WorldWideScience

Sample records for grapevine rupestris stem

  1. Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors.

    Science.gov (United States)

    Bouamama-Gzara, Badra; Selmi, Ilhem; Chebil, Samir; Melki, Imene; Mliki, Ahmed; Ghorbel, Abdelwahed; Carra, Angela; Carimi, Francesco; Mahfoudhi, Naima

    2017-12-01

    Prospecting of local grapevine ( Vitis vinifera L.) germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3), Grapevine stem pitting associated virus (GRSPaV) and Grapevine virus A (GVA), were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. 'Hencha' were successfully induced from filament, when cultured on Chée and Pool (1987). based-medium, enriched with 2 mg 1 -1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1 -1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% 'Hencha' somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

  2. Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors

    Directory of Open Access Journals (Sweden)

    Badra Bouamama-Gzara

    2017-12-01

    Full Text Available Prospecting of local grapevine (Vitis vinifera L. germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3, Grapevine stem pitting associated virus (GRSPaV and Grapevine virus A (GVA, were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. ‘Hencha’ were successfully induced from filament, when cultured on Chée and Pool (1987. based-medium, enriched with 2 mg 1−1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1−1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% ‘Hencha’ somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

  3. General properties of grapevine viruses occurring in Hungary

    Directory of Open Access Journals (Sweden)

    Eszter Cseh

    2012-03-01

    Full Text Available The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV, Arabis mosaic virus (ArMV, Tomato black ring virus (TBRV, Grapevine chrome mosaic virus (GCMV, Alfalfa mosaic virus (AMV, Grapevine Bulgarian latent virus (GBLV, Grapevine fleck virus (GFkV, Grapevine leafroll- associated viruses (GLRaV1-4, Grapevine virus A (GVA, Grapevine virus B (GVB and Grapevine rupestris stem pitting- associated virus (GRSPaV have been reported in Hungary and characterized by conventional methods as woody indexing, herbaceous indexing and serological methods. Among grapevine viruses the Grapevine line pattern virus (GLPV seems to be uncial; because it was reported only in Hungary. Causal agents of several grapevine diseases, like enation, vein necrosis and vein mosaic remained undiscovered. These virus-like diseases occurred only sporadically, without economic importance.

  4. Localization and subcellular association of Grapevine Pinot Gris Virus in grapevine leaf tissues.

    Science.gov (United States)

    Tarquini, Giulia; Ermacora, Paolo; Bianchi, Gian Luca; De Amicis, Francesca; Pagliari, Laura; Martini, Marta; Loschi, Alberto; Saldarelli, Pasquale; Loi, Nazia; Musetti, Rita

    2018-05-01

    Despite the increasing impact of Grapevine Pinot gris disease (GPG-disease) worldwide, etiology about this disorder is still uncertain. The presence of the putative causal agent, the Grapevine Pinot Gris Virus (GPGV), has been reported in symptomatic grapevines (presenting stunting, chlorotic mottling, and leaf deformation) as well as in symptom-free plants. Moreover, information on virus localization in grapevine tissues and virus-plant interactions at the cytological level is missing at all. Ultrastructural and cytochemical investigations were undertaken to detect virus particles and the associated cytopathic effects in field-grown grapevine showing different symptom severity. Asymptomatic greenhouse-grown grapevines, which tested negative for GPGV by real time RT-PCR, were sampled as controls. Multiplex real-time RT-PCR and ELISA tests excluded the presence of viruses included in the Italian certification program both in field-grown and greenhouse-grown grapevines. Conversely, evidence was found for ubiquitous presence of Grapevine Rupestris Stem Pitting-associated Virus (GRSPaV), Hop Stunt Viroid (HSVd), and Grapevine Yellow Speckle Viroid 1 (GYSVd-1) in both plant groups. Moreover, in every field-grown grapevine, GPGV was detected by real-time RT-PCR. Ultrastructural observations and immunogold labelling assays showed filamentous flexuous viruses in the bundle sheath cells, often located inside membrane-bound organelles. No cytological differences were observed among field-grown grapevine samples showing different symptom severity. GPGV localization and associated ultrastructural modifications are reported and discussed, in the perspective of assisting management and control of the disease.

  5. Magnetic resonance imaging of water ascent in embolized xylem vessels of grapevine stem segments

    Science.gov (United States)

    Mingtao Wang; Melvin T. Tyree; Roderick E. Wasylishen

    2013-01-01

    Temporal and spatial information about water refilling of embolized xylem vessels and the rate of water ascent in these vessels is critical for understanding embolism repair in intact living vascular plants. High-resolution 1H magnetic resonance imaging (MRI) experiments have been performed on embolized grapevine stem segments while they were...

  6. Comparative evaluation of oxidative enzyme activities during adventitious rooting in the cuttings of grapevine rootstocks.

    Science.gov (United States)

    Kose, Cafer; Erdal, Serkan; Kaya, Ozkan; Atici, Okkeş

    2011-03-15

    This study investigated changes in peroxidase (POX) and polyphenol oxidase (PPO) activities through adventitious rooting in hardwood cuttings of grapevine rootstocks. Three grapevine rootstocks with different propensity to produce adventitious roots were selected: recalcitrant (Ramsey), non-recalcitrant (Rupestris du Lot) and intermediate (99R) cultivars. The averages of root number at 65 days were 96 in Lot, 76 in 99R and 30 in Ramsey. Both enzyme activities characteristically increased before adventitious rooting, regardless of rooting ability of the rootstocks, and then decreased. POX activity increased in Ramsey cuttings at 22 days, in Lot and 99R cuttings at 14 days after planting, and then decreased gradually until 51 days. The highest POX activity was determined in Ramsey rootstock with the highest rooting ability and the lowest activity was determined in the rootstocks with the lowest rooting ability. PPO activity gradually increased in Ramsey rootstock cuttings from 10 days to 22 days, in Lot and 99R cuttings at 14 days, and then decreased until 51 days. A significant correlation was identified between high POX activity and adventitious rooting capability in rootstocks, but the same result was not determined with PPO activity. A recalcitrant rooting variety cannot increase POX activity sufficiently before rooting. Therefore applications that could increase POX activity in stem cuttings during rooting may facilitate increased rooting in such rootstocks. Copyright © 2011 Society of Chemical Industry.

  7. Neofusicoccum parvum Colonization of the Grapevine Woody Stem Triggers Asynchronous Host Responses at the Site of Infection and in the Leaves

    Directory of Open Access Journals (Sweden)

    Mélanie Massonnet

    2017-06-01

    Full Text Available Grapevine trunk diseases cause important economic losses in vineyards worldwide. Neofusicoccum parvum, one of the most aggressive causal agents of the trunk disease Botryosphaeria dieback, colonizes cells and tissues of the grapevine wood, leading to the formation of an internal canker. Symptoms then extend to distal shoots, with wilting of leaves and bud mortality. Our aim was to characterize the transcriptional dynamics of grapevine genes in the woody stem and in the leaves during Neofusicoccum parvum colonization. Genome-wide transcriptional profiling at seven distinct time points (0, 3, and 24 hours; 2, 6, 8, and 12 weeks showed that both stems and leaves undergo extensive transcriptomic reprogramming in response to infection of the stem. While most intense transcriptional responses were detected in the stems at 24 hours, strong responses were not detected in the leaves until the next sampling point at 2 weeks post-inoculation. Network co-expression analysis identified modules of co-expressed genes common to both organs and showed most of these genes were asynchronously modulated. The temporal shift between stem vs. leaf responses affected transcriptional modulation of genes involved in both signal perception and transduction, as well as downstream biological processes, including oxidative stress, cell wall rearrangement and cell death. Promoter analysis of the genes asynchronously modulated in stem and leaves during N. parvum colonization suggests that the temporal shift of transcriptional reprogramming between the two organs might be due to asynchronous co-regulation by common transcriptional regulators. Topology analysis of stem and leaf co-expression networks pointed to specific transcription factor-encoding genes, including WRKY and MYB, which may be associated with the observed transcriptional responses in the two organs.

  8. Impact of tissue surface properties on the desorption electrospray ionization imaging of organic acids in grapevine stem.

    Science.gov (United States)

    Dong, Yonghui; Guella, Graziano; Franceschi, Pietro

    2016-03-30

    Desorption electrospray ionization (DESI) imaging is a fast analytical technique used to assess spatially resolved biological processes over unmodified sample surfaces. Although DESI profiling experiments have demonstrated that the properties of the sample surface significantly affect the outcomes of DESI analyses, the potential implications of these phenomena in imaging applications have not yet been explored extensively. The distribution of endogenous and exogenous organic acids in pith and out pith region of grapevine stems was investigated by using DESI imaging, ion chromatography and direct infusion methods. Several common normalization strategies to account for the surface effect, including TIC normalization, addition of the internal standard in the spray solvent and deposition of the standard over the sample surface, were critically evaluated. DESI imaging results show that, in our case, the measured distributions of these small organic acids are not consistent with their 'true' localizations within the tissues. Furthermore, our results indicate that the common normalization strategies are not able to completely compensate for the observed surface effect. Variations in the tissue surface properties across the tissue sample can greatly affect the semi-quantitative detection of organic acids. Attention should be paid when interpreting DESI imaging results and an independent analytical validation step is important in untargeted DESI imaging investigations. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Wild grapevine management

    Science.gov (United States)

    H. Clay Smith

    1989-01-01

    Wild grapevines are a problem for forest managers in many areas of the central hardwood forests. The vines grow on a wide range of soil and site conditions but usually are more concentrated on good sites (northern red oak site index 70 and above), on the faster growing more valuable timber. Presently there is more interest and concern in controlling grapevine for the...

  10. Effectiveness of some microorganisms in the limitation of grapevine cuttings infection by Phomopsis viticola Sacc.

    Directory of Open Access Journals (Sweden)

    Ewa Król

    2013-12-01

    Full Text Available The possibilities of using antagonistic fungi and bacteria in the limitation of grapevine stems infection by Phomopsis viticola Sacc. were studied. Trichodema koningii Oud., T.viride Persoon ex S.F.,T.harzianum Rifai, Gliocladium catenulatum Gilman and Abbott, G.fimbriatum Gilman and Abbott, Bacillus sp., Pseudomonas fluorescens and five unidentified isolates of bacteria i.e.: 22a, 35, 40, 45, 66 were estimated. It was appeared what Trichoderma spp. were the most effective in protection of grapevine stems against the infection by P.viticola. After these antagonistic fungi were used on protected grapevine canes not numerous necrosis were observed and few cultures of pathogen were reisolated from them. Moreover, Trichoderma spp. survived on the grapevine stems during the period of experiment. The abilities of other microorganisms tested to protect grapevine cuttings against P.viticola infection and to exist on the stems were less than Trichoderma spp.

  11. Identification of Repellent and Insecticidal Constituents of the Essential Oil of Artemisia rupestris L. Aerial Parts against Liposcelis bostrychophila Badonnel

    OpenAIRE

    Liu, Xin; Li, Yin; Li, He; Deng, Zhi; Zhou, Ligang; Liu, Zhi; Du, Shu

    2013-01-01

    The aim of this research was to determine the chemical composition and insecticidal and repellent activity of the essential oil of Artemisia rupestris L. aerial parts against the booklice Liposcelis bostrychophila Badonnel and isolation of insecticidal and repellent constituents from the essential oil. The essential oil of A. rupestris was obtained by hydrodistillation and analyzed by GC-MS. A total of 30 components of the essential oil of A. rupestris was identified and the principal compoun...

  12. Grapevine (Vitis vinifera L.).

    Science.gov (United States)

    Torregrosa, Laurent; Vialet, Sandrine; Adivèze, Angélique; Iocco-Corena, Pat; Thomas, Mark R

    2015-01-01

    Grapevine (Vitis) is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes, and the focus of this chapter is on wine grape cultivars. Grapevine cultivars of Vitis vinifera L. have a reputation for producing premium quality wines. These premium quality wines are produced from a small number of cultivars that enjoy a high level of consumer acceptance and are firmly entrenched in the market place because of varietal name branding and the association of certain wine styles and regions with specific cultivars. In light of this situation, grapevine improvement by a transgenic approach is attractive when compared to a classical breeding approach. The transfer of individual traits as single genes with a minimum disruption to the original genome would leave the traditional characteristics of the cultivar intact. However, a reliable transformation system is required for a successful transgenic approach to grapevine improvement. There are three criteria for achieving an efficient Agrobacterium-mediated transformation system: (1) the production of highly regenerative transformable tissue, (2) optimal cocultivation conditions for both grapevine tissue and Agrobacterium, and (3) an efficient selection regime for transgenic plant regeneration. In this chapter, we describe a grapevine transformation system that meets these criteria. We also describe a protocol for the production of transformed roots suitable for functional gene studies and for the production of semi-transgenic grafted plants.

  13. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  14. Respecting the Grapevine.

    Science.gov (United States)

    Carroll, David J.

    2001-01-01

    Administrators can create word-of-mouth communication that dispels negative attitudes and build good school reputations by discovering what parents and students are saying, targeting employee satisfaction and retention, providing excellent customer service, actively seeking and handling complaints, nurturing champions, and integrating "grapevine"…

  15. Phylogenetic relationships of Semaphore geckos (Squamata: Sphaerodactylidae: Pristurus) with an assessment of the taxonomy of Pristurus rupestris.

    Science.gov (United States)

    Badiane, Arnaud; Garcia-Porta, Joan; Červenka, Jan; Kratochvíl, Lukáš; Sindaco, Roberto; Robinson, Michael D; Morales, Hernan; Mazuch, Tomáš; Price, Thomas; Amat, Fèlix; Shobrak, Mohammed Y; Wilms, Thomas; Simó-Riudalbas, Marc; Ahmadzadeh, Faraham; Papenfuss, Theodore J; Cluchier, Alexandre; Viglione, Julien; Carranza, Salvador

    2014-07-09

    A molecular phylogeny of the sphaerodactylid geckos of the genus Pristurus is inferred based on an alignment of 1845 base pairs (bp) of concatenated mitochondrial (12S) and nuclear (acm4, cmos, rag1 and rag2) genes for 80 individuals, representing 18 of the 23-26 species, and the three subspecies of P. rupestris. The results indicate that P. rupestris is polyphyletic and includes two highly divergent clades: the eastern clade, found in coastal Iran and throughout the Hajar Mountain range in northern Oman and eastern UAE; and the western clade, distributed from central coastal Oman, through Yemen, Saudi Arabia and north to southern Jordan. Inferred haplotype networks for the four nuclear genes show that the eastern and western clades of "P. rupestris" are highly differentiated and do not share any alleles. Moreover, although the two clades are differentiated by a morphological multivariate analysis, no one character or set of characters was found to be diagnostic. Based on the molecular analysis of specimens from the type locality of P. rupestris rupestris, the name P. rupestris is applied to the eastern clade. The name that should apply to the western clade cannot be clarified until morphological and genetic data for "P. rupestris" is available from the vicinity of Bosaso, Somalia, and therefore we refer to it as Pristurus sp. 1. The phylogenetic tree of Pristurus supports the hypothesis that P. celerrimus is sister to all the other species in the analyses and that the Socotra Archipelago was independently colonized a minimum of two times.

  16. Forest management guidelines for controlling wild grapevines

    Science.gov (United States)

    H. Clay Smith

    1984-01-01

    Grapevines (Vitis spp.) are becoming a major problem to forest managers in the Appalachians, especially when clearcutting is done on highly productive hardwood sites. Where present, grapevines can reduce tree quality and growth, and eventually kill the tree. Silvical characteristics of grapevines are discussed as background for grapevine control....

  17. Biotechnological potential of the seaweed Cladophora rupestris (Chlorophyta, Cladophorales) lipidic extract.

    Science.gov (United States)

    Stabili, L; Acquaviva, M I; Biandolino, F; Cavallo, R A; De Pascali, S A; Fanizzi, F P; Narracci, M; Cecere, E; Petrocelli, A

    2014-09-25

    Recently, with the advent of modern technologies, various marine organisms including algae are being studied as sources of natural substances effective on classical microorganisms and able to also combat the new trend of acquired resistance in microbes. In the present study the antimicrobial activity of the lipidic extract of the green seaweed Cladophora rupestris collected in a Mediterranean area, in two sampling periods (January and April), was assayed. The chemical characterization of the lipidic fractions was performed by gas-chromatography and multinuclear and multidimensional NMR spectroscopy. In the lipidic extract of C. rupestris collected in January an antibacterial activity against Enterococcus sp., Streptococcus agalactiae and Vibrio cholerae non-O1 was recorded; by contrast, bacterial inhibition was measured on several Vibrio species only in April. The fatty acid profile of C. rupestris lipidic extract, analyzed by gas chromatography, resulted mainly composed of palmitic, myristic, oleic, α linolenic, palmitoleic and linoleic acids. Moreover, since α-linolenic acid was the predominant ω3 fatty acid in April, we suggest its involvement in the antibacterial activity observed in this month, taking also into account that pure α-linolenic acid resulted effective towards some vibrios strains. C. rupestris fatty acid profile revealed also an interesting composition in polyunsaturated fatty acids in both the considered periods with the ω6/ω3 ratio lower than 1, leading to conclude that this macroalga may be employed as a natural source of ω3. Finally, the (1)H NMR spectrum in CDCl3 of algal lipid fractions showed the characteristic signals of saturated (SAFAs) and unsaturated fatty acids (UFAs) as well as other metabolites and a marked difference in free fatty acids (FFAs) content for the two examined algal lipid fractions. It is noteworthy that C. rupestris lipidic extracts show, by NMR spectroscopy, the signal pattern of polyhydroxybutyrate, a natural

  18. ROOTSTOCK-SCION INTERACTION: 1. EFFECT ON THE YIELD COMPONENTS OF CABERNET SAUVIGNON GRAPEVINE

    Directory of Open Access Journals (Sweden)

    ALBERTO MIELE

    Full Text Available ABSTRACT The interaction between rootstock, scion and environment can induce different responses to the grapevine physiology. Thus, the aim of this study was to determine the rootstock effect on the yield components of Cabernet Sauvignon (CS grapevine grown in the Serra Gaúcha viticultural region. The experimental design was completely randomized blocks, with 15 treatments, three replicates and ten vines per plot. The results show that all variables evaluated were significantly affected by the year and the rootstock. The CS/Solferino was among other combinations influenced by the year and had higher significant yield/ vine. Indeed, it was higher than that CS/Rupestris du Lot, CS/101-14 Mgt., CS/3309 C, CS/5BB K, CS/161- 49 C, CS/1103 P. and CS/Isabel. The number of clusters/bud, per burst bud and per vine and the weight of clusters were affected by the rootstock as well. Pruning weight/vine, yield/pruning weight, leaf area/vine, leaf area index and leaf area/fresh fruit weight are variables related to the physiology of grapevine which were also affected by the rootstock. In general, rootstocks had adapted well to the environment where the experiment was carried out, giving vigor and high yield to Cabernet Sauvignon grapevine, which means that they may be used by grape growers in this region. However, the choice of the right rootstock depends on various aspects, such as those related to the soil characteristics, climate conditions, grape varieties, and even clones, and production purposes.

  19. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  20. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  1. Chemical Bonds of Cations in Grapevine Berries and Stems of Some Important Cultivars of Vitis vinifera (L. and Their Relevance for Viticulture and Enology

    Directory of Open Access Journals (Sweden)

    Klaus Schaller

    2016-11-01

    An analysis of variance shows that the varieties have a significant influence on nutrient distribution in different tissues. It seems that the relation Ca/Mg (NaCl fraction in stems is a good indicator for BSN because susceptible varieties show lower ratios than resistant ones. Some more research is necessary to clear up this possible relationship.

  2. Influence of water stress on Botryosphaeriaceae disease expression in grapevines

    Directory of Open Access Journals (Sweden)

    Jan VAN NIEKERK

    2011-12-01

    Full Text Available Several species in Botryosphaeriaceae have been associated with grapevine trunk diseases. To evaluate the effect of water stress on infection of grapevines by Botryosphaeriaceae spp., 1-year-old Shiraz/101-14 Mgt nursery grapevine plants were planted in plastic potting bags and placed outdoors under shade netting. Five weeks after planting, vines were pruned and the pruning wounds inoculated with spore suspensions of Neofusicoccum australe, Neofusicoccum parvum, Lasiodiplodia theobromae or Diplodia seriata. Control treatments consisted of applications of sterile water or a Trichoderma harzianum spore suspension. Stem inoculations were done by inserting a colonised or uncolonised agar plug into a wound made in each stem. Four different irrigation regimes were introduced 12 weeks after planting to simulate varying degrees of water stress. Measurements of stomatal conductance, photosynthetic rate and leaf spectrometry were made to monitor physiological stress. Eight months after inoculation, vines were uprooted and the root, shoot and plant mass of each vine determined. Lesions observed in the inoculated pruning wounds and stems were also measured. Vines subjected to the lowest irrigation regime were significantly smaller than optimally irrigated vines. Water stressed vines also had significantly lower photosynthetic rates and levels of stomatal conductance compared with vines receiving optimal irrigation, indicating that these plants experienced significantly higher levels of physiological stress. The mean lesion length was significantly longer in the pruning wounds and stems of plants subjected to the lowest irrigation regime, with lesion length declining linearly with increasing irrigation volume. These results clearly indicate that when a grapevine is exposed to water stress, colonisation and disease expression by Botryosphaeriaceae spp. are much more severe.

  3. Physiological and agronomical responses of Syrah grapevine under protected cultivation

    Directory of Open Access Journals (Sweden)

    Claudia Rita de Souza

    2015-01-01

    Full Text Available The performance of Syrah grapevine under protected cultivation with different plastic films was evaluated during 2012 and 2013 seasons in South of Minas Gerais State. Agronomical and physiological measurements were done on eight years old grapevines, grafted onto ‘1103 Paulsen’ rootstock cultivated under uncovered conditions, covered with transparent and with diffuse plastic films. Both plastic covers induced the highest shoot growth rate and specific leaf area. The diffuse plastic induced greater differences on leaf area, pruning weight and leaf chlorophyll content as compared to uncovered vines. Grapevines under diffuse plastic also had the lowest rates of photosynthesis, stomatal conductance and transpiration. Leaf starch, glucose and fructose contents were not affected by treatment, but leaf sucrose was reduced by transparent plastic. The leaf and stem water potential were higher under diffuse plastic. In 2013, grapevines under diffuse plastic showed the highest yields mainly due to decreased rot incidence and increased cluster weight. Furthermore, berries under diffuse plastic showed the highest anthocyanins concentration. The use of diffuse plastic induces more agronomical benefits to produce Syrah grape under protected cultivation.

  4. General properties of grapevine viruses occurring in Hungary

    OpenAIRE

    Eszter Cseh; András Takács; László Kocsis; Richard Gáborjányi

    2012-01-01

    The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), Alfalfa mosaic virus (AMV), Grapevine Bulgarian latent virus (GBLV), Grapevine fleck virus (GFkV), Grapevine leafroll- associated viruses (GLRaV1-4), Grapevine virus A (GVA), Grape...

  5. Evaluation of uva camarona (Macleania rupestris Kunth A.C. Smith propagation with air layering

    Directory of Open Access Journals (Sweden)

    Santiago Durán-Casas

    2013-04-01

    Full Text Available Uva camarona (Macleania rupestris Kunth A.C. Smith belongs to the Ericaceae family and grows in páramo and subpáramo areas in Colombia, between 2,200 and 3,500 m a.s.l. This plant presents edible berries that serve as a source of food and small income for local communities. The absence of a propagation protocol for this species limits its use. This study aimed to evaluate the effectiveness of asexual propagation of M. rupestris with air layering, using indole-butyric acid (IBA as a rooting hormone at different concentrations: 0, 500, 1,000, and 2,000 mg L-1. The results showed that an exogenous application of IBA accelerated the rooting process in the layered zone, with a notable emission of first adventitious roots at 60 days from the start of the experiment. The treatments of 500 and 1,000 mg L-1 IBA had the highest number of roots per layer, being two to three times higher than those presented in the control. No significant differences were seen in root length between treatments. The treatments of 500 and 1,000 mg L-1 IBA showed a high production for the dry weights of the roots and callus, with a higher weight of callus compared to root weight. Air layering negatively affected the longitudinal growth of the branches, since their average growth rate was 1.49 cm per month, while the growth of intact branches was 2.78 cm per month. The results suggest that the best concentration for rooting was 1.200 mg L-1 IBA because it had the largest number and dry weight of roots in air-layered M. rupestris

  6. Genetic diversity and population structure of leafy kale and Brassica rupestris Raf. in south Italy.

    Science.gov (United States)

    Maggioni, Lorenzo; von Bothmer, Roland; Poulsen, Gert; Branca, Ferdinando; Bagger Jørgensen, Rikke

    2014-12-01

    Local varieties of leafy kales (Brassica oleracea L.) are grown in home gardens in Calabria and Sicily for self-consumption, in the same area where the wild relative Brassica rupestris Raf. also grows. With the use of AFLP markers, comparisons were made of the genetic diversity and population structure of ten wild and 22 cultivated populations, as well as of a hybrid population and of four commercial cultivars of different B. oleracea crops. The level of genetic diversity was higher in leafy kales than in wild populations and this diversity was mainly distributed within populations. Wild populations remained distinct from cultivated material. Additionally, most wild populations were distinctively isolated from each other. On the other hand, it was not possible to molecularly distinguish even geographically distant leafy kale populations from each other or from different B. oleracea crops. It was possible to detect inter-crossing between leafy kales and B. rupestris. Findings from this study illustrate the existing level of genetic diversity in the B. oleracea gene pool. Individual populations (either wild or leafy kales) with higher levels of genetic diversity have been identified and suggestions are given for an informed conservation strategy. Domestication hypotheses are also discussed. © 2015 The Authors.

  7. In Vitro Anticariogenic Effects of Drymocallis rupestris Extracts and Their Quality Evaluation by HPLC-DAD-MS3 Analysis

    Directory of Open Access Journals (Sweden)

    Sebastian Granica

    2013-07-01

    Full Text Available In this study, for the first time, we investigated in vitro inhibitory effects of Drymocallis rupestris extracts and their subfractions obtained with solvents of different polarity (aqueous, 50% ethanolic, diethyl ether, ethyl acetate and n-butanolic against bacterial viability and caries virulence factors of Streptococcus spp. strains. The diethyl ether subfraction (PRU2 showed bacteriostatic and bactericidal activity against mutans streptococci, with minimum inhibitory concentrations (MICs in the range of 0.75–1.5 mg/mL and minimum bactericidal concentrations (MBCs in the range of 1.5–3 mg/mL. Furthermore, PRU2 inhibited biofilm formation by Streptococci in a dose-dependent manner. It was also found that all five D. rupestris preparations exhibited diverse inhibitory effects on de novo synthesis of water-insoluble and water-soluble α-d-glucans by glucosyltransferases of the mutans group streptococci. The phytochemical profile of investigated samples was determined by spectrophotometric and chromatographic (HPLC-DAD-MS3 methods. The high polyphenol (total phenol, phenolic acids, tannins, proantocyanidins, and flavonoids contents were found which correlated with anticariogenic activity of the analyzed samples. The results demonstrate that D. rupestris extracts and their subfractions could become useful supplements for pharmaceutical products as a new anticariogenic agent in a wide range of oral care products. Further studies are necessary to clarify which phytoconstituents of D. rupestris are responsible for anticaries properties.

  8. Grapevine fruiting cuttings: validation of an experimental system to study grapevine physiology. I. Main vegetative characteristics

    Directory of Open Access Journals (Sweden)

    Nathalie Ollat

    1998-03-01

    Full Text Available A method for producing fruiting cuttings of grapevine cv. Cabernet Sauvignon is described. The main developmental features of these cuttings are presented. The clusters reach maturity after 5 months and the period of cluster development is not shortened. Before flowering, a careful control of stem and leaf growth improves the partitioning of stored carbon towards the roots and the cluster. Vegetative growth occurs mainly between fruit set and veraison. During ripening, the leaf to fruit ratio is between 20 and 30 cm2 of leaf area per gram of fruit. In the cuttings as well as in grapevines from the vineyard, free polyamine content in the leafblade does not change during development. Conjugate polyamine content does not evolve in the same way. It peaks at veraison for vineyard leaves but decreases continuously for cuttings. A proper nutrient solution provides a minerai composition in accordance with viticultural requirements. The cuttings also behave like vineyard plants in response to different levels of potassium in the nutrient solution.

  9. VULNERABILITY TO CAVITATION IN GRAPEVINES HAS BEEN OVERESTIMATED BY THE CENTRIFUGE TECHNIQUE

    Science.gov (United States)

    Grapevines are considered among the most vulnerable woody plant species to water stress-induced cavitation with embolism forming at slight tensions. However, we found that native embolism in stems of field grown Vitis vinifera cv. Chardonnay never exceeded 30% despite xylem water potentials ('x) rea...

  10. Computer Vision for High-Throughput Quantitative Phenotyping: A Case Study of Grapevine Downy Mildew Sporulation and Leaf Trichomes.

    Science.gov (United States)

    Divilov, Konstantin; Wiesner-Hanks, Tyr; Barba, Paola; Cadle-Davidson, Lance; Reisch, Bruce I

    2017-12-01

    Quantitative phenotyping of downy mildew sporulation is frequently used in plant breeding and genetic studies, as well as in studies focused on pathogen biology such as chemical efficacy trials. In these scenarios, phenotyping a large number of genotypes or treatments can be advantageous but is often limited by time and cost. We present a novel computational pipeline dedicated to estimating the percent area of downy mildew sporulation from images of inoculated grapevine leaf discs in a manner that is time and cost efficient. The pipeline was tested on images from leaf disc assay experiments involving two F 1 grapevine families, one that had glabrous leaves (Vitis rupestris B38 × 'Horizon' [RH]) and another that had leaf trichomes (Horizon × V. cinerea B9 [HC]). Correlations between computer vision and manual visual ratings reached 0.89 in the RH family and 0.43 in the HC family. Additionally, we were able to use the computer vision system prior to sporulation to measure the percent leaf trichome area. We estimate that an experienced rater scoring sporulation would spend at least 90% less time using the computer vision system compared with the manual visual method. This will allow more treatments to be phenotyped in order to better understand the genetic architecture of downy mildew resistance and of leaf trichome density. We anticipate that this computer vision system will find applications in other pathosystems or traits where responses can be imaged with sufficient contrast from the background.

