable Unit 3-13, Group 3, Other Surface Soils, Remediation Sets 4-6 (Phase II) located at the Idaho Nuclear Technology and Engineering Center at the Idaho National Laboratory. This plan details the design developed to support the remediation and disposal activities selected in the Final Operable Unit 3-13, Record of Decision.

  9. Efficacy and safety of bilastine in Japanese patients with perennial allergic rhinitis: A multicenter, randomized, double-blind, placebo-controlled, parallel-group phase III study

    OpenAIRE

    Kimihiro Okubo; Minoru Gotoh; Mikiya Asako; Yasuyuki Nomura; Michinori Togawa; Akihiro Saito; Takayuki Honda; Yoshihiro Ohashi

    2017-01-01

    Background: Bilastine, a novel non-sedating second-generation H1 antihistamine, has been approved in most European countries since 2010. This study aimed to evaluate the superiority of bilastine over placebo in Japanese patients with perennial allergic rhinitis (PAR). Methods: This randomized, double-blind, placebo-controlled, parallel-group, phase III study (trial registration number JapicCTI-142600) evaluated the effect of a 2-week treatment period with bilastine (20 mg once daily), fexo...

  10. Gibbs free energy of transfer of a methylene group on {UCON + (sodium or potassium) phosphate salts} aqueous two-phase systems: Hydrophobicity effects

    OpenAIRE

    Silvério, Sara C.; Rodríguez, Oscar; Teixeira, J. A.; Macedo, Eugénia

    2010-01-01

    The Gibbs free energy of transfer of a suitable hydrophobic probe can be regarded as a measure of the relative hydrophobicity of the different phases. The methylene group (CH2) can be considered hydrophobic, and thus be a suitable probe for hydrophobicity. In this work, the partition coefficients of a series of five dinitrophenylated-amino acids were experimentally determined, at 23 °C, in three different tie-lines of the biphasic systems: (UCON + K2HPO4), (UCON + potassium phosph...

  11. Phase diagrams of the corner cubic Heisenberg model and its site-diluted version on a triangular lattice: Renormalization-group treatment

    Science.gov (United States)

    Nagai, Kiyoshi

    1985-02-01

    The global phase diagrams of the corner cubic anisotropic discrete-spin Heisenberg (CH) model and its site-diluted version (dCH) on a triangular lattice are investigated through the position-space renormalization-group method of the simple Migdal-Kadanoff type. The two models include many simpler models as their subspaces, and the interrelations among these models are elucidated. The five-dimensional (5D) phase diagram of the dCH model is generated from the 3D one of the CH model by introducing 2D site-dilution operation. The structure of the 5D phase diagram and the effect of site dilution on the CH model are conveniently visualized by introducing the concept of paths in the 3D subspace. The path describes the temperature variation provided that the ratios between the interaction parameters in the original CH model are fixed. The resulting phase diagrams of the dCH model exhibit the typical three-phase coexistence of solid, liquid, and gas, and their qualitative interpretations are summarized.

  12. Influence of saliva, gastric and intestinal phases on the prediction of As relative bioavailability using the Unified Bioaccessibility Research Group of Europe Method (UBM).

    Science.gov (United States)

    Juhasz, Albert L; Weber, John; Smith, Euan

    2011-12-15

    In this study, As-contaminated soils (n=12) were assessed for As bioaccessibility using the Unified Bioaccessibility Research Group of Europe in vitro method (UBM) incorporating gastric, saliva-gastric or saliva-gastric-intestinal phases. Arsenic bioaccessibility was compared to previous published As relative bioavailability data for these soils to determine the correlation between in vitro and in vivo data. Comparison of in vitro and in vivo data indicated that the correlation between As bioaccessibility (UBM) and As relative bioavailability (swine assay) was similar irrespective of the in vitro phase used for its determination. The UBM incorporating all phases (saliva-gastric-intestinal) provided the best in vivo-in vitro correlation (slope=1.08; R(2)=0.59), however there was no significant difference in the goodness of fit (R(2) ranged from 0.48 to 0.59) or the slope of the lines (0.93-1.08) for either variation of the UBM (P=0.9946). This indicates that there was no improvement in the As relative bioavailability predictive capabilities when the UBM was extended from a single gastric phase to saliva-gastric or saliva-gastric-intestinal phases. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Renormalization-group study of a superconducting phase transition: Asymptotic behavior of higher expansion orders and results of three-loop calculations

    Science.gov (United States)

    Kalagov, G. A.; Kompaniets, M. V.; Nalimov, M. Yu.

    2014-11-01

    We use quantum-field renormalization group methods to study the phase transition in an equilibrium system of nonrelativistic Fermi particles with the "density-density" interaction in the formalism of temperature Green's functions. We especially attend to the case of particles with spins greater than 1/2 or fermionic fields with additional indices for some reason. In the vicinity of the phase transition point, we reduce this model to a ϕ 4 -type theory with a matrix complex skew-symmetric field. We define a family of instantons of this model and investigate the asymptotic behavior of quantum field expansions in this model. We calculate the β-functions of the renormalization group equation through the third order in the ( 4 ∈)-scheme. In the physical space dimensions D = 2, 3, we resum solutions of the renormalization group equation on trajectories of invariant charges. Our results confirm the previously proposed suggestion that in the system under consideration, there is a first-order phase transition into a superconducting state that occurs at a higher temperature than the classical theory predicts.

  14. Phase and group velocity tracing analysis of projected wave packet motion along oblique radar beams – qualitative analysis of QP echoes

    Directory of Open Access Journals (Sweden)

    C. L. Fern

    2007-02-01

    Full Text Available The wave packets of atmospheric gravity waves were numerically generated, with a given characteristic wave period, horizontal wave length and projection mean wind along the horizontal wave vector. Their projection phase and group velocities along the oblique radar beam (vpr and vgr, with different zenith angle θ and azimuth angle φ, were analyzed by the method of phase- and group-velocity tracing. The results were consistent with the theoretical calculations derived by the dispersion relation, reconfirming the accuracy of the method of analysis. The RTI plot of the numerical wave packets were similar to the striation patterns of the QP echoes from the FAI irregularity region. We propose that the striation range rate of the QP echo is equal to the radial phase velocity vpr, and the slope of the energy line across the neighboring striations is equal to the radial group velocity vgr of the wave packet; the horizontal distance between two neighboring striations is equal to the characteristic wave period τ. Then, one can inversely calculate all the properties of the gravity wave responsible for the appearance of the QP echoes. We found that the possibility of some QP echoes being generated by the gravity waves originated from lower altitudes cannot be ruled out.

  15. Proprioceptive feedback and brain computer interface (BCI based neuroprostheses.

    Directory of Open Access Journals (Sweden)

    Ander Ramos-Murguialday

    Full Text Available Brain computer interface (BCI technology has been proposed for motor neurorehabilitation, motor replacement and assistive technologies. It is an open question whether proprioceptive feedback affects the regulation of brain oscillations and therefore BCI control. We developed a BCI coupled on-line with a robotic hand exoskeleton for flexing and extending the fingers. 24 healthy participants performed five different tasks of closing and opening the hand: (1 motor imagery of the hand movement without any overt movement and without feedback, (2 motor imagery with movement as online feedback (participants see and feel their hand, with the exoskeleton moving according to their brain signals, (3 passive (the orthosis passively opens and closes the hand without imagery and (4 active (overt movement of the hand and rest. Performance was defined as the difference in power of the sensorimotor rhythm during motor task and rest and calculated offline for different tasks. Participants were divided in three groups depending on the feedback receiving during task 2 (the other tasks were the same for all participants. Group 1 (n = 9 received contingent positive feedback (participants' sensorimotor rhythm (SMR desynchronization was directly linked to hand orthosis movements, group 2 (n = 8 contingent "negative" feedback (participants' sensorimotor rhythm synchronization was directly linked to hand orthosis movements and group 3 (n = 7 sham feedback (no link between brain oscillations and orthosis movements. We observed that proprioceptive feedback (feeling and seeing hand movements improved BCI performance significantly. Furthermore, in the contingent positive group only a significant motor learning effect was observed enhancing SMR desynchronization during motor imagery without feedback in time. Furthermore, we observed a significantly stronger SMR desynchronization in the contingent positive group compared to the other groups during active and

  16. Distributed Wireless Power Transfer With Energy Feedback

    Science.gov (United States)

    Lee, Seunghyun; Zhang, Rui

    2017-04-01

    Energy beamforming (EB) is a key technique for achieving efficient radio-frequency (RF) transmission enabled wireless energy transfer (WET). By optimally designing the waveforms from multiple energy transmitters (ETs) over the wireless channels, they can be constructively combined at the energy receiver (ER) to achieve an EB gain that scales with the number of ETs. However, the optimal design of EB waveforms requires accurate channel state information (CSI) at the ETs, which is challenging to obtain practically, especially in a distributed system with ETs at separate locations. In this paper, we study practical and efficient channel training methods to achieve optimal EB in a distributed WET system. We propose two protocols with and without centralized coordination, respectively, where distributed ETs either sequentially or in parallel adapt their transmit phases based on a low-complexity energy feedback from the ER. The energy feedback only depends on the received power level at the ER, where each feedback indicates one particular transmit phase that results in the maximum harvested power over a set of previously used phases. Simulation results show that the two proposed training protocols converge very fast in practical WET systems even with a large number of distributed ETs, while the protocol with sequential ET phase adaptation is also analytically shown to converge to the optimal EB design with perfect CSI by increasing the training time. Numerical results are also provided to evaluate the performance of the proposed distributed EB and training designs as compared to other benchmark schemes.

  17. Small group discussion: Students perspectives.

    Science.gov (United States)

    Annamalai, Nachal; Manivel, Rajajeyakumar; Palanisamy, Rajendran

    2015-08-01

    Various alternative methods are being used in many medical colleges to reinforce didactic lectures in physiology. Small group teaching can take on a variety of different tasks such as problem-solving, role play, discussions, brainstorming, and debate. Research has demonstrated that group discussion promotes greater synthesis and retention of materials. The aims of this study were to adopt a problem-solving approach by relating basic sciences with the clinical scenario through self-learning. To develop soft skills, to understand principles of group dynamics, and adopt a new teaching learning methodology. Experimental study design was conducted in Phase I 1(st) year medical students of 2014-2015 batch (n = 120). On the day of the session, the students were grouped into small groups (15 each). The session started with the facilitator starting off the discussion. Feedback forms from five students in each group was taken (n = 40). A five point Likert scale was used ranging from strongly agree to strongly disagree. Data were analyzed using IBM SPSS Statistics for Windows, Version 21.0. Armonk, NY: IBM Corp. Our results show that 70% of the students opined that small group discussion were interactive, friendly, innovative, built interaction between teacher and student. Small group discussion increased their thought process and helped them in better communication. The small group discussion was interactive, friendly, and bridged the gap between the teacher and student. The student's communication skills are also improved. In conclusion, small group discussion is more effective than the traditional teaching methods.

  18. On the relationship between learning strategy and feedback processing in the weather prediction task--Evidence from event-related potentials.

