WorldWideScience

Sample records for group conference attracted

  1. The Relationship of Interpersonal Attraction and Attraction to Group in a Growth Group Setting.

    Science.gov (United States)

    Evans, Nancy J.

    1984-01-01

    Investigated the relationship of interpersonal attraction and attraction to groups. Students (N=56) participating in growth groups completed the Group Attitude Scale and individual rating scales early, midway, and late in the group. Data indicated an increasing relationship between interpersonal and group attraction throughout the life of the…

  2. A group's physical attractiveness is greater than the average attractiveness of its members : The group attractiveness effect

    NARCIS (Netherlands)

    van Osch, Y.M.J.; Blanken, Irene; Meijs, Maartje H. J.; van Wolferen, Job

    2015-01-01

    We tested whether the perceived physical attractiveness of a group is greater than the average attractiveness of its members. In nine studies, we find evidence for the so-called group attractiveness effect (GA-effect), using female, male, and mixed-gender groups, indicating that group impressions of

  3. A group's physical attractiveness is greater than the average attractiveness of its members : The group attractiveness effect

    NARCIS (Netherlands)

    van Osch, Y.M.J.; Blanken, Irene; Meijs, Maartje H. J.; van Wolferen, Job

    2015-01-01

    We tested whether the perceived physical attractiveness of a group is greater than the average attractiveness of its members. In nine studies, we find evidence for the so-called group attractiveness effect (GA-effect), using female, male, and mixed-gender groups, indicating that group impressions of

  4. A group's physical attractiveness is greater than the average attractiveness of its members: the group attractiveness effect.

    Science.gov (United States)

    van Osch, Yvette; Blanken, Irene; Meijs, Maartje H J; van Wolferen, Job

    2015-04-01

    We tested whether the perceived physical attractiveness of a group is greater than the average attractiveness of its members. In nine studies, we find evidence for the so-called group attractiveness effect (GA-effect), using female, male, and mixed-gender groups, indicating that group impressions of physical attractiveness are more positive than the average ratings of the group members. A meta-analysis on 33 comparisons reveals that the effect is medium to large (Cohen's d = 0.60) and moderated by group size. We explored two explanations for the GA-effect: (a) selective attention to attractive group members, and (b) the Gestalt principle of similarity. The results of our studies are in favor of the selective attention account: People selectively attend to the most attractive members of a group and their attractiveness has a greater influence on the evaluation of the group. © 2015 by the Society for Personality and Social Psychology, Inc.

  5. Groups and Geometries : Siena Conference

    CERN Document Server

    Kantor, William; Lunardon, Guglielmo; Pasini, Antonio; Tamburini, Maria

    1998-01-01

    On September 1-7, 1996 a conference on Groups and Geometries took place in lovely Siena, Italy. It brought together experts and interested mathematicians from numerous countries. The scientific program centered around invited exposi­ tory lectures; there also were shorter research announcements, including talks by younger researchers. The conference concerned a broad range of topics in group theory and geometry, with emphasis on recent results and open problems. Special attention was drawn to the interplay between group-theoretic methods and geometric and combinatorial ones. Expanded versions of many of the talks appear in these Proceedings. This volume is intended to provide a stimulating collection of themes for a broad range of algebraists and geometers. Among those themes, represented within the conference or these Proceedings, are aspects of the following: 1. the classification of finite simple groups, 2. the structure and properties of groups of Lie type over finite and algebraically closed fields of f...

  6. Some Measures of Interpersonal Attraction and Group Cohesiveness.

    Science.gov (United States)

    Aiken, Lewis R.

    1992-01-01

    The computation and determination of the statistical significance of three coefficients of interpersonal attractiveness or cohesiveness in task-oriented or social groups are described. The approach is based on ratings made by each member of a group of all other group members. Experience using the technique is reviewed. (SLD)

  7. Visibility and anonymity effects on attraction and group cohesiveness

    NARCIS (Netherlands)

    Lea, Martin; Spears, Russell; Watt, Susan E.

    2007-01-01

    This study investigated attraction and group cohesiveness under different visibility and anonymity conditions for social categories that differed in their capacity to be visually cued. Using computer-mediated communication in 36 mixed gender (visually cued category) and nationality (non-visually

  8. Visibility and anonymity effects on attraction and group cohesiveness

    NARCIS (Netherlands)

    Lea, Martin; Spears, Russell; Watt, Susan E.

    2007-01-01

    This study investigated attraction and group cohesiveness under different visibility and anonymity conditions for social categories that differed in their capacity to be visually cued. Using computer-mediated communication in 36 mixed gender (visually cued category) and nationality (non-visually cue

  9. Visibility and anonymity effects on attraction and group cohesiveness

    NARCIS (Netherlands)

    Lea, Martin; Spears, Russell; Watt, Susan E.

    2007-01-01

    This study investigated attraction and group cohesiveness under different visibility and anonymity conditions for social categories that differed in their capacity to be visually cued. Using computer-mediated communication in 36 mixed gender (visually cued category) and nationality (non-visually cue

  10. PREFACE: Electron Microscopy and Analysis Group Conference (EMAG2015)

    Science.gov (United States)

    MacLaren, Ian

    2015-10-01

    2015 marked a new venture for the EMAG group of the Institute of Physics in that the conference was held in conjunction with the MMC2015 conference at the wonderful Manchester Central conference centre. As anyone who was there would be able to confirm, this went exceptionally well and was a really vibrant and top quality conference. The oral sessions were filled with good talks, the poster sessions were very lively, and there was a good balance between oral sessions with a specifically "EMAG" identity, and the integration into a larger conference with the ability to switch between up to six parallel sessions covering physical sciences, techniques, and life sciences. The large conference also attracted a wide range of exhibitors, and this is essential for the ongoing success of all of our work, in a field that is very dependent on continued technical innovation and on collaborations between academic researchers and commercial developers of microscopes, holders, detectors, spectrometers, sample preparation equipment, and software, among other things. As has long been the case at EMAG, all oral and poster presenters were invited to submit papers for consideration for the proceedings. As ever, these papers were independently reviewed by other conference attendees, with the aim of continuing the long tradition of the EMAG proceedings being a top quality, peer-reviewed publication, worthy of reference in future years. Whilst I recognise that not all presenters were able to submit papers to the proceedings (for instance due to the need not to prejudice publication in some other journals, or due to avoiding duplicate publication of data), we are gratified that our presenters submitted as many papers as they did. The 41 papers included provide an interesting snapshot of many of the areas covered in the conference presentations, including functional materials, coatings, 3D microscopy, FIB and SEM, nanomaterials, magnetic and structural materials, advances in EM techniques

  11. National GAP Conference 2007-Discussion Groups Report

    Science.gov (United States)

    Ratz, Joan M.; Lamb, Berton Lee

    2010-01-01

    We led two discussion groups during the 2007 National GAP Conference. These discussion groups provided information to help develop a survey of National Gap Analysis Program (GAP) data users. One group discussed technical issues, and the second group discussed the use of GAP data for decisionmaking. Themes emerging from the technical issues group included concerns about data quality, need for information on how to use data, and passive data distribution. The decisionmaking discussion included a wide range of topics including the need to understand presentation of information, the need to connect with and understand users of data, the revision of GAP's mission, and the adaptability of products and data. The decisionmaking group also raised concerns regarding technical issues. One conclusion is that a deep commitment to ongoing information transfer and support is a key component of success for the GAP program.

  12. Striving for Group Agency: Threat to Personal Control Increases the Attractiveness of Agentic Groups

    Directory of Open Access Journals (Sweden)

    Janine eStollberg

    2015-05-01

    Full Text Available When their sense of personal control is threatened people try to restore perceived control through the social self. We propose that it is the perceived agency of ingroups that provides the self with a sense of control. In three experiments, we for the first time tested the hypothesis that threat to personal control increases the attractiveness of being part or joining those groups that are perceived as coherent entities engaging in coordinated group goal pursuit (agentic groups but not of those groups whose agency is perceived to be low. Consistent with this hypothesis we found in Study 1 (N = 93 that threat to personal control increased ingroup identification only with task groups, but not with less agentic types of ingroups that were made salient simultaneously. Furthermore, personal control threat increased a sense of collective control and support within the task group, mediated through task-group identification (indirect effects. Turning to groups people are not (yet part of, Study 2 (N = 47 showed that personal control threat increased relative attractiveness ratings of small groups as possible future ingroups only when the relative agency of small groups was perceived to be high. Perceived group homogeneity or social power did not moderate the effect. Study 3 (N = 78 replicated the moderating role of perceived group agency for attractiveness ratings of entitative groups, whereas perceived group status did not moderate the effect. These findings extend previous research on group-based control, showing that perceived agency accounts for group-based responses to threatened control.

  13. Striving for group agency: threat to personal control increases the attractiveness of agentic groups.

    Science.gov (United States)

    Stollberg, Janine; Fritsche, Immo; Bäcker, Anna

    2015-01-01

    When their sense of personal control is threatened people try to restore perceived control through the social self. We propose that it is the perceived agency of ingroups that provides the self with a sense of control. In three experiments, we for the first time tested the hypothesis that threat to personal control increases the attractiveness of being part or joining those groups that are perceived as coherent entities engaging in coordinated group goal pursuit (agentic groups) but not of those groups whose agency is perceived to be low. Consistent with this hypothesis we found in Study 1 (N = 93) that threat to personal control increased ingroup identification only with task groups, but not with less agentic types of ingroups that were made salient simultaneously. Furthermore, personal control threat increased a sense of collective control and support within the task group, mediated through task-group identification (indirect effects). Turning to groups people are not (yet) part of, Study 2 (N = 47) showed that personal control threat increased relative attractiveness ratings of small groups as possible future ingroups only when the relative agency of small groups was perceived to be high. Perceived group homogeneity or social power did not moderate the effect. Study 3 (N = 78) replicated the moderating role of perceived group agency for attractiveness ratings of entitative groups, whereas perceived group status did not moderate the effect. These findings extend previous research on group-based control, showing that perceived agency accounts for group-based responses to threatened control.

  14. Attracted to power: challenge/threat and promotion/prevention focus differentially predict the attractiveness of group power.

    Science.gov (United States)

    Scholl, Annika; Sassenrath, Claudia; Sassenberg, Kai

    2015-01-01

    Depending on their motivation, individuals prefer different group contexts for social interactions. The present research sought to provide more insight into this relationship. More specifically, we tested how challenge/threat and a promotion/prevention focus predict attraction to groups with high- or low-power. As such, we examined differential outcomes of threat and prevention focus as well as challenge and promotion focus that have often been regarded as closely related. According to regulatory focus, individuals should prefer groups that they expect to "feel right" for them to join: Low-power groups should be more attractive in a prevention (than a promotion) focus, as these groups suggest security-oriented strategies, which fit a prevention focus. High-power groups should be more attractive in a promotion (rather than a prevention) focus, as these groups are associated with promotion strategies fitting a promotion focus (Sassenberg et al., 2007). In contrast, under threat (vs. challenge), groups that allow individuals to restore their (perceived) lack of control should be preferred: Low-power groups should be less attractive under threat (than challenge) because they provide low resources which threatened individuals already perceive as insufficient and high-power groups might be more attractive under threat (than under challenge), because their high resources allow individuals to restore control. Two experiments (N = 140) supported these predictions. The attractiveness of a group often depends on the motivation to engage in what fits (i.e., prefer a group that feels right in the light of one's regulatory focus). However, under threat the striving to restore control (i.e., prefer a group allowing them to change the status quo under threat vs. challenge) overrides the fit effect, which may in turn guide individuals' behavior in social interactions.

  15. Family group conferences in youth justice.

    Science.gov (United States)

    Mutter, Robin; Shemmings, David; Dugmore, Paul; Hyare, Mina

    2008-05-01

    This paper discusses part of an evaluation of the 'Family Group Conference (FGC) Project for Young People Who Offend' within a large social services department ('Exshire'). The evaluation covers all 30 family group conferences during a 15-month period from September 2000 to December 2001. This article presents the findings relating to young people along with changes in their psychosocial profile using a modified version of the Strengths and Difficulties Questionnaire (SDQ; Goodman 1997). The views of all participants were positive, with the majority saying they would recommend FGCs to others. FGC was felt by most participants to have brought about changes in the way young people view the world, partly by helping them to accept the reality of offending in a way that had not previously been possible. It provided victims with a unique opportunity to become involved in the youth justice system, recognising them as key stakeholders as a result of a crime. This process left most victims with a sense of satisfaction and resolution. Average SDQ scores were lower following FGC for the 12 young people who responded to follow-up interviews. Although there are a number of restorative justice projects using FGC in youth justice, we believe this project is among the first in the UK to establish the use of the New Zealand model with its emphasis on 'private family time' as an ongoing established service. Although the data were collected before 2002, the project contains unique features which we believe should be brought to the attention of the wider academic and practice community given that FGC is still a fairly new, unexplored and under-evaluated phenomenon in youth justice. There is currently a need for more research looking at the use of FGC in relation to young offenders.

  16. [Emotional and instrumental orientations in interpersonal attraction and their relationship to group norms in a group-work setting].

    Science.gov (United States)

    Hatano, J

    1996-10-01

    This study investigated the relationship between group norms and interpersonal attraction in group work setting. It may be assumed that interpersonal attraction, like group functions, has two conflictive orientations: instrumentality and emotionality. Relationship of the two orientations in interpersonal attraction to group norms was examined in two experiments. Results of Experiment 1, with 66 female university students, suggested that specific contents of group norms influenced both instrumental and emotional attraction. Experiment 2, with 60 female university students, indicated that emotional attraction had normative influence on task selection and goal setting. Conflicting dynamics of the two orientations in group-work setting are discussed.

  17. International Conference on Groups and Geometries

    CERN Document Server

    Groups of Exceptional Type, Coxeter Groups and Related Geometries

    2014-01-01

    The book deals with fundamental structural aspects of algebraic and simple groups, Coxeter groups and the related geometries and buildings. All contributing authors are very active researchers in the topics related to the theme of the book. Some of the articles provide the latest developments in the subject; some provide an overview of the current status of some important problems in this area; some survey an area highlighting the current developments; and some provide an exposition of an area to collect problems and conjectures. It is hoped that these articles would be helpful to a beginner to start independent research on any of these topics, as well as to an expert to know some of the latest developments or to consider some problems for investigation.

  18. The 11th China Conference on Investment Casting Attracted more than 400 Attendees

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    @@ On October 20-23, 2009, the 11th China Conference on Investment Casting, organized by the Investment Casting Branch of China Foundry Association, was held at the Yatai Grand Hotel in Shijiazhuang City, Hebei Province. The theme of the conference was "Strategy on the Healthy and Sustainable Development of China Investment Casting Industry in the New Situation". The 428 delegates participated in the conference, among which 324 came from the 188 investment casting manufacturers and research institutions, and 104 from the 76 suppliers of raw & auxiliary materials and equipment.

  19. The 17th Annual Magnet Technology Conference Hosted By CERN Is Proving That Opposites Attract...

    CERN Multimedia

    2001-01-01

    Hundreds were drawn together by the 17th Magnet Technology Conference, the largest conference devoted to magnets in the world. Thirty-six years ago about 50 physicists and engineers came together at SLAC, Stanford, to have a symposium on magnet technology. Simple as it seemed at the moment, it was the first time that anyone seriously considered building superconducting magnets and was the birth of the Magnet Technology (MT) conference. The conference has occurred every two years since that time and had its most recent incarnation, MT-17, hosted by CERN just last week at the International Conference Centre here in Geneva. With so much innovative work being done with magnets in the LHC and its experiments (ATLAS, CMS, Alice and LHCb), having an MT conference hosted by CERN in Geneva was expected. However, what was not expected was the level of interest with which MT-17 was met. 'We are victims of our own success', says Romeo Perin who was one of the 50 physicists/engineers who attended the Stanford symposium a...

  20. Two replications of "Hierarchical encoding makes individuals in a group seem more attractive (2014; Experiment 4".

    Directory of Open Access Journals (Sweden)

    Yuko Ojiro

    2015-06-01

    Full Text Available The cheerleader effect implies that a person in a group look like more attractive than in isolation. Walker and Vul (2014 reported results supporting the existence of the cheerleader effect. We replicated Walker and Vul’s Experiment 4, which manipulated group size. Their participants were asked to rate attractiveness of each female face image in a group (one of 4, 9, or 16 members and in isolation and revealed that attractiveness ratings significantly increased in all the group conditions. We performed two direct replications of this experiment using Japanese participants. As a result, at least one experiment yielded a pattern of results similar to those of the previous study, although the effect was not significant and the effect size was small.

  1. CPAFFC Working Group Attends Sino-African Initiative Conference

    Institute of Scientific and Technical Information of China (English)

    Duan; Jun

    2013-01-01

    <正>A CPAFFC working group led by its Vice President Xie Yuan attended the 2013 Sino-African Initiative (SAI) Conference sponsored by Sister Cities International (SCI) of the United States and organized by the Eastern Africa Sister Cities (EASC) in Nairobi, Kenya, from January 31 to February 2. About 60 officials and representatives of sister cities associations from China, the United States, Kenya, Nigeria and

  2. Honeybee drones are attracted by groups of consexuals in a walking simulator.

    Science.gov (United States)

    Brandstaetter, Andreas Simon; Bastin, Florian; Sandoz, Jean-Christophe

    2014-04-15

    During the mating season, honeybee males, the drones, gather in congregation areas 10-40 m above ground. When a receptive female, a queen, enters the congregation, drones are attracted to her by queen-produced pheromones and visual cues and attempt to mate with the queen in mid-air. It is still unclear how drones and queens find the congregations. Visual cues on the horizon are most probably used for long-range orientation. For shorter-range orientation, however, attraction by a drone-produced aggregation pheromone has been proposed, yet so far its existence has not been confirmed conclusively. The low accessibility of congregation areas high up in the air is a major hurdle and precise control of experimental conditions often remains unsatisfactory in field studies. Here, we used a locomotion compensator-based walking simulator to investigate drones' innate odor preferences under controlled laboratory conditions. We tested behavioral responses of drones to 9-oxo-2-decenoic acid (9-ODA), the major queen-produced sexual attractant, and to queen mandibular pheromone (QMP), an artificial blend of 9-ODA and several other queen-derived components. While 9-ODA strongly dominates the odor bouquet of virgin queens, QMP rather resembles the bouquet of mated queens. In our assay, drones were attracted by 9-ODA, but not by QMP. We also investigated the potential attractiveness of male-derived odors by testing drones' orientation responses to the odor bouquet of groups of 10 living drones or workers. Our results demonstrate that honeybee drones are attracted by groups of other drones (but not by workers), which may indicate a role of drone-emitted cues for the formation of congregations.

  3. Family group conferences in public mental health care : An exploration of opportunities

    NARCIS (Netherlands)

    de Jong, Gideon; Schout, Gert

    2011-01-01

    Family group conferences are usually organized in youth care settings, especially in cases of (sexual) abuse of children and domestic violence. Studies on the application of family group conferences in mental health practices are scarce, let alone in a setting even more specific, such as public ment

  4. Family group conferences in public mental health care : An exploration of opportunities

    NARCIS (Netherlands)

    de Jong, Gideon; Schout, Gert

    2011-01-01

    Family group conferences are usually organized in youth care settings, especially in cases of (sexual) abuse of children and domestic violence. Studies on the application of family group conferences in mental health practices are scarce, let alone in a setting even more specific, such as public ment

  5. Family group conferences in public mental health care : An exploration of opportunities

    NARCIS (Netherlands)

    de Jong, Gideon; Schout, Gert

    Family group conferences are usually organized in youth care settings, especially in cases of (sexual) abuse of children and domestic violence. Studies on the application of family group conferences in mental health practices are scarce, let alone in a setting even more specific, such as public

  6. Beijing Press Conference of American WWⅡ POWs Memorial Visiting Group

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    <正>Organized by the Truth Council for WWⅡ in Asia,a 10-member delegation of American WWⅡ POWs and their relatives visited China,during which they gave a press conference at the CPAFFC on May 25. The American veterans spread friendship between the American and Chinese people,and the love of world peace by reviewing history and sharing their experience during WWⅡ. Journalists and photographers from dozens of news agencies,namely Xinhua News Agency,People’s Daily,CCTV,Beijing Youth Daily,Reuters,etc. attended the conference.

  7. EDITORIAL: Electron Microscopy and Analysis Group Conference 2011 (EMAG 2011)

    Science.gov (United States)

    Moebus, Guenter; Walther, Thomas; Brydson, Rik; Ozkaya, Dogan; MacLaren, Ian; Donnelly, Steve; Nellist, Pete; Li, Ziyou; Baker, Richard; Chiu, YuLung

    2012-07-01

    The biennial EMAG conference has established a strong reputation as a key event for the national and international electron microscopy community. In 2011 the meeting was held at The University of Birmingham, and I must first take this opportunity of thanking Birmingham for hosting the conference and for the excellent support we received from the local organisers. As a committee, we are delighted to see that enthusiasm for the EMAG conference series continues to be strong. We received more than 160 submitted abstracts, and 157 delegates attended the meeting. The scientific programme organiser, Ian MacLaren, put together an exciting programme. Plenary lectures were presented by Professor Knut Urban, Dr Frances Ross and Dr Richard Henderson. There were a further 10 invited speakers, from the UK, Continental Europe, Australia, the USA and Japan. The quality of the contributed oral and poster presentations was also very high. EMAG is keen to encourage student participation, and a winner and two runners-up were presented with prizes for the best oral and poster presentations from a student. I am always struck by the scientific quality of the oral and poster contributions and the vibrant discussions that occur both in the formal sessions and in the exhibition space at EMAG. I am convinced that a crucial part of maintaining that scientific quality is the opportunity that is offered of having a paper fully reviewed by two internationally selected referees and published in the Journal of Physics: Conference Series. For many students, this is the first fully reviewed paper they publish. I hope that you, like me, will be struck by the scientific quality of the 87 papers that follow, and that you will find them interesting and informative. Finally I must thank the platinum sponsors for their support of the meeting. These were Gatan, Zeiss, FEI, JEOL and Hitachi. I must also thank the European Microscopy Society for their generous sponsorship and support for the travel costs of

  8. 9th Annual Conference of the North East Polytechnics Mathematical Modelling & Computer Simulation Group

    CERN Document Server

    Bradley, R

    1987-01-01

    In recent years, mathematical modelling allied to computer simulation has emerged as en effective and invaluable design tool for industry and a discipline in its own right. This has been reflected in the popularity of the growing number of courses and conferences devoted to the area. The North East Polytechnics Mathematical Modelling and Computer Simulation Group has a balanced representation of academics and industrialists and, as a Group, has the objective of promoting a continuing partnership between the Polytechnics in the North East and local industry. Prior to the present conference the Group has organised eight conferences with a variety of themes related to mathematical modelling and computer simulation. The theme chosen for the Polymodel 9 Conference held in Newcastle upon Tyne in May 1986 was Industrial Vibration Modelling, which is particularly approp riate for 'Industry Year' and is an area which continues to present industry and academics with new and challenging problems. The aim of the Conferen...

  9. Lessons learned using Web conference technology for online focus group interviews.

    Science.gov (United States)

    Tuttas, Carol A

    2015-01-01

    Researchers use Internet technology for data collection in qualitative studies. In the literature there are published accounts of synchronous (real-time) and more commonly, asynchronous (not-real-time) focus group data collection methods supported by Internet technology in the form of email correspondence, LISTSERVs, discussion boards, and chat rooms. Real-time audiovisual Web conference technology offers qualitative researchers a promising alternative means to carry out focus groups. In this methodological article I describe how I used Web conference technology to host online focus groups for a qualitative study about job integration experiences of travel nurses geographically dispersed across the United States. I describe lessons learned from the use of this innovative method for qualitative data collection, including a brief overview about the use of dictation software for transcription. This new knowledge is useful to researchers considering Web conference technology to carry out focus group data collection in qualitative research.

  10. Interest groups at transnational negotiation conferences: goals, strategies, interactions, and influence

    NARCIS (Netherlands)

    Hanegraaff, M.

    2015-01-01

    Interest groups partake in transnational negotiation conferences en masse. This is surprising given that the chances for influencing policymaking at these venues appear to be slim while the costs of participation are high. This amounts to an interesting question: why do so many interest groups atten

  11. Interest groups at transnational negotiation conferences: goals, strategies, interactions, and influence

    NARCIS (Netherlands)

    Hanegraaff, M.

    2015-01-01

    Interest groups partake in transnational negotiation conferences en masse. This is surprising given that the chances for influencing policymaking at these venues appear to be slim while the costs of participation are high. This amounts to an interesting question: why do so many interest groups

  12. Leaders are more attractive: birds with bigger yellow breast patches are followed by more group-mates in foraging groups.

    Science.gov (United States)

    Tóth, Zoltán; Griggio, Matteo

    2011-01-01

    Social network theory provides a perfect tool to better understand the population-level consequences of how individuals interact and make their decisions; however, this approach is generally overlooked among evolutionary biologists interested in social relationships. Here, we used social network analysis to examine the patterns of leader-follower interactions in relation to individual characteristics in foraging groups of free-living rock sparrows (Petronia petronia). We found that yellow feather ornamentation, a carotenoid-based trait, was the best predictor of leadership: birds with bigger ornaments exerted greater influence in the foraging groups and were followed by more group-mates than less elaborate individuals. An individual's tendency for eliciting followings was not influenced by sex, condition or the level of parental investment. None of the above individual characteristics had significant effect on the tendency of individuals to follow others. Our results indicate that a sexually selected trait can also play a significant role in group coordination and social organization of a species.

  13. Leaders are more attractive: birds with bigger yellow breast patches are followed by more group-mates in foraging groups.

    Directory of Open Access Journals (Sweden)

    Zoltán Tóth

    Full Text Available Social network theory provides a perfect tool to better understand the population-level consequences of how individuals interact and make their decisions; however, this approach is generally overlooked among evolutionary biologists interested in social relationships. Here, we used social network analysis to examine the patterns of leader-follower interactions in relation to individual characteristics in foraging groups of free-living rock sparrows (Petronia petronia. We found that yellow feather ornamentation, a carotenoid-based trait, was the best predictor of leadership: birds with bigger ornaments exerted greater influence in the foraging groups and were followed by more group-mates than less elaborate individuals. An individual's tendency for eliciting followings was not influenced by sex, condition or the level of parental investment. None of the above individual characteristics had significant effect on the tendency of individuals to follow others. Our results indicate that a sexually selected trait can also play a significant role in group coordination and social organization of a species.

  14. Revolution or flight from reality? The IoP Education Group Conference 1999

    Science.gov (United States)

    Dobson, Ken

    1999-09-01

    The 1999 Education Group Conference attracted some 60 teachers and educationalists to the salubrious outskirts of the city of Leicester on 2 3 July. The title of the conference was The ICT revolution: just how will ICT change my physics teaching? For those not au courant with current jargon ICT stands for Information and Communications Technology, or, in short, computers. ICT was certainly to the fore from the presenters, who practised what they preached. Every talk was delivered using Microsoft PowerPoint, obsolescent overhead projectors serving only as laptop stands. Animated slides, computer generated and controlled, were projected on to a screen and supplemented as required by (fairly) instant live excerpts from relevant computer programs. The theme of the conference was set by the opening discussion led by the trio PowerPoint, Ian Lawrence (chairman of the Institute of Physics Education Group) and Philip Britton (vice-chair). They gave us the slogan Physics first! with technology, however brilliant or politically correct, only significant and valuable insofar as it helped students learn physics. And learning is a social activity: any system that places one child in front of a computer screen for hours on end should be suspect. Much the same could be said of a voltmeter, of course, and the minimal situation must include a pair of students and a teacher as well as the apparatus. Another message: think of the computer system as just another piece of equipment whose use is determined by the learning task, not as an item that determines the task. Figure 1. Jason Wye, Secretary of the Education Group, opening the Conference. It may not be surprising that the level-headed delegates agreed whole-heartedly with these sentiments, but they were also supported and reinforced by all the speakers as the conference went on. The first speaker was Jerry Wellington, ex-physics teacher, now at the University of Sheffield. In his presentation `Multimedia in science teaching

  15. Taking Ownership of Learning in a Large Class: Group Projects and a Mini-Conference

    Science.gov (United States)

    Borda, Emily J.; Kriz, George S.; Popejoy, Kate L.; Dickinson, Alison K.; Olson, Amy L.

    2009-01-01

    Helping students take ownership of their learning is often a challenge in a large lecture course. In this article, the authors describe a nature of science-oriented group project in a chemistry course in which students gave presentations in concurrent conference sessions as well as its impact on student learning as evidenced through multiple data…

  16. Taking Ownership of Learning in a Large Class: Group Projects and a Mini-Conference

    Science.gov (United States)

    Borda, Emily J.; Kriz, George S.; Popejoy, Kate L.; Dickinson, Alison K.; Olson, Amy L.

    2009-01-01

    Helping students take ownership of their learning is often a challenge in a large lecture course. In this article, the authors describe a nature of science-oriented group project in a chemistry course in which students gave presentations in concurrent conference sessions as well as its impact on student learning as evidenced through multiple data…

  17. A summary of the Nordic-group conference on safety management

    Energy Technology Data Exchange (ETDEWEB)

    Salo, I. [Lund University (Sweden); Svenson, O. [Stockholm University (Sweden)

    2005-04-01

    The report summarizes the Nordic-group conference on safety management, which took place in Lund, Sweden on October 28-29, 2004. The theme-group was originally created by researchers who had a common interest in cooperation, sharing their results, and discuss topics focusing on safety management and safety culture in nuclear power production, but also in other technologies involving risks. The research has, so far, basically been related to the areas of MTO, partly from a psychological perspective, but also from other perspectives. Today, the group consists primarily of members from Sweden, Finland and Norway. During the last three years the group has gathered twice a year. (au)

  18. The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Phillips, Lawrence R; Beaucage, Serge L

    2002-09-06

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  19. The Tavistock Group Relations Conference: Description and Comparison with Laboratory Training. A CRUSK-ISR Working Paper.

    Science.gov (United States)

    Crowfoot, James E.

    Laboratory training and the Tavistock Conference, two types of experiential learning, contrast in important ways. They are designed to respond to different societal issues and make different types of responses to these issues. Tavistock conferences focus consciously and exclusively on group operation, role, role relationships, intergroup…

  20. International Conference on Harmonisation; choice of control group and related issues in clinical trials; availability. Notice.

    Science.gov (United States)

    2001-05-14

    The Food and Drug Administration (FDA) is announcing the availability of a guidance entitled "E10 Choice of Control Group and Related Issues in Clinical Trials." The guidance was prepared under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The guidance sets forth general principles that are relevant to all controlled trials and are especially pertinent to the major clinical trials intended to demonstrate drug (including biological drug) efficacy. The guidance describes the principal types of control groups and discusses their appropriateness in particular situations. The guidance is intended to assist sponsors and investigators in the choice of control groups for clinical trials.

  1. Conference

    CERN Multimedia

    Association du personnel

    2013-01-01

    A new integrated model for dementia management A Greek interdisciplinary scientific group proposes new technologies, novel neuroscientific concepts and advanced socio-economic and administrational organisation to ease the management of dementia in elderly Dr. Kostas Petsanis Thursday 23 May from 6.30 p.m. to 8.00 p.m. Council Chamber The general economic crisis while being a nightmare for the society, it has also given way to a new kind of reorganization and living. Elderly people come up against many health problems. A society of elders needs flexible solutions in every day living in order to avoid social and health stalemates. The mood and cognition in the elderly turn out to be doubtful and problematic. These situations give rise to a continuously growing number of depressed and demented elderly people with catastrophic results to the quality of life and social management. Αn interdisciplinary group of greek scientists proposes a novel advanced process of ambient interaction for elderly peo...

  2. Distance learning strategies for weight management utilizing online social networks versus group phone conference call.

    Science.gov (United States)

    Willis, Erik A; Szabo-Reed, Amanda N; Ptomey, Lauren T; Steger, Felicia L; Honas, Jeffery J; Al-Hihi, Eyad M; Lee, Robert; Lee, Jaehoon; Oh, Youngha; Washburn, Richard A; Donnelly, Joseph E

    2017-06-01

    The increase in technology and online social networks (OSNs) may present healthcare providers with an innovative modality for delivering weight management programmes that could have an impact on health care at the population level. The objective of this study was to evaluate the feasibility and efficacy of using an OSN to deliver a weight loss programme to inform future, large-scale trials. Seventy individuals (age = 47 ± 12.4, minority = 24.3%) with obesity (BMI = 36.2 ± 4.0) completed a 6-month weight loss intervention and were randomized to either a conference call or OSN delivery group. Weight loss was achieved by reducing energy intake by 500-700 kcal·d(-1) below estimated total daily energy expenditure and progressing physical activity to 300 min/week. Behavioural weight loss strategies were delivered weekly throughout the intervention. Conference call and OSN groups produced clinically meaningful weight loss of ≥5% from baseline to 6 months (phone = -6.3 ± 6.4%, OSN = -5.8 ± 6.7%). There was no significant difference in weight change between groups (p = 0.765). The phone and OSN groups met the American Heart Association/American College of Cardiology/The Obesity Society's Guidelines by reducing baseline weight by 5-10% within 6 months. OSNs appear to be a viable delivery platform for weight loss interventions; however, larger scale adequately powered trials are needed.

  3. Fatal attraction

    DEFF Research Database (Denmark)

    Jensen, Kim Ebensgaard

    2012-01-01

    of the use of the Danish ihjel-construction which accounts for patterns of attraction of construction-verb attraction, patterns of productivity, and various types of subconstructions, including item- and item-class-based ones and metaphorical extensions. The description of the ihjel-construction should also...

  4. Goal Setting during Early Childhood Parent-Teacher Conferences: A Comparison of Three Groups of Parents

    Science.gov (United States)

    Cheatham, Gregory A.; Ostrosky, Michaelene M.

    2013-01-01

    Parent-teacher communication and partnerships are important in children's early years. This study compared goal setting, conducted in English, during Head Start parent-teacher conferences with native Spanish speaking, Latino bilingual, and native English speaking parents and their children's teachers. To understand conference goal-setting…

  5. Goal Setting during Early Childhood Parent-Teacher Conferences: A Comparison of Three Groups of Parents

    Science.gov (United States)

    Cheatham, Gregory A.; Ostrosky, Michaelene M.

    2013-01-01

    Parent-teacher communication and partnerships are important in children's early years. This study compared goal setting, conducted in English, during Head Start parent-teacher conferences with native Spanish speaking, Latino bilingual, and native English speaking parents and their children's teachers. To understand conference goal-setting…

  6. European Group for Atomic Spectroscopy. Summaries of contributions, eleventh annual conference, Paris-Orsay, July 10-13, 1979

    Energy Technology Data Exchange (ETDEWEB)

    1979-07-01

    Summaries are presented of talks given at the eleventh conference of the European group for atomic spectroscopy. Topics covered include: lifetimes; collisions; line shape; hyperfine structure; isotope shifts; saturation spectroscopy; Hanle effect; Rydberg levels; quantum beats; helium and helium-like atoms; metrology; and molecules. (GHT)

  7. An Investigation of Sex Roles, Dimensions of Interpersonal Attraction and Communication Behavior In a Small Group Communication Exercise.

    Science.gov (United States)

    McDowell, Earl E.; McDowell, Carlene E.

    Biological sex, social area, task area, and psychological sex were used as independent variables when 72 high school students in speech communication classes rated themselves and other members of small discussion groups. The results for males, females, and composite groups revealed that psychological sex was a more significant discriminating…

  8. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (24th, Hiroshima, Japan, July 23-27, 2000), Volume 1.

    Science.gov (United States)

    Nakahara, Tadao, Ed.; Koyama, Masataka, Ed.

    The first volume of the 24th annual conference of the International Group for the Psychology of Mathematics Education includes plenary addresses, plenary panel discussions, research forum, project groups, discussion groups, short oral communications, and poster presentations. (ASK)

  9. 2nd International Gliomatosis Cerebri Working Group Conference | Center for Cancer Research

    Science.gov (United States)

    On June 22-23, the NIH hosted the 2nd Gliomatosis Cerebri International Conference that brought together leading neuro-oncologists, neuroscientists and families who have lost a child to the disease. Learn more...

  10. Assertiveness and Physical Attractiveness.

    Science.gov (United States)

    Kleim, David M.; And Others

    Earlier research investigating the relationship between physical attractiveness and assertiveness found that physically attractive females were more assertive than other females. To investigate this relationship further and to broaden the scope of the study, 69 students were videotaped in groups of five to ten while responding to open-ended…

  11. Altruists Attract

    Directory of Open Access Journals (Sweden)

    Daniel Farrelly

    2007-04-01

    Full Text Available Explaining human cooperation continues to present a challenge because it goes beyond what is predicted by established theories of kinship and reciprocal altruism. Little attention has been paid to the sexual selection hypothesis that proposes that cooperation can act as a display that attracts mates. The costs of cooperating are then offset not by kinship or reciprocation but by increased mating success. Here we present results from a series of experiments which show that, as predicted by the sexual selection hypothesis, people preferentially direct cooperative behavior towards more attractive members of the opposite sex. Furthermore, cooperative behavior increases the perceived attractiveness of the cooperator. Economically costly behaviors can therefore bring benefits through mate choice and sexual selection should be regarded as an evolutionary mechanism capable of promoting cooperation.

  12. AQSIQ Sends Working Groups to Implement the Spirit of National Quality Working Conference

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ On August 1st, the General Administration of Quality Supervision, Inspection and Quarantine (AQSIQ) convened a conference to transmit the spirit of national quality work and study an important speech regarding standards from Wen Jiabao,Premier of the State Council.

  13. Fatal attraction

    DEFF Research Database (Denmark)

    Jensen, Kim Ebensgaard

    2012-01-01

    The purpose of this paper is two-fold. Firstly, it presents an argument for usage-based inheritance models over complete inheritance models in construction grammar. It is argued that, with the principle of inductive language learning as their foundation, usage-based inheritance models allow...... for redundancies and incongruities in construction networks which enables linguists to take into account details of language use, which would otherwise not be facilitated in complete inheritance models. Secondly, making use of the method of collostructional analysis, the article offers a corpus-based description...... of the use of the Danish ihjel-construction which accounts for patterns of attraction of construction-verb attraction, patterns of productivity, and various types of subconstructions, including item- and item-class-based ones and metaphorical extensions. The description of the ihjel-construction should also...

  14. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 5: surgical margins.

    NARCIS (Netherlands)

    Tan, P.H.; Cheng, L.; Srigley, J.R.; Griffiths, D.; Humphrey, P.A.; Kwast, T.H. van der; Montironi, R.; Wheeler, T.M.; Delahunt, B.; Egevad, L.; Epstein, J.I.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston, made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to surgical margin assessment were coordinated by working group 5. Pathologists agreed

  15. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (15th, Assisi, Italy, June 29-July 4, 1991), Volume 3.

    Science.gov (United States)

    Furinghetti, Fulvia, Ed.

    Research reports from the annual conference of the International Group for the Psychology of Mathematics Education include: "La construcion algorithmique: niveaux ou stades?" (Mesquita); "For Establishing the Generality of Conjectures" (Miyazaki); "Teachers' Attitudes Towards Mathematics and Mathematics Teaching:…

  16. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 5: surgical margins.

    NARCIS (Netherlands)

    Tan, P.H.; Cheng, L.; Srigley, J.R.; Griffiths, D.; Humphrey, P.A.; Kwast, T.H. van der; Montironi, R.; Wheeler, T.M.; Delahunt, B.; Egevad, L.; Epstein, J.I.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston, made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to surgical margin assessment were coordinated by working group 5. Pathologists agreed

  17. Proceedings of the 27th International Group for the Psychology of Mathematics Education Conference Held Jointly with the 25th PME-NA Conference (Honolulu, Hawaii, July 13-18, 2003). Volume 1

    Science.gov (United States)

    Pateman, Neil A., Ed; Dougherty, Barbara J., Ed.; Zilliox, Joseph T., Ed.

    2003-01-01

    This volume of the 27th International Group for the Psychology of Mathematics Education Conference presents papers from: plenary panels; research forums; working sessions; discussion groups; short oral communications; and poster sessions from the meeting. Plenary lectures included: (1) Studying and Capturing the Complexity of Practice: The Case of…

  18. Suicidal Ideation and Attempt among Adolescents Reporting "Unsure" Sexual Identity or Heterosexual Identity Plus Same-Sex Attraction or Behavior: Forgotten Groups?

    Science.gov (United States)

    Zhao, Yue; Montoro, Richard; Igartua, Karine; Thombs, Brett D.

    2010-01-01

    Objective: To compare risk of suicide ideation and attempts in adolescents with 1) gay, lesbian, or bisexual (GLB) identity, 2) "unsure" identity, or 3) heterosexual identity with same-sex attraction/fantasy or behavior, to heterosexual identity without same-sex attraction/fantasy or behavior. Method: A total of 1,856 students 14 years…

  19. Meeting report: 4th ISIRV antiviral group conference: Novel antiviral therapies for influenza and other respiratory viruses.

    Science.gov (United States)

    McKimm-Breschkin, Jennifer L; Fry, Alicia M

    2016-05-01

    The International Society for Influenza and other Respiratory Virus Diseases (isirv) held its 4th Antiviral Group Conference at the University of Texas on 2-4 June, 2015. With emerging resistance to the drugs currently licensed for treatment and prophylaxis of influenza viruses, primarily the neuraminidase inhibitor oseltamivir phosphate (Tamiflu) and the M2 inhibitors amantadine and rimantadine, and the lack of effective interventions against other respiratory viruses, the 3-day programme focused on the discovery and development of inhibitors of several virus targets and key host cell factors involved in virus replication or mediating the inflammatory response. Virus targets included the influenza haemagglutinin, neuraminidase and M2 proteins, and both the respiratory syncytial virus and influenza polymerases and nucleoproteins. Therapies for rhinoviruses and MERS and SARS coronaviruses were also discussed. With the emerging development of monoclonal antibodies as therapeutics, the potential implications of antibody-dependent enhancement of disease were also addressed. Topics covered all aspects from structural and molecular biology to preclinical and clinical studies. The importance of suitable clinical trial endpoints and regulatory issues were also discussed from the perspectives of both industry and government. This meeting summary provides an overview, not only for the conference participants, but also for those interested in the current status of antivirals for respiratory viruses.

  20. African Attraction

    Institute of Scientific and Technical Information of China (English)

    JANKOT

    2004-01-01

    Edward Xu is excited. The 55-year-old Shanghai businessman is talking about his latest project in Gabon,one of Africa's richest countries. “We build these pre-fabricated houses in China, equip them with furniture and electronics and then send the whole thing in cargos.” Once the shipment arrives in Gabon, Xu and his company, Shanghai New Years International Group, will unwrap them, put them up in a two square kilometer piece of land granted by the local government and finally sell the estates at a cost of over US$120,000 each.

  1. The Colombian conference of bishops and its participation in peace negotiations with insurgent groups: origins and discussions (1982-1990

    Directory of Open Access Journals (Sweden)

    Andrea Cristancho

    2011-06-01

    Full Text Available This paper analyses the most representative academic works about the participation of the Colombian Bishops’ Conference in negotiations with insurgent groups during the eighties, focusing on their perspective about their vision of peace. In that sense, this paper analyses how the Colombian clergy adapted to the national reality their perspective of peace, identifying the main debates and the wide variety of answers, focusing on two main issues: the relevance of establishing a relationship between the need to address social issues with the overcoming of violence and the participation of bishops and priests in the talks with the insurgency. As a result of these discussions, the Colombian Catholic Church gained greater unity in action on peace and conflict.

  2. Genomics:GTL Contractor-Grantee Workshop IV and Metabolic Engineering Working Group Inter-Agency Conference on Metabolic Engineering 2006

    Energy Technology Data Exchange (ETDEWEB)

    Mansfield, Betty Kay [ORNL; Martin, Sheryl A [ORNL

    2006-02-01

    Welcome to the 2006 joint meeting of the fourth Genomics:GTL Contractor-Grantee Workshop and the six Metabolic Engineering Working Group Inter-Agency Conference. The vision and scope of the Genomics:GTL program continue to expand and encompass research and technology issues from diverse scientific disciplines, attracting broad interest and support from researchers at universities, DOE national laboratories, and industry. Metabolic engineering's vision is the targeted and purposeful alteration of metabolic pathways to improve the understanding and use of cellular pathways for chemical transformation, energy transduction, and supramolecular assembly. These two programs have much complementarity in both vision and technological approaches, as reflected in this joint workshop. GLT's challenge to the scientific community remains the further development and use of a broad array of innovative technologies and computational tools to systematically leverage the knowledge and capabilities brought to us by DNA sequencing projects. The goal is to seek a broad and predictive understanding of the functioning and control of complex systems--individual microbes, microbial communities, and plants. GTL's prominent position at the interface of the physical, computational, and biological sciences is both a strength and challenge. Microbes remain GTL's principal biological focus. In the complex 'simplicity' of microbes, they find capabilities needed by DOE and the nation for clean and secure energy, cleanup of environmental contamination, and sequestration of atmospheric carbon dioxide that contributes to global warming. An ongoing challenge for the entire GTL community is to demonstrate that the fundamental science conducted in each of your research projects brings us a step closer to biology-based solutions for these important national energy and environmental needs.

  3. High mobility group A1 enhances tumorigenicity of human cholangiocarcinoma and confers resistance to therapy

    DEFF Research Database (Denmark)

    Quintavalle, Cristina; Burmeister, Katharina; Piscuoglio, Salvatore

    2017-01-01

    High mobility group A1 (HMGA1) protein has been described to play an important role in numerous types of human carcinoma. By the modulation of several target genes HMGA1 promotes proliferation and epithelial-mesenchymal transition of tumor cells. However, its role in cholangiocarcinoma (CCA) has ...

  4. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (16th, Durham, NH, August 6-11, 1992). Volumes I-III.

    Science.gov (United States)

    Geeslin, William, Ed.; Graham, Karen, Ed.

    The Proceedings of PME-XVI has been published in three volumes because of the large number of papers presented at the conference. Volume 1 contains: (1) brief reports from each of the 11 standing Working Groups on their respective roles in organizing PME-XVI; (2) brief reports from 6 Discussion Groups; and (3) 35 research reports covering authors…

  5. Proceedings of the Annual Conference of the International Group for the Psychology of Mathematics Education with the North American Chapter 12th PME-NA Conference (14th, Mexico, July 15-20, 1990), Volume 2.

    Science.gov (United States)

    Booker, George, Ed.; Cobb, Paul, Ed.; de Mendicuti, Teresa N., Ed.

    This proceedings of the annual conference of the International Group for the Psychology of Mathematics Education (PME) includes the following research papers: "Children's Connections among Representations of Mathematical Ideas" (A. Alston & C.A. Maher); "Algebraic Syntax Errors: A Study with Secondary School Children" (A. Avila, F. Garcia, & T.…

  6. Proceedings of the Annual Conference of the International Group for the Psychology of Mathematics Education with the North American Chapter 12th PME-NA Conference (14th, Mexico, July 15-20, 1990), Volume 3.

    Science.gov (United States)

    Booker, George, Ed.; Cobb, Paul, Ed.; de Mendicuti, Teresa N.

    This proceedings of the annual conference of the International Group for the Psychology of Mathematics Education (PME) contains the following research papers: "The Construct Theory of Rational Numbers: Toward a Semantic Analysis" (M. Behr & G. Harel); "Reflections on Dealing: An Analysis of One Child's Interpretations" (G. Davis); "About…

  7. Proceedings of the Annual Conference of the International Group for the Psychology of Mathematics Education with the North American Chapter 12th PME-NA Conference (14th, Mexico, July 15-20, 1990), Volume 1.

    Science.gov (United States)

    Booker, George, Ed.; Cobb, Paul, Ed.; de Mendicuti, Teresa N., Ed.

    This proceedings of the annual conference of the International Group for the Psychology of Mathematics Education (PME) includes the following papers: "The Knowledge of Cats: Epistemological Foundations of Mathematics Education" (R.B. Davis) and "PME Algebra Research: A Working Perspective" (E. Filloy); "Some Misconceptions in Calculus: Anecdotes…

  8. Proceedings of the 27th International Group for the Psychology of Mathematics Education Conference Held Jointly with the 25th PME-NA Conference (Honolulu, Hawaii, July 13-18, 2003). Volume 4

    Science.gov (United States)

    Pateman, Neil A., Ed; Dougherty, Barbara J., Ed.; Zilliox, Joseph T., Ed.

    2003-01-01

    This volume of the 27th International Group for the Psychology of Mathematics Education Conference includes the following research reports: (1) Improving Decimal Number Conception by Transfer from Fractions to Decimals (Irita Peled and Juhaina Awawdy Shahbari); (2) The Development of Student Teachers' Efficacy Beliefs in Mathematics during…

  9. Proceedings of the 27th International Group for the Psychology of Mathematics Education Conference Held Jointly with the 25th PME-NA Conference (Honolulu, Hawaii, July 13-18, 2003). Volume 2

    Science.gov (United States)

    Pateman, Neil A., Ed.; Dougherty, Barbara J., Ed.; Zilliox, Joseph T., Ed.

    2003-01-01

    This volume of the 27th International Group for the Psychology of Mathematics Education Conference presents the following research reports: (1) Text Talk, Body Talk, Table Talk: A Design of Ratio and Proportion as Classroom Parallel Events (Dor Abrahamson); (2) Generalizing the Context and Generalising the Calculation (Janet Ainley); (3) Interview…

  10. Proceedings of the 27th International Group for the Psychology of Mathematics Education Conference Held Jointly with the 25th PME-NA Conference (Honolulu, Hawaii, July 13-18, 2003). Volume 3

    Science.gov (United States)

    Pateman, Neil A., Ed; Dougherty, Barbara J., Ed.; Zilliox, Joseph T., Ed.

    2003-01-01

    This volume of the 27th International Group for the Psychology of Mathematics Education Conference includes the following research reports: (1) The Affective Views of Primary School Children (Peter Grootenboer); (2) Theoretical Model of Analysis of Rate Problems in Algebra (Jose Guzman, Nadine Bednarz and Fernando Hitt); (3) Locating Fractions on…

  11. The low-luminosity galaxy population in the NGC 5044 Group (Conference proceeding)

    CERN Document Server

    Cellone, S A; Cellone, Sergio A.; Buzzoni, Alberto

    2006-01-01

    Detailed surface photometry for 79 (mostly dwarf) galaxies in the NGC 5044 Group area is analysed, revealing the existence of different morphologies among objects originally classified as early-type dwarfs. Particularly, a significant fraction of bright dwarf "ellipticals" show a distinct bulge+disc structure; we thus re-classify these objects as dwarf lenticulars (dS0). Our finding points at a possible scenario where these systems are the remnants of "harassed" disc galaxies. This is emphasized by the discovery of a few objects with hints for very low-surface brightness spiral-like structure. The colours, structure, and spatial distribution of the different galaxy types suggest that our classification may indeed be separating objects with different origins and/or evolutionary paths.

  12. Distribution of genes conferring combined resistance to tetracycline and minocycline among group B streptococcal isolates from humans and various animals.