  11. Phytochemistry and molecular systematics of Triaenophora rupestris and Oreosolen wattii (Scrophulariaceae).

    Science.gov (United States)

    Jensen, Søren Rosendal; Li, Hong-Qing; Albach, Dirk C; Gotfredsen, Charlotte H

    2008-08-01

    The relationships between the genera Triaenophora, Oreosolen and Rehmannia were investigated. All three genera were previously included in tribe Veroniceae which was part of Scrophulariaceae but which is now included in Plantaginaceae. With regard to the content of iridoid glucosides, Triaenophora rupestris and the much-investigated Rehmannia were almost identical in containing catalpol, ajugol and 6-feruloylajugol. Oreosolen wattii was rather different in having compounds typical for the tribe Scrophularieae (Scrophulariaceae), namely aucubin, harpagide, harpagoside as well as two diesters of rhamnopyranosylcatalpol, one of which, here named oreosolenoside, had not previously been described in the literature. These results are consistent with recent analyses based on DNA sequencing and a phylogenetic tree illustrating the taxonomic relationships is presented.

  12. Genetic diversity and population structure of leafy kale and Brassica rupestris Raf. in south Italy

    DEFF Research Database (Denmark)

    Maggioni, Lorenzo; von Bothmer, Roland; Poulsen, Gert

    2014-01-01

    Local varieties of leafy kales (Brassica oleracea L.) are grown in home gardens in Calabria and Sicily for self-consumption, in the same area where the wild relative Brassica rupestris Raf. also grows. With the use of AFLP markers, comparisons were made of the genetic diversity and population...... structure of ten wild and 22 cultivated populations, as well as of a hybrid population and of four commercial cultivars of different B. oleracea crops. The level of genetic diversity was higher in leafy kales than in wild populations and this diversity was mainly distributed within populations. Wild...... populations remained distinct from cultivated material. Additionally, most wild populations were distinctively isolated from each other. On the other hand, it was not possible to molecularly distinguish even geographically distant leafy kale populations from each other or from different B. oleracea crops...

  13. Identification of Repellent and Insecticidal Constituents of the Essential Oil of Artemisia rupestris L. Aerial Parts against Liposcelis bostrychophila Badonnel

    Directory of Open Access Journals (Sweden)

    Zhi Long Liu

    2013-09-01

    Full Text Available The aim of this research was to determine the chemical composition and insecticidal and repellent activity of the essential oil of Artemisia rupestris L. aerial parts against the booklice Liposcelis bostrychophila Badonnel and isolation of insecticidal and repellent constituents from the essential oil. The essential oil of A. rupestris was obtained by hydrodistillation and analyzed by GC-MS. A total of 30 components of the essential oil of A. rupestris was identified and the principal compounds in the essential oil were α-terpinyl acetate (37.18%, spathulenol (10.65%, α-terpineol (10.09%, and linalool (7.56%, followed by 4-terpineol (3.92% and patchoulol (3.05%. Based on bioactivity-guided fractionation, the four active constituents were isolated from the essential oil and identified as α-terpineol, α-terpinyl acetate, 4-terpineol and linalool. The essential oil of A. rupestris exhibited contact toxicity against L. bostrychophila with LD50 value of 414.48 µg/cm2. α-Terpinyl acetate (LD50 = 92.59 µg/cm2 exhibited stronger contact toxicity against booklice than α-terpineol (LD50 = 140.30 µg/cm2, 4-terpineol (LD50 = 211.35 µg/cm2, and linalool (LD50 = 393.16 µg/cm2. The essential oil of A. rupestris (LC50 = 6.67 mg/L air also possessed fumigant toxicity against L. bostrychophila while the four constituents, 4-terpineol, α-terpineol, α-terpinyl acetate and linalool had LC50 values of 0.34, 1.12, 1.26 and 1.96 mg/L air, respectively. α-Terpinol and α-terpinyl acetate showed strong repellency against L. bostrychophila, while linalool and 4-terpinol exhibited weak repellency. The results indicate that the essential oil of A. rupestris aerial parts and its constituent compounds have potential for development into natural insecticides or fumigants as well as repellents for control of insects in stored grains.

  14. Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.

    Science.gov (United States)

    Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea

    2014-01-01

    Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.

  15. PLEADING FOR THE GRAPEVINE CULTURE

    Directory of Open Access Journals (Sweden)

    Ionela Cătălina Guţă

    2012-04-01

    Full Text Available The grapevine is cultivated with good results on hilly terrain, on sand and sandy soils, thus ensuring high recovery of these categories of agricultural land considered unsuitable for other crops. Vineyards, so related to people existence everywhere, became something more than just places of economic interest. What makes the viticulture to be so important is that it refers to the food value, therapeutic, recreational of grapes, must and wine, wine derived products and residues from wine, the great extent of the area occupied by vineyards, to good natural conditions (pedo-climatic existing in our country and also to the aesthetic value of the land planted with vines worldwide. The fitting of the gardens of the house, both in the countryside and in urban areas, includes in most cases the presence of grapevine plants cut in different art forms, their care being an exciting job. In general, by the presence of vines are valued the spaces next to existing buildings (house, yard, various outbuildings, along fences and roads. Grapevines location, cutting types chosen, besides beautifying the yard, must make a harmonious aspect of the whole surrounding. Chosen forms of management (arches, halfarches can protect the strong sunlight places. By the kiosks or other artistic realized forms are created spaces for rest, shade.

  16. Caracterização morfológica dos dentes de mocó Kerodon rupestris: Mammalia: Rodentia

    Directory of Open Access Journals (Sweden)

    Juliana Montovani Thomaz

    2006-10-01

    Full Text Available O Kerodon rupestris, também conhecido como mocó, é um roedor herbívoro encontrado no Brasil. A dentição dos mamíferos apresenta-se variável de acordo com as espécies embora seja formada pelos mesmos componentes: esmalte, dentina, cemento e polpa. Neste estudo foram utilizadas sete cabeças de Kerodon rupestris, adultos, de ambos os sexos. Na cavidade oral do Kerodon rupestris, devido ao tamanho relativamente grande dos incisivos, estes se destacaram dos demais e foram encontrados um par em cada mandíbula. Dois pares de pré-molares e três pares de molares foram encontrados, sendo representados na fórmula 2x (I 1/1, C 0/0, P 1/1, M 3/3. Os molares apresentaram duas cúspides, conformação que conferia a estes dentes um aspecto serrilhado. Microscopicamente os dentes incisivos, pré-molares e molares foram classificados como hipsodontes, ou seja, dentes em constante erupção.

  17. Arthropods vector grapevine trunk disease pathogens.

    Science.gov (United States)

    Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

    2014-10-01

    Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

  18. THE ORIGIN OF GRAPEVINE CULTIVATION IN ITALY: THE ARCHAEOBOTANICAL EVIDENCE

    Directory of Open Access Journals (Sweden)

    S. Marvelli

    2013-04-01

    Full Text Available Grapevine remains show that this plant has been important for humans since ancient times. This paper presents a synthesis of archaeobotanical studies on grapevine remains (pollen, wood, charcoal, seed/fruit and other botanical remains from Epigravettian to Bronze Age sites. Carpological remains are the most important ones, because they often allow to distinguish cultivated and wild grapevines. Grapevine findings are rare in Mesolithic sites, they increase during Neolithic period and become frequent in Bronze Age. Archaeobotanical data show that during Neolithic and in the Early Bronze Age a good level of knowledge concerning grapevine utilization was already acquired; during Middle and Late Bronze Age the grapevine diffusion increases. Based on archaeobotanical data, the wild grapevine evolution by indigenous people was probably accompanied by an input of allochtonous vines from Mycenaean world, and then from Hellenic world. Therefore, the critical period of grapevine domestication can be placed between Bronze Age and Early Iron Age.

  19. Quality information from the grapevine.

    Science.gov (United States)

    Laszlo, Pierre

    2010-07-01

    A letter by Lucien Herr, a highly regarded leading French intellectual at the time of World War I, provides capsule portraits of chemists such as Gabriel Bertrand, Paul Lebeau, Charles Moureu, and Georges Urbain. It makes us better aware of who they were and of how their contemporaries saw their work, which had much to do with their personalities, whether congenial or abrasive. This article is concerned with the kind of information carried by the so-called grapevine. It can be invaluable to the historian, for the light it sheds on the character of a scientist. The document drawn upon, from World War I (1915), depicts graphically the personalities of some of the French chemists engaged in the rush to design and produce chemical weapons. It is a frank and even brutal appraisal of their strengths and weaknesses. This is the kind of evaluation that scientists routinely engage in, but devoid of the hyperbole, pro or con, which usually flavours it.

  20. The status of Botryosphaeriaceae species infecting grapevines

    Directory of Open Access Journals (Sweden)

    Jose Ramón URBEZ-TORRES

    2011-12-01

    Full Text Available Normal 0 MicrosoftInternetExplorer4 Normal 0 MicrosoftInternetExplorer4 Species in the Botryosphaeriaceae have a cosmopolitan distribution, and occur on a wide range of annual and perennial hosts including grapevines. To date, morphological and taxonomic studies, as well as analyses of nucleotide sequences of multiple genes, have allowed the identification of at least 21 different species in the Botryosphaeriaceae occurring in grapevines worldwide. Grapevine disease symptoms caused by members of this family include leaf spots, fruit rots, shoot dieback, bud necrosis, vascular discoloration of the wood, and perennial cankers, and their current status as pathogens is reviewed. Additionally, the disease name Botryosphaeria dieback is proposed here to describe the different grapevine trunk disease symptoms caused by species of Botryosphaeriaceae. Much has been written during the last decade about the association between species in the Botryosphaeriaceae and grapevine trunk diseases, which has contributed to a better understanding of the role that these fungal taxa play in grapevine diseases. Although virulence has been shown to vary between species and isolates of the same species in different countries, these fungi have become well-recognized as important grapevine pathogens worldwide. Latest and novel findings from studies conducted in different countries, on disease etiology and species distribution, epidemiology and biology are discussed. Much progress has been achieved in the development and implementation of novel diagnostic and detection techniques.Vineyard sanitation techniques, as well as chemical, biological, and cultural control strategies available at the present time to reduce the infection caused by botryosphaeriaceous fungi, are presented in this review. 

  1. Origem do plexo braquial de mocós (Kerodon rupestris wied, 1820

    Directory of Open Access Journals (Sweden)

    Jailson José Santana

    2003-01-01

    Full Text Available O mocó, Kerodon rupestris, um mamífero roedor da família dos cavídeos muito parecido com preá, é um animal altamente adaptado às condições de calor e de escassez de água e de alimento, principalmente nos períodos das grandes secas que assolam periodicamente a região do semi-árido nordestino. Verifica-se que na literatura há escassez de dados referentes à anatomia funcional dos mocós e, em especial de trabalhos envolvendo a anatomia do sistema nervoso. Objetivando elucidar o comportamento anatômico do plexo braquial de mocó e com o propósito de contribuir para o desenvolvimento da neuroanatomia comparada, procedeu-se esta pesquisa, na qual foram utilizados dez animais adultos de diferentes idades (nove machos e uma fêmea que vieram a óbito no Centro de Multiplicação de Animais Silvestres (CEMAS da Escola Superior de Agricultura de Mossoró-ESAM. Após a fixação em solução aquosa de formol a 10,00%, realizou-se a dissecação bilateral da origem dos plexos braquiais, sendo os resultados registrados em desenhos esquemáticos, e suas disposições agrupadas em tabelas para posterior análise estatística, fundamentada na freqüência percentual. Observando-se que o plexo braquial de mocó é resultante de comunicações estabelecidas, principalmente, entre os ramos ventrais dos três últimos nervos cervicais e dos dois primeiros nervos torácicos, havendo contribuição do quinto nervo cervical em 35,00% dos casos. O plexo braquial originou-se mais freqüentemente a partir de C6, C7, C8, T1 e T2, consiguando-se em 40,00% das dissecações.

  2. Soaking grapevine cuttings in water: a potential source of cross contamination by micro-organisms

    Directory of Open Access Journals (Sweden)

    Helen WAITE

    2013-09-01

    Full Text Available Grapevine nurseries soak cuttings in water during propagation to compensate for dehydration and promote root initiation. However, trunk disease pathogens have been isolated from soaking water, indicating cross contamination. Cuttings of Vitis vinifera cv. Sunmuscat and V. berlandieri x V. rupestris rootstock cv. 140 Ruggeri were immersed in sterilized, deionised water for 1, 2, 4, 8 and 16 h. The soaking water was cultured (25°C for 3 days on non-specific and specific media for fungi and bacteria. The base of each cutting was debarked and trimmed and three 3 mm thick, contiguous, transverse slices of wood cultured at 25°C for 3 days. The soaking water for both cultivars became contaminated with microorganisms within the first hour. Numbers of fungi iso-lated from the wood slices soaked for one hour were significantly greater than those from non-soaked cuttings. The number of bacterial colonies growing from the wood slices increased after soaking for 2‒4 h in Sunmuscat. In a second experiment Shiraz cuttings were soaked for 1, 2, 4, 8 and 24 h. The soaking water became contaminated within the first hour but only the bacterial count increased significantly over time. Microorganisms also established on the container surfaces within the first hour although there were no significant increases over 24 h. These results confirm that soaking cuttings is a potential cause of cross contamination and demonstrate contamination of cuttings occurs after relatively short periods of soaking. Avoiding exposing cuttings to water will reduce the transmission of trunk diseases in propagation.

  3. Ecophysiological modeling of grapevine water stress in Burgundy terroirs by a machine-learning approach

    Directory of Open Access Journals (Sweden)

    Luca eBrillante

    2016-06-01

    Full Text Available In a climate change scenario, successful modeling of the relationships between plant-soil-meteorology is crucial for a sustainable agricultural production, especially for perennial crops. Grapevines (Vitis vinifera L. cv Chardonnay located in eight experimental plots (Burgundy, France along a hillslope were monitored weekly for three years for leaf water potentials, both at predawn (Ψpd and at midday (Ψstem. The water stress experienced by grapevine was modeled as a function of meteorological data (minimum and maximum temperature, rainfall and soil characteristics (soil texture, gravel content, slope by a gradient boosting machine. Model performance was assessed by comparison with carbon isotope discrimination (δ13C of grape sugars at harvest and by the use of a test-set. The developed models reached outstanding prediction performance (RMSE < 0.08 MPa for Ψstem and < 0.06 MPa for Ψpd, comparable to measurement accuracy. Model predictions at a daily time step improved correlation with δ13C data, respect to the observed trend at a weekly time scale. The role of each predictor in these models was described in order to understand how temperature, rainfall, soil texture, gravel content and slope affect the grapevine water status in the studied context. This work proposes a straight-forward strategy to simulate plant water stress in field condition, at a local scale; to investigate ecological relationships in the vineyard and adapt cultural practices to future conditions.

  4. Ecophysiological Modeling of Grapevine Water Stress in Burgundy Terroirs by a Machine-Learning Approach.

    Science.gov (United States)

    Brillante, Luca; Mathieu, Olivier; Lévêque, Jean; Bois, Benjamin

    2016-01-01

    In a climate change scenario, successful modeling of the relationships between plant-soil-meteorology is crucial for a sustainable agricultural production, especially for perennial crops. Grapevines (Vitis vinifera L. cv Chardonnay) located in eight experimental plots (Burgundy, France) along a hillslope were monitored weekly for 3 years for leaf water potentials, both at predawn (Ψpd) and at midday (Ψstem). The water stress experienced by grapevine was modeled as a function of meteorological data (minimum and maximum temperature, rainfall) and soil characteristics (soil texture, gravel content, slope) by a gradient boosting machine. Model performance was assessed by comparison with carbon isotope discrimination (δ(13)C) of grape sugars at harvest and by the use of a test-set. The developed models reached outstanding prediction performance (RMSE < 0.08 MPa for Ψstem and < 0.06 MPa for Ψpd), comparable to measurement accuracy. Model predictions at a daily time step improved correlation with δ(13)C data, respect to the observed trend at a weekly time scale. The role of each predictor in these models was described in order to understand how temperature, rainfall, soil texture, gravel content and slope affect the grapevine water status in the studied context. This work proposes a straight-forward strategy to simulate plant water stress in field condition, at a local scale; to investigate ecological relationships in the vineyard and adapt cultural practices to future conditions.

  5. Grapevine leafroll-associated virus 3

    Directory of Open Access Journals (Sweden)

    Hans J. Maree

    2013-04-01

    Full Text Available Grapevine leafroll disease (GLD is one of the most important grapevine viral diseases affecting grapevines worldwide. The impact on vine health, crop yield and quality is difficult to assess due to a high number of variables, but significant economic losses are consistently reported over the lifespan of a vineyard if intervention strategies are not implemented. Several viruses from the family Closteroviridae are associated with GLD. However, Grapevine leafroll-associated virus 3 (GLRaV-3, the type species for the genus Ampelovirus, is regarded as the most important causative agent. Here we provide a general overview on various aspects of GLRaV-3, with an emphasis on the latest advances in the characterization of the genome. The full genome of several isolates have recently been sequenced and annotated, revealing the existence of several genetic variants. The classification of these variants, based on their genome sequence, will be discussed and a guideline is presented to facilitate future comparative studies. The characterization of sgRNAs produced during the infection cycle of GLRaV-3 has given some insight into the replication strategy and the putative functionality of the ORFs. The latest nucleotide sequence based molecular diagnostic techniques were shown to be more sensitive than conventional serological assays and although ELISA is not as sensitive it remains valuable for high-throughput screening and complementary to molecular diagnostics. The application of next-generation sequencing is proving to be a valuable tool to study the complexity of viral infection as well as plant-pathogen interaction. Next-generation sequencing data can provide information regarding disease complexes, variants of viral species, and abundance of particular viruses. This information can be used to develop more accurate diagnostic assays. Reliable virus screening in support of robust grapevine certification programs remains the cornerstone of GLD management.

  6. Identification of Eutypa lata, a Grapevine Parasite

    Directory of Open Access Journals (Sweden)

    Goran Delibašić

    2006-01-01

    Full Text Available The phytopathogenic fungus Eutypa lata (Pers.: Fr. Tul. and C. Tul., the causing agent of eutypa dieback, has been increasingly often identified in recent times as a cause of grapevine disease. It was first discovered and identified in Australian vineyards (Carter,1973, where it represented one of the most dangerous fungus pathogens of this plant. A few years later it was discovered in European vineyards as well. This polyfagous fungus,known originally as E. armeniaca (Honsf. & Carter, was first discovered on apricot, on which it caused the “gummosis disease”.In Serbia, Eutypa lata has not been determined officially. However, bearing in mind the form of its spreading (anemochory, as well as the fact that our country is a major producer of grape and fruit, we need to pay special attention to this dangerous pathogen since thereare indications that it is already present in our vineyards.During the period between 2003 and 2005, an inspection of a great number of vineyards in the areas of Vršac, Fruška Gora and Kruševac, was conducted. Many of them had grapevines with typical eutypa dieback symptoms. The aim of the inspection was to find grapevines with this disease, to mark them and take samples for laboratory analysis. Marking suspicious grapevines enabled us to monitor the volume of symptoms, as well as other changes on grapevines. Different colours were used for markings, according to the principle “same colour – same year” The procedure revealed that the average periodbetween early and mild disease symptoms and extreme changes, including withering of entire vines, was 2 to 3 years.The signs of eutypa dieback on diseased grapevines are manifested: on leaves in the form of chlorosis, twisting, necrosis of the edges, drying out and falling off; on shoots,where the shortening of internodia is noticable, as well as colour change and “zig-zag” distribution of internodes; on blossoms and clusters, where absence of flowering, partial

  7. The study of antioxidants in grapevine seeds

    Directory of Open Access Journals (Sweden)

    Lenka Tomášková

    2017-01-01

    Full Text Available Grapevine seeds contain a large amount of antioxidant components, and are therefore recommended in the prevention and treatment of many diseases. For this research, we studied the antioxidant properties of grapevine seeds from the Marlen variety, as evidence suggests that these types have higher resistance against fungal diseases. Through high-performance liquid chromatography with UV/VIS detection, a total of 10 antioxidant components were selected for further investigation, specifically: catechin, epicatechin, rutin, quercitrin, quercetin, caftaric acid, caffeic acid, p-coumaric acid, ferulic acid, and gallic acid. The antioxidant activity was determinated spectrophotometrically through the adoption of three fundamentally different methods (the DPPH assay, the ABTS method, and the FRAP method. Using the Folin-Ciocalteu method, it was possible to determine the content of all the polyphenolic compounds. The results of the assessment antioxidant activity and the content of polyphenolic compounds were recalculated to gallic acid equivalents (GAE. The values of the antioxidant activity as determinated by the DPPH test were 6643 (±154 mg of GAE; 1984 (±88 mg of GAE when using the FRAP method; and 812 (±31 mg of GAE when the ABTS method was utilised. The content of the total polyphenolic compounds came to 6982 (±221 mg of GAE. The most abundant antioxidant was catechin, with a content of 115 mg.L-1, whilst the least represented compound was ferulic acid (0.139 mg.L-1. Overall, this study showed a high antioxidant potential of grapevine seeds. 

  8. Modeling deployment of Pierce’s disease resistant grapevines

    Science.gov (United States)

    Deployment of Pierce’s disease resistant grapevines is a key solution to mitigating economic losses caused by Xylella fastidiosa. While Pierce’s disease resistant grapevines under development display mild symptoms and have lower bacterial populations than susceptible varieties, all appear to remain ...

  9. The grapevine VvCAX3 is a cation/H+ exchanger involved in vacuolar Ca2+ homeostasis.

    Science.gov (United States)

    Martins, Viviana; Carneiro, Filipa; Conde, Carlos; Sottomayor, Mariana; Gerós, Hernâni

    2017-12-01

    The grapevine VvCAX3 mediates calcium transport in the vacuole and is mostly expressed in green grape berries and upregulated by Ca 2+ , Na + and methyl jasmonate. Calcium is an essential plant nutrient with important regulatory and structural roles in the berries of grapevine (Vitis vinifera L.). On the other hand, the proton-cation exchanger CAX proteins have been shown to impact Ca 2+ homeostasis with important consequences for fruit integrity and resistance to biotic/abiotic stress. Here, the CAX gene found in transcriptomic databases as having one of the highest expressions in grapevine tissues, VvCAX3, was cloned and functionally characterized. Heterologous expression in yeast showed that a truncated version of VvCAX3 lacking its NNR autoinhibitory domain (sCAX3) restored the ability of the yeast strain to grow in 100-200 mM Ca 2+ , demonstrating a role in Ca 2+ transport. The truncated VvCAX3 was further shown to be involved in the transport of Na + , Li + , Mn 2+ and Cu 2+ in yeast cells. Subcellular localization studies using fluorescently tagged proteins confirmed VvCAX3 as a tonoplast transporter. VvCAX3 is expressed in grapevine stems, leaves, roots, and berries, especially at pea size, decreasing gradually throughout development, in parallel with the pattern of calcium accumulation in the fruit. The transcript abundance of VvCAX3 was shown to be regulated by methyl jasmonate (MeJA), Ca 2+ , and Na + in grape cell suspensions, and the VvCAX3 promotor contains several predicted cis-acting elements related to developmental and stress response processes. As a whole, the results obtained add new insights on the mechanisms involved in calcium homeostasis and intracellular compartmentation in grapevine, and indicate that VvCAX3 may be an interesting target towards the development of strategies for enhancement of grape berry properties.

  10. Reproductive biology of the critically endangered endemic Mediterranean plant Coincya rupestris subsp. rupestris (Spain: the effects of competition and summer drought on seedling establishment Biología reproductiva de la planta endémica mediterránea amenazada Coincya rupestris subsp. rupestris (España: efectos de la competencia y sequía estival en el establecimiento de plántulas

    Directory of Open Access Journals (Sweden)

    MIGUEL A COPETE

    2008-09-01

    Full Text Available Flower, fruit, seed production, and flowering phenology (duration, intensity, moment and synchrony were studied in the two main populations (south east Spain of the critically endangered endemic Mediterranean plant Coincya rupestris subsp. rupestris (Cruciferae. Production of flowers and fruits (mean ± SD ranged from 483 (± 688 to 748 (± 636, and from 317 (± 518 to 553 (± 500, respectively, between populations. In addition, the average seed production per plant was 1,607-2,798, thus concluding that fertility was not responsible for the rarity of this taxon. The fruit/flower ratio ranged from 0.60 to 0.75, showing significant inter-population differences. Flowering extended from February-March to the end of spring, with high synchrony (= 85 %. This parameter was negatively correlated with duration of the flowering period. The role of pollinator insects on reproductive success, and the effect of watering treatments and the elimination of competitors on seedling recruitment were analysed in the classical locality. The exclusion of pollinators dramatically affected fructification, reducing reproductive success from moderate values in plants exposed to insects (= 0.5 to null values in those where insects were experimentally excluded. Seedling emergence was autumnal and no influence of the factors analysed (i.e., water availability and inter-specific competition was detected on seedling establishment. A high interannual variability in the size and survival of cohorts originated each autumn was observed. It should be emphasized that the rarity of the taxon is not due to fecundity restrictions.Para el endemismo amenazado mediterráneo Coincya rupestris subsp. rupestris (Cruciferae se analizaron diferentes aspectos de su biología reproductiva como la producción de flores, frutos y semillas, y la fenología de la floración a través de las variables representativas de la misma (duración, intensidad, momento y sincronía, de forma independiente en

  11. Efeito do porta-enxerto no teor de nutrientes em tecidos da videira "cabernet sauvignon" Effect of rootstock on nutrient content of 'cabernet sauvignon' grapevine tissues

    Directory of Open Access Journals (Sweden)

    Alberto Miele

    2009-12-01

    Full Text Available A nutrição mineral da videira constitui-se em importante fator para a qualidade dos vinhos. Devido a isso, avaliou-se o efeito de porta-enxertos no teor de nutrientes em diferentes tecidos da videira 'Cabernet Sauvignon' (Vitis vinifera L. na Serra Gaúcha. o experimento foi conduzido durante o ciclo vegetativo de 2004/2005, com os porta-enxertos Rupestris du lot, 101-14, 3309, 420A, Kober 5BB, 161-49, So4 e Paulsen 1103, enxertados em 1993 com a cv. 'Cabernet Sauvignon'. o delineamento experimental foi em blocos ao acaso, com oito tratamentos e três repetições, sendo quatro plantas/parcela. Coletaram-se folhas - separando-se os pecíolos dos limbos -, cachos - separando-se as bagas das ráquis - e ramos, os quais foram posteriormente secados em estufa e pesados. Analisaram-se os nutrientes n, P, K, Ca e Mg. os resultados mostram que houve efeito significativo do porta-enxerto nos teores de N, P, K, Ca e Mg no limbo, pecíolo, ráquis e baga da videira 'Cabernet Sauvignon' e que este efeito variou em função do nutriente e do tecido considerado. Entretanto, não houve efeito significativo do porta-enxerto no teor desses nutrientes no ramo da videira. Além disso, a ordem de grandeza do teor dos nutrientes variou em função do tecido avaliado. Assim, os teores de n e de Ca foram maiores no limbo; os de P e K, na ráquis; e o de Mg, no pecíolo.Grapevine mineral nutrition is an important factor influencing wine quality. For this, the effect of rootstocks on the nutrient content in different tissues of 'Cabernet Sauvignon' grapevines (Vitis vinifera L. grown in the Serra Gaúcha region was evaluated. The experiment was carried out during the 2004/2005 vegetative cycle with the rootstocks Rupestris du Lot, 101-14, 3309, 420A, Kober 5BB, 161-49, SO4, and Paulsen 1103. The experimental design was in randomized blocks, with eight treatments, three replicates, four plants/plot. leaves - petioles were separated from the limbs -, clusters - berries

  12. Avaliação do enraizamento, desenvolvimento de raízes e parte aérea de porta-enxertos de videira em condições de campo Evaluation of rooting, development of roots and shoot biomass from rootstock of grapevine, in field conditions

    Directory of Open Access Journals (Sweden)