    Science.gov (United States)

    Rustemeier, Martina; Schwabe, Lars; Bellebaum, Christian

    2013-03-01

    Previous work has shown that both declarative and non-declarative strategies can be engaged in probabilistic classification learning. With respect to the neural correlates of these strategies, earlier studies have focused on the classification process itself. In the present experiment, we asked whether the feedback for classification performance is processed differently by declarative and non-declarative learners. We recorded event-related potentials (ERPs) while participants performed a modified version of the weather prediction task, a well-known probabilistic classification learning task. ERP analysis focused on two ERP components typically associated with feedback processing, the feedback-related negativity (FRN) and the P300. FRN amplitude was not affected by learning strategy. The P300, however, was more pronounced in declarative learners, particularly at frontal electrode site Fz. In addition, P300 topography was different in declarative learners, with amplitude differences between negative and positive feedback being more pronounced over the frontal than the parietal cortex. Differences in feedback processing between groups were still seen after declarative learners had switched to a non-declarative strategy in later phases of the task. Our findings provide evidence for different neural mechanisms of feedback processing in declarative and non-declarative learning. This difference emerges at later stages of feedback processing, after the typical time window of the FRN.

  19. Feedback i undervisningen

    DEFF Research Database (Denmark)

    Kirkegaard, Preben Olund

    2015-01-01

    undervisningsdifferentiering, feedback på læreprocesser, formativ og summativ evaluering, observationer og analyse af undervisning samt lærernes teamsamarbejde herom. Praktikken udgør et særligt læringsrum i læreruddannelsen. Samspillet mellem studerende, praktiklærere og undervisere giver den studerende en unik mulighed...

  20. Feedback and Prior Achievement.

    Science.gov (United States)

    Hyman, Cynthia; Tobias, Sigmund

    The hypothesis that feedback in programmed instruction is an important variable in the learning of novel, but not familiar, content was investigated. A linear, constructed response program dealing with the Sabbath rituals in the synagogue was chosen due to wide variability in student familiarity with this topic. Subjects were randomly assigned to…

  1. Review of Assessment Feedback

    Science.gov (United States)

    Li, Jinrui; De Luca, Rosemary

    2014-01-01

    This article reviews 37 empirical studies, selected from 363 articles and 20 journals, on assessment feedback published between 2000 and 2011. The reviewed articles, many of which came out of studies in the UK and Australia, reflect the most current issues and developments in the area of assessing disciplinary writing. The article aims to outline…

  2. Acoustic attenuation, phase and group velocities in liquid-filled pipes: Theory, experiment, and examples of water and mercury.

    Science.gov (United States)

    Baik, Kyungmin; Jiang, Jian; Leighton, Timothy G

    2010-11-01

    Del Grosso's [Acustica 24, 299-311 (1971)] formulation, which predicts the phase speed of propagating axisymmetric modes inside a liquid-filled tube, is here extended to the complex domain in order to predict the attenuation, as well as the sound speed, of the modes as a function of frequency. Measurements of the sound speeds and the attenuations of the modes were performed in a water-filled Poly (methyl methacrylate) (PMMA) tube of internal radius, b=4.445 cm, in the range of the wavenumber-radius product, k(1)b, from 2 to 10. Parts of three or four modes were investigated and the measured sound speeds and the damping of the modes were compared with the theoretical predictions. The theory was then used to estimate the modal sound speeds and attenuations in a stainless-steel pipe filled with mercury having the same dimensions as are used in the Spallation Neutron Source at Oak Ridge National Laboratory, Tennessee.

  3. Detection of Lewis, P1, and some MNS blood group system antibodies by a solid phase assay.

    Science.gov (United States)

    Rolih, S; Thomas, R; Sinor, L

    1995-01-01

    Some solid phase red cell adherence (SPRCA) assays are designed to detect IgG antibodies to red blood cell (RBC) antigens. These assays use anti-IgG-coated red cells as the indicator. It is reported that most antibodies to Lea, Leb, P1, M, and N fail to react by solid phase (SP), presumably because they are IgM antibodies. Those detected are assumed to be IgG. In one year, during routine testing using SPRCA to screen patients for intended RBC transfusion, 28 of 59 such examples were found to react: anti-Lea(9), -Leb(1), -M(14), -N(1), and -P1(3). A study was undertaken to determine if reactivity was due to crosslinking by IgM antibodies of antigen-positive indicator RBCs to antigen-positive reagent RBC monolayers, or due to detection of IgG antibodies. Antibodies were tested according to standard SP protocols, except where IgG-neutralized indicator RBCs were substituted for anti-IgG-active indicator cells. The 59 samples were retested with antigen-positive and antigen-negative indicator RBCs. Only 5 of 59 reacted optimally when antigen-positive indicator cells were used: anti-Lea(2), -Leb(1), -M(1), and -N(1). The reactions of all antibodies were abolished when the anti-IgG component of the indicator was neutralized by soluble IgG. These findings show that detection of most Lewis, P1, M, and N antibodies by SPRCA is dependent on the presence of an IgG antibody in the serum.

  4. Defining a roadmap for harmonizing quality indicators in Laboratory Medicine: a consensus statement on behalf of the IFCC Working Group "Laboratory Error and Patient Safety" and EFLM Task and Finish Group "Performance specifications for the extra-analytical phases".

    Science.gov (United States)

    Sciacovelli, Laura; Panteghini, Mauro; Lippi, Giuseppe; Sumarac, Zorica; Cadamuro, Janne; Galoro, César Alex De Olivera; Pino Castro, Isabel Garcia Del; Shcolnik, Wilson; Plebani, Mario

    2017-08-28

    The improving quality of laboratory testing requires a deep understanding of the many vulnerable steps involved in the total examination process (TEP), along with the identification of a hierarchy of risks and challenges that need to be addressed. From this perspective, the Working Group "Laboratory Errors and Patient Safety" (WG-LEPS) of International Federation of Clinical Chemistry and Laboratory Medicine (IFCC) is focusing its activity on implementation of an efficient tool for obtaining meaningful information on the risk of errors developing throughout the TEP, and for establishing reliable information about error frequencies and their distribution. More recently, the European Federation of Clinical Chemistry and Laboratory Medicine (EFLM) has created the Task and Finish Group "Performance specifications for the extra-analytical phases" (TFG-PSEP) for defining performance specifications for extra-analytical phases. Both the IFCC and EFLM groups are working to provide laboratories with a system to evaluate their performances and recognize the critical aspects where improvement actions are needed. A Consensus Conference was organized in Padova, Italy, in 2016 in order to bring together all the experts and interested parties to achieve a consensus for effective harmonization of quality indicators (QIs). A general agreement was achieved and the main outcomes have been the release of a new version of model of quality indicators (MQI), the approval of a criterion for establishing performance specifications and the definition of the type of information that should be provided within the report to the clinical laboratories participating to the QIs project.

  5. The Use of Freshmen Seminar Programs to Deliver Personalized Feedback

    Science.gov (United States)

    Henslee, Amber M.; Correia, Christopher J.

    2009-01-01

    The current study tested the effectiveness of delivering personalized feedback to first-semester college freshmen in a group lecture format. Participants enrolled in semester-long courses were randomly assigned to receive either personalized feedback or general information about alcohol. Both lecture conditions were delivered during a standard…

  6. Use of Videotape Feedback with Severely Disturbed Adolescents.

    Science.gov (United States)

    Michel, Jane; Blitstein, Sheldon

    1979-01-01

    Summarizes the design and effects of a group therapy project using videotape feedback with seriously disturbed adolescents. Offers anecdotal evidence that the feedback facilitated the correction of the participants' distorted body images, low self-esteem, lack of capacity for self-observation, and poor peer relationships. (SS)

  7. From "Plodder" to "Creative": Feedback in Teacher Education

    Science.gov (United States)

    Kurtoglu-Hooton, Nur

    2016-01-01

    This article discusses the case study of four student teachers, examining the ways in which a particular kind of feedback--namely, confirmatory feedback--can act as a catalyst for some of the learning and potential change student teachers in a teaching practice group may experience on an initial teacher education programme. It illustrates how one…

  8. The effect of direct and indirect corrective feedback on students’ spelling errors

    OpenAIRE

    Baleghizadeh Sasan; Dadashi Mehdi

    2011-01-01

    The study presented here is an attempt to examine the role of indirect feedback in promoting junior high school students’ spelling accuracy in English. It compares the effect of direct feedback with indirect feedback on students’ written work dictated by their teacher from their textbooks. Two classes were selected from the Zanjanrood District in Iran. Forty-four male students in two groups, one from School A (the direct feedback group) and the other from School B (the indirect feedb...

  9. "I Really Need Feedback to Learn:" Students' Perspectives on the Effectiveness of the Differential Feedback Messages

    Science.gov (United States)

    Lipnevich, Anastasiya A.; Smith, Jeffrey K.

    2009-01-01

    The current study examined students' perceptions of the effects of different forms of instructional feedback on their performance, motivation, and emotion. Forty-nine students attending an eastern US university participated in focus group discussions. The groups explored students' reactions to grades, praise, and computer versus instructor…

  10. The test channel groups in the Wolsong-3 reactor for the evaluation of PHWR fuel integrity in the two phase flow condition

    Energy Technology Data Exchange (ETDEWEB)

    Jun, Ji Su; Cho, Moon Sung

    2004-07-01

    This report intends to select the test channel groups in the Wolsong-3 reactor for the evaluation of PHWR fuel integrity in the two phase flow condition. First, a detailed work schedule for fuel inspection, fuel loading, storage of the discharged fuel, and in-bay visual and dimensional examination was established on the CIGAR work plan of the Wolsong-3 reactor. According to the schedule, it is necessary to suggest the appropriate test channel groups with two phase flow before the new fuel loading. For the selection of the test channel groups, the distributions of the channel flow rate and the channel exit quality are calculated by the NUCIRC code with the monthly measured operation data of the Wolsong-3 reactor during May 2001 to December 2002. The monthly calculated data could sort out the channels with the channel exit quality greater than 0.2%, in the high power channels with the power higher than 6300 kW and the flow rate greater than 25.5 kg/s, and in the low power channels with the power higher than 4800 kW and less than 5300 kW. Based on the frequency rank of these sorted channels, O16 channel with thirty other channels in the high power region and D17 channel with ten other channels in the low power region are suggested as the test channel groups.

  11. Online feedback op schriftelijk werk: betere feedback in minder tijd.

    NARCIS (Netherlands)

    van den Berg, B.A.M.|info:eu-repo/dai/nl/288125797; van der Hulst, M.E.

    2015-01-01

    Feedback is a powerful teaching technic to raise students’ performance, provided that the feedback is informative on how to improve, is given in a timely manner and students have the opportunity to act upon it. Therefore, many institutions want their students to receive feedback on their performance

  12. Online feedback op schriftelijk werk: betere feedback in minder tijd.

    NARCIS (Netherlands)

    van den Berg, B.A.M.; van der Hulst, M.E.