    Science.gov (United States)

    Schwarz, S; Wibawan, I W; Lämmler, C

    1994-11-01

    Forty-nine tetracycline and minocycline resistant streptococci of serological group B isolated from humans, cattle, pigs and nutrias were investigated for the presence of genes conferring this combined resistance. Southern blot hybridization of EcoRI-digested chromosomal DNA of the bacteria revealed for 39 of the cultures a hybridization signal with tet(M), for four of the cultures a hybridization signal with tet(O) and for none of the cultures a hybridization signal with the tet(Q) gene probe. The restriction endonuclease digested and blotted DNA of six tetracycline and minocycline resistant group B streptococci did not hybridize with any of the available gene probes. The tet(M) gene probes recognized complementary sequences of EcoRI fragments of approximately 10.5 kb and 21.5 kb, the tet(O) gene probe hybridized with fragments of approximately 19 kb. The hybridization of the tet(M) gene probe in two different patterns appeared to be related to the origin of the cultures.

  13. Activities of the task group 8 on thin film PV module reliability (Conference Presentation)

    Science.gov (United States)

    Dhere, Neelkanth G.

    2016-09-01

    Photovoltaic (PV) modules and systems are being used increasingly to provide renewable energy to schools, residences, small businesses and utilities. At this time, the home owners and small businesses have considerable difficulty in detecting module and/or system degradation and especially enforcing warranty. It needs to be noted that IEC 61215-1 (test req.), -2 (test proc.) and -1-1 (c-Si) are forecasted to be circulated end of Feb 2016 and only editorial changes would be possible. 61215 series does include thin film technologies and would be replacing 61646. Moreover, IEC 61215-1, section 7.2 power output and electric circuitry does contain significant changes to acceptance criteria regarding rated label values, particularly rated power. Even though it is believed that consensus could be achieved within IEC TC82 WG2, some of the smaller players that do not participate actively in IEC TC82 - may not be surprised and must be informed. The other tech specific parts 61215-1-2 (CdTe), -1-3 (a-Si, µc-Si) and -1-4 (CIS, CIGS) are out for comments. The IEC closing date was January 29, 2016. The additions alternative damp heat (DH) test proposed Solar Frontier is being reviewed. In the past, only 600 V systems were permitted in the grid-connected residential and commercial systems in the US. The US commercial systems can now use higher voltage (1,000-1500V) in order to reduce BOS component costs. It is believed that there would not be any problems. The Task Group 8 is collecting data on higher voltage systems.

  14. Proceedings of the Annual Conference of the International Group for the Psychology of Mathematics Education (13th, Paris, France, July 9-13, 1989), Volume 2.

    Science.gov (United States)

    Vergnaud, Gerard, Ed.; Rogalski, Janine, Ed.; Artique, Michele, Ed.

    This proceedings of the annual conference of the International Group for the Psychology of Mathematics Education (PME) includes the following research papers: "Logo et Symetrie Centrale" (E. Gallou-Dumiel); "About Continuous Operator Subconstruct in Rational Numbers" (J. Gimenez); "Constructivist Epistemology and Discovery Learning in Mathematics"…

  15. Proceedings of the Annual Conference of the International Group for the Psychology of Mathematics Education (13th, Paris, France, July 9-13, 1989), Volume 3.

    Science.gov (United States)

    Vergnaud, Gerard, Ed.; Rogalski, Janine, Ed.; Artique, Michele, Ed.

    This proceedings of the annual conference of the International Group for the Psychology of Mathematics Education (PME) includes the following research papers: "A Model of Understanding Two-Digit Numeration and Computation" (H. Murray & A. Olivier); "The Computer Produces a Special Graphic Situation of Learning the Change of Coordinate System" (S.…

  16. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME 20) (20th, Valencia, Spain, July 8-12, 1996). Addenda.

    Science.gov (United States)

    Puig, Luis, Ed.; Gutierrez, Angel, Ed.

    This booklet is an addendum to the conference proceedings of the 20th annual meeting of the International Group for the Psychology of Mathematics Education (PME 20). It contains three reactions to the research forum: (1) "Mathematizing: The 'Real' Need for Representational Fluency" (R. Lesh); (2) "Mathematics Teacher Development: An Alternative…

  17. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (24th, Hiroshima, Japan, July 23-27, 2000), Volume 2.

    Science.gov (United States)

    Nakahara, Tadao, Ed.; Koyama, Masataka, Ed.

    The second volume of the 24th annual conference of the International Group for the Psychology of Mathematics Education contains full research report papers. Papers include: (1) "What you see is what you get: The influence of visualization on the perception of data structures" (Dan Aharoni); (2) "Exploring the transparency of graphs and graphing"…

  18. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (24th, Hiroshima, Japan, July 23-27, 2000), Volume 4.

    Science.gov (United States)

    Nakahara, Tadao, Ed.; Koyama, Masataka, Ed.

    The fourth volume of the 24th annual conference of the International Group for the Psychology of Mathematics Education contains full research report papers. Papers include: (1) "What are essential to apply the 'discovery' function of proof in lower secondary school mathematics?" (Mikio Miyazaki); (2) "The anatomy of an 'open' mathematics lesson"…

  19. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (15th, Assisi, Italy, June 29-July 4, 1991), Volume 1.

    Science.gov (United States)

    Furinghetti, Fulvia, Ed.

    This document, the first of three volumes, reports on the 15th annual conference of the International Group for the Psychology of Mathematics Education (PME) held in Italy 1991. Plenary addresses and speakers are: "Social Interaction and Mathematical Knowledge" (B. M. Bartolini); "Meaning: Image Schemata and Protocols" (W.…

  20. Proceedings of the Conference of the International Group for the Psychology of Mathematics Education (PME) (24th, Hiroshima, Japan, July 23-27, 2000), Volume 3.

    Science.gov (United States)

    Nakahara, Tadao, Ed.; Koyama, Masataka, Ed.

    The third volume of the 24th annual conference of the International Group for the Psychology of Mathematics Education contains full research report papers. Papers include: (1) "Mathematics classrooms functioning as communities of inquiry: Possibilities and constraints for changing practice" (Susie Groves, Brian Doig, and Laurance Splitter); (2)…

  1. The Effectiveness of Writing Conferences and Peer Response Groups Strategies on the EFL Secondary Students' Writing Performance and Their Self Efficacy (A Comparative Study)

    Science.gov (United States)

    Hussein, Mohamed Abdel Hadi; Al Ashri, Ismail Ibrahim El shirbini Abdel fattah

    2013-01-01

    The present study aimed at identifying the necessary writing performance skills for the first year secondary stage students. These skills are necessary for writing the compositions. In this study, the writing conferences and peer response groups strategies were used to develop the students' writing skills, improve their achievement and performance…

  2. Proceedings of the Annual Conference of the International Group for the Psychology of Mathematics Education (13th, Paris, France, July 9-13, 1989), Volume 1.

    Science.gov (United States)

    International Group for the Psychology of Mathematics Education.

    This proceedings of the annual conference of the International Group for the Psychology of Mathematics Education (PME) includes the following papers: "Transformations Accelerees de l'Education Scientifique Pendant la Revolution Francaise" (Jean Dhombres); "Building on the Knowledge of Students and Teachers" (Thomas P. Carpenter & Elizabeth…

  3. Proceedings of the 2013 sorghum improvement conference of north america

    Science.gov (United States)

    The 2013 Sorghum Improvement Conference of North America (SICNA) meeting was held at the International Cultural Center, Texas Tech University, Lubbock, Texas, from August 28-30, 2013. The meeting attracted a large group of participants from a wide spectrum of the sorghum research community, represe...

  4. Resolution VII International Conference Working Group on Birds of Prey of Northern Eurasia “Birds of Prey of Northern Eurasia: Problems and Adaptation Under Modern Conditions”

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2017-01-01

    Full Text Available From 19 to 24 September, 2016 VII International Conference of the Working Group on Raptors of Northern Eurasia “Birds of prey of Northern Eurasia: problems and adaptation under modern conditions” was held on the basis of the Sochi National Park. Materials for the conference were presented by 198 ornithologists from Russia, Ukraine, Belarus, Kazakhstan, Moldova, Turkmenistan, Austria, Great Britain, Hungary, Mongolia, Poland, Estonia and the USA, who published 148 articles in two collections “Birds of prey of Northern Eurasia” and “Palearctic Harriers”.

  5. Understanding the complexity of trans fatty acid reduction in the American diet: American Heart Association Trans Fat Conference 2006: report of the Trans Fat Conference Planning Group.

    Science.gov (United States)

    Eckel, Robert H; Borra, Susan; Lichtenstein, Alice H; Yin-Piazza, Shirley Y

    2007-04-24

    A 2-day forum was convened to discuss the current status and future implications of reducing trans fatty acids without increasing saturated fats in the food supply while maintaining functionality and consumer acceptance of packaged, processed, and prepared foods. Attendees represented the agriculture and oilseed industry and oil processing, food manufacturing, food service, government, food technology, and health and nutrition disciplines. Presentations included food science behind fatty acid technology, the health science of dietary fatty acids, alternatives to trans fatty acids, and the use of alternatives in food manufacturing and food service. The reduction of trans fatty acids in the food supply is a complex issue involving interdependent and interrelated stakeholders. Actions to reduce trans fatty acids need to carefully consider both intended and unintended consequences related to nutrition and public health. The unintended consequence of greatest concern is that fats and oils high in saturated fats, instead of the healthier unsaturated fats, might be used to replace fats and oils with trans fatty acids. Many different options of alternative oils and fats to replace trans fatty acids are available or in development. Decisions on the use of these alternatives need to consider availability, health effects, research and development investments, reformulated food quality and taste, supply-chain management, operational modifications, consumer acceptance, and cost. The conference demonstrated the value of collaboration between the food industry and health and nutrition professionals, and this conference model should be used to address other food development, processing, and/or technology issues.

  6. Antipsychotics and physical attractiveness.

    Science.gov (United States)

    Seeman, Mary V

    2011-10-01

    Antipsychotics are effective in treating the symptoms of schizophrenia, but they may induce adverse effects, some of which-those that impact negatively on physical appearance-have not been sufficiently discussed in the psychiatric literature. Through a narrative review, to catalog antipsychotic side effects that interfere with physical attractiveness and to suggest ways of addressing them. PubMed databases were searched for information on the association between "antipsychotic side effects" and "attractiveness" using those two search phrases plus the following terms: "weight," "teeth," "skin," "hair," "eyes," "gait," "voice," "odor." Data from relevant qualitative and quantitative articles were considered, contextualized, and summarized. Antipsychotics, as a group, increase weight and may lead to dry mouth and bad breath, cataracts, hirsutism, acne, and voice changes; they may disturb symmetry of gait and heighten the risk for tics and spasms and incontinence, potentially undermining a person's attractiveness. Clinicians need to be aware of the impact of therapeutic drugs on appearance and how important this issue is to patients. Early in treatment, they need to plan preventive and therapeutic strategies.

  7. Inverted micelle formation of cell-penetrating peptide studied by coarse-grained simulation: Importance of attractive force between cell-penetrating peptides and lipid head group

    Science.gov (United States)

    Kawamoto, Shuhei; Takasu, Masako; Miyakawa, Takeshi; Morikawa, Ryota; Oda, Tatsuki; Futaki, Shiroh; Nagao, Hidemi

    2011-03-01

    Arginine-rich peptide and Antennapedia are cell-penetrating peptides (CPPs) which have the ability to permeate plasma membrane. Deformation of the plasma membrane with CPPs is the key to understand permeation mechanism. We investigate the dynamics of CPP and the lipid bilayer membrane by coarse-grained simulation. We found that the peptide makes inverted micelle in the lipid bilayer membrane, when the attractive potential between the peptide and lipid heads is strong. The inverted micelle is formed to minimize potential energy of the peptide. For vesicle membrane, the peptide moves from the outer vesicle to the inner vesicle through the membrane. The translocation of the peptide suggests inverted micelle model as a possible mechanism of CPPs.

  8. Duesseldorf :An Attractive City for Investments in Germany

    Institute of Scientific and Technical Information of China (English)

    Li Zhen

    2009-01-01

    @@ At the 3rd Chinese Enterprises Outbound Investment Conference,a seminar was sponsored by Duesseldorf municipal government,a city of 600,000 inhabitants in Germany,in hopes of attracting Chinese investments.

  9. Euclidean gravity attracts

    CERN Document Server

    De Bakker, B V; Bakker, Bas de; Smit, Jan

    1994-01-01

    We look at gravitational attraction in simplicial gravity using the dynamical triangulation method. On the dynamical triangulation configurations we measure quenched propagators of a free massive scalar field. The masses measured from these propagators show that gravitational attraction is present.

  10. Conference Report: CAQD Conference 2013

    Directory of Open Access Journals (Sweden)

    Christina Silver

    2013-05-01

    Full Text Available Nestled on the banks of the river Lahn in central Germany, the 15th CAQD conference was held at Marburg. A beautiful provincial town, it is one of very few that was spared the bombings of WWII; now providing the perfect backdrop for meeting to discuss developments in qualitative technology. This was the second international conference in the series with more than 140 delegates from 14 countries, including: Canada, Brazil, Portugal, the UK, as well as Germany. Hosted by MAGMA, the Marburg Research Group for Methodology and Evaluation, in partnership with Philipps-University Marburg, CAQD prioritizes a user-focus which balances practical and methodological workshops with conference presentations. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1302249

  11. Small Island Visitor Attractions

    Directory of Open Access Journals (Sweden)

    Haven Allahar

    2015-03-01

    Full Text Available This article proposes a process framework for developing and managing visitor attractions (VA in small island developing states with Trinidad and Tobago, a two-island state in the Caribbean, as the case study. An extensive literature review was conducted, supported by field observations, individual depth interviews, and small and large focus group meetings. The process framework identified four sets of processes: national policy formulation and legislation; inventory, classification, evaluation, and ranking of VA; general operations management involving project management activities; and site specific activities of development, operations, and maintenance. The value of the framework lies in the fact that no similar framework applicable to small islands was covered in the literature and validation was obtained from a panel of experts and a cross section of tourism stakeholders in Tobago.

  12. President Xi Jinping Confers “Five Principles Of Peaceful Coexistence Friendship Award” on Indian Friendship Groups and Individuals

    Institute of Scientific and Technical Information of China (English)

    Tu; Lili

    2014-01-01

    <正>On September 19,2014 during a state visit to India,President Xi Jinping attended a ceremony held by the CPAFFC in New Delhi to confer the"Five Principles of Peaceful Coexistence Friendship Award"on various recipients.The year of 2014 marks the 60th anniversary of the enunciation of the Five Principles of Peaceful Coexistence,namely,mutual respect for sovereignty and territorial integrity,mutual

  13. Conference this! Lead Pipers compare conference experiences

    Directory of Open Access Journals (Sweden)

    Editorial Board

    2010-04-01

    Full Text Available As library travel budgets are increasingly slashed around the country, it’s a tough time for conference-going. In this group post, we compare notes about the conferences we’ve attended, which have been our favorites, and why. We hope this will generate creative ideas on good conferences (online or in-person to look forward to, and maybe offer [...

  14. Regulating Customs – the 12th Annual International Conference of the SIEF Working group “The Ritual Year”, Findhorn (Scotland, 8–12 January 2016 (Scientific Life

    Directory of Open Access Journals (Sweden)

    Thomas McKean

    2016-04-01

    Full Text Available The 12th annual international conference of the SIEF Working group “The Ritual Year” took place in Findhorn, Morayshire, Scotland, 8–12 January 2016 under the general title “Regulating Customs”. The academic event was organized by Thomas McKean, with Frances Wilkins, Athanasios Barbalexis and Marlene Hugoson on the committee, under the auspices of the Elphinstone Institute, University of Aberdeen. The very venue of the conference, The Findhorn Foundation, apart from giving the scholars an opportunity to experience the local Scottish atmosphere, was most interesting from an ethnographic, religious, and folkloric point of view. The Foundation was established in 1964 as a place for spiritual growth; it has its own complex history (https://www.findhorn.org/, with many events related to the ritual year integrated into its calendar

  15. Power, attraction, and reference in macrolevel social relations: An analysis of closed groups and closed societies based on the psychology of the “Soviet person”

    Directory of Open Access Journals (Sweden)

    Radina Nadezhda K.

    2017-03-01

    Full Text Available In this article the features of social-relationship systems are analyzed based on the data from a sociopsychological empirical study conducted in two stages (2002 and 2014 on a large sample with the help of g. Kelly’s Repertory grid Technique. A. V. Petrovsky’s three-factor interpersonal-relationships model as interpreted for closed groups by M. Yu. Kondratev and the concept of the closed society as described by Karl Popper provide the foundation for the theoretical hypothesis we tested. The empirical data obtained in 2002 came from 391 participants of different ages who were living in provincial towns in the Nizhny Novgorod region. The elderly respondents (232 people had lived almost all their lives under the Soviet regime; the middle-aged respondents (159 people got their education and started their careers in the USSR. Soviet society is considered to be closed because of its authoritarian and collectivist nature, static social structure, and dogmatic ideology. It is argued that both closed societies and closed groups are characterized by a rigid hierarchical social structure, isolation from other systems, and depersonalization of social relations. We have proved that members of a closed group and citizens of a closed society have similar social-relationship matrices.

  16. Romantic attraction and adolescent smoking trajectories.

    Science.gov (United States)

    Pollard, Michael S; Tucker, Joan S; Green, Harold D; Kennedy, David P; Go, Myong-Hyun

    2011-12-01

    Research on sexual orientation and substance use has established that lesbian, gay, and bisexual (LGB) individuals are more likely to smoke than heterosexuals. This analysis furthers the examination of smoking behaviors across sexual orientation groups by describing how same- and opposite-sex romantic attraction, and changes in romantic attraction, are associated with distinct six-year developmental trajectories of smoking. The National Longitudinal Study of Adolescent Health dataset is used to test our hypotheses. Multinomial logistic regressions predicting smoking trajectory membership as a function of romantic attraction were separately estimated for men and women. Romantic attraction effects were found only for women. The change from self-reported heterosexual attraction to lesbian or bisexual attraction was more predictive of higher smoking trajectories than was a consistent lesbian or bisexual attraction, with potentially important differences between the smoking patterns of these two groups.

  17. The Ambiguous Attractiveness of Mobility

    DEFF Research Database (Denmark)

    Presskorn-Thygesen, Thomas

    2015-01-01

    ’ can help us understand the attractiveness of constantly being ‘on the move’. Qualitative data from three exemplars of this elite group of workers is used to illustrate how the ideal of being mobile is perceived as an often problematic imperative, but also as one which is nevertheless rewarding...

  18. Metabolic Engineering X Conference

    Energy Technology Data Exchange (ETDEWEB)

    Flach, Evan [American Institute of Chemical Engineers

    2015-05-07

    The International Metabolic Engineering Society (IMES) and the Society for Biological Engineering (SBE), both technological communities of the American Institute of Chemical Engineers (AIChE), hosted the Metabolic Engineering X Conference (ME-X) on June 15-19, 2014 at the Westin Bayshore in Vancouver, British Columbia. It attracted 395 metabolic engineers from academia, industry and government from around the globe.

  19. ‘Communicating Manuscripts’: Third Conference of LIBER's Manuscript Librarians Group, Berlin, 28-30 November 2007

    Directory of Open Access Journals (Sweden)

    Jutta Weber

    2008-03-01

    Full Text Available LIBER's Manuscript Librarians Group held its third conference, entitled 'Communicating Manuscripts' in Berlin from 28-30 November 2007. More than 70 participants from all over Europe came to discuss their experiences and opinions concerning manuscripts (ranging from medieval codices to modern papers and letter collections — in response to a series of papers delivered by a number of specialists from European research libraries and archival institutions. For the Staatsbibliothek it was a pleasure to welcome them and to make the days in Berlin comfortable and successful.

  20. Intelligence and Physical Attractiveness

    Science.gov (United States)

    Kanazawa, Satoshi

    2011-01-01

    This brief research note aims to estimate the magnitude of the association between general intelligence and physical attractiveness with large nationally representative samples from two nations. In the United Kingdom, attractive children are more intelligent by 12.4 IQ points (r=0.381), whereas in the United States, the correlation between…

  1. White paper report from working groups attending the international conference on research and educational opportunities in bio-fuel crop production

    Energy Technology Data Exchange (ETDEWEB)

    Morgan, K.T. [University of Florida, Soil and Water Science Dep., Southwest Florida Res. and Educ. Center, Immokalee, FL 34142 (United States); Gilbert, R.A. [University of Florida, Agronomy Dep., Everglades Res. and Educ. Center, Belle Glade, FL 33430 (United States); Helsel, Z.A. [Rutgers University, Plant Biology and Pathology Dep., New Brunswick, NJ 08901-8520 (United States); Buacum, L. [University of Florida, Hendry County Extension, LaBelle, FL 33935 (United States); Leon, R.; Perret, J. [EARTH University, Apto. 4442-1000, San Jose (Costa Rica)

    2010-12-15

    A conference on current research and educational programs in production of crops for bio-fuel was sponsored and organized by the EARTH University and the University of Florida in November, 2008. The meeting addressed current research on crops for bio-fuel production with discussions of research alternatives for future crop production systems, land use issues, ethics of food vs. fuel production, and carbon sequestration in environmentally sensitive tropical and sub-tropical regions of the Americas. The need and potential for development of graduate and undergraduate curricula and inter-institutional cooperation among educational institutions in the region were also discussed. Delegations from Belize, Brazil, Columbia, Costa Rica, Cuba, Honduras, Panama, The Dominican Republic, and the United States including ministers of Agriculture and Energy attended this meeting. Over a two-day period, four working groups provided a framework to facilitate networking, motivate task oriented creative thinking, and maintain a timely accomplishment of assigned duties in the context of the conference themes. Participants in the conference were assigned to one of four working groups, each following given topics: Agronomy, Environment, Socio-Economics and Education/Extension. It was the consensus of representatives of industry, academic and regulatory community assembled in Costa Rica that significant research, education and socio-economic information is needed to make production of bio-fuel crops sustainable. Agronomic research should include better crop selection based on local conditions, improved production techniques, pest and disease management, and mechanical cultivation and harvesting. Another conclusion was that tailoring of production systems to local soil characteristics and use of bio-fuel by-products to improve nutrient use efficiency and reduction of environmental impact on water quantity and quality is critical to sustainability of bio-fuel crop production. (author)

  2. MEXICO Wants to Attract Chinese Tourists

    Institute of Scientific and Technical Information of China (English)

    Audrey GUO

    2009-01-01

    @@ Though last year many countries were affected by the global financial crisis,tourism in Mexico enjoyed an increase of 5% in 2008.Aiming at attracting more Chinese tourists to Mexico,on April 7,2009,Ambassador Jorge Guajardo together with Mr.Eligio Serna,China Director of the Mexico Tourism Board,held a conference to introduce Mexico Travel in Mexico Embassy to China,Beijing.

  3. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 2: T2 substaging and prostate cancer volume.

    Science.gov (United States)

    van der Kwast, Theo H; Amin, Mahul B; Billis, Athanase; Epstein, Jonathan I; Griffiths, David; Humphrey, Peter A; Montironi, Rodolfo; Wheeler, Thomas M; Srigley, John R; Egevad, Lars; Delahunt, Brett

    2011-01-01

    The 2009 International Society of Urological Pathology consensus conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the substaging of pT2 prostate cancers according to the TNM 2002/2010 system, reporting of tumor size/volume and zonal location of prostate cancers were coordinated by working group 2. A survey circulated before the consensus conference demonstrated that 74% of the 157 participants considered pT2 substaging of prostate cancer to be of clinical and/or academic relevance. The survey also revealed a considerable variation in the frequency of reporting of pT2b substage prostate cancer, which was likely a consequence of the variable methodologies used to distinguish pT2a from pT2b tumors. Overview of the literature indicates that current pT2 substaging criteria lack clinical relevance and the majority (65.5%) of conference attendees wished to discontinue pT2 substaging. Therefore, the consensus was that reporting of pT2 substages should, at present, be optional. Several studies have shown that prostate cancer volume is significantly correlated with other clinicopathological features, including Gleason score and extraprostatic extension of tumor; however, most studies fail to demonstrate this to have prognostic significance on multivariate analysis. Consensus was reached with regard to the reporting of some quantitative measure of the volume of tumor in a prostatectomy specimen, without prescribing a specific methodology. Incorporation of the zonal and/or anterior location of the dominant/index tumor in the pathology report was accepted by most participants, but a formal definition of the identifying features of the dominant/index tumor remained undecided.

  4. Pullback incremental attraction

    Directory of Open Access Journals (Sweden)

    Kloeden Peter E.

    2014-01-01

    Full Text Available A pullback incremental attraction, a nonautonomous version of incremental stability, is introduced for nonautonomous systems that may have unbounded limiting solutions. Its characterisation by a Lyapunov function is indicated

  5. Attention Alters Perceived Attractiveness.

    Science.gov (United States)

    Störmer, Viola S; Alvarez, George A

    2016-04-01

    Can attention alter the impression of a face? Previous studies showed that attention modulates the appearance of lower-level visual features. For instance, attention can make a simple stimulus appear to have higher contrast than it actually does. We tested whether attention can also alter the perception of a higher-order property-namely, facial attractiveness. We asked participants to judge the relative attractiveness of two faces after summoning their attention to one of the faces using a briefly presented visual cue. Across trials, participants judged the attended face to be more attractive than the same face when it was unattended. This effect was not due to decision or response biases, but rather was due to changes in perceptual processing of the faces. These results show that attention alters perceived facial attractiveness, and broadly demonstrate that attention can influence higher-level perception and may affect people's initial impressions of one another.

  6. Physical Attractiveness and Courtship

    Science.gov (United States)

    Silverman, Irwin

    1971-01-01

    This study shows a high and disquieting degree of similarity in physical attractiveness between dating partners, and suggests also that more similar partners tend to form stronger romantic attachments. (Author)

  7. Issues in defining and measuring veteran community reintegration: Proceedings of the Working Group on Community Reintegration, VA Rehabilitation Outcomes Conference, Miami, Florida

    Directory of Open Access Journals (Sweden)

    Linda Resnik, PT, PhD

    2012-02-01

    Full Text Available In January 2010, the Department of Veterans Affairs (VA Rehabilitation Research and Development Service convened a State of the Art (SOTA conference to advance the field of outcome measurement for rehabilitation-related studies. This article reports on the proceedings of the SOTA Working Group on Community Reintegration. We explored the use of the International Classification of Health, Disability, and Functioning as a theoretical framework for measuring community reintegration; identified key dimensions of community reintegration that could and/or should be measured; discussed challenges in measuring community reintegration; suggested steps to enhance community reintegration measurement; proposed future research that focuses on outcomes measures for community reintegration and the study of community reintegration outcomes; and made policy recommendations that would facilitate community reintegration research within the VA.

  8. Issues in defining and measuring veteran community reintegration: proceedings of the Working Group on Community Reintegration, VA Rehabilitation Outcomes Conference, Miami, Florida.

    Science.gov (United States)

    Resnik, Linda; Bradford, Daniel W; Glynn, Shirley M; Jette, Alan M; Johnson Hernandez, Caitlin; Wills, Sharon

    2012-01-01

    In January 2010, the Department of Veterans Affairs (VA) Rehabilitation Research and Development Service convened a State of the Art (SOTA) conference to advance the field of outcome measurement for rehabilitation-related studies. This article reports on the proceedings of the SOTA Working Group on Community Reintegration. We explored the use of the International Classification of Health, Disability, and Functioning as a theoretical framework for measuring community reintegration; identified key dimensions of community reintegration that could and/or should be measured; discussed challenges in measuring community reintegration; suggested steps to enhance community reintegration measurement; proposed future research that focuses on outcomes measures for community reintegration and the study of community reintegration outcomes; and made policy recommendations that would facilitate community reintegration research within the VA.

  9. Transforming Clinical Documentation in EHRs for 2020: Recommendations from University of Minnesota's Big Data Conference Working Group.

    Science.gov (United States)

    Weaver, Charlotte; O'Brien, Ann

    2016-01-01

    In 2014, a group of diverse informatics leaders from practice, academia, and the software industry formed to address how best to transform electronic documentation to provide knowledge at the point of care and to deliver value to front line nurses and nurse leaders. This presentation reports the recommendations from this Working Group geared towards a 2020 framework. The recommendations propose redesign to optimize nurses' documentation efficiency while contributing to knowledge generation and attaining a balance that ensures the capture of nursing's impact on safety, quality, yet minimizes "death by data entry."

  10. Attracting International Hotels

    DEFF Research Database (Denmark)

    Assaf, A. George; Josiassen, Alexander; Agbola, Frank Wogbe

    2015-01-01

    With the increased international competition facing hotel chains, it is essential that the next destination they enter is the most attractive option possible. The host destinations too have a keen interest in strategically positioning themselves in order to attract international hotels since...... their presence has several positive effects. Using, for the first time, actual on-location data we investigate the factors that matter most for international hotels when selecting host destinations. Specifically, we identify 23 factors that make a destination an attractive (or unattractive) location...... for international hotels. We then rank these. The results show that welcomeness, infrastructure, and crime rate are the three most important factors that influence the location of international hotels in host destinations....

  11. Correlates of Interpersonal Attraction.

    Science.gov (United States)

    Prisbell, Marshall

    A study assessed the relationship of the independent variables of interpersonal attraction to the dependent variables of feeling good, relational safety, and uncertainty level. Subjects were 75 elementary and secondary school teachers, 61 communication students, 18 child development professionals, and 8 service club members. Each subject completed…

  12. Enzymatic grafting of carboxyl groups on to chitosan--to confer on chitosan the property of a cationic dye adsorbent.

    Science.gov (United States)

    Chao, An-Chong; Shyu, Shin-Shing; Lin, Yu-Chuang; Mi, Fwu-Long

    2004-01-01

    Chitosan (CTS) is a good adsorbent for dyes but lacks the ability to adsorb cationic dyes. In this study, chitosan was modified to possess the ability to adsorb cationic dyes from water. Four kinds of phenol derivatives: 4-hydroxybenzoic acid (BA), 3,4-dihydroxybenzoic acid (DBA), 3,4-dihydroxyphenyl-acetic acid (PA), hydrocaffeic acid (CA) were used individually as substrates of tyrosinase to graft onto chitosan. FTIR analysis provided supporting evidence of phenol derivatives being grafted. The grafting amounts of these phenol derivatives onto chitosan were examined by the adsorption of an anionic dye (amaranth) and reached a plateau value. The final contents of carboxyl groups in chitosan (mmol carboxyl groups per kg chitosan) were measured as 46.36 for BA, 70.32 for DBA, 106.44 for PA, and 113.15 for CA. These modified chitosans were used in experiments on uptake of the cationic dyes crystal violet (CV) and bismarck brown Y (BB) by a batch adsorption technique at pH 7 for CV and at pH 9 for BB and 30 degrees C. Langmuir type adsorption was found, and the maximum adsorption capacities for both dyes were increased with the following order CTS-CA>CTS-PA>CTS-DBA>CTS-BA.

  13. Overexpression of OsEm1 encoding a group I LEA protein confers enhanced drought tolerance in rice.

    Science.gov (United States)

    Yu, Jing; Lai, Yongmin; Wu, Xi; Wu, Gang; Guo, Changkui

    2016-09-16

    Drought is the greatest threat for crops, including rice. In an effort to identify rice genes responsible for drought tolerance, a drought-responsive gene OsEm1 encoding a group I LEA protein, was chosen for this study. OsEm1 was shown at vegetative stages to be responsive to various abiotic stresses, including drought, salt, cold and the hormone ABA. In this study, we generated OsEm1-overexpressing rice plants to explore the function of OsEm1 under drought conditions. Overexpression of OsEm1 increases ABA sensitivity and enhances osmotic tolerance in rice. Compared with wild type, the OsEm1-overexpressing rice plants showed enhanced plant survival ratio at the vegetative stage; moreover, over expression of OsEm1 in rice increased the expression of other LEA genes, including RAB16A, RAB16C, RAB21, and LEA3, likely protecting organ integrity against harsh environments. Interestingly, the elevated level of OsEm1 had no different phenotype compared with wild type under normal condition. Our findings suggest that OsEm1 is a positive regulator of drought tolerance and is potentially promising for engineering drought tolerance in rice.

  14. Canadian Helicobacter Study Group Consensus Conference on the Approach to Helicobacter Pylori Infection in Children and Adolescents

    Directory of Open Access Journals (Sweden)

    P Sherman

    1999-01-01

    Full Text Available Gastric infection with Helicobacter pylori is common in both children and adults, but children are considerably less susceptible to peptic ulcers and other pathological sequelae. As a result, the risk to benefit ratio of diagnostic studies and therapeutic regimens for H pylori in adults are likely different from those in paediatric populations. These guidelines for the management of paediatric H pylori infection, developed by the Canadian Helicobacter Study Group, are designed to identify when the diagnosis and treatment of H pylori may improve patient care. Given the low prevalence of this infection in Canada, it is important to recognize that indiscriminate testing and treatment programs in children are not recommended, and indeed may threaten the optimal care of children. Diagnostic tests should be employed judiciously and be reserved for children who are most likely to derive measurable benefit, such as those likely to have peptic ulcer disease. At this time a test and treat strategy in children cannot be considered prudent, evidence based or cost effective. It is appropriate to limit diagnosis and treatment to children and adolescents in whom H pylori has been identified during endoscopic investigation.

  15. Timetable Attractiveness Parameters

    DEFF Research Database (Denmark)

    Schittenhelm, Bernd

    2008-01-01

    Timetable attractiveness is influenced by a set of key parameters that are described in this article. Regarding the superior structure of the timetable, the trend in Europe goes towards periodic regular interval timetables. Regular departures and focus on optimal transfer possibilities make...... these timetables attractive. The travel time in the timetable depends on the characteristics of the infrastructure and rolling stock, the heterogeneity of the planned train traffic and the necessary number of transfers on the passenger’s journey. Planned interdependencies between trains, such as transfers...... and heterogeneous traffic, add complexity to the timetable. The risk of spreading initial delays to other trains and parts of the network increases with the level of timetable complexity....

  16. Task Performance and Interpersonal Attraction in Children.

    Science.gov (United States)

    Levine, John M.; And Others

    1982-01-01

    Reports two studies investigating how performance information affects interpersonal attraction in children. In both experiments children worked on perceptual problems in simulated groups, received feedback about their own and other group members' performance, and then indicated their desire to interact with selected group members in various…

  17. NATO Conference

    CERN Document Server

    Lynn, W

    1975-01-01

    The contents of this volume involve selection, emendation and up-dating of papers presented at the NATO Conference "Mathe­ matical Analysis of Decision problems in Ecology" in Istanbul, Turkey, July 9-13, 1973. It was sponsored by the System Sciences Division of NATO directed by Dr. B. Bayraktar with local arrange­ ments administered by Dr. Ilhami Karayalcin, professor of the Department of Industrial Engineering at the Technical University of Istanbul. It was organized by A. Charnes, University professor across the University of Texas System, and Walter R.Lynn, Di­ rector of the School of Civil and Environmental Engineering at Cornell Unjversity. The objective of the conference was to bring together a group of leading researchers from the major sciences involved in eco­ logical problems and to present the current state of progress in research of a mathematical nature which might assist in the solu­ tion of these problems. Although their presentations are not herein recorded, the key­ note address of Dr....

  18. The Ambiguous Attractiveness of Mobility

    DEFF Research Database (Denmark)

    Presskorn-Thygesen, Thomas

    2015-01-01

    allows us to explore the distinctly normative side of new forms of mobility without succumbing to a celebratory picture of work-related mobility. More specifically and in the context of the ‘kinetic elite’, the article explores how Boltanski and Chiapello’s (2005) analysis of a ‘projective order of worth......’ can help us understand the attractiveness of constantly being ‘on the move’. Qualitative data from three exemplars of this elite group of workers is used to illustrate how the ideal of being mobile is perceived as an often problematic imperative, but also as one which is nevertheless rewarding...... and worth living up to....

  19. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  20. How facial attractiveness affects sustained attention.

    Science.gov (United States)

    Li, Jie; Oksama, Lauri; Hyönä, Jukka

    2016-10-01

    The present study investigated whether and how facial attractiveness affects sustained attention. We adopted a multiple-identity tracking paradigm, using attractive and unattractive faces as stimuli. Participants were required to track moving target faces amid distractor faces and report the final location of each target. In Experiment 1, the attractive and unattractive faces differed in both the low-level properties (i.e., luminance, contrast, and color saturation) and high-level properties (i.e., physical beauty and age). The results showed that the attractiveness of both the target and distractor faces affected the tracking performance: The attractive target faces were tracked better than the unattractive target faces; when the targets and distractors were both unattractive male faces, the tracking performance was poorer than when they were of different attractiveness. In Experiment 2, the low-level properties of the facial images were equalized. The results showed that the attractive target faces were still tracked better than unattractive targets while the effects related to distractor attractiveness ceased to exist. Taken together, the results indicate that during attentional tracking the high-level properties related to the attractiveness of the target faces can be automatically processed, and then they can facilitate the sustained attention on the attractive targets, either with or without the supplement of low-level properties. On the other hand, only low-level properties of the distractor faces can be processed. When the distractors share similar low-level properties with the targets, they can be grouped together, so that it would be more difficult to sustain attention on the individual targets. © 2016 Scandinavian Psychological Associations and John Wiley & Sons Ltd.

  1. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 5: surgical margins.

    Science.gov (United States)

    Tan, Puay Hoon; Cheng, Liang; Srigley, John R; Griffiths, David; Humphrey, Peter A; van der Kwast, Theodore H; Montironi, Rodolfo; Wheeler, Thomas M; Delahunt, Brett; Egevad, Lars; Epstein, Jonathan I

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston, made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to surgical margin assessment were coordinated by working group 5. Pathologists agreed that tumor extending close to the 'capsular' margin, yet not to it, should be reported as a negative margin, and that locations of positive margins should be indicated as either posterior, posterolateral, lateral, anterior at the prostatic apex, mid-prostate or base. Other items of consensus included specifying the extent of any positive margin as millimeters of involvement; tumor in skeletal muscle at the apical perpendicular margin section, in the absence of accompanying benign glands, to be considered organ confined; and that proximal and distal margins be uniformly referred to as bladder neck and prostatic apex, respectively. Grading of tumor at positive margins was to be left to the discretion of the reporting pathologists. There was no consensus as to how the surgical margin should be regarded when tumor is present at the inked edge of the tissue, in the absence of transected benign glands at the apical margin. Pathologists also did not achieve agreement on the reporting approach to benign prostatic glands at an inked surgical margin in which no carcinoma is present.

  2. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 3: extraprostatic extension, lymphovascular invasion and locally advanced disease.

    Science.gov (United States)

    Magi-Galluzzi, Cristina; Evans, Andrew J; Delahunt, Brett; Epstein, Jonathan I; Griffiths, David F; van der Kwast, Theo H; Montironi, Rodolfo; Wheeler, Thomas M; Srigley, John R; Egevad, Lars L; Humphrey, Peter A

    2011-01-01

    The International Society of Urological Pathology Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to extraprostatic extension (pT3a disease), bladder neck invasion, lymphovascular invasion and the definition of pT4 were coordinated by working group 3. It was agreed that prostate cancer can be categorized as pT3a in the absence of adipose tissue involvement when cancer bulges beyond the contour of the gland or beyond the condensed smooth muscle of the prostate at posterior and posterolateral sites. Extraprostatic extension can also be identified anteriorly. It was agreed that the location of extraprostatic extension should be reported. Although there was consensus that the amount of extraprostatic extension should be quantitated, there was no agreement as to which method of quantitation should be employed. There was overwhelming consensus that microscopic urinary bladder neck invasion by carcinoma should be reported as stage pT3a and that lymphovascular invasion by carcinoma should be reported. It is recommended that these elements are considered in the development of practice guidelines and in the daily practice of urological surgical pathology.

  3. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 1: specimen handling.

    Science.gov (United States)

    Samaratunga, Hemamali; Montironi, Rodolfo; True, Lawrence; Epstein, Jonathan I; Griffiths, David F; Humphrey, Peter A; van der Kwast, Theo; Wheeler, Thomas M; Srigley, John R; Delahunt, Brett; Egevad, Lars

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the handling and processing of radical prostatectomy specimens were coordinated by working group 1. Most uropathologists followed similar procedures for fixation of radical prostatectomy specimens, with 51% of respondents transporting tissue in formalin. There was also consensus that the prostate weight without the seminal vesicles should be recorded. There was consensus that the surface of the prostate should be painted. It was agreed that both the prostate apex and base should be examined by the cone method with sagittal sectioning of the tissue sample. There was consensus that the gland should be fully fixed before sectioning. Both partial and complete embedding of prostates was considered to be acceptable as long as the method of partial embedding is stated. No consensus was determined regarding the necessity of weighing and measuring the length of the seminal vesicles, the preparation of whole mounts rather than standardized blocks and the methodology for sampling of fresh tissue for research purposes, and it was agreed that these should be left to the discretion of the working pathologist.

  4. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 4: seminal vesicles and lymph nodes.

    Science.gov (United States)

    Berney, Daniel M; Wheeler, Thomas M; Grignon, David J; Epstein, Jonathan I; Griffiths, David F; Humphrey, Peter A; van der Kwast, Theo; Montironi, Rodolfo; Delahunt, Brett; Egevad, Lars; Srigley, John R

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the infiltration of tumor into the seminal vesicles and regional lymph nodes were coordinated by working group 4. There was a consensus that complete blocking of the seminal vesicles was not necessary, although sampling of the junction of the seminal vesicles and prostate was mandatory. There was consensus that sampling of the vas deferens margins was not obligatory. There was also consensus that muscular wall invasion of the extraprostatic seminal vesicle only should be regarded as seminal vesicle invasion. Categorization into types of seminal vesicle spread was agreed by consensus to be not necessary. For examination of lymph nodes, there was consensus that special techniques such as frozen sectioning were of use only in high-risk cases. There was no consensus on the optimal sampling method for pelvic lymph node dissection specimens, although there was consensus that all lymph nodes should be completely blocked as a minimum. There was also a consensus that a count of the number of lymph nodes harvested should be attempted. In view of recent evidence, there was consensus that the diameter of the largest lymph node metastasis should be measured. These consensus decisions will hopefully clarify the difficult areas of pathological assessment in radical prostatectomy evaluation and improve the concordance of research series to allow more accurate assessment of patient prognosis.

  5. US green building conference - 1994

    Energy Technology Data Exchange (ETDEWEB)

    Fanney, A.H.; Whitter, K.M.; Traugott, A.E.; Simon, L.N. [eds.

    1994-12-31

    This report constitutes the proceedings of the Green Building Conference held in Gaithersburg, Maryland, February 16-17, 1994. The conference was co-sponsored by the National Institute of Standards and Technology (NIST) and the US Green Building Council (USGBC). Over 450 individuals attended the conference representing building product manufacturers, building owners and managers, environmental groups, utilities, contractors, builders, architects, engineers, and the local, state, and the federal governments. The conference provided an opportunity to acquire practical, useful information on green buildings, resources, and guidelines. Eighteen papers were presented at the conference. Separate abstracts and indexing were prepared for each paper for inclusion in the Energy Science and Technology Database.

  6. Cohesiveness and Interpersonal Attraction: A Selected, Annotated Basic Bibliography.

    Science.gov (United States)

    Beebe, Steven A.; Webb, Marsha Short

    This 43-item selected, annotated bibliography on cohesiveness and interpersonal attraction includes books, journal articles and conference papers published between 1953 and 1990. The bibliography is in two parts. The first part consists of key sources, most of which have extensive bibliographies or lists of references. The second part consists of…

  7. The 50th Annual Maize Genetics Conference

    Energy Technology Data Exchange (ETDEWEB)

    Cone, Karen

    2014-03-26

    The 50th Annual Maize Genetics Conference was held February 27 - March 2, 2008 at the Marriott Wardman Park Hotel in Washington, D.C. As the golden anniversary of the Conference and coinciding with the release of a draft of the maize genome sequence, this was a special meeting. To publicize this unique occasion, meeting organizers hosted a press conference, which was attended by members of the press representing science and non-science publications, and an evening reception at the Smithsonian National Museum of Natural History, where the draft sequence was announced and awards were presented to Dr. Mary Clutter and Senator Kit Bond to thank them for their outstanding contributions to maize genetics and genomics research. As usual, the Conference provided an invigorating forum for exchange of recent research results in many areas of maize genetics, e.g., cytogenetics, development, molecular genetics, transposable element biology, biochemical genetics, and genomics. Results were shared via both oral and poster presentations. Invited talks were given by four distinguished geneticists: Vicki Chandler, University of Arizona; John Doebley, University of Wisconsin; Susan Wessler, University of Georgia; and Richard Wilson, Washington University. There were 46 short talks and 241 poster presentations. The Conference was attended by over 500 participants. This included a large number of first-time participants in the meeting and an increasingly visible presence by individuals from underrepresented groups. Although we do not have concrete counts, there seem to be more African American, African and Hispanic/Latino attendees coming to the meeting than in years past. In addition, this meeting attracted many participants from outside the U.S. Student participation continues to be hallmark of the spirit of free exchange and cooperation characteristic of the maize genetics community. With the generous support provided by DOE, USDA NSF, and corporate/private donors, organizers were

  8. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 3: extraprostatic extension, lymphovascular invasion and locally advanced disease.

    NARCIS (Netherlands)

    Magi-Galluzzi, C.; Evans, A.J.; Delahunt, B.; Epstein, J.I.; Griffiths, D.F.; Kwast, T.H. van der; Montironi, R.; Wheeler, T.M.; Srigley, J.R.; Egevad, L.L.; Humphrey, P.A.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The International Society of Urological Pathology Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to extraprostatic extension (pT3a

  9. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 4: seminal vesicles and lymph nodes.

    NARCIS (Netherlands)

    Berney, D.M.; Wheeler, T.M.; Grignon, D.J.; Epstein, J.I.; Griffiths, D.F.; Humphrey, P.A.; Kwast, T. van der; Montironi, R.; Delahunt, B.; Egevad, L.; Srigley, J.R.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the infiltration of tumor into the seminal vesicles and regional lymph nodes were coo

  10. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 1: specimen handling.

    NARCIS (Netherlands)

    Samaratunga, H.; Montironi, R.; True, L.; Epstein, J.I.; Griffiths, D.F.; Humphrey, P.A.; Kwast, T. van der; Wheeler, T.M.; Srigley, J.R.; Delahunt, B.; Egevad, L.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the handling and processing of radical prostatectomy specimens were coordinated by wo

  11. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 4: seminal vesicles and lymph nodes.

    NARCIS (Netherlands)

    Berney, D.M.; Wheeler, T.M.; Grignon, D.J.; Epstein, J.I.; Griffiths, D.F.; Humphrey, P.A.; Kwast, T. van der; Montironi, R.; Delahunt, B.; Egevad, L.; Srigley, J.R.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the infiltration of tumor into the seminal vesicles and regional lymph nodes were coo

  12. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 3: extraprostatic extension, lymphovascular invasion and locally advanced disease.

    NARCIS (Netherlands)

    Magi-Galluzzi, C.; Evans, A.J.; Delahunt, B.; Epstein, J.I.; Griffiths, D.F.; Kwast, T.H. van der; Montironi, R.; Wheeler, T.M.; Srigley, J.R.; Egevad, L.L.; Humphrey, P.A.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The International Society of Urological Pathology Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to extraprostatic extension (pT3a

  13. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 1: specimen handling.

    NARCIS (Netherlands)

    Samaratunga, H.; Montironi, R.; True, L.; Epstein, J.I.; Griffiths, D.F.; Humphrey, P.A.; Kwast, T. van der; Wheeler, T.M.; Srigley, J.R.; Delahunt, B.; Egevad, L.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology Consensus Conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the handling and processing of radical prostatectomy specimens were coordinated by wo

  14. Nostradamus conference

    CERN Document Server

    Rössler, Otto; Snášel, Václav; Abraham, Ajith; Corchado, Emilio; Nostradamus: Modern Methods of Prediction, Modeling and Analysis of Nonlinear Systems

    2013-01-01

    This proceeding book of Nostradamus conference (http://nostradamus-conference.org) contains accepted papers presented at this event in 2012. Nostradamus conference was held in the one of the biggest and historic city of Ostrava (the Czech Republic, http://www.ostrava.cz/en), in September 2012. Conference topics are focused on classical as well as modern methods for prediction of dynamical systems with applications in science, engineering and economy. Topics are (but not limited to): prediction by classical and novel methods, predictive control, deterministic chaos and its control, complex systems, modelling and prediction of its dynamics and much more.

  15. Rules of Attraction

    Science.gov (United States)

    2004-01-01

    This image composite shows two of the Mars Exploration Rover Opportunity's magnets, the 'capture' magnet (upper portion of left panel) and the 'filter' magnet (lower portion of left panel). Scientists use these tools to study the origins of martian dust in the atmosphere. The left panel was taken by the rover's panoramic camera. The four panels to the right, taken by the microscopic imager, show close-up views of the two magnets. The bull's-eye appearance of the capture magnet is a result of alternating magnetic fields, which are used to increase overall magnetic force. The filter magnet lacks these alternating fields and consequently produces a weaker magnetic force. This weaker force selectively attracts only strong magnetic particles. Scientists were surprised by the large dark particles on the magnets because airborne particles are smaller in size. They theorize that these spots might be aggregates of small particles that clump together in a magnetic field.

  16. Physical attractiveness and personality development.

    Science.gov (United States)

    Shea, J; Crossman, S M; Adams, G R

    1978-05-01

    A test of the relationship between physical attractiveness and ego development was completed through an interview study of 294 men and women college students. Ss responded to personality measures assessing identity formation, locus of control, and ego functioning and were rated on facial attractiveness and body form scales. Contrary to the physical attractiveness stereotype, attractive and unattractive Ss did not differ in their personality styles.

  17. Communication and Culture: Interpersonal Attraction.

    Science.gov (United States)

    Brown, Lydia Ledesma; Emry, Robert A.

    Cultural differences in interpersonal attraction were studied using 93 black, 112 Chicano, and 112 white college students who completed 40 Likert-type rating scales for each of four concepts of attraction (intimate, friendship, acquaintance, and stranger attraction). When a factor solution was generated, differences were noted in the amount of…

  18. Communication and Culture: Interpersonal Attraction.

    Science.gov (United States)

    Brown, Lydia Ledesma; Emry, Robert A.

    Cultural differences in interpersonal attraction were studied using 93 black, 112 Chicano, and 112 white college students who completed 40 Likert-type rating scales for each of four concepts of attraction (intimate, friendship, acquaintance, and stranger attraction). When a factor solution was generated, differences were noted in the amount of…

  19. Consensus conferences

    DEFF Research Database (Denmark)

    Nielsen, Annika Porsborg; Lassen, Jesper

    Our results point to significant national variation both in terms of the perceived aim of consensus conferences, expectations to conference outcomes, conceptions of the roles of lay people and experts, and in terms of the way in which the role of public deliberation is interpreted. Interestingly...