    Marco Antonio Tecchio

    2007-12-01

    Full Text Available Objetivou-se neste trabalho avaliar o enraizamento, a brotação e o desenvolvimento de raízes de diferentes porta-enxertos de videira em condições de campo. Estacas lenhosas dos porta-enxertos '420 A', 'Golia', '5C', '8B', 'RR101-14', 'SO4', '99R', 'Kober 5BB', 'IAC 766', 'IAC 572', 'IAC 571-6', 'Ripária do Traviú' e 'Rupestris du Lot' foram colocadas em canteiro de terra, sem tratamento prévio. O delineamento foi em blocos ao acaso, com cinco repetições e vinte estacas por parcela, com as estacas dispostas em espaçamento de 12 x 5cm. As estacas foram colocadas para enraizar no início de julho e removidas no final de setembro para as avaliações. A porcentagem de estacas enraizadas variou de 79% para 'Ripária do Traviú' a 99% para o 'RR101-14'. Quanto à brotação, o 'Ripária do Traviú' apresentou 47%, 'IAC 571-6', 'IAC 572', '420 A', 'Rupestris du Lot', 'Kober', 'IAC 766', '8B', '5C', apresentaram de 76 a 89% e 'Golia', 'SO4', '99R' e 'RR 101-14' mais de 90%. 'IAC 572' e 'IAC 571-6' apresentaram o menor número de raízes por estaca, no entanto, foram as que apresentaram raízes mais desenvolvidas, seguidas pelo '5C' e 'Rupestris du Lot'. 'Kober 5BB' e 'Ripária do Traviú' apresentaram as raízes menos desenvolvidas. As demais variedades apresentaram valores intermediários. Concluiu-se que, entre todos os porta-enxertos, o 'Ripária do Traviú' apresentou os menores índices de enraizamento e brotação das estacas, nas condições de campo.The goals of this investigation was to evaluate the rooting, budding and development of roots from different rootstock of grapevine, in field conditions. Ligneous cutting of rootstock '420 A', 'Golia', '5C', '8B', 'RR101-14', 'SO4', '99R', 'Kober 5BB', 'IAC 766', 'IAC 572', 'IAC 571-6', 'Ripária do Traviú' and 'Rupestris du Lot' were planted in soil, without previous preparation. The experimental design was done in randomized blocks, with five repetitions and twenty cutting per plot

  13. Effects of Drought Stress and Rewatering on some Morphological and Physiological Properties of Three Grapevine Cultivars

    Directory of Open Access Journals (Sweden)

    Mehdi Aran

    2017-12-01

    Full Text Available Introduction: Most plants have developed morphological and physiological mechanisms which allow them to cope with drought stress. Almost all the studies conducted on grapevines (Vitisvinifera L. responses to drought conditions have focused on physiological responses such as stomatal reactions, photosynthesis and osmotic adjustment, and biochemical responses like carbohydrates and proline. According to these studies, physiological and biochemical responses of grapevines to water stress are quite variable. This variability could be related to cultivar, time of the year, previous water stress level, intensity of stress, and environmental conditions. Osmotic adjustment in terms of compatible solutes accumulation has been considered as an important physiological adaptation for plant to resist drought, which facilitates the extraction of water from dry soils and maintenance of cell turgor, gas exchange and growth in very dry environments. Acting as compatible solutes as well as antioxidants, a significant rise in proline amount was observed in grapevine leaves under water stress conditions, suggesting that this amino acid has a protective role against the formation of excessive reactive oxygen species (ROS. Plants, in order to overcome oxidative stress, have developed enzymatic and non-enzymatic antioxidant defense mechanisms against scavenge ROS. Materials and Methods: This research was conducted to assess the effect of different levels of irrigation on some characteristics of three cultivars of grapevine (Yaghooti, Bidanesefid and Askari, as a factorial based on a randomized complete block design in two years with four replications. The experiment started in June 21, 2014 and 2015. Water treatments were applied in four levels including: control plant (100% FC, moderate stress (60% FC, severe stress (30% FC and rewatering treatment after severe stress treatment. Increase height, leaf number, stem diameter, leaf fresh and dry weight, stem dry weight

  14. Development of a Grapevine Pruning Algorithm for Using in Pruning

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2017-10-01

    image. Then, the plant distance from the cameras was calculated by using the stereo vision. In next stage, the main trunk and one year old branches were identified and branches with thicknesses less than 7 mm were removed from the image. To omit these branches consecutive dilation and erosion operations were applied with circular structures having radii of 2 and 4 pixels. Then, based on the branch diameter, one-year-old branches were detected and pruned through considering the pruning parameters. The branches were pruned so that only three buds were left on them. For this aim, the branches should be pruned to have a length of 15 cm. To truncate the branches to 15 cm, the length of the main stem was measured for each of the branches, and branches with length less than 15 cm were omitted from the images. Then the main skeleton of grapevine was determined. Using this skeleton, the attaching points of the branches as well as attachment points to the trunk were identified. Distance between the branches was maintained. At the last step, the cutting points on the branches were determined by labeling the removed branches at each step. Results and Discussion The results indicated that the color components in the texture of the branches could not be used to identify one year old branches and evaluation results of algorithm showed that the proposed algorithm had acceptable performance and in all photos, one year old branches were correctly identified and pruning point of the grapevines were correctly marked. Also among 254 cut off-points extracted from 20 images, just 7 pruning points were misdiagnosed. These results revealed that the accuracy of the algorithm was about 96.8 percent. Conclusions Based on the reasonable achievement of the algorithm it can be concluded that it is possible to use machine vision routines to determine the most suitable cut off points for pruning robots. By an intelligent pruning robot, the one year old branches are diagnosed properly and the cut off

  15. Biotechnology of temperate fruit trees and grapevines.

    Science.gov (United States)

    Laimer, Margit; Mendonça, Duarte; Maghuly, Fatemeh; Marzban, Gorji; Leopold, Stephan; Khan, Mahmood; Balla, Ildiko; Katinger, Hermann

    2005-01-01

    Challenges concerning fruit trees and grapevines as long lived woody perennial crops require adapted biotechnological approaches, if solutions are to be found within a reasonable time frame. These challenges are represented by the need for correct identification of genetic resources, with the foreseen use either in conservation or in breeding programmes. Molecular markers provide most accurate information and will be the major solution for questions about plant breeders rights. Providing healthy planting material and rapid detection of newly introduced pathogens by reliable methods involving serological and molecular biological tools will be a future challenge of increases importance, given the fact that plant material travels freely in the entire European Union. But also new breeding goals and transgenic solutions are part of the biotechnological benefits, e.g. resistance against biotic and abiotic stress factors, modified growth habits, modified nutritional properties and altered processing and storage qualities. The successful characterization of transgenic grapevines and stone fruit trees carrying genes of viral origin in different vectors constructed under ecological consideration, will be presented. Beyond technical feasibility, efficiency of resistance, environmental safety and Intellectual Property Rights, also public acceptance needs consideration and has been addressed in a specific project. The molecular determination of internal quality parameters of food can also be addressed by the use of biotechnological tools. Patient independent detection tools for apple allergens have been developed and should allow to compare fruits from different production systems, sites, and genotypes for their content of health threatening compounds.

  16. From 'Fire Esca' to 'Esca of Grapevine'

    Directory of Open Access Journals (Sweden)

    A. Graniti

    2006-04-01

    Full Text Available The use of tinder (‘esca’ or ‘amadou’ prepared from basidiocarps of some bracket fungi, e.g. Fomes fomentarius and Phellinus igniarius as an easy-to-burn matter goes back to the man’s conquest of fire. Archaeological finds, such as fragments of tinder, flint-stones and traces of pyrite carried by the ‘Ice man’ on his way across the Alps more than 5,000 years ago, bear evidence of the use of tinder in the Neolithic age. In 1926, on the assumption that P. igniarius was one of the pathogens of the so-called ‘apoplexy’ of grapevine, the name ‘esca’ was given to the disease. For long time, esca was thought to affect old vines only. In the last decades, however, various forms of the disease have been found to be widespread and to cause losses even to young vines. Aetiological studies have shown that esca of grapevine is a complex disease, incited by wilt-inducing ascomycetes (Togninia, Phaeoacremonium, Phaeomoniella and/or the wood-decaying basidiomycete Fomitiporia mediterranea. Since the latter is not a tinder fungus, the advisability of retaining the name ‘esca’ for the disease is discussed.

  17. Grapevine responses to terroir: a global approach

    Directory of Open Access Journals (Sweden)

    Alain Deloire

    2005-12-01

    Full Text Available This paper deals with the technical and/or practical treatment of terroir as a study concept, together with related functional aspects. Functioning of the terroir relies on the relation between climate, soil and vine. In addition to this interaction, a comprehensive study concept for terroir requires the consideration of viticultural and enological sciences and techniques necessary to ensure the assurance of wine quality, together with spatial aspects of the grapevine response to environmental factors, as required for vineyard management. In order to comprehend the quality of the harvest, it is necessary to understand the relationship « whole plant - berry ». An easy field and laboratory method to study the relationship between the whole plant and berry and the consequences thereof for wine quality is proposed. Knowledge of grapevine water status and the biochemical evolution within the grape berry from berry set onwards are important issues for the understanding of the role that terroir plays with respect to the quality of the harvest and the wine style or « typicality ».

  18. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-02-01

    phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

  19. Non-destructive assessment of grapevine water status in the field using a portable NIR spectrophotometer.

    Science.gov (United States)

    Tardaguila, Javier; Fernández-Novales, Juan; Gutiérrez, Salvador; Diago, Maria Paz

    2017-08-01

    Until now, the majority of methods employed to assess grapevine water status have been destructive, time-intensive, costly and provide information of a limited number of samples, thus the ability of revealing within-field water status variability is reduced. The goal of this work was to evaluate the capability of non-invasive, portable near infrared (NIR) spectroscopy acquired in the field, to assess the grapevine water status in diverse varieties, grown under different environmental conditions, in a fast and reliable way. The research was conducted 2 weeks before harvest in 2012, in two commercial vineyards, planted with eight different varieties. Spectral measurements were acquired in the field on the adaxial and abaxial sides of 160 individual leaves (20 leaves per variety) using a commercially available handheld spectrophotometer (1600-2400 nm). Principal component analysis (PCA) and modified partial least squares (MPLS) were used to interpret the spectra and to develop reliable prediction models for stem water potential (Ψ s ) (cross-validation correlation coefficient (r cv ) ranged from 0.77 to 0.93, and standard error of cross validation (SECV) ranged from 0.10 to 0.23), and leaf relative water content (RWC) (r cv ranged from 0.66 to 0.81, and SECV between 1.93 and 3.20). The performance differences between models built from abaxial and adaxial-acquired spectra is also discussed. The capability of non-invasive NIR spectroscopy to reliably assess the grapevine water status under field conditions was proved. This technique can be a suitable and promising tool to appraise within-field variability of plant water status, helpful to define optimised irrigation strategies in the wine industry. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  20. Detection and Molecular Characterization of Grapevine Virus A in Jordan

    Directory of Open Access Journals (Sweden)

    G. Anfoka

    2004-12-01

    Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.

  1. Follow-up of fluorine pollution effect on grapevine

    Directory of Open Access Journals (Sweden)

    Ferjani Ben Abdallah

    2004-12-01

    By another way, our results seem to show that full mature grapevine leaves may constitute an efficient tool to assess fluorine pollution impact. Berries contamination seems to be affected directly by the factory smoke, there is no endogenous supply. Likewise, by its characteristic necrosis in the leaf boundaries, grapevine may be considered as a bioindicator variety of fluorine pollution which can be used in mapping polluted areas.

  2. Origem e distribuição do nervo femoral do mocó, Kerodon rupestris (Cavidae

    Directory of Open Access Journals (Sweden)

    Gleidson B Oliveira

    2011-12-01

    Full Text Available O mocó (Kerodon rupestris Wied,1820, um mamífero roedor da família Cavidae, que se assemelha bastante ao preá, é um animal altamente adaptado às condições de calor e de escassez de água e de alimento, principalmente nos períodos das grandes secas que assolam periodicamente a região do semi-árido nordestino. Verifiica-se que na literatura há escassez de dados referentes à anatomia funcional dos mocós, em especial de trabalhos envolvendo a anatomia do sistema nervoso. Visando conhecer a origem do nervo femoral junto aos forames intervertebrais, sua localização e distribuição pelo membro pélvico, a musculatura envolvida em seu trajeto, a importância desse estudo para clínica de animais silvestres e contribuir para o desenvolvimento da neuroanatomia comparada, procedeu-se esta pesquisa, na qual foram utilizados dez animais adultos de diferentes idades (4 machos e 6 fêmeas que vieram a óbito no Centro de Multiplicação de Animais Silvestres (Cemas da Universidade Federal Rural do Semi-Árido (Ufersa. Os animais foram fiixados em solução aquosa de formaldeído a 10% e posteriormente tiveram a cavidade abdominal dissecada até a completa visualização do nervo femoral. Foram verifiicadas variações no número de vértebras lombares nos animais, entre seis (30% e sete (70% vértebras, alterando, conseqüentemente, a origem do nervo. No antímero direito, verifiicou-se que em 40% dos animais o nervo femoral originava-se de ramos ventrais de L5L6, em 40% de L5L6L7 e em 20% de L4L5L6. Já no esquerdo 50% dos exemplares o nervo femoral foi formado de raízes ventrais de L5L6, em 30% de L5L6L7 e em 20% de L4L5L6.

  3. High taxonomic diversity of cultivation-recalcitrant endophytic bacteria in grapevine field shoots, their in vitro introduction, and unsuspected persistence.

    Science.gov (United States)

    Thomas, Pious; Sekhar, Aparna C; Shaik, Sadiq Pasha

    2017-11-01

    Molecular and microscopic analyses reveal enormous non-cultivable endophytic bacteria in grapevine field shoots with functional significance. Diverse bacteria enter tissue cultures through surface-sterilized tissues and survive surreptitiously with varying taxonomic realignments. The study was envisaged to assess the extent of endophytic bacterial association with field shoot tissues of grapevine and the likelihood of introduction of such internally colonizing bacteria in vitro adopting molecular techniques targeting the non-cultivable bacterial community. PowerFood ® -kit derived DNA from surface-sterilized field shoot tips of grapevine Flame Seedless was employed in a preliminary bacterial class-specific PCR screening proving positive for major prokaryotic taxa including Archaea. Taxonomic and functional diversity were analyzed through whole metagenome profiling (WMG) which revealed predominantly phylum Actinobacteria, Proteobacteria, and minor shares of Firmicutes, Bacteroidetes, and Deinococcus-Thermus with varying functional roles ascribable to the whole bacterial community. Field shoot tip tissues and callus derived from stem segments were further employed in 16S rRNA V3-V4 amplicon taxonomic profiling. This revealed elevated taxonomic diversity in field shoots over WMG, predominantly Proteobacteria succeeded by Actinobacteria, Firmicutes, Bacteroidetes, and 15 other phyla including several candidate phyla (135 families, 179 genera). Callus stocks also displayed broad bacterial diversity (16 phyla; 96 families; 141 genera) bearing resemblance to field tissues with Proteobacterial dominance but a reduction in its share, enrichment of Actinobacteria and Firmicutes, disappearance of some field-associated phyla and detection of a few additional taxonomic groups over field community. Similar results were documented during 16S V3-V4 amplicon taxonomic profiling on Thompson Seedless field shoot tip and callus tissues. Video microscopy on tissue homogenates

  4. Combination of RGB and Multispectral Imagery for Discrimination of Cabernet Sauvignon Grapevine Elements

    Directory of Open Access Journals (Sweden)

    Carlota Salinas

    2013-06-01

    Full Text Available This paper proposes a sequential masking algorithm based on the K-means method that combines RGB and multispectral imagery for discrimination of Cabernet Sauvignon grapevine elements in unstructured natural environments, without placing any screen behind the canopy and without any previous preparation of the vineyard. In this way, image pixels are classified into five clusters corresponding to leaves, stems, branches, fruit and background. A custom-made sensory rig that integrates a CCD camera and a servo-controlled filter wheel has been specially designed and manufactured for the acquisition of images during the experimental stage. The proposed algorithm is extremely simple, efficient, and provides a satisfactory rate of classification success. All these features turn out the proposed algorithm into an appropriate candidate to be employed in numerous tasks of the precision viticulture, such as yield estimation, water and nutrients needs estimation, spraying and harvesting.

  5. Combination of RGB and multispectral imagery for discrimination of cabernet sauvignon grapevine elements.

    Science.gov (United States)

    Fernández, Roemi; Montes, Héctor; Salinas, Carlota; Sarria, Javier; Armada, Manuel

    2013-06-19

    This paper proposes a sequential masking algorithm based on the K-means method that combines RGB and multispectral imagery for discrimination of Cabernet Sauvignon grapevine elements in unstructured natural environments, without placing any screen behind the canopy and without any previous preparation of the vineyard. In this way, image pixels are classified into five clusters corresponding to leaves, stems, branches, fruit and background. A custom-made sensory rig that integrates a CCD camera and a servo-controlled filter wheel has been specially designed and manufactured for the acquisition of images during the experimental stage. The proposed algorithm is extremely simple, efficient, and provides a satisfactory rate of classification success. All these features turn out the proposed algorithm into an appropriate candidate to be employed in numerous tasks of the precision viticulture, such as yield estimation, water and nutrients needs estimation, spraying and harvesting.

  6. Developmental control of hypoxia during bud burst in grapevine.

    Science.gov (United States)

    Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

    2018-05-01

    Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

  7. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  8. Genetic characterization of some Romanian red wine grapevine varieties

    Science.gov (United States)

    Ghetea, Ligia Gabriela; Motoc, Rozalia Magda; Niculescu, Ana-Maria; Litescu, Simona Carmen; Duma, Virgil-Florin; Popescu, Carmen Florentina

    2008-04-01

    In our study we have considered three of the most valuable Romanian red wine grapevine cultivars: Feteasca neagra, Feteasca alba and Novac. We have chosen to study grapevine because grapes and wine are an important part of a healthy diet, and because red grapes have the highest content of proanthocyanidins, that act as antioxidants (free radical scavengers) in the human body. Proanthocyanidins possess anti-mutagenic, anti-tumor, anti-viral activities and they present many other confirmed or potential benefits. Genotyping method was applied in order to asses the genetic profile at 14 microsatellite loci, for two cultivars: Feteasca neagra and Feteasca alba. In order to achieve this, the HPLC-DAD method was used. The content of anthocyans in grape skin from two cultivars - Feteasca neagra and Novac - was measured. Microsatellite markers have been certified as powerful tools for assessing genetic identities and genetic relationships between grapevine gene pools. Genetic characterization of grapevine cultivars can certify their authenticity and purity, two features that have a direct effect on the quality and value of the finished product, the wine. In our country, this is the first attempt in order to establish a genetic profile for valuable Romanian origin grapevine varieties. In some of the 14 microsatellitic loci, Feteasca neagra and Feteasca alba cultivars presented allele size variants different from the values cited in the literature, proving that these cultivars belong to a geographical distinct gene pool. The content of anthocyans in Feteasca neagra grape skin was significantly higher than in Novac.

  9. "Parco Archeologico Storico Naturale delle Chiese Rupestri del Materano": geomorphological fragility and slope instability in a rupestrian-heritage rich area (Basilicata, south Italy).

    Science.gov (United States)

    Francioso, R.; Sdao, F.; Tropeano, M.

    2003-04-01

    The Italian Ministry of Education, University and Research financed a research project about the study and the control of hydrogeological hazard of some sites belonging to the "Parco Archeologico Storico Naturale delle Chiese Rupestri del Materano"; the Park and the old city of Matera ("Sassi di Matera") was inserted in the UNESCO World Heritage list since 1993. The studied sites ("Belvedere Chiese Rupestri" and "Iazzo dell'Ofra" localities) are located along the top of the walls of the deep canyon (locally called "Gravina di Matera" and deeper than 100 m) which characterizes the area. Several valuable medieval rupestrian hand-hewn rock churches and sanctuaries are present along the canyon walls. The canyon cut weak rocks (Plio-Pleistocene calcarenites, in which churches and sanctuaries are excavated) and the underlying well-stratified limestones (Cretaceous calcilutites). Both rocks are abundantly and strongly fractured and disjointed by several different joint sets, and, on the left wall of the "Gravina di Matera" canyon, they are characterized by a mainly dipping-slope attitude. Consequently, rock blocks of different sizes formed (up to some tens of m^3 in volume), and are characterized by low stability condition. The considerable acclivity of the walls and the defects and intense fracturing state of rocks, especially along the edge, cause rapid falls, topples and rockslides of the blocks. This geomorphological fragility, confirmed by wide-spread signs of potential instability and by several rock blocks fell in the stream, causes the diffuse and significant structural-failures processes that involve most of the very fine rupestrian heritages. Our study, after the geological and geomorphological description of the sites and the editing of thematic maps, concentrates on the determination the present-day slope instability conditions. Moreover, the study demonstrated the notable genetic relationship between jointing, slope instability and failure type of carbonate

  10. Control of grapevine wood fungi in commercial nurseries

    Directory of Open Access Journals (Sweden)

    C. Rego

    2009-05-01

    Full Text Available Previous surveys conducted in commercial nurseries found that different wood fungi, namely Cylindrocarpon spp., Botryosphaeriaceae, Phomopsis viticola and Phaeomoniella chlamydospora infect grapevine cuttings. Two field trials were carried out to evaluate the effectiveness of cyprodinil + fludioxonil, pyraclostrobin + metiram, fludioxonil and cyprodinil to prevent or reduce natural infections caused by such fungi. Rootstock and scion cuttings were soaked in fungicidal suspensions for 50 min prior to grafting. After callusing, the grafted cuttings were planted in two commercial field nurseries with and without a previous history of grapevine cultivation. After nine months in the nursery, the plants were uprooted and analysed for the incidence and severity of the wood fungi. Plants uprooted from the field without a previous history of grapevine cultivation were generally less strongly infected by wood fungi. Under this condition, only the mixture cyprodinil + fludioxonil simultaneously reduced the incidence of Cylindrocarpon and Botryosphaeriaceae fungi, as well as the severity of Cylindrocarpon infections. Treatments did not produce significant differences in the incidence and severity of P. viticola, and Pa. chlamydospora. For plants grown in the field with a grapevine history, all fungicides except cyprodinil significantly reduced the incidence and severity of Cylindrocarpon fungi. Also, the incidence and severity of Botryosphaeriaceae pathogens were significantly decreased both by cyprodinil + fludioxonil and by cyprodinil. No significant differences were noticed for P. viticola incidence and severity, and Pa. chlamydospora was not detected again. These results suggest that the practice of soaking grapevine cuttings in selected fungicides prior to grafting significantly reduces Cylindrocarpon spp. and Botryosphaeriaceae infections, thus improving the quality of planting material.

  11. Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought.

    Science.gov (United States)

    Brillante, Luca; Belfiore, Nicola; Gaiotti, Federica; Lovat, Lorenzo; Sansone, Luigi; Poni, Stefano; Tomasi, Diego

    2016-01-01

    Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE) without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin) and compares it to a film-forming antitranspirant (pinolene), traditionally used to limit leaf water loss, and to an untreated control. The trial was carried out under field conditions over three growing seasons, during which moderate to very severe plant water stress (down to -1.9 MPa) was measured through stem water potential. Leaf stomatal conductance (gs) and photosynthesis rate (An) were measured during the seasons and used to compute intrinsic WUE (WUEi, defined as An/gs ratio). Leaf temperature was also recorded and compared between treatments. Bunch quantity, bunch and berry weight, sugar accumulation, anthocyanin and flavonoid contents were measured. Finally, microvinifications were performed and resultant wines subjected to sensory evaluation.Results showed that the use of kaolin increased grapevine intrinsic WUE (+18% on average as compared to unsprayed vines) without affecting berry and bunch weight and quantity, or sugar level. Anthocyanin content increased (+35%) in kaolin treatment, and the wine was judged more attractive (p-value wine was the least appreciated. This study demonstrates that particle film technology can improve vine WUEi and wine quality at the same time, while traditional antitranspirants were not as effective for these purposes. This positive effect can be used in interaction with other already-demonstrated uses of particle film technology, such as pest control and sunburn reduction, in order to achieve more sustainable vineyard management.

  12. Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought.

    Directory of Open Access Journals (Sweden)

    Luca Brillante

    Full Text Available Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin and compares it to a film-forming antitranspirant (pinolene, traditionally used to limit leaf water loss, and to an untreated control. The trial was carried out under field conditions over three growing seasons, during which moderate to very severe plant water stress (down to -1.9 MPa was measured through stem water potential. Leaf stomatal conductance (gs and photosynthesis rate (An were measured during the seasons and used to compute intrinsic WUE (WUEi, defined as An/gs ratio. Leaf temperature was also recorded and compared between treatments. Bunch quantity, bunch and berry weight, sugar accumulation, anthocyanin and flavonoid contents were measured. Finally, microvinifications were performed and resultant wines subjected to sensory evaluation.Results showed that the use of kaolin increased grapevine intrinsic WUE (+18% on average as compared to unsprayed vines without affecting berry and bunch weight and quantity, or sugar level. Anthocyanin content increased (+35% in kaolin treatment, and the wine was judged more attractive (p-value <0.05 and slightly more appreciated (p-value < 0.1 than control. Pinolene did not increase WUEi, limiting An more than gs; grapes with this treatment contained lower sugar and anthocyanin content than control, and the obtained wine was the least appreciated. This study demonstrates that particle film technology can improve vine WUEi and wine quality at the same time, while traditional antitranspirants were not as effective for these purposes. This positive effect can be used in interaction with other already

  13. Distribution of Rotundone and Possible Translocation of Related Compounds Amongst Grapevine Tissues in Vitis vinifera L. cv. Shiraz

    Science.gov (United States)

    Zhang, Pangzhen; Fuentes, Sigfredo; Wang, Yueying; Deng, Rui; Krstic, Mark; Herderich, Markus; Barlow, Edward W. R.; Howell, Kate

    2016-01-01

    Rotundone is an attractive wine aroma compound, especially important for cool climate Shiraz. Its presence in wine is mainly from the grape skin, but can also be found in non-grape tissues, such as leaves and stems. Whether rotundone is produced independently within different grapevine tissues or transported amongst non-grape tissues and grape berries remains unclear. The current study investigated the distribution of this compound in different vine tissues during development and studied the most likely mode of rotundone translocation—via phloem—using stable isotope feeding. In addition, local production of rotundone induced by herbivore feeding was assessed. Results showed that rotundone was firstly detected in the petioles and peduncles/rachises within the development of Vitis vinifera L. cv. Shiraz. Different grapevine tissues had a similar pattern of rotundone production at different grape developmental stages. In the individual vine shoots, non-grape tissues contained higher concentrations and amounts of rotundone compared to berries, which showed that non-grape tissues were the larger pool of rotundone within the plant. This study confirmed the local production of rotundone in individual tissues and ruled out the possibility of phloem translocation of rotundone between different tissues. In addition, other terpenes, including one monoterpenoid (geraniol) and six sesquiterpenes (clovene, α-ylangene, β-copaene, α-muurolene, δ-cadinene, and cis/trans-calamenene) were, for the first time, detected in the ethylenediaminetetraacetic acid-facilitated petiole phloem exudates, with their originality unconfirmed. Unlike other herbivore-induced terpenes, herbivorous activity had limited influences on the concentration of rotundone in grapevine leaves. PMID:27446104

  14. Levels of polonium-210 in the grapevine leaves in Alasehir district in Turkey

    International Nuclear Information System (INIS)

    Gurboga, G.; Aytas Oelmez, S.

    2001-01-01

    The objective of present work is the estimation of Po-210 (polonium) content in the edible grapevine leaves (Vitis viniferae, L.cv Sultana syn.) collected from Gediz plain in Western Turkey. Alasehir District in Gediz plain is one of the most important wine culture region of Turkey. Grapevine leaves are important food material for Dolma in Turkish cuisine. Dolma is a name applied to such vegetables as grapevine leaves, cabbage leaves and green peppers stuffed ground meat or spiked rice. Levels of Po-210 in the grapevine leaves had not been analyzed before in Turkey. In this study, after wet ashing of grapevine leaves, Po-210 was spontaneously plated onto a copper disc from dilute hydrochloric acid medium and deposited activity was measured. The results for Po-210 in the grapevine leaves are compared with the other foodstuff values in the literature

  15. Impact of Ozone Gradient on Grapevine Leaves

    Science.gov (United States)

    Alebic-Juretic, Ana; Bokan-Vucelic, Itana; Mifka, Boris; Zatezalo, Marija; Zubak, Velimir

    2017-04-01

    Due to complex orography and air mass circulation, the Rijeka Bay area is characterized by O3 gradient, with concentrations risen with the altitude (1). Therefore AOT40 values were often exceeded and should result in harmful effects on vegetation. Based on previous controlled experiments (2), we examined the possible effect of atmospheric ozone on grape leaves under natural O3 gradient. Grapevine leaves (2-5) were collected from May to September 2016 at two sampling points in the proximity of two AQM stations: Site 1 in the city centre (20m asl) and Site 2 (186m asl) in the suburban settlement. Subsequent to weighing and determination of surface area, the leaves (0,5 g) were extracted in 95% ethanol and analysed on chlorophyl a (Chla), chlorophyl b (Chlb) and carotene (Car) content by UV-VIS spectrometry on 3 wavelengths (664, 649, 470 nm) (3) In summer 2016 O3 gradient was not that pronounced as usual (1), but stil the concentrations differed by approx. 20%, exceeding national AOT40 value at both sites (22.360 and 28.061 μg m-3 h, respectively, at Sites 1 and 2). The concentrations of other pollutants were bellow limit values (LV). The Cha and Chb in a sample leaves collected at the end of May at Site 2 are equal to that with filtered O3 in control experiment (2), i.e. without damage caused by ozone, while the Car content is lower approx. 50% and is kept at the same level. The con-centrations of pigments obtained in July prooved the possible damage by O3, while in subsequent months could speed up natural ageing. This is the first evidence of O3 damage on plants in the Rijeka Bay area, in spite of weaker O3 gradient and lacking visible signs of damage. Preliminary results indicate the need for more frequent sampling, particularly in the period included in AOT40 (May-July). References: 1. Alebić-Juretić A (2012) Int J Remote Sensing, 33(2): 335-345 2. Britvec M, Reichenauer T, Soja G., Ljubešić N, Pećina M (2001) Biologia (Bratislava),56/4: 417-424 3. Sumanata

  16. TrMADS3, a new MADS-box gene, from a perennial species Taihangia rupestris (Rosaceae) is upregulated by cold and experiences seasonal fluctuation in expression level.