    2015-01-01

    Feedback is a powerful teaching technic to raise students’ performance, provided that the feedback is informative on how to improve, is given in a timely manner and students have the opportunity to act upon it. Therefore, many institutions want their students to receive feedback on their performance

  13. Group additive values for the gas-phase standard enthalpy of formation, entropy and heat capacity of oxygenates.

    Science.gov (United States)

    Paraskevas, Paschalis D; Sabbe, Maarten K; Reyniers, Marie-Françoise; Papayannakos, Nikos; Marin, Guy B

    2013-11-25

    A complete and consistent set of 60 Benson group additive values (GAVs) for oxygenate molecules and 97 GAVs for oxygenate radicals is provided, which allow to describe their standard enthalpies of formation, entropies and heat capacities. Approximately half of the GAVs for oxygenate molecules and the majority of the GAVs for oxygenate radicals have not been reported before. The values are derived from an extensive and accurate database of thermochemical data obtained by ab initio calculations at the CBS-QB3 level of theory for 202 molecules and 248 radicals. These compounds include saturated and unsaturated, α- and β-branched, mono- and bifunctional oxygenates. Internal rotations were accounted for by using one-dimensional hindered rotor corrections. The accuracy of the database was further improved by adding bond additive corrections to the CBS-QB3 standard enthalpies of formation. Furthermore, 14 corrections for non-nearest-neighbor interactions (NNI) were introduced for molecules and 12 for radicals. The validity of the constructed group additive model was established by comparing the predicted values with both ab initio calculated values and experimental data for oxygenates and oxygenate radicals. The group additive method predicts standard enthalpies of formation, entropies, and heat capacities with chemical accuracy, respectively, within 4 kJ mol(-1) and 4 J mol(-1) K(-1) for both ab initio calculated and experimental values. As an alternative, the hydrogen bond increment (HBI) method developed by Lay et al. (T. H. Lay, J. W. Bozzelli, A. M. Dean, E. R. Ritter, J. Phys. Chem.- 1995, 99, 14514) was used to introduce 77 new HBI structures and to calculate their thermodynamic parameters (Δ(f)H°, S°, C(p)°). The GAVs reported in this work can be reliably used for the prediction of thermochemical data for large oxygenate compounds, combining rapid prediction with wide-ranging application.

  14. Electronic basis of the hcp, omega and bcc phases in group IVB elements under pressure or on alloying

    Science.gov (United States)

    Gyanchandani, Jyoti; Sikka, S. K.

    2013-03-01

    Using the first principles DFT calculations, we have elucidated the electronic basis of the α→ω and the ω→β transitions in group IVB elements. After considering several possible factors that could give rise to the structural stability of a particular crystal structure, the changes in the band structure energy due to Peierls-Jahn-Teller distortion and crystal-field effects on sub orbital of d bands coupled with Ewald energy differences have been identified as the causes for these transitions. The role of van Hove singularities and consequent electronic topological transitions has also been examined.

  15. Electronic Relaxation of the Phenylalanine Residue in Gas Phase Peptides: Role of the Neighbouring Amide Groups in the Photophysics

    Science.gov (United States)

    Loquais, Y.; Biswal, H. S.; Tardivel, B.; Brenner, V.; Mons, M.; Gloaguen, E.; Jouvet, C.; Broquier, M.; Malis, M.; Ljubic, I.; Doslic, N.

    2012-06-01

    Protein absorption in the near UV is mainly due to the presence of aromatic systems on the side chain of three residues: phenylalanine, tryptophan and tyrosine. It is generally expected that the photophysics of these UV chromophores depends on their immediate environment within the molecule and thus on the conformation of these flexible molecules. This property may in particular be used as an optical diagnostic of the conformational state of the peptide chain. The structure of peptide chains isolated in the gas phase can be characterized by UV and IR laser spectroscopy. These measurements allow us to distinguish the spectral contributions of the different conformers and thus provide us with an elegant way to address the issue of the conformational dependence on the photophysics. For this purpose, the dynamics of relaxation of the ππ* excited state of several peptides containing a phenylalanine residue have been studied using two-colour resonant two-photon ionization (2C-R2PI) in the ns time scale at CEA and ps at CLUPS and laser-induced fluorescence as well. The lifetime of the ππ* excited state is found to strongly depend on the conformation adopted by the molecule and on the excess energy in the excited state, with measured lifetimes ranging from 1 ns to 80 ns. W. Chin; F. Piuzzi; I. Dimicoli and M. Mons, Phys. Chem. Chem. Phys., 8, pp 1033-1048 (2006)

  16. Periodicity in Delta-modulated feedback control

    Institute of Scientific and Technical Information of China (English)

    Xiaohua XIA; Guanrong CHEN; Rudong GAI; Alan S. I. ZINOBER

    2008-01-01

    The Delta-modulated feedback control of a linear system introduces nonlinearity into the system through switchings between two input values. It has been found that Delta-modulation gives rise to periodic orbits. The existence of periodic points of all orders of Sigma-Delta modulation with "leaky" integration is completely characterized by some interesting groups of polynomials with "sign" coefficients. The results are naturally generalized to Sigma-Delta modulations with multiple delays, Delta-modulations in the "downlink", unbalanced Delta-modulations and systems with two-level quantized feedback. Further extensions relate to the existence of periodic points arising from Delta-modulated feedback control of a stable linear system in an arbitrary direction, for which some necessary and sufficient conditions are given.

  17. Engaging Students with Audio Feedback

    Science.gov (United States)

    Cann, Alan

    2014-01-01

    Students express widespread dissatisfaction with academic feedback. Teaching staff perceive a frequent lack of student engagement with written feedback, much of which goes uncollected or unread. Published evidence shows that audio feedback is highly acceptable to students but is underused. This paper explores methods to produce and deliver audio…

  18. Efimov-like phase of a three-stranded DNA and the renormalization-group limit cycle

    Science.gov (United States)

    Pal, Tanmoy; Sadhukhan, Poulomi; Bhattacharjee, Somendra M.

    2015-04-01

    A three-stranded DNA with short range base pairings only is known to exhibit a classical analog of the quantum Efimov effect, viz., a three-chain bound state at the two-chain melting point where no two are bound. By using a nonperturbative renormalization-group method for a rigid duplex DNA and a flexible third strand, with base pairings and strand exchange, we show that the Efimov-DNA is associated with a limit cycle type behavior of the flow of an effective three-chain interaction. The analysis also shows that thermally generated bubbles play an essential role in producing the effect. A toy model for the flow equations shows the limit cycle in an extended three-dimensional parameter space of the two-chain coupling and a complex three-chain interaction.

  19. Improving the quality of written feedback using written feedback.

    Science.gov (United States)

    Bartlett, Maggie; Crossley, James; McKinley, Robert

    2017-01-01

    Educational feedback is amongst the most powerful of all learning interventions. (1) Can we measure the quality of written educational feedback with acceptable metrics? (2) Based on such a measure, does a quality improvement (QI) intervention improve the quality of feedback? We developed a QI instrument to measure the quality of written feedback and applied it to written feedback provided to medical students following workplace assessments. We evaluated the measurement characteristics of the QI score using generalisability theory. In an uncontrolled intervention, QI profiles were fed back to GP tutors and pre and post intervention scores compared. A single assessor scoring 6 feedback summaries can discriminate between practices with a reliability of 0.82.The quality of feedback rose for two years after the introduction of the QI instrument and stabilised in the third year. The estimated annual cost to provide this feedback is £12 per practice. Interpretation and recommendations: It is relatively straightforward and inexpensive to measure the quality of written feedback with good reliability. The QI process appears to improve the quality of written feedback. We recommend routine use of a QI process to improve the quality of educational feedback.

  20. Positive feedback promotes oscillations in negative feedback loops.

    Directory of Open Access Journals (Sweden)

    Bharath Ananthasubramaniam

    Full Text Available A simple three-component negative feedback loop is a recurring motif in biochemical oscillators. This motif oscillates as it has the three necessary ingredients for oscillations: a three-step delay, negative feedback, and nonlinearity in the loop. However, to oscillate, this motif under the common Goodwin formulation requires a high degree of cooperativity (a measure of nonlinearity in the feedback that is biologically "unlikely." Moreover, this recurring negative feedback motif is commonly observed augmented by positive feedback interactions. Here we show that these positive feedback interactions promote oscillation at lower degrees of cooperativity, and we can thus unify several common kinetic mechanisms that facilitate oscillations, such as self-activation and Michaelis-Menten degradation. The positive feedback loops are most beneficial when acting on the shortest lived component, where they function by balancing the lifetimes of the different components. The benefits of multiple positive feedback interactions are cumulative for a majority of situations considered, when benefits are measured by the reduction in the cooperativity required to oscillate. These positive feedback motifs also allow oscillations with longer periods than that determined by the lifetimes of the components alone. We can therefore conjecture that these positive feedback loops have evolved to facilitate oscillations at lower, kinetically achievable, degrees of cooperativity. Finally, we discuss the implications of our conclusions on the mammalian molecular clock, a system modeled extensively based on the three-component negative feedback loop.

  1. Regenerative feedback resonant circuit

    Science.gov (United States)

    Jones, A. Mark; Kelly, James F.; McCloy, John S.; McMakin, Douglas L.

    2014-09-02

    A regenerative feedback resonant circuit for measuring a transient response in a loop is disclosed. The circuit includes an amplifier for generating a signal in the loop. The circuit further includes a resonator having a resonant cavity and a material located within the cavity. The signal sent into the resonator produces a resonant frequency. A variation of the resonant frequency due to perturbations in electromagnetic properties of the material is measured.

  2. Effects of Group-Based Exercise on Range of Motion, Muscle Strength, Functional Ability, and Pain During the Acute Phase After Total Knee Arthroplasty: A Controlled Clinical Trial.

    Science.gov (United States)

    Hiyama, Yoshinori; Kamitani, Tsukasa; Wada, Osamu; Mizuno, Kiyonori; Yamada, Minoru

    2016-09-01

    Study Design Prospective observational study including a historical control group. Background The extent to which group-based exercise (G-EXE) improves knee range of motion (ROM), quadriceps strength, and gait ability is similar to that of individualized exercise (I-EXE) at 6 weeks and 8 months after total knee arthroplasty (TKA). However, the benefits of G-EXE for patients during the acute recovery phase after TKA remain unclear. Objective To determine the effects of G-EXE during the acute recovery phase after TKA on knee ROM, quadriceps strength, functional ability, and knee pain. Methods Two hundred thirty-one patients participated in G-EXE in addition to regular ambulation and activities-of-daily-living exercises twice daily during the hospital stay. Outcomes were compared to those of a retrospectively identified, historical control group (I-EXE group [n = 206]) that included patients who performed exercises identical to those performed by the G-EXE group. The outcomes included knee ROM, quadriceps strength, pain intensity, and timed up-and-go test score at 1 month before surgery and at discharge. Analyses were adjusted for age, body mass index, sex, length of hospital stay, and preoperative values. Results Changes in ROM of knee flexion and extension (Pexercises demonstrated greater changes in knee ROM, quadriceps strength, and knee pain than those performing I-EXE in addition to regular ambulation and activities-of-daily-living exercises. The nonrandomized, asynchronous design decreases certainty of these findings. Level of Evidence Therapy, level 2b. J Orthop Sports Phys Ther 2016;46(9):742-748. Epub 5 Aug 2016. doi:10.2519/jospt.2016.6409.

  3. Feedback-cooling of an atomic spin ensemble

    CERN Document Server

    Behbood, N; Colangelo, G; Ciurana, F Martin; Sewell, R J; 1,; Mitchell, M W

    2013-01-01

    We describe a measurement-and-feedback technique to deterministically prepare low-entropy states of atomic spin ensembles. Using quantum non-demolition measurement and incoherent optical feedback, we drive arbitrary states in the spin-orientation space toward the origin of the spin space. We observe 12 dB of spin noise reduction, or a factor of 63 reduction in phase-space volume. We find optimal feedback conditions and show that multi-stage feedback is advantageous. An input-output calculation of quantum noise incorporating realistic quantum noise sources and experimental limitations agrees well with the observations. The method may have application to generation of exotic phases of ultracold gases, for example macroscopic singlet states and valence-bond solids.