  20. Summary of a joint US-Japan study of potential approaches to reduce the attractiveness of various nuclear materials for use in a nuclear explosive device by a terrorist group

    Energy Technology Data Exchange (ETDEWEB)

    Bathke, C.G. [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, NM (United States); Inoue, N.; Kuno, Y.; Mihara, T.; Sagara, H. [Japan Atomic Energy Agency, 4-49 Muramatsu, Tokai-mura, Naka-gun, Ibaraki 319-1184 (Japan); Ebbinghaus, B.B. [Lawrence Livermore National Laboratory, P.O. Box L-168, Livermore, CA 94551 (United States); Murphy, J.; Dalton, D. [National Nuclear Security Administration, Department of Energy, 1000 Independence Ave, SW, Washington, DC 20585 (United States); Nagayama, Y. [Ministry of Education, Culture, Sports, Science and Technology, 3-2-2 Kasumigaseki, Chiyoda-ku, Tokyo 100-8959 (Japan)

    2013-07-01

    This paper summarizes the results of a joint US-Japan study to establish a mutual understanding, through scientific-based study, of potential approaches to reduce the attractiveness of various nuclear materials for use in a terrorist nuclear explosive device (NED). 4 approaches that can reduce materials attractiveness with a very high degree of effectiveness are: -) diluting HEU with natural or depleted U to an enrichment of less than 10% U-235; -) storing Pu in nuclear fuel that is not man portable and with a dose rate greater or equal to 10 Gy/h at 1 m; -) storing Pu or HEU in heavy items, i.e. not transportable, provided the removal of the Pu or HEU from the item requires a purification/processing capability; and -) converting Pu and HEU to very dilute forms (such as wastes) that, without any security barriers, would require very long acquisition times to acquire a Category I quantity of Pu or of HEU. 2 approaches that can reduce materials attractiveness with a high degree of effectiveness are: -) converting HEU-fueled research reactors into LEU-fueled research reactors or dilute HEU with natural or depleted U to an enrichment of less than 20% U-235; -) converting U/Al reactor fuel into U/Si reactor fuel. Other approaches have been assessed as moderately or totally inefficient to reduce the attractiveness of nuclear materials.

  1. The Ambiguous Attractiveness of Mobility

    DEFF Research Database (Denmark)

    Presskorn-Thygesen, Thomas

    2015-01-01

    ’ can help us understand the attractiveness of constantly being ‘on the move’. Qualitative data from three exemplars of this elite group of workers is used to illustrate how the ideal of being mobile is perceived as an often problematic imperative, but also as one which is nevertheless rewarding......This article examines the forms of mobility that characterize contemporary work life. In doing so, it applies the theoretical framework associated with Luc Boltanski’s sociology of critique (Boltanski, 2012 [1990]; Boltanski and Thévenot, 2006 [1991]) and argues that this framework offers...... a fruitful and important perspective in conceptualizing and understanding the forms of mobility that are becoming increasingly prevalent in today’s knowledge work. The sociology of critique allows one to chart the economic and historical conditions of mobility critically, while its sociology of morals also...

  2. The learning conference

    DEFF Research Database (Denmark)

    Ravn, Ib

    2007-01-01

    are described: Individual reflection, the buzz dyad, ?You have won two consultants, free of charge?, facilitated group work, the knowledge exchange, and lunch with gaffer tape. Originality/value: This paper introduces modern learning theory and techniques into an educational context which has resisted......Purpose: To call attention to the fact that conferences for professionals rely on massive one-way communication and hence produce little learning for delegates. To introduce an alternative, the ?learning conference,? that involves delegates in fun and productive learning processes. Design....../methodology/approach: A typical full-day conference is analyzed. It has six hours of podium talk and twenty-five minutes for delegates to become involved. What model of learning can possibly lie behind this? The transfer model, which assumes learners to be empty vessels. An alternative view is that conference delegates...

  3. The learning conference

    DEFF Research Database (Denmark)

    Ravn, Ib

    2007-01-01

    are described: Individual reflection, the buzz dyad, ?You have won two consultants, free of charge?, facilitated group work, the knowledge exchange, and lunch with gaffer tape. Originality/value: This paper introduces modern learning theory and techniques into an educational context which has resisted......Purpose: To call attention to the fact that conferences for professionals rely on massive one-way communication and hence produce little learning for delegates. To introduce an alternative, the ?learning conference,? that involves delegates in fun and productive learning processes. Design....../methodology/approach: A typical full-day conference is analyzed. It has six hours of podium talk and twenty-five minutes for delegates to become involved. What model of learning can possibly lie behind this? The transfer model, which assumes learners to be empty vessels. An alternative view is that conference delegates...

  4. Conference Report: Methodologies of Systems—How to Get to the Case and How to Get Behind It. Organized by Arbeitskreis Funktionale Analyse [Research Group Functional Analysis

    Directory of Open Access Journals (Sweden)

    Jasmin Siri

    2009-03-01

    Full Text Available The international conference on "Methodologies of the System" provided an inventory of empirical research informed by systems theory. In eight parallel workshops on topics such as "Organization," "Interaction," and "Semantics," more than twenty different empirical research projects were discussed. The workshops were framed by eight keynote lectures on "Methodology and Systems Theory," "Theory as Methodology," "Method and Methodology," as well as "Methodological Imports." In this conference report I will summarize the main topics of the conference and connect them with current approaches to empirical research with systems theory. The following questions will be answered: Which position do studies inspired by systems theory take within the sociological discussions about methods? Which analytical advancements are possible and necessary? Does a "unity" of systems theoretical research exist? Did the conference produce an appearance of unity, which does not represent the plurality of different approaches? Systems theoretical approaches seek access to empirical fields in very different ways. In the process, those approaches seem particularly productive which focus on the empirical interest and not on the faithfulness to their own theory. Given that different approaches presented at this conference produced sound arguments about how to deal with empirical data, it would be counterproductive to implement a rigid canon of method systems theoretical research. The commensurability of a specific method or methodology needs to be extracted from the empirical case and its needs. The conference showed that systems theoretical research and empirical concerns mate. However, it showed as well the misunderstandings that this approach possibly feeds by its terminology and self-descriptions. URN: urn:nbn:de:0114-fqs0902223

  5. Physical attractiveness of boys with gender identity disorder.

    Science.gov (United States)

    Zucker, K J; Wild, J; Bradley, S J; Lowry, C B

    1993-02-01

    University students blind to group status rated boys with gender identity disorder and clinical control boys regarding their physical attractiveness. Ratings were made of the face and upper torso from photographs taken at the time of clinical assessment (mean age, 8.1 years). On all five adjectives (attractive, beautiful, cute, handsome, and pretty), boys with gender identity disorder were judged to be more attractive than were the clinical control boys. Attractiveness correlated with extent of behavioral femininity in the clinical control group, but not in the group of boys with gender identity disorder. The extent to which the group differences in attractiveness were due to objective, structural differences in facial attractiveness vs. socially created, or subjective, processes is discussed.

  6. Making vasectomy attractive.

    Science.gov (United States)

    Herndon, N

    1992-08-01

    In 1989, Pro-Pater, a private, nonprofit family planning organization in Brazil, used attractive ads with the message Vasectomy, An Act of Love to promote vasectomy. The number of vasectomies performed/day at Pro-Pater clinics increased from 11 to 20 during the publicity campaign and fell after the ads stopped but continued at higher levels. Word of mouth communication among friends, neighbors, and relatives who had vasectomies maintained these high levels. This type of communication reduced the fear that often involves vasectomies because men hear from men they know and trust that vasectomies are harmless and do not deprive them of potency. In Sao Paulo, the percentage of men familiar with vasectomies and how they are performed increased after the campaign, but in Salvador, knowledge did not increase even though the number of vasectomies in Pro-Pater clinics increased. Organizations in Colombia and Guatemala have also been effective in educating men about vasectomies. These successes were especially relevant in Latin American where machismo has been an obstacle of family planning programs. The no-scalpel technique 1st introduced in China in 1974 reduces the fear of vasectomy and has fewer complications than the conventional technique. Further trained physicians can perform the no-scalpel technique in about 10 minutes compared with 15 minutes for the conventional technique. In 1987 during a 1-day festival in Thailand, physicians averaged 57 no-scalpel vasectomies/day compared with only 33 for conventional vasectomies. This technique has not spread to Guatemala, Brazil, Colombia, the US, and some countries in Asia and Africa. Extensive research does not indicate that vasectomy has an increased risk of testicular cancer, prostate cancer, and myocardial infarction. Physicians are working on ways to improve vasectomy.

  7. Judging attractiveness: Biases due to raters’ own attractiveness and intelligence

    Directory of Open Access Journals (Sweden)

    Stacy Yen-Lin Sim

    2015-12-01

    Full Text Available Tennis and Dabbs (1975 reported that physically attractive males showed a positivity bias when rating the attractiveness of others. The opposite pattern was observed for females. We attempted to replicate and extend these findings by: (1 using self-assessed attractiveness rather than the experimentally derived attractiveness measure used in previous research, (2 using face-to-face interactions with targets as opposed to using photographs, and (3 examining the effect of another ego-involving attribute: intelligence. Consistent with previous research, attractiveness judgments made by men, but not women, correlated positively with their own self-perceived level of attractiveness (r = .51, p < .001. Attractiveness judgments made by women, but not men, correlated negatively with their intelligence (r = −.32, p = .001. Judgments of attractiveness are thus biased by a rater’s own attributes (e.g. attractiveness and intelligence, but these effects are not generalizable across men and women raters, and may be driven by different mechanisms.

  8. Beyond initial attraction: physical attractiveness in newlywed marriage.

    Science.gov (United States)

    McNulty, James K; Neff, Lisa A; Karney, Benjamin R

    2008-02-01

    Physical appearance plays a crucial role in shaping new relationships, but does it continue to affect established relationships, such as marriage? In the current study, the authors examined how observer ratings of each spouse's facial attractiveness and the difference between those ratings were associated with (a) observations of social support behavior and (b) reports of marital satisfaction. In contrast to the robust and almost universally positive effects of levels of attractiveness on new relationships, the only association between levels of attractiveness and the outcomes of these marriages was that attractive husbands were less satisfied. Further, in contrast to the importance of matched attractiveness to new relationships, similarity in attractiveness was unrelated to spouses' satisfaction and behavior. Instead, the relative difference between partners' levels of attractiveness appeared to be most important in predicting marital behavior, such that both spouses behaved more positively in relationships in which wives were more attractive than their husbands, but they behaved more negatively in relationships in which husbands were more attractive than their wives. These results highlight the importance of dyadic examinations of the effects of spouses' qualities on their marriages.

  9. The Key for Holding a Successful ELT Conference: Some Nuts and Bolts

    Science.gov (United States)

    Sadeghi, Karim; Modirkhameneh, Sima

    2013-01-01

    Conferences are gatherings that attract attendants from various places and serve both academic and social purposes. Organizing an international conference is, accordingly, a very challenging, demanding and time-consuming task. In order for the conference organizers to hold a successful conference, there is a need for a comprehensive guide to use…

  10. Racial stereotypes and interracial attraction: phenotypic prototypicality and perceived attractiveness of Asians.

    Science.gov (United States)

    Wilkins, Clara L; Chan, Joy F; Kaiser, Cheryl R

    2011-10-01

    What does it take to find a member of a different race attractive? In this research, we suggest that for Whites, attraction to Asians may be based, in part, on stereotypes and variations in Asians' racial appearance. Study 1 reveals that Asians are stereotyped as being more feminine and less masculine than other racial groups-characteristics considered appealing for women but not for men to possess. Study 2 examines how variation in racial appearance, phenotypic prototypicality (PP), shapes the degree to which Asians are gender stereotyped and how PP relates to perceptions of attractiveness. Higher PP Asian men are perceived as being less masculine and less physically attractive than lower PP Asian men. These findings inform theory on how within-group variation in racial appearance affects stereotyping and other social outcomes.

  11. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 2: T2 substaging and prostate cancer volume.

    NARCIS (Netherlands)

    Kwast, T.H. van der; Amin, M.B.; Billis, A.; Epstein, J.I.; Griffiths, D.; Humphrey, P.A.; Montironi, R.; Wheeler, T.M.; Srigley, J.R.; Egevad, L.; Delahunt, B.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology consensus conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the substaging of pT2 prostate cancers according to the TNM 2002/2010 system, reporti

  12. International Society of Urological Pathology (ISUP) Consensus Conference on Handling and Staging of Radical Prostatectomy Specimens. Working group 2: T2 substaging and prostate cancer volume.

    NARCIS (Netherlands)

    Kwast, T.H. van der; Amin, M.B.; Billis, A.; Epstein, J.I.; Griffiths, D.; Humphrey, P.A.; Montironi, R.; Wheeler, T.M.; Srigley, J.R.; Egevad, L.; Delahunt, B.; Hulsbergen- van de Kaa, C.A.

    2011-01-01

    The 2009 International Society of Urological Pathology consensus conference in Boston made recommendations regarding the standardization of pathology reporting of radical prostatectomy specimens. Issues relating to the substaging of pT2 prostate cancers according to the TNM 2002/2010 system, reporti

  13. Canadian Helicobacter Study Group Consensus Conference: Update on the Approach to Helicobacter Pylori Infection in Children and Adolescents – an Evidence-Based Evaluation

    Directory of Open Access Journals (Sweden)

    Nicola L Jones

    2005-01-01

    Full Text Available As an update to previously published recommendations for the management of Helicobacter pylori infection, an evidence-based appraisal of 14 topics was undertaken in a consensus conference sponsored by the Canadian Helicobacter Study Group. The goal was to update guidelines based on the best available evidence using an established and uniform methodology to address and formulate recommendations for each topic. The degree of consensus for each recommendation is also presented. The clinical issues addressed and recommendations made were: population-based screening for H pylori in asymptomatic children to prevent gastric cancer is not warranted; testing for H pylori in children should be considered if there is a family history of gastric cancer; the goal of diagnostic interventions should be to determine the cause of presenting gastrointestinal symptoms and not the presence of H pylori infection; recurrent abdominal pain of childhood is not an indication to test for H pylori infection; H pylori testing is not required in patients with newly diagnosed gastroesophageal reflux disease; H pylori testing may be considered before the use of long-term proton pump inhibitor therapy; testing for H pylori infection should be considered in children with refractory iron deficiency anemia when no other cause has been found; when investigation of pediatric patients with persistent or severe upper abdominal symptoms is indicated, upper endoscopy with biopsy is the investigation of choice; the 13C-urea breath test is currently the best noninvasive diagnostic test for H pylori infection in children; there is currently insufficient evidence to recommend stool antigen tests as acceptable diagnostic tools for H pylori infection; serological antibody tests are not recommended as diagnostic tools for H pylori infection in children; first-line therapy for H pylori infection in children is a twice-daily, triple-drug regimen comprised of a proton pump inhibitor plus two

  14. Stereotyping Physical Attractiveness: A Sociocultural Perspective.

    Science.gov (United States)

    Dion, Karen K.; And Others

    1990-01-01

    Studies the tendency to stereotype physical attractiveness and identification in a collectivist culture using a group of 53 Chinese Canadian college students. Finds that introverts tended to be more prone to stereotyping than extroverts. Subjects with the highest cultural involvement were least prone to stereotyping with regard to social…

  15. Physical Attractiveness Stereotypes about Marriage: Attractiveness Matching Is Good.

    Science.gov (United States)

    Sussman, Steve; And Others

    Previous research on physical attractiveness stereotypes about marriage have used stimulus individuals in isolation. To examine these attractiveness stereotypes using couples as targets, 72 college students (36 females, 36 males) rated eight photographs of four male-female couple types. Members of each couple were either matched (attractive…

  16. Predicting Attraction to the Novel Stimulus Person: Affect and Concern.

    Science.gov (United States)

    Kelley, Kathryn

    1982-01-01

    Predicted interpersonal attraction to the novel stimulus by assessing the affective properties of stimulus descriptions. One group responded to characterizations on scales of concern. In another group, positive feelings and high concern about the stimulus led to greatest attraction. Results illustrate the benefits of prediction of the liking…

  17. Joint US/German Conference

    CERN Document Server

    Gulledge, Thomas; Jones, Albert

    1993-01-01

    This proceedings volume contains selected and refereed contributions that were presented at the conference on "Recent Developments and New Perspectives of Operations Research in the Area of Production Planning and Control" in Hagen/Germany, 25. - 26. June 1992. This conference was organized with the cooperation of the FernuniversiHit Hagen and was jointly hosted by the "Deutsche Gesellschaft fur Operations Research (DGOR)" and the "Manufacturing Special Interest Group of the Operations Research Society of America (ORSA-SIGMA)". For the organization of the conference we received generous financial support from the sponsors listed at the end of this volume. We wish to express our appreciation to all supporters for their contributions. This conference was the successor of the JOInt ORSA/DGOR-conference in Gaithersburg/Maryland, USA, on the 30. and 31. July 1991. Both OR-societies committed themselves in 1989 to host joint conferences on special topics of interest from the field of operations research. This goal ...

  18. A Naturally Attractive Supermodel

    CERN Document Server

    Cohen, Timothy; Torroba, Gonzalo

    2012-01-01

    We propose an attractor mechanism which generates the "more minimal" supersymmetric standard model from a broad class of supersymmetry breaking boundary conditions. The hierarchies in the fermion masses and mixings are produced by the same dynamics and a natural weak scale results from gaugino mediation. These features arise from augmenting the standard model with a new SU(3) gauge group under which only the third generation quarks are charged. The theory flows to a strongly interacting fixed point which induces a negative anomalous dimension for the third generation quarks and a positive anomalous dimension for the Higgs. As a result, a split-family natural spectrum and the flavor hierarchies are dynamically generated.

  19. Creating beauty: creativity compensates for low physical attractiveness when individuals assess the attractiveness of social and romantic partners.

    Science.gov (United States)

    Watkins, Christopher D

    2017-04-01

    Although creativity is attractive in a potential mate, it is unclear (i) whether the effects of creativity on attractiveness generalize to other social contexts and (ii) whether creativity has equivalent effects on men's and women's attractiveness. As social knowledge of creativity may either enhance or 'offset' the appeal of social partners who differ in physical attractiveness, three repeated measures experiments were conducted to directly address these issues. Here, participants rated a series of face-text pairs for attractiveness on trials that differed in one of four combinations of facial attractiveness (attractive and less attractive) and creativity (creative and less creative), rating story-tellers in two experiments (short interpretations of an identical painting) and creative ideas in a further experiment (alternative uses for an everyday object). Regardless of the sex of the judge, creativity and facial attractiveness had independent effects on men's overall attractiveness (initial experiment) and, in further experiments, more substantial effects on the attractiveness of men with less attractive faces than men with attractive faces (when using a different measure of creativity) and specific effects on the attractiveness of individuals with less attractive faces (when using different face stimuli). Collectively, across three experiments, these findings suggest that creativity may compensate for putative cues to lower biological 'quality' and that the benefits of creativity to social groups more generally enhance attraction to creative men (in two experiments) and creative men and women (one experiment). More broadly, the data suggest that species can integrate knowledge of cognitive intelligence with visual cues to biological 'quality' to facilitate mate and/or ally choice.

  20. Creating beauty: creativity compensates for low physical attractiveness when individuals assess the attractiveness of social and romantic partners

    Science.gov (United States)

    2017-01-01

    Although creativity is attractive in a potential mate, it is unclear (i) whether the effects of creativity on attractiveness generalize to other social contexts and (ii) whether creativity has equivalent effects on men's and women's attractiveness. As social knowledge of creativity may either enhance or ‘offset’ the appeal of social partners who differ in physical attractiveness, three repeated measures experiments were conducted to directly address these issues. Here, participants rated a series of face–text pairs for attractiveness on trials that differed in one of four combinations of facial attractiveness (attractive and less attractive) and creativity (creative and less creative), rating story-tellers in two experiments (short interpretations of an identical painting) and creative ideas in a further experiment (alternative uses for an everyday object). Regardless of the sex of the judge, creativity and facial attractiveness had independent effects on men's overall attractiveness (initial experiment) and, in further experiments, more substantial effects on the attractiveness of men with less attractive faces than men with attractive faces (when using a different measure of creativity) and specific effects on the attractiveness of individuals with less attractive faces (when using different face stimuli). Collectively, across three experiments, these findings suggest that creativity may compensate for putative cues to lower biological ‘quality’ and that the benefits of creativity to social groups more generally enhance attraction to creative men (in two experiments) and creative men and women (one experiment). More broadly, the data suggest that species can integrate knowledge of cognitive intelligence with visual cues to biological ‘quality’ to facilitate mate and/or ally choice. PMID:28484614

  1. Personality Mediators of Interpersonal Attraction.

    Science.gov (United States)

    Johnson, Charles D.; And Others

    The current study was an examination of the effect of personality variables on the relationship between attitude disagreement and attraction. Attraction was measured in a neutral situation, designed to maximize any existing affective predispositions toward attitude agreement-disagreements. Subjects were placed in an ambiguous face-to-face…

  2. AIM: Attracting Women into Sciences.

    Science.gov (United States)

    Hartman, Icial S.

    1995-01-01

    Addresses how to attract more college women into the sciences. Attracting Women into Sciences (AIM) is a comprehensive approach that begins with advising, advertising, and ambiguity. The advising process includes dispelling stereotypes and reviewing the options open to a female basic science major. Interaction, involvement and instruction, finding…

  3. The Measurement of Interpersonal Attraction.

    Science.gov (United States)

    McCroskey, James C.; McCain, Thomas A.

    This paper reports a factor analytic investigation of the interpersonal attraction construct. Two hundred-fifteen subjects completed 30 Likert-type, 7-step scales concerning an acquaintance. Factor analysis indicated three dimensions of the interpersonal attraction construct which were labeled "task,""social," and "physical." Obtained internal…

  4. Physical Attractiveness and Courtship Progress.

    Science.gov (United States)

    White, Gregory L.

    1980-01-01

    Among college students who were casual or serious daters, greater relative attractiveness was positively correlated with greater relative availability of opposite-sexed friends and negatively correlated with worrying about partner's potential involvement with others. A 9-month follow-up revealed that similarity of attractiveness was predictive of…

  5. Physical Attractiveness and Counseling Skills.

    Science.gov (United States)

    Vargas, Alice M.; Borkowski, John G.

    1982-01-01

    Searched for interaction between quality of counseling skills (presence or absence of empathy, genuineness, and positive regard) and physical attractiveness as determinants of counseling effectiveness. Attractiveness influenced perceived effectiveness of counselor's skill. Analyses of expectancy data revealed that only with good skills did…

  6. Physical Attractiveness and Counseling Skills.

    Science.gov (United States)

    Vargas, Alice M.; Borkowski, John G.

    1982-01-01

    Searched for interaction between quality of counseling skills (presence or absence of empathy, genuineness, and positive regard) and physical attractiveness as determinants of counseling effectiveness. Attractiveness influenced perceived effectiveness of counselor's skill. Analyses of expectancy data revealed that only with good skills did…

  7. From field observations on eclogites towards modeling of deep subduction processes: 7th International Eclogite Conference (IEC- 7) and First Workshop of Task Group Ⅱ-10 of International Lithosphere Program

    Institute of Scientific and Technical Information of China (English)

    Larissa Dobrzhinetskaya; Georg Hoinkes; Alexander Proyer; Jane Gilotti

    2006-01-01

    @@ The 7th International Eclogite Conference was held in Seggau, near Leibnitz, Austria,from July 3-9, 2005, and was accompanied by inter-conference and post-conference field trips to the Tauren Window of the Alps.

  8. Physical attractiveness stereotype and memory.

    Science.gov (United States)

    Rohner, Jean-Christophe; Rasmussen, Anders

    2011-08-01

    Three experiments examined explicit and implicit memory for information that is congruent with the physical attractiveness stereotype (i.e. attractive-positive and unattractive-negative) and information that is incongruent with the physical attractiveness stereotype (i.e. attractive-negative and unattractive-positive). Measures of explicit recognition sensitivity and implicit discriminability revealed a memorial advantage for congruent compared to incongruent information, as evident from hit and false alarm rates and reaction times, respectively. Measures of explicit memory showed a recognition bias toward congruent compared to incongruent information, where participants tended to call congruent information old, independently of whether the information had been shown previously or not. This recognition bias was unrelated to reports of subjective confidence in retrieval. The present findings shed light on the cognitive mechanisms that might mediate discriminatory behavior towards physically attractive and physically unattractive individuals.

  9. African perceptions of female attractiveness.

    Directory of Open Access Journals (Sweden)

    Vinet Coetzee

    Full Text Available Little is known about mate choice preferences outside Western, educated, industrialised, rich and democratic societies, even though these Western populations may be particularly unrepresentative of human populations. To our knowledge, this is the first study to test which facial cues contribute to African perceptions of African female attractiveness and also the first study to test the combined role of facial adiposity, skin colour (lightness, yellowness and redness, skin homogeneity and youthfulness in the facial attractiveness preferences of any population. Results show that youthfulness, skin colour, skin homogeneity and facial adiposity significantly and independently predict attractiveness in female African faces. Younger, thinner women with a lighter, yellower skin colour and a more homogenous skin tone are considered more attractive. These findings provide a more global perspective on human mate choice and point to a universal role for these four facial cues in female facial attractiveness.

  10. Attractive steric interactions

    CERN Document Server

    Augustus, A S

    1999-01-01

    and (iii), and both the X and Z groups as in (ii), lie on the same side of the ring plane and a 180 deg rotation about a Ar-CH sub 2 X or Ar-CH sub 2 Z bond should give the anti form. In each of these compounds we were able to slow down rotation about both bonds on the NMR time scale and determine whether or not the more compact syn form is the more populated and therefore more stable relative to the anti. The barrier to rotation about the Ar-CH sub 2 X and Ar-CH sub 2 Z bonds is also discussed. In majority of the compounds, with the exception of a few such as the 1-(halomethyl)-3-neopentyl-2,4,5,6-tetramethylbenzenes and the 1,4-disubstituted-2,3,5,6-tetramethylbenzenes, dynamic NMR spectroscopy show that the more compact syn conformations is more stable relative to the anti. The best results were obtained for the 1-neopentyl-2,4,5,6-tetramethylbenzenes left brace type (ii)right brace, where X = tert-butyl and Z = alpha-naphthyl, beta-naphthyl or phenyl. In each of the three compounds, molecular mechanic cal...

  11. Mendel conference

    CERN Document Server

    2015-01-01

    This book is a collection of selected accepted papers of Mendel conference that has been held in Brno, Czech Republic in June 2015. The book contents three chapters which represent recent advances in soft computing including intelligent image processing and bio-inspired robotics.: Chapter 1: Evolutionary Computing, and Swarm intelligence, Chapter 2: Neural Networks, Self-organization, and Machine Learning, and Chapter3: Intelligent Image Processing, and Bio-inspired Robotics. The Mendel conference was established in 1995, and it carries the name of the scientist and Augustinian priest Gregor J. Mendel who discovered the famous Laws of Heredity. In 2015 we are commemorating 150 years since Mendel's lectures, which he presented in Brno on February and March 1865. The main aim of the conference was to create a periodical possibility for students, academics and researchers to exchange their ideas and novel research methods.  .

  12. Effects of student physical attractiveness

    Directory of Open Access Journals (Sweden)

    Krnjajić Stevan B.

    2005-01-01

    Full Text Available Implicit personality theories suggest that people draw conclusions about other persons by using a relatively small number of visible features. The formation of "the first impression" is influenced by the factors, such as sex, age, appearances, race or nationality. Frequently, conclusions based on those factors lead to developing social stereotypes. Attractiveness is a good example of "the first impression" effect, because physical attractiveness entails the creation of impression about another person along a relatively great number of dimensions. Experimental paradigm, introduced in the sphere of interpersonal perception around the mid-20th century, led to a relatively great number of studies on stereotype based on physical attractiveness. One of the most often quoted conclusions of studies on physical attractiveness is summarized by the idiom "what is beautiful is good". For example, socially desirable personality traits (responsibility kindness, energy quality, modesty, more successful private and professional life, are all attributed to physically attractive persons. In addition physical attractiveness is coupled with positive expectations, peer acceptance, academic achievement etc. On the basis of studies on the "what is beautiful is good" stereotype, we have situated our analysis within the domain of roles regulating social interaction between teachers and students i.e. effects of physical attractiveness on teacher expectations, peer acceptance and academic achievement.

  13. Conference Notification

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Roskill Information Services and Metal Events Ltd areorganizing the 2nd International Rare Earths Conference,which will be held at the Conrad Hotel in Hong Kong onFebruary 28 to March 2 2006.The program is structured tocover all the main aspects of the rare earths industry,including development of Chinese rare earth industry; trendsin rare earths demand; potential constraints on supply;research on potential capacity of rare earths supply chain.Global rare earths consumers will attend the conference.Registra...

  14. DOE Workshop at Tapia Conference

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Valerie [Texas A & M Univ., College Station, TX (United States)

    2015-02-19

    The DE-SC0013568 DOE Grant, in the amount of $11,822.79, was used to support five doctoral students from underrepresented groups to attend the 2015 Richard Tapia Celebration of Diversity in Computing Conference, held February 18-21 in Boston, MA. Each scholarship was approximately $1200 to cover conference registration, travel, and lodging for the duration of the conference. The remaining $5,822.79 was used to support a DOE Breakfast Workshop during breakfast on Thursday, February 19. The Breakfast supported approximately 140 graduate students from underrepresented groups to learn about the different career opportunities at the different DOE National Laboratories.

  15. Depression, Schizophrenia, and Social Attraction.

    Science.gov (United States)

    Boswell, Philip C.; Murray, Edward J.

    1981-01-01

    Compared the dysphoric mood induction and attraction that subjects reported after a vicarious experience with a depressed patient and a comparable experience with a schizophrenic patient. Results showed similar arousal of dysphoric mood and rejection for both patients. (RC)

  16. The most attractive energy source

    Energy Technology Data Exchange (ETDEWEB)

    Seltmann, T.

    2003-07-01

    Photovoltaic modules for seamless integration into the roof or the facade are still relatively expensive. Only few building clients treat themselves to the luxury of this attractive power supply. The range on offer is nevertheless very diverse. (orig.)

  17. Environmental Esthetics and Interpersonal Attraction

    Science.gov (United States)

    Kitchens, James T.; And Others

    1977-01-01

    Discusses a study designed to determine the effects of visual environmental esthetics on interpersonal attraction and concludes that visual esthetics influence participants' perspectives of their partners in live interpersonal communication settings. (MH)

  18. African perceptions of female attractiveness

    National Research Council Canada - National Science Library

    Coetzee, Vinet; Faerber, Stella J; Greeff, Jaco M; Lefevre, Carmen E; Re, Daniel E; Perrett, David I

    2012-01-01

    .... To our knowledge, this is the first study to test which facial cues contribute to African perceptions of African female attractiveness and also the first study to test the combined role of facial...

  19. Conference Hopes

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Annual conference outlines tasks for 2010 to solidify China’s economic recovery through rational investment and increasing consumptionc hina will adhere to a consistent and stable economic strategy, putting in place a proactive fiscal policy and an accommodative monetary policy for the 2010 fiscal year-the macro-economic course mapped out during China’s Central

  20. Conference proceedings

    African Journals Online (AJOL)

    abp

    2015-08-07

    Aug 7, 2015 ... African epidemiological association and 1st conference of the Cameroon society of ... International Reference Centre (CIRCB) for research on HIV/AIDS prevention and .... interests (third line regimens, clinical trials and HIV functional cure). ... sharing. Regarding Mycobacterium Tuberculosis, the efficacy of.

  1. Creating kampong as tourist attractions

    Science.gov (United States)

    Sari, N.; Utama, R.; Hidayat, A. R. T.; Zamrony, A. B.

    2017-06-01

    Tourism attractions become one of the main components and they drive the tourism activity in a region. The quality of tourism attractions would affect tourists’ visits. Tourism power can basically be built on any conditions which can attract people to visit. Towns is full of activities which include their economic, social, cultural and physical features, if they are presented properly, they can be a tourist attraction. Kampung City, as a form of urban settlement, has the potential to be developed as a tourism attraction. Kampung is not only a physical area of housing but it has also productive activities. Even the city’s economic activities are also influenced by the productive activities of its Kampung. The shape of Kampung which varies in physical, social, economic and cultural raises special characteristics of each Kampung. When it is linked with the city’s tourism activities, these special characteristics of course could be one of the attractions to attract tourists. This paper studies about one of Kampung in the Malang City. Administratively located in the Penanggungan Village Lowokwaru District, but the potential will just be focused on RW 4. Main productive activities of this village are pottery. In contrast to ceramics, pottery is made from clay and its uniqueness in color and shape. Based on the history of pottery in the Malang, it is concentrated in Penanggungan Village. But along with its development, pottery is decreasingly in demand and number of craftsmen is dwindling. Based on these circumstances, a concept is prepared to raise the image of the region as the Kampung of pottery and to repack it as a tourism attraction of the city.

  2. Same-Sex Attraction and Successful Adolescent Development

    Science.gov (United States)

    Busseri, Michael A.; Willoughby, Teena; Chalmers, Heather; Bogaert, Anthony R.

    2006-01-01

    This study investigated the relation of adolescent same-sex attraction to "successful development" (Baltes, P. B., "Am. Psychol." 32:366-380, 1997). Based on a survey of high-school adolescents, four groups were defined according to the nature of self-reported sexual attraction: exclusively heterosexual (EHA; n=3594); mostly heterosexual (MHA;…

  3. Diagnostic standards for dopaminergic augmentation of restless legs syndrome: report from a World Association of Sleep Medicine-International Restless Legs Syndrome Study Group consensus conference at the Max Planck Institute.

    Science.gov (United States)

    García-Borreguero, Diego; Allen, Richard P; Kohnen, Ralf; Högl, Birgit; Trenkwalder, Claudia; Oertel, Wolfgang; Hening, Wayne A; Paulus, Walter; Rye, David; Walters, Arthur; Winkelmann, Juliane; Earley, Christopher J

    2007-08-01

    Augmentation of symptom severity is the main complication of dopaminergic treatment of restless legs syndrome (RLS). The current article reports on the considerations of augmentation that were made during a European Restless Legs Syndrome Study Group (EURLSSG)-sponsored Consensus Conference in April 2006 at the Max Planck Institute (MPI) in Munich, Germany, the conclusions of which were endorsed by the International RLS Study Group (IRLSSG) and the World Association of Sleep Medicine (WASM). The Consensus Conference sought to develop a better understanding of augmentation and generate a better operational definition for its clinical identification. Current concepts of the pathophysiology, clinical features, and therapy of RLS augmentation were evaluated by subgroups who presented a summary of their findings for general consideration and discussion. Recent data indicating sensitivity and specificity of augmentation features for identification of augmentation were also evaluated. The diagnostic criteria of augmentation developed at the National Institutes of Health (NIH) conference in 2002 were reviewed in light of current data and theoretical understanding of augmentation. The diagnostic value and criteria for each of the accepted features of augmentation were considered by the group. A consensus was then developed for a revised statement of the diagnostic criteria for augmentation. Five major diagnostic features of augmentation were identified: usual time of RLS symptom onset each day, number of body parts with RLS symptoms, latency to symptoms at rest, severity of the symptoms when they occur, and effects of dopaminergic medication on symptoms. The quantitative data available relating the time of RLS onset and the presence of other features indicated optimal augmentation criteria of either a 4-h advance in usual starting time for RLS symptoms or a combination of the occurrence of other features. A paradoxical response to changes in medication dose also indicates

  4. Vocal attractiveness increases by averaging.

    Science.gov (United States)

    Bruckert, Laetitia; Bestelmeyer, Patricia; Latinus, Marianne; Rouger, Julien; Charest, Ian; Rousselet, Guillaume A; Kawahara, Hideki; Belin, Pascal

    2010-01-26

    Vocal attractiveness has a profound influence on listeners-a bias known as the "what sounds beautiful is good" vocal attractiveness stereotype [1]-with tangible impact on a voice owner's success at mating, job applications, and/or elections. The prevailing view holds that attractive voices are those that signal desirable attributes in a potential mate [2-4]-e.g., lower pitch in male voices. However, this account does not explain our preferences in more general social contexts in which voices of both genders are evaluated. Here we show that averaging voices via auditory morphing [5] results in more attractive voices, irrespective of the speaker's or listener's gender. Moreover, we show that this phenomenon is largely explained by two independent by-products of averaging: a smoother voice texture (reduced aperiodicities) and a greater similarity in pitch and timbre with the average of all voices (reduced "distance to mean"). These results provide the first evidence for a phenomenon of vocal attractiveness increases by averaging, analogous to a well-established effect of facial averaging [6, 7]. They highlight prototype-based coding [8] as a central feature of voice perception, emphasizing the similarity in the mechanisms of face and voice perception.

  5. Heritability of Attractiveness to Mosquitoes

    Science.gov (United States)

    Fernández-Grandon, G. Mandela; Gezan, Salvador A.; Armour, John A. L.; Pickett, John A.; Logan, James G.

    2015-01-01

    Female mosquitoes display preferences for certain individuals over others, which is determined by differences in volatile chemicals produced by the human body and detected by mosquitoes. Body odour can be controlled genetically but the existence of a genetic basis for differential attraction to insects has never been formally demonstrated. This study investigated heritability of attractiveness to mosquitoes by evaluating the response of Aedes aegypti (=Stegomyia aegypti) mosquitoes to odours from the hands of identical and non-identical twins in a dual-choice assay. Volatiles from individuals in an identical twin pair showed a high correlation in attractiveness to mosquitoes, while non-identical twin pairs showed a significantly lower correlation. Overall, there was a strong narrow-sense heritability of 0.62 (SE 0.124) for relative attraction and 0.67 (0.354) for flight activity based on the average of ten measurements. The results demonstrate an underlying genetic component detectable by mosquitoes through olfaction. Understanding the genetic basis for attractiveness could create a more informed approach to repellent development. PMID:25901606

  6. International Youth Conference on the Poles

    Science.gov (United States)

    Church, A. K.; Kuhn, T. S.; Baeseman, J.; Garmulewicz, A.; Raymond, M.; Salmon, R.

    2006-12-01

    The International Polar Year (IPY) is an international effort, involving more than 50 countries, to focus research in both the sciences and social sciences on the world's Polar Regions. In order to secure youth involvement in the IPY, the Youth Steering Committee (YSC) has been formed, aiming specifically to network young polar researchers from all backgrounds enabling collaboration and to involve this group in outreach focused towards other young people. A conference targeted directly at an audience of early career researchers and international youth will be central to fulfilling these aims. The YSC has therefore developed the concept of the International Youth Conference on the Poles (IYCP). Proposed for 2008, this conference will bring together youth from a diverse set of backgrounds and nationalities to discuss the issues affecting the Polar Regions, their effects on a global scale and ways of addressing these issues. The conference will also serve to highlight ongoing IPY research, especially research being undertaken by young researchers, and provide a perennial framework for youth involvement in polar research and policies. The IYCP will run for three days in May 2008, attracting an international youth audience, as well as representatives from polar organizations, teachers, politicians, policy makers, the general public and media. The IYCP will be divided into three sections. Youth Roundtable Discussions will bring youth together to discuss issues affecting the Polar Regions and potential solutions to these. A Young Researchers Conference will provide the opportunity for young researchers working in the Polar Regions to present their work to an interdisciplinary audience. The Polar Fair will provide an interactive environment for youth to learn about the Polar Regions. The IYCP will be of great importance to the IPY because it will serve as the principle venue during the Polar Year where youth from many different disciplines, backgrounds and countries will

  7. SIGEF Conference

    CERN Document Server

    Terceño-Gómez, Antonio; Ferrer-Comalat, Joan; Merigó-Lindahl, José; Linares-Mustarós, Salvador

    2015-01-01

    This book is a collection of selected papers presented at the SIGEF conference, held at the Faculty of Economics and Business of the University of Girona (Spain), 06-08 July, 2015. This edition of the conference has been presented with the slogan “Scientific methods for the treatment of uncertainty in social sciences”. There are different ways for dealing with uncertainty in management. The book focuses on soft computing theories and their role in assessing uncertainty in a complex world. It gives a comprehensive overview of quantitative management topics and discusses some of the most recent developments in all the areas of business and management in soft computing including Decision Making, Expert Systems and Forgotten Effects Theory, Forecasting Models, Fuzzy Logic and Fuzzy Sets, Modelling and Simulation Techniques, Neural Networks and Genetic Algorithms and Optimization and Control. The book might be of great interest for anyone working in the area of management and business economics and might be es...

  8. Conference information

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    @@ Thermag Ⅳ- The 4th International Conference on Magnetic Refrigeration at Room Temperature of IIR Refrigeration technology is widely used today. However, traditional vapor compression/expansion refrigeration technology has some disadvantages, such as low conversion efficiency of vapor compressor, and emission of the ozonosphere depletion gas and greenhouse effect gas, etc. Magnetic refrigeration is a new cooling technology with huge potential application prospect, characterized by high efficiency, energy saving and environmental friendly.

  9. Attractive ellipsoids in robust control

    CERN Document Server

    Poznyak, Alexander; Azhmyakov, Vadim

    2014-01-01

    This monograph introduces a newly developed robust-control design technique for a wide class of continuous-time dynamical systems called the “attractive ellipsoid method.” Along with a coherent introduction to the proposed control design and related topics, the monograph studies nonlinear affine control systems in the presence of uncertainty and presents a constructive and easily implementable control strategy that guarantees certain stability properties. The authors discuss linear-style feedback control synthesis in the context of the above-mentioned systems. The development and physical implementation of high-performance robust-feedback controllers that work in the absence of complete information is addressed, with numerous examples to illustrate how to apply the attractive ellipsoid method to mechanical and electromechanical systems. While theorems are proved systematically, the emphasis is on understanding and applying the theory to real-world situations. Attractive Ellipsoids in Robust Control will a...

  10. The physics of pollinator attraction.

    Science.gov (United States)

    Moyroud, Edwige; Glover, Beverley J

    2017-10-01

    Contents 350 I. 350 II. 350 III. 352 IV. 353 V. 353 353 References 354 SUMMARY: This Tansley Insight focuses on recent advances in our understanding of how flowers manipulate physical forces to attract animal pollinators and ensure reproductive success. Research has traditionally explored the role of chemical pigments and volatile organic compounds as cues for pollinators, but recent reports have demonstrated the importance of physical and structural means of pollinator attraction. Here we explore the role of petal microstructure in influencing floral light capture and optics, analysing colour, gloss and polarization effects. We discuss the interaction between flower, pollinator and gravity, and how petal surface structure can influence that interaction. Finally, we consider the role of electrostatic forces in pollen transfer and pollinator attraction. We conclude that this new interdisciplinary field is evolving rapidly. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  11. International Conference on Cosmic Rays

    CERN Multimedia

    W.O. LOCK

    1964-01-01

    Towards the end of last year the 8th International conference on cosmic rays, held under the auspices of the International Union of Pure and Applied Physics (I.U.P.A.P.) and the Department of Atomic Energy of the Government of India, was held at Jaipur, India. Among the participants was W.O. Lock, head of CERN's Emulsion Group, who gave an invited talk on recent work in the field of what is normally known as high-energy physics — though in the context of this conference such energies seem quite low. In this article, Dr. Lock gives a general review of the conference and of the subjects discussed.

  12. International Conference on Algebraic Topology

    CERN Document Server

    Cohen, Ralph; Miller, Haynes; Ravenel, Douglas

    1989-01-01

    These are proceedings of an International Conference on Algebraic Topology, held 28 July through 1 August, 1986, at Arcata, California. The conference served in part to mark the 25th anniversary of the journal Topology and 60th birthday of Edgar H. Brown. It preceded ICM 86 in Berkeley, and was conceived as a successor to the Aarhus conferences of 1978 and 1982. Some thirty papers are included in this volume, mostly at a research level. Subjects include cyclic homology, H-spaces, transformation groups, real and rational homotopy theory, acyclic manifolds, the homotopy theory of classifying spaces, instantons and loop spaces, and complex bordism.

  13. Functional Similarity and Interpersonal Attraction.

    Science.gov (United States)

    Neimeyer, Greg J.; Neimeyer, Robert A.

    1981-01-01

    Students participated in dyadic disclosure exercises over a five-week period. Results indicated members of high functional similarity dyads evidenced greater attraction to one another than did members of low functional similarity dyads. "Friendship" pairs of male undergraduates displayed greater functional similarity than did…

  14. Attracting Birds to Your Backyard.

    Science.gov (United States)

    Joyce, Brian

    1994-01-01

    Discusses methods for drawing birds to outdoor education areas, including the use of wild and native vegetation. Lists specific garden plants suitable for attracting birds in each season. Includes a guide to commercial bird seed and instructions for building homemade birdfeeders and nestboxes. (LZ)

  15. Functional Similarity and Interpersonal Attraction.

    Science.gov (United States)

    Neimeyer, Greg J.; Neimeyer, Robert A.

    1981-01-01

    Students participated in dyadic disclosure exercises over a five-week period. Results indicated members of high functional similarity dyads evidenced greater attraction to one another than did members of low functional similarity dyads. "Friendship" pairs of male undergraduates displayed greater functional similarity than did "nominal" pairs from…

  16. Attracting and Preparing Worthy Teachers.

    Science.gov (United States)

    Shiina, Mankichi; Chonan, Mitsuo

    1993-01-01

    Attracting worthy teachers to the compulsory education system in Japan requires attention to three issues: teacher salaries, strengthening initial teacher preparation, and expansion and systemization of teacher training. The one-year beginning teachers' inservice training program began in 1989 in response to the third issue. (IAH)

  17. The attractiveness of car use

    NARCIS (Netherlands)

    Bleijenberg, A.N.

    2012-01-01

    Understanding the driving forces behind car use is necessary for the development of effective transport policies. The high door-to-door speed of the car in comparison with other travel modes forms its main attractiveness. And speed is the main engine for mobility growth, which is not easy to curb. P

  18. European consensus conference on diagnosis and treatment of germ cell cancer: a report of the second meeting of the European Germ Cell Cancer Consensus group (EGCCCG): part I.

    NARCIS (Netherlands)

    Krege, S.; Beyer, J.; Souchon, R.; Albers, P.; Albrecht, W.; Algaba, F.; Bamberg, M.; Bodrogi, I.; Bokemeyer, C.; Cavallin-Stahl, E.; Classen, J.; Clemm, C.; Cohn-Cedermark, G.; Culine, S.; Daugaard, G.; Mulder, P.H.M. de; Santis, M. de; Wit, M. de; Wit, R. de; Derigs, H.G.; Dieckmann, K.P.; Dieing, A.; Droz, J.P.; Fenner, M.; Fizazi, K.; Flechon, A.; Fossa, S.D.; Muro, X.G. del; Gauler, T.; Geczi, L.; Gerl, A.; Germa-Lluch, J.R.; Gillessen, S.; Hartmann, J.T.; Hartmann, M.; Heidenreich, A.; Hoeltl, W.; Horwich, A.; Huddart, R.; Jewett, M.; Joffe, J.; Jones, W.G.; Kisbenedek, L.; Klepp, O.; Kliesch, S.; Koehrmann, K.U.; Kollmannsberger, C.; Kuczyk, M.; Laguna, P.; Galvis, O.L.; Loy, V.; Mason, M.D.; Mead, G.M.; Mueller, R.; Nichols, C.; Nicolai, N.; Oliver, T.; Ondrus, D.; Oosterhof, G.O.; Ares, L.P.; Pizzocaro, G.; Pont, J.; Pottek, T.; Powles, T.; Rick, O.; Rosti, G.; Salvioni, R.; Scheiderbauer, J.; Schmelz, H.U.; Schmidberger, H.; Schmoll, H.J.; Schrader, M.; Sedlmayer, F.; Skakkebaek, N.E.; Sohaib, A.; Tjulandin, S.; Warde, P.; Weinknecht, S.; Weissbach, L.; Wittekind, C.; Winter, E.; Wood, L.; Maase, H. von der

    2008-01-01

    OBJECTIVES: The first consensus report presented by the European Germ Cell Cancer Consensus Group (EGCCCG) in the year 2004 has found widespread approval by many colleagues throughout the world. In November 2006, the group met a second time under the auspices of the Department of Urology of the Amst

  19. European consensus conference on diagnosis and treatment of germ cell cancer: a report of the second meeting of the European Germ Cell Cancer Consensus Group (EGCCCG): part II.

    NARCIS (Netherlands)

    Krege, S.; Beyer, J.; Souchon, R.; Albers, P.; Albrecht, W.; Algaba, F.; Bamberg, M.; Bodrogi, I.; Bokemeyer, C.; Cavallin-Stahl, E.; Classen, J.; Clemm, C.; Cohn-Cedermark, G.; Culine, S.; Daugaard, G.; Mulder, P.H.M. de; Santis, M. De; Wit, M. de; Wit, R. de; Derigs, H.G.; Dieckmann, K.P.; Dieing, A.; Droz, J.P.; Fenner, M.; Fizazi, K.; Flechon, A.; Fossa, S.D.; Muro, X.G. del; Gauler, T.; Geczi, L.; Gerl, A.; Germa-Lluch, J.R.; Gillessen, S.; Hartmann, J.T.; Hartmann, M.; Heidenreich, A.; Hoeltl, W.; Horwich, A.; Huddart, R.; Jewett, M.; Joffe, J.; Jones, W.G.; Kisbenedek, L.; Klepp, O.; Kliesch, S.; Koehrmann, K.U.; Kollmannsberger, C.; Kuczyk, M.; Laguna, P.; Galvis, O.L.; Loy, V.; Mason, M.D.; Mead, G.M.; Mueller, R.; Nichols, C.; Nicolai, N.; Oliver, T.; Ondrus, D.; Oosterhof, G.O.; Paz-Ares, L.; Pizzocaro, G.; Pont, J.; Pottek, T.; Powles, T.; Rick, O.; Rosti, G.; Salvioni, R.; Scheiderbauer, J.; Schmelz, H.U.; Schmidberger, H.; Schmoll, H.J.; Schrader, M.; Sedlmayer, F.; Skakkebaek, N.E.; Sohaib, A.; Tjulandin, S.; Warde, P.; Weinknecht, S.; Weissbach, L.; Wittekind, C.; Winter, E.; Wood, L.; Maase, H. von der

    2008-01-01

    OBJECTIVES: The first consensus report that had been presented by the European Germ Cell Cancer Consensus Group (EGCCCG) in 2004 has found widespread approval by many colleagues throughout the world. In November 2006, the group met a second time under the auspices of the Department of Urology of the

  20. European consensus conference on diagnosis and treatment of germ cell cancer: a report of the second meeting of the European Germ Cell Cancer Consensus Group (EGCCCG): part II

    DEFF Research Database (Denmark)

    Krege, Susanne; Beyer, Jörg; Souchon, Rainer;

    2007-01-01

    OBJECTIVES: The first consensus report that had been presented by the European Germ Cell Cancer Consensus Group (EGCCCG) in 2004 has found widespread approval by many colleagues throughout the world. In November 2006, the group met a second time under the auspices of the Department of Urology of ...

  1. European consensus conference on diagnosis and treatment of germ cell cancer: a report of the second meeting of the European Germ Cell Cancer Consensus group (EGCCCG): part I

    DEFF Research Database (Denmark)

    Krege, Susanne; Beyer, Jörg; Souchon, Rainer;

    2007-01-01

    OBJECTIVES: The first consensus report presented by the European Germ Cell Cancer Consensus Group (EGCCCG) in the year 2004 has found widespread approval by many colleagues throughout the world. In November 2006, the group met a second time under the auspices of the Department of Urology of the A...