    Science.gov (United States)

    Du, Xiaoqiu; Xiao, Qiying; Zhao, Ran; Wu, Feng; Xu, Qijiang; Chong, Kang; Meng, Zheng

    2008-06-01

    In many temperate perennial plants, floral transition is initiated in the first growth season but the development of flower is arrested during the winter to ensure production of mature flowers in the next spring. The molecular mechanisms of the process remain poorly understood with few well-characterized regulatory genes. Here, a MADS-box gene, named as TrMADS3, was isolated from the overwintering inflorescences of Taihangia rupestris, a temperate perennial in the rose family. Phylogenetic analysis reveals that TrMADS3 is more closely related to the homologs of the FLOWERING LOCUS C lineage than to any of the other MIKC-type MADS-box lineages known from Arabidopsis. The TrMADS3 transcripts are extensively distributed in inflorescences, roots, and leaves during the winter. In controlled conditions, the TrMADS3 expression level is upregulated by a chilling exposure for 1 to 2 weeks and remains high for a longer period of time in warm conditions after cold treatment. In situ hybridization reveals that TrMADS3 is predominantly expressed in the vegetative and reproductive meristems. Ectopic expression of TrMADS3 in Arabidopsis promotes seed germination on the media containing relatively high NaCl or mannitol concentrations. These data indicate that TrMADS3 in a perennial species might have its role in both vegetative and reproductive meristems in response to cold.

  17. Characteristics of unique HBr-hydrolyzed cellulose nanocrystals from freshwater green algae (Cladophora rupestris) and its reinforcement in starch-based film.

    Science.gov (United States)

    Sucaldito, Melvir R; Camacho, Drexel H

    2017-08-01

    Cellulose nanocrystals (CNCs) are promising materials that are readily extracted from plants and other cellulose-containing organisms. In this study, CNCs were isolated from freshwater green algae (Cladophora rupestris) thriving in a volcanic lake, using hydrobromic acid (HBr) hydrolysis. Morphological and structural studies revealed highly crystalline CNCs (94.0% crystallinity index) with preferred orientation to [100] lattice plane as shown by XRD measurements and have an average diameter of 20.0 (±4.4)nm as shown by TEM. Thermal studies showed increased temperature for thermal decomposition of CNCs (381.6°C), which is a result of HBr hydrolysis for CNCs isolation. The isolated CNCs were reinforced into starch based biocomposites via solution casting and evaporation method. Mechanical strength was improved as high as 78% upon addition of 1% cellulose nanocrystals in the films. The produced films are promising materials for their high mechanical strength, biodegradability and availability of raw materials. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti

    2014-01-01

    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  19. Current perspectives in proteomic analysis of abiotic stress in Grapevines

    Directory of Open Access Journals (Sweden)

    Iniga Seraphina George

    2014-12-01

    Full Text Available Grapes are an important crop plant which forms the basis of a globally important industry. Grape and wine production is particularly vulnerable to environmental and climatic fluctuations, which makes it essential for us to develop a greater understanding of the molecular level responses of grape plants to various abiotic stresses. The completion of the initial grape genome sequence in 2007 has led to a significant increase in research on grapes using proteomics approaches. In this article, we discuss some of the current research on abiotic stress in grapevines, in the context of abiotic stress research in other plant species. We also highlight some of the current limitations in grapevine proteomics and identify areas with promising scope for potential future research.

  20. Biostimulation of grapevine : mode of action and possible agronomic uses

    OpenAIRE

    Krzyzaniak, Yuko; Trouvelot, Sophie; Heloir, Marie-Claire; Fourquez, P.; Magnin-Robert, Jean-Bernard; Randoux, B.; Siah, A.; Halama, Patrice; Moreau, Emmanuelle; Adrian, Marielle

    2016-01-01

    Although there is a growing interest for the use of biostimulants in agriculture, only few methods allowing a precise description of their effects on plants have been reported. In the IRIS+ FUI project, two major and highly different worldwide crops, wheat (annual, monocotyledon) and grapevine (perennial, broadleaf), were chosen to deepen our knowledge of such compounds and explore their potential additional interest. The first objective is to develop in greenhouse conditions, a panel of tool...

  1. Atmospheric circulation patterns and phenological anomalies of grapevine in Italy

    Science.gov (United States)

    Cola, Gabriele; Alilla, Roberta; Dal Monte, Giovanni; Epifani, Chiara; Mariani, Luigi; Parisi, Simone Gabriele

    2014-05-01

    Grapevine (Vitis vinifera L.) is a fundamental crop for Italian agriculture as testified by the first place of Italy in the world producers ranking. This justify the importance of quantitative analyses referred to this crucial crop and aimed to quantify meteorological resources and limitations to development and production. Phenological rhythms of grapevine are strongly affected by surface fields of air temperature which in their turn are affected by synoptic circulation. This evidence highlights the importance of an approach based on dynamic climatology in order to detect and explain phenological anomalies that can have relevant effects on quantity and quality of grapevine production. In this context, this research is aimed to study the existing relation among the 850 hPa circulation patterns over the Euro-Mediterranean area from NOAA Ncep dataset and grapevine phenological fields for Italy over the period 2006-2013, highlighting the main phenological anomalies and analyzing synoptic determinants. This work is based on phenological fields with a standard pixel of 2 km routinely produced from 2006 by the Iphen project (Italian Phenological network) on the base of phenological observations spatialized by means of a specific algorithm based on cumulated thermal resources expressed as Normal Heat Hours (NHH). Anomalies have been evaluated with reference to phenological normal fields defined for the Italian area on the base of phenological observations and Iphen model. Results show that relevant phenological anomalies observed over the reference period are primarily associated with long lasting blocking systems driving cold air masses (Arctic or Polar-Continental) or hot ones (Sub-Tropical) towards the Italian area. Specific cases are presented for some years like 2007 and 2011.

  2. ADVANCES IN PROPAGATION OF GRAPEVINE IN THE WORLD

    OpenAIRE

    GROHS, DANIEL SANTOS; ALMANÇA, MARCUS ANDRÉ KURTZ; FAJARDO, THOR VINICIUS MARTINS; HALLEEN, FRANCOIS; MIELE, ALBERTO

    2017-01-01

    ABSTRACT Grapevine production by classical grafting methods and in commercial scale emerged over 130 years. This system remained handmade until the mid-1950s, when the first international certification programs aimed at obtaining mother plants with high viral sanity emerged. The necessity to increase the scale of production on industrial model and plant material production based on minimum morphological standards appeared at the end of the 1960s. Along the 1970s, research unlocked knowledge ...

  3. ADVANCES IN PROPAGATION OF GRAPEVINE IN THE WORLD

    Directory of Open Access Journals (Sweden)

    DANIEL SANTOS GROHS

    2017-12-01

    Full Text Available ABSTRACT Grapevine production by classical grafting methods and in commercial scale emerged over 130 years. This system remained handmade until the mid-1950s, when the first international certification programs aimed at obtaining mother plants with high viral sanity emerged. The necessity to increase the scale of production on industrial model and plant material production based on minimum morphological standards appeared at the end of the 1960s. Along the 1970s, research unlocked knowledge on semi-automated grafting, process hygiene, use of plant growth regulators and understanding of physiological events of rootstock-scion compatibility, callus formation and rooting. So, until the mid-2000s, certification schemes and propagation processes advanced little in technical standard. However, grapevine growing areas were expanded and demands for plant material increased, and new diseases emerged from contaminated nurseries. These new diseases (new viral complexes, phytoplasmas, bacteria and grapevine trunk diseases were discovered by high-sensitivity diagnostic methods. Today, there is a new discussion on the nursery segment worldwide. The propagation techniques have been reviewed from the perspective of reducing the incidence of new diseases and minimum physiological damage of nursery plants during the production stages. Therefore, technological innovations regarding equipment, practices and production inputs have been incorporated in new certification schemes. However, despite these advantages, these schemes have become more complex and multidisciplinary than previous ones, bringing difficulties in adaptation of nurserymen.

  4. Grapevine dynamics after manual tending of juvenile stands on the Hoosier National Forest, Indiana

    Science.gov (United States)

    Robert C. Morrissey; Martin-Michel Gauthier; John A., Jr. Kershaw; Douglass F. Jacobs; Burnell C. Fischer; John R. Siefert

    2008-01-01

    Large woody vines, most notably grapevines, are a source of great concern for forest and wildlife managers in many parts of the Central Hardwood Forest Region of the United States. We examined grapevine dynamics in stands aged 21 - 35 years. The plots, located in regenerated clearcuts in the Hoosier National Forest (HNF), were evaluated for vine control, site, and tree...

  5. Effects of chilling and ABA on [3H]gibberellin A4 metabolism in somatic embryos of grape (Vitis vinifera L. x V. rupestris Scheele)

    International Nuclear Information System (INIS)

    Pearce, D.; Pharis, R.P.; Rajasekaran, K.; Mullins, M.G.

    1987-01-01

    Previous work has indicated that changes in gibberellin (GA) metabolism may be involved in chilling-induced release from dormancy in somatic embryos of grape (Vitis vinifera L. x V. rupestris Scheele). The authors have chilled somatic embryos of grape for 2, 4, or 8 weeks, then incubated them with [ 3 H]GA 4 (of high specific activity, 4.81 x 10 19 becquerel per millimole) for 48 hours at 26 0 C. Chilling had little effect on the total amount of free [ 3 H]GA-like metabolites formed during incubation at 26 0 C, but did change the relative proportions of individual metabolites. The amount of highly water-soluble [ 3 H] metabolites formed at 26 0 C decreased in embryos chilled for 4 or 8 weeks. The concentration of endogeneous GA precursors (e.g., GA 12 aldehyde-, kaurene, and kaurenoic acid-like substances) increased in embryos chilled for 4 or 8 weeks. Treatment with abscisic acid (ABA) (known to inhibit germination in grape embryos) concurrent with [ 3 H]GA 4 treatment at 26 0 C, reduced the uptake of [ 3 H] GA 4 but had little effect on the qualitative spectrum of metabolites. However, in the embryos chilled for 8 weeks and then treated with ABA for 48 hours at 26 0 C, there was a higher concentration of GA precursors than in untreated control embryos. Chilled embryos thus have an enhanced potential for an increase in free GAs through synthesis from increased amounts of GA precursors, or through a reduced ability to form highly water-soluble GA metabolites (i.e., GA conjugates or polyhydroxylated free GAs)

  6. Response of mycorrhizal grapevine to Armillaria mellea inoculation: disease development and polyamines.

    OpenAIRE

    Nogales, A. (Amaia); Aguirreolea, J. (Jone); Santa-Maria, E. (Eva); Camprubi, A. (Amalia); Calvet, C. (Cinta)

    2009-01-01

    A study was conducted with the vine rootstock Richter 110 (Vitis berlandieri Planch. x Vitis rupestris L.) in order to assess whether the colonisation by the arbuscular mycorrhizal fungus (AMF) Glomus intraradices (BEG 72) can delay the disease development in plants inoculated with the root-rot fungus Armillaria mellea (Vahl:Fr) Kummer, and to elucidate if the levels of polyamines (PAs) are modified in response to G. intraradices, A. mellea or by the dual infection. Four treatments were consi...

  7. Oxidative stress homeostasis in grapevine (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Luisa C Carvalho

    2015-03-01

    Full Text Available Plants can maintain growth and reproductive success by sensing changes in the environment and reacting through mechanisms at molecular, cellular, physiological and developmental levels. Each stress condition prompts a unique response although some overlap between the reactions to abiotic stress (drought, heat, cold, salt or high light and to biotic stress (pathogens does occur. A common feature in the response to all stresses is the onset of oxidative stress, through the production of reactive oxygen species (ROS. As hydrogen peroxide and superoxide are involved in stress signaling, a tight control in ROS homeostasis requires a delicate balance of systems involved in their generation and degradation. If the plant lacks the capacity to generate scavenging potential, this can ultimately lead to death. In grapevine, antioxidant homeostasis can be considered at whole plant levels and during the development cycle. The most striking example lies in berries and their derivatives, such as wine, with nutraceutical properties associated with their antioxidant capacity. Antioxidant homeostasis is tightly regulated in leaves, assuring a positive balance between photosynthesis and respiration, explaining the tolerance of many grapevine varieties to extreme environments.In this review we will focus on antioxidant metabolites, antioxidant enzymes, transcriptional regulation and cross-talk with hormones prompted by abiotic stress conditions. We will also discuss three situations that require specific homeostasis balance: biotic stress, the oxidative burst in berries at veraison and in vitro systems. The genetic plasticity of the antioxidant homeostasis response put in evidence by the different levels of tolerance to stress presented by grapevine varieties will be addressed. The gathered information is relevant to foster varietal adaptation to impending climate changes, to assist breeders in choosing the more adapted varieties and to suitable viticulture

  8. Shoot growth of Merlot and Cabernet Sauvignon grapevine varieties

    OpenAIRE

    Marcelo Borghezan; Olavo Gavioli; Hamilton Justino Vieira; Aparecido Lima da Silva

    2012-01-01

    The objective of this work was to evaluate shoot growth of the grapevine varieties Merlot and Cabernet Sauvignon, during 2006/2007, and Cabernet Sauvignon, during 2008/2009, in São Joaquim, SC, Brazil. The experiment was carried out in a commercial vineyard trained on a vertical trellis system. The shoots of the central part of the plants were selected, and the lengths from the base to the apex of 20 shoots per cultivar were evaluated. In 2006/2007, monitoring began at pruning, on 9/15/2006, ...

  9. Nitrogen nutrition of the grape-vine (Vitis vinifera spp)

    International Nuclear Information System (INIS)

    Conradie, W.J.

    1985-12-01

    A thorough knowledge concerning the nitrogen relationship in the grape-vine is essential in order to appreciate how different patterns of uptake, assimilation, storage and utilisation of nitrogen might be advantageous in particular environmental situations. The 15 N-isotope technique has been used to determine the uptake and distribution of nitrogen absorbed during early spring, early summer and autumn. Apart from the total N fraction, protein N and soluble N were determined as well. The utilisation of labelled N applied in the field, was determined for vineyards on heavier and lighter soils

  10. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  11. Application of mutagenesis for improvement of grapevines

    International Nuclear Information System (INIS)

    Becker, H.

    1989-01-01

    Full text: The objectives of our mutation breeding programme are to improve good clones in a limited number of characteristics. One year old grafted vines were treated with x-rays during dormancy just before bud burst. Root stocks and base of the grafted vines were shielded. Among varieties irradiated with 2-6 kR were the following: 'White Riesling' clone 239-25 Gm, 'White Riesling' clone 110-18 Gm, 'Mueller-Thurgau' clone 6-8 Gm, 'Rulaender' (Pinot gris) clone 2 Gm, 'Blauer Spaetburgunder' (Pinot noir) clone 20 Gm and 'Trollinger'. Grafted and rooted vines were found to tolerate higher doses of radiation than unrooted cuttings. In M 1 V 2 many chimeric and non-chimeric variant shoots could be observed. Two stable periclinal chimeras were obtained in 'White Riesling' and 'Trollinger' after irradiation. Out of irradiated 'Rulaender', mutants of 'Weisser Burgunder (Pinot blanc)' type were selected. In another experiment using 1500 rad of fast neutrons mutants with the characteristics of 'Blauer Spaet-Burgunder (Pinot noir)' were found. Within progenies of irradiated 'Blauer Spaetburgunder' early ripening types with dark skin berries were discovered. New mutant clones under evaluation show interesting properties with regard to stem rot, Botrytis, yield and quality. (author)

  12. Irrigation effects on soil attributes and grapevine performance in a 'Godello' vineyard of NW Spain

    Science.gov (United States)

    Fandiño, María; Trigo-Córdoba, Emiliano; Martínez, Emma M.; Bouzas-Cid, Yolanda; Rey, Benjamín J.; Cancela, Javier J.; Mirás-Avalos, Jose M.

    2014-05-01

    Irrigation systems are increasingly being used in Galician vineyards. However, a lack of information about irrigation management can cause a bad use of these systems and, consequently, reductions in berry quality and loss of water resources. In this context, experiences with Galician cultivars may provide useful information. A field experiment was carried out over two seasons (2012-2013) on Vitis vinifera (L.) cv. 'Godello' in order to assess the effects of irrigation on soil attributes, grapevine performance and berry composition. The field site was a commercial vineyard located in A Rúa (Ourense-NW Spain). Rain-fed vines (R) were compared with two irrigation systems: surface drip irrigation (DI) and subsurface drip irrigation (SDI). Physical and chemical characteristics of soil were analyzed after installing irrigation systems at the beginning of each season, in order to assess the effects that irrigation might have on soil attributes. Soil water content, leaf and stem water potentials and stomatal conductance were periodically measured over the two seasons. Yield components including number of clusters, yield per plant and cluster average weight were taken. Soluble solids, pH, total acidity and amino acids contents were measured on the grapes at harvest. Pruning weight was also recorded. Soil attributes did not significantly vary due to the irrigation treatments. Stem water potentials were significantly lower for R plants on certain dates through the season, whereas stomatal conductance was similar for the three treatments in 2013, while in 2012 SDI plants showed greater stomatal conductance values. SDI plants yielded more than those R due to both a greater number of clusters per plant and to heavier clusters. Pruning weight was significantly higher in SI plants. Berry composition was similar for the three treatments except for the amino acids content, which was higher under SDI conditions. These results may be helpful for a sustainable management of irrigation

  13. Response to crop-tree release by 7-year-old stems of yellow-poplar and black cherry

    Science.gov (United States)

    G.R. Jr. Trimble; G.R. Jr. Trimble

    1973-01-01

    Five years after crop-tree release of yellow-poplar and black cherry sterns in a 7-year-old stand of Appalachian hardwoods, measurements indicated that released trees were but slightly superior to control trees in height, diameter, and crown position. Sprout regrowth of cut tree stems and grapevines had largely nullified the effects of release. Indications are that for...

  14. VARYING DEGREE OF GRAFTING COMPATIBILITY BETWEEN CV. CHARDONNAY, MERLOT AND DIFFERENT GRAPEVINE ROOTSTOCKS

    Directory of Open Access Journals (Sweden)

    Slavica TODIĆ

    2006-02-01

    Full Text Available Level of affi nity between grapevine rootstock and Vitis vinifera as scion, quality of reproductive materials and technological actions in grapevine rootstock production process determine success in grapevine rootstock production in large extent. Practical training showed that difference in level of compatibility between grapevine rootstock and grafted Vitis vinifera cultivars are existing. Direct effects of these differences are unequal yield of fi rst class grafted grapevine rootlings. In this paper, level of compatibility in nursery between clones of cv. Chardonnay BCL 75, VCR4 and cv. Merlot R18, MCL 519 and grapevine rootstocks Kober 5BB (Vitis berlandieri x V. riparia, SO4 (V. berlandieri x V. riparia and 41B (Chasselas x V.berlandieri were investigated. The trial was conducted in commercial grapevine nursery located in Velika Drenova, Serbia. As an index of compatibility, grade of high quality grapevine grafted rootlings, dry matter in mature shoots and root system development were used. Grafting was done by `tongue grafting` indoor technique. Stratifi cation was done in sand, on temperature of the stratifi cation material of 26-28oC, and humidity of around 90%. Grafted cuttings were waxed twice: before stratifi cation, and before planting in the nursery. Grafted rootlings were classed in two classes according to regulations of quality, (Yugoslav Offi cial Register, 26/79. Grafted rootlings that did not satisfi ed standard criteria were discarded. Both clones of cv. Chardonnay gave the highest percentage of I class grafted rootlings on grapevine rootstock 41B: clone BCL 75 – 60% and clone VCR4 – 61%. In the same combination, those grapevine grafted rootlings had the highest weight of the root system. Lower percentage of obtained I class grafted rootlings was established on rootstock Kober 5BB, while statistically signifi cantly lower yields were obtained on grapevine rootstock SO4: clone BCL75 – 43% and clone VCR4 – 48%. Dry

  15. A Comparison of Petiole Hydraulics and Aquaporin Expression in an Anisohydric and Isohydric Cultivar of Grapevine in Response to Water-Stress Induced Cavitation.

    Science.gov (United States)

    Shelden, Megan C; Vandeleur, Rebecca; Kaiser, Brent N; Tyerman, Stephen D

    2017-01-01

    We report physiological, anatomical and molecular differences in two economically important grapevine ( Vitis vinifera L.) cultivars cv. Grenache (near-isohydric) and Chardonnay (anisohydric) in their response to water-stress induced cavitation. The aim of the study was to compare organ vulnerability (petiole and stem) to cavitation by measuring ultrasonic acoustic emissions (UAE) and percent loss of conductance of potted grapevines subject to the onset of water-stress. Leaf (ψ L ) and stem water potential (ψ S ), stomatal conductance ( g s ), transpiration ( E ), petiole hydraulics ( K Pet ), and xylem diameter were also measured. Chardonnay displayed hydraulic segmentation based on UAE, with cavitation occurring at a less negative ψ L in the petiole than in the stem. Vulnerability segmentation was not observed in Grenache, with both petioles and stems equally vulnerable to cavitation. Leaf water potential that induced 50% of maximum UAE was significantly different between petioles and stems in Chardonnay (ψ 50Petiole = -1.14 and ψ 50Stem = -2.24 MPa) but not in Grenache (ψ 50Petiole = -0.73 and ψ 50Stem = -0.78 MPa). Grenache stems appeared more susceptible to water-stress induced cavitation than Chardonnay stems. Grenache displayed (on average) a higher K Pet likely due to the presence of larger xylem vessels. A close relationship between petiole hydraulic properties and vine water status was observed in Chardonnay but not in Grenache. Transcriptional analysis of aquaporins in the petioles and leaves ( VvPIP1;1, VvPIP2;1, VvPIP2;2 VvPIP2;3, VvTIP1;1 , and VvTIP2;1 ) showed differential regulation diurnally and in response to water-stress. VvPIP2;1 showed strong diurnal regulation in the petioles and leaves of both cultivars with expression highest predawn. Expression of VvPIP2;1 and VvPIP2;2 responded to ψ L and ψ S in both cultivars indicating the expression of these two genes are closely linked to vine water status. Expression of several aquaporin

  16. Identification of a novel vitivirus from grapevines in New Zealand.

    Science.gov (United States)

    Blouin, Arnaud G; Keenan, Sandi; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

    2018-01-01

    We report a sequence of a novel vitivirus from Vitis vinifera obtained using two high-throughput sequencing (HTS) strategies on RNA. The initial discovery from small-RNA sequencing was confirmed by HTS of the total RNA and Sanger sequencing. The new virus has a genome structure similar to the one reported for other vitiviruses, with five open reading frames (ORFs) coding for the conserved domains described for members of that genus. Phylogenetic analysis of the complete genome sequence confirmed its affiliation to the genus Vitivirus, with the closest described viruses being grapevine virus E (GVE) and Agave tequilana leaf virus (ATLV). However, the virus we report is distinct and shares only 51% amino acid sequence identity with GVE in the replicase polyprotein and 66.8% amino acid sequence identity with ATLV in the coat protein. This is well below the threshold determined by the ICTV for species demarcation, and we propose that this virus represents a new species. It is provisionally named "grapevine virus G".

  17. Shoot growth of Merlot and Cabernet Sauvignon grapevine varieties

    Directory of Open Access Journals (Sweden)

    Marcelo Borghezan

    2012-02-01

    Full Text Available The objective of this work was to evaluate shoot growth of the grapevine varieties Merlot and Cabernet Sauvignon, during 2006/2007, and Cabernet Sauvignon, during 2008/2009, in São Joaquim, SC, Brazil. The experiment was carried out in a commercial vineyard trained on a vertical trellis system. The shoots of the central part of the plants were selected, and the lengths from the base to the apex of 20 shoots per cultivar were evaluated. In 2006/2007, monitoring began at pruning, on 9/15/2006, and ended on 2/6/2007, totalizing 144 days of evaluation. During the 2008/2009 cycle, phenology and shoot growth for 'Cabernet Sauvignon' were assessed from grape development (1/13/2009 (pea-sized grapes until shoot vegetative growth had ceased. Budburst occurred in the second half of September, and shoot-growth cessation occurred during ripening. Higher growth rates (about 4 cm per day were observed in pre- and post-flowering, followed by reduction due to the competition for photosynthates for the formation of flowers and bunches. Temperature and photoperiod induce grapevine shoots to cease growth in the highland regions of Santa Catarina State, Brazil.

  18. Dissipation of glyphosate from grapevine soils in Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Norma J. Salazar López

    2016-10-01

    Full Text Available Grapevine is one of the important crops in Sonora, due to revenue generation from its export to foreign countries. Among the most widely used herbicides for this crop is glyphosate, which is considered moderately toxic and persistent. The present research evaluates the dissipation of glyphosate in grapevine planted soil at three depths (5, 30 and 60 cm. Sampling was carried out before glyphosate application, and 5, 10, 18, 27, and 65 days after. Glyphosate was extracted from soil samples using ammonium hydroxide. The derivate extracts were partitioned with dichloromethane and analyzed using gas chromatography with pulsed flame photometric detector (PFPD. The results showed that average glyphosate residues are significantly greater at 5 cm (0.09 mg kg-1 than the other depths (30 and 60 cm, having a difference of 0.078 mg kg-1 between them (P < 0.03. Glyphosate concentration time profiles were similar; it reached maximum soil concentration in a range of 10 to 18 days after application. The half-life of glyphosate in soil has an average of 39 days at all depths. Our data suggests that the release in soil of glyphosate applied to weeds delays its transference to soil by 14 days, and extends residue half life to 55 days after application. These results could be the basis for further research, including more environmental parameters that could affect the dissipation or degradation process in soil.

  19. Phytotoxins Produced by Fungi Associated with Grapevine Trunk Diseases

    Science.gov (United States)

    Andolfi, Anna; Mugnai, Laura; Luque, Jordi; Surico, Giuseppe; Cimmino, Alessio; Evidente, Antonio

    2011-01-01

    Up to 60 species of fungi in the Botryosphaeriaceae family, genera Cadophora, Cryptovalsa, Cylindrocarpon, Diatrype, Diatrypella, Eutypa, Eutypella, Fomitiporella, Fomitiporia, Inocutis, Phaeoacremonium and Phaeomoniella have been isolated from decline-affected grapevines all around the World. The main grapevine trunk diseases of mature vines are Eutypa dieback, the esca complex and cankers caused by the Botryospheriaceae, while in young vines the main diseases are Petri and black foot diseases. To understand the mechanism of these decline-associated diseases and the symptoms associated with them, the toxins produced by the pathogens involved in these diseases were isolated and characterised chemically and biologically. So far the toxins of only a small number of these decline fungi have been studied. This paper presents an overview of the toxins produced by the most serious of these vine wood pathogens: Eutypa lata, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and some taxa in the Botryosphaeriaceae family, and examines how these toxins produce decline symptoms. The chemical structure of these metabolites and in some cases their vivotoxin nature are also discussed. PMID:22295177

  20. Phytotoxins Produced by Fungi Associated with Grapevine Trunk Diseases

    Directory of Open Access Journals (Sweden)

    Antonio Evidente

    2011-12-01

    Full Text Available Up to 60 species of fungi in the Botryosphaeriaceae family, genera Cadophora, Cryptovalsa, Cylindrocarpon, Diatrype, Diatrypella, Eutypa, Eutypella, Fomitiporella, Fomitiporia, Inocutis, Phaeoacremonium and Phaeomoniella have been isolated from decline-affected grapevines all around the World. The main grapevine trunk diseases of mature vines are Eutypa dieback, the esca complex and cankers caused by the Botryospheriaceae, while in young vines the main diseases are Petri and black foot diseases. To understand the mechanism of these decline-associated diseases and the symptoms associated with them, the toxins produced by the pathogens involved in these diseases were isolated and characterised chemically and biologically. So far the toxins of only a small number of these decline fungi have been studied. This paper presents an overview of the toxins produced by the most serious of these vine wood pathogens: Eutypa lata, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and some taxa in the Botryosphaeriaceae family, and examines how these toxins produce decline symptoms. The chemical structure of these metabolites and in some cases their vivotoxin nature are also discussed.

  1. Genetic structure of the fungal grapevine pathogen Eutypa lata from four continents

    Science.gov (United States)

    The generalist ascomycete fungus Eutypa lata causes Eutypa dieback of grapevine (Vitis vinifera) worldwide. To decipher the cosmopolitan distribution of this fungus, the population genetic structure of 17 geographic samples was investigated from four continental regions (Australia, California, Europ...

  2. Water stress exacerbates the severity of Botryosphaeria dieback in grapevines infected by Neofusicoccum parvum

    Science.gov (United States)

    Botryosphaeria dieback (causal fungus Neofusicoccum parvum) is a detrimental grapevine trunk disease, causing internal wood degradation, killing shoots, and reducing yields. We examined the interactive effects of drought and N. parvum infection, common vineyard stresses, on wood-lesion development. ...

  3. Xylella fastidiosa requires polygalacturonase for colonization and pathogenicity in Vitis vinifera grapevines.

    Science.gov (United States)

    Roper, M Caroline; Greve, L Carl; Warren, Jeremy G; Labavitch, John M; Kirkpatrick, Bruce C

    2007-04-01

    Xylella fastidiosa is the causal agent of Pierce's disease of grape, an economically significant disease for the grape industry. X. fastidiosa systemically colonizes the xylem elements of grapevines and is able to breach the pit pore membranes separating xylem vessels by unknown mechanisms. We hypothesized that X. fastidiosa utilizes cell wall degrading enzymes to break down pit membranes, based on the presence of genes involved in plant cell wall degradation in the X. fastidiosa genome. These genes include several beta-1,4 endoglucanases, several xylanases, several xylosidases, and one polygalacturonase (PG). In this study, we demonstrated that the pglA gene encodes a functional PG. A mutant in pglA lost pathogenicity and was compromised in its ability to systemically colonize Vitis vinifera grapevines. The results indicate that PG is required for X. fastidiosa to successfully infect grapevines and is a critical virulence factor for X. fastidiosa pathogenesis in grapevine.