  4. Discrete Group Gas-Solid Two-Phase Flow Model and Its Simulation in the Large Caliber High Speed Davis Gun

    Institute of Scientific and Technical Information of China (English)

    Shuyuan Jiang∗and Hao Wang

    2016-01-01

    Aiming at the characteristics of the long tubular powder, a one⁃dimensional discrete group gas⁃solid two-phase flow model was established for the large caliber high speed Davis gun with a tubular modular charge. In this model, the tubular modules were described by the Lagrangian system without being assumed as pseudo⁃fluid, whereas the gas field is described by Eulerian system. The new model was used to simulate a 480 mm Davis gun. The simulation results were compared with test results, and the model was verified to be feasibility. This study provides a new method to research the interior ballistic performance of Davis guns.

  5. Feedback on Feedback: Eliciting Learners' Responses to Written Feedback through Student-Generated Screencasts

    Science.gov (United States)

    Fernández-Toro, María; Furnborough, Concha

    2014-01-01

    Despite the potential benefits of assignment feedback, learners often fail to use it effectively. This study examines the ways in which adult distance learners engage with written feedback on one of their assignments. Participants were 10 undergraduates studying Spanish at the Open University, UK. Their responses to feedback were elicited by means…

  6. Feedback on Feedback: Eliciting Learners' Responses to Written Feedback through Student-Generated Screencasts

    Science.gov (United States)

    Fernández-Toro, María; Furnborough, Concha

    2014-01-01

    Despite the potential benefits of assignment feedback, learners often fail to use it effectively. This study examines the ways in which adult distance learners engage with written feedback on one of their assignments. Participants were 10 undergraduates studying Spanish at the Open University, UK. Their responses to feedback were elicited by means…

  7. Feedback på arbejdspladser

    DEFF Research Database (Denmark)

    Holdt Christensen, Peter

    Feedback på arbejdspladser er vigtig. Men feedback er også et populært begreb mange taler med om uden dog at vide sig helt sikker på hvad det er. Formålet med denne bog er at bidrage til en bedre forståelse af hvad feedback er, hvordan det fungerer og dermed hvordan arbejdspladser bedst muligt bør...... understøtte feedback. Med udgangspunkt i forskningen identificeres centrale udfordringer ved feedback, bl.a. hvorfor det kan være svært at give præcis feedback, hvordan forholdet mellem lederen og den ansatte påvirker den feedback der gives, og hvad der kendetegner en feedback kultur. Bogen er skrevet til...... undervisere og studerende på videregående uddannelser samt praktikere der ønsker en systematisk og forskningsbaseret forståelse af feedback på arbejdspladser. Bogen er således ikke en kogebog til bedre feedback, men en analyse og diskussion af hvad forskningen ved om feedback, og bidrager med inspiration og...

  8. Beyond individualism: professional culture and its influence on feedback.

    Science.gov (United States)

    Watling, Christopher; Driessen, Erik; van der Vleuten, Cees P M; Vanstone, Meredith; Lingard, Lorelei

    2013-06-01

    Although feedback is widely considered essential to learning, its actual influence on learners is variable. Research on responsivity to feedback has tended to focus on individual rather than social or cultural influences on learning. In this study, we explored how feedback is handled within different professional cultures, and how the characteristics and values of a profession shape learners' responses to feedback. Using a constructivist grounded theory approach, we conducted 12 focus groups and nine individual interviews (with a total of 50 participants) across three cultures of professional training in, respectively, music, teacher training and medicine. Constant comparative analysis for recurring themes was conducted iteratively. Each of the three professional cultures created a distinct context for learning that influenced how feedback was handled. Despite these contextual differences, credibility and constructiveness emerged as critical constants, identified by learners across cultures as essential for feedback to be perceived as meaningful. However, the definitions of credibility and constructiveness were distinct to each professional culture and the cultures varied considerably in how effectively they supported the occurrence of feedback with these critical characteristics. Professions define credibility and constructiveness in culturally specific ways and create contexts for learning that may either facilitate or constrain the provision of meaningful feedback. Comparison with other professional cultures may offer strategies for creating a productive feedback culture within medical education. © 2013 John Wiley & Sons Ltd.

  9. Unveiling The Physics of Star Formation and Feedback in Galaxies

    CERN Document Server

    Tabatabaei, F S; Kramer, C; Schinnerer, E; Beckman, J; Knapen, J

    2016-01-01

    Recent studies show the importance of feedback in the evolution of the star formation rate in the Universe. However, the nature and physics of the feedback are still pressing questions. Radio continuum observations can provide unique dust-unbiased tracers of massive star formation and of the interstellar medium (ISM) and hence are ideal to address the regulation of star formation in galaxies. Our multi-frequency and multi-resolution radio surveys in nearby galaxies enable us to trace various phases of star formation and dissect the thermal and nonthermal ISM in galaxies. Mapping the cosmic ray electron energy index and magnetic field strength, we have found observational evidence that massive star formation significantly affects the energy balance in the ISM through the injection and acceleration of cosmic rays and the amplification of magnetic fields. How the next generation of stars could form in such a magnetized and turbulent ISM will be addressed in our 'EVLA cloud-scale survey of the local group galaxy ...

  10. A phase II study of amifostine in children with myelodysplastic syndrome: a report from the Children's Oncology Group study (AAML0121).

    Science.gov (United States)

    Mathew, Prasad; Gerbing, Robert; Alonzo, Todd A; Wallas, Tanya; Gong, Jerald Z; Jasty, Rama; Jorstad, Dean T; Raimondi, Susana C; Chavez, Cathy M; Eisenberg, Nancy L; Hirsch, Betsy; Gamis, Alan; Smith, Franklin O; Arceci, Robert J

    2011-12-15

    Based on its potential role in adult myelodysplastic syndrome (MDS), the Children's Oncology Group (COG) embarked on a phase II study using amifostine in pediatric MDS (WHO 2001 criteria) patients. Responses were evaluated after two cycles. Ten patients were enrolled; five were deemed ineligible, and four withdrew after the first course. Only one patient completed two courses, and was found to be in complete remission. The study was closed after being open for 2 years due to slow accrual. Studying a rare disease like MDS may pose insurmountable obstacles even in a large clinical trials group such as COG, in part because of the changing definitions of MDS and the rarity of adult type MDS in children. The role of amifostine in pediatric MDS was not known at the time of study.

  11. Developmental programming: contribution of prenatal androgen and estrogen to estradiol feedback systems and periovulatory hormonal dynamics in sheep.

    Science.gov (United States)

    Veiga-Lopez, Almudena; Astapova, Olga I; Aizenberg, Esther F; Lee, James S; Padmanabhan, Vasantha

    2009-04-01

    Prenatal testosterone excess leads to neuroendocrine and periovulatory disruptions in the offspring culminating in progressive loss of cyclicity. It is unknown whether the mediary of these disruptions is androgen or estrogen, because testosterone can be aromatized to estrogen. Taking a reproductive life span approach of studying control, prenatal testosterone, and dihydrotestosterone-treated offspring, this study tested the hypothesis that disruptions in estradiol-negative but not -positive feedback effects are programmed by androgenic actions of testosterone and that these disruptions in turn will have an impact on the periovulatory hormonal dynamics. The approach was to test estradiol-negative and -positive feedback responses of all three groups of ovary-intact females during prepubertal age and then compare the periovulatory dynamics of luteinizing hormone, follicle-stimulating hormone, estradiol, and progesterone during the first breeding season. The findings show that estradiol-negative but not estradiol-positive feedback disruptions in prenatal testosterone-treated females are programmed by androgenic actions of prenatal testosterone excess and that follicular phase estradiol and gonadotropins surge disruptions during reproductive life are consistent with estrogenic programming. Additional studies carried out testing estradiol-positive feedback response over time found progressive deterioration of estradiol-positive feedback in prenatal testosterone-treated sheep until the time of puberty. Together, these findings provide insight into the mechanisms by which prenatal testosterone disrupts the reproductive axis. The findings may be of translational relevance since daughters of mothers with hyperandrogenism are at risk of increased exposure to androgens.

  12. Does an Observer's Content Knowledge Influence the Feedback Offered about Mathematics Lessons?

    Science.gov (United States)

    Peck, Duane C.

    2016-01-01

    The purpose of this study was two-fold. First, feedback from 3 different groups of observers: math content specialists, content specialists in areas other than mathematics, and building principals, was analyzed using an inductive approach to identify themes within the feedback. Second, differences in the feedback offered by participants of the 3…

  13. The influence on response of axial rotation of a six-group local-conductance probe in horizontal oil-water two-phase flow

    Science.gov (United States)

    Weihang, Kong; Lingfu, Kong; Lei, Li; Xingbin, Liu; Tao, Cui

    2017-06-01

    Water volume fraction is an important parameter of two-phase flow measurement, and it is an urgent task for accurate measurement in horizontal oil field development and optimization of oil production. The previous ring-shaped conductance water-cut meter cannot obtain the response values corresponding to the oil field water conductivity for oil-water two-phase flow in horizontal oil-producing wells characterized by low yield liquid, low velocity and high water cut. Hence, an inserted axisymmetric array structure sensor, i.e. a six-group local-conductance probe (SGLCP), is proposed in this paper. Firstly, the electric field distributions generated by the exciting electrodes of SGLCP are investigated by the finite element method (FEM), and the spatial sensitivity distributions of SGLCP are analyzed from the aspect of different separations between two electrodes and different axial rotation angles respectively. Secondly, the numerical simulation responses of SGLCP in horizontal segregated flow are calculated from the aspect of different water cut and heights of the water layer, respectively. Lastly, an SGLCP-based well logging instrument was developed, and experiments were carried out in a horizontal pipe with an inner diameter of 125 mm on the industrial-scale experimental multiphase flow setup in the Daqing Oilfield, China. In the experiments, the different oil-water two-phase flow, mineralization degree, temperature and pressure were tested. The results obtained from the simulation experiments and simulation well experiments demonstrate that the designed and developed SGLCP-based instrument still has a good response characteristic for measuring water conductivity under the different conditions mentioned above. The validity and reliability of obtaining the response values corresponding to the water conductivity through the designed and developed SGLCP-based instrument are verified by the experimental results. The significance of this work can provide an effective

  14. Combination of Trabectedin and Gemcitabine for Advanced Soft Tissue Sarcomas: Results of a Phase I Dose Escalating Trial of the German Interdisciplinary Sarcoma Group (GISG

    Directory of Open Access Journals (Sweden)

    Bernd Kasper

    2015-01-01

    Full Text Available Background: Evaluation of the potential efficacy and safety of combination therapies for advanced soft tissue sarcomas (STS has increased substantially after approval of trabectedin and pazopanib. Trabectedin's introduction in Europe in 2007 depended mainly on its activity in so-called L-sarcomas (liposarcoma and leiomyosarcoma; combination of trabectedin with other chemotherapies used in STS seems of particular interest. Methods: We initiated within the German Interdisciplinary Sarcoma Group (GISG a phase I dose escalating trial evaluating the combination of trabectedin and gemcitabine in patients with advanced and/or metastatic L-sarcomas (GISG-02; ClinicalTrials.gov NCT01426633. Patients were treated with increasing doses of trabectedin and gemcitabine. The primary endpoint was to determine the maximum tolerated dose. Results: Five patients were included in the study. Two patients were treated on dose level 1 comprising trabectedin 0.9 mg/m2 on day 1 and gemcitabine 700 mg/m2 on days 1 + 8, every 3 weeks. Due to dose-limiting toxicity (DLT in both patients (elevated transaminases and thrombocytopenia, an additional three patients were treated on dose level −1 with trabectedin 0.7 mg/m2 plus gemcitabine 700 mg/m2. Of these three patients, two demonstrated another DLT; therefore, the trial was stopped and none of the dose levels could be recommended for phase II testing. Conclusion: The GISG-02 phase I study was stopped with the conclusion that the combination of gemcitabine and trabectedin is generally not recommended for the treatment of patients with advanced and/or metastatic leiomyosarcoma or liposarcoma. Also, this phase I study strongly supports the necessity for careful evaluation of combination therapies.