  2. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  3. Conference Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Riveros, P. A.; Dutrizac, J. E. [Natural Resources Canada, Ottawa, ON (Canada)] [eds.

    2001-07-01

    This workshop is part of a continuing series of joint workshops organized by CANMET of Natural Resources Canada and the Research Directorate-General of the European Commission in the areas of sustainable metallurgical processing, recycling and environmental protection. The program presented at this conference also benefited from the organizational support of the Canadian Association of Recycling Industries. Over the past twenty years these workshops served as a valuable forum for the discussion of the technological issues associated with metallurgical processing, recycling and compliance with environmental regulations within the framework of sustainable development. The program this year was organized in five sessions. A total of 32 papers were presented. Session One emphasized the international dimension of modern research as illustrated by the Intelligent Manufacturing System (MIS) program. Session Two dealt with recycling, with special attention to the recycling of plastics and construction materials. Session Three was devoted to highlighting European efforts to treat chromium-bearing solutions or to find alternatives to chromium salts in surface treatment operations. Session Four emphasized primary and secondary zinc processing and the importance of energy conservation. The final session reviewed waste management practices and the utilization of waste materials. Opening addresses by representatives of the sponsoring organizations and a list of conference attendees and their affiliations are also included.

  4. EGC Conferences

    CERN Document Server

    Ritschard, Gilbert; Pinaud, Bruno; Venturini, Gilles; Zighed, Djamel; Advances in Knowledge Discovery and Management

    This book is a collection of representative and novel works done in Data Mining, Knowledge Discovery, Clustering and Classification that were originally presented in French at the EGC'2012 Conference held in Bordeaux, France, on January 2012. This conference was the 12th edition of this event, which takes place each year and which is now successful and well-known in the French-speaking community. This community was structured in 2003 by the foundation of the French-speaking EGC society (EGC in French stands for ``Extraction et Gestion des Connaissances'' and means ``Knowledge Discovery and Management'', or KDM). This book is intended to be read by all researchers interested in these fields, including PhD or MSc students, and researchers from public or private laboratories. It concerns both theoretical and practical aspects of KDM. The book is structured in two parts called ``Knowledge Discovery and Data Mining'' and ``Classification and Feature Extraction or Selection''. The first part (6 chapters) deals with...

  5. Designing attractive gamification features for collaborative storytelling websites.

    Science.gov (United States)

    Hsu, Shang Hwa; Chang, Jen-Wei; Lee, Chun-Chia

    2013-06-01

    Gamification design is considered as the predictor of collaborative storytelling websites' success. Although aforementioned studies have mentioned a broad range of factors that may influence gamification, they neither depicted the actual design features nor relative attractiveness among them. This study aims to identify attractive gamification features for collaborative storytelling websites. We first constructed a hierarchical system structure of gamification design of collaborative storytelling websites and conducted a focus group interview with eighteen frequent users to identify 35gamification features. After that, this study determined the relative attractiveness of these gamification features by administrating an online survey to 6333 collaborative storytelling websites users. The results indicated that the top 10 most attractive gamification features could account for more than 50% of attractiveness among these 35 gamification features. The feature of unpredictable time pressure is important to website users, yet not revealed in previous relevant studies. Implications of the findings were discussed.

  6. Acarine attractants: Chemoreception, bioassay, chemistry and control.

    Science.gov (United States)

    Carr, Ann L; Roe, Michael

    2016-07-01

    The Acari are of significant economic importance in crop production and human and animal health. Acaricides are essential for the control of these pests, but at the same time, the number of available pesticides is limited, especially for applications in animal production. The Acari consist of two major groups, the mites that demonstrate a wide variety of life strategies, i.e., herbivory, predation and ectoparasitism, and ticks which have evolved obligatory hematophagy. The major sites of chemoreception in the acarines are the chelicerae, palps and tarsi on the forelegs. A unifying name, the "foretarsal sensory organ" (FSO), is proposed for the first time in this review for the sensory site on the forelegs of all acarines. The FSO has multiple sensory functions including olfaction, gustation, and heat detection. Preliminary transcriptomic data in ticks suggest that chemoreception in the FSO is achieved by a different mechanism from insects. There are a variety of laboratory and field bioassay methods that have been developed for the identification and characterization of attractants but minimal techniques for electrophysiology studies. Over the past three to four decades, significant progress has been made in the chemistry and analysis of function for acarine attractants in mites and ticks. In mites, attractants include aggregation, immature female, female sex and alarm pheromones; in ticks, the attraction-aggregation-attachment, assembly and sex pheromones; in mites and ticks host kairomones and plant allomones; and in mites, fungal allomones. There are still large gaps in our knowledge of chemical communication in the acarines compared to insects, especially relative to acarine pheromones, and more so for mites than ticks. However, the use of lure-and-kill and lure-enhanced biocontrol strategies has been investigated for tick and mite control, respectively, with significant environmental advantages which warrant further study.

  7. On Attracting Lagrangian Coherent Structures

    CERN Document Server

    Karrasch, Daniel

    2013-01-01

    In this note, we show that in the autonomous, two-dimensional incompressible saddle flow, contrary to common intuition, also attracting Lagrangian Coherent Structures (LCSs) can show up as ridges of the forward finite-time Lyapunov exponent (FTLE) field. This raises the issue of characterization of attracting LCSs from forward time FTLE analysis. First, we extend recent results of Haller & Sapsis (2011) [11] on the relation between forward and backward maximal and minimal stretching rates to the whole finite-time Lyapunov spectrum and to stretching directions by considering the singular value decomposition (SVD) of the deformation gradient. We show two significant advantages of the SVD compared to the usual eigendecomposition of the Cauchy-Green strain tensor: (1) one gains theoretical insight into local deformation under a finite-time dynamical system, and (2) one obtains both complete forward and backward strain information from a single grid advection. Furthermore, we give a short and direct proof of t...

  8. Attract Visitors to Your Site

    CERN Document Server

    MacDonald, Matthew

    2010-01-01

    To be a success, a website has to attract-and keep--visitors. This Mini Missing Manual shows you how to attract new and return visitors and use the power of keywords and Web search engines to rise up in the rankings of search results. You'll also learn how to use a powerful-and free--service that tracks visitor activity on your site so you know which of your Web pages they love, and-just as important--which pages don't work for them. Using this information, you can fine-tune your site to keep the visitors coming. This Mini Missing Manual is excerpted from Creating a Web Site: The Missing Man

  9. Fingertip aura and interpersonal attraction.

    Science.gov (United States)

    Murstein, B I; Hadjolian, S E

    1977-06-01

    Concluding from our survey of the literature that fingertip auras (Kirlian effect) might be associated with interpersonal attraction, four hypotheses were advanced to test this assertion. It was hypothesized that individuals would respond with bigger auras to (1) opposite-sex photographers as compared to same-sex photographers, (2) to seductive opposite-sex photographers as opposed to normally behaving opposite-sex photographers, (3) to opposite-sex unknown peers as opposed to same-sex unknown peers, and (4) to liked as opposed to disliked same-sex persons. All hypotheses except (2) were supported. The second hypothesis was significant in a direction contrary to hypothesis. Fingertip auras are seen as a promising measurement device in the study of interpersonal attraction.

  10. Pyrazines Attract Catocheilus Thynnine Wasps

    Directory of Open Access Journals (Sweden)

    Bjorn Bohman

    2014-06-01

    Full Text Available Five previously identified semiochemicals from the sexually deceptive Western Australian hammer orchid Drakaea livida, all showing electrophysiological activity in gas chromatography–electroantennogram detection (EAD studies, were tested in field bioassays as attractants for a Catocheilus thynnine wasp. Two of these compounds, (3,5,6-trimethylpyrazin-2-ylmethyl 3-methylbutanoate and 2-(3-methylbutyl-3,5,6-trimethylpyrazine, were attractive to male wasps. Additionally, the semiochemical 3-(3-methylbutyl-2,5-dimethylpyrazine, a close analogue to 2-(3-methylbutyl-3,5,6-trimethylpyrazine, identified in five other species of thynnine wasps, was equally active. The three remaining compounds from D. livida, which were EAD-active against Catocheilus, did not attract the insects in field trials. It is interesting that two structurally similar compounds induce similar behaviours in field experiments, yet only one of these compounds is present in the orchid flower. Our findings suggest the possibility that despite the high specificity normally characterising sex pheromone systems, the evolution of sexual deception may not be entirely constrained by the need to precisely match the sex pheromone constituents and blends. Such evolutionary flexibility may be particularly important during the early stages of speciation.

  11. Subjective and Objective Facial Attractiveness

    Science.gov (United States)

    Stillman, Mark A.; Frisina, Andrew C.

    2010-01-01

    Background: Studies have not adequately compared subjective/objective ratings of female dermatology patients including patients presenting for cosmetic procedures. Objective: To examine objective versus subjective facial attractiveness ratings, demographic variables, and how men versus women judge female facial attractiveness. Methods: Sixty-five women (mean 42 years) presenting to a dermatology office. Subjects filled out a demographic and attractiveness questionnaire and were photographed. Four judges (2 male and 2 female) rated the photographs on a predefined 1 to 7 scale. Results: Mean subjective rating (subjects rating themselves) was 4.85 versus 3.61 for objective rating (judges rating subjects) (p<0.001). The mean age of subjects self-rating (subjective rating) who rated themselves in the 5 to 7 range was 39 years; the mean age of subjects self-rating (subjective rating) who rated themselves in the 3 to 4 range was 45 years (p=0.053). The mean age of subjects objectively rated by judges in the 5 to 7 range was 33 years; the mean age of subjects objectively rated by judges in the 3 to 4 range was 43 years (p<0.001); and the mean age of subjects objectively rated by judges in the 1 to 2 range was 50 years (p<0.001). The mean subjective rating (subjects rating themselves) for married women was 4.55 versus 5.27 for unmarried women (p=0.007); the mean objective rating (judges rating subjects) was 3.22 versus 4.15 (p<0.001). The mean objective rating by male judges was 3.09 versus 4.12 for female judges (p<0.001) Conclusion: Female patients presenting to a dermatology office rated themselves more attractive than did judges who viewed photographs of the subjects. Age and marital status were significant factors, and male judges rated attractiveness lower than female judges. Limitations of the study, implications, and suggestions for future research directions are discussed. PMID:21203353

  12. Branner-Hubbard Motions and attracting dynamics

    DEFF Research Database (Denmark)

    Petersen, Carsten Lunde; Tan, Lei

    2006-01-01

    We introduce a new notion of attracting dynamics, which is related to polynomial-like mappings. Also we review the Branner-Hubbard Motion and study its action on attracting dynamics.......We introduce a new notion of attracting dynamics, which is related to polynomial-like mappings. Also we review the Branner-Hubbard Motion and study its action on attracting dynamics....

  13. Global Conference on Applied Physics and Mathematics

    CERN Document Server

    2016-01-01

    The Global Conference on Applied Physics and Mathematics is organized by academics and researchers belonging to different scientific areas of the C3i/Polytechnic Institute of Portalegre (Portugal) and the University of Extremadura (Spain) with the technical support of ScienceKnow Conferences. The event has the objective of creating an international forum for academics, researchers and scientists from worldwide to discuss worldwide results and proposals regarding to the soundest issues related to Applied Physics and Mathematics. This event will include the participation of renowned keynote speakers, oral presentations, posters sessions and technical conferences related to the topics dealt with in the Scientific Program as well as an attractive social and cultural program. The papers will be published in the Proceedings e-books. The proceedings of the conference will be sent to possible indexing on Thomson Reuters (selective by Thomson Reuters, not all-inclusive) and Google Scholar. Those communications con...

  14. MUSME Conference

    CERN Document Server

    Martinez, Eusebio

    2015-01-01

    This volume contains the Proceedings of MUSME 2014, held at Huatulco in Oaxaca, Mexico, October 2014. Topics include analysis and synthesis of mechanisms; dynamics of multibody systems; design algorithms for mechatronic systems; simulation procedures and results; prototypes and their performance; robots and micromachines; experimental validations; theory of mechatronic simulation; mechatronic systems; and control of mechatronic systems. The MUSME symposium on Multibody Systems and Mechatronics was held under the auspices of IFToMM, the International Federation for Promotion of Mechanism and Machine Science, and FeIbIM, the Iberoamerican Federation of Mechanical Engineering. Since the first symposium in 2002, MUSME events have been characterised by the way they stimulate the integration between the various mechatronics and multibody systems dynamics disciplines, present a forum for facilitating contacts among researchers and students mainly in South American countries, and serve as a joint conference for the ...

  15. Individual differences in valuing mates' physical attractiveness.

    Science.gov (United States)

    Mathes, Eugene W; Bielser, Abby; Cassell, Ticcarra; Summers, Sarah; Witowski, Aggie

    2006-10-01

    To investigate correlates of valuing physical attractiveness in a mate, it was hypothesized that valuing physical attractiveness in a mate would correlate with sex and valuing promiscuous sex, status, personal physical attractiveness, beauty, and order. Men and women college students completed measures of the extent to which they valued physical attractiveness in a mate and other variables. Valuing physical attractiveness in a mate was correlated with sex (men valued physical attractiveness in a mate more than did women) and valuing promiscuous sex and status, and, for women, valuing personal physical attractiveness. The results were explained in terms of evolutionary theory.

  16. Group Cooperation, Inclusion and Disaffected Pupils: Some Responses to Informal Learning in the Music Classroom. Presented at the RIME Conference 2007, Exeter, UK

    Science.gov (United States)

    Green, Lucy

    2008-01-01

    This paper examines some personal and interpersonal issues concerning group work and informal learning in the music classroom. It analyses data from a recent research project, which adopted and adapted the informal music learning practices of popular musicians, for use in the classroom. The discussion focuses on three aspects of the project.…

  17. Infant preferences for attractive faces: a cognitive explanation.

    Science.gov (United States)

    Rubenstein, A J; Kalakanis, L; Langlois, J H

    1999-05-01

    Research on infant face perception has shown that infants' preferences for attractive faces exist well before socialization from parents, peers, and the media can affect these preferences. Four studies assessed a cognitive explanation for the development of attractiveness preferences: cognitive averaging and infant preferences for mathematically averaged faces, or prototypes. Studies 1 and 2 demonstrated that both adults and 6-month-old infants prefer prototypical, mathematically averaged faces. Studies 3 and 4 demonstrated that 6-month-olds can abstract the central tendency from a group of naturalistic faces. Taken together, the studies suggest that infants' preferences for attractive faces can be explained by general information-processing mechanisms.

  18. Is There an Own-Race Preference in Attractiveness?

    Directory of Open Access Journals (Sweden)

    Darren Burke

    2013-10-01

    Full Text Available Even in multicultural nations interracial relationships and marriages are quite rare, one reflection of assortative mating. A relatively unexplored factor that could explain part of this effect is that people may find members of their own racial group more attractive than members of other groups. We tested whether there is an own-race preference in attractiveness judgments, and also examined the effect of familiarity by comparing the attractiveness ratings given by participants of different ancestral and geographic origins to faces of European, East Asian and African origin. We did not find a strong own-race bias in attractiveness judgments, but neither were the data consistent with familiarity, suggesting an important role for other factors determining the patterns of assortative mating observed.

  19. Is there an own-race preference in attractiveness?

    Science.gov (United States)

    Burke, Darren; Nolan, Caroline; Hayward, William Gordon; Russell, Robert; Sulikowski, Danielle

    2013-08-15

    Even in multicultural nations interracial relationships and marriages are quite rare, one reflection of assortative mating. A relatively unexplored factor that could explain part of this effect is that people may find members of their own racial group more attractive than members of other groups. We tested whether there is an own-race preference in attractiveness judgments, and also examined the effect of familiarity by comparing the attractiveness ratings given by participants of different ancestral and geographic origins to faces of European, East Asian and African origin. We did not find a strong own-race bias in attractiveness judgments, but neither were the data consistent with familiarity, suggesting an important role for other factors determining the patterns of assortative mating observed.

  20. 2 nd Mid-European Clay Conference

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The 2nd Mid-European Clay Conference (MECC'04) was held between 20-24th September 2004, in Miskolc, Hungary. The idea to hold common conferences was accepted by the national clay groups of four neighbouring countries, Poland, Slovakia, Hungary and Croatia, during the EUROCLAY Meeting in Cracow, Poland, in 1999. The first conference was held in 2001 at Stará Lesná, in the High Tatra Mts. in Slovakia.

  1. 78 FR 10180 - Annual Computational Science Symposium; Conference

    Science.gov (United States)

    2013-02-13

    ... current initiatives, and collaborative project groups will address specific challenges in accessing and... HUMAN SERVICES Food and Drug Administration Annual Computational Science Symposium; Conference AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public conference. SUMMARY: The Food and Drug...

  2. The Analysis on the Relationship of Tourist Attraction Interest Groups of the Cities Along the Yangtze River in Anhui Province based on the Game Theory%基于博弈视角的皖江城市带旅游景区利益群体关系测度分析

    Institute of Scientific and Technical Information of China (English)

    秦广虎

    2013-01-01

      文章基于旅游景区利益群体关系复杂的背景,运用博弈论中的不完全信息动态博弈理论,分析我国旅游景区利益群体间的利益构成、影响因素和博弈形成的不同格局,通过对皖江城市带景区利益群体关系实证分析,探讨利益群体间的博弈关系发展轨迹,并从门票价格制定、旅行社服务质量、当地居民行为规范、景区的服务与接待能力提升和政府利益再分配等方面,提出改善我国旅游景区利益群体关系的对策。%Based on the complex background of the tourist attraction interest groups, the paper uses the Game Theory of incompleta-tion information dynamic, analyses the interests constitutation 、factors and different patterns of formation among tourist attraction interest groups, through the analysis of the patterns, from the ticket price formulation, the service quality of travel agency, the local residents be-havior,promotion of the service and reception ability, and government redistribution of interests to explore the development path of the in-terest groups and the countermeasures to improve the relationship among interest groups in our country.

  3. Fourth Integrated Communications, Navigation, and Surveillance (ICNS) Conference and Workshop 2004: Conclusions and Recommendations

    Science.gov (United States)

    Phillips, Brent; Swanda, Ronald L.; Lewis, Michael S.; Kenagy, Randy; Donahue, George; Homans, Al; Kerczewski, Robert; Pozesky, Marty

    2004-01-01

    The NASA Glenn Research Center organized and hosted the Fourth Integrated Communications, Navigation, and Surveillance (ICNS) Technologies Conference and Workshop, which took place April 26-30, 2004 at the Hyatt Fair Lakes Hotel in Fairfax, Virginia. This fourth conference of the annual series followed the very successful first ICNS Conference (May 1-3, 2001 in Cleveland, Ohio), second ICNS conference (April 29-May 2, 2002 in Vienna, Virginia), and third ICNS conference (May 19-22, 2003 in Annapolis, Maryland). The purpose of the Fourth ICNS Conference was to assemble government, industry and academic communities performing research and development for advanced digital communications, surveillance and navigation systems and associated applications supporting the national and global air transportation systems to: 1) Understand current efforts and recent results in near- and far-term R&D and technology demonstration; 2) Identify integrated digital communications, navigation and surveillance R&D requirements necessary for a safe, secure and reliable, high-capacity, advanced air transportation system; 3) Provide a forum for fostering collaboration and coordination; and 4) Discuss critical issues and develop recommendations to achieve the future integrated CNS vision for national and global air transportation. The workshop attracted 316 attendees from government, industry and academia to address these purposes through technical presentations, breakout sessions, and individual and group discussions during the workshop and after-hours events, and included 16 international attendees. An Executive Committee consisting of representatives of several key segments of the aviation community concerned with CNS issues met on the day following the workshop to consider the primary outcomes and recommendations of the workshop. This report presents an overview of the conference, workshop breakout session results, and the findings of the Executive Committee.

  4. Attracting Principals to the Superintendency

    Directory of Open Access Journals (Sweden)

    Aimee Howley

    2002-10-01

    Full Text Available Responding to a perceived shortage of school superintendents in Ohio as well as elsewhere in the nation, this study examined the conditions of the job that make it attractive or unattractive as a career move for principals. The researchers surveyed a random sample of Ohio principals, receiving usable responses from 508 of these administrators. Analysis of the data revealed that principals perceived the ability to make a difference and the extrinsic motivators (e.g., salary and benefits associated with the superintendency as conditions salient to the decision to pursue such a job. Furthermore, they viewed the difficulties associated with the superintendency as extremely important. Among these difficulties, the most troubling were: (1 increased burden of responsibility for local, state, and federal mandates; (2 need to be accountable for outcomes that are beyond an educator’s control; (3 low levels of board support, and (4 excessive pressure to perform. The researchers also explored the personal and contextual characteristics that predisposed principals to see certain conditions of the superintendency as particularly attractive or particularly troublesome. Only two such characteristics, however, proved to be predictive: (1 principals with fewer years of teaching experience were more likely than their more experienced counterparts to rate the difficulty of the job as important to the decision to pursue a position as superintendent, and (2 principals who held cosmopolitan commitments were more likely than those who did not hold such commitments to view the salary and benefits associated with the superintendency as important. Findings from the study provided some guidance to those policy makers who are looking for ways to make the superintendency more attractive as a career move for principals. In particular, the study suggested that policy makers should work to design incentives that address school leaders’ interest in making a difference at the

  5. Attracting young talents to manufacturing

    DEFF Research Database (Denmark)

    Perini, Stefano; Oliveira, Manuel; Costa, Joao

    2014-01-01

    a strong integrated strategy towards attracting young talent to manufacturing, by raising the aware-ness and providing the acquisition of new manufacturing skills. The key-concepts and the strategy to achieve learning objectives are presented. Finally, ManuSkills Five Pillars, i.e. Interaction...... have been made both in STEM and manufacturing education. However, there is still a lack of concrete strategies harmonizing together delivery mechanisms and pedagogical frameworks throughout the whole student lifecycle. In order to mitigate these urgent needs, ManuSkills innovative approach provides...

  6. U.S. Geological Survey Subsidence Interest Group conference, Edwards Air Force Base, Antelope Valley, California, November 18-19, 1992; abstracts and summary

    Science.gov (United States)

    Prince, Keith R.; Galloway, Devin L.; Leake, Stanley A.

    1995-01-01

    with this unprecedented increase in pumpage, substantial amounts of land subsidence were observed in several areas of the United States, most notably in Arizona, California, and Texas. Beginning in 1955, under the direction of Joseph Poland, the Geological Survey began the "Mechanics of Aquifers Project," which focused largely on the processes that resulted in land subsidence due to the withdrawal of ground water. This research team gained international renown as they advanced the scientific understanding of aquifer mechanics and land-subsidence theory. The results of field studies by members of this research group not only verified the validity of the application of Terzaghi's consolidation theory to compressible aquifers, but they also provided definitions, methods of quantification, and confirmation of the interrelation among hydraulic head declines, aquifer-system compaction, and land subsidence. In addition to conducting pioneering research, this group also formed a "center of expertise," providing a focal point within the Geological Survey for the dissemination of technology and scientific understanding in aquifer mechanics. However, when the "Mechanics of Aquifers Project" was phased out in 1984, the focal point for technology transfer no longer existed. Interest among various state and local agencies in land subsidence has persisted, and the Geological Survey has continued to participate in a broad spectrum of cooperative and Federally funded projects in aquifer mechanics and land subsidence. These projects are designed to identify and monitor areas with the potential for land subsidence, to conduct basic research in the processes that control land subsidence and the development of earth fissures, as well as to develop new quantitative tools to predict aquifer-system deformation. In 1989 an ad hoc "Aquifer Mechanics and Subsidence Interest Group" (referred to herein as the "Subsidence Interest Group") was formed

  7. Seventh Scandinavian Conference on Artificial Intelligence

    DEFF Research Database (Denmark)

    Lund, Henrik Hautop; Mayoh, Brian Henry; Perram, John

    2001-01-01

    The book covers the seventh Scandinavian Conference on Artificial Intelligence, held at the Maersk Mc-Kinney Moller Institute for Production Technology at the University of Southern Denmark during the period 20-21 February, 2001. It continues the tradition established by SCAI of being one...... of the most important regional AI conferences in Europe, attracting high quality submissions from Scandinavia and the rest of the world, including the Baltic countries. The contents include robotics, sensor/motor intelligence, evolutionary robotics, behaviour-based systems, multi-agent systems, applications...

  8. Seventh Scandinavian Conference on Artificial Intelligence

    DEFF Research Database (Denmark)

    Lund, Henrik Hautop; Mayoh, Brian Henry; Perram, John

    2001-01-01

    The book covers the seventh Scandinavian Conference on Artificial Intelligence, held at the Maersk Mc-Kinney Moller Institute for Production Technology at the University of Southern Denmark during the period 20-21 February, 2001. It continues the tradition established by SCAI of being one...... of the most important regional AI conferences in Europe, attracting high quality submissions from Scandinavia and the rest of the world, including the Baltic countries. The contents include robotics, sensor/motor intelligence, evolutionary robotics, behaviour-based systems, multi-agent systems, applications...

  9. Mate attraction, retention and expulsion.

    Science.gov (United States)

    Miner, Emily J; Shackelford, Todd K

    2010-02-01

    Sexual selection theory and parental investment theory have guided much of the evolutionary psychological research on human mating. Based on these theories, researchers have predicted and found sex differences in mating preferences and behaviors. Men generally prefer that their long-term partners are youthful and physically attractive. Women generally prefer that their long-term partners have existing resources or clear potential for securing resources and display a willingness to invest those resources in children the relationship might produce. Both men and women, however, desire long-term partners who are kind and intelligent. Once a partner is obtained, men and women act in sex-specific ways to ensure the continuation and exclusivity of the relationship. Men, in particular, engage in behaviors designed to prevent, correct, and anticipate their partner's sexual infidelity. Relationships dissolve for evolutionarily-relevant reasons: infidelity, childlessness, and infertility. The discussion addresses directions for future research.

  10. The 1st Baltic Osseointegration Academy and Lithuanian University of Health Sciences Consensus Conference 2016. Summary and Consensus Statements: Group II - Peri-Implantitis Diagnostics and Decision Tree

    Directory of Open Access Journals (Sweden)

    Tolga Fikret Tözüm

    2016-09-01

    Full Text Available Introduction: The task of Group 2 was to review and update the existing data concerning clinical and genetic methods of diagnostics of peri-implantitis. Special interest was paid to the peri-implant crevicular fluid (PICF overview including analysis of enzymes and biomarkers and microbial profiles from implants. Material and Methods: The main areas of interest were as follows: effect of smoking and history of periodontitis, prosthetic treatment mistakes, excess cement, overloading, general diseases influence on peri-implantitis development. The systematic review and/or meta-analysis were registered in PROSPERO, an international prospective register of systematic reviews: http://www.crd.york.ac.uk/PROSPERO/. The literature in the corresponding areas of interest was searched and reported using the PRISMA (Preferred Reporting Item for Systematic Review and Meta-Analysis Statement: http://www.prisma-statement.org/. The method of preparation of systematic reviews of the literature based on comprehensive search strategies was discussed and standardized. The summary of the materials and methods employed by the authors in preparing the systematic review and/or meta-analysis is presented in Preface chapter. Results: The results and conclusions of the review process are presented in the respective papers. The group′s general commentaries, consensus statements, clinical recommendations and implications for research are presented in this article.

  11. The 1st Baltic Osseointegration Academy and Lithuanian University of Health Sciences Consensus Conference 2016. Summary and Consensus Statements: Group II - Peri-Implantitis Diagnostics and Decision Tree

    Science.gov (United States)

    Dursun, Erhan; Galindo-Moreno, Pablo; Juodzbalys, Gintaras; López-Martínez, Jesús; O'Valle, Francisco; Padial-Molina, Miguel; Ramanauskaite, Ausra

    2016-01-01

    ABSTRACT Introduction The task of Group 2 was to review and update the existing data concerning clinical and genetic methods of diagnostics of peri-implantitis. Special interest was paid to the peri-implant crevicular fluid (PICF) overview including analysis of enzymes and biomarkers and microbial profiles from implants. Material and Methods The main areas of interest were as follows: effect of smoking and history of periodontitis, prosthetic treatment mistakes, excess cement, overloading, general diseases influence on peri-implantitis development. The systematic review and/or meta-analysis were registered in PROSPERO, an international prospective register of systematic reviews: http://www.crd.york.ac.uk/PROSPERO/. The literature in the corresponding areas of interest was searched and reported using the PRISMA (Preferred Reporting Item for Systematic Review and Meta-Analysis) Statement: http://www.prisma-statement.org/. The method of preparation of systematic reviews of the literature based on comprehensive search strategies was discussed and standardized. The summary of the materials and methods employed by the authors in preparing the systematic review and/or meta-analysis is presented in Preface chapter. Results The results and conclusions of the review process are presented in the respective papers. The group′s general commentaries, consensus statements, clinical recommendations and implications for research are presented in this article. PMID:27833736

  12. The 1st Baltic Osseointegration Academy and Lithuanian University of Health Sciences Consensus Conference 2016. Summary and Consensus Statements: Group III - Peri-Implantitis Treatment

    Science.gov (United States)

    Faria e Almeida, Ricardo; Cicciù, Marco; Daugela, Povilas; Ramanauskaite, Ausra; Saulacic, Nikola; Tervonen, Tellervo; Wang, Hom-Lay; Yu, Shan-Huey

    2016-01-01

    ABSTRACT Introduction The task of Group 3 was to review and update the existing data concerning non-surgical, surgical non-regenerative and surgical regenerative treatment of peri-implantitis. Special interest was paid to the preventive and supporting therapy in case of peri-implantitis. Material and Methods The main areas of interest were as follows: effect of smoking and history of periodontitis, prosthetic treatment mistakes, excess cement, overloading, general diseases influence on peri-implantitis development. The systematic review and/or meta-analysis were registered in PROSPERO, an international prospective register of systematic reviews: http://www.crd.york.ac.uk/PROSPERO/. The literature in the corresponding areas of interest was searched and reported using the PRISMA (Preferred Reporting Item for Systematic Review and Meta-Analysis) Statement: http://www.prisma-statement.org/. The method of preparation of systematic reviews of the literature based on comprehensive search strategies was discussed and standardized. The summary of the materials and methods employed by the authors in preparing the systematic review and/or meta-analysis is presented in Preface chapter. Results The results and conclusions of the review process are presented in the respective papers. The group′s general commentaries, consensus statements, clinical recommendations and implications for research are presented in this article. PMID:27833741

  13. Interpersonal Congruency, Attitude Similarity, and Interpersonal Attraction

    Science.gov (United States)

    Touhey, John C.

    1975-01-01

    As no experimental study has examined the effects of congruency on attraction, the present investigation orthogonally varied attitude similarity and interpersonal congruency in order to compare the two independent variables as determinants of interpersonal attraction. (Author/RK)

  14. Interpersonal Congruency, Attitude Similarity, and Interpersonal Attraction

    Science.gov (United States)

    Touhey, John C.

    1975-01-01

    As no experimental study has examined the effects of congruency on attraction, the present investigation orthogonally varied attitude similarity and interpersonal congruency in order to compare the two independent variables as determinants of interpersonal attraction. (Author/RK)

  15. Evaluating self and partner physical attractiveness.

    Science.gov (United States)

    Swami, Viren; Furnham, Adrian; Georgiades, Chrissa; Pang, Lily

    2007-03-01

    This study used a novel questionnaire to examine ratings of self and partner physical attractiveness. Seventy-two men and 83 women estimated their own and their opposite-sex partner's overall physical attractiveness and the attractiveness of various body parts and measures. They also answered six simple questions concerning physical attractiveness. Results showed significant gender differences in self-estimates of overall facial attractiveness and upper body features. In general, and regardless of gender, participants rated their opposite-sex partners as being significantly more attractive than themselves. In addition, the results showed that body weight and facial attractiveness were the best predictors of overall physical attractiveness. Implications of these results in terms of social biases are considered.

  16. U.S. Geological Survey Subsidence Interest Group Conference; proceedings of the Technical Meeting, Las Vegas, Nevada, February 14-16, 1995

    Science.gov (United States)

    Prince, Keith R.; Leake, Stanley A.

    1997-01-01

    Introducation to Papers: This report is a compilation of short papers that are based on oral presentations summarizing the results of recent research that were given at the third meeting of the Subsidence Interest Group held in Las Vegas, Nevada, February 14?16, 1995. The report includes case studies of land subsidence and aquifer-system deformation resulting from fluid withdrawal, geothermal development, and mine collapse. Methods for monitoring land subsidence using Global Positioning System technology for the rapid and accurate measurement of changes in land-surface altitude also are described. The current status of numerical simulation of land subsidence in the USGS is summarized, and several of the short papers deal with the development and application of new numerical techniques for simulation and quantification of aquifersystem deformation. Not all oral presentations made at the meeting are documented in this report. Several of the presentations were of ongoing research and as such, the findings were provisional in nature and were offered at the meeting to stimulate scientific discussion and debate among colleagues. The information presented in this report, although only a subset of the proceedings of the meeting in Las Vegas, should help expand the scientific basis for management decisions to mitigate or control the effects of land subsidence. The short papers describing the results of these studies provide a cross section of ongoing research in aquifer mechanics and land subsidence and also form an assessment of the current technology and 'state of the science.' The analytical and interpretive methods described in this report will be useful to scientists involved in studies of ground-water hydraulics and aquifer-system deformation.

  17. Investment attractiveness of Ukraine: problems and solutions

    Directory of Open Access Journals (Sweden)

    Onishchenko Irina

    2016-03-01

    Full Text Available The article describes basic questions of the investment climate and investment attractiveness of Ukraine. Investment Attractiveness Index is analyzed by the methodology of European Business Association. The main advantages of Ukraine that attract foreign investors are revised. The article applies the comprehensive approach to study the problems hindering the increase of investment attractiveness of Ukraine. It determines the ways of solving the problems associated with deterring investment development.

  18. Non-immune binding of human IgG to M-related proteins confers resistance to phagocytosis of group A streptococci in blood.

    Directory of Open Access Journals (Sweden)

    Harry S Courtney

    Full Text Available The non-immune binding of immunoglobulins by bacteria is thought to contribute to the pathogenesis of infections. M-related proteins (Mrp are group A streptococcal (GAS receptors for immunoglobulins, but it is not known if this binding has any impact on virulence. To further investigate the binding of immunoglobulins to Mrp, we engineered mutants of an M type 4 strain of GAS by inactivating the genes for mrp, emm, enn, sof, and sfbX and tested these mutants in IgG-binding assays. Inactivation of mrp dramatically decreased the binding of human IgG, whereas inactivation of emm, enn, sof, and sfbx had only minor effects, indicating that Mrp is a major IgG-binding protein. Binding of human immunoglobulins to a purified, recombinant form of Mrp indicated that it selectively binds to the Fc domain of human IgG, but not IgA or IgM and that it preferentially bound subclasses IgG₁>IgG₄>IgG₂>IgG₃. Recombinant proteins encompassing different regions of Mrp were engineered and used to map its IgG-binding domain to its A-repeat region and a recombinant protein with 3 A-repeats was a better inhibitor of IgG binding than one with a single A-repeat. A GAS mutant expressing Mrp with an in-frame deletion of DNA encoding the A-repeats had a dramatically reduced ability to bind human IgG and to grow in human blood. Mrp exhibited host specificity in binding IgG; human IgG was the best inhibitor of the binding of IgG followed by pig, horse, monkey, and rabbit IgG. IgG from goat, mouse, rat, cow, donkey, chicken, and guinea pig were poor inhibitors of binding. These findings indicate that Mrp preferentially binds human IgG and that this binding contributes to the ability of GAS to resist phagocytosis and may be a factor in the restriction of GAS infections to the human host.

  19. Inhibition of IL-10 production by maternal antibodies against Group B Streptococcus GAPDH confers immunity to offspring by favoring neutrophil recruitment.

    Directory of Open Access Journals (Sweden)

    Pedro Madureira

    2011-11-01

    Full Text Available Group B Streptococcus (GBS is the leading cause of neonatal pneumonia, septicemia, and meningitis. We have previously shown that in adult mice GBS glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH is an extracellular virulence factor that induces production of the immunosuppressive cytokine interleukin-10 (IL-10 by the host early upon bacterial infection. Here, we investigate whether immunity to neonatal GBS infection could be achieved through maternal vaccination against bacterial GAPDH. Female BALB/c mice were immunized with rGAPDH and the progeny was infected with a lethal inoculum of GBS strains. Neonatal mice born from mothers immunized with rGAPDH were protected against infection with GBS strains, including the ST-17 highly virulent clone. A similar protective effect was observed in newborns passively immunized with anti-rGAPDH IgG antibodies, or F(ab'(2 fragments, indicating that protection achieved with rGAPDH vaccination is independent of opsonophagocytic killing of bacteria. Protection against lethal GBS infection through rGAPDH maternal vaccination was due to neutralization of IL-10 production soon after infection. Consequently, IL-10 deficient (IL-10(-/- mice pups were as resistant to GBS infection as pups born from vaccinated mothers. We observed that protection was correlated with increased neutrophil trafficking to infected organs. Thus, anti-rGAPDH or anti-IL-10R treatment of mice pups before GBS infection resulted in increased neutrophil numbers and lower bacterial load in infected organs, as compared to newborn mice treated with the respective control antibodies. We showed that mothers immunized with rGAPDH produce neutralizing antibodies that are sufficient to decrease IL-10 production and induce neutrophil recruitment into infected tissues in newborn mice. These results uncover a novel mechanism for GBS virulence in a neonatal host that could be neutralized by vaccination or immunotherapy. As GBS GAPDH is a

  20. Attribution, the Attractiveness Stereotype, and the Elderly.

    Science.gov (United States)

    Johnson, Douglas F.; Pittenger, John B.

    1984-01-01

    Tests the applicability of the physical attractiveness stereotype to perceptions of the elderly. In the first study, college-age and elderly observers rated the attractiveness of faces of elderly people. In the second study, subjects rated faces at three levels of attractiveness on personality, success in life experiences, and occupational…

  1. Attribution, the Attractiveness Stereotype, and the Elderly.

    Science.gov (United States)

    Johnson, Douglas F.; Pittenger, John B.

    1984-01-01

    Tests the applicability of the physical attractiveness stereotype to perceptions of the elderly. In the first study, college-age and elderly observers rated the attractiveness of faces of elderly people. In the second study, subjects rated faces at three levels of attractiveness on personality, success in life experiences, and occupational…

  2. Attraction of the housefly (Musca domestica L)

    NARCIS (Netherlands)

    Smallegange, RC; den Otter, CJ; Sommeijer, MJ; Francke, PJ

    1998-01-01

    Ultraviolet (UV) light attracts more houseflies compared to green and white light. The attractiveness of UV light is not effected by its spectral composition. The number of flies attracted does not seem to change when a UV lamp is combined with moving elements, although the time spend on the lamp de

  3. Real Time Conference 2016 Overview

    Science.gov (United States)

    Luchetta, Adriano

    2017-06-01

    This is a special issue of the IEEE Transactions on Nuclear Science containing papers from the invited, oral, and poster presentation of the 20th Real Time Conference (RT2016). The conference was held June 6-10, 2016, at Centro Congressi Padova “A. Luciani,” Padova, Italy, and was organized by Consorzio RFX (CNR, ENEA, INFN, Università di Padova, Acciaierie Venete SpA) and the Istituto Nazionale di Fisica Nucleare. The Real Time Conference is multidisciplinary and focuses on the latest developments in real-time techniques in high-energy physics, nuclear physics, astrophysics and astroparticle physics, nuclear fusion, medical physics, space instrumentation, nuclear power instrumentation, general radiation instrumentation, and real-time security and safety. Taking place every second year, it is sponsored by the Computer Application in Nuclear and Plasma Sciences technical committee of the IEEE Nuclear and Plasma Sciences Society. RT2016 attracted more than 240 registrants, with a large proportion of young researchers and engineers. It had an attendance of 67 students from many countries.

  4. Conference of CAS History Commission

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    @@ The Commission of CAS History held its third conference on Oct. 31 in Beijing. CAS Vice-President Yang Bailing and Vice-Secretary of the CPC Leading Group at CAS Guo Chuanjie addressed the meeting, which was chaired by Guo Huadong, CAS vice secretary -general.

  5. Interpersonal attraction in buyer–supplier relationships

    DEFF Research Database (Denmark)

    Ellegaard, Chris

    2012-01-01

    The concept of attraction is not reserved for the study of interpersonal relationships between husband and wife, family members, or lifelong friends. On the contrary, it contains much potential as a variable describing interpersonal business exchange relationships. This potential has been noted...... future research efforts on interpersonal attraction in the buyer– supplier context. Finally, the managerial value and challenges of applying attraction to buyer–supplier exchange relationships are discussed....... by well-known industrial marketing scholars in the past, and recent theoretical advances have incorporated attraction to describe buyer– supplier exchange, although primarily at the interorganizational level of analysis. The in-depth understanding of interpersonal attraction between boundary spanners...

  6. Designing Scientific Academic Conferences as a Learning Environment: How to Stimulate Active Learning at Academic Conferences?

    DEFF Research Database (Denmark)

    Verbeke, Johan

    2015-01-01

    architecture, arts and design) and on the way knowledge sharing and knowledge development was stimulated at these events. These conferences included less traditional conference designs, collective learning and explicit sharing of understanding between participants. Results: Collaboration in small groups...... as well as moments of collective learning. Organizers are recommended to adopt an explicit conference design. Constructivist content: Following a constructivist approach to learning environments, this paper stresses the importance of scheduling moments of active and collective learning and knowledge...

  7. Attractive faces temporally modulate visual attention

    Directory of Open Access Journals (Sweden)

    Koyo eNakamura

    2014-06-01

    Full Text Available Facial attractiveness is an important biological and social signal on social interaction. Recent research has demonstrated that an attractive face captures greater spatial attention than an unattractive face does. Little is known, however, about the temporal characteristics of visual attention for facial attractiveness. In this study, we investigated the temporal modulation of visual attention induced by facial attractiveness by using a rapid serial visual presentation (RSVP. Fourteen male faces and two female faces were successively presented for 160 ms respectively, and participants were asked to identify two female faces embedded among a series of multiple male distractor faces. Identification of a second female target (T2 was impaired when a first target (T1 was attractive compared to neutral or unattractive faces, at 320 ms SOA; identification was improved when T1 was attractive compared to unattractive faces at 640 ms SOA. These findings suggest that the spontaneous appraisal of facial attractiveness modulates temporal attention.

  8. On the modulispace of attracting dynamics

    DEFF Research Database (Denmark)

    Petersen, Carsten Lunde

    An Attracting Dynamics is a triple (f,W,a), where W is an open subset of the R(iemann) S(phere), f is a holomorphic map from W into the RS and a is an attracting periodic point for f. Denote by B(a) the attracted basin of the orbit of a for f. Two attracting dynamics (f,W,a) and (f',W',a') are i...... of B(a). The moduli space for the attracting dynamics (f,W,a) is the space of attractings dynamics (f,W,a') which are hybridly equivalent to (f,W,a). The talk will discuss properties of moduli spaces of different attracting dynamics....

  9. On the modulispace of attracting dynamics

    DEFF Research Database (Denmark)

    Petersen, Carsten Lunde

    An Attracting Dynamics is a triple (f,W,a), where W is an open subset of the R(iemann) S(phere), f is a holomorphic map from W into the RS and a is an attracting periodic point for f. Denote by B(a) the attracted basin of the orbit of a for f. Two attracting dynamics (f,W,a) and (f',W',a') are i...... of B(a). The moduli space for the attracting dynamics (f,W,a) is the space of attractings dynamics (f,W,a') which are hybridly equivalent to (f,W,a). The talk will discuss properties of moduli spaces of different attracting dynamics....

  10. A statistical model of facial attractiveness.

    Science.gov (United States)

    Said, Christopher P; Todorov, Alexander

    2011-09-01

    Previous research has identified facial averageness and sexual dimorphism as important factors in facial attractiveness. The averageness and sexual dimorphism accounts provide important first steps in understanding what makes faces attractive, and should be valued for their parsimony. However, we show that they explain relatively little of the variance in facial attractiveness, particularly for male faces. As an alternative to these accounts, we built a regression model that defines attractiveness as a function of a face's position in a multidimensional face space. The model provides much more predictive power than the averageness and sexual dimorphism accounts and reveals previously unreported components of attractiveness. The model shows that averageness is attractive in some dimensions but not in others and resolves previous contradictory reports about the effects of sexual dimorphism on the attractiveness of male faces.

  11. International Conference GIREP EPEC 2015

    CERN Document Server

    Dębowska, Ewa

    2017-01-01

    This book presents a selection of the best contributions to GIREP EPEC 2015, the Conference of the International Research Group on Physics Teaching (GIREP) and the European Physical Society’s Physics Education Division (EPS PED). It introduces readers interested in the field to the problem of identifying strategies and tools to improve physics teaching and learning so as to convey Key Competences and help students acquire them. The main topic of the conference was Key Competences (KC) in physics teaching and learning in the form of knowledge, skills and attitudes that are fundamental for every member of society. Given the role of physics as a field strongly connected not only to digital competence but also to several other Key Competences, this conference provided a forum for in-depth discussions of related issues.

  12. Highlights from the Quark Matter 2012 conference: a theorist's perspective

    CERN Document Server

    CERN. Geneva

    2012-01-01

    The series of Quark Matter conferences is traditionally the most important venue for showing new results in the field of ultra-relativistic nucleus-nucleus collisions. This year's edition was held in August in Washington DC and it attracted almost 700 participants. It featured the newest results from experiments at the LHC and at RHIC, as well as a broad range of new theoretical developments. This talk will provide - from a theorist's perspective - a selective review of results presented at this conference.

  13. At the XI International Conference on High Energy Accelerators

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The Conference was held at CERN and attracted some 300 specialists (see CERN Courier 1980 p. 231). The conference was a success thanks also to many CERN people. Here, first raw, Susannah Tracy, Ingrid Barnett, ..?, Danièle Lajust, Simon Newman, Owen Lock. Second raw, (2) Ed Powell, (3) Ernest Bissa, (7) Myrna Guarisco, (8) Barbara Strasser, (10) Michèle Compoint, (11) Anne Caton, (12) Mike Crowley-Milling.

  14. 76 FR 64083 - Reliability Technical Conference; Notice of Technical Conference

    Science.gov (United States)

    2011-10-17

    ... Energy Regulatory Commission Reliability Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, November 29... addressing risks to reliability that were identified in earlier Commission technical conferences....

  15. QCD@LHC International Conference

    CERN Document Server

    2016-01-01

    The particle physics groups of UZH and ETH will host the QCD@LHC2016 conference (22.8.-26.8., UZH downtown campus), which is part of an annual conference series bringing together theorists and experimentalists working on hard scattering processes at the CERN LHC, ranging from precision studies of Standard Model processes to searches for new particles and phenomena. The format of the conference is a combination of plenary review talks and parallel sessions, with the latter providing a particularly good opportunity for junior researchers to present their results. The conference will take place shortly after the release of the new data taken by the LHC in sping 2016 at a collision energy of 13TeV, expected to more than double the currently available data set. It will be one of the first opportunities to discuss these data in a broader context, and we expect the conference to become a very lively forum at the interface of phenomenology and experiment.

  16. A facial attractiveness account of gender asymmetries in interracial marriage.

    Directory of Open Access Journals (Sweden)

    Michael B Lewis

    Full Text Available BACKGROUND: In the US and UK, more Black men are married to White women than vice versa and there are more White men married to Asian women than vice versa. Models of interracial marriage, based on the exchange of racial status for other capital, cannot explain these asymmetries. A new explanation is offered based on the relative perceived facial attractiveness of the different race-by-gender groups. METHOD AND FINDINGS: This explanation was tested using a survey of perceived facial attractiveness. This found that Black males are perceived as more attractive than White or East Asian males whereas among females, it is the East Asians that are perceived as most attractive on average. CONCLUSIONS: Incorporating these attractiveness patterns into the model of marriage decisions produces asymmetries in interracial marriage similar to those in the observed data in terms of direction and relative size. This model does not require differences in status between races nor different strategies based on gender. Predictions are also generated regarding the relative attractiveness of those engaging in interracial marriage.

  17. The Attraction Effect Modulates Reward Prediction Errors and Intertemporal Choices.

    Science.gov (United States)

    Gluth, Sebastian; Hotaling, Jared M; Rieskamp, Jörg

    2017-01-11

    Classical economic theory contends that the utility of a choice option should be independent of other options. This view is challenged by the attraction effect, in which the relative preference between two options is altered by the addition of a third, asymmetrically dominated option. Here, we leveraged the attraction effect in the context of intertemporal choices to test whether both decisions and reward prediction errors (RPE) in the absence of choice violate the independence of irrelevant alternatives principle. We first demonstrate that intertemporal decision making is prone to the attraction effect in humans. In an independent group of participants, we then investigated how this affects the neural and behavioral valuation of outcomes using a novel intertemporal lottery task and fMRI. Participants' behavioral responses (i.e., satisfaction ratings) were modulated systematically by the attraction effect and this modulation was correlated across participants with the respective change of the RPE signal in the nucleus accumbens. Furthermore, we show that, because exponential and hyperbolic discounting models are unable to account for the attraction effect, recently proposed sequential sampling models might be more appropriate to describe intertemporal choices. Our findings demonstrate for the first time that the attraction effect modulates subjective valuation even in the absence of choice. The findings also challenge the prospect of using neuroscientific methods to measure utility in a context-free manner and have important implications for theories of reinforcement learning and delay discounting.

  18. Third International Conference on Complex Systems

    CERN Document Server

    Minai, Ali A; Unifying Themes in Complex Systems

    2006-01-01

    In recent years, scientists have applied the principles of complex systems science to increasingly diverse fields. The results have been nothing short of remarkable: their novel approaches have provided answers to long-standing questions in biology, ecology, physics, engineering, computer science, economics, psychology and sociology. The Third International Conference on Complex Systems attracted over 400 researchers from around the world. The conference aimed to encourage cross-fertilization between the many disciplines represented and to deepen our understanding of the properties common to all complex systems. This volume contains over 35 papers selected from those presented at the conference on topics including: self-organization in biology, ecological systems, language, economic modeling, ecological systems, artificial life, robotics, and complexity and art. ALI MINAI is an Affiliate of the New England Complex Systems Institute and an Associate Professor in the Department of Electrical and Computer Engine...

  19. Third International Conference on Complex Systems

    CERN Document Server

    Minai, Ali A; Unifying Themes in Complex Systems

    2006-01-01

    In recent years, scientists have applied the principles of complex systems science to increasingly diverse fields. The results have been nothing short of remarkable: their novel approaches have provided answers to long-standing questions in biology, ecology, physics, engineering, computer science, economics, psychology and sociology. The Third International Conference on Complex Systems attracted over 400 researchers from around the world. The conference aimed to encourage cross-fertilization between the many disciplines represented and to deepen our understanding of the properties common to all complex systems. This volume contains selected transcripts from presentations given at the conference. Speakers include: Chris Adami, Kenneth Arrow, Michel Baranger, Dan Braha, Timothy Buchman, Michael Caramanis, Kathleen Carley, Greg Chaitin, David Clark, Jack Cohen, Jim Collins, George Cowan, Clay Easterly, Steven Eppinger, Irving Epstein, Dan Frey, Ary Goldberger, Helen Harte, Leroy Hood, Don Ingber, Atlee Jackson,...