  4. ‘Bois noir’: new phytoplasma disease of grapevine in Iran

    Directory of Open Access Journals (Sweden)

    Mirchenari Seyed Mehdi

    2015-01-01

    Full Text Available Recently, grapevines showing symptoms suggesting the ‘bois noir’ phytoplasma disease were observed in vineyards located in several central provinces of Iran. Polymerase chain reaction assays using phytoplasma universal primer pair P1A/P7A followed by primer pair R16F2n/R16R2 in nested PCR, confirmed the association of phytoplasmas with symptomatic grapevines. The results of RFLP analyses using HpaII, HinfI, MseI, RsaI, and TaqI restriction enzymes, indicated that grapevine phytoplasma isolates in these regions could be related to the 16SrXII group. Sequence analyses of the partial 16S rRNA gene confirmed that Iranian grapevine phytoplasmas are associated with ‘Candidatus Phytoplasma solani’. This is the first report of the ‘bois noir’ disease outbreak in Iran

  5. Root-associated bacteria promote grapevine growth: from the laboratory to the field

    KAUST Repository

    Rolli, Eleonora

    2016-08-18

    Background and Aims: Laboratory and greenhouse experiments have shown that root-associated bacteria have beneficial effects on grapevine growth; however, these effects have not been tested in the field. Here, we aimed to demonstrate whether bacteria of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant growth, we sorted fifteen bacterial strains from a larger isolate collection to study in vitro Plant Growth Promoting (PGP) traits. We analysed the ability of these strains to colonise the root tissues of grapevine and Arabidopsis using green-fluorescent-protein-labelled strain derivatives and a cultivation independent approach. We assessed the ability of two subsets randomly chosen from the 15 selected strains to promote grapevine growth in two field-scale experiments in north and central Italy over two years. Parameters of plant vigour were measured during the vegetative season in de novo grafted vine cuttings and adult productive plants inoculated with the bacterial strains. Results: Beneficial bacteria rapidly and intimately colonized the rhizoplane and the root system of grapevine. In the field, plants inoculated with bacteria isolated from grapevine roots out-performed untreated plants. In both the tested vineyards, bacteria-promotion effects largely rely in the formation of an extended epigeal system endowed of longer shoots with larger diameters and more nodes than non-inoculated plants. Conclusions: PGP bacteria isolated in the laboratory can be successfully used to promote growth of grapevines in the field. The resulting larger canopy potentially increased the photosynthetic surface of the grapevine, promoting growth.

  6. SOYBEAN AND CASEIN HYDROLYSATES INDUCE GRAPEVINE IMMUNE RESPONSES AND RESISTANCE AGAINST PLASMOPARA VITICOLA

    Directory of Open Access Journals (Sweden)

    Nihed eLachhab

    2014-12-01

    Full Text Available Plasmopara viticola, the causal agent of grapevine downy mildew, is one of the most devastating grape pathogen in Europe and North America. Although phytochemicals are used to control pathogen infections, the appearance of resistant strains and the concern for possible adverse effects on environment and human health are increasing the search for alternative strategies. In the present investigation, we successfully tested two protein hydrolysates from soybean (soy and casein (cas to trigger grapevine resistance against P. viticola. On Vitis vinifera cv. Marselan plants, the application of soy and cas reduced the infected leaf surface by 76 and 63%, as compared to the control, respectively. Since both hydrolysates might trigger the plant immunity, we investigated their ability to elicit grapevine defence responses. On grapevine cell suspensions, a different free cytosolic calcium signature was recorded for each hydrolysate, whereas a similar transient phosphorylation of two MAP kinases of 45 and 49 kDa was observed. These signalling events were followed by transcriptome reprogramming, including the up-regulation of defence genes encoding pathogenesis-related (PR proteins and the stilbene synthase enzyme responsible for the biosynthesis of resveratrol, the main grapevine phytoalexin. Liquid chromatography analyses confirmed the production of resveratrol and its dimer metabolites, δ- and ε-viniferins. Overall, soy effects were more pronounced as compared to the cas one. Both hydrolysates proved to act as elicitors to enhance grapevine immunity against pathogen attack.

  7. The grapevine kinome: annotation, classification and expression patterns in developmental processes and stress responses.

    Science.gov (United States)

    Zhu, Kaikai; Wang, Xiaolong; Liu, Jinyi; Tang, Jun; Cheng, Qunkang; Chen, Jin-Gui; Cheng, Zong-Ming Max

    2018-01-01

    Protein kinases (PKs) have evolved as the largest family of molecular switches that regulate protein activities associated with almost all essential cellular functions. Only a fraction of plant PKs, however, have been functionally characterized even in model plant species. In the present study, the entire grapevine kinome was identified and annotated using the most recent version of the grapevine genome. A total of 1168 PK-encoding genes were identified and classified into 20 groups and 121 families, with the RLK-Pelle group being the largest, with 872 members. The 1168 kinase genes were unevenly distributed over all 19 chromosomes, and both tandem and segmental duplications contributed to the expansion of the grapevine kinome, especially of the RLK-Pelle group. Ka/Ks values indicated that most of the tandem and segmental duplication events were under purifying selection. The grapevine kinome families exhibited different expression patterns during plant development and in response to various stress treatments, with many being coexpressed. The comprehensive annotation of grapevine kinase genes, their patterns of expression and coexpression, and the related information facilitate a more complete understanding of the roles of various grapevine kinases in growth and development, responses to abiotic stress, and evolutionary history.

  8. Whole genome amplification and microsatellite genotyping of herbarium DNA revealed the identity of an ancient grapevine cultivar

    Science.gov (United States)

    Malenica, Nenad; Šimon, Silvio; Besendorfer, Višnja; Maletić, Edi; Karoglan Kontić, Jasminka; Pejić, Ivan

    2011-09-01

    Reconstruction of the grapevine cultivation history has advanced tremendously during the last decade. Identification of grapevine cultivars by using microsatellite DNA markers has mostly become a routine. The parentage of several renowned grapevine cultivars, like Cabernet Sauvignon and Chardonnay, has been elucidated. However, the assembly of a complete grapevine genealogy is not yet possible because missing links might no longer be in cultivation or are even extinct. This problem could be overcome by analyzing ancient DNA from grapevine herbarium specimens and other historical remnants of once cultivated varieties. Here, we present the first successful genotyping of a grapevine herbarium specimen and the identification of the corresponding grapevine cultivar. Using a set of nine grapevine microsatellite markers, in combination with a whole genome amplification procedure, we found the 90-year-old Tribidrag herbarium specimen to display the same microsatellite profile as the popular American cultivar Zinfandel. This work, together with information from several historical documents, provides a new clue of Zinfandel cultivation in Croatia as early as the beginning of fifteenth century, under the native name Tribidrag. Moreover, it emphasizes substantial information potential of existing grapevine and other herbarium collections worldwide.

  9. Stem Cells

    Science.gov (United States)

    Stem cells are cells with the potential to develop into many different types of cells in the body. ... the body. There are two main types of stem cells: embryonic stem cells and adult stem cells. Stem ...

  10. Nitrogen metabolism in a grapevine in vitro system

    Directory of Open Access Journals (Sweden)

    Nuria Llorens

    2002-09-01

    Full Text Available Ammonium, nitrate, nitrite, protein and individual and total amino acid contents were determined in grapevine (cv Sauvignon cultured in vitro. The enzyme activities of nitrate and nitrite reductases, glutamine synthetase, glutamate synthetase and dehydrogenase were also determined. The nitrogen taken up by the plants was 70% of the total nitrogen in the medium after 75 days of in vitro culture. Most of the nitrogen taken up was recovered in the leaves, yet only ammonia and amino acid concentrations were significantly higher in leaves. In roots, glutamine was the most abundant amino acid. In leaves, the most abundant amino acids were aspartate, glutamate, glutamine, alanine, arginine and g-aminobutirate. All enzyme activities were higher in roots than in leaves. These results suggest that both roots and leaves incorporate inorganic nitrogen into organic forms.

  11. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  12. STACHYS RUPESTRIS (LAMIACEAE’İN UÇUCU YAĞ BİLEŞİMİ VE ANTİMİKROBİYAL ETKİLERİ

    Directory of Open Access Journals (Sweden)

    GÖKALP İŞCAN

    2015-12-01

    Full Text Available Stachys cinsi (Lamiaceae dünya üzerinde tanımlanmış yaklaşık 300 türle geniş bir yayılış gösterirken, bu cins ülkemizde %48 endemizm oranıyla 91 tür ve 116 taksa ile temsil edilmektedir. Anadolu’da “Deli adaçayı” veya “Dağ çayı” isimleriyle bilinen Stachys türleri sahip olduğu antibakteriyel, antienflamatuvar, antipiretik, antioksidan ve sitotoksik etkilerinden dolayı, halk arasında cilt hastalıkları, ülser, kanser, solunum rahatsızlıkları ve böbrek hastalıklarında kullanılmaktadır. Yapılan çalışmalarda sekonder metabolitlerinin genellikle iridoit ve flavon glikozitleri ile diterpenler ve uçucu yağlar olduğu ortaya konmuştur.Çalışmamızda Mersin ve civarı için endemik olan Stachys rupestris Montbret et Aucher ex Benth.’in çiçekli toprak üstü kısımlarından hidrodistilasyon ile elde edilen uçucu yağın kompozisyonu gaz kromatografisi/alev iyonlaşma dedektörü ve gaz kromatografisi/kütle spektrometresi ile ortaya konmuştur,  Ana bileşenler a-pinen (%14.4, tetradekanoik asit (%10.3 ve β-karyofillen (%5.3 olarak saptanmıştır.Uçucu yağın patojen bakteri ve maya türlerine karşı antimikrobiyal özellikleri “Klinik ve Laboratuvar Standartları Enstitüsü”nün yayımladığı CLSI M27-A2 ve M7-A7 protokolleri uyarınca mikrodilüsyon duyarlılık testleri ile ortaya konmuştur. Yağın bakterilere kıyasla test edilen Candida türlerine karşı daha etkili olduğu görülmüş, Candida parapsilosis, C. zeylanoides ve C. krusei’yi 31,25 µg/mL, C. zeylanoides’i ise 15,0 µg/mL konsantrasyonda (MİK inhibe ettiği belirlenmiştir.

  13. VitisNet: "Omics" integration through grapevine molecular networks.

    Directory of Open Access Journals (Sweden)

    Jérôme Grimplet

    Full Text Available BACKGROUND: Genomic data release for the grapevine has increased exponentially in the last five years. The Vitis vinifera genome has been sequenced and Vitis EST, transcriptomic, proteomic, and metabolomic tools and data sets continue to be developed. The next critical challenge is to provide biological meaning to this tremendous amount of data by annotating genes and integrating them within their biological context. We have developed and validated a system of Grapevine Molecular Networks (VitisNet. METHODOLOGY/PRINCIPAL FINDINGS: The sequences from the Vitis vinifera (cv. Pinot Noir PN40024 genome sequencing project and ESTs from the Vitis genus have been paired and the 39,424 resulting unique sequences have been manually annotated. Among these, 13,145 genes have been assigned to 219 networks. The pathway sets include 88 "Metabolic", 15 "Genetic Information Processing", 12 "Environmental Information Processing", 3 "Cellular Processes", 21 "Transport", and 80 "Transcription Factors". The quantitative data is loaded onto molecular networks, allowing the simultaneous visualization of changes in the transcriptome, proteome, and metabolome for a given experiment. CONCLUSIONS/SIGNIFICANCE: VitisNet uses manually annotated networks in SBML or XML format, enabling the integration of large datasets, streamlining biological functional processing, and improving the understanding of dynamic processes in systems biology experiments. VitisNet is grounded in the Vitis vinifera genome (currently at 8x coverage and can be readily updated with subsequent updates of the genome or biochemical discoveries. The molecular network files can be dynamically searched by pathway name or individual genes, proteins, or metabolites through the MetNet Pathway database and web-portal at http://metnet3.vrac.iastate.edu/. All VitisNet files including the manual annotation of the grape genome encompassing pathway names, individual genes, their genome identifier, and chromosome

  14. Burgundy regional climate change and its potential impact on grapevines

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yiwen [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); G.C. Rieber Climate Institute at the Nansen Environment and Remote Sensing Center, Bergen (Norway); Castel, Thierry [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); AgroSup, Department of Agriculture and Environment, Dijon (France); Richard, Yves; Cuccia, Cedric [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); Bois, Benjamin [University of Burgundy, Center for Climate Research, UMR 5210 CNRS, Dijon (France); IUVV, University of Burgundy, Dijon (France)

    2012-10-15

    ARPEGE general circulation model simulations were dynamically downscaled by The Weather Research and Forecasting Model (WRF) for the study of climate change and its impact on grapevine growth in Burgundy region in France by the mid twenty-first century. Two time periods were selected: 1970-1979 and 2031-2040. The WRF model driven by ERA-INTERIM reanalysis data was validated against in situ surface temperature observations. The daily maximum and minimum surface temperature (T{sub max} and T{sub min}) were simulated by the WRF model at 8 x 8 km horizontal resolution. The averaged daily T{sub max} for each month during 1970-1979 have good agreement with observations, the averaged daily T{sub min} have a warm bias about 1-2 K. The daily T{sub max} and T{sub min} for each month (domain averaged) during 2031-2040 show a general increase. The largest increment ({proportional_to}3 K) was found in summer. The smallest increments (<1 K) were found in spring and fall. The spatial distribution of temperature increment shows a strong meridional gradient, high in south in summer, reversing in winter. The resulting potential warming rate in summer is equivalent to 4.7 K/century under the IPCC A2 emission scenario. The dynamically downscaled T{sub max} and T{sub min} were used to simulate the grape (Pinot noir grape variety) flowering and veraison dates. For 2031-2040, the projected dates are 8 and 12 days earlier than those during 1970-1979, respectively. The simulated hot days increase more than 50% in the two principal grapevine regions. They show strong impact on Pinot noir development. (orig.)

  15. Cabernet Sauvignon grapevine grafted onto rootstocks during the autumn-winter season in southeastern Brazilian

    Directory of Open Access Journals (Sweden)

    Claudia Rita de Souza

    2015-02-01

    Full Text Available The change of grape (Vitis vinifera harvest from summer to winter through double pruning management has improved the fine wine quality in southern Brazil. High altitude, late cultivar and grafting combination all need to be investigated to optimize this new viticulture management. For this purpose, this study was carried out during the 2011 and 2012 growing seasons in a high altitude region of the state of Minas Gerais, Brazil, using eight grafting combinations for five year old Cabernet Sauvignon vines. The stem water potential, photosynthetic rate and stomatal conductance were not affected by rootstock type. The rootstocks IAC 766 and 101-14 induced, respectively, the highest and lowest vegetative vigor in Cabernet Sauvignon, as shown by leaf area and pruning weight. In the 2011 growing season, the leaf chlorophyll contents were increased in IAC 766, whereas vines grafted onto 101-14 accumulated more leaf starch, probably due to reduced vegetative and reproductive growth. In general, rootstocks K5BB, 1045P, SO4 and IAC 766 had the highest yield as compared to 1103P and 101-14. Berries from the grapevine with the highest yield did not differ in pH, total soluble solids and acidity. The rootstocks did not influence the anthocyanins and total phenols in both growing seasons. Quality parameters were better in the 2011 than in the 2012 growing season due to better climatic conditions, mainly less rainfall. The best performance of Cabernet Sauvignon was achieved when grafted onto K5BB, 1045P, SO4 and IAC 766 rootstocks.

  16. Effect of rootstock on nutrient content of 'cabernet sauvignon' grapevine tissues

    OpenAIRE

    Miele, Alberto; Rizzon, Luiz Antenor; Giovannini, Eduardo

    2009-01-01

    A nutrição mineral da videira constitui-se em importante fator para a qualidade dos vinhos. Devido a isso, avaliou-se o efeito de porta-enxertos no teor de nutrientes em diferentes tecidos da videira 'Cabernet Sauvignon' (Vitis vinifera L.) na Serra Gaúcha. o experimento foi conduzido durante o ciclo vegetativo de 2004/2005, com os porta-enxertos Rupestris du lot, 101-14, 3309, 420A, Kober 5BB, 161-49, So4 e Paulsen 1103, enxertados em 1993 com a cv. 'Cabernet Sauvignon'. o delineamento exper...

  17. Characterization of Cadophora luteo-olivacea and C. melinii isolates obtained from grapevines and environmental samples from grapevine nurseries in Spain

    Directory of Open Access Journals (Sweden)

    David GRAMAJE

    2011-12-01

    Full Text Available Fifty-eight Cadophora luteo-olivacea and three C. melinii isolates were recovered from grapevines showing black vascular streaking and decline symptoms characteristic of Petri disease, and from different stages of the grapevine nursery process in Spain. The isolates were studied by means of phenotypical characterization, DNA analysis and pathogenicity tests. The morphological characters studied included conidiophore, phialide and conidial morphology. Colony characters and pigment production on MEA, PDA and OA were also examined. Phenotypical data were subjected to cluster analysis, which clearly separated C.luteo-olivacea isolates into four groups. Mating tests were performed on all possible combinations for each Cadophora species but no sexual fruiting bodies were produced. Partial sequences of the nuclear ribosomal internal transcribed spacer (ITS, beta-tubulin (BT and the elongation factor 1a (EF were analysed, but no genetic variation occurred within the C. luteo-olivacea isolates or within the C. melinii isolates in any of the regions studied. Pathogenicity tests were conducted on 1-year-old grapevine cuttings of four different rootstocksusing four C. luteo-olivacea isolates and one isolate of C. melinii. All Cadophora isolates except the C.melinii isolate caused significantly longer lesions in the xylem of grapevine rootstocks than in the controls.

  18. Multi-gene analysis and morphology reveal novel Ilyonectria species associated with black foot disease of grapevines

    NARCIS (Netherlands)

    Cabral, A.; Rego, C.; Nascimento, T.; Oliveira, H.; Groenewald, J.Z.; Crous, P.W.

    2012-01-01

    Black foot is an important disease of grapevines, which has in recent years been recorded with increased incidence and severity throughout the world, affecting grapevines both in nurseries and young vineyards. In the past the disease has been associated with infections by Ilyonectria macrodidyma,

  19. Effect of ploughing-down of grapevine chips on soil structure when using special agricultural machinery

    Directory of Open Access Journals (Sweden)

    Barbora Badalíková

    2012-01-01

    Full Text Available Within the period of 2008–2011, changes in soil structure were studied in two selected localities: one of them was situated in vineyards of the University Training Farm of Mendel University in Žabčice near Brno, the other was in vineyards situated in the cadastre of wine-growing municipality Velké Bílovice. Established were altogether three variants of experiments with application of crushed grapevine wood (chips: Variant 1 – control; Variant 2 – crushed grapevine wood ploughed down to the depth of 0.10 m; Variant 3 – crushed grapevine wood + grass spread on the soil surface as a mulch. Grapevine canes were crushed to chips using a special agricultural machinery while the soil in inter-rows was processed using conventional tilling machines. The obtained results showed that the best coefficient of structurality (expressing the degree of destruction of soil structure was recorded in Variants 2 in both localities. Considering values of this coefficient it could be concluded that just this variant showed a positive effect on soil structure. This variant reduced the compaction of soil caused by the movement of agricultural machines in vineyard inter-rows Crushed grapevine waste wood can therefore compensate losses of organic matter in soil. Better values of structurality coefficient were recorded in the locality Žabčice.

  20. Differential expression of genes of Xylella fastidiosa in xylem fluid of citrus and grapevine.

    Science.gov (United States)

    Shi, Xiangyang; Bi, Jianlong; Morse, Joseph G; Toscano, Nick C; Cooksey, Donald A

    2010-03-01

    Xylella fastidiosa causes a serious Pierce's disease (PD) in grapevine. Xylella fastidiosa cells from a PD strain were grown in a pure xylem fluid of a susceptible grapevine cultivar vs. xylem fluid from citrus, which is not a host for this strain of X. fastidiosa. When grown in grapevine xylem fluid, cells of the PD strain formed clumps and biofilm formed to a greater extent than in citrus xylem fluid, although the PD strain did grow in xylem fluid of three citrus varieties. The differential expression of selected genes of a PD X. fastidiosa strain cultured in the two xylem fluids was analyzed using a DNA macroarray. Compared with citrus xylem fluid, grapevine xylem fluid stimulated the expression of X. fastidiosa genes involved in virulence regulation, such as gacA, algU, xrvA, and hsq, and also genes involved in the biogenesis of pili and twitching motility, such as fimT, pilI, pilU, and pilY1. Increased gene expression likely contributes to PD expression in grapevine, whereas citrus xylem fluid did not support or possibly suppressed the expression of these virulence genes.

  1. Genetic characterization of autochthonous grapevine cultivars from Eastern Turkey by simple sequence repeats (SSRs

    Directory of Open Access Journals (Sweden)

    Sadiye Peral Eyduran

    2016-01-01

    Full Text Available In this research, two well-recognized standard grape cultivars, Cabernet Sauvignon and Merlot, together with eight historical autochthonous grapevine cultivars from Eastern Anatolia in Turkey, were genetically characterized by using 12 pairs of simple sequence repeat (SSR primers in order to evaluate their genetic diversity and relatedness. All of the used SSR primers produced successful amplifications and revealed DNA polymorphisms, which were subsequently utilized to evaluate the genetic relatedness of the grapevine cultivars. Allele richness was implied by the identification of 69 alleles in 8 autochthonous cultivars with a mean value of 5.75 alleles per locus. The average expected heterozygosity and observed heterozygosity were found to be 0.749 and 0.739, respectively. Taking into account the generated alleles, the highest number was recorded in VVC2C3 and VVS2 loci (nine and eight alleles per locus, respectively, whereas the lowest number was recorded in VrZAG83 (three alleles per locus. Two main clusters were produced by using the unweighted pair-group method with arithmetic mean dendrogram constructed on the basis of the SSR data. Only Cabernet Sauvignon and Merlot cultivars were included in the first cluster. The second cluster involved the rest of the autochthonous cultivars. The results obtained during the study illustrated clearly that SSR markers have verified to be an effective tool for fingerprinting grapevine cultivars and carrying out grapevine biodiversity studies. The obtained data are also meaningful references for grapevine domestication.

  2. Management of Botryosphaeriaceae species infection in grapevine propagation materials

    Directory of Open Access Journals (Sweden)

    Regina BILLONES-BAAIJENS

    2015-09-01

    Full Text Available In New Zealand grapevine propagation nurseries, Botryosphaeriaceae species have been reported to infect the source blocks of the nursery propagators leading to infection of the propagation materials. This research investigated the efficacy of different control methods which could prevent infection or eradicate the pathogen from harvested canes prior to plant propagation. In the source blocks, attempts to reduce infection of shoots by protecting trimming wounds were partially successful (P=0.036, with 19.5% incidence in fungicide-treated shoots and 24.3% infection in the control shoots. Further sampling showed that overall 19.9% of these infections were in the bark and 9.6% in the wood. Hot water treatment (HWT of dormant rootstock 5C canes, previously infected with Neofusicoccum luteum and N. parvum, at 50°C for 30 min resulted in internal infection incidences of 55 and 100%, respectively. HWT at 53°C reduced infection incidence to 0 and 8.5%, respectively, but killed the buds. In naturally infected canes, HWT of 50°C for 30 min reduced infection incidence from 35% in controls, to 0–15% over all Botryosphaeriaceae species. Shorter periods of HWT, at 55°C for 10 min, designed to kill bark infections, were effective in Sauvignon blanc but killed the buds of Pinot noir. Sauvignon blanc canes superficially infected with N. luteum were soaked for 30 min in the fungicides carbendazim, tebuconazole, thiophanate methyl and flusilazole, with and without a polyether-modified trisiloxane adjuvant. Results showed that carbendazim with no adjuvant and tebuconazole with 0.5 mL L-1 adjuvant eliminated 100% of bark infections. A further experiment that soaked 2,000 canes (Sauvignon blanc and Pinot noir in a carbendazim solution prior to rooting found that all canes were free of Botryosphaeriaceae species infection, compared to 17% natural incidence. These results have indicated the potential efficacy of several methods for preventing or reducing infection

  3. Transcriptional analysis of late ripening stages of grapevine berry

    Science.gov (United States)

    2011-01-01

    Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar) grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7), harvest (TH), and 10-days after harvest (TH+10)). Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S-adenosyl-L-methionine:salicylic acid carboxyl

  4. Transcriptional analysis of late ripening stages of grapevine berry

    Directory of Open Access Journals (Sweden)

    Guillaumie Sabine

    2011-11-01

    Full Text Available Abstract Background The composition of grapevine berry at harvest is a major determinant of wine quality. Optimal oenological maturity of berries is characterized by a high sugar/acidity ratio, high anthocyanin content in the skin, and low astringency. However, harvest time is still mostly determined empirically, based on crude biochemical composition and berry tasting. In this context, it is interesting to identify genes that are expressed/repressed specifically at the late stages of ripening and which may be used as indicators of maturity. Results Whole bunches and berries sorted by density were collected in vineyard on Chardonnay (white cultivar grapevines for two consecutive years at three stages of ripening (7-days before harvest (TH-7, harvest (TH, and 10-days after harvest (TH+10. Microvinification and sensory analysis indicate that the quality of the wines made from the whole bunches collected at TH-7, TH and TH+10 differed, TH providing the highest quality wines. In parallel, gene expression was studied with Qiagen/Operon microarrays using two types of samples, i.e. whole bunches and berries sorted by density. Only 12 genes were consistently up- or down-regulated in whole bunches and density sorted berries for the two years studied in Chardonnay. 52 genes were differentially expressed between the TH-7 and TH samples. In order to determine whether these genes followed a similar pattern of expression during the late stages of berry ripening in a red cultivar, nine genes were selected for RT-PCR analysis with Cabernet Sauvignon grown under two different temperature regimes affecting the precocity of ripening. The expression profiles and their relationship to ripening were confirmed in Cabernet Sauvignon for seven genes, encoding a carotenoid cleavage dioxygenase, a galactinol synthase, a late embryogenesis abundant protein, a dirigent-like protein, a histidine kinase receptor, a valencene synthase and a putative S

  5. Transmission of Xylella fastidiosa to Grapevine by the Meadow Spittlebug.

    Science.gov (United States)

    Cornara, D; Sicard, A; Zeilinger, A R; Porcelli, F; Purcell, A H; Almeida, R P P

    2016-11-01

    There is little information available on Xylella fastidiosa transmission by spittlebugs (Hemiptera, Cercopoidea). This group of insect vectors may be of epidemiological relevance in certain diseases, so it is important to better understand the basic parameters of X. fastidiosa transmission by spittlebugs. We used grapevines as a host plant and the aphrophorid Philaenus spumarius as a vector to estimate the effect of plant access time on X. fastidiosa transmission to plants; in addition, bacterial population estimates in the heads of vectors were determined and correlated with plant infection status. Results show that transmission efficiency of X. fastidiosa by P. spumarius increased with plant access time, similarly to insect vectors in another family (Hemiptera, Cicadellidae). Furthermore, a positive correlation between pathogen populations in P. spumarius and transmission to plants was observed. Bacterial populations in insects were one to two orders of magnitude lower than those observed in leafhopper vectors, and population size peaked within 3 days of plant access period. These results suggest that P. spumarius has either a limited number of sites in the foregut that may be colonized, or that fluid dynamics in the mouthparts of these insects is different from that in leafhoppers. Altogether our results indicate that X. fastidiosa transmission by spittlebugs is similar to that by leafhoppers. In addition, the relationship between cell numbers in vectors and plant infection may have under-appreciated consequences to pathogen spread.

  6. Iron deficiency stimulates anthocyanin accumulation in grapevine apical leaves.

    Science.gov (United States)

    Caramanico, Leila; Rustioni, Laura; De Lorenzis, Gabriella

    2017-10-01

    Iron chlorosis is a diffuse disorder affecting Mediterranean vineyards. Beside the commonly described symptom of chlorophyll decrease, an apex reddening was recently observed. Secondary metabolites, such as anthocyanins, are often synthetized to cope with stresses in plants. The present work aimed to evaluate grapevine responses to iron deficiency, in terms of anthocyanin metabolism (reflectance spectrum, total anthocyanin content, HPLC profile and gene expression) in apical leaves of Cabernet sauvignon and Sangiovese grown in hydroponic conditions. Iron supply interruption produced after one month an increasing of anthocyanin content associated to a more stable profile in both cultivars. In Cabernet sauvignon, the higher red pigment accumulation was associated to a lower intensity of chlorotic symptoms, while in Sangiovese, despite the activation of the metabolism, the lower anthocyanin accumulation was associated to a stronger decrease in chlorophyll concentration. Gene expression data showed a significant increase of anthocyanin biosynthesis. The effects on the expression of structural and transcription factor genes of phenylpropanoid pathway were cultivar dependent. F3H, F3'H, F3'5'H and LDOX genes, in Cabernet sauvignon, and AOMT1 and AOMT genes, in Sangiovese, were positively affected by the treatment in response to iron deficiency. All data support the hypothesis of an anthocyanin biosynthesis stimulation rather than a decreased degradation of them due to iron chlorosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. VESPUCCI: exploring patterns of gene expression in grapevine

    Directory of Open Access Journals (Sweden)

    Marco eMoretto

    2016-05-01

    Full Text Available Large-scale transcriptional studies aim to decipher the dynamic cellular responses to a stimulus, like different environmental conditions. In the era of high-throughput omics biology, the most used technologies for these purposes are microarray and RNA-Seq, whose data are usually required to be deposited in public repositories upon publication. Such repositories have the enormous potential to provide a comprehensive view of how different experimental conditions lead to expression changes, by comparing gene expression across all possible measured conditions. Unfortunately, this task is greatly impaired by differences among experimental platforms that make direct comparisons difficult.In this paper we present the Vitis Expression Studies Platform Using COLOMBOS Compendia Instances (VESPUCCI, a gene expression compendium for grapevine which was built by adapting an approach originally developed for bacteria, and show how it can be used to investigate complex gene expression patterns. We integrated nearly all publicly available microarray and RNA-Seq expression data: 1608 gene expression samples from 10 different technological platforms. Each sample has been manually annotated using a controlled vocabulary developed ad hoc to ensure both human readability and computational tractability. Expression data in the compendium can be visually explored using several tools provided by the web interface or can be programmatically accessed using the REST interface. VESPUCCI is freely accessible at http://vespucci.colombos.fmach.it.