  15. The Endogenous Feedback Network

    DEFF Research Database (Denmark)

    Augustenborg, Claudia Carrara

    2010-01-01

    proposals, it will first be considered the extents of their reciprocal compatibility, tentatively shaping an integrated, theoretical profile of consciousness. A new theory, the Endogenous Feedback Network (EFN) will consequently be introduced which, beside being able to accommodate the main tenets...... of the reviewed theories, appears able to compensate for the explanatory gaps they leave behind. The EFN proposes consciousness as the phenomenon emerging from a distinct network of neural paths broadcasting the neural changes associated to any mental process. It additionally argues for the need to include a 5th...

  16. Portfolio, refleksion og feedback

    Directory of Open Access Journals (Sweden)

    Ane Qvortrup

    2017-08-01

    Full Text Available Denne leder definerer indledningsvist begrebet portfolio og gør rede for anvendelsesmuligheder i en uddannelseskontekst. Dernæst behandles portfoliometodens kvalitet og effekt for læring og undervisning og de centrale begreber refleksion, progression og feedback præsenteres og diskuteres. Herefter listes teknologier, der understøtter portfolioens opbygning og brug og implikationerne forbundet med valg af teknologi diskuteres kort. Afslutningsvist præsenteres temanummerets 5 artikler, der endvidere er inddraget undervejs i lederen som eksemplificering af de præsenterede begreber og teknologier.

  17. Precipitation-Regulated Feedback

    Science.gov (United States)

    Voit, Mark

    2016-07-01

    Star formation in the central galaxies of galaxy clusters appears to be fueled by precipitation of cold clouds out of hot circumgalactic gas via thermal instability. I will present both observational and theoretical support for the precipitation mode in large galaxies and discuss how it can be implemented in cosmological simulations of galaxy evolution. Galaxy cluster cores are unique laboratories for studying the astrophysics of thermal instability and may be teaching us valuable lessons about how feedback works in galaxies spanning the entire mass spectrum.

  18. Models of AGN feedback

    CERN Document Server

    Combes, F

    2014-01-01

    The physical processes responsible of sweeping up the surrounding gas in the host galaxy of an AGN, and able in some circumstances to expel it from the galaxy, are not yet well known. The various mechanisms are briefly reviewed: quasar or radio modes, either momentum-conserving outflows, energy-conserving outflows, or intermediate. They are confronted to observations, to know whether they can explain the M-sigma relation, quench the star formation or whether they can also provide some positive feedback and how the black hole accretion history is related to that of star formation.

  19. Sensory feedback to ankle plantar flexors is not exaggerated during gait in spastic hemiplegic children with cerebral palsy

    DEFF Research Database (Denmark)

    Willerslev-Olsen, Maria; Andersen, Jacob Buus; Sinkjær, Thomas;

    2014-01-01

    It is commonly assumed that exaggerated stretch reflex activity and the resulting increased muscle tone in ankle plantar flexors contribute to reduced ankle joint movement during gait in children with cerebral palsy (CP). We investigated the contribution of sensory feedback mechanisms to ankle...... in a similar proportion in both groups. Shortening of the plantar flexors in swing caused a larger drop in Soleus EMG in control children than in children with CP. The lack of age related decline in stretch reflexes in the stance phase and the inability to suppress the reflex in the swing phase is likely...

  20. A randomized study of feedback on student write-ups using an electronic portfolio.

    Science.gov (United States)

    Spickard, Anderson; Denny, Josh; Gigante, Joseph

    2007-10-11

    Traditional methods allowing medical students and residents to review their work and receive feedback are lacking. We developed a web-based portfolio system that collects all clinical documentation and allows teachers to give feedback electronically. In a randomized control trial, we found that this system significantly increased feedback to students, often exceeding clerkship expectations. Seventy-five percent of students found the system a "valuable teaching tool". Students in control and portfolio groups agreed that the system increased feedback.

  1. Timing matters: the impact of immediate and delayed feedback on artificial language learning.

    Science.gov (United States)

    Opitz, Bertram; Ferdinand, Nicola K; Mecklinger, Axel

    2011-01-01

    In the present experiment, we used event-related potentials (ERP) to investigate the role of immediate and delayed feedback in an artificial grammar learning (AGL) task. Two groups of participants were engaged in classifying non-word strings according to an underlying rule system, not known to the participants. Visual feedback was provided after each classification either immediately or with a short delay of 1 s. Both groups were able to learn the artificial grammar system as indicated by an increase in classification performance. However, the gain in performance was significantly larger for the group receiving immediate feedback as compared to the group receiving delayed feedback. Learning was accompanied by an increase in P300 activity in the ERP for delayed as compared to immediate feedback. Irrespective of feedback delay, both groups exhibited learning related decreases in the feedback-related positivity (FRP) elicited by positive feedback only. The feedback-related negativity (FRN), however, remained constant over the course of learning. These results suggest, first, that delayed feedback is less effective for AGL as task requirements are very demanding, and second, that the FRP elicited by positive prediction errors decreases with learning while the FRN to negative prediction errors is elicited in an all-or-none fashion by negative feedback throughout the entire experiment.

  2. Timing matters: The impact of immediate and delayed feedback on artificial language learning

    Directory of Open Access Journals (Sweden)

    Bertram Opitz

    2011-02-01

    Full Text Available In the present experiment, we used event-related potentials (ERP to investigate the role of immediate and delayed feedback in an artificial grammar learning task. Two groups of participants were engaged in classifying non-word strings according to an underlying rule system, not known to the participants. Visual feedback was provided after each classification either immediately or with a short delay of one second. Both groups were able to learn the artificial grammar system as indicated by an increase in classification performance. However, the gain in performance was significantly larger for the group receiving immediate feedback as compared to the group receiving delayed feedback. Learning was accompanied by an increase in P300 activity in the ERP for delayed as compared to immediate feedback. Irrespective of feedback delay, both groups exhibited learning related decreases in the feedback-related positivity (FRP elicited by positive feedback only. The feedback-related negativity (FRN, however, remained constant over the course of learning. These results suggest, first, that delayed feedback is less effective for artificial grammar learning as task requirements are very demanding, and second, that the FRP elicited by positive prediction errors decreases with learning while the FRN to negative prediction errors is elicited in an all-or-none fashion by negative feedback throughout the entire experiment.

  3. Haptic gas pedal feedback.

    Science.gov (United States)

    Mulder, M; Mulder, M; van Paassen, M M; Abbink, D A

    2008-11-01

    Active driver support systems either automate a control task or present warnings to drivers when their safety is seriously degraded. In a novel approach, utilising neither automation nor discrete warnings, a haptic gas pedal (accelerator) interface was developed that continuously presents car-following support information, keeping the driver in the loop. This interface was tested in a fixed-base driving simulator. Twenty-one drivers between the ages of 24 and 30 years participated in a driving experiment to investigate the effects of haptic gas pedal feedback on car-following behaviour. Results of the experiment indicate that when haptic feedback was presented to the drivers, some improvement in car-following performance was achieved, while control activity decreased. Further research is needed to investigate the effectiveness of the system in more varied driving conditions. Haptics is an under-used modality in the application of human support interfaces, which usually draw on vision or hearing. This study demonstrates how haptics can be used to create an effective driver support interface.

  4. Emotional feedback for mobile devices

    CERN Document Server

    Seebode, Julia

    2015-01-01

    This book investigates the functional adequacy as well as the affective impression made by feedback messages on mobile devices. It presents an easily adoptable experimental setup to examine context effects on various feedback messages, and applies it to auditory, tactile and auditory-tactile feedback messages. This approach provides insights into the relationship between the affective impression and functional applicability of these messages as well as an understanding of the influence of unimodal components on the perception of multimodal feedback messages. The developed paradigm can also be extended to investigate other aspects of context and used to investigate feedback messages in modalities other than those presented. The book uses questionnaires implemented on a Smartphone, which can easily be adopted for field studies to broaden the scope even wider. Finally, the book offers guidelines for the design of system feedback.

  5. Distributed Beamforming with Feedback: Convergence Analysis

    CERN Document Server

    Lin, C; Meyn, S

    2008-01-01

    The focus of this work is on the analysis of transmit beamforming schemes with a low-rate feedback link in wireless sensor/relay networks, where nodes in the network need to implement beamforming in a distributed manner. Specifically, the problem of distributed phase alignment is considered, where neither the transmitters nor the receiver has perfect channel state information, but there is a low-rate feedback link from the receiver to the transmitters. In this setting, a framework for systematically analyzing the performance of a general set of distributed beamforming schemes is proposed. To illustrate the advantage of this framework, a simple adaptive distributed beamforming scheme that was recently proposed by Mudambai et al. is studied. Two important properties for the received signal magnitude function are derived. Using these properties and the systematic framework, it is shown that the adaptive distributed beamforming scheme converges both in probability and in mean. Furthermore, it is established that ...

  6. LHC One-turn Delay Feedback Commissioning

    CERN Document Server

    Mastoridis, T; Molendijk, J

    2012-01-01

    The LHC One-Turn delay FeedBack (OTFB) is an FPGA based feedback system part of the LHC cavity controller, which produces gain only around the revolution frequency (frev = 11.245 kHz) harmonics. As such, it helps reduce the transient beam loading and effective cavity impedance. Consequently, it increases the stability margin for Longitudinal Coupled Bunch Instabilities driven by the cavity impedance at the fundamental and allows reliable operation at higher beam currents. The OTFB was commissioned on all sixteen cavities in mid-October 2011 and has been used in operation since. The commissioning procedure and algorithms for setting-up are presented. The resulting improvements in transient beam loading, beam stability, and required klystron power are analyzed. The commissioning of the OTFB reduced the cavity voltage phase modulation from approximately six degrees peak-to-peak to below one degree at 400 MHz with nominal bunch intensity of 1.1e11 protons.

  7. Do students profit from feedback?

    OpenAIRE

    Arild Raaheim

    2006-01-01

    Undergraduate students in psychology were given the opportunity to exchange the traditional exam with portfolio assessment. The students received written feedback, by way of a standard feedback form, on two of the three essays of the portfolio. To investigate whether students attend to and act on the feedback, a comparison was made between unofficial marks on the first draft of the first essay and the official marks on the full portfolio at the end of the semester. With approximately 20% of t...

  8. Performance of a solid phase enzyme immunoassay for detection of group A streptococci in a pediatric office laboratory as refereed by a hospital laboratory.