  20. PREFACE: The Anglo-French Physical Acoustics Conference

    Science.gov (United States)

    Lhemery, Alain; Saffari, Nader; Aristegui, Christophe

    2009-11-01

    The Anglo-French Physical Acoustics Conference (AFPAC) had its 8th annual meeting at Arcachon in France, between 8 to 10 December 2008. This series of meetings is a successful collaboration between the Physical Acoustics Group (PAG) of the Institute of Physics and the Groupe d'Acoustique Physique, Sous-marine et UltraSonore (GAPSUS) of the Société Française d'Acoustique. First established in 2001, the aim of this annual conference is to provide a forum where the most recent research developments in the field of Physical Acoustics in the UK and France are reviewed. AFPAC alternates between venues in the UK and France and the format has been designed to be 'small and friendly'. The conference attracts the main research leaders in the two countries and likes to encourage research students in particular to have their debut presentations at this event. Every year the organisers also invite a number of keynote speakers who are leading international authorities in their fields. For the meeting in Arcachon, the invited speakers included Dame Anne Dowling of Cambridge University, Anthony Kent of Nottingham University, Michel Bruneau of Université du Maine, Richard Hazelwood, Jérôme Vasseur of Institut d'Electronique, de Micro électronique et de Nanotechnologie and Michel Castaings of Laboratoire de Mécanique Physique of Université Bordeaux 1. The scope of the conference is kept intentionally wide so as to encourage cross-fertilisation of ideas across different application areas in the field of Physical Acoustics. Presentations in the past have covered non-destructive evaluation and material characterisation, medical ultrasound, underwater acoustics and ultrasonic sensors. This is the first time the proceedings of AFPAC are being published in the event's history and the participants were invited to submit manuscripts for publication. As a result there are 9 peer reviewed papers from a total of 34 that were presented at the meeting. In view of the high standard of

  1. Miscalibrations in judgements of attractiveness with cosmetics.

    Science.gov (United States)

    Jones, Alex L; Kramer, Robin S S; Ward, Robert

    2014-10-01

    Women use cosmetics to enhance their attractiveness. How successful they are in doing so remains unknown--how do men and women respond to cosmetics use in terms of attractiveness? There are a variety of miscalibrations where attractiveness is concerned--often, what one sex thinks the opposite sex finds attractive is incorrect. Here, we investigated observer perceptions about attractiveness and cosmetics, as well as their understanding of what others would find attractive. We used computer graphic techniques to allow observers to vary the amount of cosmetics applied to a series of female faces. We asked observers to optimize attractiveness for themselves, for what they thought women in general would prefer, and what they thought men in general would prefer. We found that men and women agree on the amount of cosmetics they find attractive, but overestimate the preferences of women and, when considering the preferences of men, overestimate even more. We also find that models' self-applied cosmetics are far in excess of individual preferences. These findings suggest that attractiveness perceptions with cosmetics are a form of pluralistic ignorance, whereby women tailor their cosmetics use to an inaccurate perception of others' preferences. These findings also highlight further miscalibrations of attractiveness ideals.

  2. Fake/Bogus Conferences

    DEFF Research Database (Denmark)

    Asadi, Amin; Rahbar, Nader; Rezvani, Mohammad Javad

    2017-01-01

    The main objective of the present paper is to introduce some features of fake/bogus conferences and some viable approaches to differentiate them from the real ones. These fake/bogus conferences introduce themselves as international conferences, which are multidisciplinary and indexed in major sci...... scientific digital libraries. Furthermore, most of the fake/bogus conference holders offer publishing the accepted papers in ISI journals and use other techniques in their advertisement e-mails....

  3. Sexual attraction and inter-sexual dominance among virtual agents

    NARCIS (Netherlands)

    Hemelrijk, C.K.; Moss, S.; Davidsson, P.

    2001-01-01

    In many group-living primates, males are dominant over females, but despite this dominance, they allow females access to resources during the period when females are sexually attractive - but only then and not otherwise. Conventionally, such male 'courtesy' is explained as a special strategy to gain

  4. Sexual attraction and inter-sexual dominance among virtual agents

    NARCIS (Netherlands)

    Hemelrijk, C.K.; Moss, S.; Davidsson, P.

    2001-01-01

    In many group-living primates, males are dominant over females, but despite this dominance, they allow females access to resources during the period when females are sexually attractive - but only then and not otherwise. Conventionally, such male 'courtesy' is explained as a special strategy to gain

  5. Physical Appearance Cues and Interpersonal Attraction in Children

    Science.gov (United States)

    Kleck, Robert E.; And Others

    1974-01-01

    Two studies are reported which demonstrate a positive relationship between sociometric status (after two weeks of intense social interaction) and social acceptance judged from photographs by an independent group of peers. Acceptance was found to be related to physical attractiveness. (ST)

  6. Brief Report: Sexual Attraction and Relationships in Adolescents with Autism

    Science.gov (United States)

    May, Tamara; Pang, Ken C.; Williams, Katrina

    2017-01-01

    Past research suggests more variation in sexual attraction in Autism Spectrum Disorder (ASD) using clinical samples. This study utilised a population representative group of 14/15 year olds from the Longitudinal Study of Australian Children. Ninety-four adolescents (73 males, 21 females) with ASD and 3454 (1685 males, 1675 females) without…

  7. Physical Attractiveness, Locus of Control, Sex Role, and Conversational Assertiveness.

    Science.gov (United States)

    Campbell, Keith F.; And Others

    1990-01-01

    Analyzes the relationship among physical attractiveness, locus of control, sex role orientation, and assertiveness in undergraduate students. Reviews videotapes of mixed-sex student groups engaged in discussion. Finds an internal locus of control positively correlated with assertiveness. Uses a behavioral measure of assertiveness rather than…

  8. International Conference on Software Engineering, Knowledge Engineering and Information Engineering (SEKEIE 2012)

    CERN Document Server

    Software Engineering and Knowledge Engineering: Theory and Practice

    2012-01-01

    2012 International Conference on Software Engineering, Knowledge Engineering and Information Engineering (SEKEIE 2012) will be held in Macau, April 1-2, 2012 . This conference will bring researchers and experts from the three areas of Software Engineering, Knowledge Engineering and Information Engineering together to share their latest research results and ideas.   This volume book covered significant recent developments in the Software Engineering, Knowledge Engineering and Information Engineering field, both theoretical and applied. We are glad this conference attracts your attentions, and thank your support to our conference. We will absorb remarkable suggestion, and make our conference more successful and perfect.

  9. Attractiveness and Cooperation in Social Exchange

    Directory of Open Access Journals (Sweden)

    Chisato Takahashi

    2006-01-01

    Full Text Available We tested the hypothesis that physically more attractive men are less likely to cooperate in social exchange than less attractive men, while physical attractiveness has no effect on women's tendency toward cooperation, with four different experimental games (Prisoner's Dilemma with 99 players, Allocator Choice with 77 players, Faith with 16 players, and Trust with 21 players. Pictures of the game players were taken after they participated in one of the four games, and those pictures were presented to another set of participants (85 raters in Study 1 and 2, 36 raters in Study 3 for attractiveness ratings. Both male and female raters who were unaware of the photographed game players' actual behavior in the game judged the faces of male defectors (who defected in one of the four games to be more attractive than those of male cooperators, but they did not give differential attractiveness ratings to female defectors and female cooperators.

  10. Facial aesthetics: babies prefer attractiveness to symmetry.

    Science.gov (United States)

    Samuels, Curtis A; Butterworth, George; Roberts, Tony; Graupner, Lida; Hole, Graham

    2013-01-01

    The visual preferences of human infants for faces that varied in their attractiveness and in their symmetry about the midline were explored. The aim was to establish whether infants' visual preference for attractive faces may be mediated by the vertical symmetry of the face. Chimeric faces, made from photographs of attractive and unattractive female faces, were produced by computer graphics. Babies looked longer at normal and at chimeric attractive faces than at normal and at chimeric unattractive faces. There were no developmental differences between the younger and older infants: all preferred to look at the attractive faces. Infants as young as 4 months showed similarity with adults in the 'aesthetic perception' of attractiveness and this preference was not based on the vertical symmetry of the face.

  11. 9th Annual UNCG Regional Mathematics and Statistics Conference

    CERN Document Server

    Chhetri, Maya; Gupta, Sat; Shivaji, Ratnasingham

    2015-01-01

    This volume contains rigorously reviewed papers on the topics presented by students at The 9th Annual University of North Carolina at Greensboro Regional Mathematics and Statistics Conference (UNCG RMSC) that took place on November 2, 2013.  All papers are coauthored by student researchers and their faculty mentors. This conference series was inaugurated in 2005, and it now attracts over 150 participants from over 30 universities from North Carolina and surrounding states. The conference is specifically tailored for students to present their research projects that encompass a broad spectrum of topics in mathematics, mathematical biology, statistics, and computer science.

  12. Personnel marketing focused on graduates' attraction

    OpenAIRE

    Solovská, Petra

    2012-01-01

    This diploma thesis refers to the topic of personnel marketing focused on graduates' attraction. In theoretical part it describes concepts of personnel marketing, its components, tools and parts, then it focuses on personnel marketing in a context of social system of organization and on specifics of graduates. The empirical part is searching for answers why is it important for organizations to attract graduates, which methods of personnel marketing are used to attract them, what is the strate...

  13. Observation of attraction between dark solitons

    DEFF Research Database (Denmark)

    Dreischuh, A.; Neshev, D.N.; Petersen, D.E.

    2006-01-01

    We demonstrate a dramatic change in the interaction forces between dark solitons in nonlocal nonlinear media. We present what we believe is the first experimental evidence of attraction of dark solitons. Our results indicate that attraction should be observable in other nonlocal systems, such as ......We demonstrate a dramatic change in the interaction forces between dark solitons in nonlocal nonlinear media. We present what we believe is the first experimental evidence of attraction of dark solitons. Our results indicate that attraction should be observable in other nonlocal systems...

  14. International Conference on Physics

    CERN Document Server

    2016-01-01

    OMICS International, (conference series) the World Class Open Access Publisher and Scientific Event Organizer is hosting “International Conference on physics” which is going to be the biggest conference dedicated to Physics. The theme “Highlighting innovations and challenges in the field of Physics” and it features a three day conference addressing the major breakthroughs, challenges and the solutions adopted. The conference will be held during June 27-29, 2016 at New Orleans, USA. Will be published in: http://physics.conferenceseries.com/

  15. Facilitating Learning at Conferences

    DEFF Research Database (Denmark)

    Ravn, Ib; Elsborg, Steen

    2011-01-01

    and facilitate a variety of simple learning techniques at thirty one- and two-day conferences of up to 300 participants each. We present ten of these techniques and data evaluating them. We conclude that if conference organizers allocate a fraction of the total conference time to facilitated processes......The typical conference consists of a series of PowerPoint presentations that tend to render participants passive. Students of learning have long abandoned the transfer model that underlies such one-way communication. We propose an al-ternative theory of conferences that sees them as a forum...... for learning, mutual inspiration and human flourishing. We offer five design principles that specify how conferences may engage participants more and hence increase their learning. In the research-and-development effort reported here, our team collaborated with conference organizers in Denmark to introduce...

  16. The learning conference

    DEFF Research Database (Denmark)

    Ravn, Ib

    2007-01-01

    Purpose: To call attention to the fact that conferences for professionals rely on massive one-way communication and hence produce little learning for delegates. To introduce an alternative, the ?learning conference,? that involves delegates in fun and productive learning processes. Design....../methodology/approach: A typical full-day conference is analyzed. It has six hours of podium talk and twenty-five minutes for delegates to become involved. What model of learning can possibly lie behind this? The transfer model, which assumes learners to be empty vessels. An alternative view is that conference delegates...... are active professionals in search of inspiration, and they also want to share knowledge with their peers at the conference. A theory of the conference as a forum for mutual inspiration and human co-flourishing is proposed, as are four design principles for a learning conference: 1. Presentations must...

  17. International Logistics Science Conference

    CERN Document Server

    Hompel, Michael; Meier, J

    2014-01-01

    The importance of logistics in all its variations is still increasing. New technologies emerge, new planning methods and algorithms are developed, only to face a market with a growing complexity and the need of weighting monetary costs against ecological impact. Mastering these challenges requires a scientific viewpoint on logistics, but always with applications in mind. This volume presents up-to-date logistics research in all its diversity and interconnectedness. It grew out of the “International Logistics Science Conference” (ILSC) held in Dortmund in September 2013, bringing together leading scientists and young academics from nine different countries. The conference was jointly organized by the “Efficiency Cluster Logistics” and the “Fraunhofer Institute for Material Flow and Logistics”. The Program Committee used a double blind review process to choose the 12 strongest contributions, which were then grouped in four areas: - Sustainability logistics, including electric mobility, smart inform...

  18. Humans are not fooled by size illusions in attractiveness judgements.

    Science.gov (United States)

    Bateson, Melissa; Tovée, Martin J; George, Hannah R; Gouws, Anton; Cornelissen, Piers L

    2014-03-01

    Could signallers use size contrast illusions to dishonestly exaggerate their attractiveness to potential mates? Using composite photographs of women from three body mass index (BMI) categories designed to simulate small groups, we show that target women of medium size are judged as thinner when surrounded by larger women than when surrounded by thinner women. However, attractiveness judgements of the same target women were unaffected by this illusory change in BMI, despite small true differences in the BMIs of the target women themselves producing strong effects on attractiveness. Thus, in the context of mate choice decisions, the honesty of female body size as a signal of mate quality appears to have been maintained by the evolution of assessment strategies that are immune to size contrast illusions. Our results suggest that receiver psychology is more flexible than previously assumed, and that illusions are unlikely to drive the evolution of exploitative neighbour choice in human sexual displays.

  19. Proceedings of the Spring noise conference 2011: what's the buzz?: innovations and issues

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    This event is a global conference that attracts delegates and speakers from around the world to talk about environmental and occupational noise. The conference provides industry, government, the public, academics and acoustical professionals worldwide with the opportunity to share experiences and innovations in environmental and applied acoustics; specifically noise identification, measurement, regulation and control. Presentation of new research, technical developments, and case studies were given during the event. All 21 presentations from the conference were processed separately for inclusion in this database.

  20. Ontogeny of collective behavior reveals a simple attraction rule

    Science.gov (United States)

    Hinz, Robert C.; de Polavieja, Gonzalo G.

    2017-01-01

    The striking patterns of collective animal behavior, including ant trails, bird flocks, and fish schools, can result from local interactions among animals without centralized control. Several of these rules of interaction have been proposed, but it has proven difficult to discriminate which ones are implemented in nature. As a method to better discriminate among interaction rules, we propose to follow the slow birth of a rule of interaction during animal development. Specifically, we followed the development of zebrafish, Danio rerio, and found that larvae turn toward each other from 7 days postfertilization and increase the intensity of interactions until 3 weeks. This developmental dataset allows testing the parameter-free predictions of a simple rule in which animals attract each other part of the time, with attraction defined as turning toward another animal chosen at random. This rule makes each individual likely move to a high density of conspecifics, and moving groups naturally emerge. Development of attraction strength corresponds to an increase in the time spent in attraction behavior. Adults were found to follow the same attraction rule, suggesting a potential significance for adults of other species. PMID:28193864

  1. Laws of attraction: from perceptual forces to conceptual similarity.

    Science.gov (United States)

    Ziemkiewicz, Caroline; Kosara, Robert

    2010-01-01

    Many of the pressing questions in information visualization deal with how exactly a user reads a collection of visual marks as information about relationships between entities. Previous research has suggested that people see parts of a visualization as objects, and may metaphorically interpret apparent physical relationships between these objects as suggestive of data relationships. We explored this hypothesis in detail in a series of user experiments. Inspired by the concept of implied dynamics in psychology, we first studied whether perceived gravity acting on a mark in a scatterplot can lead to errors in a participant's recall of the mark's position. The results of this study suggested that such position errors exist, but may be more strongly influenced by attraction between marks. We hypothesized that such apparent attraction may be influenced by elements used to suggest relationship between objects, such as connecting lines, grouping elements, and visual similarity. We further studied what visual elements are most likely to cause this attraction effect, and whether the elements that best predicted attraction errors were also those which suggested conceptual relationships most strongly. Our findings show a correlation between attraction errors and intuitions about relatedness, pointing towards a possible mechanism by which the perception of visual marks becomes an interpretation of data relationships.

  2. Ontogeny of collective behavior reveals a simple attraction rule.

    Science.gov (United States)

    Hinz, Robert C; de Polavieja, Gonzalo G

    2017-02-13

    The striking patterns of collective animal behavior, including ant trails, bird flocks, and fish schools, can result from local interactions among animals without centralized control. Several of these rules of interaction have been proposed, but it has proven difficult to discriminate which ones are implemented in nature. As a method to better discriminate among interaction rules, we propose to follow the slow birth of a rule of interaction during animal development. Specifically, we followed the development of zebrafish, Danio rerio, and found that larvae turn toward each other from 7 days postfertilization and increase the intensity of interactions until 3 weeks. This developmental dataset allows testing the parameter-free predictions of a simple rule in which animals attract each other part of the time, with attraction defined as turning toward another animal chosen at random. This rule makes each individual likely move to a high density of conspecifics, and moving groups naturally emerge. Development of attraction strength corresponds to an increase in the time spent in attraction behavior. Adults were found to follow the same attraction rule, suggesting a potential significance for adults of other species.

  3. Reciprocity of Interpersonal Attraction: A Confirmed Hypothesis.

    Science.gov (United States)

    La Voie, Lawrence; Kenny, David A.

    An increase in reciprocity of interpersonal attraction during the early acquaintance period followed by continuing social reciprocity are propositions that are central principles of several social psychological viewpoints. However, there is little empirical evidence of increasing reciprocity of interpersonal attraction over time. Two potential…

  4. Sexual Attraction and Harassment: Management's New Problems.

    Science.gov (United States)

    Driscoll, Jeanne Bosson

    1981-01-01

    Both sexual attraction and harassment must be dealt with if men and women are to develop truly productive working relationships. Key issues include policies on sexual attraction and harassment, availability of professional resources on the subjects, training, and the role of personnel specialists. (CT)

  5. Attraction, Discrepancy and Responses to Psychological Treatment.

    Science.gov (United States)

    Patton, Michael J.

    The responses of a laboratory subject (S) to a counselor-accomplice and to the psychological treatment situation are examined by manipulating experimentally interpersonal attraction and communication discrepancy. Four treatment conditions were set up: (1) topic similarity and positive attraction for counselor, (2) topic discrepancy and positive…

  6. Electron attraction mediated by Coulomb repulsion.

    Science.gov (United States)

    Hamo, A; Benyamini, A; Shapir, I; Khivrich, I; Waissman, J; Kaasbjerg, K; Oreg, Y; von Oppen, F; Ilani, S

    2016-07-21

    One of the defining properties of electrons is their mutual Coulomb repulsion. However, in solids this basic property may change; for example, in superconductors, the coupling of electrons to lattice vibrations makes the electrons attract one another, leading to the formation of bound pairs. Fifty years ago it was proposed that electrons can be made attractive even when all of the degrees of freedom in the solid are electronic, by exploiting their repulsion from other electrons. This attraction mechanism, termed 'excitonic', promised to achieve stronger and more exotic superconductivity. Yet, despite an extensive search, experimental evidence for excitonic attraction has yet to be found. Here we demonstrate this attraction by constructing, from the bottom up, the fundamental building block of the excitonic mechanism. Our experiments are based on quantum devices made from pristine carbon nanotubes, combined with cryogenic precision manipulation. Using this platform, we demonstrate that two electrons can be made to attract each other using an independent electronic system as the 'glue' that mediates attraction. Owing to its tunability, our system offers insights into the underlying physics, such as the dependence of the emergent attraction on the underlying repulsion, and the origin of the pairing energy. We also demonstrate transport signatures of excitonic pairing. This experimental demonstration of excitonic pairing paves the way for the design of exotic states of matter.

  7. Aging and Attractiveness: Marriage Makes a Difference.

    Science.gov (United States)

    Giesen, Carol Boellhoff

    1989-01-01

    Examined women's agreement with double standard of aging. Women (N=32) aged 28 to 63 shared definitions of attractiveness, femininity, and sexual appeal. Findings showed attractiveness was defined primarily by appearance, femininity by behavior and inferred traits, and sexual appeal by both. Found age differences among married women, but few age…

  8. Sexual Attraction and Harassment: Management's New Problems.

    Science.gov (United States)

    Driscoll, Jeanne Bosson

    1981-01-01

    Both sexual attraction and harassment must be dealt with if men and women are to develop truly productive working relationships. Key issues include policies on sexual attraction and harassment, availability of professional resources on the subjects, training, and the role of personnel specialists. (CT)

  9. Positive illusions about one's partner's physical attractiveness

    NARCIS (Netherlands)

    Barelds-Dijkstra, Pieternel; Barelds, Dick P. H.

    2008-01-01

    This study examined couples' ratings of self and partner physical attractiveness. On the basis of the theory of positive illusions, it was expected that individuals would rate their partners as more attractive than their partners would rate themselves. Both members of 93 heterosexual couples, with a

  10. Positive illusions about one's partner's physical attractiveness

    NARCIS (Netherlands)

    Barelds-Dijkstra, Pieternel; Barelds, Dick P. H.

    2008-01-01

    This study examined couples' ratings of self and partner physical attractiveness. On the basis of the theory of positive illusions, it was expected that individuals would rate their partners as more attractive than their partners would rate themselves. Both members of 93 heterosexual couples, with a

  11. Positive illusions about one's partner's physical attractiveness

    NARCIS (Netherlands)

    Barelds-Dijkstra, Pieternel; Barelds, Dick P. H.

    This study examined couples' ratings of self and partner physical attractiveness. On the basis of the theory of positive illusions, it was expected that individuals would rate their partners as more attractive than their partners would rate themselves. Both members of 93 heterosexual couples, with a

  12. Correlates of Attraction Among Preschool Children.

    Science.gov (United States)

    Ross, Michael B.

    The generalizability of several variables which have been related to attraction among adults to preschool children was investigated. It was found that perceived physical attractiveness, perceived proximity, and familiarity are all significantly positively correlated with how popular a child is in his nursery school class. (Author)

  13. Interpersonal Attraction in the Counseling Relationship.

    Science.gov (United States)

    Wachowiak, Dale; Diaz, Sandra

    Murstein's Stimulus-Value-Role theory of dyadic relationships, in which attraction depends on the exchange value of the assets and liabilities each person brings to the situation, is employed as a foundation for this review of the literature on interpersonal attraction in the counseling relationship. A three-stage model, accounting for both…

  14. The influence of facial attractiveness on imitation

    NARCIS (Netherlands)

    Leeuwen, M.L. van; Veling, H.P.; Baaren, R.B. van; Dijksterhuis, A.J.

    2009-01-01

    People judge, evaluate, and treat attractive people better than moderately attractive or unattractive people [Langlois, J. H., Kalakanis, L., Rubenstein, A. J., Larson, A., Hallam, M., & Smoot, M. (2000). Maxims or myths of beauty? A meta-analytic and theoretical review. Psychological Bulletin, 126,

  15. Branner-Hubbard motions and attracting dynamics

    DEFF Research Database (Denmark)

    Petersen, Carsten Lunde; Tan, Lei

    We introduce the new notion an aatracting dynamics, which is related to polynomial-likke mappings. Also we review the Branner-Hubbard motion and study its action on attracting dynamics.......We introduce the new notion an aatracting dynamics, which is related to polynomial-likke mappings. Also we review the Branner-Hubbard motion and study its action on attracting dynamics....

  16. Electron attraction mediated by Coulomb repulsion

    Science.gov (United States)

    Hamo, A.; Benyamini, A.; Shapir, I.; Khivrich, I.; Waissman, J.; Kaasbjerg, K.; Oreg, Y.; von Oppen, F.; Ilani, S.

    2016-07-01

    One of the defining properties of electrons is their mutual Coulomb repulsion. However, in solids this basic property may change; for example, in superconductors, the coupling of electrons to lattice vibrations makes the electrons attract one another, leading to the formation of bound pairs. Fifty years ago it was proposed that electrons can be made attractive even when all of the degrees of freedom in the solid are electronic, by exploiting their repulsion from other electrons. This attraction mechanism, termed ‘excitonic’, promised to achieve stronger and more exotic superconductivity. Yet, despite an extensive search, experimental evidence for excitonic attraction has yet to be found. Here we demonstrate this attraction by constructing, from the bottom up, the fundamental building block of the excitonic mechanism. Our experiments are based on quantum devices made from pristine carbon nanotubes, combined with cryogenic precision manipulation. Using this platform, we demonstrate that two electrons can be made to attract each other using an independent electronic system as the ‘glue’ that mediates attraction. Owing to its tunability, our system offers insights into the underlying physics, such as the dependence of the emergent attraction on the underlying repulsion, and the origin of the pairing energy. We also demonstrate transport signatures of excitonic pairing. This experimental demonstration of excitonic pairing paves the way for the design of exotic states of matter.

  17. Facial cosmetics have little effect on attractiveness judgments compared with identity.

    Science.gov (United States)

    Jones, Alex L; Kramer, S S

    2015-01-01

    The vast majority of women in modern societies use facial cosmetics, which modify facial cues to attractiveness. However, the size of this increase remains unclear--how much more attractive are individuals after an application of cosmetics? Here, we utilised a 'new statistics' approach, calculating the effect size of cosmetics on attractiveness using a within-subjects design, and compared this with the effect size due to identity--that is, the inherent differences in attractiveness between people. Women were photographed with and without cosmetics, and these images were rated for attractiveness by a second group of participants. The proportion of variance in attractiveness explained by identity was much greater than the variance within models due to cosmetics. This result was unchanged after statistically controlling for the perceived amount of cosmetics that each model used. Although cosmetics increase attractiveness, the effect is small, and the benefits of cosmetics may be inflated in everyday thinking.

  18. Beauty at the ballot box: disease threats predict preferences for physically attractive leaders.

    Science.gov (United States)

    White, Andrew Edward; Kenrick, Douglas T; Neuberg, Steven L

    2013-12-01

    Why does beauty win out at the ballot box? Some researchers have posited that it occurs because people ascribe generally positive characteristics to physically attractive candidates. We propose an alternative explanation-that leadership preferences are related to functional disease-avoidance mechanisms. Because physical attractiveness is a cue to health, people concerned with disease should especially prefer physically attractive leaders. Using real-world voting data and laboratory-based experiments, we found support for this relationship. In congressional districts with elevated disease threats, physically attractive candidates are more likely to be elected (Study 1). Experimentally activating disease concerns leads people to especially value physical attractiveness in leaders (Study 2) and prefer more physically attractive political candidates (Study 3). In a final study, we demonstrated that these findings are related to leadership preferences, specifically, rather than preferences for physically attractive group members more generally (Study 4). Together, these findings highlight the nuanced and functional nature of leadership preferences.

  19. ESMO consensus conference on malignant lymphoma

    DEFF Research Database (Denmark)

    Ladetto, M; Buske, C; Hutchings, M;

    2016-01-01

    into three working groups; each group focused on one of these areas in order to address four clinically relevant questions relating to that topic. All relevant scientific literature, as identified by the experts, was reviewed in advance. During the consensus conference, each working group developed...

  20. An Internet study of men sexually attracted to children: Sexual attraction patterns.

    Science.gov (United States)

    Bailey, J Michael; Hsu, Kevin J; Bernhard, Paula A

    2016-10-01

    To our knowledge, this is the first large study of the attractions of child-attracted men recruited in any manner other than their being charged with legal offenses. We recruited 1,189 men from websites for adults attracted to children. Men in our sample were highly attracted to children, and they were much less attracted to adults, especially to adult men. However, men varied with respect to which combination of gender and age they found most attractive. Men in our sample were especially attracted to pubescent boys and prepubescent girls. Their self-reported attraction patterns closely tracked the age/gender gradient of sexual arousal established in prior research. Consistent with the gradient, men most attracted to prepubescent children were especially likely to have bisexual attractions to children. Pedohebephilia-attraction to sexually immature children-is best considered a collection of related if distinct sexual orientations, which vary in the particular combination of gender and sexual maturity that elicits greatest sexual attraction. Finally, our study reveals the potential power and efficiency of studying highly cooperative child-attracted men recruited via the Internet. (PsycINFO Database Record

  1. Men's attraction to women's bodies changes seasonally.

    Science.gov (United States)

    Pawlowski, Bogusław; Sorokowski, Piotr

    2008-01-01

    Humans exhibit seasonal variation in hormone levels, behaviour, and perception. Here we show that men's assessments of women's attractiveness change also seasonally. In five seasons (from winter 2004 to winter 2005) 114 heterosexual men were asked to assess the attractiveness of the same stimuli: photos of a female with three different waist-to-hip ratios; photos of female breasts, and photos of average-looking faces of young women. For each season, the scores given to the stimuli of the same category (body shape, breast, and face) were combined. Friedman's test revealed significant changes for body shape and breast attractiveness assessments across the seasons, but no changes for face ratings. The highest scores for attractiveness were given in winter and the lowest in summer. We suggest that the observed seasonality is related to the well-known 'contrast effect'. More frequent exposure to women's bodies in warmer seasons might increase men's attractiveness criteria for women's body shape and breasts.

  2. SIAM conference on applications of dynamical systems

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    A conference (Oct.15--19, 1992, Snowbird, Utah; sponsored by SIAM (Society for Industrial and Applied Mathematics) Activity Group on Dynamical Systems) was held that highlighted recent developments in applied dynamical systems. The main lectures and minisymposia covered theory about chaotic motion, applications in high energy physics and heart fibrillations, turbulent motion, Henon map and attractor, integrable problems in classical physics, pattern formation in chemical reactions, etc. The conference fostered an exchange between mathematicians working on theoretical issues of modern dynamical systems and applied scientists. This two-part document contains abstracts, conference program, and an author index.

  3. History of NAMES Conferences

    Science.gov (United States)

    Filippov, Lev

    2013-03-01

    Franco-Russian NAMES Seminars are held for the purpose of reviewing and discussing actual developments in the field of materials science by researchers from Russia and from the Lorraine Region of France. In more precise terms, as set down by the organizers of the seminar (the Moscow Institute of Steel and Alloys and the Institut National Polytechnique de Lorraine), the mission of the seminars is as follows: the development of scientific and academic contacts, giving a new impulse to joint fundamental research and technology transfer the development and consolidation of scientific, technical and business collaboration between the regions of Russia and Lorraine through direct contact between the universities, institutes and companies involved The first Seminar took place on 27-29 October 2004, at the Institut National Polytechnique de Lorraine (on the premises of the Ecole Européenne d'Ingénieurs en Génie des Matériaux, Nancy, France). The number, variety and quality of the oral presentations given and posters exhibited at the first Seminar were of high international standard. 30 oral presentations were given and 72 posters were presented by 19 participants from five universities and three institutes of the Russian Academy of Sciences participants from 11 laboratories of three universities from the Lorraine region three industrial companies, including the European Aeronautic Defence and Space Company—EADS, and ANVAR (Agence Nationale de Valorisation de la Recherche) From 2005 onwards, it was decided to organize the Seminar every other year. The second Seminar convened on the occasion of the 75th Anniversary of the Moscow Institute of Steel and Alloys on 10-12 November 2005 in Moscow, Russia. The seminar demonstrated the efficiency of the scientific partnership founded between the research groups of Russia and France during the first Seminar. High productivity of the Franco-Russian scientific cooperation on the basis of the Research-Educational Franco

  4. EDITORIAL: THE INTERNATIONAL CONFERENCE ON LIFE CYCLE ASSESSMENT

    Science.gov (United States)

    This is a special issue of Journal of Life Cycle Assessment that includes selected papers from the Internatonal Conference and Exhibition on Life Cycle Assessment (InLCA). In April 2000, the EPA, with co-organizer IERE, held the InLCA conferencethat attracted over 265 attendees (...

  5. SIAM Conference on Geometric Design and Computing. Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    None

    2002-03-11

    The SIAM Conference on Geometric Design and Computing attracted 164 domestic and international researchers, from academia, industry, and government. It provided a stimulating forum in which to learn about the latest developments, to discuss exciting new research directions, and to forge stronger ties between theory and applications. Final Report

  6. Attractiveness in African American and Caucasian women: is beauty in the eyes of the observer?

    Science.gov (United States)

    Davis, Dawnavan S; Sbrocco, Tracy; Odoms-Young, Angela; Smith, Dionne M

    2010-01-01

    Traditional body image studies have been constrained by focusing on body thinness as the sole component of attractiveness. Evidence suggests that African American women may hold a multifactorial view of attractiveness that extends beyond size to include factors such as dress attire and race. The current study employed a culturally sensitive silhouette Model Rating Task (MRT) to examine the effects of attire, body size, and race on attractiveness. Unexpectedly, minimal differences on attractiveness ratings emerged by attire, body size, or model race between African American and Caucasian women. Overall, participants preferred the dressed, underweight, and African American models. Factors such as exposure to diverse groups and changes in African American culture may explain the present findings. Future studies to delineate the components of attractiveness for African American and Caucasian women using the MRT are needed to broaden our understanding and conceptualization of attractiveness across racial groups.

  7. International Cryocooler Conference

    CERN Document Server

    Cryocoolers 13

    2005-01-01

    This is the 13th volume in the conference series. Over the years the International Cryocoolers Conference has become the preeminent worldwide conference for the presentation of the latest developments and test experiences with cryocoolers. The typical applications of this technology include cooling space and terrestrial infrared focal plane arrays, space x-ray detectors, medical applications, and a growing number of high-temperature super-capacitor applications.

  8. Expectations for Cancun Conference

    Institute of Scientific and Technical Information of China (English)

    DING ZHITAO

    2010-01-01

    Compared with the great hopes raised by the Copenhagen Climate Conference in 2009, the 2010 UN Climate Change Conference in Cancun aroused fewer expectations. However, the international community is still waiting for a positive outcome that will benefit humankind as a whole. The Cancun conference is another important opportunity for all the participants to advance the Bali Road Map negotiations after last year's meeting in Copenhagen, which failed to reach a legally binding treaty for the years beyond 2012.

  9. Algebraic Groups

    DEFF Research Database (Denmark)

    2007-01-01

    The workshop continued a series of Oberwolfach meetings on algebraic groups, started in 1971 by Tonny Springer and Jacques Tits who both attended the present conference. This time, the organizers were Michel Brion, Jens Carsten Jantzen, and Raphaël Rouquier. During the last years, the subject...... of algebraic groups (in a broad sense) has seen important developments in several directions, also related to representation theory and algebraic geometry. The workshop aimed at presenting some of these developments in order to make them accessible to a "general audience" of algebraic group......-theorists, and to stimulate contacts between participants. Each of the first four days was dedicated to one area of research that has recently seen decisive progress: \\begin{itemize} \\item structure and classification of wonderful varieties, \\item finite reductive groups and character sheaves, \\item quantum cohomology...

  10. Conference proceedings ISES 2014

    DEFF Research Database (Denmark)

    Christensen, Janne Winther; Peerstrup Ahrendt, Line; Malmkvist, Jens

    The 10th Internatinal Equitation Science Conference is held i Denmark from August 6th - 9th 2014. This book of proceedings contaions abstracts of 35 oral and 57 poster presentations within the conference themes Equine Stress, Learning and Training as well as free papers.......The 10th Internatinal Equitation Science Conference is held i Denmark from August 6th - 9th 2014. This book of proceedings contaions abstracts of 35 oral and 57 poster presentations within the conference themes Equine Stress, Learning and Training as well as free papers....

  11. From Blackboard to Green Screen: Teachers, Technology and Turmoil. Proceedings of the Conference of the Townsville Regional Group of the Australian College of Education (8th, Townsville, Queensland, Australia, May 15-16, 1987).

    Science.gov (United States)

    Moon, R., Ed.

    The examination of technological change and its impact on schools that is reported in these conference proceedings focuses on the human dimensions of this change, and in particular, whether the introduction of technology into education is causing turmoil for teachers. It is argued that teachers appear to be feeling the strain of the actual changes…

  12. Social preferences based on sexual attractiveness

    DEFF Research Database (Denmark)

    Brask, Josefine Bohr; Croft, Darren P.; Thompson, Katharine

    2012-01-01

    with females that are more sexually attractive than themselves and that they perform active partner choices based on this relative attractiveness. We propose that this strategy is likely to represent an important pathway by which females can construct social niches that influence the decision-making of others......Male sexual harassment of females is common across sexually reproducing species and can result in fitness costs to females. We hypothesized that females can reduce unwanted male attention by constructing a social niche where their female associates are more sexually attractive than themselves, thus...... influencing the decision-making of males to their advantage. We tested this hypothesis in the Trinidadian guppy (Poecilia reticulata), a species with high levels of male sexual harassment. First, we confirmed that non-receptive females were harassed less when they were paired with a more sexually attractive...

  13. Locus of Control and Interpersonal Attraction.

    Science.gov (United States)

    Fagan, M. Michael

    1980-01-01

    The role of locus of control in interpersonal attraction was examined by administering 1) the Nowicki-Strickland Locus of Control Scale and 2) a sociometric test of friendship to 200 eighth graders. (CM)

  14. Screening for attractants compatible with entomopathogenic fungus ...

    African Journals Online (AJOL)

    RACHEL

    2016-04-27

    Apr 27, 2016 ... They were selected on the basis of structural analogies to known attractant such as methyl isonicotinate (Lurem-TR) (Teulon et al., ..... plants: transcription of a monoterpene synthase gene and volatile emission. J. Exp. Bot.

  15. Dovecots: tourist attraction of Isfahan villages

    National Research Council Canada - National Science Library

    Atefeh Ansari; Dariyush Heydari bani

    2014-01-01

    ... industry.One of the notable subdivisions of this industry is rural tourism. This kind oftourism has played a considerable role in attracting tourists and in helpingeconomic activities all around the world...

  16. Facial attractiveness: General patterns of facial preferences

    National Research Council Canada - National Science Library

    Kościński, Krzysztof

    2007-01-01

    This review covers universal patterns in facial preferences. Facial attractiveness has fascinated thinkers since antiquity, but has been the subject of intense scientific study for only the last quarter of a century...

  17. Integrating Body Movement into Attractiveness Research

    Directory of Open Access Journals (Sweden)

    Bernhard eFink

    2015-03-01

    Full Text Available People judge attractiveness and make trait inferences from the physical appearance of others, and research reveals high agreement among observers making such judgments. Evolutionary psychologists have argued that interest in physical appearance and beauty reflects adaptations that motivate the search for desirable qualities in a potential partner. Although men more than women value the physical appearance of a partner, appearance universally affects social perception in both sexes. Most studies of attractiveness perceptions have focused on third party assessments of static representations of the face and body. Corroborating evidence suggests that body movement, such as dance, also conveys information about mate quality. Here we review evidence that dynamic cues (e.g., gait, dance also influence perceptions of mate quality, including personality traits, strength, and overall attractiveness. We recommend that attractiveness research considers the informational value of body movement in addition to static cues, to present an integrated perspective on human social perception.

  18. Integrating body movement into attractiveness research.

    Science.gov (United States)

    Fink, Bernhard; Weege, Bettina; Neave, Nick; Pham, Michael N; Shackelford, Todd K

    2015-01-01

    People judge attractiveness and make trait inferences from the physical appearance of others, and research reveals high agreement among observers making such judgments. Evolutionary psychologists have argued that interest in physical appearance and beauty reflects adaptations that motivate the search for desirable qualities in a potential partner. Although men more than women value the physical appearance of a partner, appearance universally affects social perception in both sexes. Most studies of attractiveness perceptions have focused on third party assessments of static representations of the face and body. Corroborating evidence suggests that body movement, such as dance, also conveys information about mate quality. Here we review evidence that dynamic cues (e.g., gait, dance) also influence perceptions of mate quality, including personality traits, strength, and overall attractiveness. We recommend that attractiveness research considers the informational value of body movement in addition to static cues, to present an integrated perspective on human social perception.

  19. Discovery of Linguistic Relations Using Lexical Attraction

    CERN Document Server

    Yuret, D

    1998-01-01

    This work has been motivated by two long term goals: to understand how humans learn language and to build programs that can understand language. Using a representation that makes the relevant features explicit is a prerequisite for successful learning and understanding. Therefore, I chose to represent relations between individual words explicitly in my model. Lexical attraction is defined as the likelihood of such relations. I introduce a new class of probabilistic language models named lexical attraction models which can represent long distance relations between words and I formalize this new class of models using information theory. Within the framework of lexical attraction, I developed an unsupervised language acquisition program that learns to identify linguistic relations in a given sentence. The only explicitly represented linguistic knowledge in the program is lexical attraction. There is no initial grammar or lexicon built in and the only input is raw text. Learning and processing are interdigitated....

  20. Electrostatic attraction between overall neutral surfaces.

    Science.gov (United States)

    Adar, Ram M; Andelman, David; Diamant, Haim

    2016-08-01

    Two overall neutral surfaces with positively and negatively charged domains ("patches") have been shown in recent experiments to exhibit long-range attraction when immersed in an ionic solution. Motivated by the experiments, we calculate analytically the osmotic pressure between such surfaces within the Poisson-Boltzmann framework, using a variational principle for the surface-averaged free energy. The electrostatic potential, calculated beyond the linear Debye-Hückel theory, yields an overall attraction at large intersurface separations, over a wide range of the system's controlled length scales. In particular, the attraction is stronger and occurs at smaller separations for surface patches of larger size and charge density. In this large patch limit, we find that the attraction-repulsion crossover separation is inversely proportional to the square of the patch-charge density and to the Debye screening length.

  1. Colloidal attraction induced by a temperature gradient.

    Science.gov (United States)

    Di Leonardo, R; Ianni, F; Ruocco, G

    2009-04-21

    Colloidal crystals are of extreme importance for applied research and for fundamental studies in statistical mechanics. Long-range attractive interactions, such as capillary forces, can drive the spontaneous assembly of such mesoscopic ordered structures. However, long-range attractive forces are very rare in the colloidal realm. Here we report a novel strong, long-ranged attraction induced by a thermal gradient in the presence of a wall. By switching the thermal gradient on and off, we can rapidly and reversibly form stable hexagonal 2D crystals. We show that the observed attraction is hydrodynamic in nature and arises from thermally induced slip flow on particle surfaces. We used optical tweezers to measure the force law directly and compare it to an analytical prediction based on Stokes flow driven by Marangoni-like forces.

  2. MUSEUMS AS CULTURAL TOURISM ATTRACTIONS IN UBUD

    Directory of Open Access Journals (Sweden)

    Ida Bagus Kade Subhiksu

    2016-03-01

    Full Text Available Recently, there has been a shift in the attributes of several museums in Ubud in order to attract more tourists to visit museums as cultural tourism attractions. Some museums have expanded their collections and add other attributes to complement their main collections, which as the potential to alter the idealism, functions, and roles of museums. Another challenge faced by museum operators is the development of other tourist attractions, such as the addition of tourism destination attributes in Ubud, which was initially known as tourism destinations that offered art and culture such as dance performances and museums, and now have expanded into yoga destination, adventure destination, and so on. Based on these factors, the problem statements in this research are formulated as follows: (1 How are museums as tourist attractions in Ubud area, from the perspective of operators? (2 How are museums as tourist attractions in Ubud area, from the perspective of visitors? (3 How is the relationship between museums and other tourism components when examined from the role of museums as cultural tourism attractions in Ubud area?. This research on museums was conducted in the Ubud area because Ubud has made museums as the cultural tourism attractions in the area, which include the Blanco Museum, Museum Puri Lukisan, Agung Rai Museum of Art (ARMA, the Rudana Museum, and Neka Art Museum. This research is based on the theories of museum management, marketing, and theories on cultural tourism attraction. The research involved the participation of 82 foreign visitors and 79 domestic visitors as respondents, in addition to five museum owners and two museum professionals as informants. The conclusion of this research are as follows: (1 From the perspective of museum operators, museums function as cultural tourism attractions, as sources of historical information, as the media for cultural preservation, and the actualization of the noble objective of the museum

  3. Second international conference on isotopes. Conference proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, C.J. [ed.

    1997-10-01

    The Second International Conference on Isotopes (2ICI) was hosted by the Australian Nuclear Association in Sydney, NSW, Australia. The Theme of the Second Conference: Isotopes for Industry, Health and a Better Environment recognizes that isotopes have been used in these fields successfully for many years and offer prospects for increasing use in the future. The worldwide interest in the use of research reactors and accelerators and in applications of stable and radioactive isotopes, isotopic techniques and radiation in industry, agriculture, medicine, environmental studies and research in general, was considered. Other radiation issues including radiation protection and safety were also addressed. International and national overviews and subject reviews invited from leading experts were included to introduce the program of technical sessions. The invited papers were supported by contributions accepted from participants for oral and poster presentation. A Technical Exhibition was held in association with the Conference. This volume contains the full text or extended abstracts of papers number 61- to number 114

  4. Cultured skin microbiota attracts malaria mosquitoes

    OpenAIRE

    Takken Willem; Knols Bart GJ; Beijleveld Hans; Verhulst Niels O; Schraa Gosse; Bouwmeester Harro J; Smallegange Renate C

    2009-01-01

    Abstract Background Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human body odours. It is hypothesized that host attractiveness and selection of An. gambiae is affected by the species composition, density, and metabolic activity of the skin microbiota. A study ...

  5. Social attraction mediated by fruit flies' microbiome.

    Science.gov (United States)

    Venu, Isvarya; Durisko, Zachary; Xu, Jianping; Dukas, Reuven

    2014-04-15

    Larval and adult fruit flies are attracted to volatiles emanating from food substrates that have been occupied by larvae. We tested whether such volatiles are emitted by the larval gut bacteria by conducting tests under bacteria-free (axenic) conditions. We also tested attraction to two bacteria species, Lactobacillus brevis, which we cultured from larvae in our lab, and L. plantarum, a common constituent of fruit flies' microbiome in other laboratory populations and in wild fruit flies. Neither larvae nor adults showed attraction to axenic food that had been occupied by axenic larvae, but both showed the previously reported attraction to standard food that had been occupied by larvae with an intact microbiome. Larvae also showed significant attraction to volatiles from axenic food and larvae to which we added only either L. brevis or L. plantarum, and volatiles from L. brevis reared on its optimal growth medium. Controlled learning experiments indicated that larvae experienced with both standard and axenic used food do not perceive either as superior, while focal larvae experienced with simulated used food, which contains burrows, perceive it as superior to unused food. Our results suggest that flies rely on microbiome-derived volatiles for long-distance attraction to suitable food patches. Under natural settings, fruits often contain harmful fungi and bacteria, and both L. brevis and L. plantarum produce compounds that suppress the growth of some antagonistic fungi and bacteria. The larval microbiome volatiles may therefore lead prospective fruit flies towards substrates with a hospitable microbial environment.

  6. Persepsi Wisatawan Terhadap Night Life Attraction

    Directory of Open Access Journals (Sweden)

    Hary Hermawan

    2017-04-01

    ABSTRACT Cabaret is a term performances of music, comedy, dance, drama, and other special mix of art perfomed by men who dressed in women (ladyboy on stage. Cabaret performances in Oyot Godhong Restaurant intended as new tourist attraction that is expected to increase the interest of tourists to visit Malioboro in Yogyakarta, especially to Oyot Godhong Restaurants. Based descriptive study shows that the characteristics travelers who viewed Kabaret show is very diverse, each of which has perceptions and motivations are different. Cabaret performances have qualified to become the cultural attractions are staged at night (night atraction in the city of Yogyakarta. Based on traveler perception indicates that the cabaret performances have beauty or aesthetics, uniqueness, and values that match the criteria criteria of the standard as a tourist attraction. Performances Cabaret in Oyot Godhong Restaurants able to increase the sale value. Oyot Godhong Restaurants previously only form of tourism facilities (amenities, but is now a restaurant that has a tourist attraction (atraction.   Keywords: Cabaret show, night life attractions, tourism attraction, tourists perception, tourism marketing

  7. The effect of corporate image on the formation of customer attraction

    Directory of Open Access Journals (Sweden)

    Reza Koohjani Gouji

    2016-10-01

    Full Text Available This paper examines the relationship of corporate image with customer attraction in Irancell Telecommunications Services Company in city of Ahvaz, Iran. The study uses a sample of 384 randomly selected people who use the firm’s services. Measuring tools for corporate image and customer attraction are an 18-item questionnaire of Rampersad (2001 [Rampersad, H. (2001. 75 painful questions about your customer satisfaction. the TQM Magazine, 13(5, 341-347.] and a 14-item questionnaire of Geib (2005 [Geib, M. (2005. Architecture for customer relationship management to attract and retain customers approaches in financial services, IEEE, Proceedings of the 38th Hawaii International Conference on System Sciences.], respectively. Results of regression analysis showed that there was a significant relationship between corporate image and attracting customers in Irancell firm. In addition, dimensions of corporate image including experience, character, competence, quality, differentiation, cost, technology, and culture and cognition increase customer attraction to the company. On the other hand, component of culture has the most effect on attracting customers in this firm.

  8. Eighth International Conference on Paleoceanography

    Science.gov (United States)

    Grousset, Francis; Peterson, Larry; Delaney, Peggie; Elderfield, Harry; Emeis, Kay; Haug, Gerald; Stocker, Thomas; Wang, Pinxian

    Every three years since 1983, the paleoceanographic community has come together at a different venue to share new data and discoveries at the International Conference on Paleoceanography (ICP). For the recent ICP-8, France was the host country for a conference focused on the theme of “An Ocean View of Global Change.” The Environnements et Paleoenvironnement Oceanique (EPOC) paleoceanography group of the University Bordeaux I acted as the local organizing committee.Scientific presentations at ICP-8 addressed the latest discoveries in paleoceanography and highlighted both emerging and as-yet-unsolved questions on global climate change. Thirty-five speakers, invited by the ICP-8 Science Committee, gave overview talks during morning sessions organized around five major scientific themes. These themes were Cenozoic-Mesozoic Oceans; Carbonate and Silica Systems of the Pleistocene Ocean; Biogeochemical Cycles of the Past; High-Frequency Climate Variability; and Interhemispheric Ocean-Continent-Climate Linkages.

  9. Radiation`96. Conference handbook

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-12-31

    The conference program includes eight invited lectures which cover a range of contemporary topics in radiation science and technology. In addition, thirty-two oral papers were presented, along with forty-five posters. The conference handbook contains one-page precis or extended abstracts of all presentations, and is a substantial compendium of current radiation research in Australia.

  10. Expectations for Cancun Conference

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Compared with the great hopes raised by the Copenhagen Climate Conference in 2009, the 2010 UN Climate Change Conference in Cancun aroused fewer expectations. However, the international community is still waiting for a positive outcome that will benefit humankind as a whole.