  8. Grapevine acclimation to water deficit: the adjustment of stomatal and hydraulic conductance differs from petiole embolism vulnerability.

    Science.gov (United States)

    Hochberg, Uri; Bonel, Andrea Giulia; David-Schwartz, Rakefet; Degu, Asfaw; Fait, Aaron; Cochard, Hervé; Peterlunger, Enrico; Herrera, Jose Carlos

    2017-06-01

    Drought-acclimated vines maintained higher gas exchange compared to irrigated controls under water deficit; this effect is associated with modified leaf turgor but not with improved petiole vulnerability to cavitation. A key feature for the prosperity of plants under changing environments is the plasticity of their hydraulic system. In the present research we studied the hydraulic regulation in grapevines (Vitis vinifera L.) that were first acclimated for 39 days to well-watered (WW), sustained water deficit (SD), or transient-cycles of dehydration-rehydration-water deficit (TD) conditions, and then subjected to varying degrees of drought. Vine development under SD led to the smallest leaves and petioles, but the TD vines had the smallest mean xylem vessel and calculated specific conductivity (k ts ). Unexpectedly, both the water deficit acclimation treatments resulted in vines more vulnerable to cavitation in comparison to WW, possibly as a result of developmental differences or cavitation fatigue. When exposed to drought, the SD vines maintained the highest stomatal (g s ) and leaf conductance (k leaf ) under low stem water potential (Ψ s ), despite their high xylem vulnerability and in agreement with their lower turgor loss point (Ψ TLP ). These findings suggest that the down-regulation of k leaf and g s is not associated with embolism, and the ability of drought-acclimated vines to maintain hydraulic conductance and gas exchange under stressed conditions is more likely associated with the leaf turgor and membrane permeability.

  9. Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Baozhong, E-mail: bmeng@uoguelph.ca [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Venkataraman, Srividhya; Li, Caihong; Wang, Weizhou [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Dayan-Glick, Cathy; Mawassi, Munir [The Plant Pathology Department-The Virology Unit, Plant Protection Institute, Agricultural Research Organization, The Volcani Center, Bet-Dagan 50250 (Israel)

    2013-01-20

    Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does not cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.

  10. A Fundamental Step in IPM on Grapevine: Evaluating the Side Effects of Pesticides on Predatory Mites

    Directory of Open Access Journals (Sweden)

    Alberto Pozzebon

    2015-10-01

    Full Text Available Knowledge on side effects of pesticides on non-target beneficial arthropods is a key point in Integrated Pest Management (IPM. Here we present the results of four experiments conducted in vineyards where the effects of chlorpyrifos, thiamethoxam, indoxacarb, flufenoxuron, and tebufenozide were evaluated on the generalist predatory mites Typhlodromus pyri Scheuten and Amblyseius andersoni (Chant, key biocontrol agents of herbivorous mites on grapevines. Results show that indoxacarb and tebufenozide had a low impact on the predatory mites considered here, while a significant impact was observed for chlorpyrifos, flufenoxuron, and thiamethoxam. The information obtained here should be considered in the design of IPM strategies on grapevine.

  11. Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Silvia Dal Santo

    Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

  12. Genes expressed in grapevine leaves reveal latent wood infection by the fungal pathogen Neofusicoccum parvum.

    Directory of Open Access Journals (Sweden)

    Stefan Czemmel

    Full Text Available Some pathogenic species of the Botryosphaeriaceae have a latent phase, colonizing woody tissues while perennial hosts show no apparent symptoms until conditions for disease development become favorable. Detection of these pathogens is often limited to the later pathogenic phase. The latent phase is poorly characterized, despite the need for non-destructive detection tools and effective quarantine strategies, which would benefit from identification of host-based markers in leaves. Neofusicoccum parvum infects the wood of grapevines and other horticultural crops, killing the fruit-bearing shoots. We used light microscopy and high-resolution computed tomography (HRCT to examine the spatio-temporal relationship between pathogen colonization and anatomical changes in stem sections. To identify differentially-expressed grape genes, leaves from inoculated and non-inoculated plants were examined using RNA-Seq. The latent phase occurred between 0 and 1.5 months post-inoculation (MPI, during which time the pathogen did not spread significantly beyond the inoculation site nor were there differences in lesion lengths between inoculated and non-inoculated plants. The pathogenic phase occurred between 1.5 and 2 MPI, when recovery beyond the inoculation site increased and lesion lengths of inoculated plants tripled. By 2 MPI, inoculated plants also had decreased starch content in xylem fibers and rays, and increased levels of gel-occluded xylem vessels, the latter of which HRCT revealed at a higher frequency than microscopy. RNA-Seq and screening of 21 grape expression datasets identified 20 candidate genes that were transcriptionally-activated by infection during the latent phase, and confirmed that the four best candidates (galactinol synthase, abscisic acid-induced wheat plasma membrane polypeptide-19 ortholog, embryonic cell protein 63, BURP domain-containing protein were not affected by a range of common foliar and wood pathogens or abiotic stresses

  13. Studies on retranslocation of accumulated assimilates in 'Delaware' grapevines, (1)

    International Nuclear Information System (INIS)

    Yang, Yau-Shiang; Hori, Yutaka

    1979-01-01

    Potted Delaware grapevines were supplied with 14 CO 2 in summer or autumn, and the accumulation and retranslocation of 14 C-assimilates were investigated. At pruning time, 14 C-assimilates were distributed to the roots at higher ratio than to the trunks and canes, and this trend was more marked in the autumn feeding than the summer feeding. The respiratory consumption and retranslocation of 14 C during the growth period of new shoots were evaluated as the percentage of 14 C found in the vines just after pruning. The percentage of the respiratory consumption of 14 C was evidently higher in the autumn feeding. The retranslocation began with the bud burst, and reached maximum at the 6- to 8-leaf stages in the vines fed 14 CO 2 in autumn and at the 10-leaf stage in those fed in summer. The retranslocation in both groups ceased by the flowering stage. Such course of the retranslocation with time was recognized in radioautographs of the new shoots. The maximum percentage of the translocation to the newly developed shoots was 5.1 - 5.2 and 15.3 - 10.7 in the vines fed 14 CO 2 in summer and autumn, respectively. It was peculiar to the new shoots that nearly half of their ethanol-soluble 14 C was found in amino acids unlike the one-sided distribution to soluble carbohydrates in the trunks and roots. It was assumed that amino acids were retranslocated to the new shoots after they had been synthesized in the roots. (Kaihara, S.)

  14. Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

    Science.gov (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

    2012-10-01

    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  15. Temperature dependent RNA metabolism in Xylella fastidiosa during cold stress and grapevine infection

    Science.gov (United States)

    Re-occurrence of Pierce’s disease of grapes, caused by Xylella fastidiosa, is known to be influenced by environmental factors, particularly cold temperatures during overwintering. Grapevines in colder regions are often cured of X. fastidiosa infection over the winter season, depending on cultivar, t...

  16. Interaction of Ulocladium atrum, a Potential Biological Control Agent, with Botrytis cinerea and Grapevine Plantlets

    Directory of Open Access Journals (Sweden)

    Sébastien Ronseaux

    2013-09-01

    Full Text Available The effectiveness of biological control agent, Ulocladium atrum (isolates U13 and U16 in protecting Vitis vinifera L. cv. Chardonnay against gray mold disease caused by Botrytis cinerea, and simulation of the foliar defense responses was investigated. A degraded mycelium structure during cultural assay on potato dextrose agar revealed that U. atrum isolates U13 and U16 were both antagonistic to B. cinerea, mainly when isolates were inoculated two days before Botrytis. Under in vitro conditions, foliar application of U. atrum protected grapevine leaves against gray mold disease. An increase in chitinase activity was induced by the presence of U. atrum isolates indicating that the biological control agents triggered plant defense mechanisms. Moreover, U13 has the potential to colonize the grapevine plantlets and to improve their growth. The ability of U. atrum isolates to exhibit an antagonistic effect against B. cinerea in addition to their aptitude to induce plant resistance and to promote grapevine growth may explain a part of their biological activity. Hence, this study suggests that U. atrum provides a suitable biocontrol agent against gray mold in grapevines.

  17. Restructuring of endophytic bacterial communities in grapevine yellows-diseased and recovered Vitis vinifera L. plants.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

    2011-07-01

    Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response.

  18. Species of Diatrypaceae associated with grapevine trunk diseases in Eastern Spain

    Directory of Open Access Journals (Sweden)

    Jordi LUQUE

    2013-01-01

    Full Text Available The presence and diversity of Diatrypaceae species occurring on grapevines in Eastern Spain were investigated. Several species were identified on the basis of morphological characters and phylogenetic analyses of the complete sequence of the internal transcribed spacers of the ribosomal DNA and part of the β-tubulin gene. Five species of Diatrypaceae isolated from the wood of diseased grapevines, pruning debris and/or perithecia were identified, including Anthostoma decipiens, Cryptovalsa ampelina, Eutypa lata, Eutypella citricola and Eutypella microtheca. Additionally, four taxa could not be identified to the species level but were closely related to Eutypa tetragona based on phylogenetic analyses. Eutypa lata was the most prevalent species and showed the greatest degree of genetic diversity. Cryptovalsa ampelina and E. microtheca ranked second in the frequency of isolations, while all the remaining species were less frequently isolated. Eutypella citricola and E. microtheca are reported for the first time as occurring on grapevine in Spain and this is the first report of A. decipiens occurring on grapevine.

  19. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  20. Phakopsora euvitis Causes Unusual Damage to Leaves and Modifies Carbohydrate Metabolism in Grapevine

    Directory of Open Access Journals (Sweden)

    Antonio F. Nogueira Júnior

    2017-09-01

    Full Text Available Asian grapevine rust (Phakopsora euvitis is a serious disease, which causes severe leaf necrosis and early plant defoliation. These symptoms are unusual for a strict biotrophic pathogen. This work was performed to quantify the effects of P. euvitis on photosynthesis, carbohydrates, and biomass accumulation of grapevine. The reduction in photosynthetic efficiency of the green leaf tissue surrounding the lesions was quantified using the virtual lesion concept (β parameter. Gas exchange and responses of CO2 assimilation to increasing intercellular CO2 concentration were analyzed. Histopathological analyses and quantification of starch were also performed on diseased leaves. Biomass and carbohydrate accumulation were quantified in different organs of diseased and healthy plants. Rust reduced the photosynthetic rate, and β was estimated at 5.78, indicating a large virtual lesion. Mesophyll conductance, maximum rubisco carboxylation rate, and regeneration of ribulose-1,5-bisphosphate dependent on electron transport rate were reduced, causing diffusive and biochemical limitations to photosynthesis. Hypertrophy, chloroplast degeneration of mesophyll cells, and starch accumulation in cells close to lesions were observed. Root carbohydrate concentration was reduced, even at low rust severity. Asian grapevine rust dramatically reduced photosynthesis and altered the dynamics of production and accumulation of carbohydrates, unlike strict biotrophic pathogens. The reduction in carbohydrate reserves in roots would support polyetic damage on grapevine, caused by a polycyclic disease.

  1. The distribution and symptomatology of grapevine trunk disease pathogens are influenced by climate

    NARCIS (Netherlands)

    van Niekerk, J.M.; Bester, W.; Halleen, F.; Crous, P.W.; Fourie, P.H.

    2011-01-01

    Grapevine trunk diseases, caused by a range of phytopathogenic fungi, represent a serious impediment to wine and table grape production wherever these crops are cultivated. Previous studies have shown that the distribution of these pathogens is influenced by climate and that they are associated with

  2. Root-associated bacteria promote grapevine growth: from the laboratory to the field

    KAUST Repository

    Rolli, Eleonora; Marasco, Ramona; Saderi, Stefano; Corretto, Erika; Mapelli, Francesca; Cherif, Ameur; Borin, Sara; Valenti, Leonardo; Sorlini, Claudia; Daffonchio, Daniele

    2016-01-01

    of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant

  3. Presence and uses of wild grapevine (Vitis spp. in the central region of Veracruz in Mexico

    Directory of Open Access Journals (Sweden)

    Juan Guillermo Cruz-Castillo

    2009-06-01

    Significance and impact of study: The exploration of Vitis spp. in the area studied raises the possibility of finding new hybrids or multi-hybrids between species. Wild grapevines could be used to produce natural products that could be sold on the market.

  4. Predicting the occurrence of iron chlorosis in grapevine with tests based on soil iron forms

    Directory of Open Access Journals (Sweden)

    Isabel Díaz de la Torre

    2010-06-01

    Significance and impact of study: This study has shown the limited usefulness of tests based on the contents and reactivity of the soil carbonate to predict the occurrence of Fe chlorosis in grapevine; tests capable of estimating the contents of the labile soil Fe forms constitute the best alternative.

  5. Design and validation of an STR hexaplex assay for DNA profiling of grapevine cultivars

    Czech Academy of Sciences Publication Activity Database

    Drábek, A.; Smolíková, M.; Kalendar, R.; Pinto, F. A. L.; Pavloušek, P.; Klepárník, Karel; Frébort, I.

    2016-01-01

    Roč. 37, 23-24 (2016), s. 3059-3067 ISSN 0173-0835 Institutional support: RVO:68081715 Keywords : grapevine DNA analysis * multiplex PCR * STRs * Vitis vinifera L Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.744, year: 2016

  6. Fatty Acid Methyl Ester (FAME) analyses for characterization and detection of grapevine pathogens

    Science.gov (United States)

    Grapevines can become infected by a variety of devastating pathogens, including the bacterium Xylella fastidiosa and canker fungi. Multiple strains of Xylella fastidiosa exist, each causing different diseases on various hosts. Although sequence-based genotyping can assist in distinguishing these str...

  7. A polyphasic approach for the characterization of endophytic Alternaria strains isolated from grapevines

    DEFF Research Database (Denmark)

    Polizzotto, Rachele; Andersen, Birgitte; Martini, Marta

    2012-01-01

    A polyphasic approach was set up and applied to characterize 20 fungal endophytes belonging to the genus Alternaria, recovered from grapevine in different Italian regions.Morphological, microscopical, molecular and chemical investigations were performed and the obtained results were combined in a...

  8. GRAPEVINE FE-CHLOROSIS ON PODUNAVLJE VINEGROWING AREA

    Directory of Open Access Journals (Sweden)

    Mato Drenjančević

    2012-06-01

    Full Text Available The characteristic of Podunavlje vinegrowing area in the far east of the Republic of Croatia is carbonate soil with loess as a parent substrate. Chlorosis is common on this soil and it is often caused by excess concentrations of calcium and magnesium and deficiency of iron and zinc. It can also be resulted by inactivation, if it is transformed so that a plant can not use it. The lack of iron in grape vine is resulted in leaf vein, first in younger leaves where the venation remains green, and then marginal necrosis and defoliation are developed. The results of the study include the data based on the field researches of Podunavlje vinegrowing subregion and exact research of fertilization field trial. Field research of Podunavlje vinegrowing subregion, vineyards of Srijem, Erdut and Baranya were conducted in July 2007. The field research consisted of locating plantations, measuring plantations chlorosis, determining their general condition and measuring total concentration of chloroplast pigments by an indirect method (chlorophyll meter on the chlorotic and nonchlorotic plants of a grapevine. The intensity of a relative chlorosis was calculated from data measured by a chlorophyll meter. Field research was located on the production area of a company Agro-Ilok ltd. in Ilok, locality Radoš, and carried out during the period 2008 and 2009. It included cultivar Welsh Riesling, grapevine stock Kober 5BB, the most important white cultivar and grapevine stock in the vinegrowing region Continental Croatia. The experiment was set up according to a split plot method at 5x3 levels. The main factor A consisted of different chemical treatments in a basic fertilization: : A1 = 0 control without fertilization; A2 = 150 kg P2O5 + 300 K2O kg ha-1 (KCl; A3 = 150 kg P2O5 + 300 K2O kg ha-1 (K2SO4; A4 = 150 kg P2O5 + 300 K2O kg ha-1 (KCl + 25 kg ha-1 Fe - FeSO4x7H2O; A5 = 150 kg P2O5 + 300 K2O kg ha-1 (K2SO4 + 25 kg ha-1 Fe - FeSO4x7H2O. Factor B had got three levels

  9. Spatio-temporal effects of soil and bedrock variability on grapevine water status in hillslope vineyards.

    Science.gov (United States)

    Brillante, Luca; Bois, Benjamin; Mathieu, Olivier; Leveque, Jean

    2014-05-01

    Hillslope vineyards show various and complex water dynamics between soil and plants, and in order to gain further insight into this phenomenon, 8 grapevine plots were monitored during three vintages, from 2010 to 2013, on Corton Hill, Burgundy, France. Plots were distributed along a topolithosequence from 330 to 270 metres a.s.l. Grapevine water status was monitored weekly by surveying water potential, and, at the end of the season, by the use of the δ13C analysis of grape juice. Soil profile of each plot was described and analysed (soil texture, gravel content, organic carbon, total nitrogen, pH, CEC). Soil volumetric humidity was measured weekly, using TDR probes. A pedotransfer function was developed to transform Electrical Resistivity Imaging (ERI) into soil volume wetness and therefore to spatialise and observe variation in the Fraction of Transpirable Soil Water (FTSW). During the three years of monitoring, grapevines experienced great variation in water status, which ranged from low to considerable water deficit (as expressed by pre-dawn leaf water potential and δ13C analysis of grape juice). With ERI imaging, it was possible to observe differences in water absorption pattern by roots, in different soils, and at different depth. In addition, significant differences were observed in grapevine water status in relation to variations in the physical characteristics of the terroir along the hillslope (i.e. the geo-pedological context, the elevation etc.). Grapevine water behaviour and plant-soil water relationships on the hillslope of Corton Hill have been extensively characterised in this study by ultimate technologies, allowing to present this terroir as a very interesting example for future generalisation and modelling of the hillslope vineyard water dynamics.

  10. Cyclic lipopeptides from Bacillus subtilis activate distinct patterns of defence responses in grapevine.

    Science.gov (United States)

    Farace, Giovanni; Fernandez, Olivier; Jacquens, Lucile; Coutte, François; Krier, François; Jacques, Philippe; Clément, Christophe; Barka, Essaid Ait; Jacquard, Cédric; Dorey, Stéphan

    2015-02-01

    Non-self-recognition of microorganisms partly relies on the perception of microbe-associated molecular patterns (MAMPs) and leads to the activation of an innate immune response. Bacillus subtilis produces three main families of cyclic lipopeptides (LPs), namely surfactins, iturins and fengycins. Although LPs are involved in induced systemic resistance (ISR) activation, little is known about defence responses induced by these molecules and their involvement in local resistance to fungi. Here, we showed that purified surfactin, mycosubtilin (iturin family) and plipastatin (fengycin family) are perceived by grapevine plant cells. Although surfactin and mycosubtilin stimulated grapevine innate immune responses, they differentially activated early signalling pathways and defence gene expression. By contrast, plipastatin perception by grapevine cells only resulted in early signalling activation. Gene expression analysis suggested that mycosubtilin activated salicylic acid (SA) and jasmonic acid (JA) signalling pathways, whereas surfactin mainly induced an SA-regulated response. Although mycosubtilin and plipastatin displayed direct antifungal activity, only surfactin and mycosubtilin treatments resulted in a local long-lasting enhanced tolerance to the necrotrophic fungus Botrytis cinerea in grapevine leaves. Moreover, challenge with specific strains overproducing surfactin and mycosubtilin led to a slightly enhanced stimulation of the defence response compared with the LP-non-producing strain of B. subtilis. Altogether, our results provide the first comprehensive view of the involvement of LPs from B. subtilis in grapevine plant defence and local resistance against the necrotrophic pathogen Bo. cinerea. Moreover, this work is the first to highlight the ability of mycosubtilin to trigger an immune response in plants. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. Physical mapping in highly heterozygous genomes: a physical contig map of the Pinot Noir grapevine cultivar

    Directory of Open Access Journals (Sweden)

    Jurman Irena

    2010-03-01

    Full Text Available Abstract Background Most of the grapevine (Vitis vinifera L. cultivars grown today are those selected centuries ago, even though grapevine is one of the most important fruit crops in the world. Grapevine has therefore not benefited from the advances in modern plant breeding nor more recently from those in molecular genetics and genomics: genes controlling important agronomic traits are practically unknown. A physical map is essential to positionally clone such genes and instrumental in a genome sequencing project. Results We report on the first whole genome physical map of grapevine built using high information content fingerprinting of 49,104 BAC clones from the cultivar Pinot Noir. Pinot Noir, as most grape varieties, is highly heterozygous at the sequence level. This resulted in the two allelic haplotypes sometimes assembling into separate contigs that had to be accommodated in the map framework or in local expansions of contig maps. We performed computer simulations to assess the effects of increasing levels of sequence heterozygosity on BAC fingerprint assembly and showed that the experimental assembly results are in full agreement with the theoretical expectations, given the heterozygosity levels reported for grape. The map is anchored to a dense linkage map consisting of 994 markers. 436 contigs are anchored to the genetic map, covering 342 of the 475 Mb that make up the grape haploid genome. Conclusions We have developed a resource that makes it possible to access the grapevine genome, opening the way to a new era both in grape genetics and breeding and in wine making. The effects of heterozygosity on the assembly have been analyzed and characterized by using several complementary approaches which could be easily transferred to the study of other genomes which present the same features.

  12. Use of Endophytic and Rhizosphere Actinobacteria from Grapevine Plants To Reduce Nursery Fungal Graft Infections That Lead to Young Grapevine Decline.

    Science.gov (United States)

    Álvarez-Pérez, José Manuel; González-García, Sandra; Cobos, Rebeca; Olego, Miguel Ángel; Ibañez, Ana; Díez-Galán, Alba; Garzón-Jimeno, Enrique; Coque, Juan José R

    2017-12-15

    Endophytic and rhizosphere actinobacteria isolated from the root system of 1-year-old grafted Vitis vinifera plants were evaluated for their activities against fungi that cause grapevine trunk diseases. A total of 58 endophytic and 94 rhizosphere isolates were tested. Based on an in vitro bioassay, 15.5% of the endophytic isolates and 30.8% of the rhizosphere isolates exhibited antifungal activity against the fungal pathogen Diplodia seriata , whereas 13.8% of the endophytic isolates and 16.0% of the rhizosphere isolates showed antifungal activity against Dactylonectria macrodidyma (formerly Ilyonectria macrodidyma ). The strains which showed the greatest in vitro efficacy against both pathogens were further analyzed for their ability to inhibit the growth of Phaeomoniella chlamydospora and Phaeoacremonium minimum (formerly Phaeoacremonium aleophilum ). Based on their antifungal activity, three rhizosphere isolates and three endophytic isolates were applied on grafts in an open-root field nursery in a 3-year trial. The field trial led to the identification of one endophytic strain, Streptomyces sp. VV/E1, and two rhizosphere isolates, Streptomyces sp. VV/R1 and Streptomyces sp. VV/R4, which significantly reduced the infection rates produced by the fungal pathogens Dactylonectria sp., Ilyonectria sp., P. chlamydospora , and P. minimum , all of which cause young grapevine decline. The VV/R1 and VV/R4 isolates also significantly reduced the mortality level of grafted plants in the nursery. This study shows that certain actinobacteria could represent a promising new tool for controlling fungal trunk pathogens that infect grapevine plants through the root system in nurseries. IMPORTANCE Grapevine trunk diseases are a major threat to the wine and grape industry worldwide. They cause a significant reduction in yields as well as in grape quality, and they can even cause plant death. Trunk diseases are caused by fungal pathogens that enter through pruning wounds and/or the

  13. Vegetative, productive and qualitative performance of grapevine "Cabernet Sauvignon" according to the use of winter cover crops

    OpenAIRE

    Bettoni, Jean Carlos; Feldberg, Nelson Pires; Nava, Gilberto; Veiga, Milton da; Wildner, Leandro do Prado

    2016-01-01

    ABSTRACT To study the effect of winter cover crops on the vegetative, productive and qualitative behavior of "Cabernet Sauvignon" grapevines, an experiment was conducted in two wine harvests by sowing different species of winter cover crops and additional treatments with manual weeding and mechanical mowing in an experimental vineyard located at the Experimental Station of Epagri in Videira, state of Santa Catarina, Brazil. Plant attributes of the grapevine, such as number of rods and weight ...

  14. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  15. VTCdb: a gene co-expression database for the crop species Vitis vinifera (grapevine).

    Science.gov (United States)

    Wong, Darren C J; Sweetman, Crystal; Drew, Damian P; Ford, Christopher M

    2013-12-16

    Gene expression datasets in model plants such as Arabidopsis have contributed to our understanding of gene function and how a single underlying biological process can be governed by a diverse network of genes. The accumulation of publicly available microarray data encompassing a wide range of biological and environmental conditions has enabled the development of additional capabilities including gene co-expression analysis (GCA). GCA is based on the understanding that genes encoding proteins involved in similar and/or related biological processes may exhibit comparable expression patterns over a range of experimental conditions, developmental stages and tissues. We present an open access database for the investigation of gene co-expression networks within the cultivated grapevine, Vitis vinifera. The new gene co-expression database, VTCdb (http://vtcdb.adelaide.edu.au/Home.aspx), offers an online platform for transcriptional regulatory inference in the cultivated grapevine. Using condition-independent and condition-dependent approaches, grapevine co-expression networks were constructed using the latest publicly available microarray datasets from diverse experimental series, utilising the Affymetrix Vitis vinifera GeneChip (16 K) and the NimbleGen Grape Whole-genome microarray chip (29 K), thus making it possible to profile approximately 29,000 genes (95% of the predicted grapevine transcriptome). Applications available with the online platform include the use of gene names, probesets, modules or biological processes to query the co-expression networks, with the option to choose between Affymetrix or Nimblegen datasets and between multiple co-expression measures. Alternatively, the user can browse existing network modules using interactive network visualisation and analysis via CytoscapeWeb. To demonstrate the utility of the database, we present examples from three fundamental biological processes (berry development, photosynthesis and flavonoid biosynthesis

  16. A molecular approach to study the arbuscular mycorrhizal fungi community in a typical Piedmont grapevine cultivar

    Science.gov (United States)

    Magurno, F.; Bughi Peruglia, G.; Lumini, E.; Bianciotto, V.; Balestrini, R.

    2009-04-01

    Viticulture and wine production represent one of the most relevant agro-food sectors for the Piedmont Region (Italy) in terms of value, with more than 400 millions € a year (12 % of total agricultural production of the Region and the 10 % of the national grape and wine production). The soil where grapevines (Vitis spp.) grow is one of the first parameters influencing the complex grapevine-wine chain. Arbuscular mycorrhizal fungi (AMFs), a main component of soil microbiota in most agrosystems, are considered crucial biomarkers of soil quality because of their biofertilisers role. As mutualistic symbionts, they colonize the roots of the majority of plants. Benefits in symbiosis are well showed as an improvement in shoot/root growth, mineral transport, water-stress tolerance and resistance to certain diseases. Grapevines roots are often heavily colonized by AMFs under field conditions and in some cases AMFs appear to be necessary for their normal growth and survival. Even so, little information are until now available about composition of AMFs communities living in the vineyards soil and in associations with grapevine roots, mainly related to morphological characterization. Vineyard of Nebbiolo, one of the most important Piedmont cultivar, was selected in order to study the AMFs community using a molecular approach. Soil samples and roots from an experimental vineyard located in Lessona (Biella, Piedmont, Italy) were analyzed using AM fungal-specific primers to partially amplify the small subunit (SSU) of the ribosomal DNA genes. Much more than 650 clones were sequenced. Phylogenetic analyses identified 32 OTUs from soil, clustered into Glomus groups Aa, Ab, Ad and B, Diversisporaceae and Gigasporaceae families. Thirteen OTUs from roots were determined, clustered into Glomus groups Ab, Ad and B, and Gigasporaceae family. In particular, Glomus group Ad was the best represented in both compartments, suggesting a correlation between intra and extra radical communities

  17. Destino do nitrogênio em videiras 'chardonnay' e 'riesling renano' quando aplicado no inchamento das gemas Nitrogen destiny in 'chardonnay' and 'riesling renano' grapevines, when applied in bud break

    Directory of Open Access Journals (Sweden)

    Gustavo Brunetto

    2006-12-01

    Chardonnay and Riesling Renano grapevines, at a Udorthent soil in, Bento Gonçalves, Southern Brazil. The vines received the application of 15.91g N plant-1, 40 kg N ha-1, with 4% atoms 15N, in bud break. The buds and leaves were collected in the central parts of the year branch eight different times in the Chardonnay grapes and seven times in the Riesling Renano grapes. The grapevines in the last collection of the leaves were separated in leaves, fruits, year branches, branches with two years and stem, and then were oven-dried, weighted and analyzed total N and 15N contents. The results showed that the larger percentage of N in the leaves of the Chardonnay and the Riesling Renano grapevines, since the beginning of the bud break until harvest is derived of different forms of N from those applied in the bud break. The highest quantity of N accumulated in the annual and perennial part of the grapevines is derived of the soil N, being very small the amounts of N applied in the bud break stored in the perennial parts.