    Science.gov (United States)

    Yuckienuz, S A; Thorne, G M; Macone, A B; Goldmann, D A; St Pierre, J; Marcus, E P

    1988-06-01

    We evaluated the performance of a new rapid solid phase enzyme immunoassay, SUDS Group A Strep (MUREX Corp., Norcross, GA) for the detection of Group A beta-hemolytic streptococci in a pediatric office practice. Duplicate throat swabs were obtained from 341 children with pharyngitis. One swab was used in the SUDS test and the other was cultured in the office laboratory. Office SUDS and culture (sheep blood agar plate, aerobic 24-hour incubation) were compared with culture using reference techniques (sheep blood agar plate, anaerobic 48-hour incubation) in a hospital laboratory. Compared with hospital laboratory culture, the sensitivity of office SUDS (73.8%) was superior to that of office culture (66.6%) at P = 0.05. Specificities were 93.1 and 98.6%, respectively; positive predictive values were 86.1 and 96.6%; and negative predictive values were 85.9 and 83.5%. The sensitivity and specificity of SUDS compared with office culture were 88.5 and 87.8%, respectively, but would have been 93 and 94% had hemolyzed media not been used on several occasions in the office culture procedure. We conclude that SUDS Group A Strep was significantly more sensitive than throat cultures as performed in a typical pediatric practice although the performance of office cultures could have been improved by standard quality control techniques.

  9. Functional role of delta and theta band oscillations for auditory feedback processing during vocal pitch motor control.

    Science.gov (United States)

    Behroozmand, Roozbeh; Ibrahim, Nadine; Korzyukov, Oleg; Robin, Donald A; Larson, Charles R

    2015-01-01

    The answer to the question of how the brain incorporates sensory feedback and links it with motor function to achieve goal-directed movement during vocalization remains unclear. We investigated the mechanisms of voice pitch motor control by examining the spectro-temporal dynamics of EEG signals when non-musicians (NM), relative pitch (RP), and absolute pitch (AP) musicians maintained vocalizations of a vowel sound and received randomized ± 100 cents pitch-shift stimuli in their auditory feedback. We identified a phase-synchronized (evoked) fronto-central activation within the theta band (5-8 Hz) that temporally overlapped with compensatory vocal responses to pitch-shifted auditory feedback and was significantly stronger in RP and AP musicians compared with non-musicians. A second component involved a non-phase-synchronized (induced) frontal activation within the delta band (1-4 Hz) that emerged at approximately 1 s after the stimulus onset. The delta activation was significantly stronger in the NM compared with RP and AP groups and correlated with the pitch rebound error (PRE), indicating the degree to which subjects failed to re-adjust their voice pitch to baseline after the stimulus offset. We propose that the evoked theta is a neurophysiological marker of enhanced pitch processing in musicians and reflects mechanisms by which humans incorporate auditory feedback to control their voice pitch. We also suggest that the delta activation reflects adaptive neural processes by which vocal production errors are monitored and used to update the state of sensory-motor networks for driving subsequent vocal behaviors. This notion is corroborated by our findings showing that larger PREs were associated with greater delta band activity in the NM compared with RP and AP groups. These findings provide new insights into the neural mechanisms of auditory feedback processing for vocal pitch motor control.

  10. Functional role of delta and theta band oscillations for auditory feedback processing during vocal pitch motor control

    Directory of Open Access Journals (Sweden)

    Roozbeh eBehroozmand

    2015-03-01

    Full Text Available The answer to the question of how the brain incorporates sensory feedback and links it with motor function to achieve goal-directed movement during vocalization remains unclear. We investigated the mechanisms of voice pitch motor control by examining the spectro-temporal dynamics of EEG signals when non-musicians (NM, relative pitch (RP and absolute pitch (AP musicians maintained vocalizations of a vowel sound and received randomized ±100 cents pitch-shift stimuli in their auditory feedback. We identified a phase-synchronized (evoked fronto-central activation within the theta band (5-8 Hz that temporally overlapped with compensatory vocal responses to pitch-shifted auditory feedback and was significantly stronger in RP and AP musicians compared with non-musicians. A second component involved a non-phase-synchronized (induced frontal activation within the delta band (1-4 Hz that emerged at approximately 1 second after the stimulus onset. The delta activation was significantly stronger in the NM compared with RP and AP groups and correlated with the pitch rebound error (PRE, indicating the degree to which subjects failed to re-adjust their voice pitch to baseline after the stimulus offset. We propose that the evoked theta is a neurophysiological marker of enhanced pitch processing in musicians and reflects mechanisms by which humans incorporate auditory feedback to control their voice pitch. We also suggest that the delta activation reflects adaptive neural processes by which vocal production errors are monitored and used to update the state of sensory-motor networks for driving subsequent vocal behaviors. This notion is corroborated by our findings showing that larger PREs were associated with greater delta band activity in the NM compared with RP and AP groups. These findings provide new insights into the neural mechanisms of auditory feedback processing for vocal pitch motor control.

  11. FEEDBACK REALIZATION OF HAMILTONIAN SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    CHENG Daizhan; XI Zairong

    2002-01-01

    This paper investigates the relationship between state feedback and Hamiltonian realizatiou. First, it is proved that a completely controllable linear system always has a state feedback state equation Hamiltonian realization. Necessary and sufficient conditions are obtained for it to have a Hamiltonian realization with natural outpnt. Then some conditions for an affine nonlinear system to have a Hamiltonian realization arc given.For generalized outputs, the conditions of the feedback, keeping Hamiltonian, are discussed. Finally, the admissible feedback controls for generalized Hamiltonian systems are considered.

  12. FEEDBACK REALIZATION OF HAMILTONIAN SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    CHENGDaizhan; XIZairong

    2002-01-01

    This paper investigates the relationship between state feedback and Hamiltonican realization.Firest,it is proved that a completely controllable linear system always has a state feedback state equation Hamiltonian realization.Necessary and sufficient conditions are obtained for it to have a Hamiltonian realization with natural output.Then some conditions for an affine nonlinear system to have a Hamiltonian realization are given.some conditions for an affine nonlinear system to have a Hamiltonian realization are given.For generalized outputs,the conditions of the feedback,keeping Hamiltonian,are discussed.Finally,the admissible feedback controls for generalized Hamiltonian systems are considered.

  13. Feedback strategies for wireless communication

    CERN Document Server

    Ozbek, Berna

    2014-01-01

    This book explores the different strategies regarding the feedback information for wireless communication systems. The text analyzes the impact of quantization and correlation of channel state information (CSI) on the system performance. The authors show the effect of the reduced and limited feedback information and gives an overview about the feedback strategies in the standards. This volume presents theoretical analysis as well as practical algorithms for the required feedback information at the base stations to perform adaptive resource allocation efficiently and mitigate interference coming from other cells.

  14. Immediate Web-Based Essay Critiquing System Feedback and Teacher Follow-Up Feedback on Young Second Language Learners' Writings: An Experimental Study in a Hong Kong Secondary School

    Science.gov (United States)

    Lee, Cynthia; Cheung, William Kwok Wai; Wong, Kelvin Chi Kuen; Lee, Fion Sau Ling

    2013-01-01

    This article is an effort to add to computer-assisted language learning by extending a study on an essay critiquing system (ECS) feedback to secondary school language learners' writing. The study compared two groups of participants' performance, namely the treatment group which received both the system feedback and teacher feedback (i.e., blended…

  15. Dynamics of semiconductor microring lasers subject to on-chip filtered optical feedback

    Science.gov (United States)

    Khoder, Mulham; Friart, Gaetan; Danckaert, Jan; Erneux, Thomas; Van der Sande, Guy; Verschaffelt, Guy

    2016-04-01

    Tunable laser diodes are needed in a range of applications including wavelength division multiplexing, optical instrument testing, optical sensing and tera hertz generation. In this work, we investigate the stability of lasers which use filtered optical feedback for wavelength tuning. We investigate experimentally the dynamics induced by this on-chip filtered optical feedback. In this study, we choose to use a compact device which combines a semiconductor ring laser with on-chip filtered optical feedback to achieve wavelength tunability. The filtered optical feedback is realized by employing two arrayed waveguide gratings to split/recombine light into different wavelength channels. Semiconductor optical amplifiers are placed in the feedback loop in order to control the feedback of each wavelength channel independently. Experimental observations show that the stability of the clockwise and counterclockwise propagation modes depends on the feedback strength. Experiments also show that for a specific range of the feedback strength, anti-phase oscillations in the intensity of the clockwise and counterclockwise propagating modes can be induced. These oscillations could not be seen in the same semiconductor ring laser without filtered optical feedback. We investigate how the frequency and the amplitude of these oscillations change under the effect of filtered optical feedback. We also discuss how these anti-phase oscillations can be suppressed by properly choosing the feedback strength.

  16. Epigenetic Therapy Using Belinostat for Patients With Unresectable Hepatocellular Carcinoma: A Multicenter Phase I/II Study With Biomarker and Pharmacokinetic Analysis of Tumors From Patients in the Mayo Phase II Consortium and the Cancer Therapeutics Research Group

    Science.gov (United States)

    Yeo, Winnie; Chung, Hyun C.; Chan, Stephen L.; Wang, Ling Z.; Lim, Robert; Picus, Joel; Boyer, Michael; Mo, Frankie K.F.; Koh, Jane; Rha, Sun Y.; Hui, Edwin P.; Jeung, Hei C.; Roh, Jae K.; Yu, Simon C.H.; To, Ka F.; Tao, Qian; Ma, Brigette B.; Chan, Anthony W.H.; Tong, Joanna H.M.; Erlichman, Charles; Chan, Anthony T.C.; Goh, Boon C.

    2012-01-01

    Purpose Epigenetic aberrations have been reported in hepatocellular carcinoma (HCC). In this study of patients with unresectable HCC and chronic liver disease, epigenetic therapy with the histone deacetylase inhibitor belinostat was assessed. The objectives were to determine dose-limiting toxicity and maximum-tolerated dose (MTD), to assess pharmacokinetics in phase I, and to assess activity of and explore potential biomarkers for response in phase II. Patients and Methods Major eligibility criteria included histologically confirmed unresectable HCC, European Cooperative Oncology Group performance score ≤ 2, and adequate organ function. Phase I consisted of 18 patients; belinostat was given intravenously once per day on days 1 to 5 every 3 weeks; dose levels were 600 mg/m2 per day (level 1), 900 mg/m2 per day (level 2), 1,200 mg/m2 per day (level 3), and 1,400 mg/m2 per day (level 4). Phase II consisted of 42 patients. The primary end point was progression-free survival (PFS), and the main secondary end points were response according to Response Evaluation Criteria in Solid Tumors (RECIST) and overall survival (OS). Exploratory analysis was conducted on pretreatment tumor tissues to determine whether HR23B expression is a potential biomarker for response. Results Belinostat pharmacokinetics were linear from 600 to 1,400 mg/m2 without significant accumulation. The MTD was not reached at the maximum dose administered. Dose level 4 was used in phase II. The median number of cycles was two (range, one to 12). The partial response (PR) and stable disease (SD) rates were 2.4% and 45.2%, respectively. The median PFS and OS were 2.64 and 6.60 months, respectively. Exploratory analysis revealed that disease stabilization rate (complete response plus PR plus SD) in tumors having high and low HR23B histoscores were 58% and 14%, respectively (P = .036). Conclusion Epigenetic therapy with belinostat demonstrates tumor stabilization and is generally well-tolerated. HR23B

  17. Exact conditional distribution of a three-phase invariant in the space group P1. I. Derivation and simplification of the Fourier series.