  11. 2016 American Conference on Neutron Scattering (ACNS)

    Energy Technology Data Exchange (ETDEWEB)

    Woodward, Patrick [Materials Research Society, Warrendale, PA (United States)

    2017-02-09

    The 8th American Conference on Neutron Scattering (ACNS) was held July 10-14, 2016 in Long Beach California, marking the first time the meeting has been held on the west coast. The meeting was coordinated by the Neutron Scattering Society of America (NSSA), and attracted 285 attendees. The meeting was chaired by NSSA vice president Patrick Woodward (the Ohio State University) assisted by NSSA president Stephan Rosenkranz (Argonne National Laboratory) together with the local organizing chair, Brent Fultz (California Institute of Technology). As in past years the Materials Research Society assisted with planning, logistics and operation of the conference. The science program was divided into the following research areas: (a) Sources, Instrumentation, and Software; (b) Hard Condensed Matter; (c) Soft Matter; (d) Biology; (e) Materials Chemistry and Materials for Energy; (f) Engineering and Industrial Applications; and (g) Neutron Physics.

  12. 3rd Cryocooler Conference

    CERN Document Server

    Louie, Berverly; McCarthy, Sandy

    1985-01-01

    Cryocoolers 3 documents the output of the Third Cryocooler Conference, held at the National Bureau of Standards, Boulder, Colorado, on September 17-18, 1984. About 140 people from 10 countries attended the conference representing industry, government, and academia. A total of 26 papers were presented orally at the conference and all appear in written form in the proceedings. The focus of this conference was on small cryocoolers in the temperature range of 4 - 80 K. Mechanical and nonmechanical types are discussed in the various papers. Applications of these small cryocoolers include the cooling of infrared detectors, cryopumps, small superconducting devices and magnets, and electronic devices. The conference proceedings reproduced here was published by the National Bureau of Standards in Boulder, Colorado as NBS Special Publication #698.

  13. Conference Summary: First International Conference on Global Warming and the Next Ice Age

    Science.gov (United States)

    Wetzel, Peter J.; Chylek, Petr; Lesins, Glen; Starr, David OC. (Technical Monitor)

    2002-01-01

    The First International Conference on Global Warming and the Next Ice Age was convened in Halifax, Nova Scotia, August 19-24, 2001. The conference program began each day with a 30 minute live classical music performances of truly international quality before the beginning business. Ample time for panel discussions was also scheduled. The general public was invited to attend and participate in a special evening panel session on the last day of the conference. The unusual and somewhat provocative title of the conference was designed to attract diverse views on global climate change. This summary attempts to accurately reflect the tone and flavor of the lively discussions which resulted. Presentations ranged from factors forcing current climate to those in effect across the span of time from the Proterozoic "snowball Earth" epoch to 50,000 years in the future. Although, as should be expected, attendees at the conference arrived with opinions on some of the controversial issues regarding climate change, and no-one openly admitted to a 'conversion' from their initial point of view, the interdisciplinary nature of the formal presentations, poster discussions, panels, and abundant informal discourse helped to place the attendees' personal perspectives into a broader, more diversified context.

  14. Conference report: hot topics in antibody-drug conjugate development.

    Science.gov (United States)

    Thudium, Karen; Bilic, Sanela

    2013-12-01

    American Association of Pharmaceutical Scientists National Biotechnology Conference Sheraton San Diego Hotel and Marina, San Diego, CA, USA, 19-23 May 2013 The National Biotechnology Conference, is a premier meeting for biotechnology professionals covering a broad range of hot topics in the biotechnology industry. Attracting participants from academia, industry and regulatory, this meeting features sessions that aim to address emerging subjects of interest and allows for open exchange between scientists. The 2013 conference featured leading researchers in the fields of antibody-drug conjugates (ADCs) and immunogenicity. Herein, we present a summary of the ADC hot topics, including bioanalytical and PK considerations, quantitative evaluation of the impact of immunogenicity and ADME to understand ADC drug-drug interactions, and clinical considerations for ADC development. This article aims to summarize the recommendations that were made by the speakers during various sessions throughout the conference.

  15. Highlights from the 2013 national cancer research institute conference.

    Science.gov (United States)

    Lewis, Ian

    2014-01-01

    Cancer research is a multifaceted endeavour that incorporates not only a myriad of techniques and specialties but also encompasses a huge range of disease types. The National Cancer Research Institute (NCRI) is a UK partnership comprising 21 charity and government funders of cancer research along with the Association of British Pharmaceutical Industry. Each year, the NCRI hosts the largest cancer meeting in the UK; bringing together members of the UK cancer research community, research leaders from around the world, health professionals, service users, research funders, and industry to discuss the latest findings in cancer research from a wide range of disciplines. The 2013 NCRI Conference attracted over 1700 delegates and 150 speakers from 15 different countries. The conference programme covered a large range of topic areas including prevention, screening, model systems, the provision of information, survivorship, and end-of-life care. This conference report gives an overview of the plenary sessions at the conference as well as highlights from the parallel sessions.

  16. Global Conference on Applied Computing in Science and Engineering

    CERN Document Server

    2016-01-01

    The Global Conference on Applied Computing in Science and Engineering is organized by academics and researchers belonging to different scientific areas of the C3i/Polytechnic Institute of Portalegre (Portugal) and the University of Extremadura (Spain) with the technical support of ScienceKnow Conferences. The event has the objective of creating an international forum for academics, researchers and scientists from worldwide to discuss worldwide results and proposals regarding to the soundest issues related to Applied Computing in Science and Engineering. This event will include the participation of renowned keynote speakers, oral presentations, posters sessions and technical conferences related to the topics dealt with in the Scientific Program as well as an attractive social and cultural program. The papers will be published in the Proceedings e-books. The proceedings of the conference will be sent to possible indexing on Thomson Reuters (selective by Thomson Reuters, not all-inclusive) and Google Scholar...

  17. Report on the 13th conference on "Strategies for Survival: collections, data, institutions" of the Groupe des Cartothécaires de LIBER, 3-7 September, Helsinki, Finland.

    Directory of Open Access Journals (Sweden)

    Christopher Fleet

    2003-03-01

    Full Text Available In spite of being an inauspicious 13th conference, this was a successful and highly enjoyable gathering of map curators, which - despite a close encounter with a Helsinki tram! - managed to avoid any mishaps or disasters. Our Finnish Organising Committee provided a well-organised, interesting programme with considerable good-humour and kindness, allowing an excellent base for our discussions and talks. As usual there was a varied spread of people, issues and subjects brought together, both practical and theoretical, historical and contemporary, reflecting the diverse nature of European map libraries. This report is a somewhat personal and abbreviated account of the conference, summarising the main issues of the various papers, providing an introduction to them, and highlighting general trends. Eight of the papers are being published in this issue of the LIBER Quarterly.

  18. Second international conference on isotopes. Conference proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, C.J. [ed.

    1997-10-01

    The Second International Conference on Isotopes (2ICI) was hosted by the Australian Nuclear Association in Sydney, NSW, Australia. The Theme of the Second Conference: Isotopes for Industry, Health and a Better Environment recognizes that isotopes have been used in these fields successfully for many years and offer prospects for increasing use in the future. The worldwide interest in the use of research reactors and accelerators and in applications of stable and radioactive isotopes, isotopic techniques and radiation in industry, agriculture, medicine, environmental studies and research in general, was considered. Other radiation issues including radiation protection and safety were also addressed. International and national overviews and subject reviews invited from leading experts were included to introduce the program of technical sessions. The invited papers were supported by contributions accepted from participants for oral and poster presentation. A Technical Exhibition was held in association with the Conference. This volume contains the foreword, technical program, the author index and of the papers (1-60) presented at the conference.

  19. Insulin signaling mediates sexual attractiveness in Drosophila.

    Directory of Open Access Journals (Sweden)

    Tsung-Han Kuo

    Full Text Available Sexually attractive characteristics are often thought to reflect an individual's condition or reproductive potential, but the underlying molecular mechanisms through which they do so are generally unknown. Insulin/insulin-like growth factor signaling (IIS is known to modulate aging, reproduction, and stress resistance in several species and to contribute to variability of these traits in natural populations. Here we show that IIS determines sexual attractiveness in Drosophila through transcriptional regulation of genes involved in the production of cuticular hydrocarbons (CHC, many of which function as pheromones. Using traditional gas chromatography/mass spectrometry (GC/MS together with newly introduced laser desorption/ionization orthogonal time-of-flight mass spectrometry (LDI-MS we establish that CHC profiles are significantly affected by genetic manipulations that target IIS. Manipulations that reduce IIS also reduce attractiveness, while females with increased IIS are significantly more attractive than wild-type animals. IIS effects on attractiveness are mediated by changes in CHC profiles. Insulin signaling influences CHC through pathways that are likely independent of dFOXO and that may involve the nutrient-sensing Target of Rapamycin (TOR pathway. These results suggest that the activity of conserved molecular regulators of longevity and reproductive output may manifest in different species as external characteristics that are perceived as honest indicators of fitness potential.

  20. Visual perception of female physical attractiveness.

    Science.gov (United States)

    Fan, J; Liu, F; Wu, J; Dai, W

    2004-02-22

    On the basis of visual assessment of figure drawings and front/profile images, past researchers believed that the waist-hip ratio (WHR) and the body mass index (BMI) were two putative cues to female physical attractiveness. However, this view was not tested on three-dimensional (3D) female images. In the present study, 3D images of 31 Caucasian females having varying body weights (BMI ranged from 16 to 35) were shown to 29 male and 25 female viewers, who were asked to rate the physical attractiveness. The results showed that the body volume divided by the square of the height, defined as volume height index (VHI), is the most important and direct visual determinant of female physical attractiveness. In determining the female attractiveness, human observers may first use VHI as a visual cue, which is also a key indicator of health and fertility owing to its strong linear relation to BMI. To fine-tune the judgement, observers may then use body proportions, the most important of which are the ratio of waist height over the chin height (WHC) (a measure of the length of legs over total tallness) and the deviation of WHR from the ideal ratio. It also appears that the effect of the body's physical parameters on the perception of female physical attractiveness conforms to Stevens' power law of psychophysics.

  1. Conference Report: Wyoming Invitational Conference on Instructional Applications of Computers.

    Science.gov (United States)

    Kansky, Bob

    This report: (1) describes the organization of an invitational conference aimed at gathering direction from classroom teachers regarding instructional applications of computers; (2) provides copies of all materials used in organizing such a conference; and (3) reports the results of the conference in terms of conference products (resolutions,…

  2. Recognition bias and the physical attractiveness stereotype.

    Science.gov (United States)

    Rohner, Jean-Christophe; Rasmussen, Anders

    2012-06-01

    Previous studies have found a recognition bias for information consistent with the physical attractiveness stereotype (PAS), in which participants believe that they remember that attractive individuals have positive qualities and that unattractive individuals have negative qualities, regardless of what information actually occurred. The purpose of this research was to examine whether recognition bias for PAS congruent information is replicable and invariant across a variety of conditions (i.e. generalizable). The effects of nine different moderator variables were examined in two experiments. With a few exceptions, the effect of PAS congruence on recognition bias was independent of the moderator variables. The results suggest that the tendency to believe that one remembers information consistent with the physical attractiveness stereotype is a robust phenomenon.

  3. Hot Particles Attract in a Cold Bath

    CERN Document Server

    Tanaka, Hidenori; Brenner, Michael P

    2016-01-01

    Controlling interactions out of thermodynamic equilibrium is crucial for designing addressable and functional self-organizing structures. These active interactions also underpin collective behavior in biological systems. Here we study a general setting of active particles in a bath of passive particles, and demonstrate a novel mechanism for long ranged attraction between active particles. The mechanism operates when the translational persistence length of the active particle motion is smaller than the particle diameter. In this limit, the system reduces to particles of higher diffusivity ("hot" particles) in a bath of particles with lower diffusivity ("cold" particles). This attractive interaction arises as a hot particle pushes cold particles away to create a large hole around itself, and the holes interact via a depletion-like attraction even though all particles have the same size. Although the mechanism occurs outside the parameter range of typical biological organisms, the mechanism could be realized in ...

  4. Self-attracting walk on heterogeneous networks

    Science.gov (United States)

    Kim, Kanghun; Kyoung, Jaegu; Lee, D.-S.

    2016-05-01

    Understanding human mobility in cyberspace becomes increasingly important in this information era. While human mobility, memory-dependent and subdiffusive, is well understood in Euclidean space, it remains elusive in random heterogeneous networks like the World Wide Web. Here we study the diffusion characteristics of self-attracting walks, in which a walker is more likely to move to the locations visited previously than to unvisited ones, on scale-free networks. Under strong attraction, the number of distinct visited nodes grows linearly in time with larger coefficients in more heterogeneous networks. More interestingly, crossovers to sublinear growths occur in strongly heterogeneous networks. To understand these phenomena, we investigate the characteristic volumes and topology of the cluster of visited nodes and find that the reinforced attraction to hubs results in expediting exploration first but delaying later, as characterized by the scaling exponents that we derive. Our findings and analysis method can be useful for understanding various diffusion processes mediated by human.

  5. Social preferences based on sexual attractiveness

    DEFF Research Database (Denmark)

    Brask, Josefine Bohr; Croft, Darren P.; Thompson, Katharine

    2012-01-01

    with females that are more sexually attractive than themselves and that they perform active partner choices based on this relative attractiveness. We propose that this strategy is likely to represent an important pathway by which females can construct social niches that influence the decision-making of others......Male sexual harassment of females is common across sexually reproducing species and can result in fitness costs to females. We hypothesized that females can reduce unwanted male attention by constructing a social niche where their female associates are more sexually attractive than themselves, thus...... (receptive) female than with another non-receptive female. We then found that, indeed, females exploit this as a strategy to reduce sexual harassment; non-receptive females actively preferred to associate with receptive over non-receptive females. Importantly, when given access only to chemosensory cues, non...

  6. International Conference on Intelligent Systems for Molecular Biology (ISMB)

    Energy Technology Data Exchange (ETDEWEB)

    Goldberg, Debra; Hibbs, Matthew; Kall, Lukas; Komandurglayavilli, Ravikumar; Mahony, Shaun; Marinescu, Voichita; Mayrose, Itay; Minin, Vladimir; Neeman, Yossef; Nimrod, Guy; Novotny, Marian; Opiyo, Stephen; Portugaly, Elon; Sadka, Tali; Sakabe, Noboru; Sarkar, Indra; Schaub, Marc; Shafer, Paul; Shmygelska, Olena; Singer, Gregory; Song, Yun; Soumyaroop, Bhattacharya; Stadler, Michael; Strope, Pooja; Su, Rong; Tabach, Yuval; Tae, Hongseok; Taylor, Todd; Terribilini, Michael; Thomas, Asha; Tran, Nam; Tseng, Tsai-Tien; Vashist, Akshay; Vijaya, Parthiban; Wang, Kai; Wang, Ting; Wei, Lai; Woo, Yong; Wu, Chunlei; Yamanishi, Yoshihiro; Yan, Changhui; Yang, Jack; Yang, Mary; Ye, Ping; Zhang, Miao

    2009-12-29

    The Intelligent Systems for Molecular Biology (ISMB) conference has provided a general forum for disseminating the latest developments in bioinformatics on an annual basis for the past 13 years. ISMB is a multidisciplinary conference that brings together scientists from computer science, molecular biology, mathematics and statistics. The goal of the ISMB meeting is to bring together biologists and computational scientists in a focus on actual biological problems, i.e., not simply theoretical calculations. The combined focus on "intelligent systems" and actual biological data makes ISMB a unique and highly important meeting, and 13 years of experience in holding the conference has resulted in a consistently well organized, well attended, and highly respected annual conference. The ISMB 2005 meeting was held June 25-29, 2005 at the Renaissance Center in Detroit, Michigan. The meeting attracted over 1,730 attendees. The science presented was exceptional, and in the course of the five-day meeting, 56 scientific papers, 710 posters, 47 Oral Abstracts, 76 Software demonstrations, and 14 tutorials were presented. The attendees represented a broad spectrum of backgrounds with 7% from commercial companies, over 28% qualifying for student registration, and 41 countries were represented at the conference, emphasizing its important international aspect. The ISMB conference is especially important because the cultures of computer science and biology are so disparate. ISMB, as a full-scale technical conference with refereed proceedings that have been indexed by both MEDLINE and Current Contents since 1996, bridges this cultural gap.

  7. INTERNATIONAL CONFERENCE ON INTELLIGENT SYSTEMS FOR MOLECULAR BIOLOGY (ISMB)

    Energy Technology Data Exchange (ETDEWEB)

    Debra Goldberg; Matthew Hibbs; Lukas Kall; Ravikumar Komandurglayavilli; Shaun Mahony; Voichita Marinescu; Itay Mayrose; Vladimir Minin; Yossef Neeman; Guy Nimrod; Marian Novotny; Stephen Opiyo; Elon Portugaly; Tali Sadka; Noboru Sakabe; Indra Sarkar; Marc Schaub; Paul Shafer; Olena Shmygelska; Gregory Singer; Yun Song; Bhattacharya Soumyaroop; Michael Stadler; Pooja Strope; Rong Su; Yuval Tabach; Hongseok Tae; Todd Taylor; Michael Terribilini; Asha Thomas; Nam Tran; Tsai-Tien Tseng; Akshay Vashist; Parthiban Vijaya; Kai Wang; Ting Wang; Lai Wei; Yong Woo; Chunlei Wu; Yoshihiro Yamanishi; Changhui Yan; Jack Yang; Mary Yang; Ping Ye; Miao Zhang

    2009-12-29

    The Intelligent Systems for Molecular Biology (ISMB) conference has provided a general forum for disseminating the latest developments in bioinformatics on an annual basis for the past 13 years. ISMB is a multidisciplinary conference that brings together scientists from computer science, molecular biology, mathematics and statistics. The goal of the ISMB meeting is to bring together biologists and computational scientists in a focus on actual biological problems, i.e., not simply theoretical calculations. The combined focus on “intelligent systems” and actual biological data makes ISMB a unique and highly important meeting, and 13 years of experience in holding the conference has resulted in a consistently well organized, well attended, and highly respected annual conference. The ISMB 2005 meeting was held June 25-29, 2005 at the Renaissance Center in Detroit, Michigan. The meeting attracted over 1,730 attendees. The science presented was exceptional, and in the course of the five-day meeting, 56 scientific papers, 710 posters, 47 Oral Abstracts, 76 Software demonstrations, and 14 tutorials were presented. The attendees represented a broad spectrum of backgrounds with 7% from commercial companies, over 28% qualifying for student registration, and 41 countries were represented at the conference, emphasizing its important international aspect. The ISMB conference is especially important because the cultures of computer science and biology are so disparate. ISMB, as a full-scale technical conference with refereed proceedings that have been indexed by both MEDLINE and Current Contents since 1996, bridges this cultural gap.

  8. Attraction between like-charged monovalent ions

    Science.gov (United States)

    Zangi, Ronen

    2012-05-01

    Ions with like-charges repel each other with a magnitude given by the Coulomb law. The repulsion is also known to persist in aqueous solutions albeit factored by the medium's dielectric constant. In this paper, we report results from molecular dynamics simulations of alkali halides salt solutions indicating an effective attraction between some of the like-charged monovalent ions. The attraction is observed between anions, as well as between cations, leading to the formation of dimers with lifetimes on the order of few picoseconds. Two mechanisms have been identified to drive this counterintuitive attraction. The first is exhibited by high-charge density ions, such as fluoride, at low salt concentrations, yielding effective attractions with magnitude up to the order of 1-2 kT. In this case, the stronger local electric field generated when the two ions are in contact augments the alignment of neighboring waters toward the ions. This results in a gain of substantial favorable ion-water interaction energy. For fluorides, this interaction constitutes the major change among the different energy components compensating for the anion-anion repulsion, and therefore, rendering like-charge association possible. The second mechanism involves mediation by counterions, the attractions increase with salt concentration and are characterized by small magnitudes. In particular, clusters of ion triplets, in which a counterion is either bridging the two like-charged ions or is paired to only one of them, are formed. Although these two mechanisms may not yield net attractions in many cases, they might still be operational and significant, explaining effective repulsions between like-charged ions with magnitudes much smaller than expected based on continuum electrostatics.

  9. Attraction between like-charged monovalent ions.

    Science.gov (United States)

    Zangi, Ronen

    2012-05-14

    Ions with like-charges repel each other with a magnitude given by the Coulomb law. The repulsion is also known to persist in aqueous solutions albeit factored by the medium's dielectric constant. In this paper, we report results from molecular dynamics simulations of alkali halides salt solutions indicating an effective attraction between some of the like-charged monovalent ions. The attraction is observed between anions, as well as between cations, leading to the formation of dimers with lifetimes on the order of few picoseconds. Two mechanisms have been identified to drive this counterintuitive attraction. The first is exhibited by high-charge density ions, such as fluoride, at low salt concentrations, yielding effective attractions with magnitude up to the order of 1-2 kT. In this case, the stronger local electric field generated when the two ions are in contact augments the alignment of neighboring waters toward the ions. This results in a gain of substantial favorable ion-water interaction energy. For fluorides, this interaction constitutes the major change among the different energy components compensating for the anion-anion repulsion, and therefore, rendering like-charge association possible. The second mechanism involves mediation by counterions, the attractions increase with salt concentration and are characterized by small magnitudes. In particular, clusters of ion triplets, in which a counterion is either bridging the two like-charged ions or is paired to only one of them, are formed. Although these two mechanisms may not yield net attractions in many cases, they might still be operational and significant, explaining effective repulsions between like-charged ions with magnitudes much smaller than expected based on continuum electrostatics.

  10. Visual cues to female physical attractiveness.

    OpenAIRE

    Tovée, M.J.; Maisey, D S; Emery, J. L.; Cornelissen, P L

    1999-01-01

    Evolutionary psychology suggests that a woman's sexual attractiveness is based on cues of health and reproductive potential. In recent years, research has focused on the ratio of the width of the waist to the width of the hips (the waist-to-hip ratio (WHR). A low WHR (i.e. a curvaceous body) is believed to correspond to the optimal fat distribution for high fertility, and so this shape should be highly attractive. In this paper we present evidence that weight scaled for height (the body mass ...

  11. Glassy states in attractive micellar systems

    Science.gov (United States)

    Mallamace, F.; Broccio, M.; Faraone, A.; Chen, W. R.; Chen, S.-H.

    2004-08-01

    Recent mode coupling theory (MCT) calculations show that in attractive colloids one may observe a new type of glass originating from clustering effects, as a result of the attractive interaction. This happens in addition to the known glass-forming mechanism due to cage effects in the hard sphere system. MCT also indicates that, within a certain volume fraction range, varying the external control parameter, the effective temperature, makes the glass-to-liquid-to-glass re-entrance and the glass-to-glass transitions possible. Here we present experimental evidence and details on this complex phase behavior in a three-block copolymer micellar system.

  12. Quantitative Methods to Evaluate Timetable Attractiveness

    DEFF Research Database (Denmark)

    Schittenhelm, Bernd; Landex, Alex

    2009-01-01

    timetable is, the article categorizes the different interests for each key stakeholder. Based on this categorization, the most important timetable attractiveness parameters are described (timetable structure, timetable complexity, travel time, transfers, punctuality and reliability). The descriptions...... is proposed it is still necessary to keep the individual attractiveness parameters to be able to analyse where it is possible to improve the timetable – and possibly the infrastructure too. Since the indexes are preliminary proposals they can each be improved and thereby also improving the overall timetable...... making it possible to create better transfer indexes....

  13. Bayesian long branch attraction bias and corrections.

    Science.gov (United States)

    Susko, Edward

    2015-03-01

    Previous work on the star-tree paradox has shown that Bayesian methods suffer from a long branch attraction bias. That work is extended to settings involving more taxa and partially resolved trees. The long branch attraction bias is confirmed to arise more broadly and an additional source of bias is found. A by-product of the analysis is methods that correct for biases toward particular topologies. The corrections can be easily calculated using existing Bayesian software. Posterior support for a set of two or more trees can thus be supplemented with corrected versions to cross-check or replace results. Simulations show the corrections to be highly effective.

  14. Facial Features: What Women Perceive as Attractive and What Men Consider Attractive.

    Science.gov (United States)

    Muñoz-Reyes, José Antonio; Iglesias-Julios, Marta; Pita, Miguel; Turiegano, Enrique

    2015-01-01

    Attractiveness plays an important role in social exchange and in the ability to attract potential mates, especially for women. Several facial traits have been described as reliable indicators of attractiveness in women, but very few studies consider the influence of several measurements simultaneously. In addition, most studies consider just one of two assessments to directly measure attractiveness: either self-evaluation or men's ratings. We explored the relationship between these two estimators of attractiveness and a set of facial traits in a sample of 266 young Spanish women. These traits are: facial fluctuating asymmetry, facial averageness, facial sexual dimorphism, and facial maturity. We made use of the advantage of having recently developed methodologies that enabled us to measure these variables in real faces. We also controlled for three other widely used variables: age, body mass index and waist-to-hip ratio. The inclusion of many different variables allowed us to detect any possible interaction between the features described that could affect attractiveness perception. Our results show that facial fluctuating asymmetry is related both to self-perceived and male-rated attractiveness. Other facial traits are related only to one direct attractiveness measurement: facial averageness and facial maturity only affect men's ratings. Unmodified faces are closer to natural stimuli than are manipulated photographs, and therefore our results support the importance of employing unmodified faces to analyse the factors affecting attractiveness. We also discuss the relatively low equivalence between self-perceived and male-rated attractiveness and how various anthropometric traits are relevant to them in different ways. Finally, we highlight the need to perform integrated-variable studies to fully understand female attractiveness.

  15. Facial Features: What Women Perceive as Attractive and What Men Consider Attractive.

    Directory of Open Access Journals (Sweden)

    José Antonio Muñoz-Reyes

    Full Text Available Attractiveness plays an important role in social exchange and in the ability to attract potential mates, especially for women. Several facial traits have been described as reliable indicators of attractiveness in women, but very few studies consider the influence of several measurements simultaneously. In addition, most studies consider just one of two assessments to directly measure attractiveness: either self-evaluation or men's ratings. We explored the relationship between these two estimators of attractiveness and a set of facial traits in a sample of 266 young Spanish women. These traits are: facial fluctuating asymmetry, facial averageness, facial sexual dimorphism, and facial maturity. We made use of the advantage of having recently developed methodologies that enabled us to measure these variables in real faces. We also controlled for three other widely used variables: age, body mass index and waist-to-hip ratio. The inclusion of many different variables allowed us to detect any possible interaction between the features described that could affect attractiveness perception. Our results show that facial fluctuating asymmetry is related both to self-perceived and male-rated attractiveness. Other facial traits are related only to one direct attractiveness measurement: facial averageness and facial maturity only affect men's ratings. Unmodified faces are closer to natural stimuli than are manipulated photographs, and therefore our results support the importance of employing unmodified faces to analyse the factors affecting attractiveness. We also discuss the relatively low equivalence between self-perceived and male-rated attractiveness and how various anthropometric traits are relevant to them in different ways. Finally, we highlight the need to perform integrated-variable studies to fully understand female attractiveness.

  16. Statistical Physics: Third Tohwa University International Conference. AIP Conference Proceedings No. 519 [ACPCS

    Energy Technology Data Exchange (ETDEWEB)

    Tokuyama, M.; Stanley, H.E. [eds.

    2000-12-01

    The main purpose of the Tohwa University International Conference on Statistical Physics is to provide an opportunity for an international group of experimentalists, theoreticians, and computational scientists who are working on various fields of statistical physics to gather together and discuss their recent advances. The conference covered six topics: complex systems, general methods of statistical physics, biological physics, cross-disciplinary physics, information science, and econophysics.

  17. PREFACE: XXIX International Conference on Photonic, Electronic, and Atomic Collisions (ICPEAC2015)

    Science.gov (United States)

    Díaz, C.; Rabadán, I.; García, G.; Méndez, L.; Martín, F.

    2015-09-01

    The 29th International Conference on Photonic, Electronic and Atomic Collisions (XXIX ICPEAC) was held at the Palacio de Congresos ''El Greco'', Toledo, Spain, on 22-28 July, 2015, and was organized by the Universidad Autónoma de Madrid (UAM) and the Consejo Superior de Investigaciones Científicas (CSIC). ICPEAC is held biannually and is one of the most important international conferences on atomic and molecular physics. The topic of the conference covers the recent progresses in photonic, electronic, and atomic collisions with matter. With a history back to 1958, ICPEAC came to Spain in 2015 for the very first time. UAM and CSIC had been preparing the conference for six years, ever since the ICPEAC International General Committee made the decision to hold the XXIX ICPEAC in Toledo. The conference gathered 670 participants from 52 countries and attracted 854 contributed papers for presentation in poster sessions. Among the latter, 754 are presented in issues 2-12 of this volume of the Journal of Physics Conference Series. In addition, five plenary lectures, including the opening one by the Nobel laureate Prof. Ahmed H. Zewail and the lectures by Prof. Maciej Lewenstein, Prof. Paul Scheier, Prof. Philip H. Bucksbaum, and Prof. Stephen J. Buckman, 62 progress reports and 26 special reports were presented following the decision of the ICPEAC International General Committee. Detailed write-ups of most of the latter are presented in issue 1 of this volume, constituting a comprehensive tangible record of the meeting. On the occasion of the International Year of Light (IYL2015) and with the support of the Fundación Española para la Ciencia y la Tecnología (FECYT), the program was completed with two public lectures delivered by the Nobel laureate Prof. Serge Haroche and the Príncipe de Asturias laureate Prof. Pedro M. Echenique on, respectively, ''Fifty years of laser revolutions in physics'rquot; and ''The sublime usefulness of useless science''. Also a

  18. The learning conference

    DEFF Research Database (Denmark)

    Ravn, Ib

    The typical one-day conference attended by managers or professionals in search of inspiration is packed with PowerPoint presentations and offers little opportunity for involvement or knowledge sharing. Behind the conventional conference format lurks the transfer model of learning, which finds...... little support amongst serious students of learning. The professional conference as a forum for knowledge sharing is in dire need of a new learning theory and a more enlightened practice. The notion of human flourishing is offered as basis for theory, and four simple design principles for the so......-called “learning conference” are proposed: People go to conferences to 1. get concise input, 2. interpret it in the light of their ongoing concerns, 3. talk about their current projects and 4. meet the other attendees and be inspired by them. Six practical techniques that induce attendees to do these things...

  19. Statewide Professional Development Conference

    Directory of Open Access Journals (Sweden)

    Paul V. Bredeson

    2000-02-01

    Full Text Available In an environment increasingly skeptical of the effectiveness of large-scale professional development activities, this study examines K-12 educators' reasons for participating and beliefs in the utility in a large-scale professional development conference. Pre- and post-conference surveys revealed that while financial support played a significant role in educators' ability to participate, they were drawn to the conference by the promise to learn substantive issues related to, in this case, performance assessment—what it means, how to implement it, and how to address community concerns. In spite of the conference's utility as a means to increase awareness of critical issues and to facilitate formal and informal learning, well conceived linkages to transfer new knowledge to the school and classroom were lacking.

  20. Tackling conference carbon footprints

    Science.gov (United States)

    Grozier, Jim

    2016-12-01

    In reply to Margaret Harris's Lateral Thoughts article "Putting my foot down", which discussed the challenges of attending a conference with a physical disability (October p76) and a subsequent letter by Anna Wood (November p18).

  1. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  2. Ranking Operations Management Conferences

    NARCIS (Netherlands)

    Steenhuis, Harm-Jan; Bruijn, de Erik Joost; Gupta, Sushil; Laptaned, U.

    2007-01-01

    Several publications have appeared in the field of Operations Management which rank Operations Management related journals. Several ranking systems exist for journals based on , for example, perceived relevance and quality, citation, and author affiliation. Many academics also publish at conferences

  3. EVOLVE 2014 International Conference

    CERN Document Server

    Tantar, Emilia; Sun, Jian-Qiao; Zhang, Wei; Ding, Qian; Schütze, Oliver; Emmerich, Michael; Legrand, Pierrick; Moral, Pierre; Coello, Carlos

    2014-01-01

    This volume encloses research articles that were presented at the EVOLVE 2014 International Conference in Beijing, China, July 1–4, 2014.The book gathers contributions that emerged from the conference tracks, ranging from probability to set oriented numerics and evolutionary computation; all complemented by the bridging purpose of the conference, e.g. Complex Networks and Landscape Analysis, or by the more application oriented perspective. The novelty of the volume, when considering the EVOLVE series, comes from targeting also the practitioner’s view. This is supported by the Machine Learning Applied to Networks and Practical Aspects of Evolutionary Algorithms tracks, providing surveys on new application areas, as in the networking area and useful insights in the development of evolutionary techniques, from a practitioner’s perspective. Complementary to these directions, the conference tracks supporting the volume, follow on the individual advancements of the subareas constituting the scope of the confe...

  4. Physical Attractiveness, Attitude Similarity, and Length of Acquaintance as Contributors to Interpersonal Attraction Among Adolescents

    Science.gov (United States)

    Cavior, Norman; And Others

    1975-01-01

    Tenth and twelfth grade males and females who knew each other judged, within grade levels, their classmates on physical attractiveness (PA), perceived attitude similarity (PAS), and interpersonal attraction (IA). Regression analyses supported the hypotheses that PA and PAS are positively correlated. (Author)

  5. Effects of Perceived Attractiveness and Sex-Role Interests on Interpersonal Attraction.

    Science.gov (United States)

    Thornton, Billy; Linnstaedter, LaNelle

    Subjects (40 male, 40 female) viewed a videotaped "interview" with a competent female stimulus person (SP) who appeared to be sex-role congruent or incongruent and was either physically attractive or unattractive. Interpersonal attraction (Likability) was assessed by objective questionnaires. Subjects' sex and attitudes toward women were included…

  6. The Effects of Physical Attractiveness and Anxiety on Heterosexual Attraction Over a Series of Five Encounters

    Science.gov (United States)

    Mathes, Eugene W.

    1975-01-01

    The "information availability model" of heterosexual attraction was tested by having subjects go on a series of five encounters. It was found that both physical attractiveness and the personality variable, anxiety, had early and continuous effects on liking. It was concluded the model is an inadequate explanation of heterosexual…

  7. Physical Attractiveness, Attitude Similarity, and Length of Acquaintance as Contributors to Interpersonal Attraction Among Adolescents

    Science.gov (United States)

    Cavior, Norman; And Others

    1975-01-01

    Tenth and twelfth grade males and females who knew each other judged, within grade levels, their classmates on physical attractiveness (PA), perceived attitude similarity (PAS), and interpersonal attraction (IA). Regression analyses supported the hypotheses that PA and PAS are positively correlated. (Author)

  8. Multiphoton processes: conference proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Lambropoulos, P.; Smith, S.J. (eds.)

    1984-01-01

    The chapters of this volume represent the invited papers delivered at the conference. They are arranged according to thermatic proximity beginning with atoms and continuing with molecules and surfaces. Section headings include multiphoton processes in atoms, field fluctuations and collisions in multiphoton process, and multiphoton processes in molecules and surfaces. Abstracts of individual items from the conference were prepared separately for the data base. (GHT)

  9. 2nd SUMO Conference

    CERN Document Server

    Weber, Melanie

    2015-01-01

    This contributed volume contains the conference proceedings of the Simulation of Urban Mobility (SUMO) conference 2014, Berlin. The included research papers cover a wide range of topics in traffic planning and simulation, including open data, vehicular communication, e-mobility, urban mobility, multimodal traffic as well as usage approaches. The target audience primarily comprises researchers and experts in the field, but the book may also be beneficial for graduate students.  

  10. Understanding talent attraction: The influence of financial rewards elements on perceived job attractiveness

    Directory of Open Access Journals (Sweden)

    Anton Schlechter

    2014-02-01

    Full Text Available Orientation: In order to attract knowledge workers and maintain a competitive advantage,it is necessary for organisations to understand how knowledge workers are attracted todifferent types and levels of financial rewards.Research purpose: This research investigated a set of financial reward elements (remuneration, employee benefits and variable pay to determine whether knowledgeworkers perceived them as attractive inducements when considering a job or position.Motivation for the study: In South Africa there is a shortage of talent, largely due to highrates of emigration of scarce skills (human capital. Financial rewards or inducementsare necessary to attract talent and it is essential to assess which of these rewards are mostsuccessful in this regard.Method: A 23 full-factorial experimental design (field experiment was used. The threefinancial reward elements (remuneration, employee benefits and variable pay weremanipulated in a fictitious job advertisement (each at two levels. Eight (2 × 2 × 2 = 8 differentversions of a job advertisement were used as a stimulus to determine the effect of financialreward elements on perceived job attractiveness. A questionnaire was used to measure howparticipants perceived the attractiveness of the job. A convenience sampling approach wasused. Different organisations throughout South Africa, as well as corporate members of the South African Reward Association, were asked to participate in the study. Respondents (n = 169 were randomly assigned to the various experimental conditions (i.e. one of the eightadvertisements. Data were analysed using descriptive statistics. A full-factorial analysis ofvariance was used to investigate if significant main effects could be found.Main findings: Participants considered high levels of remuneration, the inclusion ofbenefits and variable pay to be significant job attraction factors within a reward package. Remuneration was found to have the largest main effect on job

  11. Conference scene: DGVS spring conference 2009.

    Science.gov (United States)

    Kolligs, Frank Thomas

    2009-10-01

    The 3rd annual DGVS Spring Conference of the German Society for Gastroenterology (Deutsche Gesellschaft für Verdauungs- und Stoffwechselkrankheiten) was held at the Seminaris Campus Hotel in Berlin, Germany, on 8-9 May, 2009. The conference was organized by Roland Schmid and Matthias Ebert from the Technical University of Munich, Germany. The central theme of the meeting was 'translational gastrointestinal oncology: towards personalized medicine and individualized therapy'. The conference covered talks on markers for diagnosis, screening and surveillance of colorectal cancer, targets for molecular therapy, response prediction in clinical oncology, development and integration of molecular imaging in gastrointestinal oncology and translational research in clinical trial design. Owing to the broad array of topics and limitations of space, this article will focus on biomarkers, response prediction and the integration of biomarkers into clinical trials. Presentations mentioned in this summary were given by Matthias Ebert (Technical University of Munich, Germany), Esmeralda Heiden (Epigenomics, Berlin, Germany), Frank Kolligs (University of Munich, Germany), Florian Lordick (University of Heidelberg, Germany), Hans Jorgen Nielsen (University of Copenhagen, Denmark), Anke Reinacher-Schick (University of Bochum, Germany), Christoph Röcken (University of Berlin, Germany), Wolff Schmiegel (University of Bochum, Germany) and Thomas Seufferlein (University of Halle, Germany).

  12. Conference Report: The BPS Annual Conference 2004

    Directory of Open Access Journals (Sweden)

    Irina Roncaglia

    2004-05-01

    Full Text Available In this article I will review four papers presented at the British Psychological Society Annual Conference held this year in London held over a 3 day period. The Conference included a variety of scientific presentations and discussions through symposia, roundtable discussions, single papers and poster sessions. Although numerous papers took an experimental approach, few applied any type of qualitative methodology. The topics covered within the different psychological disciplines spanned from early childhood through old age; I have chosen four papers that covered a life course perspective and took into consideration clinical issues as well. The first paper discusses a grounded theory approach used to analyse a play therapy session between therapist and child. The second review reports some recent findings in the way the brains of people on the autistic spectrum disorder might function. The third paper discusses positive psychology and how such an emerging movement has influenced new research in the field. The last paper reviewed will discuss the issue of the ageing process, and I will present some arguments related to the useful application of qualitative methodologies within this area of research. In conclusion, I will highlight some personal reflections on the Conference and the need for a greater balance between qualitative and quantitative methodologies to be used in collaboration rather than as antagonists. URN: urn:nbn:de:0114-fqs0402176

  13. Business Partnerships: Sex and Attractiveness Stereotypes.

    Science.gov (United States)

    Kushner, T.

    1982-01-01

    Examined the preference for men over women as business partners in three studies. Results showed that both men and women tended to use masculine names when naming imaginary partners, and chose attractive males most and unattractive females least when choosing imaginary partners from photographs. (WAS)

  14. The Attractive Character of Jane Eyre

    Institute of Scientific and Technical Information of China (English)

    车婧瑜; 郭文睿

    2008-01-01

    Jane Eyre,written by Charlotte Bront(e),is a story of the heroine's struggle for independent personality and perfect love.Viewed as a classic work of English literature,the author of Jane Eyre makes it valuable and popular by creating a kind of Hew imagination.This paper argues for Jane's attractive character through her life experience.

  15. Restricted total stability and total attractivity

    Directory of Open Access Journals (Sweden)

    Giuseppe Zappala'

    2006-08-01

    Full Text Available In this paper the new concepts of restricted total stability and total attractivity is formulated. For this purpose the classical theory of Malkin with suitable changes and the theory of limiting equations, introduced by Sell developed by Artstein and Andreev, are used. Significant examples are presented.

  16. Male and Female Perception of Physical Attractiveness

    Directory of Open Access Journals (Sweden)

    Ray Garza

    2016-02-01

    Full Text Available Waist-to-hip ratio (WHR and breast size are morphological traits that are associated with female attractiveness. Previous studies using line drawings of women have shown that men across cultures rate low WHRs (0.6 and 0.7 as most attractive. In this study, we used additional viewing measurements (i.e., first fixation duration and visual regressions to measure visual attention and record how long participants first focused on the female body and whether they regressed back to an area of interest. Additionally, we manipulated skin tone to determine whether they preferred light- or dark-skinned women. In two eye tracking experiments, participants rated the attractiveness of female nude images varying in WHR (0.5–0.9, breast size, and skin tone. We measured first fixation duration, gaze duration, and total time. The overall results of both studies revealed that visual attention fell mostly on the face, the breasts, and the midriff of the female body, supporting the evolutionary view that reproductively relevant regions of the female body are important to female attractiveness. Because the stimuli varied in skin tone and the participants were mainly Hispanic of Mexican American descent, the findings from these studies also support a preference for low WHRs and reproductively relevant regions of the female body.

  17. Living in Shenzhen: attractive for creatives?

    NARCIS (Netherlands)

    Bontje, M.

    2014-01-01

    Like many cities across the globe, Shenzhen is attempting to redevelop itself as a ‘creative city’. This policy concept can mean different things to different people. Strategies aiming at becoming a ‘creative city’ refer to attracting and developing cultural and creative industries like

  18. Cultured skin microbiota attracts malaria mosquitoes

    NARCIS (Netherlands)

    Verhulst, N.O.; Beijleveld, H.; Knols, B.G.J.; Takken, W.; Schraa, G.; Bouwmeester, H.J.; Smallegange, R.C.

    2009-01-01

    Background - Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human

  19. Vortex attraction and the formation of sunspots

    Science.gov (United States)

    Parker, E. N.

    1992-01-01

    A downdraft vortex ring in a stratified atmosphere exhibits universal attraction for nearby vertical magnetic flux bundles. It is speculated that the magnetic fields emerging through the surface of the sun are individually encircled by one or more subsurface vortex rings, providing an important part of the observed clustering of magnetic fibrils to form pores and sunspots.

  20. Agreement Attraction in Comprehension: Representations and Processes

    Science.gov (United States)

    Wagers, Matthew W.; Lau, Ellen F.; Phillips, Colin

    2009-01-01

    Much work has demonstrated so-called attraction errors in the production of subject-verb agreement (e.g., "The key to the cabinets are on the table", [Bock, J. K., & Miller, C. A. (1991). "Broken agreement." "Cognitive Psychology, 23", 45-93]), in which a verb erroneously agrees with an intervening noun. Six self-paced reading experiments examined…

  1. Attraction of nonlocal dark optical solitons

    DEFF Research Database (Denmark)

    Nikolov, Nikola Ivanov; Neshev, Dragomir; Krolikowski, Wieslaw

    2004-01-01

    We study the formation and interaction of spatial dark optical solitons in materials with a nonlocal nonlinear response. We show that unlike in local materials, where dark solitons typically repel, the nonlocal nonlinearity leads to a long-range attraction and formation of stable bound states...... of dark solitons. (C) 2004 Optical Society of America...

  2. Living in Shenzhen: attractive for creatives?

    NARCIS (Netherlands)

    M. Bontje

    2014-01-01

    Like many cities across the globe, Shenzhen is attempting to redevelop itself as a ‘creative city’. This policy concept can mean different things to different people. Strategies aiming at becoming a ‘creative city’ refer to attracting and developing cultural and creative industries like architecture

  3. Modeling Multiple Risks: Hidden Domain of Attraction

    CERN Document Server

    Mitra, Abhimanyu

    2011-01-01

    Hidden regular variation is a sub-model of multivariate regular variation and facilitates accurate estimation of joint tail probabilities. We generalize the model of hidden regular variation to what we call hidden domain of attraction. We exhibit examples that illustrate the need for a more general model and discuss detection and estimation techniques.

  4. The International Scientific Conference on Probiotics and Prebiotics.

    Science.gov (United States)

    Madsen, Karen

    2011-10-01

    The 5th International Scientific Conference on Probiotics and Prebiotics was held in the Doubletree Hotel in Kosice, Slovakia, and highlighted current advances in the research and use of probiotics and prebiotics in both animal and human health. The conference attracted academic and industry representatives from over 35 countries and facilitated networking between research scientists and industry. A poster session was on display throughout the entire meeting. Over the course of the 3-day symposium, 12 sessions addressed issues related to the use of probiotics and prebiotics in the prevention and treatment of chronic and infectious diseases, their effects on host immune function and how they may modulate existing gut microbes.

  5. Cultured skin microbiota attracts malaria mosquitoes

    Directory of Open Access Journals (Sweden)

    Takken Willem

    2009-12-01

    Full Text Available Abstract Background Host-seeking of the African malaria mosquito, Anopheles gambiae sensu stricto, is guided by human odours. The precise nature of the odours, and the composition of attractive blends of volatiles, remains largely unknown. Skin microbiota plays an important role in the production of human body odours. It is hypothesized that host attractiveness and selection of An. gambiae is affected by the species composition, density, and metabolic activity of the skin microbiota. A study is presented in which the production and constituency of volatile organic compounds (VOCs by human skin microbiota is examined and the behavioural responses of An. gambiae to VOCs from skin microbiota are investigated. Methods Blood agar plates incubated with skin microbiota from human feet or with a reference strain of Staphylococcus epidermidis were tested for their attractiveness to An. gambiae in olfactometer bioassays and indoor trapping experiments. Entrained air collected from blood agar plates incubated with natural skin microbiota or with S. epidermidis were analysed using GC-MS. A synthetic blend of the compounds identified was tested for its attractiveness to An. gambiae. Behavioural data were analysed by a χ2-test and GLM. GC-MS results were analysed by fitting an exponential regression line to test the effect of the concentration of bacteria. Results More An. gambiae were caught with blood agar plates incubated with skin bacteria than with sterile blood agar plates, with a significant effect of incubation time and dilution of the skin microbiota. When bacteria from the feet of four other volunteers were tested, similar effects were found. Fourteen putative attractants were found in the headspace of the skin bacteria. A synthetic blend of 10 of these was attractive to An. gambiae. Conclusions The discovery that volatiles produced by human skin microorganisms in vitro mediate An. gambiae host-seeking behaviour creates new opportunities for the

  6. 16th international conference on the physics of highly charged ions

    Science.gov (United States)

    Fritzsche, Stephan; Stöhlker, Thomas; Surzhykov, Andrey

    2013-09-01

    physicists. The conference was held in the Physics Lecture Hall at the New Campus of Heidelberg University. On the evening of 2 September, the day before the opening of HCI 2012, all participants were welcomed warmly at the foyer of this lecture hall, whose decorative glass front provides a view upon artificial ponds and water lilies at this time of the year. For many colleagues and delegates, this evening offered a hearty re-encounter with each other, along with wine and other beverages. The conference then opened on the morning of 3 September, and an exciting program was organized by the local committee with the help of the International Advisory Board, including 5 invited talks, 10 progress reports as well as 26 selected talks. In addition, more than 230 posters were presented in two sessions, with beer and brezels aside. On Tuesday evening, an exciting public lecture on Heavy ions in therapy and space was given by Marco Durante from the GSI Helmholtz Center and Technical University in Darmstadt. Moreover, many of the participants joined the guided tour through the old city of Heidelberg with its famous (ruins of the) castle, and several the Solar Boat Trip. On Thursday night, we all enjoyed the conference dinner with home-brewed beer and regional specialties at the 'Kulturbrauerei' in the historic center of Heidelberg. Finally, scientific tours were also organized to GSI Darmstadt and the Max-Planck Institute for Nuclear Physics in Heidelberg on the last day of the conference, and attracted much consideration. We here present the proceedings of this conference that contain a total of 104 contributions, including invited papers, progress reports and contributed papers. As previously, these papers are grouped into five categories. (1) Fundamental aspects, structure and spectroscopy. (2) Collisions with electrons, ions, atoms and molecules. (3) Interactions with clusters, surfaces and solids. (4) Interactions with photons, plasmas and strong field processes. (5) Production

  7. 2012 Gordon Research Conference, Organometallic Chemistry, 8-13 2012

    Energy Technology Data Exchange (ETDEWEB)

    Hillhouse, Gregory [Univ. of Chicago, IL (United States)

    2012-07-13

    The 2012 Organometallic Chemistry Gordon Research Conference will highlight new basic science and fundamental applications of organometallic chemistry in industrial, academic, and national lab settings. Scientific themes of the conference will include chemical synthesis, reactivity, catalysis, polymer chemistry, bonding, and theory that involve transition-metal (and main-group) interactions with organic moieties.

  8. Egypt Aiming at Attracting Investment from China

    Institute of Scientific and Technical Information of China (English)

    Audrey GUO

    2009-01-01

    @@ Jointly with China Economic & Trade Counselor Office in Egypt,the General Authority for Investment (GAFI) and the General Authority for Special Economic Zone North-West Gulf of Suez (SEZone) held China-Africa Development Fund Conference in Cairo,Egypt on March 16,2009.The Minister of Investment Egypt Dr.Mahmoud Mohieldin,Chinese Ambassador to Egypt Mr.Wu Chunhua,Chairman of GAFI and SEZone Mr.Assem Ragab,Vice President of China-Africa Development Fund Mr.Lu Qingchen,Economic and Trade Minister Counselor of the Chinese Embassy in Egypt Mr.Cao Jiachang,as well as over 100 Chinese/Egyptian businessmen attended the conference.