  18. Gene expression profiling in susceptible interaction of grapevine with its fungal pathogen Eutypa lata: Extending MapMan ontology for grapevine

    Directory of Open Access Journals (Sweden)

    Usadel Björn

    2009-08-01

    Full Text Available Abstract Background Whole genome transcriptomics analysis is a very powerful approach because it gives an overview of the activity of genes in certain cells or tissue types. However, biological interpretation of such results can be rather tedious. MapMan is a software tool that displays large datasets (e.g. gene expression data onto diagrams of metabolic pathways or other processes and thus enables easier interpretation of results. The grapevine (Vitis vinifera genome sequence has recently become available bringing a new dimension into associated research. Two microarray platforms were designed based on the TIGR Gene Index database and used in several physiological studies. Results To enable easy and effective visualization of those and further experiments, annotation of Vitis vinifera Gene Index (VvGI version 5 to MapMan ontology was set up. Due to specificities of grape physiology, we have created new pictorial representations focusing on three selected pathways: carotenoid pathway, terpenoid pathway and phenylpropanoid pathway, the products of these pathways being important for wine aroma, flavour and colour, as well as plant defence against pathogens. This new tool was validated on Affymetrix microarrays data obtained during berry ripening and it allowed the discovery of new aspects in process regulation. We here also present results on transcriptional profiling of grape plantlets after exposal to the fungal pathogen Eutypa lata using Operon microarrays including visualization of results with MapMan. The data show that the genes induced in infected plants, encode pathogenesis related proteins and enzymes of the flavonoid metabolism, which are well known as being responsive to fungal infection. Conclusion The extension of MapMan ontology to grapevine together with the newly constructed pictorial representations for carotenoid, terpenoid and phenylpropanoid metabolism provide an alternative approach to the analysis of grapevine gene expression

  19. Electronic nose as an innovative tool for the diagnosis of grapevine crown gall

    Energy Technology Data Exchange (ETDEWEB)

    Blasioli, S., E-mail: sonia.blasioli@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Biondi, E., E-mail: erbiondi@tin.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Braschi, I., E-mail: ilaria.braschi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Mazzucchi, U., E-mail: umberto.mazzucchi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Bazzi, C., E-mail: carlo.bazzi@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy); Gessa, C.E., E-mail: carloemanuele.gessa@unibo.it [Dipartimento di Scienze e Tecnologie Agroambientali, Universita di Bologna, V.le Fanin, 44, 40127 Bologna (Italy)

    2010-07-05

    For the first time, a portable electronic nose was used to discriminate between healthy and galled grapevines, experimentally inoculated with two tumourigenic strains of Agrobacterium vitis. The volatile profile of target cutting samples was analysed by headspace solid phase microextraction coupled with gas chromatography-mass spectrometry. Spectra from tumoured samples revealed the presence of styrene which is compatible with decarboxylation of cinnamic acid involved in secondary metabolism of plants. Principal Component Analysis confirmed the difference in volatile profiles of infected vines and their healthy controls. Linear Discriminant Analysis allowed the correct discrimination between healthy and galled grapevines (83.3%, cross-validation). Although a larger number of samples should be analysed to create a more robust model, our results give novel interesting clues to go further with research on the diagnostic potential of this innovative system associated with multi-dimensional chemometric techniques.

  20. Biochemical method for fast affinity diagnosis in grape-vine transplantation

    International Nuclear Information System (INIS)

    Lilov, D.

    1977-01-01

    Long term experiments have proved the affinity of cv. Mavroud in transplantations on various root stocks. Best affinity was observed in the combination cv. Mavroud X Riparia tomanteau, followed, in a descending order, by the combinations Mavroud X Mavroud (autotransplantation), Mavroud X Berlandieri X Riparia Kobber SBB and Mavroud X Riparia 33 EM. In view to establish indices for predicting the transplantation affinity a great number of physiological-biochemical and morphological-anatomical studies were carried out. The results obtained showed that a most clearly expressed positive, statistically significant correlation exists between the amount of 15 N transported from the root stock to the scions, shoots and leaves. As a result, a biochemical method for fast affinity diagnosis in grape-vine transplantation has been developed. The reliability of the method has been checked up also with other cultivars. Up to the present no such method was known in grape-vine science and practice. (author)

  1. Characterization of Campylocarpon pseudofasciculare associated with black foot of grapevine in southern Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Feliciano dos SANTOS

    2015-01-01

    Full Text Available The incidence and severity of black foot has been recently increasing in nurseries and vineyards of southern Brazil. The goal of the present study was to characterize Campylocarpon isolates associated with black foot of grapevines (Vitis spp. using multi-gene DNA analysis (internal transcribed spacers [ITS rDNA], β-tubulin and histone H3 and morphological characteristics, and to test the pathogenicity of the isolates in grapevine (Vitis labrusca cv. Bordô. The three DNA regions analyzed indicated that all the isolates belonged to Campylocarpon pseudofasciculare. Their morphology was similar to descriptions published for the species. Isolates exhibited umber- to chestnut-coloured colonies and macroconidia (38.0 × 7.0 μm predominantly with three septa. All the isolates inoculated in V. labrusca cv. Bordô caused typical symptoms of black foot. This is the first report of Campylocarpon pseudofasciculare in southern Brazil.

  2. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  3. Types of Stem Cells

    Science.gov (United States)

    ... Stem Cell Glossary Search Toggle Nav Types of Stem Cells Stem cells are the foundation from which all ... Learn About Stem Cells > Types of Stem Cells Stem cells Stem cells are the foundation for every organ ...

  4. Comparing Kaolin and Pinolene to Improve Sustainable Grapevine Production during Drought

    OpenAIRE

    Brillante, Luca; Belfiore, Nicola; Gaiotti, Federica; Lovat, Lorenzo; Sansone, Luigi; Poni, Stefano; Tomasi, Diego

    2016-01-01

    Viticulture is widely practiced in dry regions, where the grapevine is greatly exposed to water stress. Optimizing plant water use efficiency (WUE) without affecting crop yield, grape and wine quality is crucial to limiting use of water for irrigation and to significantly improving viticulture sustainability. This study examines the use in vineyards of particle film technology (engineered kaolin) and compares it to a film-forming antitranspirant (pinolene), traditionally used to limit leaf wa...

  5. Analysis of high-identity segmental duplications in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Carelli Francesco N

    2011-08-01

    Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

  6. Physiological behaviors and recovery responses of four Galician grapevine (Vitis vinifera L. ) cultivars under water stress

    OpenAIRE

    Islam, M.; Berrios, J.

    2012-01-01

    Gas exchange parameters and chlorophyll fluorescence of four pot grown Galician grapevines (Vitis vinifera L. cv. Albariño, Brancellao, Godello and Treixadura) were examined under different levels of water stress in greenhouse. After extreme stress, gas exchange recovery responses were evaluated. Average ΨPD for control and stressed plants were -0.4MPa and -1.45MPa respectively. All varieties showed gradual declining of all gas exchange parameters (gs, E and A) with increasing of stress perio...

  7. Endophytic bacterial community of grapevine leaves influenced by sampling date and phytoplasma infection process.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Quaglino, Fabio; Bianco, Piero A

    2014-07-21

    Endophytic bacteria benefit host plant directly or indirectly, e.g. by biocontrol of the pathogens. Up to now, their interactions with the host and with other microorganisms are poorly understood. Consequently, a crucial step for improving the knowledge of those relationships is to determine if pathogens or plant growing season influence endophytic bacterial diversity and dynamic. Four healthy, four phytoplasma diseased and four recovered (symptomatic plants that spontaneously regain a healthy condition) grapevine plants were sampled monthly from June to October 2010 in a vineyard in north-western Italy. Metagenomic DNA was extracted from sterilized leaves and the endophytic bacterial community dynamic and diversity were analyzed by taxon specific real-time PCR, Length-Heterogeneity PCR and genus-specific PCR. These analyses revealed that both sampling date and phytoplasma infection influenced the endophytic bacterial composition. Interestingly, in June, when the plants are symptomless and the pathogen is undetectable (i) the endophytic bacterial community associated with diseased grapevines was different from those in the other sampling dates, when the phytoplasmas are detectable inside samples; (ii) the microbial community associated with recovered plants differs from that living inside healthy and diseased plants. Interestingly, LH-PCR database identified bacteria previously reported as biocontrol agents in the examined grapevines. Of these, Burkholderia, Methylobacterium and Pantoea dynamic was influenced by the phytoplasma infection process and seasonality. Results indicated that endophytic bacterial community composition in grapevine is correlated to both phytoplasma infection and sampling date. For the first time, data underlined that, in diseased plants, the pathogen infection process can decrease the impact of seasonality on community dynamic. Moreover, based on experimental evidences, it was reasonable to hypothesize that after recovery the restructured

  8. The effect of reclaimed wastewater on the quality and growth of grapevines.

    Science.gov (United States)

    Mendoza-Espinosa, L G; Cabello-Pasini, A; Macias-Carranza, V; Daessle-Heuser, W; Orozco-Borbón, M V; Quintanilla-Montoya, A L

    2008-01-01

    The effect of the use of treated wastewater on the growth of cabernet sauvignon and merlot grapes from the Guadalupe Valley, Mexico was evaluated. Secondary advanced effluent was used to irrigate the grapevines at a rate of 66 L/vine/week. Wastewater quality results confirmed that all parameters complied with Mexican legislation for crop irrigation as well as reuse in activities in which the public would be in direct or indirect contact with the reclaimed water. Results showed that the number of leaves per shoot and the overall biomass increased in plants irrigated with wastewater and grape production per plant was 20% higher. The concentration of carbohydrates, organic acids and pH were similar in grapes from vines irrigated with wastewater to those irrigated with groundwater. Throughout the experiment, no fecal coliform bacteria were detected in the cultivated grapes. The wastewater caused an increase in the biomass of the grapevines and there was no presence of microbial indicators in the final product so a higher wine production could be achieved without an increase in health risk related problems. If 200 L/s of reclaimed wastewater would be returned to be used for grapevine irrigation in Valle de Guadalupe (the same amount that is currently being sent as drinking water to Ensenada), assuming an irrigation application of 6,000-7.500 m3/ha/year, approximately 837-1046 hectares (ha) of grapevines could be irrigated. Part of ongoing research includes an economical analysis of the best options for Ensenada and the Valle de Guadalupe in order to establish the optimum volume of water to be returned, the cost of its transportation, as well as the cost of irrigation. (c) IWA Publishing 2008.

  9. HONEY BEE CONTRIBUTION TO ‘BORDÔ’ GRAPEVINE FRUIT PRODUCTION IN SOUTHERN BRAZIL

    OpenAIRE

    MARTIGNAGO, MIRELI; MARTINS, RAFAEL; HARTER-MARQUES, BIRGIT

    2017-01-01

    ABSTRACT The production of fruits and seeds of many crops is increased when bees visit their flowers pollinating them. The aim of this study was to evaluate the effect of different pollination treatments on ‘Bordô’ grapevine (Vitis labrusca L.) fruit quantity and quality. Quantitative and qualitative fruit production parameters of plants visited by Apis mellifera L., manually self- and cross-pollinated plants and plants without pollination were analyzed and compared. Fruit production was hig...

  10. Exogenous strigolactone interacts with abscisic acid-mediated accumulation of anthocyanins in grapevine berries

    Czech Academy of Sciences Publication Activity Database

    Ferrero, M.; Pagliarani, C.; Novák, Ondřej; Ferrandino, A.; Cardinale, F.; Visentin, I.; Schubert, A.

    2018-01-01

    Roč. 69, č. 9 (2018), s. 2391-2401 ISSN 0022-0957 Institutional support: RVO:61389030 Keywords : vitis-vinifera l. * cabernet-sauvignon * seed-germination * drought stress * nonclimacteric fruit * lotus-japonicus * gene-expression * plant hormones * analog gr24 * biosynthesis * ABA conjugation * ABA hydroxylases * ABA transporters * abscisic acid * anthocyanin * grapevine * gr24 * ripening * strigolactones Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.830, year: 2016

  11. Determination of the activity signature of key carbohydrate metabolism enzymes in phenolic-rich grapevine tissues

    DEFF Research Database (Denmark)

    Covington, Elizabeth Dunn; Roitsch, Thomas Georg; Dermastia, Marina

    2016-01-01

    Physiological studies in plants often require enzyme extraction from tissues containing high concentrations of phenols and polyphenols. Unless removed or neutralized, such compounds may hinder extraction, inactivate enzymes, and interfere with enzyme detection. The following protocol for activity...... assays for enzymes of primary carbohydrate metabolism, while based on our recently published one for quantitative measurement of activities using coupled spectrophotometric assays in a 96-well format, is tailored to the complexities of phenolic- and anthocyanin-rich extracts from grapevine leaf...

  12. Selection of grapevine leaf varieties for culinary process based on phytochemical composition and antioxidant properties.

    Science.gov (United States)

    Lima, Adriano; Bento, Albino; Baraldi, Ilton; Malheiro, Ricardo

    2016-12-01

    Grapevine leaves are an abundant sub-product of vineyards which is devalued in many regions. The objective of this work is to study the antioxidant activity and phytochemical composition of ten grapevine leaf varieties (four red varieties: Tinta Amarela, Tinta Roriz, Touriga Franca, and Touriga Nacional; and six white varieties: Côdega do Larinho, Fernão Pires, Gouveio, Malvasia Fina, Rabigato, and Viosinho) to select varieties to be used as food ingredients. White grapevine leaves revealed higher antioxidant potential. Malvasia Fina reported better antioxidant properties contrasting with Touriga Franca. Phenolic content varied between 112 and 150mgGAEg(-1) of extract (gallic acid equivalents), hydroxycinnamic acid derivatives and flavonols varied between 76 and 108mgCAEg(-1) of extract (caffeic acid equivalents) and 39 and 54mgQEg(-1) of extract (quercetin equivalents). Malvasia Fina is a good candidate for culinary treatment due to its antioxidant properties and composition in bioactive compounds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Nitrogen fertilization of Cabernet Sauvignon grapevines: yield, total nitrogen content in the leaves and must composition

    Directory of Open Access Journals (Sweden)

    Felipe Lorensini

    2015-08-01

    Full Text Available Grapevines grown on sandy soils are subjected to the application of supplemental nitrogen (N; however, there is little information available regarding the impact of these applications on yield, plant nutritional state and must composition. The aim of this study was to evaluate the yield, nutritional state and must composition of grapevines subjected to N fertilization. Cabernet Sauvignon grapevines were subjected to annual applications of 0, 10, 15, 20, 40, 80 and 120 kg N ha-1 in 2008, 2009 and 2010. During the 2008/09, 2009/10 and 2010/11 harvest seasons, leaves were collected during full flowering and when the berries changed color, and the total N content was analyzed. The grape yield and the enological characteristics of the must were evaluated. The response to applied N was low, and the highest Cabernet Sauvignon grape yield was obtained in response to an application of 20 kg N ha-1 year-1. The application of N increased the nutrient content in the leaf collected at full flowering, but it had little effect on the total nutrient content in the must, and it did not affect the enological characteristics of the must, such as soluble solids, pH, total acidity, malic acid and tartaric acid.

  14. Poly(lactic-co-glycolic) acid nanoparticles uptake by Vitis vinifera and grapevine-pathogenic fungi

    International Nuclear Information System (INIS)

    Valletta, Alessio; Chronopoulou, Laura; Palocci, Cleofe; Baldan, Barbara; Donati, Livia; Pasqua, Gabriella

    2014-01-01

    Poly(lactic-co-glycolic) acid (PLGA)-based NPs are currently considered among the most promising drug carriers, nevertheless their use in plants has never been investigated. In this work, for the first time, we demonstrated the ability of PLGA NPs to cross the plant cell wall and membrane of Vitis vinifera cell cultures and grapevine-pathogenic fungi. By means of fluorescence microscopy, we established that PLGA NPs can enter in grapevine leaf tissues through stomata openings and that they can be absorbed by the roots and transported to the shoot through vascular tissues. TEM analysis on cultured cells showed that NPs ≤ 50 nm could enter cells, while bigger ones remained attached to the cell wall. Viability tests demonstrated that PLGA NPs were not cytotoxic for V. vinifera-cultured cells. The cellular uptake of PLGA NPs by some important grapevine-pathogenic fungi has also been observed, thus suggesting that PLGA NPs could be used to deliver antifungal compounds within fungal cells. Overall the results reported suggest that such NPs may play a key role in future developments of agrobiotechnologies, as it is currently happening in biomedicine

  15. Poly(lactic-co-glycolic) acid nanoparticles uptake by Vitis vinifera and grapevine-pathogenic fungi

    Energy Technology Data Exchange (ETDEWEB)

    Valletta, Alessio [“Sapienza” University of Rome, Department of Environmental Biology (Italy); Chronopoulou, Laura; Palocci, Cleofe, E-mail: cleofe.palocci@uniroma1.it [“Sapienza” University of Rome, Department of Chemistry (Italy); Baldan, Barbara [University of Padua, Department of Biology (Italy); Donati, Livia; Pasqua, Gabriella [“Sapienza” University of Rome, Department of Environmental Biology (Italy)

    2014-12-15

    Poly(lactic-co-glycolic) acid (PLGA)-based NPs are currently considered among the most promising drug carriers, nevertheless their use in plants has never been investigated. In this work, for the first time, we demonstrated the ability of PLGA NPs to cross the plant cell wall and membrane of Vitis vinifera cell cultures and grapevine-pathogenic fungi. By means of fluorescence microscopy, we established that PLGA NPs can enter in grapevine leaf tissues through stomata openings and that they can be absorbed by the roots and transported to the shoot through vascular tissues. TEM analysis on cultured cells showed that NPs ≤ 50 nm could enter cells, while bigger ones remained attached to the cell wall. Viability tests demonstrated that PLGA NPs were not cytotoxic for V. vinifera-cultured cells. The cellular uptake of PLGA NPs by some important grapevine-pathogenic fungi has also been observed, thus suggesting that PLGA NPs could be used to deliver antifungal compounds within fungal cells. Overall the results reported suggest that such NPs may play a key role in future developments of agrobiotechnologies, as it is currently happening in biomedicine.

  16. Association of RGA-SSCP markers with resistance to downy mildew and anthracnose in grapevines.

    Science.gov (United States)

    Tantasawat, P A; Poolsawat, O; Prajongjai, T; Chaowiset, W; Tharapreuksapong, A

    2012-07-02

    Downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) are two major diseases that severely affect most grapevine (Vitis vinifera) cultivars grown commercially in Thailand. Progress of conventional breeding programs of grapevine for improved resistance to these diseases can be speeded up by selection of molecular markers associated with resistance traits. We evaluated the association between 13 resistance gene analog (RGA)-single-strand conformation polymorphism (SSCP) markers with resistance to downy mildew and anthracnose in 71 segregating progenies of seven cross combinations between susceptible cultivars and resistant lines. F(1) hybrids from each cross were assessed for resistance to downy mildew and anthracnose (isolates Nk4-1 and Rc2-1) under laboratory conditions. Association of resistance traits with RGA-SSCP markers was evaluated using simple linear regression analysis. Three RGA-SSCP markers were found to be significantly correlated with anthracnose resistance, whereas significant correlation with downy mildew resistance was observed for only one RGA-SSCP marker. These results demonstrate the usefulness of RGA-SSCP markers. Four candidate markers with significant associations to resistance to these two major diseases of grapevine were identified. However, these putative associations between markers and resistance need to be verified with larger segregating populations before they can be used for marker-assisted selection.

  17. Isolation and pathogenicity of Xylella fastidiosa from grapevine and almond in Iran

    Directory of Open Access Journals (Sweden)

    Naser AMANIFAR

    2014-09-01

    Full Text Available Symptoms similar to those of Pierce’s disease (PD of grapevine and leaf scorch of almond were observed in vineyards and almond orchards in several provinces of Iran. Grafting of scions from symptomatic almond trees onto seedlings of a local almond (cv. Mamaee under greenhouse conditions resulted in the transmission of the leaf scorch agent. A number of symptomatic samples from orchard and greenhouse plants were positive for presence of Xylella fastidiosa when tested by DAS-ELISA and PCR with X. fastidiosa specific antibodies and primers. A Gram-negative bacterium similar to X. fastidiosa was isolated on ‘periwinkle wilt’ (PW medium. Selected isolates induced symptoms similar to those caused by X. fastidiosa when inoculated on Nicotiana tabacum, seedlings of almond and grapevine under greenhouse conditions. DAS-ELISA and PCR confirmed the identity of the isolated bacteria. On the basis of disease symptoms, graft transmission, isolation on specific X. fastidiosa culture medium, pathogenicity tests and positive reactions in DAS-ELISA and PCR, X. fastidiosa is associated with almond leaf scorch and Pierce’s disease in grapevine in Iran. This is the first report on the presence of X. fastidiosa in the Middle East and western Asia.

  18. Climate vs grapevine pests and diseases worldwide: the first results of a global survey

    Directory of Open Access Journals (Sweden)

    Benjamin Bois

    2017-05-01

    Methods and results: Based on the answer of respondent about the main reported diseases/pests in their region, a severity index was calculated. Each region was geolocalised and data were compared to the WorldClim gridded climate database to document the range of climate conditions (growing season temperature and rainfall associated to the main diseases/pests. The potential climatic-induced changes of grapevine disease and pest geography by 2050 are assessed using agro-climate projections from the ARPEGE CNRM model, using the RCP 4.5 scenario. The preliminary results allow to determine the distribution of diseases as function of agroclimatic indicators. Conclusion: While the distribution of diseases differs according to the region of the world, the current analysis suggests that mildews remain the major phytosanitary threat in most of the regions. Powdery mildew, trunk diseases and viruses were reported in extremely diverse climatic conditions, including intermediate and wet regions.  Significance and impact of the study: This paper present an original methodology to address the relationship between grapevine disease and pest occurrences and climate. Such documentation is scarce in the current literature. Further analysis is currently being performed, including additional survey answers, climate indices and supplementary data collected (spatial extension, frequency of treatments… to better depict the challenges of grapevine phytosanitary management in a changing climate.

  19. Gating in grapevine: Relationship between application of the fungicide fludioxonil and circadian rhythm on photosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Petit, Anne-Noelle [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: petit081@etudiant.univ-reims.fr; Fontaine, Florence [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: florence.fontaine@univ-reims.fr; Clement, Christophe [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: christophe.clement@univ-reims.fr; Vaillant-Gaveau, Nathalie [Laboratoire de Stress, Defenses et Reproduction des Plantes, URVVC-SE EA 2069, Universite de Reims Champagne-Ardenne, UFR Sciences Exactes et Naturelles, Batiment 18, Moulin de la Housse, BP 1039, F-51687 REIMS Cedex 2 (France)], E-mail: nathalie.vaillant-gaveau@univ-reims.fr

    2009-01-15

    The aim of this study was to determine the impact of the fludioxonil (fdx) fungicide on the diurnal fluctuation in grapevine photosynthesis. Therefore, fdx treatment was performed at the end of flowering, at 8 am, 12 am or 7 pm. The study was performed in experimental field and several photosynthesis parameters were followed one day after treatment. Morning fdx treatment induced (i) a significant and simultaneous drop of both photosynthesis (Pn) and stomatal conductance between 8 am and 4 pm and (ii) an increase of intercellular CO{sub 2} concentration when compared to control plants. On the contrary, evening fdx treatment did not affect Pn whereas midday treatment caused Pn increase after 4 pm. These data suggest that (i) morning fdx treatment results in a non-stomatal limitation of Pn, (ii) midday treatment is more suitable to treat grapevine with fdx and (iii) a phenomenon of gating was noticed. - The period of fdx spraying was an important parameter in stress response: the midday fdx treatment is more suitable to treat grapevine with fdx.

  20. Comparative response of six grapevine rootstocks to inoculation with arbuscular mycorrhizal fungi based on root traits

    Science.gov (United States)

    Pogiatzis, Antreas; Bowen, Pat; Hart, Miranda; Holland, Taylor; Klironomos, John

    2017-04-01

    Arbuscular mycorrhizal (AM) symbiosis has been proven to be essential in grapevines, sustaining plant growth especially under abiotic and biotic stressors. The mycorrhizal growth response of young grapevines varies among rootstock cultivars and the underlying mechanisms involved in this variation are unknown. We predicted that this variation in mycorrhizal response may be explained by differences in root traits among rootstocks. We analyzed the entire root system of six greenhouse-grown rootstocks (Salt Creek, 3309 Couderc, Riparia Gloire, 101-14 Millardet et de Grasset, Swarzmann, Teleki 5C), with and without AM fungal inoculation (Rhizophagus irregularis) and characterized their morphological and architectural responses. Twenty weeks after the inoculation, aboveground growth was enhanced by AM colonization. The rootstock varieties were distinctly different in their response to AM fungi, with Salt Creek receiving the highest growth benefit, while Schwarzmann and 5C Teleki receiving the lowest. Plant responsiveness to AM fungi was negatively correlated with branching intensity (fine roots per root length). Furthermore, there was evidence that mycorrhizas can influence the expression of root traits, inducing a higher branching intensity and a lower root to shoot ratio. The results of this study will help to elucidate how interactions between grapevine rootstocks and AM fungi may benefit the establishment of new vineyards.

  1. Radicinin from Cochliobolus sp. inhibits Xylella fastidiosa, the causal agent of Pierce's Disease of grapevine.

    Science.gov (United States)

    Aldrich, Thomas J; Rolshausen, Philippe E; Roper, M Caroline; Reader, Jordan M; Steinhaus, Matthew J; Rapicavoli, Jeannette; Vosburg, David A; Maloney, Katherine N

    2015-08-01

    The fastidious phytopathogenic bacterium, Xylella fastidiosa, poses a substantial threat to many economically important crops, causing devastating diseases including Pierce's Disease of grapevine. Grapevines (Vitis vinifera L.) planted in an area under Pierce's Disease pressure often display differences in disease severity and symptom expression, with apparently healthy vines growing alongside the dying ones, despite the fact that all the vines are genetic clones of one another. Under the hypothesis that endophytic microbes might be responsible for this non-genetic resistance to X. fastidiosa, endophytic fungi were isolated from vineyard cvs. 'Chardonnay' and 'Cabernet Sauvignon' grown under high Pierce's Disease pressure. A Cochliobolus sp. isolated from a Cabernet Sauvignon grapevine inhibited the growth of X. fastidiosa in vitro. Bioassay-guided isolation of an organic extract of Cochliobolus sp. yielded the natural product radicinin as the major active compound. Radicinin also inhibited proteases isolated from the culture supernatant of X. fastidiosa. In order to assess structure-activity relationships, three semi-synthetic derivatives of radicinin were prepared and tested for activity against X. fastidiosa in vitro. Assay results of these derivatives are consistent with enzyme inactivation by conjugate addition to carbon-10 of radicinin, as proposed previously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Evaluation of pollen dispersal and cross pollination using transgenic grapevine plants.

    Science.gov (United States)

    Harst, Margit; Cobanov, Beatrix-Axinja; Hausmann, Ludger; Eibach, Rudolf; Töpfer, Reinhard

    2009-01-01

    Public debate about the possible risk of genetically modified plants often concerns putative effects of pollen dispersal and out-crossing into conventional fields in the neighborhood of transgenic plants. Though Vitis vinifera (grapevine) is generally considered to be self-pollinating, it cannot be excluded that vertical gene transfer might occur. For monitoring pollen flow and out-crossing events, transgenic plants of Vitis vinifera cv. 'Dornfelder' harboring the gus-int gene were planted in the center of a field experiment in Southwest Germany in 1999. The rate of pollen dispersal was determined by pollen traps placed at radial distances of 5-150 m from the pollen-donor plants, at 1.00 and 1.80 m above ground. Transgenic pollen was evaluated by GUS staining, and could clearly be distinguished from pollen originating from non-transgenic grapevine plants. Transgenic pollen was observed up to 150 m from the pollen donors. The rate of out-crossing was determined by sampling seeds of selected grapevines at a distance of 10 m to the pollen source, and of a sector at 20 m distance, respectively, followed by GUS analysis of seedlings. The average cross-pollination rate during the experiment (2002-2004) was 2.7% at a distance of 20 m. The results of this first pilot study present a good base for further assessment under the conditions of normal viticulture practice.