    Science.gov (United States)

    Shmueli, U; Rabinovich, S; Weiss, G H

    1989-06-01

    An exact expression is derived for the conditional probability density function of a three-phase invariant and the general result is applied to the space group P1. The expression for the conditional density is given in terms of a sixfold Fourier series. A straightforward numerical evaluation of this series, without further analysis, is extremely time consuming. Much of the present paper is therefore devoted to an exposition of symmetries hidden in the various summations. The computational effort required for the evaluation of the above expression is thereby reduced to manageable proportions in a number of interesting cases. Results of numerical computations of the exact conditional density are given in the second paper in this series. It is also shown that the exact expression for the conditional probability reduces to that given by Cochran [Acta Cryst. (1955), 8, 473-478].

  18. Synthesis and phase behavior of dendrons derived from 3,4,5-tris(tetradecyloxy)benzoic acid with different functional groups in focal point

    Indian Academy of Sciences (India)

    Matvey Gruzdev; Ulyana Chervonova; Olga Akopova; Arkadiy Kolker

    2015-10-01

    A number of dendrons of various chain lengths derived from the esters of 3,4,5-tris(tetrade-cyloxy)benzoic acid were synthesized. These esters were used as building blocks in the design of polyester molecules. Intermediate products, such as branched compounds with variation of functional groups in focal point (aromatic acids and their benzyl esters, aldehydes of different generation) were obtained. The structure and purity of all the compounds were determined by elemental analysis, FT-IR, NMR spectroscopy, mass spectrometry (MALDI-ToF). The phase behavior was investigated by differential scanning calorimetry and confirmed by polarized optical microscopy. Consequently, it was established that the liquid-crystalline properties of this series of dendrons arise from the degree of branching. This behavior can be explained by the formation of hydrogen bonds, as well as microsegregation processes of the links of the macromolecule.

  19. Improvement of oxygen-containing functional groups on olive stones activated carbon by ozone and nitric acid for heavy metals removal from aqueous phase.

    Science.gov (United States)

    Bohli, Thouraya; Ouederni, Abdelmottaleb

    2016-08-01

    Recently, modification of surface structure of activated carbons in order to improve their adsorption performance toward especial pollutants has gained great interest. Oxygen-containing functional groups have been devoted as the main responsible for heavy metal binding on the activated carbon surface; their introduction or enhancement needs specific modification and impregnation methods. In the present work, olive stones activated carbon (COSAC) undergoes surface modifications in gaseous phase using ozone (O3) and in liquid phase using nitric acid (HNO3). The activated carbon samples were characterized using N2 adsorption-desorption isotherm, SEM, pHpzc, FTIR, and Boehm titration. The activated carbon parent (COSAC) has a high surface area of 1194 m(2)/g and shows a predominantly microporous structure. Oxidation treatments with nitric acid and ozone show a decrease in both specific surface area and micropore volumes, whereas these acidic treatments have led to a fixation of high amount of surface oxygen functional groups, thus making the carbon surface more hydrophilic. Activated carbon samples were used as an adsorbent matrix for the removal of Co(II), Ni(II), and Cu(II) heavy metal ions from aqueous solutions. Adsorption isotherms were obtained at 30 °C, and the data are well fitted to the Redlich-Peterson and Langmuir equation. Results show that oxidized COSACs, especially COSAC(HNO3), are capable to remove more Co(II), Cu(II), and Ni(II) from aqueous solution. Nitric acid-oxidized olive stones activated carbon was tested in its ability to remove metal ions from binary systems and results show an important maximum adsorbed amount as compared to single systems.

  20. Glucocorticoid feedback resistance.

    Science.gov (United States)

    De Kloet, E R; Vreugdenhil, E; Oitzl, M S; Joëls, M

    1997-01-01

    Glucocorticoid feedback resistance can be inherited or locally acquired. The implications of these two forms of resistance for disease are strikingly different. The inherited form is characterized by enhanced adrenocortical function and hypercorticism to compensate for a generalized deficit in the glucocorticoid receptor gene, but these individuals lack symptoms of Cushing's syndrome. By contrast, resistance acquired at the level of the hypothalamic corticotropin-releasing hormone (CRH) neurons is linked to hypercorticism, which is not compensatory but overexposes the rest of the body and the brain to glucocorticoids. This cell-specific glucocorticoid resistance can be acquired by genetically predisposed individuals failing to cope with (early) life events and causes enhanced vulnerability to disease-specific actions of glucocorticoids. (c) 1997, Elsevier Science Inc. (Trends Endocrinol Metab 1997; 8:26-33).

  1. Hybrid organic-inorganic silica monolith with hydrophobic/strong cation-exchange functional groups as a sorbent for micro-solid phase extraction.

    Science.gov (United States)

    Zheng, Ming-Ming; Ruan, Ge-Deng; Feng, Yu-Qi

    2009-11-06

    A hybrid organic-inorganic silica monolith with hydrophobic and strong cation-exchange functional groups was prepared and used as a sorbent for micro-solid phase extraction (micro-SPE). The hybrid silica monolith functionalized with octyl and thiol groups was conveniently synthesized by hydrolysis and polycondensation of a mixture of tetraethoxysilane (TEOS), n-octyltriethoxysilane (C8-TEOS) and 3-mercaptopropyltrimethoxysilane (MPTMS) via a two-step catalytic sol-gel process. Due to the favorable chemical reactivity of mercapto pendant moieties, the obtained hybrid monolith was oxidized using hydrogen peroxide (30%, w/w) to yield sulfonic acid groups, which provided strong cation-exchange sites. The obtained hybrid monolith was characterized by diffused infrared spectroscopy, elemental analysis, scanning electron microscopy and mercury intrusion porosimetry. The results show that the resulting monolith contains much higher carbon (31.6%) and sulfur (4.8%) contents than traditionally bonded silica materials. The extraction performance of the hybrid monolith was evaluated using sulfonamides as testing analytes by micro-SPE on-line coupled to HPLC. The results show that the hybrid monolith with hydrophobic and strong cation-exchange functional groups exhibits high extraction efficiency towards the testing analytes. The column-to-column RSD values were 1.3-9.8% for the extraction of SAs investigated. The extraction performance of the hybrid silica monolith remained practically unchanged after treated with acid (pH 1.0) and basic solutions (pH 10.5). Finally, the application of the hybrid monolith was demonstrated by micro-SPE of sulfonamide residues from milk followed by HPLC-UV analysis. The limits of detection (S/N=3) for eight SAs were found to be 1.0-3.0ng/mL in milk. The recoveries of eight SAs spiked in milk sample ranged from 80.2% to 115.6%, with relative standard deviations less than 11.8%.

  2. The Effects of an Interdependent Group Oriented Contingency and Performance Feedback on the Praise Statements of Pre-Service Teachers during a Summer Day-Camp for Children with Disabilities

    Science.gov (United States)

    Smith, Clinton; Bicard, David F.; Casey, Laura B.; Bicard, Sara C.

    2013-01-01

    Teacher praise is one of the most important elements of teaching and learning. Behavioral consultation with and without performance has been shown to be an effective method for increasing instructional praise. The authors used an ABCBC design to investigate the effects of an interdependent group oriented contingency (GC) and the GC plus…

  3. The effect of video-assisted oral feedback versus oral feedback on surgical communicative competences in undergraduate training.

    Science.gov (United States)

    Ruesseler, M; Sterz, J; Bender, B; Hoefer, S; Walcher, F

    2017-08-01

    Feedback can significantly improve future performance. Reviewing one's performance by video is discussed as useful adjunct to debriefing, particularly for non-technical skills. Communicative competencies are an essential part of daily clinical practice; thus should be taught and assessed during undergraduate training. The aim of this study was to compare the educational value of video-assisted feedback versus oral feedback in communicative competencies in the surgical context. Fourth-year medical students completed a 210-min training unit of 'taking patient's history and obtaining informed consents prior to surgery' using role plays. Oral feedback was received directly thereafter using agenda-led, outcome-based guidelines (ALOBA). In the study group, the role plays were video-taped and reviewed thereafter. Afterwards, students completed two OSCE stations, where they were assessed regarding their communicative competencies and the content of the clinical scenario. One-hundred students (49 receiving video-assisted feedback, 51 oral) participated in the study. Those receiving video-assisted feedback performed significantly better in overall score in both OSCE stations (p communicative competencies at taking patient history (p = 0.029 or better), and in 2 of 5 items at obtaining informed consent (p = 0.008, <0.001). The educational effect size for both tasks was large. Using our methodology, video-assisted feedback offered a significant educational benefit over oral feedback alone during a simulated patient encounter in a surgical context.

  4. Are there rapid feedback effects on Approximate Number System acuity?

    Science.gov (United States)

    Lindskog, Marcus; Winman, Anders; Juslin, Peter

    2013-01-01

    Humans are believed to be equipped with an Approximate Number System (ANS) that supports non-symbolic representations of numerical magnitude. Correlations between individual measures of the precision of the ANS and mathematical ability have raised the question of whether the precision can be improved by feedback training. A study (DeWind and Brannon, 2012) reported improvement in discrimination precision occurring within 600-700 trials of feedback, suggesting ANS malleability with rapidly improving acuity in response to feedback. We tried to replicate the rapid improvement in a control group design, while controlling for the use of perceptual cues. The results indicate no learning effects, but a minor constant advantage for the feedback group. The measures of motivation suggest that feedback has a positive effect on motivation and that the difference in discrimination is due to the greater motivation of participants with feedback. These results suggest that at least for adults the number sense may not respond to feedback in the short-term.

  5. Are there rapid feedback effects on Approximate Number System acuity?

    Directory of Open Access Journals (Sweden)

    Marcus eLindskog

    2013-06-01

    Full Text Available Humans are believed to be equipped with an Approximate Number System (ANS that supports non-symbolic representations of numerical magnitude. Correlations between individual measures of the precision of the ANS and mathematical ability have raised the question of whether the precision can be improved by feedback training. A study (DeWind & Brannon, 2012 reported improvement in discrimination precision occurring within 600-700 trials of feedback, suggesting ANS malleability with rapidly improving acuity in response to feedback. We tried to replicate the rapid improvement in a control group design, while controlling for the use of perceptual cues. The results indicate no learning effects, but a minor constant advantage for the feedback group. The measures of motivation suggest that feedback has a positive effect on motivation and that the difference in discrimination is due to the greater motivation of participants with feedback. These results suggest that at least for adults the number sense may not respond to feedback in the short-term.

  6. Initiatives to improve feedback culture in the final year of a veterinary program.

    Science.gov (United States)

    Warman, Sheena M; Laws, Emma J; Crowther, Emma; Baillie, Sarah

    2014-01-01

    Despite the recognized importance of feedback in education, student satisfaction with the feedback process in medical and veterinary programs is often disappointing. We undertook various initiatives to try to improve the feedback culture in the final clinical year of the veterinary program at the University of Bristol, focusing on formative verbal feedback. The initiatives included E-mailed guidelines to staff and students, a faculty development workshop, and a reflective portfolio task for students. Following these initiatives, staff and students were surveyed regarding their perceptions of formative feedback in clinical rotations, and focus groups were held to further explore issues. The amount of feedback appeared to have increased, along with improved recognition of feedback by students and increased staff confidence and competence in the process. Other themes that emerged included inconsistencies in feedback among staff and between rotations; difficulties with giving verbal feedback to students, particularly when it relates to professionalism; the consequences of feedback for both staff and students; changes and challenges in students' feedback-seeking behavior; and the difficulties in providing accurate, personal end-of-rotation assessments. This project has helped improve the feedback culture within our clinics; the importance of sustaining and further developing the feedback culture is discussed in this article.