  9. Same-sex attraction in a birth cohort: prevalence and persistence in early adulthood.

    Science.gov (United States)

    Dickson, Nigel; Paul, Charlotte; Herbison, Peter

    2003-04-01

    There is a continuing debate about the importance of social versus biological factors in the expression of same-sex attraction. Investigation of prevalence, continuities, and changes over time among young adults growing up in a country with a relatively accepting climate to homosexuality is likely to illuminate this debate. Analyses were therefore undertaken of self-reported same-sex attraction at age 21 and 26, in a cohort of about 1000 people born in 1972/3 in one New Zealand city. Participants were also asked about same-sex behaviour and attitudes to same-sex relationships. By age 26, 10.7% of men and 24.5% of women reported being attracted to their own sex at some time. This dropped to 5.6% of men and 16.4% of women who reported some current same-sex attraction. Current attraction predominantly to their own sex or equally to both sexes (major attraction) was reported by 1.6% of men and 2.1% of women. Occasional same-sex attraction, but not major attraction, was more common among the most educated. Between age 21 and 26, slightly more men moved away from an exclusive heterosexual attraction (1.9% of all men) than moved towards it (1.0%), while for women, many more moved away (9.5%) than towards (1.3%) exclusive heterosexual attraction. These findings show that much same-sex attraction is not exclusive and is unstable in early adulthood, especially among women. The proportion of women reporting some same-sex attraction in New Zealand is high compared both to men, and to women in the UK and US. These observations, along with the variation with education, are consistent with a large role for the social environment in the acknowledgement of same-sex attraction. The smaller group with major same-sex attraction, which changed less over time, and did not differ by education, is consistent with a basic biological dimension to sexual attraction. Overall these findings argue against any single explanation for homosexual attraction.

  10. Importance of facial physical attractiveness of audiovisual models in descriptions and preferences of children and adolescents.

    Science.gov (United States)

    Ruiz, Cristina; Conde, Elena; Torres, Esteban

    2005-08-01

    We performed a cross-sectional study with three age groups (8, 14, and 17 years) to evaluate developmental differences in stereotyped beliefs about physical attractiveness and the value of this as perceived by the participants. Given the current importance of television in the development of social knowledge, television models were used. The children and adolescents were asked to evaluate, using bipolar open scales, the physical attractiveness, likeableness, generosity, intelligence, fun, and altruism of 12 television models of both sexes, previously selected by judges, as well as the desire to resemble or feel close to the models. Analysis showed developmental differences across age groups both in the concept of physical attractiveness and in stereotyped beliefs about this. As in other areas of social knowledge, the younger children's responses were bipolar, global, and much more stereotyped, while the adolescents introduced subtle distinctions and elaborated their responses. Nevertheless, physical attractiveness appeared a desirable characteristic for all age groups.

  11. Cross-cultural agreement in facial attractiveness preferences: the role of ethnicity and gender.

    Directory of Open Access Journals (Sweden)

    Vinet Coetzee

    Full Text Available Previous work showed high agreement in facial attractiveness preferences within and across cultures. The aims of the current study were twofold. First, we tested cross-cultural agreement in the attractiveness judgements of White Scottish and Black South African students for own- and other-ethnicity faces. Results showed significant agreement between White Scottish and Black South African observers' attractiveness judgements, providing further evidence of strong cross-cultural agreement in facial attractiveness preferences. Second, we tested whether cross-cultural agreement is influenced by the ethnicity and/or the gender of the target group. White Scottish and Black South African observers showed significantly higher agreement for Scottish than for African faces, presumably because both groups are familiar with White European facial features, but the Scottish group are less familiar with Black African facial features. Further work investigating this discordance in cross-cultural attractiveness preferences for African faces show that Black South African observers rely more heavily on colour cues when judging African female faces for attractiveness, while White Scottish observers rely more heavily on shape cues. Results also show higher cross-cultural agreement for female, compared to male faces, albeit not significantly higher. The findings shed new light on the factors that influence cross-cultural agreement in attractiveness preferences.

  12. Self-assessment of attractiveness of persons with body decoration.

    Science.gov (United States)

    Kozieł, S; Sitek, A

    2013-08-01

    Tattoos and body piercing are forms of body decoration that have been known for ages. The use of such ornamentation is becoming more and more common. Researchers attempt to explain the meaning of this phenomenon within the discipline of behavioural ecology, attributing a sexual selection aspect to body decoration, and thus interpreting it in an evolutionary sense. The hypothesis that superior biological quality of individuals is indicated by body modification is becoming more and more popular. In the present study, this hypothesis is tested on the basis of physical attractiveness as an indicator of genotype quality. The total of 64 males and 52 females with tattoos and body piercings were subjected to tests consisting of the self-assessment of the attractiveness of their bodies. The control group comprised 86 subjects (38 males and 48 females) without body decoration. The results confirm that both women and men with body decoration assess the attractiveness of different parts of their bodies higher (regardless whether the decoration is located there or not) than people without tattoos and body piercing. Thus, the hypothesis has been confirmed that body decoration is a signal of superior biological quality of individuals. Copyright © 2013 Elsevier GmbH. All rights reserved.

  13. You are what you eat: within-subject increases in fruit and vegetable consumption confer beneficial skin-color changes.

    Directory of Open Access Journals (Sweden)

    Ross D Whitehead

    Full Text Available BACKGROUND: Fruit and vegetable consumption and ingestion of carotenoids have been found to be associated with human skin-color (yellowness in a recent cross-sectional study. This carotenoid-based coloration contributes beneficially to the appearance of health in humans and is held to be a sexually selected cue of condition in other species. METHODOLOGY AND PRINCIPAL FINDINGS: Here we investigate the effects of fruit and vegetable consumption on skin-color longitudinally to determine the magnitude and duration of diet change required to change skin-color perceptibly. Diet and skin-color were recorded at baseline and after three and six weeks, in a group of 35 individuals who were without makeup, self-tanning agents and/or recent intensive UV exposure. Six-week changes in fruit and vegetable consumption were significantly correlated with changes in skin redness and yellowness over this period, and diet-linked skin reflectance changes were significantly associated with the spectral absorption of carotenoids and not melanin. We also used psychophysical methods to investigate the minimum color change required to confer perceptibly healthier and more attractive skin-coloration. Modest dietary changes are required to enhance apparent health (2.91 portions per day and attractiveness (3.30 portions. CONCLUSIONS: Increased fruit and vegetable consumption confers measurable and perceptibly beneficial effects on Caucasian skin appearance within six weeks. This effect could potentially be used as a motivational tool in dietary intervention.

  14. Intensity of smiling and attractiveness as facial signals of trustworthiness in women.

    Science.gov (United States)

    Schmidt, K; Levenstein, R; Ambadar, Z

    2012-06-01

    Facial attractiveness is associated with a variety of positive social characteristics including trustworthiness. Variations in smiling, such as the appearance of the Duchenne marker and increased intensity of expression, have likewise been linked with positive judgments of trustworthiness. The study investigated the interaction of the effects of models' attractiveness and their smiling intensity on impressions of perceived trustworthiness. Participants rated the attractiveness and expressivity of neutral, low intensity, and high intensity smiling images of 45 women models. These images were also presented to a second group of participants who rated trustworthiness. Repeated measures analysis of covariance of the effects of attractiveness and manipulated smile intensity on trustworthiness indicated a main effect for smile intensity: increased smile intensity was associated with greater trustworthiness. Attractiveness also contributed to rated trustworthiness independently of smiling intensity. Results suggested there is an additional contribution of facial expression in creating social impressions of trustworthiness.

  15. 2010 Membranes: Materials & Processes Gordon Research Conference

    Energy Technology Data Exchange (ETDEWEB)

    Jerry Lin

    2010-07-30

    The GRC series on Membranes: Materials and Processes have gained significant international recognition, attracting leading experts on membranes and other related areas from around the world. It is now known for being an interdisciplinary and synergistic meeting. The next summer's edition will keep with the past tradition and include new, exciting aspects of material science, chemistry, chemical engineering, computer simulation with participants from academia, industry and national laboratories. This edition will focus on cutting edge topics of membranes for addressing several grand challenges facing our society, in particular, energy, water, health and more generally sustainability. During the technical program, we want to discuss new membrane structure and characterization techniques, the role of advanced membranes and membrane-based processes in sustainability/environment (including carbon dioxide capture), membranes in water processes, and membranes for biological and life support applications. As usual, the informal nature of the meeting, excellent quality of the oral presentations and posters, and ample opportunity to meet many outstanding colleagues make this an excellent conference for established scientists as well as for students. A Gordon Research Seminar (GRS) on the weekend prior to the GRC meeting will provide young researchers an opportunity to present their work and network with outstanding experts. It will also be a right warm-up for the conference participants to join and enjoy the main conference.

  16. Future-Search Conferences at Cornell University

    Science.gov (United States)

    Warzynski, Chester C.

    2004-01-01

    A future-search conference is a participatory planning and decision-making process in which a group of individuals with diverse perspectives come together; engage in a process of data collection, discussion, and learning; and decide on an appropriate course of action. The competencies, skills, and intellectual capital developed as part of this…

  17. The Fourth International Conference on Adult Education.

    Science.gov (United States)

    Prospects: Quarterly Review of Education, 1985

    1985-01-01

    Conference recommendations dealing with the following areas of adult education are presented: objectives and policies; needs of special groups; formal and non-formal sectors; the use of educational technologies; teacher training; illiteracy; international cooperation; development and research; and information dissemination. (RM)

  18. The perception of smile attractiveness among Saudi population

    Directory of Open Access Journals (Sweden)

    Mokhtar HA

    2015-01-01

    Full Text Available Hadeel A Mokhtar, Layla W Abuljadayel, Reem M Al-Ali, Mohammed Yousef Department of Operative Dentistry, Faculty of Dentistry, King Abdulaziz University, Jeddah, Saudi Arabia Abstract: Parameters of dental beauty change across time for varying reasons. Thus, an understanding of the factors that help or harm the attractiveness of a smile is an important step in creating attractive smiles. This study aimed to identify factors that affect smile perception and attractiveness among the Saudi population. A cross-sectional study was conducted among the Saudi population. Questionnaires were distributed to 130 dentists and final-year dental students, and to 130 laypersons. The questionnaire contained six smile photographs created by Photoshop® software. There was a statistically significant difference in scale ratings, based on participant background, for the “gummy: smile picture (P-value =0.003, diastema picture (P-value =0.000 and the “Reverse” smile picture (P-value =0.004. As for sex, males significantly underscored the gummy picture (P-value =0.009. Older people accepted the gummy smile less than did younger people, but diastema was considered as one of the variations that spoiled the attractiveness of the smile. “Dental background” participants significantly identified the ideal smile better than the “nondental” group. The perception of diastema as a sign of beauty among Saudi population in the past has definitely changed, according to the results of our study, where diastema and reverse smile received the lowest score in this survey. Keywords: diastema, gummy, reverse

  19. Properties of magnetically attractive experimental resin composites.

    Science.gov (United States)

    Hirano, S; Yasukawa, H; Nomoto, R; Moriyama, K; Hirasawa, T

    1996-12-01

    SUS444 stainless steel filled chemically cured resin composites that can attract magnet were fabricated. The filler was treated with various concentrations of silane. The experimental composite was easy to handle and showed a good shelf life. The maximal properties obtained are as follows; The attraction force to a magnetic attachment was 1/3-1/4 lower than the commercially available magnet-keeper system for dental magnetic attachment. Flexural strength and Knoop hardness of the composite were 76MPa (7.7 kgf/mm2) and 64 KHN. These values were lower than the commercially available chemically cured composite used as a reference. Eluted metal from the composite in 1% lactic acid solution for 7 days showed 0.7 mg/cm2, but in 0.9% NaCl solution for 7 days, it could not be detected.

  20. Service Packages – Attractiveness Has Many Faces

    Directory of Open Access Journals (Sweden)

    Ilona Bondos

    2016-01-01

    Full Text Available This article is an attempt to identify the impact of the customer age (especially the Baby boomers generation and the X and the Y generation on the assessment of incentives to buy service package. Belonging to different age generations seems to be important for the effectiveness of service packages sales – the entrance by the consumers in subsequent phases of the life cycle is related to their perception of the market offer. The starting point for the empirical part of the article was to analyze the different average scores attractiveness of the ten packages service features (incentives to purchase. Then, using multidimensional scaling authors determined the similarity or dissimilarity data on a set of applied incentives to use service packages. Visible differences indicate a different perception of the attractiveness of packages representatives of the Baby boomer generation and Y generation. Managerial implications and directions for future research are discussed.

  1. 2nd Bozeman Conference

    CERN Document Server

    Lund, John

    1991-01-01

    This volume contains a collection of papers delivered by the partici­ pants at the second Conference on Computation and Control held at Mon­ tana State University in Bozeman, Montana from August 1-7, 1990. The conference, as well as this proceedings, attests to the vitality and cohesion between the control theorist and the numerical analyst that was adver­ tised by the first Conference on Computation and Control in 1988. The proceedings of that initial conference was published by Birkhiiuser Boston as the first volume of this same series entitled Computation and Control, Proceedings of the Bozeman Conference, Bozeman, Montana, 1988. Control theory and numerical analysis are both, by their very nature, interdisciplinary subjects as evidenced by their interaction with other fields of mathematics and engineering. While it is clear that new control or es­ timation algorithms and new feedback design methodologies will need to be implemented computationally, it is likewise clear that new problems in computation...

  2. Experience-dependent modulation of the attraction to faeces in the kissing bug Triatoma infestans.

    Science.gov (United States)

    Mengoni, Sofía L; Lorenzo-Figueiras, Alicia N; Minoli, Sebastián A

    2016-11-11

    Triatoma infestans is the main vector of the Chagas disease in Latin America. These nocturnal bugs spend most of the daylight hours aggregated with conspecifics inside crevices in roofs and walls. Around the entrances of the shelters T. infestans deposits faeces that contain chemical cues that attract conspecifics. In this work we investigated whether attraction to faeces can be modulated by experience in this insect species. First, we analyzed if the attraction of nymphs to faeces is innate or acquired through previous sensory experiences. Results show that after hatching, 1st instar nymphs are attracted to faeces even if they had never been in contact with them before, thus indicating that this attraction is innate. Second, we studied if attraction to faeces can be influenced by the presence of con-specifics. No differences were found in the attraction to faeces of nymphs released alone or in groups, suggesting that attraction to faeces is independent of the presence of other individuals. Third, we examined if the innate response to faeces of nymphs can be modulated by experience. After pre-exposing nymphs to faeces during 24h, insects were no longer attracted to faeces. Finally, by pairing the presence of faeces with an aversive mechanical disturbance, nymphs switched from attraction to avoidance of faeces. These results show that although faeces attraction has a strong innate component, it can be modulated by experience. The learning and memory capacities of triatomines have been studied only recently, and our work is the first report on the effects of experience in the aggregation context.

  3. Iconicity and flagshipness of tourist attractions

    OpenAIRE

    Weidenfeld, Adi

    2010-01-01

    Major attractions (iconic or flagship) are considered as tools for economic development and as catalysts of urban regeneration, social change, and rebranding in urban and rural settings as they increase local appeal to visitors and quality of life for residents. Their impact has been often defined in the professional jargon as ‘effect’. This research note calls for further studies on the associated issues of definition, management strategies, social and environmental effects, as well as the d...

  4. Satisfaction with visit to tourism attractions

    OpenAIRE

    Navrátil, Josef; Pícha, Kamil; Navrátilová, Jana

    2012-01-01

    The aim of this study is to assess the impact of a several factors on satisfaction with a visit to water-based natural attractions. After reviewing relevant studies, it was hypothesized that satisfaction is influenced by push motivations, pull motivations, on-site experience, perceived quality and perceived values of visit. As a method of data reduction, the factor analysis based on principal component analysis was used for multi-item constructs (push motivations, pull motivations, on-site ex...

  5. Effective attraction between oscillating electrons in plasma

    CERN Document Server

    Dvornikov, Maxim

    2011-01-01

    We consider the effective interaction between electrons due to the exchange of virtual acoustic waves in low temperature plasma. Electrons are supposed to participate in rapid oscillations and form a spherically symmetric soliton like structure. We show that under certain conditions this effective interaction can result in the attraction between oscillating electrons and can be important for the dynamics of a plasmoid. Some possible applications of the obtained results to the theory of natural long lived plasma structures are also discussed.

  6. Visions for a sustainable world: A conference on science, technology and social responsibility. Conference report

    Energy Technology Data Exchange (ETDEWEB)

    1992-12-31

    This report summarizes the organization, activities, and outcomes of Student Pugwash USA`s 1992 International Conference, Visions for a Sustainable World: A Conference on Science, Technology and Social Responsibility. The conference was held June 14--20, 1992 at Emory University, and brought together 94 students and over 65 experts from industry, academe, and government. The conference addressed issues ranging from global environmental cooperation to the social impacts of the Human Genome Project to minority concerns in the sciences. It provided a valuable forum for talented students and professionals to engage in critical dialogue on many interdisciplinary issues at the juncture of science, technology and society. The conference challenged students -- the world`s future scientists, engineers, and political leaders -- to think broadly about global problems and to devise policy options that are viable and innovative. The success of the conference in stimulating interest, understanding, and enthusiasm about interdisciplinary global issues is clearly evident from both the participants` feedback and their continued involvement in Student Pugwash USA programs. Six working groups met each morning. The working group themes included: environmental challenges for developing countries; energy options: their social and environmental impact; health care in developing countries; changing dynamics of peace and global security; educating for the socially responsible use of technology; ethics and the use of genetic information. The conference was specifically designed to include mechanisms for ensuring its long-term impact. Participants were encouraged to focus on their individual role in helping resolve global issues. This was achieved through each participant`s development of a Personal Plan of Action, a plan which mapped out activities the student could undertake after the conference to continue the dialogue and work towards the resolution of global and local problems.

  7. The masculinity paradox: facial masculinity and beardedness interact to determine women's ratings of men's facial attractiveness.

    Science.gov (United States)

    Dixson, B J W; Sulikowski, D; Gouda-Vossos, A; Rantala, M J; Brooks, R C

    2016-11-01

    In many species, male secondary sexual traits have evolved via female choice as they confer indirect (i.e. genetic) benefits or direct benefits such as enhanced fertility or survival. In humans, the role of men's characteristically masculine androgen-dependent facial traits in determining men's attractiveness has presented an enduring paradox in studies of human mate preferences. Male-typical facial features such as a pronounced brow ridge and a more robust jawline may signal underlying health, whereas beards may signal men's age and masculine social dominance. However, masculine faces are judged as more attractive for short-term relationships over less masculine faces, whereas beards are judged as more attractive than clean-shaven faces for long-term relationships. Why such divergent effects occur between preferences for two sexually dimorphic traits remains unresolved. In this study, we used computer graphic manipulation to morph male faces varying in facial hair from clean-shaven, light stubble, heavy stubble and full beards to appear more (+25% and +50%) or less (-25% and -50%) masculine. Women (N = 8520) were assigned to treatments wherein they rated these stimuli for physical attractiveness in general, for a short-term liaison or a long-term relationship. Results showed a significant interaction between beardedness and masculinity on attractiveness ratings. Masculinized and, to an even greater extent, feminized faces were less attractive than unmanipulated faces when all were clean-shaven, and stubble and beards dampened the polarizing effects of extreme masculinity and femininity. Relationship context also had effects on ratings, with facial hair enhancing long-term, and not short-term, attractiveness. Effects of facial masculinization appear to have been due to small differences in the relative attractiveness of each masculinity level under the three treatment conditions and not to any change in the order of their attractiveness. Our findings suggest that

  8. The Attraction Effect in Information Visualization.

    Science.gov (United States)

    Dimara, Evanthia; Bezerianos, Anastasia; Dragicevic, Pierre

    2017-01-01

    The attraction effect is a well-studied cognitive bias in decision making research, where one's choice between two alternatives is influenced by the presence of an irrelevant (dominated) third alternative. We examine whether this cognitive bias, so far only tested with three alternatives and simple presentation formats such as numerical tables, text and pictures, also appears in visualizations. Since visualizations can be used to support decision making - e.g., when choosing a house to buy or an employee to hire - a systematic bias could have important implications. In a first crowdsource experiment, we indeed partially replicated the attraction effect with three alternatives presented as a numerical table, and observed similar effects when they were presented as a scatterplot. In a second experiment, we investigated if the effect extends to larger sets of alternatives, where the number of alternatives is too large for numerical tables to be practical. Our findings indicate that the bias persists for larger sets of alternatives presented as scatterplots. We discuss implications for future research on how to further study and possibly alleviate the attraction effect.

  9. Stochastic basins of attraction for metastable states.

    Science.gov (United States)

    Serdukova, Larissa; Zheng, Yayun; Duan, Jinqiao; Kurths, Jürgen

    2016-07-01

    Basin of attraction of a stable equilibrium point is an effective concept for stability analysis in deterministic systems; however, it does not contain information on the external perturbations that may affect it. Here we introduce the concept of stochastic basin of attraction (SBA) by incorporating a suitable probabilistic notion of basin. We define criteria for the size of the SBA based on the escape probability, which is one of the deterministic quantities that carry dynamical information and can be used to quantify dynamical behavior of the corresponding stochastic basin of attraction. SBA is an efficient tool to describe the metastable phenomena complementing the known exit time, escape probability, or relaxation time. Moreover, the geometric structure of SBA gives additional insight into the system's dynamical behavior, which is important for theoretical and practical reasons. This concept can be used not only in models with small noise intensity but also with noise whose amplitude is proportional or in general is a function of an order parameter. As an application of our main results, we analyze a three potential well system perturbed by two types of noise: Brownian motion and non-Gaussian α-stable Lévy motion. Our main conclusions are that the thermal fluctuations stabilize the metastable system with an asymmetric three-well potential but have the opposite effect for a symmetric one. For Lévy noise with larger jumps and lower jump frequencies ( α=0.5) metastability is enhanced for both symmetric and asymmetric potentials.

  10. Editorial: Special issue highlighting research presented at the 25th IWGO Conference, Chicago 2014

    Science.gov (United States)

    A joint international conference was held among corn insect entomologists from 15 countries at the Allerton Hotel, Chicago, Illinois on April 13-17, 2014. It combined the 25th IWGO (International Working Group on Ostrinia and other maize pests) Conference with the 4th Diabrotica Genetics Conference,...

  11. Introduction-2nd Fire Behavior and Fuels Conference: The fire environment-innovations, management, and policy

    Science.gov (United States)

    Wayne Cook; Bret W. Butler

    2007-01-01

    The 2nd Fire Behavior and Fuels Conference: Fire Environment -- Innovations, Management and Policy was held in Destin, FL, March 26-30, 2007. Following on the success of the 1st Fire Behavior and Fuels Conference, this conference was initiated in response to the needs of the National Wildfire Coordinating Group -- Fire Environment Working Team.

  12. BNAIC 2008, Proceedings 20th Belgian-Netherlands Conference on Artificial Intelligence

    NARCIS (Netherlands)

    Nijholt, Antinus; Pantic, Maja; Poel, Mannes; Hondorp, G.H.W.; Unknown, [Unknown

    2008-01-01

    This book contains the proceedings of the 20th edition of the Belgian-Netherlands Conference on Artificial Intelligence. The conference was organized by the Human Media Interaction group of the University of Twente. As usual, the conference was under the auspices of the Belgian-Dutch Association for

  13. Interpersonal attraction and personality: what is attractive--self similarity, ideal similarity, complementarity or attachment security?

    Science.gov (United States)

    Klohnen, Eva C; Luo, Shanhong

    2003-10-01

    Little is known about whether personality characteristics influence initial attraction. Because adult attachment differences influence a broad range of relationship processes, the authors examined their role in 3 experimental attraction studies. The authors tested four major attraction hypotheses--self similarity, ideal-self similarity, complementarity, and attachment security--and examined both actual and perceptual factors. Replicated analyses across samples, designs, and manipulations showed that actual security and self similarity predicted attraction. With regard to perceptual factors, ideal similarity, self similarity, and security all were significant predictors. Whereas perceptual ideal and self similarity had incremental predictive power, perceptual security's effects were subsumed by perceptual ideal similarity. Perceptual self similarity fully mediated actual attachment similarity effects, whereas ideal similarity was only a partial mediator.

  14. Evidence for the validity of the Children's Attraction to Physical Activity questionnaire (CAPA) with young children.

    Science.gov (United States)

    Rose, Elizabeth; Larkin, Dawne; Hands, Beth; Howard, Barbara; Parker, Helen

    2009-09-01

    Attraction to physical activity is important to an individual's intrinsic motivation to engage in play, games and sports. While there are instruments designed to measure attraction to physical activity in middle childhood years, the lack of authentic measures in young children has impeded research in this area. In this study we sought to address the validity of a scale to tap young children's attraction to physical activity. Evidence for validity was based on internal consistency, content analysis, and factor structure. Australian school children (180 boys and 154 girls) from school year two, aged 6-8 years, were individually administered a modified version of the Children's Attraction to Physical Activity Scale (CAPA) [Brustad RJ. Who will go out to play? Parental and psychological influences on children's attraction to physical activity. Pediatr Exerc Sci 1993;5:210-23; Brustad RJ. Attraction to physical activity in urban school children: parental socialization and gender influences. Res Q Exerc Sport 1996;67:316-23]. The results indicated that internal consistency was acceptable for most of the subscales when negative statements were excluded from the analyses. Factor analysis revealed that the liking of games and sports, liking of physical exertion and exercise, and the importance of exercise subscales were more robust. Second order factor analysis indicated that the overall construct of attraction to physical activity was viable in this age group. With some modifications, the scale appears to provide a valid approach to the measurement of attraction to physical activity in young children.

  15. The Petroleum Technology Conference. Success stories - and the road ahead

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    The conference comprises 16 presentations with sections on the petroleum research in Norway, achievements and potentials resulting from the Petromax and Demo 2000 programs, what makes technology attractive to the investors and the strategies of large investment companies, subsea developments and the implementation of advanced technology in view of the challenges of a maturing Norwegian shelf. 8 of the 16 papers have been indexed for the database (tk)

  16. PREFACE: The 16th International Conference on Positron Annihilation (ICPA-16)

    Science.gov (United States)

    Alam, Ashraf; Coleman, Paul; Dugdale, Stephen; Roussenova, Mina

    2013-06-01

    The 16th International Conference on Positron Annihilation (ICPA-16) was held at the University of Bristol, United Kingdom during 19-24 August, 2012. This triennial conference is the foremost gathering of the Positron Annihilation Physics community and it was hosted in the UK for the first time since the series of meetings first started back in 1965. The University of Bristol, the Alma Mater of Paul Dirac, is situated at the heart of the city, and it has established a worldwide reputation in research and teaching. Many of the topics which were discussed during ICPA-16 form an integral part of the research themes in the schools of Physics, Chemistry and Engineering of this University. ICPA-16 attracted a diverse audience, both from academic and industrial institutions, with over 200 participants from 29 countries. It continued the long held tradition of showcasing novel research in the field of positron annihilation and a total of 170 papers were presented as talks and posters. The papers reported studies of metallic and semi-conducting solids, polymers and soft matter, porous materials, surfaces and interfaces, as well as advances in experimental, analytical and biomedical applications. The high quality of the presented work, coupled with the enthusiastic exchange of ideas, provided an invaluable forum, especially for younger researchers and postgraduate students. The excellence of student presentations was acknowledged by the award of prizes for the best student posters, which were received by David Billington (University of Bristol, UK), Moussa Sidibe (CEMHTI, France) and Hongxia Xu (Tohoku University, Japan). All papers published in the Conference Proceedings were reviewed by ICPA-16 participants. We are indebted to all reviewers who contributed their time and intellectual resources, allowing the refereeing and editing process to move smoothly toward the compilation of the Proceedings. Our sincere thanks and gratitude go to everyone who contributed to the

  17. Viewing Attractiveness Socialization from a Social Network Perspective.

    Science.gov (United States)

    Downs, A. Chris

    Providing a framework for a symposium exploring the influence of physical attractiveness on the socialization process, this paper (1) offers a working definition of physical attractiveness, (2) reviews stereotypes associated with attractiveness, and (3) discusses a social network perspective on the influence of attractiveness. Physical…

  18. Impressions of Counselors as a Function of Counselor Physical Attractiveness

    Science.gov (United States)

    Carter, Jean A.

    1978-01-01

    Research assessed the effects of counselor physical attractiveness and inter-actions between attractiveness and counselor subject sex. It is suggested that sex of counselor and client may play a more important role independently and in conjunction with attractiveness than does attractiveness alone in influencing impressions and expectations.…

  19. 40 CFR 503.33 - Vector attraction reduction.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Vector attraction reduction. 503.33... STANDARDS FOR THE USE OR DISPOSAL OF SEWAGE SLUDGE Pathogens and Vector Attraction Reduction § 503.33 Vector attraction reduction. (a)(1) One of the vector attraction reduction requirements in § 503.33 (b)(1)...

  20. Genetic factors that increase male facial masculinity decrease facial attractiveness of female relatives.

    Science.gov (United States)

    Lee, Anthony J; Mitchem, Dorian G; Wright, Margaret J; Martin, Nicholas G; Keller, Matthew C; Zietsch, Brendan P

    2014-02-01

    For women, choosing a facially masculine man as a mate is thought to confer genetic benefits to offspring. Crucial assumptions of this hypothesis have not been adequately tested. It has been assumed that variation in facial masculinity is due to genetic variation and that genetic factors that increase male facial masculinity do not increase facial masculinity in female relatives. We objectively quantified the facial masculinity in photos of identical (n = 411) and nonidentical (n = 782) twins and their siblings (n = 106). Using biometrical modeling, we found that much of the variation in male and female facial masculinity is genetic. However, we also found that masculinity of male faces is unrelated to their attractiveness and that facially masculine men tend to have facially masculine, less-attractive sisters. These findings challenge the idea that facially masculine men provide net genetic benefits to offspring and call into question this popular theoretical framework.

  1. 9th Conference on Coordinate Measuring Machines

    DEFF Research Database (Denmark)

    De Chiffre, Leonardo; Dorph, Pernille

    2001-01-01

    termination of the second lifetime cycle of the club. This conference treates the traceability of geometrical measurements with particular reference to those obtained using coordinate measuring machines. A number of on-going activities and new achievements in coordinate metrology are presented by European......This one-day conference on coordinate measuring machines is the 9th in a row of conferences organised in connection with the Danish CMM Club, a users’ group regarding CMMs that has existed in Denmark since 1994. The Danish CMM Club was founded by the Department of Manufacturing Engineering...... and Management in connection with a Nordic project concerned with creation of a network in coordinate metrology in Denmark, Finland, Norway and Sweden. A major activity of the project was an industrial comparison of 62 CMMs in the Scandinavian Coutries. Since it’s start in 1994, the Danish CMM Club has held six...

  2. 5th ESCOM Conference

    DEFF Research Database (Denmark)

    Ridder, Hanne Mette Ochsner

    2003-01-01

    What happens when a music therapist participates in a conference of the European Society for the Cognitive Sciences of Music? Well, she seems to get a lot of inspiration and sees very interesting and useful research, - and sometimes she is astonished about which kind of research some people are i...... are investigating time and money in. In the following you will find thoughts and impressions from the conference where there were a huge number of presentations with a common theme on cognitive science of music, and here seen from a music therapeutic perspective....

  3. PHYSICS FOR HEALTH: CONFERENCE

    CERN Multimedia

    2016-01-01

    ICTR-PHE 2016 - International Conference on Translational Research in Radio-Oncology and Physics for Health -, co organized by CERN, aims at developing new strategies to better diagnose and treat cancer, by uniting biology and physics with clinics. Through the various sessions and symposia, the scientific programme offers the delegates the opportunity to discuss, in a friendly atmosphere, the latest progress in physics breakthroughs for health applications. The third edition of this conference took place at CICG (Centre International de Conférence Genève) from 15 to 19 Feb 2016.

  4. Conference Report: China–Myanmar Relations: The Dilemmas of Mutual Dependence

    Directory of Open Access Journals (Sweden)

    Maxwell Harrington

    2012-01-01

    Full Text Available Georgetown University’s Asian Studies program hosted a conference on November 4, 2011 entitled “China–Myanmar Relations: The Dilemmas of Mutual Dependence.” The conference included panel discussions by scholars and government officials from China, Myanmar, Thailand, India, Japan, the Netherlands, Germany, Canada, and the United States. With an attendance of over 150 people, it proved that discussions regarding the Sino–Myanmar relationship are able to attract interest in Washington.

  5. Conference report. Can spirit of Cairo survive?

    Science.gov (United States)

    Chhabra, R

    1994-01-01

    Country representatives from around the globe came together at the 1994 International Conference on Population and Development (ICPD) to draft a document in the spirit of compromise and unified intent. Marked controversy and conflict plagued the conference, both before and during the official meetings. Accord was nonetheless reached. The author wonders how long and to what extent the euphoria and compromise of the ICPD will last now that official talks are over. It is clear that paranoia and discord subsumed during the conference will persist, foment, and potentially resurface in confrontation over time. The South, for example, was upset about the failure of the conference to focus more upon development and environmental issues, while the Southern women's groups invested their energies into political ideologies and their development as a counterforce to international multinational scientific and corporate lobbies on pharmaceutical and contraceptive technologies. The women's caucus instead adopted a Western world view of sexuality which effectively permeated their lobbying and the conference. While dissent may resurface over time, the ICPD nonetheless set into motion positive processes for nongovernmental organization participation in a spirit of partnership within the UN systems and in the formulation of national policies and programs of their respective countries. In closing, the author expresses her regret that China and India maintained a low profile at the official meeting, and that Pakistan, rooted in Islam, spoke for the Indian subcontinent.

  6. Conference scene: pharmacogenomics: from cell to clinic (part 2).

    Science.gov (United States)

    Siest, Gérard; Medeiros, Rui; Melichar, Bohuslav; Stathopoulou, Maria; Van Schaik, Ron Hn; Cacabelos, Ramon; Abt, Peter Meier; Monteiro, Carolino; Gurwitz, David; Queiroz, Jao; Mota-Filipe, Helder; Ndiaye, Ndeye Coumba; Visvikis-Siest, Sophie

    2014-04-01

    Second International ESPT Meeting Lisbon, Portugal, 26-28 September 2013 The second European Society of Pharmacogenomics and Theranostics (ESPT) conference was organized in Lisbon, Portugal, and attracted 250 participants from 37 different countries. The participants could listen to 50 oral presentations, participate in five lunch symposia and were able to view 83 posters and an exhibition. Part 1 of this Conference Scene was presented in the previous issue of Pharmacogenomics. This second part will focus on: clinical implementation of pharmacogenomics tests; transporters and pharmacogenomics; stem cells and other new tools for pharmacogenomics and drug discovery; from system pharmacogenomics to personalized medicine; and, finally, we will discuss the Posters and Awards that were presented at the conference.

  7. 2015 4th China Academic Conference on Printing and Packaging

    CERN Document Server

    Xu, Min; Yang, Li; Ouyang, Yujie

    2016-01-01

    This book includes a selection of reviewed papers presented at the 2015, 4th China Academic Conference on Printing and Packaging, which was held on October 22-24, 2015 in Hangzhou, China. The conference was jointly organized by the China Academy of Printing Technology, Beijing Institute of Graphic Communication, and Hangzhou Dianzi University. With 3 keynote talks and 200 presented papers on graphic communications, packaging technologies and materials, the conference attracted more than 400 scientists.  These proceedings cover the recent research outcomes on color science and technology, image-processing technology, digital-media technology, printing-engineering technology, packaging-engineering technology etc. They will be of interest to university researchers, R&D engineers and graduate students in graphic communications, packaging, color science, image science, materials science, computer science, digital media and network technology fields.

  8. 4th European Conference on Geostatistics for Environmental Applications

    CERN Document Server

    Carrera, Jesus; Gómez-Hernández, José

    2004-01-01

    The fourth edition of the European Conference on Geostatistics for Environmental Applications (geoENV IV) took place in Barcelona, November 27-29, 2002. As a proof that there is an increasing interest in environmental issues in the geostatistical community, the conference attracted over 100 participants, mostly Europeans (up to 10 European countries were represented), but also from other countries in the world. Only 46 contributions, selected out of around 100 submitted papers, were invited to be presented orally during the conference. Additionally 30 authors were invited to present their work in poster format during a special session. All oral and poster contributors were invited to submit their work to be considered for publication in this Kluwer series. All papers underwent a reviewing process, which consisted on two reviewers for oral presentations and one reviewer for posters. The book opens with one keynote paper by Philippe Naveau. It is followed by 40 papers that correspond to those presented orally d...

  9. "LSST@Europe: the path to science" - Conference Photograph

    OpenAIRE

    Smith, Amanda

    2013-01-01

    Group photograph of attendees of "LSST@Europe: the path to science" a conference held at the Institute of Astronomy, University of Cambridge 9-12 September 2013. The LSST is the Large Synoptic Survey Telescope.

  10. 78 FR 27963 - Reliability Technical Conference; Notice of Technical Conference

    Science.gov (United States)

    2013-05-13

    ... Energy Regulatory Commission Reliability Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, July 9, 2013... to the webcast. The Capitol Connection provides technical support for webcasts and offers the...

  11. Ten Strategies to Reduce Gender Inequality at Scientific Conferences

    Directory of Open Access Journals (Sweden)

    Stephanie Sardelis

    2017-07-01

    Full Text Available Conferences organized by professional societies provide scientists and professionals with an excellent opportunity to disseminate their work, network with like-minded researchers, and form collaborative relationships for future endeavors. However, these opportunities are rarely distributed equally between women and men in science. Addressing gender inequity should be a primary consideration for all societies hosting conferences. Yet, many STEM conferences are struggling with gender biases and the understanding that gender inequity also applies to non-binary gender and overlapping social identities. At the Society for Conservation Biology's 4th International Marine Conservation Congress (IMCC4, “Promoting the Participation of Women at Science Conferences” was one of four focus groups of the Diversity Focus Group Series. This paper outlines 10 feasible intervention strategies delineated during the Women at Science Conferences focus group discussion as positive encouragement for professional societies to continue toward gender equity. The 10 interventions to reduce gender inequity at conferences include adopting community principles and a Code of Conduct, appointing a Safety Officer, requiring a registration honor system pledge and conduct surveys, offering a mentorship program, organizing focus groups, giving benefits for participating in diversity programming, assisting with child care, proffering travel grants, providing badges on lanyards, and randomizing the conference program. These strategies are intended to reduce participation barriers for women scientists at conferences, and range in the amount of planning they require to provide options for all societies regardless of their fiscal or labor capacity.

  12. Attraction Effects in Honorific Agreement in Korean.

    Science.gov (United States)

    Kwon, Nayoung; Sturt, Patrick

    2016-01-01

    Previous studies have suggested that sentence processing is mediated by content-addressable direct retrieval processes (McElree, 2000; McElree et al., 2003). However, the memory retrieval processes may differ as a function of the type of dependency. For example, while many studies have reported facilitatory intrusion effects associated with a structurally illicit antecedent during the processing of subject-verb number or person agreement and negative polarity items (Pearlmutter et al., 1999; Xiang et al., 2009; Dillon et al., 2013), studies investigating reflexives have not found consistent evidence of intrusion effects (Parker et al., 2015; Sturt and Kwon, 2015; cf. Nicol and Swinney, 1989; Sturt, 2003). Similarly, the memory retrieval processes could be also sensitive to cross-linguistic differences (cf. Lago et al., 2015). We report one self-paced reading experiment and one eye-tracking experiment that examine the processing of subject-verb honorific agreement, a dependency that is different from those that have been studied to date, in Korean, a typologically different language from those previously studied. The overall results suggest that the retrieval processes underlying the processing of subject-verb honorific agreement in Korean are susceptible to facilitatory intrusion effects from a structurally illicit but feature-matching subject, with a pattern that is similar to subject-verb agreement in English. In addition, the attraction effect was not limited to the ungrammatical sentences but was also found in grammatical sentences. The clear attraction effect in the grammatical sentences suggest that the attraction effect does not solely arise as the result of an error-driven process (cf. Wagers et al., 2009), but is likely also to result from general mechanisms of retrieval processes of activating of potential items in memory (Vasishth et al., 2008).

  13. Attraction Effects in Honorific Agreement in Korean

    Science.gov (United States)

    Kwon, Nayoung; Sturt, Patrick

    2016-01-01

    Previous studies have suggested that sentence processing is mediated by content-addressable direct retrieval processes (McElree, 2000; McElree et al., 2003). However, the memory retrieval processes may differ as a function of the type of dependency. For example, while many studies have reported facilitatory intrusion effects associated with a structurally illicit antecedent during the processing of subject-verb number or person agreement and negative polarity items (Pearlmutter et al., 1999; Xiang et al., 2009; Dillon et al., 2013), studies investigating reflexives have not found consistent evidence of intrusion effects (Parker et al., 2015; Sturt and Kwon, 2015; cf. Nicol and Swinney, 1989; Sturt, 2003). Similarly, the memory retrieval processes could be also sensitive to cross-linguistic differences (cf. Lago et al., 2015). We report one self-paced reading experiment and one eye-tracking experiment that examine the processing of subject-verb honorific agreement, a dependency that is different from those that have been studied to date, in Korean, a typologically different language from those previously studied. The overall results suggest that the retrieval processes underlying the processing of subject-verb honorific agreement in Korean are susceptible to facilitatory intrusion effects from a structurally illicit but feature-matching subject, with a pattern that is similar to subject-verb agreement in English. In addition, the attraction effect was not limited to the ungrammatical sentences but was also found in grammatical sentences. The clear attraction effect in the grammatical sentences suggest that the attraction effect does not solely arise as the result of an error-driven process (cf. Wagers et al., 2009), but is likely also to result from general mechanisms of retrieval processes of activating of potential items in memory (Vasishth et al., 2008). PMID:27630594

  14. Basins of Attraction for Chimera States

    DEFF Research Database (Denmark)

    Martens, Erik Andreas; Panaggio, Mark; Abrams, Daniel

    2016-01-01

    Chimera states---curious symmetry-broken states in systems of identical coupled oscillators---typically occur only for certain initial conditions. Here we analyze their basins of attraction in a simple system comprised of two populations. Using perturbative analysis and numerical simulation we...... evaluate asymptotic states and associated destination maps, and demonstrate that basins form a complex twisting structure in phase space. Understanding the basins' precise nature may help in the development of control methods to switch between chimera patterns, with possible technological and neural system...

  15. Attractivity and bifurcation for nonautonomous dynamical systems

    CERN Document Server

    Rasmussen, Martin

    2007-01-01

    Although, bifurcation theory of equations with autonomous and periodic time dependence is a major object of research in the study of dynamical systems since decades, the notion of a nonautonomous bifurcation is not yet established. In this book, two different approaches are developed which are based on special definitions of local attractivity and repulsivity. It is shown that these notions lead to nonautonomous Morse decompositions, which are useful to describe the global asymptotic behavior of systems on compact phase spaces. Furthermore, methods from the qualitative theory for linear and nonlinear systems are derived, and nonautonomous counterparts of the classical one-dimensional autonomous bifurcation patterns are developed.

  16. Visual perception of female physical attractiveness.

    OpenAIRE

    Fan, J.; Liu, F.; Wu, J.; Dai, W.

    2004-01-01

    On the basis of visual assessment of figure drawings and front/profile images, past researchers believed that the waist-hip ratio (WHR) and the body mass index (BMI) were two putative cues to female physical attractiveness. However, this view was not tested on three-dimensional (3D) female images. In the present study, 3D images of 31 Caucasian females having varying body weights (BMI ranged from 16 to 35) were shown to 29 male and 25 female viewers, who were asked to rate the physical attrac...

  17. Training program attracts work and health researchers

    DEFF Research Database (Denmark)

    Skakon, Janne

    2007-01-01

    Each year in Canada, the costs of disability arising from work-related causes – including workers’ compensation and health-care costs – exceed $6.7 billion. Despite the significant financial and social impacts of worker injury and illness, only a small fraction of Canadian researchers are dedicated...... to examining work disability prevention issues. An innovative program that attracts international students, the Work Disability Prevention Canadian Institutes of Health Research (CIHR) Strategic Training Program, aims to build research capacity in young researchers and to create a strong network that examines...

  18. Attractiveness of black Shannon trap for phlebotomines

    OpenAIRE

    Galati EAB; VLB Nunes; MEC Dorval; Cristaldo,G; HC Rocha; RM Gonçalves-Andrade; Naufel,G

    2001-01-01

    A white Shannon-type trap was used for captures of female sand flies in the search for natural infection with flagellates, however, due to its low productivity and as a large number of phlebotomines settled on the researchers' black clothes, we decided to compare the relative attractiveness of black and white Shannon-type traps for sand flies. Several pairs of black and white traps were placed side by side in front of caves in four areas in the Serra da Bodoquena, Bonito county, State of Mato...

  19. [Near fatal attraction of ingested magnets].

    Science.gov (United States)

    Munchak, Itamar; Yardeni, Dan; Jacobson, Jeffrey M; Soudack-Ben Nun, Michalle; Augarten, Arie

    2013-03-01

    We report a case of intestinal perforation in a 20 month old girl following the ingestion of 2 small magnets. Ingestion of multiple magnets constitutes a unique problem. Magnets in adjacent intestinal loops may forcefully attract each other and produce pressure necrosis of the bowel wall, leading to perforation, fistula formation or intestinal obstruction. Therefore, these children should be observed carefully. Early surgical intervention should be considered when clinical symptoms develop, especially when, on sequential abdominal radiographs, there is no change in the magnets' location. Since toys with small magnets are ubiquitous, efforts should be made to increase parents' awareness on the one hand, and to alert toy manufacturers on the other hand.

  20. International conference on string theory

    CERN Document Server

    2016-01-01

    The Strings conference is an annual event that brings the entire string theory community together. Since the 1980s, it has grown to be the largest and most important conference in the field. The aim is to review recent developments in string theory and to stimulate scientific exchanges among the participants. This is the second Strings conference organised in Beijing, after Strings 2006. Following the tradition, besides scientific talks, the conference will also include some public lectures open to a general audience.

  1. On the Conference Circuit.

    Science.gov (United States)

    Tyckoson, David A.

    1987-01-01

    Summarizes three conference presentations on the effects of the economic climate on academic libraries in Iowa. These presentations focused on the impact of austerity budgets on collection development, library services and personnel, and possible management approaches to retrenchment in these areas. (CLB)

  2. CONFERENCE OF YOUNG SCIENTISTS

    Directory of Open Access Journals (Sweden)

    article editorial

    2008-01-01

    Full Text Available A conference of young scientists dedicated to the 245th anniversary of the Scientific Center of Children's Health was held on September 12, 2008.Speakers at the conference were young professionals working at SCCH of RAMS, Sechenov Moscow Medical Academy, Institute of Pediatric Hematology, Oncology, and Immunology. During the conference the poster session was held in which young scientists of the Centre took part. Presentations of participants were evaluated by the members of the Academic Council of SCCH, leading specialists of the Center. Gifts to the winners of the conference were provided by "Procter & Gamble".Winners and awardees:I place: Chistyakova V.P. - Clinical intern at SCCH of RAMS;II place: Gudkova E.Yu. - Researcher at the Department of Rheumatology of SCCH of RAMS;III place: Darmanyan A.S. - Researcher at the Department of diagnostics and rehabilitation treatment of SCCH of RAMS.Best poster paper: Plyakin V.A. - Researcher at Surgical Department NTSZD RAMS.Audience Award: Tikhomirova E.A. - Researcher at the Department of functional diagnostics of SCCH of RAMS.

  3. Graphics Conference Calendar

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    1. The 13th International Conference in Central Europe on Computer Graphics, Visualization and Computer Vision'2005, University of West Bohemia, Campus-Bory Plzen (very close to Prague, the capital of the Czech Republic)Czech Republic, January 31 - February 4, 2005. http://wscg.zcu.cz, skala@kiv.zcu.cz

  4. International Nuclear Physics Conference

    CERN Document Server

    2016-01-01

    We are pleased to announce that the 26th International Nuclear Physics Conference (INPC2016) will take place in Adelaide (Australia) from September 11-16, 2016. The 25th INPC was held in Firenze in 2013 and the 24th INPC in Vancouver, Canada, in 2010. The Conference is organized by the Centre for the Subatomic Structure of Matter at the University of Adelaide, together with the Australian National University and ANSTO. It is also sponsored by the International Union of Pure and Applied Physics (IUPAP) and by a number of organisations, including AUSHEP, BNL, CoEPP, GSI and JLab. INPC 2016 will be held in the heart of Adelaide at the Convention Centre on the banks of the River Torrens. It will consist of 5 days of conference presentations, with plenary sessions in the mornings, up to ten parallel sessions in the afternoons, poster sessions and a public lecture. The Conference will officially start in the evening of Sunday 11th September with Registration and a Reception and will end late on the afternoon of ...

  5. Creating Better Satellite Conferences.

    Science.gov (United States)

    Horner, Tommy

    1998-01-01

    Presents four ways to improve broadcasts of company satellite conferences, including creative site selection (using facilities at educational institutions rather than hotel rooms); creative programming (using graphics and other interruptions to break up lectures or speeches); creative crew selection; and creative downlink site activities (to…

  6. 2002 NASPSA Conference Abstracts.

    Science.gov (United States)

    Journal of Sport & Exercise Psychology, 2002

    2002-01-01

    Contains abstracts from the 2002 conference of the North American Society for the Psychology of Sport and Physical Activity. The publication is divided into three sections: the preconference workshop, "Effective Teaching Methods in the Classroom;" symposia (motor development, motor learning and control, and sport psychology); and free…

  7. Report on the Conference.

    Science.gov (United States)

    Brown, Ralph S.

    1983-01-01

    The themes of the 1982 annual conference of the American Association of University Professors are outlined. They include the importance of planning, selective versus across-the-board retrenchment strategies, definitions and problems of financial exigency, program reduction, and affirmative action claims. (MSE)

  8. Grammar! A Conference Report.

    Science.gov (United States)

    King, Lid, Ed.; Boaks, Peter, Ed.

    Papers from a conference on the teaching of grammar, particularly in second language instruction, include: "Grammar: Acquisition and Use" (Richard Johnstone); "Grammar and Communication" (Brian Page); "Linguistic Progression and Increasing Independence" (Bernardette Holmes); "La grammaire? C'est du bricolage!" ("Grammar? That's Hardware!") (Barry…

  9. Strepsiptera, phylogenomics and the long branch attraction problem.

    Directory of Open Access Journals (Sweden)

    Bastien Boussau

    Full Text Available Insect phylogeny has recently been the focus of renewed interest as advances in sequencing techniques make it possible to rapidly generate large amounts of genomic or transcriptomic data for a species of interest. However, large numbers of markers are not sufficient to guarantee accurate phylogenetic reconstruction, and the choice of the model of sequence evolution as well as adequate taxonomic sampling are as important for phylogenomic studies as they are for single-gene phylogenies. Recently, the sequence of the genome of a strepsipteran has been published and used to place Strepsiptera as sister group to Coleoptera. However, this conclusion relied on a data set that did not include representatives of Neuropterida or of coleopteran lineages formerly proposed to be related to Strepsiptera. Furthermore, it did not use models that are robust against the long branch attraction artifact. Here we have sequenced the transcriptomes of seven key species to complete a data set comprising 36 species to study the higher level phylogeny of insects, with a particular focus on Neuropteroidea (Coleoptera, Strepsiptera, Neuropterida, especially on coleopteran taxa considered as potential close relatives of Strepsiptera. Using models robust against the long branch attraction artifact we find a highly resolved phylogeny that confirms the position of Strepsiptera as a sister group to Coleoptera, rather than as an internal clade of Coleoptera, and sheds new light onto the phylogeny of Neuropteroidea.