  7. Investigating the mechanisms of seasonal ENSO phase locking bias in the ACCESS coupled model

    Science.gov (United States)

    Rashid, Harun A.; Hirst, Anthony C.

    2016-02-01

    The mechanisms of coupled model bias in seasonal ENSO phase locking are investigated using versions 1.0 and 1.3 of the CSIRO-BOM ACCESS coupled model (hereafter, ACCESS1.0 and ACCESS1.3, respectively). The two ACCESS coupled models are mostly similar in construction except for some differences, the most notable of which are in the cloud and land surface schemes used in the models. ACCESS1.0 simulates a realistic seasonal phase locking, with the ENSO variability peaking in December as in observations. On the other hand, the simulated ENSO variability in ACCESS1.3 peaks in March, a bias shown to be shared by many other CMIP5 models. To explore the mechanisms of this model bias, we contrast the atmosphere-ocean feedbacks associated with ENSO in both ACCESS model simulations and also compare the key feedbacks with those in other CMIP5 models. We find evidence that the ENSO phase locking bias in ACCESS1.3 is primarily caused by incorrect simulations of the shortwave feedback and the thermocline feedback in this model. The bias in the shortwave feedback is brought about by unrealistic SST-cloud interactions leading to a positive cloud feedback bias that is largest around March, in contrast to the strongest negative cloud feedback found in ACCESS1.0 simulations and observations at that time. The positive cloud feedback bias in ACCESS1.3 is the result of a dominant role played by the low-level clouds in its modeled SST-cloud interactions in the tropical eastern Pacific. Two factors appear to contribute to the dominance of low-level clouds in ACCESS1.3: the occurrence of a stronger mean descending motion bias and, to a lesser extent, a larger mean SST cold bias during March-April in ACCESS1.3 than in ACCESS1.0. A similar association is found between the positive cloud feedback bias and the biases in spring-time mean descending motion and SST for a group of CMIP5 models that show a seasonal phase locking bias similar to ACCESS1.3. Significant differences are also found

  8. Effects of generic versus non-generic feedback on motor learning in children.

    Directory of Open Access Journals (Sweden)

    Suzete Chiviacowsky

    Full Text Available Non-generic feedback refers to a specific event and implies that performance is malleable, while generic feedback implies that task performance reflects an inherent ability. The present study examined the influences of generic versus non-generic feedback on motor performance and learning in 10-year-old children. In the first experiment, using soccer ball kicking at a target as a task, providing participants with generic feedback resulted in worse performance than providing non-generic feedback, after both groups received negative feedback. The second experiment measured more permanent effects. Results of a retention test, performed one day after practicing a throwing task, showed that participants who received non-generic feedback during practice outperformed the generic feedback group, after receiving a negative feedback statement. The findings demonstrate the importance of the wording of feedback. Even though different positive feedback statements may not have an immediate influence on performance, they can affect performance, and presumably individuals' motivation, when performance is (purportedly poor. Feedback implying that performance is malleable, rather than due to an inherent ability, seems to have the potential to inoculate learners against setbacks--a situation frequently encountered in the context of motor performance and learning.

  9. Bandwidth enhancement and time-delay signature suppression of chaotic signal from an optical feedback semiconductor laser by using cross phase modulation in a highly nonlinear fiber loop mirror

    Science.gov (United States)

    Wang, Liang-Yan; Zhong, Zhu-Qiong; Wu, Zheng-Mao; Lu, Dong; Chen, Xi; Chen, Jun; Xia, Guang-Qiong

    2016-11-01

    Based on a nonlinear fiber loop mirror (NOLM) composed of a fiber coupler (FC) and a highly nonlinear fiber (HNLF), a scheme is proposed to simultaneously realize the bandwidth enhancement and the time-delay signature (TDS) suppression of a chaotic signal generated from an external cavity optical feedback semiconductor laser. The simulation results show that, after passing through the NOLM, the bandwidth of chaotic signal can be efficiently enhanced and the TDS can be well suppressed under suitable operation parameters. Furthermore, the influences of the power-splitting ratio of the FC, the averaged power of the chaotic signal entering into the FC and the length of the HNLF on the chaotic bandwidth and TDS are analyzed, and the optimized parameters are determined.

  10. Fast feedback in classroom practice

    NARCIS (Netherlands)

    Emmett, K.M.; Klaassen, K.; Eijkelhof, H.

    2009-01-01

    In this article we describe one application of the fast feedback method (see Berg 2003 Aust. Sci. Teach. J. 28–34) in secondary mechanics education. Two teachers tried out a particular sequence twice, in consecutive years, once with and once without the use of fast feedback. We found the method to b

  11. Feedback on household electricity consumption

    DEFF Research Database (Denmark)

    Grønhøj, Alice; Thøgersen, John

    2011-01-01

    consumption, we evaluate the effects of giving households detailed feedback about their electricity consumption on a small liquid crystal display (LCD) screen. Twenty Danish households participated in the study over a 5-month period. A new feedback system was developed in a user-involved innovation process...

  12. Designing feedback: multimodality and specificity

    NARCIS (Netherlands)

    Ludden, Geke Dina Simone; Sugiyama, Kazuo

    2013-01-01

    Now that many of us carry around devices that are equipped with sensors (e.g., smartphones with accelerometers) we can use these sensors to measure behavior. The data thus captured can be used to give someone feedback about this behavior. These feedback mechanisms are often used in so called smart

  13. Feedback traps for virtual potentials

    CERN Document Server

    Gavrilov, Momčilo

    2016-01-01

    Feedback traps are tools for trapping and manipulating single charged objects, such as molecules in solution. An alternative to optical tweezers and other single-molecule techniques, they use feedback to counteract the Brownian motion of a molecule of interest. The trap first acquires information about a molecule's position and then applies an electric feedback force to move the molecule. Since electric forces are stronger than optical forces at small scales, feedback traps are the best way to trap single molecules without "touching" them. Feedback traps can do more than trap molecules: They can also subject a target object to forces that are calculated to be the gradient of a desired potential function U(x). If the feedback loop is fast enough, it creates a virtual potential whose dynamics will be very close to those of a particle in an actual potential U(x). But because the dynamics are entirely a result of the feedback loop--absent the feedback, there is only an object diffusing in a fluid--we are free to ...

  14. Fast Feedback in Classroom Practice

    Science.gov (United States)

    Emmett, Katrina; Klaassen, Kees; Eijkelhof, Harrie

    2009-01-01

    In this article we describe one application of the fast feedback method (see Berg 2003 "Aust. Sci. Teach. J." 28-34) in secondary mechanics education. Two teachers tried out a particular sequence twice, in consecutive years, once with and once without the use of fast feedback. We found the method to be successful, and the data that we obtained…

  15. The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Kauffman, Jon S; Duff, Robert J; Beaucage, Serge L

    2008-04-04

    Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

  16. ASYNCHRONOUS COMPUTER-MEDIATED CORRECTIVE FEEDBACK AND THE CORRECT USE OF PREPOSITIONS: Is It Really Effective?

    Directory of Open Access Journals (Sweden)

    Seyyed Behrooz HOSSEINI

    2012-08-01

    Full Text Available An area that has recently attracted increasing attention is providing feedback on learners’ writing accuracy through the Internet. However, research in this area has largely focused on synchronous communication, i.e., chatting, with fewer studies assessing asynchronous technologies, i.e., e-mailing. Therefore, this study investigates the effectiveness of asynchronous computer-mediated corrective feedback-explicit and implicit, on increasing the correct use of prepositions. Forty-five Iranian elementary EFL learners at the ILI in Tehran were randomly assigned to two experimental groups, receiving explicit and implicit corrective feedback respectively, and one control group receiving no corrective feedback. Each group included 15 participants. After the treatment, a post-test was administered to assess the probable increase in the correct use of prepositions for the experimental groups compared to the control group. Analysis of the results through a one-way ANOVA revealed that the experimental group 1 who received explicit corrective feedback significantly outperformed the experimental group 2 and the control group. The experimental group 2 who received implicit corrective feedback showed no significant improvement over the experimental group 1 and the control group. Computer-mediated communication, asynchronous CMC, synchronous CMC, the Internet, corrective feedback, e-mail, chat. Although the findings support the current view on feedback through technology, due to the scarcity of research, more investigation is merited as there is much to gain regarding this burgeoning field.

  17. Understanding Feedback: A Learning Theory Perspective

    Science.gov (United States)

    Thurlings, Marieke; Vermeulen, Marjan; Bastiaens, Theo; Stijnen, Sjef

    2013-01-01

    This article aims to review literature on feedback to teachers. Because research has hardly focused on feedback among teachers, the review's scope also includes feedback in classrooms. The review proposes that the effectiveness of feedback and feedback processes depend on the learning theory adhered to. Findings show that regardless of the…

  18. The Sound of Feedback in Higher Education

    Science.gov (United States)

    Savin-Baden, Maggi

    2010-01-01

    Whilst there is considerable literature on feedback for students and on the use of audio feedback, literature in the area of podcasting assignment feedback (PAF) remains sparse. Partly, this may be due to a lack of clarity about what counts as feedback, the way in which feedback is located pedagogically and the relationship between feedback…

  19. Snap, Crackle, Pop: sub-grid supernova feedback in AMR simulations of disk galaxies

    CERN Document Server

    Rosdahl, Joakim; Dubois, Yohan; Kimm, Taysun; Teyssier, Romain

    2016-01-01

    We compare 5 sub-grid models for supernova (SN) feedback in adaptive mesh refinement (AMR) simulations of isolated dwarf and L-star disk galaxies with 20-40 pc resolution. The models are thermal dump, stochastic thermal, 'mechanical' (injecting energy or momentum depending on the resolution), kinetic, and delayed cooling feedback. We focus on the ability of each model to suppress star formation and generate outflows. Our highest-resolution runs marginally resolve the adiabatic phase of the feedback events, which correspond to 40 SN explosions, and the first three models yield nearly identical results, possibly indicating that kinetic and delayed cooling feedback converge to wrong results. At lower resolution all models differ, with thermal dump feedback becoming inefficient. Thermal dump, stochastic, and mechanical feedback generate multiphase outflows with mass loading factors $\\beta \\ll 1$, which is much lower than observed. For the case of stochastic feedback we compare to published SPH simulations, and fi...

  20. Feedback systems for linear colliders

    CERN Document Server

    Hendrickson, L; Himel, Thomas M; Minty, Michiko G; Phinney, N; Raimondi, Pantaleo; Raubenheimer, T O; Shoaee, H; Tenenbaum, P G

    1999-01-01

    Feedback systems are essential for stable operation of a linear collider, providing a cost-effective method for relaxing tight tolerances. In the Stanford Linear Collider (SLC), feedback controls beam parameters such as trajectory, energy, and intensity throughout the accelerator. A novel dithering optimization system which adjusts final focus parameters to maximize luminosity contributed to achieving record performance in the 1997-98 run. Performance limitations of the steering feedback have been investigated, and improvements have been made. For the Next Linear Collider (NLC), extensive feedback systems are planned as an intregal part of the design. Feedback requiremetns for JLC (the Japanese Linear Collider) are essentially identical to NLC; some of the TESLA requirements are similar but there are significant differences. For NLC, algorithms which incorporate improvements upon the SLC implementation are being prototyped. Specialized systems for the damping rings, rf and interaction point will operate at hi...