  10. Attraction to and learning from social cues in fruitfly larvae.

    Science.gov (United States)

    Durisko, Zachary; Dukas, Reuven

    2013-09-22

    We examined the use of social information in fruitfly larvae, which represent an ideal model system owing to their robust learning abilities, small number of neurons and well-studied neurogenetics. Focal larvae showed attraction to the distinct odour emanating from food occupied by other larvae. In controlled learning experiments, focal larvae preferred novel odours previously paired with food occupied by other larvae over novel odours previously paired with unoccupied food. When we gave groups of larvae a choice between food patches differing in quality, more larvae aggregated on the higher-quality food, suggesting that attraction to and learning about cues associated with other larvae can be beneficial. Furthermore, larvae were more likely to find the best available food patch in trials when that food patch was occupied by other larvae than in trials when that food patch was unoccupied. Our data suggest, however, that the benefits from joining others may be at least partially offset by the fitness costs of increased competition, because larvae reared in isolation did as well as or better than larvae reared in groups on three key fitness parameters: developmental rate, survival rate and adult dry body mass. Our work establishes fruitfly larvae as a highly tractable model species for further research on the mechanisms that modulate behaviour and learning in a social context.

  11. Ninth International Conference draws 15000 to Berlin.

    Science.gov (United States)

    1993-01-01

    On June 7-11, 1993, 15,000 people attended the Ninth International Conference on AIDS in Berlin, Germany. More than 1000 speakers led presentations, plenary sessions, and workshops on the 4 major conference topics: basic science, clinical science and care, epidemiology and prevention, and psychological and social impact and social response. During the basic science sessions, evidence was presented of extensive virus variation and migration which reinforced the need for a global vaccine. Also, new information about the pathogenesis of HIV and AIDS was presented which may influence new treatment and prevention approaches. A great deal of discussion about early treatment with zidovudine was generated in the clinical sciences sessions, but no breakthroughs were announced in drugs or vaccines. During the sessions on prevention, it was reported that a 4-year program of condom promotion among prostitutes in Thailand resulted in a 75% reduction in cases of sexually transmitted diseases. Behavior change programs among at-risk populations in many countries have been effective, but they have not had a noticeable effect on the AIDS pandemic because a lack of resources has prevented their replication. The newest at-risk group seems to be young people, especially adolescent girls. During this conference, women's issues were discussed more widely than at any previous conference. Female-controlled methods of prevention, especially a vaginal virucide, received a great deal of attention. People with AIDS participated in the conference by delivering fiery opening speeches, by demonstrating publicly near the former Berlin Wall, and by urging scientists to collaborate on finding a cure rather than competing with each other in order to win a Nobel prize. The fact that the media reports from the conference were pessimistic drew criticism from participants who believe that a general feeling of pessimism will lead governments, researchers, and health care workers to adopt an attitude of

  12. Microgravity Materials Science Conference 2000. Volume 3

    Science.gov (United States)

    Ramachandran, Narayanan; Bennett, Nancy; McCauley, Dannah; Murphy, Karen; Poindexter, Samantha

    2001-01-01

    This is Volume 3 of 3 of the 2000 Microgravity Materials Science Conference that was held June 6-8 at the Von Braun Center, Huntsville, Alabama. It was organized by the Microgravity Materials Science Discipline Working Group, sponsored by the Microgravity Research Division (MRD) at NASA Headquarters, and hosted by NASA Marshall Space Flight Center and the Alliance for Microgravity Materials Science and Applications (AMMSA). It was the fourth NASA conference of this type in the Microgravity materials science discipline. The microgravity science program sponsored 200 investigators, all of whom made oral or poster presentations at this conference- In addition, posters and exhibits covering NASA microgravity facilities, advanced technology development projects sponsored by the NASA Microgravity Research Division at NASA Headquarters, and commercial interests were exhibited. The purpose of the conference was to inform the materials science community of research opportunities in reduced gravity and to highlight the Spring 2001 release of the NASA Research Announcement (NRA) to solicit proposals for future investigations. It also served to review the current research and activities in material,, science, to discuss the envisioned long-term goals. and to highlight new crosscutting research areas of particular interest to MRD. The conference was aimed at materials science researchers from academia, industry, and government. A workshop on in situ resource utilization (ISRU) was held in conjunction with the conference with the goal of evaluating and prioritizing processing issues in Lunar and Martian type environments. The workshop participation included invited speakers and investigators currently funded in the material science program under the Human Exploration and Development of Space (HEDS) initiative. The conference featured a plenary session every day with an invited speaker that was followed by three parallel breakout sessions in subdisciplines. Attendance was close

  13. Microgravity Materials Science Conference 2000. Volume 2

    Science.gov (United States)

    Ramachandran, Narayanan (Editor); Bennett, Nancy (Editor); McCauley, Dannah (Editor); Murphy, Karen (Editor); Poindexter, Samantha (Editor)

    2001-01-01

    This is Volume 2 of 3 of the 2000 Microgravity Materials Science Conference that was held June 6-8 at the Von Braun Center, Huntsville, Alabama. It was organized by the Microgravity Materials Science Discipline Working Group, sponsored by the Microgravity Research Division (MRD) at NASA Headquarters, and hosted by NASA Marshall Space Flight Center and the Alliance for Microgravity Materials Science and Applications (AMMSA). It was the fourth NASA conference of this type in the Microgravity materials science discipline. The microgravity science program sponsored approx. 200 investigators, all of whom made oral or poster presentations at this conference- In addition, posters and exhibits covering NASA microgravity facilities, advanced technology development projects sponsored by the NASA Microgravity Research Division at NASA Headquarters, and commercial interests were exhibited. The purpose of the conference %%,its to inform the materials science community of research opportunities in reduced gravity and to highlight the Spring 2001 release of the NASA Research Announcement (NRA) to solicit proposals for future investigations. It also served to review the current research and activities in material,, science, to discuss the envisioned long-term goals. and to highlight new crosscutting research areas of particular interest to MRD. The conference was aimed at materials science researchers from academia, industry, and government. A workshop on in situ resource utilization (ISRU) was held in conjunction with the conference with the goal of evaluating and prioritizing processing issues in Lunar and Martian type environments. The workshop participation included invited speakers and investigators currently funded in the material science program under the Human Exploration and Development of Space (HEDS) initiative. The conference featured a plenary session every day with an invited speaker that was followed by three parallel breakout sessions in subdisciplines. Attendance

  14. Microgravity Materials Science Conference 2000. Volume 1

    Science.gov (United States)

    Ramachandran, Narayanan (Editor); Bennett, Nancy (Editor); McCauley, Dannah (Editor); Murphy, Karen (Editor); Poindexter, Samantha (Editor)

    2001-01-01

    This is Volume 1 of 3 of the 2000 Microgravity Material Science Conference that was held June 6-8 at the Von Braun Center, Huntsville, Alabama. It was organized by the Microgravity Materials Science Discipline Working Group, sponsored by the Microgravity Research Division (MRD) at NASA Headquarters, and hosted by NASA Marshall Space Flight Center and the Alliance for Microgravity Materials Science and Applications (AMMSA). It was the fourth NASA conference of this type in the microgravity materials science discipline. The microgravity science program sponsored approx. 200 investigators, all of whom made oral or poster presentations at this conference. In addition, posters and exhibits covering NASA microgravity facilities, advanced technology development projects sponsored by the NASA Microgravity Research Division at NASA Headquarters, and commercial interests were exhibited. The purpose of the conference was to inform the materials science community of research opportunities in reduced gravity and to highlight the Spring 2001 release of the NASA Research Announcement (NRA) to solicit proposals for future investigations. It also served to review the current research and activities in materials science, to discuss the envisioned long-term goals. and to highlight new crosscutting research areas of particular interest to MRD. The conference was aimed at materials science researchers from academia, industry, and government. A workshop on in situ resource utilization (ISRU) was held in conjunction with the conference with the goal of evaluating and prioritizing processing issues in Lunar and Martian type environments. The workshop participation included invited speakers and investigators currently funded in the material science program under the Human Exploration and Development of Space (HEDS) initiative. The conference featured a plenary session every day with an invited speaker that was followed by three parallel breakout sessions in subdisciplines. Attendance was

  15. Indico CONFERENCE: Define the Programme

    CERN Document Server

    CERN. Geneva; Ferreira, Pedro

    2017-01-01

    In this tutorial you are going to learn how to define the programme of a conference in Indico. The program of your conference is divided in different “tracks”. Tracks represent the subject matter of the conference, such as “Online Computing”, “Offline Computing”, and so on.

  16. ALA Conference 2009: Chicago Hope

    Science.gov (United States)

    Berry, John N., III

    2009-01-01

    There is joy among those who have the funds to go to Chicago for the American Library Association (ALA) annual conference, July 9-15. Every librarian knows there is nothing better than a Chicago gathering, with the city's wonderful haunts, museums, restaurants, and fine memories of past conferences. The conference program covers nearly every…

  17. Potentials-attract or likes-attract in human mate choice in China.

    Science.gov (United States)

    He, Qiao-Qiao; Zhang, Zhen; Zhang, Jian-Xin; Wang, Zhi-Guo; Tu, Ying; Ji, Ting; Tao, Yi

    2013-01-01

    To explain how individuals' self-perceived long-term mate value influences their mate preference and mate choice, two hypotheses have been presented, which are "potentials-attract" and "likes-attract", respectively. The potentials-attract means that people choose mates matched with their sex-specific traits indicating reproductive potentials; and the likes-attract means that people choose mates matched with their own conditions. However, the debate about these two hypotheses still remains unsolved. In this paper, we tested these two hypotheses using a human's actual mate choice data from a Chinese online dating system (called the Baihe website), where 27,183 users of Baihe website are included, in which there are 590 paired couples (1180 individuals) who met each other via the website. Our main results show that not only the relationship between individuals' own attributes and their self-stated mate preference but also that between individuals' own attributes and their actual mate choice are more consistent with the likes-attract hypothesis, i.e., people tend to choose mates who are similar to themselves in a variety of attributes.

  18. Physical attraction to reliable, low variability nervous systems: Reaction time variability predicts attractiveness.

    Science.gov (United States)

    Butler, Emily E; Saville, Christopher W N; Ward, Robert; Ramsey, Richard

    2017-01-01

    The human face cues a range of important fitness information, which guides mate selection towards desirable others. Given humans' high investment in the central nervous system (CNS), cues to CNS function should be especially important in social selection. We tested if facial attractiveness preferences are sensitive to the reliability of human nervous system function. Several decades of research suggest an operational measure for CNS reliability is reaction time variability, which is measured by standard deviation of reaction times across trials. Across two experiments, we show that low reaction time variability is associated with facial attractiveness. Moreover, variability in performance made a unique contribution to attractiveness judgements above and beyond both physical health and sex-typicality judgements, which have previously been associated with perceptions of attractiveness. In a third experiment, we empirically estimated the distribution of attractiveness preferences expected by chance and show that the size and direction of our results in Experiments 1 and 2 are statistically unlikely without reference to reaction time variability. We conclude that an operating characteristic of the human nervous system, reliability of information processing, is signalled to others through facial appearance. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Potentials-attract or likes-attract in human mate choice in China.

    Directory of Open Access Journals (Sweden)

    Qiao-Qiao He

    Full Text Available To explain how individuals' self-perceived long-term mate value influences their mate preference and mate choice, two hypotheses have been presented, which are "potentials-attract" and "likes-attract", respectively. The potentials-attract means that people choose mates matched with their sex-specific traits indicating reproductive potentials; and the likes-attract means that people choose mates matched with their own conditions. However, the debate about these two hypotheses still remains unsolved. In this paper, we tested these two hypotheses using a human's actual mate choice data from a Chinese online dating system (called the Baihe website, where 27,183 users of Baihe website are included, in which there are 590 paired couples (1180 individuals who met each other via the website. Our main results show that not only the relationship between individuals' own attributes and their self-stated mate preference but also that between individuals' own attributes and their actual mate choice are more consistent with the likes-attract hypothesis, i.e., people tend to choose mates who are similar to themselves in a variety of attributes.

  20. Chiral metamaterials reduce the attractive Casimir force

    Science.gov (United States)

    Zhao, R.; Koschny, Th.; Economou, E. N.; Soukoulis, C. M.

    2010-08-01

    In our previous work [R. Zhao, J. Zhou, Th. Koschny, E. N. Economou, and C. M. Soukoulis, Phys. Rev. Lett. 103, 103602 (2009)], we demonstrated theoretically that one can obtain repulsive Casimir forces and stable nanolevitations by using chiral metamaterials if the chirality is strong enough. In our recent work [R. Zhao, Th. Koschny, E.N. Economou, and C.M. Soukoulis, Phys. Rev. B 81, 235126 (2010)], we checked some chiral metamaterial designs and found that the artificial chiral metamaterials constructed by passive materials is very difficult to reach the critical chirality to realize repulsive Casimir force. Therefore, in this paper, we give a four-folded rotated Ω-particle chiral metamaterial as an example, use the effective medium approximation to retrieval the constitutive parameters, and take the same procedure as we did before to see how much the chiral metamaterial can reduce the attractive force. It shows that this un-optimized chiral metamaterial can reduce the Casimir attraction by 70%.

  1. Colloidal gelation with variable attraction energy.

    Science.gov (United States)

    Zaccone, Alessio; Crassous, Jérôme J; Ballauff, Matthias

    2013-03-14

    We present an approximation scheme to the master kinetic equations for aggregation and gelation with thermal breakup in colloidal systems with variable attraction energy. With the cluster fractal dimension df as the only phenomenological parameter, rich physical behavior is predicted. The viscosity, the gelation time, and the cluster size are predicted in closed form analytically as a function of time, initial volume fraction, and attraction energy by combining the reversible clustering kinetics with an approximate hydrodynamic model. The fractal dimension df modulates the time evolution of cluster size, lag time and gelation time, and of the viscosity. The gelation transition is strongly nonequilibrium and time-dependent in the unstable region of the state diagram of colloids where the association rate is larger than the dissociation rate. Only upon approaching conditions where the initial association and the dissociation rates are comparable for all species (which is a condition for the detailed balance to be satisfied) aggregation can occur with df = 3. In this limit, homogeneous nucleation followed by Lifshitz-Slyozov coarsening is recovered. In this limited region of the state diagram the macroscopic gelation process is likely to be driven by large spontaneous fluctuations associated with spinodal decomposition.

  2. Attractiveness of black Shannon trap for phlebotomines.

    Science.gov (United States)

    Galati, E A; Nunes, V L; Dorval, M E; Cristaldo, G; Rocha, H C; Gonçalves-Andrade, R M; Naufel, G

    2001-07-01

    A white Shannon-type trap was used for captures of female sand flies in the search for natural infection with flagellates, however, due to its low productivity and as a large number of phlebotomines settled on the researchers' black clothes, we decided to compare the relative attractiveness of black and white Shannon-type traps for sand flies. Several pairs of black and white traps were placed side by side in front of caves in four areas in the Serra da Bodoquena, Bonito county, State of Mato Grosso do Sul, Brazil, for a total of 12 observations and 44 h of capture. The experiment resulted in 889 phlebotomines captured, 801 on the black and 88 on the white trap, representing 13 species. The hourly Williams' means were 8.67 and 1.24, respectively, and the black/white ratio was 7.0:1.0. Lutzomyia almerioi, an anthropophilic species closely associated with caves, was predominant (89%). Only two other species, Nyssomyia whitmani and Psathyromyia punctigeniculata, also anthropophilic, were significantly attracted to the black rather than to the white trap (chi(2) test; p < or = 0.01). The difference between the diversity index of the two traps was not significant at level 0.05. The black trap in these circumstances was much more productive than the white, especially for anthropophilic species.

  3. Attractiveness of black Shannon trap for phlebotomines

    Directory of Open Access Journals (Sweden)

    Galati EAB

    2001-01-01

    Full Text Available A white Shannon-type trap was used for captures of female sand flies in the search for natural infection with flagellates, however, due to its low productivity and as a large number of phlebotomines settled on the researchers' black clothes, we decided to compare the relative attractiveness of black and white Shannon-type traps for sand flies. Several pairs of black and white traps were placed side by side in front of caves in four areas in the Serra da Bodoquena, Bonito county, State of Mato Grosso do Sul, Brazil, for a total of 12 observations and 44 h of capture. The experiment resulted in 889 phlebotomines captured, 801 on the black and 88 on the white trap, representing 13 species. The hourly Williams' means were 8.67 and 1.24, respectively, and the black/white ratio was 7.0:1.0. Lutzomyia almerioi, an anthropophilic species closely associated with caves, was predominant (89%. Only two other species, Nyssomyia whitmani and Psathyromyia punctigeniculata, also anthropophilic, were significantly attracted to the black rather than to the white trap (chi2 test; p <= 0.01. The difference between the diversity index of the two traps was not significant at level 0.05. The black trap in these circumstances was much more productive than the white, especially for anthropophilic species.

  4. Attraction of Investment in Agriculture of Kazakhstan

    Directory of Open Access Journals (Sweden)

    Dinar Abdrakhmanova

    2014-11-01

    Full Text Available Characteristic for conditions competition increase in the market of the investments, interfaced to world financial crisis, makes superrigid deman ds to investment decisions. In similar conditions the exit on the capital markets is one of the key advantages, providing to the enterprises their further development. Attraction of investments is interfaced to a number of difficulties. In connection with shortage of own means for financing of investment activity of the organizations by the basic source of financing there was an extra financing. Necessity of considerable volume of financial resources on development of investment projects does their attraction by a paramount problem of the enterprises-borrowers. Availability of credit sources of financing is limited both because of the high price of the extra capital, and owing to inability of the enterprises-borrowers to interest potential creditors in realization of investment projects. It causes necessity of an economic justification of efficiency and appeal of investment investments. Only having defined, what concrete parameters the company should possess, and having developed concrete ways and indicators of achievement of these parameters, it is possible in modern conditions effectively to develop business. Such aspiration creates investment appeal and is realized by means of basic tools considered in given work.

  5. PREFACE: 16th International Conference on Calorimetry in High Energy Physics (CALOR 2014)

    Science.gov (United States)

    Novotny, Rainer W.

    2015-02-01

    The XVIth International Conference on Calorimetry in High Energy Physics - CALOR 2014 - was held in Giessen, Germany from 6-11 April 2014 at the Science Campus of the University. It was hosted by the Justus-Liebig-University and the HIC for FAIR Helmholtz International Center. The series of conferences on calorimetry were started in 1990 at Fermilab and are focusing primarily on operating and future calorimeter systems within the Hadron and High-Energy Physics community without neglecting the impact on other fields such as Astrophysics or Medical Imaging. Confirmed by the impressive list of over 70 oral presentations, 5 posters and over 100 attendees, the field of calorimetry appears alive and attractive. The present volume contains the written contributions of almost all presentations which can be found at http://calor2014.de. Time slots of 15 or 30 minutes including discussion were allocated. The conference was accompanied by a small exhibition of several industrial companies related to the field. The day before the opening of the scientific program, Richard Wigmans gave an excellent and vivid tutorial on basic aspects on calorimetry meant as an introduction for students and conference attendees new in the field. The opening ceremony was used to give an impression of the present and future status and the scientific program of the new FAIR facility nearby at Darmstadt presented by Klaus Peters from GSI. The conference program of the first day was dedicated to the performance and required future upgrade of the LHC experiments, dominated by ATLAS, CMS and LHCb. The program of the next day contained specific aspects on electronics and readout as well as calorimetry in outer space. Several contributions discussed in detail new concepts for hadron calorimeters within the CALICE collaboration completed by a session on sampling calorimeters. The next sections were dedicated to operating and future calorimeters at various laboratories and covering a wide range of

  6. PREFACE: Asia-Pacific Interdisciplinary Research Conference 2011 (AP-IRC 2011)

    Science.gov (United States)

    Sandhu, Adarsh; Okada, Hiroshi; Maekawa, Toru; Okano, Ken

    2012-03-01

    AP-IRC Logo Scientists, engineers, entrepreneurs and policymakers gather at the first truly interdisciplinary conference held in Asia-Pacific http://www.apirc.jp/ The inaugural Asia-Pacific Interdisciplinary Research Conference 2011 (AP-IRC 2011) was held at Toyohashi University of Technology (Toyohashi Tech) on 17-18 November 2011. The conference is a forum for enhancing mutual understanding between scientists, engineers, policymakers and experts from a wide spectrum of pure and applied sciences, to resolve the daunting global issues facing mankind. The conference attracted approximately 300 participants including delegates from France, Germany, India, Indonesia, Korea, Malaysia, Russia, Sweden, United Kingdom, USA and Vietnam. AP-IRC 2011 was chaired by Dr Yoshiyuki Sakaki, President of Toyohashi Tech, who opened the proceedings by stressing the importance of an interdisciplinary approach to research, to resolve global scientific and technical issues. Recalling his own experience as the leader of Japan's efforts in the Human Genome Project, Sakaki also encouraged participants to make an effort to try to understand the sometimes difficult concepts and terminology of other areas of research. The presentations at AP-IRC 2011 were divided into three focus sessions: innovative mechano-magneto-electronic systems, life sciences, and green science and technology. A total of 174 papers were presented over the two-day conference including eight by invited speakers. Highlights of AP-IRC 2011 included a first-hand account of the damage caused by the massive earthquake in March 2011 to experimental facilities at Tohoku University by Masayoshi Esashi; the fascinating world of bees and the inborn numerical competence of humans and animals by Hans J Gross; research on robots and cognition-enabled technical systems at Technische Universität München by Sandra Hirche; the history of events leading to the invention of the world's strongest NdFeB permanent magnet by Masato Sagawa

  7. A transnational conference romance: Elsie Andrews, Hildegarde Kneeland, and the Pan-Pacific Women's Association.

    Science.gov (United States)

    Laurie, Alison J

    2009-01-01

    Elsie Andrews, a feminist activist from New Zealand, met Dr. Hildegarde Kneeland, a progressive economist from the United States, at the 1934 Pan-Pacific Women's Association conference in Honolulu. Andrews wrote diaries of her attendance at conferences, and in these writes openly of her attraction and romantic feelings for Kneeland, despite her own long-term domestic partnership back in New Plymouth with Muriel Kirton. This article considers the role conference romances may have played for Andrews and others in encouraging their interest in women's organizations, in the context of literature on romantic friendships and lesbianism.

  8. NSS5/SP-STM2 Joint International Conference

    Energy Technology Data Exchange (ETDEWEB)

    Saw-Wai Hla

    2009-05-03

    The NSS5/SP-STM2 conference was held in Athens, Ohio July 15-19, 2008. The conference brought together a prestigious group of scientists from all over the globe to focus for 3 ½ days on a variety of nanoscience topics, particularly on nanoscale spectroscopy and spin-polarized scanning tunneling microscopy. The conference was attended by many young scientists as well as senior scientists. Attendees to the conference were drawn from more than 10 countries and included 28 invited speakers, who are the leading scientists in their respective research areas. Included among the invited speakers were 4 plenary speakers - eminent scientists in their fields. The conference was divided into two parallel sessions – the NSS5 session and the SP-STM2 session.

  9. Attracting Interest: Dynamic Displays of Proceptivity Increase the Attractiveness of Men and Women

    Directory of Open Access Journals (Sweden)

    Andrew P. Clark

    2008-10-01

    Full Text Available Proceptive signals may influence judgments of opposite-sex attractiveness because these signals indicate high mate quality and/or non-threatening behavior but they may also signal high probable rate of return for mating effort. If so, individuals observing these signals may be sensitive to where the signals are directed to; signals directed toward other individuals may not predict what signals would be directed toward the observer. To explore these possibilities I made use of video stimuli composed of mock interviews with actors. Each actor did one proceptive and one unreceptive interview. Each interview was presented as being directed toward participants or toward an opposite sex interviewer. Proceptivity enhanced the attractiveness of opposite-sex actors and an interaction between proceptive state and signal direction was found, with this pattern varying substantially between actors. The possibility that this variation is mediated by the physical attractiveness and sex of the actors will be discussed.

  10. The attractions of medicine: the generic motivations of medical school applicants in relation to demography, personality and achievement.

    Science.gov (United States)

    McManus, I C; Livingston, G; Katona, Cornelius

    2006-02-21

    The motivational and other factors used by medical students in making their career choices for specific medical specialities have been looked at in a number of studies in the literature. There are however few studies that assess the generic factors which make medicine itself of interest to medical students and to potential medical students. This study describes a novel questionnaire that assesses the interests and attractions of different aspects of medical practice in a varied range of medical scenarios, and relates them to demographic, academic, personality and learning style measures in a large group of individuals considering applying to medical school. A questionnaire study was conducted among those attending Medlink, a two-day conference for individuals considering applying to medical school for a career in medicine. The main outcome measure was the Medical Situations Questionnaire, in which individuals ranked the attraction of three different aspects of medical practise in each of nine detailed, realistic medical scenarios in a wide range of medical specialities. As well as requiring clear choices, the questionnaire was also designed so that all of the possible answers were attractive and positive, thereby helping to eliminate social demand characteristics. Factor analysis of the responses found four generic motivational dimensions, which we labelled Indispensability, Helping People, Respect and Science. Background factors assessed included sex, ethnicity, class, medical parents, GCSE academic achievement, the 'Big Five' personality factors, empathy, learning styles, and a social desirability scale. 2867 individuals, broadly representative of applicants to medical schools, completed the questionnaire. The four generic motivational factors correlated with a range of background factors. These correlations were explored by multiple regression, and by path analysis, using LISREL to assess direct and indirect effects upon the factors. Helping People was

  11. The attractions of medicine: the generic motivations of medical school applicants in relation to demography, personality and achievement

    Directory of Open Access Journals (Sweden)

    Katona Cornelius

    2006-02-01

    Full Text Available Abstract Background The motivational and other factors used by medical students in making their career choices for specific medical specialities have been looked at in a number of studies in the literature. There are however few studies that assess the generic factors which make medicine itself of interest to medical students and to potential medical students. This study describes a novel questionnaire that assesses the interests and attractions of different aspects of medical practice in a varied range of medical scenarios, and relates them to demographic, academic, personality and learning style measures in a large group of individuals considering applying to medical school. Methods A questionnaire study was conducted among those attending Medlink, a two-day conference for individuals considering applying to medical school for a career in medicine. The main outcome measure was the Medical Situations Questionnaire, in which individuals ranked the attraction of three different aspects of medical practise in each of nine detailed, realistic medical scenarios in a wide range of medical specialities. As well as requiring clear choices, the questionnaire was also designed so that all of the possible answers were attractive and positive, thereby helping to eliminate social demand characteristics. Factor analysis of the responses found four generic motivational dimensions, which we labelled Indispensability, Helping People, Respect and Science. Background factors assessed included sex, ethnicity, class, medical parents, GCSE academic achievement, the 'Big Five' personality factors, empathy, learning styles, and a social desirability scale. Results 2867 individuals, broadly representative of applicants to medical schools, completed the questionnaire. The four generic motivational factors correlated with a range of background factors. These correlations were explored by multiple regression, and by path analysis, using LISREL to assess direct and

  12. Understanding attractiveness in business relationships - A complete literature review

    DEFF Research Database (Denmark)

    Mortensen, M. H.

    2012-01-01

    The concept of attraction has received surprisingly little attention within business relationship research. Yet, recently, more and more authors have argued that attraction may contribute to the motivation and willingness of a buyer and supplier to engage in and develop a business relationship...... or resolve a particular construct: 1) attraction in the development of buyer-supplier relationships, 2) customer attractiveness to suppliers, and 3) attractiveness in portfolio and key account management. This literature review contributes to the understanding of how knowledge of the power of attraction...... could enrich the theory and practice of business relationships. (C) 2012 Elsevier Inc. All rights reserved....

  13. European Conference on Health Economics.

    Science.gov (United States)

    Malmivaara, Antti

    2010-12-01

    The biennial European Conference on Health Economics was held in Finland this year, at the Finlandia Hall in the centre of Helsinki. The European conferences rotate among European countries and fall between the biennial world congresses organized by the International Health Economics Association (iHEA). A record attendance of approximately 800 delegates from 50 countries around the world were present at the Helsinki conference. The theme of the conference was 'Connecting Health and Economics'. All major topics of health economics were covered in the sessions. For the first time, social care economics was included in the agenda of the European Conference as a session of its own.

  14. Effects of Counselor Disability Status on Disabled Subjects' Perceptions of Counselor Attractiveness and Expertness.

    Science.gov (United States)

    Strohmer, Douglas C.; Biggs, Donald A.

    1983-01-01

    Studied the influence of client-counselor group membership similarity, counselor reputation cues, and attending behavior on disabled subject's perceptions. Physically disabled adults (N=40) viewed a series of vignettes and rated counselor expertness and attractiveness. Results do not support the belief that client-counselor group membership…

  15. Energy Conferences and Symposia; (USA)

    Energy Technology Data Exchange (ETDEWEB)

    Osborne, J.H.; Simpson, W.F. Jr. (eds.)

    1991-01-01

    Energy Conferences and Symposia, a monthly publication, was instituted to keep scientists, engineers, managers, and related energy professionals abreast of meetings sponsored by the Department of Energy (DOE) and by other technical associations. Announcements cover conference, symposia, workshops, congresses, and other formal meetings pertaining to DOE programmatic interests. Complete meeting information, including title, sponsor, and contact, is presented in the main section, which is arranged alphabetically by subject area. Within a subject, citations are sorted by beginning data of the meeting. New listings are indicated by a bullet after the conference number and DOE-sponsored conferences are indicated by a star. Two indexes are provided for cross referencing conference information. The Chronological Index lists conference titles by dates and gives the subject area where complete information they may be found. The Location Index is alphabetically sorted by the city where the conference will be held.

  16. Computational Intelligence : International Joint Conference

    CERN Document Server

    Rosa, Agostinho; Cadenas, José; Dourado, António; Madani, Kurosh; Filipe, Joaquim

    2016-01-01

    The present book includes a set of selected extended papers from the sixth International Joint Conference on Computational Intelligence (IJCCI 2014), held in Rome, Italy, from 22 to 24 October 2014. The conference was composed by three co-located conferences:  The International Conference on Evolutionary Computation Theory and Applications (ECTA), the International Conference on Fuzzy Computation Theory and Applications (FCTA), and the International Conference on Neural Computation Theory and Applications (NCTA). Recent progresses in scientific developments and applications in these three areas are reported in this book. IJCCI received 210 submissions, from 51 countries, in all continents. After a double blind paper review performed by the Program Committee, 15% were accepted as full papers and thus selected for oral presentation. Additional papers were accepted as short papers and posters. A further selection was made after the Conference, based also on the assessment of presentation quality and audience in...

  17. 11th International Conference Mechatronics

    CERN Document Server

    Brezina, Tomas

    2016-01-01

    Focusing on the most rapidly changing areas of mechatronics, this book discusses signals and system control, mechatronic products, metrology and nanometrology, automatic control & robotics, biomedical engineering, photonics, design manufacturing and testing of MEMS. It is reflected in the list of contributors, including an international group of 302 leading researchers representing 12 countries. The book is intended for use in academic, government and industry R&D departments, as an indispensable reference tool for the years to come. Thid volume can serve a global community as the definitive reference source in Mechatronics. The book comprises carefully selected 93 contributions presented at the 11th International Conference Mechatronics 2015, organized by Faculty of Mechatronics, Warsaw University of Technology, on September 21-23, in Warsaw, Poland. .

  18. 8th International Conference on Boundary Element Methods

    CERN Document Server

    Brebbia, C

    1986-01-01

    The International Conference on Boundary Element Methods in Engineering was started in 1978 with the following objectives: i) To act as a focus for BE research at a time when the technique wasjust emerging as a powerful tool for engineering analysis. ii) To attract new as weIl as established researchers on Boundary Elements, in order to maintain its vitality and originality. iii) To try to relate the Boundary Element Method to other engineering techniques in an effort to help unify the field of engineering analysis, rather than to contribute to its fragmentation. These objectives were achieved during the last 7 conferences and this meeting - the eighth - has continued to be as innovative and dynamic as any ofthe previous conferences. Another important aim ofthe conference is to encourage the participation of researchers from as many different countries as possible and in this regard it is a policy of the organizers to hold the conference in different locations. It is easy to forget when working on scientific ...

  19. Proceedings of the WIN-Global 2008 conference

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2008-07-01

    WiN-France hosted the 16. WIN-Global conference May 26-30, 2008, in Marseille, France. The conference was attended by over 150 delegates, representing 30 countries. Canadian participants, from many diverse backgrounds, attended the annual conference from AECL, Bruce Power, CNSC, NB Power and OPG. The theme: Maintaining Key Competencies, Arising Key Competencies for Nuclear Energy: A Challenge and Opportunity for Diversity Development, emphasized the challenges ahead in providing a skilled workforce for the nuclear renaissance, as new build projects and a vast number of retirements are expected around the world within the next 5 years. The conference addressed such questions as 'How will nuclear, attract, develop and retain staff?' A technical tour of Marcoule invited conference attendees to visit one of: Atalante, a high level nuclear chemistry laboratory; Phenix, a fast breeding research reactor; or AVM, a vitrification plant. A subsequent technical tour visited Cadarache providing the opportunity to view ITER, the international fusion research project.

  20. PREFACE: The Second Conference on Microelectronics, Microsystems and Nanotechnology

    Science.gov (United States)

    Nassiopoulou, Androula G.; Papanikolaou, Nikos; Tsamis, Christos

    2005-01-01

    The Second Conference on Microelectronics, Microsystems and Nanotechnology took place at the National Centre for Scientific Research `Demokritos', in Athens, Greece, between 14 and 17 November 2004. The conference was organized by the Institute of Microelectronics (IMEL) with the aim to bring together scientists and engineers working in the above exciting fields in an interactive forum. The conference included 45 oral presentations with 9 invited papers and was attended by 146 participants from 16 countries. The topics covered were nanotechnologies, quantum devices, sensors, micro- and nano-systems, semiconductor devices, C-MOS fabrication and characterization techniques, new materials, and IC design. Quantum devices and nanostructured materials attracted considerable attention. Both theoretical and experimental studies of metallic and semiconducting quantum systems were presented, with emphasis on their applications in electronics, optoelectronics, and nanocrystal memory devices. Another exciting topic was the recent developments in biocompatible lithographic processes for applications in biosensors. In particular novel processes for bio-friendly lithography, together with innovations in Si sensors for applications in medicine and food industry were presented. Recent developments and perspectives in CMOS technology towards the ultimate limit were also discussed. The conference covered issues and concepts of IC design with two invited talks on RF design and cryptography.The conference included presentations from several companies active in the field of microelectronics and systems in Greece.

  1. PROMOTING AND ATTRACTING FOREIGN DIRECT INVESTMENT

    Directory of Open Access Journals (Sweden)

    Elena CHIRILA DONCIU

    2014-09-01

    Full Text Available FDI is an important element of the economic development of any country and its functioning on market principles. They have a great importance for strengthening the economy of countries in transition and their integration into the world’s economy. The modernization of national economies occurs with FDI help, by implementing advanced technologies, know-how sites, the most powerful equipment and the new quality standards by switching to a higher type of growth. The purpose of this research is to identify of the policies to attract and promote FDI, adopted by host countries for foreign investors and are highlighted beneficial aspects of foreign investments flows on recipient economies. The research results show that policies aimed at ensuring access to foreign markets, those that are considering providing commercial facilities and last, but not least, policies focused on tax incentives are very important for foreign investors.

  2. Attracting the attention of a fly.

    Science.gov (United States)

    Sareen, Preeti; Wolf, Reinhard; Heisenberg, Martin

    2011-04-26

    Organisms with complex visual systems rarely respond to just the sum of all visual stimuli impinging on their eyes. Often, they restrict their responses to stimuli in a temporarily selected region of the visual field (selective visual attention). Here, we investigate visual attention in the fly Drosophila during tethered flight at a torque meter. Flies can actively shift their attention; however, their attention can be guided to a certain location by external cues. Using visual cues, we can direct the attention of the fly to one or the other of the two visual half-fields. The cue can precede the test stimulus by several seconds and may also be spatially separated from the test by at least 20° and yet attract attention. This kind of external guidance of attention is found only in the lower visual field.

  3. Basins of Attraction for Generative Justice

    Science.gov (United States)

    Eglash, Ron; Garvey, Colin

    It has long been known that dynamic systems typically tend towards some state - an "attractor" - into which they finally settle. The introduction of chaos theory has modified our understanding of these attractors: we no longer think of the final "resting state" as necessarily being at rest. In this essay we consider the attractors of social ecologies: the networks of people, technologies and natural resources that makeup our built environments. Following the work of "communitarians" we posit that basins of attraction could be created for social ecologies that foster both environmental sustainability and social justice. We refer to this confluence as "generative justice"; a phrase which references both the "bottom-up", self-generating source of its adaptive meta stability, as well as its grounding in the ethics of egalitarian political theory.

  4. How calcium makes endocytic receptors attractive

    DEFF Research Database (Denmark)

    Andersen, Christian B F; Moestrup, Søren K

    2014-01-01

    Nutrients, biological waste-products, toxins, pathogens, and other ligands for endocytosis are typically captured by multidomain receptors with multiligand specificity. Upon internalization, the receptor-ligand complex segregates, followed by lysosomal degradation of the ligand and recycling...... of the receptor. Endosomal acidification and calcium efflux lead to the essential ligand-receptor affinity switch and separation. Recent data, including crystal structures of receptor-ligand complexes, now reveal how calcium, in different types of domain scaffolds, functions in a common way as a removable...... 'lynchpin' that stabilizes favorable positioning of ligand-attractive receptor residues. In addition to explaining how calcium depletion can cause ligand-receptor dissociation, the new data add further insight into how acidification contributes to dissociation through structural changes that affect...

  5. Trip Generation Model Based on Destination Attractiveness

    Institute of Scientific and Technical Information of China (English)

    YAO Liya; GUAN Hongzhi; YAN Hai

    2008-01-01

    Traditional trip generation forecasting methods use unified average trip generation rates to determine trip generation volumes in various traffic zones without considering the individual characteristics of each traffic zone.Therefore,the results can have significant errors.To reduce the forecasting error produced by uniform trip generation rates for different traffic zones,the behavior of each traveler was studied instead of the characteristics of the traffic zone.This paper gives a method for calculating the trip efficiency and the effect of traffic zones combined with a destination selection model based on disaggregate theory for trip generation.Beijing data is used with the trip generation method to predict trip volumes.The results show that the disaggregate model in this paper is more accurate than the traditional method.An analysis of the factors influencing traveler behavior and destination selection shows that the attractiveness of the traffic zone strongly affects the trip generation volume.

  6. A Model of Lexical Attraction and Repulsion

    CERN Document Server

    Beeferman, D; Lafferty, G D; Beeferman, Doug; Berger, Adam; Lafferty, John

    1997-01-01

    This paper introduces new methods based on exponential families for modeling the correlations between words in text and speech. While previous work assumed the effects of word co-occurrence statistics to be constant over a window of several hundred words, we show that their influence is nonstationary on a much smaller time scale. Empirical data drawn from English and Japanese text, as well as conversational speech, reveals that the ``attraction'' between words decays exponentially, while stylistic and syntactic contraints create a ``repulsion'' between words that discourages close co-occurrence. We show that these characteristics are well described by simple mixture models based on two-stage exponential distributions which can be trained using the EM algorithm. The resulting distance distributions can then be incorporated as penalizing features in an exponential language model.

  7. Solvation effects on like-charge attraction.

    Science.gov (United States)

    Ghanbarian, Shahzad; Rottler, Jörg

    2013-02-28

    We present results of molecular dynamics simulations of the electrostatic interaction between two parallel charged rods in the presence of divalent counterions. Such polyelectrolytes have been considered as a simple model for understanding electrostatic interactions in highly charged biomolecules such as DNA. Since there are correlations between the free charge carriers, the phenomenon of like charge attraction appears for specific parameters. We explore the role of solvation effects and the resulting deviations from Coulomb's law on the nanoscale on this peculiar phenomenon. The behavior of the force between the charged rods in a simulation with atomistic representation of water molecules is completely different from a model in which water is modeled as a continuum dielectric. By calculating counterion-rodion pair correlation functions, we find that the presence of water molecules changes the structure of the counterion cloud and results in both qualitative and quantitative changes of the force between highly charged polyelectrolytes.

  8. Tunneling conductivity in composites of attractive colloids.

    Science.gov (United States)

    Nigro, B; Grimaldi, C; Miller, M A; Ryser, P; Schilling, T

    2012-04-28

    In conductor-insulator nanocomposites in which conducting fillers are dispersed in an insulating matrix, the electrical connectedness is established by inter-particle tunneling or hopping processes. These systems are intrinsically non-percolative and a coherent description of the functional dependence of the conductivity σ on the filler properties, and in particular of the conductor-insulator transition, requires going beyond the usual continuum percolation approach by relaxing the constraint of a fixed connectivity distance. In this article, we consider dispersions of conducting spherical particles which are connected to all others by tunneling conductances and which are subjected to an effective attractive square-well potential. We show that the conductor-insulator transition at low contents φ of the conducting fillers does not determine the behavior of σ at larger concentrations, in striking contrast to what is predicted by percolation theory. In particular, we find that at low φ the conductivity is governed almost entirely by the stickiness of the attraction, while at larger φ values σ depends mainly on the depth of the potential well. As a consequence, by varying the range and depth of the potential while keeping the stickiness fixed, composites with similar conductor-insulator transitions may display conductivity variations of several orders of magnitude at intermediate and large φ values. By using a recently developed effective medium theory and the critical path approximation, we explain this behavior in terms of dominant tunneling processes which involve inter-particle distances spanning different regions of the square-well fluid structure as φ is varied. Our predictions could be tested in experiments by changing the potential profile with different depletants in polymer nanocomposites.

  9. Indico CONFERENCE tutorial

    CERN Document Server

    CERN. Geneva; Manzoni, Alex Marc

    2017-01-01

    This short tutorial explains how to create a CONFERENCE in indico and how to handle abstracts and registration forms, in detail: Timestamps: 1:01 - Programme  2:28 - Call for abstracts  11:50 - Abstract submission  13:41 - Abstract Review 15:41 - The Judge's Role 17:23 - Registration forms' creation 23:34 - Candidate participant's registration/application 25:54 - Customisation of Indico pages - Layout 28:08 - Customisation of Indico pages - Menus 29:47 - Configuring Event reminders and import into calendaring tools   See HERE a recent presentation by Pedro about the above steps in the life of an indico CONFERENCE event.

  10. Metabolic Engineering VII Conference

    Energy Technology Data Exchange (ETDEWEB)

    Kevin Korpics

    2012-12-04

    The aims of this Metabolic Engineering conference are to provide a forum for academic and industrial researchers in the field; to bring together the different scientific disciplines that contribute to the design, analysis and optimization of metabolic pathways; and to explore the role of Metabolic Engineering in the areas of health and sustainability. Presentations, both written and oral, panel discussions, and workshops will focus on both applications and techniques used for pathway engineering. Various applications including bioenergy, industrial chemicals and materials, drug targets, health, agriculture, and nutrition will be discussed. Workshops focused on technology development for mathematical and experimental techniques important for metabolic engineering applications will be held for more in depth discussion. This 2008 meeting will celebrate our conference tradition of high quality and relevance to both industrial and academic participants, with topics ranging from the frontiers of fundamental science to the practical aspects of metabolic engineering.

  11. 7th IAASS Conference

    CERN Document Server

    Rongier, Isabelle

    2015-01-01

    The 7th IAASS Conference, “Space Safety is No Accident” is an invitation to reflect and exchange information on a number of topics in space safety and sustainability of national and international interest. The conference is also a forum to promote mutual understanding, trust and the widest possible international cooperation in such matters. The once exclusive “club” of nations with autonomous sub-orbital and orbital space access capabilities is becoming crowded with fresh and ambitious new entrants. New commercial spaceports are starting operations and others are being built. In the manned spaceflight arena a commercial market is becoming a tangible reality with suborbital spaceflights and government use of commercial services for cargo and crew transportation to orbit. Besides the national ambitions in space, the international cooperation both civil and commercial is also gaining momentum. In the meantime robotic space exploration will accelerate and with it the need to internationally better regulat...

  12. XIX Edoardo Amaldi Conference

    CERN Document Server

    Abousahl, Said; Plastino, Wolfango

    2016-01-01

    This book, comprising contributions presented at the XIX Edoardo Amaldi Conference, examines important aspects of international cooperation aimed at enhancing nuclear safety, security, safeguards (the “3S”), and non-proliferation, thereby assisting in the development and maintenance of the verification regime and progress toward a nuclear weapon-free world. The Conference served as a forum where eminent scientists, diplomats, and policymakers could compare national perspectives and update international collaborations. The book opens by addressing the political, institutional, and legal dimensions of the 3S and non-proliferation; current challenges are discussed and attempts made to identify possible solutions and future improvements. Subsequent sections consider scientific developments that can contribute to increased effectiveness in the implementation of international regimes, particularly in critical areas, technology foresight, and the ongoing evaluation of current capabilities. The closing sections d...

  13. 2013 APPLEPIES Conference

    CERN Document Server

    2014-01-01

    This book provides a thorough overview of cutting-edge research on electronics applications relevant to industry, the environment, and society at large. A wide spectrum of application domains are covered, from automotive to space and from health to security, and special attention is devoted to the use of embedded devices and sensors for imaging, communication, and control. The book is based on the 2013 APPLEPIES Conference, held in Rome, which brought together researchers and stakeholders to consider the most significant current trends in the field of applied electronics and to debate visions for the future. Areas covered by the conference included information communication technology; biotechnology and biomedical imaging; space; secure, clean, and efficient energy; the environment; and smart, green, and integrated transport. As electronics technology continues to develop apace, constantly meeting previously unthinkable targets, further attention needs to be directed toward the electronics applications and th...

  14. Mississippi Climate & Hydrology Conference

    Energy Technology Data Exchange (ETDEWEB)

    Lawford, R.; Huang, J.

    2002-05-01

    The GEWEX Continental International Project (GCIP), which started in 1995 and completed in 2001, held its grand finale conference in New Orleans, LA in May 2002. Participants at this conference along with the scientists funded through the GCIP program are invited to contribute a paper to a special issue of Journal of Geophysical Research (JGR). This special JGR issue (called GCIP3) will serve as the final report on scientific research conducted by GCIP investigators. Papers are solicited on the following topical areas, but are not limited to, (1) water energy budget studies; (2) warm season precipitation; (3) predictability and prediction system; (4) coupled land-atmosphere models; (5) climate and water resources applications. The research areas cover observations, modeling, process studies and water resources applications.

  15. Moldova. Historic regional conference.

    Science.gov (United States)

    Moshin, V

    1995-05-01

    The Directorate of Maternal and Child Health and the Family Planning Association of Moldova organized a regional conference, which was held October 18-19, 1994, in Kishinev, Moldova, with the support of the United Nations Population Fund (UNFPA), the World Health Organization (WHO), and the International Planned Parenthood Federation (IPPF). The conference,"Problems of Family Planning in Eastern Europe," was attended by approximately 400 Moldovan delegates of governmental and nongovernmental organizations (NGOs), and by 25 delegates from Romania, Russia, Belarus, the Ukraine, and Georgia. The President of Moldova and the Ministry of Public Health of Moldova gave their approval. The main objectives of the conference were to inform the public about the recommendations of the ICPD, to analyze the status of women's reproductive health and family planning in Eastern Europe, and to find ways of implementing the ICPD Plan of Action. Major problems identified during the conference were: 1) the social and economic problems facing most families; 2) the high rate of morbidity and mortality; 3) the decrease in birth rate; 4) the increase in abortions; 5) the rising incidence of venereal disease; and 6) the absence of an effective family planning system. It was agreed that cooperation between governments and NGOs is essential in designing population programs for each country. The following goals were set: 1) to provide populations with sufficient contraceptives; 2) to actively promote family planning concepts through the mass media; 3) to train specialists and to open family planning offices and centers; 4) to introduce sex education in the curricula of Pedagogical Institutes; and 5) to create national and regional statistical and sociological databases on population issues.

  16. Genome sequencing conference II

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    Genome Sequencing Conference 2 was held September 30 to October 30, 1990. 26 speaker abstracts and 33 poster presentations were included in the program report. New and improved methods for DNA sequencing and genetic mapping were presented. Many of the papers were concerned with accuracy and speed of acquisition of data with computers and automation playing an increasing role. Individual papers have been processed separately for inclusion on the database.

  17. Strangers With Benefits: Attraction to Outgroup Men Increases as Fertility Increases Across the Menstrual Cycle.

    Science.gov (United States)

    Salvatore, Joseph F; Meltzer, Andrea L; March, David S; Gaertner, Lowell

    2016-11-20

    Research typically reveals that outgroups are regarded with disinterest at best and hatred and enmity at worst. Working from an evolutionary framework, we identify a unique pattern of outgroup attraction. The small-group lifestyle of pre-human ancestors plausibly limited access to genetically diverse mates. Ancestral females may have solved the inbreeding dilemma while balancing parental investment pressures by mating with outgroup males either via converting to an outgroup or cuckolding the ingroup. A vestige of those mating strategies might manifest in human women as a cyclic pattern of attraction across the menstrual cycle, such that attraction to outgroup men increases as fertility increases across the cycle. Two studies, one using a longitudinal method and the other an experimental method, evidenced the hypothesized linear relationship between attraction to outgroup men and fertility in naturally cycling women.

  18. Role of Physical Attractiveness in Peer Attribution of Psychological Disturbance

    Science.gov (United States)

    Cash, Thomas F.; And Others

    1977-01-01

    The physical attractiveness stereotype was examined as it pertains to the attribution of psychological disturbance among peers. Consistent with the stereotype, attractive interviewees were judged as less disturbed with better prognosis than unattractive interviewees. (Author)

  19. Role of Physical Attractiveness in Peer Attribution of Psychological Disturbance

    Science.gov (United States)

    Cash, Thomas F.; And Others

    1977-01-01

    The physical attractiveness stereotype was examined as it pertains to the attribution of psychological disturbance among peers. Consistent with the stereotype, attractive interviewees were judged as less disturbed with better prognosis than unattractive interviewees. (Author)

  20. Multiple male traits interact: attractive bower decorations facilitate attractive behavioural displays in satin bowerbirds.

    Science.gov (United States)

    Patricelli, Gail L; Uy, J Albert C; Borgia, Gerald

    2003-11-22

    Sexually selected male courtship displays often involve multiple behavioural and physical traits, but little is known about the function of different traits in mate choice. Here, we examine female courtship behaviours to learn how male traits interact to influence female mating decisions. In satin bowerbirds (Ptilonorhynchus violaceus), successful males give highly aggressive, intense behavioural displays without startling females. Males do this by modulating their displays in response to female crouching, which signals the display intensity that females will tolerate without being startled. Females typically visit multiple males for multiple courtships before choosing a mate, and females show differing tolerance for intense displays during their first courtship with each male. We test three hypotheses that may explain this: (i) familiarity with the courting male; (ii) the order of the courtship in mate-searching; and (iii) the attractiveness of the courting male. We found that females are more tolerant of intense displays during first courtships with attractive males; this increased female tolerance may allow attractive males to give higher intensity courtship displays that further enhance their attractiveness. We then examined why this is so, finding evidence that females are less likely to be startled by males with better physical displays (bower decorations), and this reduced startling then contributes to male courtship success. This role of physical displays in facilitating behavioural displays suggests a novel mechanism by which multiple physical and behavioural traits may influence female choice.