  3. Gating in grapevine: Relationship between application of the fungicide fludioxonil and circadian rhythm on photosynthesis

    International Nuclear Information System (INIS)

    Petit, Anne-Noelle; Fontaine, Florence; Clement, Christophe; Vaillant-Gaveau, Nathalie

    2009-01-01

    The aim of this study was to determine the impact of the fludioxonil (fdx) fungicide on the diurnal fluctuation in grapevine photosynthesis. Therefore, fdx treatment was performed at the end of flowering, at 8 am, 12 am or 7 pm. The study was performed in experimental field and several photosynthesis parameters were followed one day after treatment. Morning fdx treatment induced (i) a significant and simultaneous drop of both photosynthesis (Pn) and stomatal conductance between 8 am and 4 pm and (ii) an increase of intercellular CO 2 concentration when compared to control plants. On the contrary, evening fdx treatment did not affect Pn whereas midday treatment caused Pn increase after 4 pm. These data suggest that (i) morning fdx treatment results in a non-stomatal limitation of Pn, (ii) midday treatment is more suitable to treat grapevine with fdx and (iii) a phenomenon of gating was noticed. - The period of fdx spraying was an important parameter in stress response: the midday fdx treatment is more suitable to treat grapevine with fdx

  4. Sesquiterpene volatile organic compounds (VOCs are markers of elicitation by sulfated laminarine in grapevine

    Directory of Open Access Journals (Sweden)

    Malik eChalal

    2015-05-01

    Full Text Available Inducing resistance in plants by application of elicitors of defense reactions is an attractive plant protection strategy, especially for grapevine (Vitis vinifera which is susceptible to severe fungal diseases. Though induced resistance (IR can be successful in controlled conditions, under outdoor conditions IR is in most cases not effective enough for practical disease control. Progress in the application of IR requires a better understanding of grapevine defense mechanisms and the ability to monitor defense markers in order to identify factors (physiological, environmental… that can impact IR in the vineyard.Volatile organic compounds (VOCs are well-known plant defenses compounds that have only received little or no attention in the case of grape-pathogen interactions to date. This prompted us to investigate whether an elicitor, the sulfated laminarin (PS3, actually induces the production of VOCs in grapevine. Online analysis (PTR-QMS of VOC emissions in dynamic cuvettes and passive sampling in gas tight bags with solid phase micro extraction (SPME-GC-MS under greenhouse conditions showed that PS3 elicited emission of VOCs. Some of them (as (E,E-α-farnesene might be good candidates as biomarkers of elicitor-IR whereas methyl salicylate appears to be rather a biomarker of downy mildew infection. A negative correlation between VOC emission and disease severity suggests a positive role of VOCs in grape defense against diseases.

  5. Phylogeny of geminivirus coat protein sequences and digital PCR aid in identifying Spissistilus festinus (Say) as a vector of Grapevine red blotch-associated virus

    Science.gov (United States)

    Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines, and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by ...

  6. Responses of grapevine rootstocks to drought through altered root system architecture and root transcriptomic regulations.

    Science.gov (United States)

    Yıldırım, Kubilay; Yağcı, Adem; Sucu, Seda; Tunç, Sümeyye

    2018-06-01

    Roots are the major interface between the plant and various stress factors in the soil environment. Alteration of root system architecture (RSA) (root length, spread, number and length of lateral roots) in response to environmental changes is known to be an important strategy for plant adaptation and productivity. In light of ongoing climate changes and global warming predictions, the breeding of drought-tolerant grapevine cultivars is becoming a crucial factor for developing a sustainable viticulture. Root-trait modeling of grapevine rootstock for drought stress scenarios, together with high-throughput phenotyping and genotyping techniques, may provide a valuable background for breeding studies in viticulture. Here, tree grafted grapevine rootstocks (110R, 5BB and 41B) having differential RSA regulations and drought tolerance were investigated to define their drought dependent root characteristics. Root area, root length, ramification and number of root tips reduced less in 110R grafted grapevines compared to 5BB and 41B grafted ones during drought treatment. Root relative water content as well as total carbohydrate and nitrogen content were found to be much higher in the roots of 110R than it was in the roots of other rootstocks under drought. Microarray-based root transcriptome profiling was also conducted on the roots of these rootstocks to identify their gene regulation network behind drought-dependent RSA alterations. Transcriptome analysis revealed totally 2795, 1196 and 1612 differentially expressed transcripts at the severe drought for the roots of 110R, 5BB and 41B, respectively. According to this transcriptomic data, effective root elongation and enlargement performance of 110R were suggested to depend on three transcriptomic regulations. First one is the drought-dependent induction in sugar and protein transporters genes (SWEET and NRT1/PTR) in the roots of 110R to facilitate carbohydrate and nitrogen accumulation. In the roots of the same rootstock

  7. How Streptomyces anulatus Primes Grapevine Defenses to Cope with Gray Mold: A Study of the Early Responses of Cell Suspensions

    Directory of Open Access Journals (Sweden)

    Parul Vatsa-Portugal

    2017-06-01

    Full Text Available Gray mold, caused by Botrytis cinerea, is one of the most destructive diseases of grapevine and is controlled with an intense application of fungicides. As alternatives to chemicals, beneficial microbes may promote plant health by stimulating the plant’s immune system. An actinomycete, Streptomyces anulatus S37, has been screened from the rhizosphere microbiome of healthy Vitis vinifera on the basis of its ability to promote grapevine growth and to induce resistance against various phytopathogens, including B. cinerea. However, molecular mechanisms involved locally after direct perception of these bacteria by plant cells still remain unknown. This study focuses on local defense events induced in grapevine cells during interactions with S. anulatus S37 before and after pathogen challenge. We demonstrated that S. anulatus S37 induced early responses including oxidative burst, extracellular alkalinization, activation of protein kinases, induction of defense gene expression and phytoalexin accumulation, but not the programmed cell death. Interestingly, upon challenge with the B. cinerea, the S. anulatus S37 primed grapevine cells for enhanced defense reactions with a decline in cell death. In the presence of the EGTA, a calcium channel inhibitor, the induced oxidative burst, and the protein kinase activity were inhibited, but not the extracellular alkalinization, suggesting that Ca2+ may also contribute upstream to the induced defenses. Moreover, desensitization assays using extracellular pH showed that once increased by S. anulatus S37, cells became refractory to further stimulation by B. cinerea, suggesting that grapevine cells perceive distinctly beneficial and pathogenic microbes.

  8. Stem cells

    NARCIS (Netherlands)

    Jukes, Jojanneke; Both, Sanne; Post, Janine; van Blitterswijk, Clemens; Karperien, Marcel; de Boer, Jan; van Blitterswijk, Clemens A.

    2008-01-01

    This chapter defines stem cells and their properties. It identifies the major differences between embryonic and adult stem cells. Stem cells can be defined by two properties: the ability to make identical copies of themselves and the ability to form other cell types of the body. These properties are

  9. Colonization of Vitis vinifera by a green fluorescence protein-labeled, gfp-marked strain of Xylophilus ampelinus, the causal agent of bacterial necrosis of grapevine.

    Science.gov (United States)

    Grall, Sophie; Manceau, Charles

    2003-04-01

    The dynamics of Xylophilus ampelinus were studied in Vitis vinifera cv. Ugni blanc using gfp-marked bacterial strains to evaluate the relative importance of epiphytic and endophytic phases of plant colonization in disease development. Currently, bacterial necrosis of grapevine is of economic importance in vineyards in three regions in France: the Cognac, Armagnac, and Die areas. This disease is responsible for progressive destruction of vine shoots, leading to their death. We constructed gfp-marked strains of the CFBP2098 strain of X. ampelinus for histological studies. We studied the colonization of young plants of V. vinifera cv. Ugni blanc by X. ampelinus after three types of artificial contamination in a growth chamber and in a greenhouse. (i) After wounding of the stem and inoculation, the bacteria progressed down to the crown through the xylem vessels, where they organized into biofilms. (ii) When the bacteria were forced into woody cuttings, they rarely colonized the emerging plantlets. Xylem vessels could play a key role in the multiplication and conservation of the bacteria, rather than being a route for plant colonization. (iii) When bacterial suspensions were sprayed onto the plants, bacteria progressed in two directions: both in emerging organs and down to the crown, thus displaying the importance of epiphytic colonization in disease development.

  10. The Impact of Phaeomoniella chlamydospora Infection on the Grapevine's Physiological Response to Water Stress - Part 2 : Cabernet Sauvignon and Chardonnay

    Directory of Open Access Journals (Sweden)

    J. Edwards

    2007-04-01

    Full Text Available Phaeomoniella chlamydospora is a vascular pathogen that colonises the xylem tissues of the grapevine. It is associated with the diseases, esca and Petri disease, often considered to be ‘stress-related’ diseases. In glasshouse experiments using Cabernet Sauvignon and Chardonnay, stomatal conductance was higher in infected plants, implying that infection interferes with stomatal control. In Cabernet Sauvignon, leaf water potentials were lower in infected plants subjected to water stress, indicating that infection made it more difficult for the vine to get water to the leaf. This was less apparent in Chardonnay. Clearly, infection alters the grapevine response to water stress and some cultivars are affected more than others.

  11. Root Proteomic Analysis of Grapevine Rootstocks Inoculated with Rhizophagus irregularis and Fusarium oxysporum f. sp. herbemontis

    Directory of Open Access Journals (Sweden)

    Elisa Vilvert

    Full Text Available ABSTRACT Grapevine decline and death caused by the pathogenic fungus Fusarium oxysporum f. sp. herbemontis is among the main phytosanitary problem for viticulture in southern Brazil. The eradication of infected plants is presently the most common procedure for disease control in vineyards. Inoculation with arbuscular mycorrhizal fungi is an option to reduce or neutralize the negative impacts of soil pathogenic microorganisms, but the mechanisms of plant response involved in this process are not yet completely elucidated. In order to better understand these mechanisms, an experiment was carried out to identify proteins related to plant defence induced by the mycorrhizal fungus after infection with the pathogenic fungus. We used the grapevine rootstocks SO4 and R110 (susceptible and resistant to the pathogenic fungus, respectively inoculated or not inoculated with the mycorrhizal fungus Rhizophagus irregularis, and inoculated or not inoculated with Fusarium oxysporum f. sp. herbemontis. Growth of the rootstocks’ shoot and root and presence of pathogenic symptoms were evaluated. The protein profiles of roots were characterized by two-dimensional electrophoresis and proteins were identified using mass spectrometry. The grapevine rootstocks inoculated with R. irregularis had higher biomass production and lower level of pathogenic symptoms. The R110 rootstock differentially accumulated 73 proteins, while SO4 accumulated 59 proteins. Nine plant-defence proteins were expressed by SO4 rootstock, and six were expressed by R110 rootstock plants. The results confirm the effect of mycorrhizal fungi in plant growth promotion and their potential for biological control against soil pathogenic fungus. Protein expression is dependent on rootstock characteristics and on the combination of plant material with the fungi.

  12. New insights into thermal growing conditions of Portuguese grapevine varieties under changing climates

    Science.gov (United States)

    Santos, João A.; Costa, Ricardo; Fraga, Helder

    2018-03-01

    New decision support tools for Portuguese viticulture are urging under a climate change context. In the present study, heat and chilling accumulation conditions of a collection of 44 grapevine cultivars currently grown in Portugal are assessed at very high spatial resolution ( 1 km) and for 1981-2015. Two bioclimatic indices that incorporate non-linear plant-temperature relationships are selected for this purpose: growing degree hours—GDH (February-October) and chilling portions—CP (October-February). The current thermal growing conditions of each variety are examined and three clusters of grapevine cultivars are identified based on their GDH medians, thus assembling varieties with close heat accumulation requirements and providing more physiologically consistent information when compared to previous studies, as non-linear plant-temperature relationships are herein taken into account. These new clusters are also a complement to previous bioclimatic zoning. Ensemble mean projections under two anthropogenic-driven scenarios (RCP4.5 and RCP8.5, 2041-2070), from four EURO-CORDEX simulations, reveal a widespread increase of GDH and decrease of CP, but with spatial heterogeneities. The spatial variability of these indices throughout Portugal is projected to decrease (strongest increases of GDH in the coolest regions of the northeast) and to increase (strongest decreases of CP in the warmest regions of the south and west), respectively. The typical heat accumulation conditions of each cluster are projected to gradually shift north-eastwards and to higher-elevation areas, whereas insufficient chilling may represent a new challenge in warmer future climates. An unprecedented level of detail for a large collection of grapevine varieties in Portugal is provided, thus promoting a better planning of climate change adaptation measures.

  13. Effects of hot water treatments on dormant grapevine propagation materials used for grafted vine production

    Directory of Open Access Journals (Sweden)

    Soltekin Oguzhan

    2017-01-01

    Full Text Available Agrobacterium vitis is responsible for the crown gall disease of grapevine which breaks the grapevine trunk vascular system. Nutrient flow is prevented by crown gall and it leads to weak growth and death of the plants. It can be destructive disease often encountered in vineyards and it can be spread in cuttings for propagation. Thermotherapy treatment is an alternative method for eradicating A. vitis from grapevine cuttings but effects of thermotherapy treatments on dormant vine tissue, bud vitality, rooting and shooting of the propagation materials are not yet fully understood. In this research, it is aimed to determine the effects of thermotherapy treatment (Hot water treatment on callus formation (at the basal part and grafting point, grafted vine quality (shoot length, shoot width, root number, shooting and rooting development, fresh and dry weight of shoots and roots and final take in the grafted vine production. Experiment was conducted in the nursery of Manisa Viticultural Research Institute. Rootstocks (Kober 5BB, Couderc 1613 and 41B and scions (Sultan 7 and Manisa sultanı were hot-water treated at 50°C for 30 minutes which is the most common technique against Agrobacterium vitis. After thermotherapy treatment, all rootstocks were grafted with Sultan 7 and Manisa sultanıvarieties. They were kept for 22 days in callusing room for callus development and then they were planted in polyethlyene bags for rooting. At the end of the study, significant treatment x rootstock interaction were observed for the final take of Sultan 7 variety. Thermotherapy treated of 1613C/Sultan 7 combinations had more final take than the control (untreated group. For instance, hot water treated cuttings of 1613C/Sultan 7 combinations had 75% final take while the control group had the 70%. Also there were not observed any adverse effects of HWT on bud and tissue vitality.

  14. Cover crops and pruning in Bobal and Tempranillo vineyards have little influence on grapevine nutrition

    Directory of Open Access Journals (Sweden)

    Pedro Pérez-Bermúdez

    2016-06-01

    Full Text Available ABSTRACT Cover crops may improve vineyard soil properties, grapevine nutrient status and berry composition, however, factors such as cover crop type, annual rainfall, climate and irrigation may change their effects on vineyards. From 2008 to 2011, the effects of a non-permanent cover crop and two pruning techniques on soil as well as vine nutrients and grapevine performance of two vineyards (cv. Tempranillo and cv. Bobal were evaluated. For that purpose, two legumes were sown in inter-rows of hand-pruned vines in February and were tilled at flowering. Soil tillage, or cover cropping, was combined with either light pruning or severe pruning to study foliar nutrient variations. Soil N, P, K and total organic carbon (TOC were determined in samples taken from the Ap1 horizon in January prior to vine pruning. Foliar N, P, K contents were measured in leaves sampled upon grape veraison. The differences between vineyards with cover cropping and bare soils suggest that legumes positively affected soil N (1.55 vs. 1.68 g kg−1 and 1.49 vs. 1.76 g kg−1 in Bobal and Tempranillo vineyards, respectively and soil organic matter (SOM (12.5 vs. 15.5 g kg−1 and 12.9 vs. 17.2 g kg−1 in Bobal and Tempranillo vineyards, respectively. The use of cover crops did not affect grapevine yields nor quality of Bobal and Tempranillo berry . Cover crops, or light pruning, did not alter the foliar N, P, K contents of both cultivars since their concentrations were similar to those found in the leaves from vineyards with soil tillage or severe pruning.

  15. Lasiojasmonates A-C, three jasmonic acid esters produced by Lasiodiplodia sp., a grapevine pathogen.

    Science.gov (United States)

    Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Basso, Sara; Deidda, Antonio; Serra, Salvatorica; Evidente, Antonio

    2014-07-01

    In this study, a strain (BL 101) of a species of Lasiodiplodia, not yet formally described, which was isolated from declining grapevine plants showing wedge-shaped cankers, was investigated for its ability to produce in vitro bioactive secondary metabolites. From culture filtrates of this strain three jasmonic acid esters, named lasiojasmonates A-C and 16-O-acetylbotryosphaerilactones A and C were isolated together with (1R,2R)-jasmonic acid, its methyl ester, botryosphaerilactone A, (3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone and (3R,4S)-botryodiplodin. The structures of lasiojasmonates A-C were established by spectroscopic methods as (1R*,2R*,3'S*,4'R*,5'R*)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone, (1R*,2R*,3'S*,4'R*,5'R*,10'R*,12'R*,13'R*,14'S*) and (1R*,2R*,3'S*,4'R*,5'R*,10'S*,12'R*,13'R*,14'S*)-4-(4-hydroxymethyl-3,5-dimethyltetrahydro-furan-2-yloxymethyl)-3,5-dimethyldihydro-2-furanones jasmonates (1, 4 and 5). The structures of 16-O-acetylbotryosphaerilactones A and C were determined by comparison of their spectral data with those of the corresponding acetyl derivatives obtained by acetylation of botryosphaerilactone A. The metabolites isolated, except 4 and 5, were tested at 1mg/mL on leaves of grapevine cv. Cannonau and cork oak using the leaf puncture assay. They were also tested on detached grapevine leaves at 0.5mg/mL and tomato cuttings at 0.1mg/mL. In all phytotoxic assays only jasmonic acid was found to be active. All metabolites were inactive in the zootoxic assay at 50 μg/mL. Copyright © 2014. Published by Elsevier Ltd.

  16. Evaluation of biocontrol agents for grapevine pruning wound protection against trunk pathogen infection.

    Directory of Open Access Journals (Sweden)

    Charl KOTZE

    2011-12-01

    Full Text Available Trunk diseases of grapevine are caused by numerous pathogens, including Eutypa lata, Phaeomoniella chlamydospora, and species of Botryosphaeriaceae (incl. Botryosphaeria and aggregate genera, Phomopsis and Phaeoacremonium. Since infections occur mainly through pruning wounds, that have been shown by previous research to stay susceptible for up to 16 weeks after pruning, long-term pruning wound protection is required for prevention of infection. This study evaluated several biocontrol agents against a range of trunk disease pathogens in dual plate laboratory trials to determine macroscopic and microscopic interactions. The biocontrol agents had a substantial effect on all the pathogens, with a wide range of macroscopic and microscopic interactions observed. The best performing biocontrol agents were tested in two field trials. Fresh pruning wounds were treated with benomyl, Trichoderma products (Biotricho®, Vinevax® and ECO 77® and isolates (USPP-T1 and -T2, identified as T. atroviride and Bacillus subtilis. Seven days after treatment the pruning wounds were inoculated by spraying with spore suspensions of Neofusicoccum australe, N. parvum, Diplodia seriata, Lasiodiplodia theobromae, Eutypa lata, Phaeomoniella chlamydospora or Phomopsis viticola. Eight months after inoculation, the treatments were evaluated by isolation onto potato dextrose agar. The efficacy of the biocontrol agents was in most cases similar or superior to that observed for benomyl. Isolate USPP-T1, in particular, was very effective, reducing incidence of Ph. viticola, E. lata, Pa. chlamydospora, N. australe, N. parvum, D. seriata and L. theobromae by 69, 76, 77, 78, 80, 85 and 92%, respectively. This is the first report of biological protection of grapevine pruning wounds against this group of grapevine trunk disease pathogens.

  17. Ectopic expression of Arabidopsis broad-spectrum resistance gene RPW8.2 improves the resistance to powdery mildew in grapevine (Vitis vinifera).

    Science.gov (United States)

    Hu, Yang; Li, Yajuan; Hou, Fengjuan; Wan, Dongyan; Cheng, Yuan; Han, Yongtao; Gao, Yurong; Liu, Jie; Guo, Ye; Xiao, Shunyuan; Wang, Yuejin; Wen, Ying-Qiang

    2018-02-01

    Powdery mildew is the most economically important disease of cultivated grapevines worldwide. Here, we report that the Arabidopsis broad-spectrum disease resistance gene RPW8.2 could improve resistance to powdery mildew in Vitis vinifera cv. Thompson Seedless. The RPW8.2-YFP fusion gene was stably expressed in grapevines from either the constitutive 35S promoter or the native promoter (NP) of RPW8.2. The grapevine shoots and plantlets transgenic for 35S::RPW8.2-YFP showed reduced rooting and reduced growth at later development stages in the absence of any pathogens. Infection tests with an adapted grapevine powdery mildew isolate En NAFU1 showed that hyphal growth and sporulation were significantly restricted in transgenic grapevines expressing either of the two constructs. The resistance appeared to be attributable to the ectopic expression of RPW8.2, and associated with the enhanced encasement of the haustorial complex (EHC) and onsite accumulation of H 2 O 2 . In addition, the RPW8.2-YFP fusion protein showed focal accumulation around the fungal penetration sites. Transcriptome analysis revealed that ectopic expression of RPW8.2 in grapevines not only significantly enhanced salicylic acid-dependent defense signaling, but also altered expression of other phytohormone-associated genes. Taken together, our results indicate that RPW8.2 could be utilized as a transgene for improving resistance against powdery mildew in grapevines. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Weed control and cover crop management affect mycorrhizal colonization of grapevine roots and arbuscular mycorrhizal fungal spore populations in a California vineyard.

    Science.gov (United States)

    Baumgartner, Kendra; Smith, Richard F; Bettiga, Larry

    2005-03-01

    Arbuscular mycorrhizal (AM) fungi naturally colonize grapevines in California vineyards. Weed control and cover cropping may affect AM fungi directly, through destruction of extraradical hyphae by soil disruption, or indirectly, through effects on populations of mycorrhizal weeds and cover crops. We examined the effects of weed control (cultivation, post-emergence herbicides, pre-emergence herbicides) and cover crops (Secale cereale cv. Merced rye, x Triticosecale cv.Trios 102) on AM fungi in a Central Coast vineyard. Seasonal changes in grapevine mycorrhizal colonization differed among weed control treatments, but did not correspond with seasonal changes in total weed frequency. Differences in grapevine colonization among weed control treatments may be due to differences in mycorrhizal status and/or AM fungal species composition among dominant weed species. Cover crops had no effect on grapevine mycorrhizal colonization, despite higher spring spore populations in cover cropped middles compared to bare middles. Cover crops were mycorrhizal and shared four AM fungal species (Glomus aggregatum, G. etunicatum, G. mosseae, G. scintillans) in common with grapevines. Lack of contact between grapevine roots and cover crop roots may have prevented grapevines from accessing higher spore populations in the middles.

  19. Detection of a divergent variant of grapevine virus F by next-generation sequencing.

    Science.gov (United States)

    Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

    2015-08-01

    The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

  20. Proteomic analysis of shoot tissue during photoperiod induced growth cessation in V. riparia Michx. grapevines

    Directory of Open Access Journals (Sweden)

    Victor Kim J

    2010-08-01

    Full Text Available Abstract Background Growth cessation, cold acclimation and dormancy induction in grapevines and other woody perennial plants native to temperate continental climates is frequently triggered by short photoperiods. The early induction of these processes by photoperiod promotes winter survival of grapevines in cold temperate zones. Examining the molecular processes, in particular the proteomic changes in the shoot, will provide greater insight into the signaling cascade that initiates growth cessation and dormancy induction. To begin understanding transduction of the photoperiod signal, Vitis riparia Michx. grapevines that had grown for 35 days in long photoperiod (long day, LD, 15 h were subjected to either a continued LD or a short photoperiod (short day, SD, 13 h treatment. Shoot tips (4-node shoot terminals were collected from each treatment at 7 and 28 days of LD and SD for proteomic analysis via two-dimensional (2D gel electrophoresis. Results Protein profiles were characterized in V. riparia shoot tips during active growth or SD induced growth cessation to examine physiological alterations in response to differential photoperiod treatments. A total of 1054 protein spots were present on the 2D gels. Among the 1054 proteins, 216 showed differential abundance between LD and SD (≥ two-fold ratio, p-value ≤ 0.05. After 7 days, 39 protein spots were more abundant in LD and 30 were more abundant in SD. After 28 days, 93 protein spots were more abundant in LD and 54 were more abundant in SD. MS/MS spectrometry was performed to determine the functions of the differentially abundant proteins. Conclusions The proteomics analysis uncovered a portion of the signal transduction involved in V. riparia grapevine growth cessation and dormancy induction. Different enzymes of the Calvin-Benson cycle and glutamate synthetase isoforms were more abundant either in LD or SD treatments. In LD tissues the significantly differentially more abundant proteins

  1. Arsenic and trace elements in soil, water, grapevine and onion in Jáchal, Argentina.

    Science.gov (United States)

    Funes Pinter, Iván; Salomon, M Victoria; Gil, Raúl; Mastrantonio, Leandro; Bottini, Rubén; Piccoli, Patricia

    2018-02-15

    Contamination by trace elements (TE) is an increasing concern worldwide. In some areas, crop production could be limited by the presence of metals and metalloids, so it is important to determine their concentrations and mobility. The region of Jáchal, province of San Juan, Argentina, has good growing conditions for onion and grapevine production, but their quality and yield are affected by high TE concentration in soils and water. Soils, water, grapevine and onion were sampled and TE content determined. In soils elevated As, B, Cr, Hg, and Tl concentrations were detected (506±46, 149±3, 2714±217, 16±7, and 12±3μgg -1 , respectively, for maximum values measured), and physicochemical properties of the soil promotes these elements mobility. Water samples had high As, B, Cr, and Fe concentrations (1438±400, 10,871±471, 11,516±2363, and 3071±257μgL -1 , respectively, for maximum values measured) while in onion bulbs and grapevine berries, As, Cr, Cu, and Fe (92±7 and 171±20, 1412±18 and 2965±32, 17±3 and 126±88, and 418±204 and 377±213μgg -1 , respectively, for maximum values measured) exceeded the limits for food consumption established by Argentinian law. Correlation analyses indicated that: i) there is a common source of TE in this area, ii) each elements concentration in plants is associated with different soil variables and different soils depths, and iii) the lack of correlation between soil and water indicates that concentration in water is not constant over the time and/or there exists a differential accumulation of elements in soils depending on their own properties. Data obtained demonstrate very high concentration of TE in soil, grapevines, and onion plants in Jáchal region, and different remediation techniques are necessary to stabilize and minimize the bioavailability of these elements. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Survival of FUngi Associated with Grapevine Decline in Pruned Wood after Composting

    Directory of Open Access Journals (Sweden)

    P. Lecomte

    2006-04-01

    Full Text Available Recycling vine wood pruned in winter in the vineyard, after grinding and composting, might pose a risk of recontamination with fungi associated with grapevine decline. The survival of four ascomycete fungi (Botryosphaeria obtusa, Phaeomoniella chlamydospora, Phaeoacremonium aleophilum and Eutypa lata in composted material was investigated in a 3-year study conducted in the Bordeaux area. Naturally and artificially infested material was examined before and after composting using classical isolation procedures. Results clearly showed that a composting process can eradicate the four target fungi efficiently.

  3. Proteomic analysis of shoot tissue during photoperiod induced growth cessation in V. riparia Michx. grapevines

    Science.gov (United States)

    2010-01-01

    Background Growth cessation, cold acclimation and dormancy induction in grapevines and other woody perennial plants native to temperate continental climates is frequently triggered by short photoperiods. The early induction of these processes by photoperiod promotes winter survival of grapevines in cold temperate zones. Examining the molecular processes, in particular the proteomic changes in the shoot, will provide greater insight into the signaling cascade that initiates growth cessation and dormancy induction. To begin understanding transduction of the photoperiod signal, Vitis riparia Michx. grapevines that had grown for 35 days in long photoperiod (long day, LD, 15 h) were subjected to either a continued LD or a short photoperiod (short day, SD, 13 h) treatment. Shoot tips (4-node shoot terminals) were collected from each treatment at 7 and 28 days of LD and SD for proteomic analysis via two-dimensional (2D) gel electrophoresis. Results Protein profiles were characterized in V. riparia shoot tips during active growth or SD induced growth cessation to examine physiological alterations in response to differential photoperiod treatments. A total of 1054 protein spots were present on the 2D gels. Among the 1054 proteins, 216 showed differential abundance between LD and SD (≥ two-fold ratio, p-value ≤ 0.05). After 7 days, 39 protein spots were more abundant in LD and 30 were more abundant in SD. After 28 days, 93 protein spots were more abundant in LD and 54 were more abundant in SD. MS/MS spectrometry was performed to determine the functions of the differentially abundant proteins. Conclusions The proteomics analysis uncovered a portion of the signal transduction involved in V. riparia grapevine growth cessation and dormancy induction. Different enzymes of the Calvin-Benson cycle and glutamate synthetase isoforms were more abundant either in LD or SD treatments. In LD tissues the significantly differentially more abundant proteins included flavonoid

  4. A water stress index based on water balance modelling for discrimination of grapevine quality and yield

    Directory of Open Access Journals (Sweden)

    Rémi Gaudin

    2014-01-01

    Significance and impact of the study: This water stress index is a valuable tool for explaining the variations in grape yield and quality among various locations and years because it reflects the vineyard water stress history in relation to rainfall regime and soil conditions. Improvement would come from the simulation of FTSW during winter, notably for soils of high Total Transpirable Soil Water. One potential application is the quantification of water stress change brought by irrigation in Mediterranean vineyards, and its relation to grapevine production.

  5. STEM Education.

    Science.gov (United States)

    Xie, Yu; Fang, Michael; Shauman, Kimberlee

    2015-08-01

    Improving science, technology, engineering, and mathematics (STEM) education, especially for traditionally disadvantaged groups, is widely recognized as pivotal to the U.S.'s long-term economic growth and security. In this article, we review and discuss current research on STEM education in the U.S., drawing on recent research in sociology and related fields. The reviewed literature shows that different social factors affect the two major components of STEM education attainment: (1) attainment of education in general, and (2) attainment of STEM education relative to non-STEM education conditional on educational attainment. Cognitive and social psychological characteristics matter for both major components, as do structural influences at the neighborhood, school, and broader cultural levels. However, while commonly used measures of socioeconomic status (SES) predict the attainment of general education, social psychological factors are more important influences on participation and achievement in STEM versus non-STEM education. Domestically, disparities by family SES, race, and gender persist in STEM education. Internationally, American students lag behind those in some countries with less economic resources. Explanations for group disparities within the U.S. and the mediocre international ranking of US student performance require more research, a task that is best accomplished through interdisciplinary approaches.

  6. Moderate water stress from regulated deficit irrigation decreases transpiration similarly to net carbon exchange in grapevine canopies

    Science.gov (United States)

    To determine the effects of timing and extent of regulated deficit irrigation (RDI) on grapevine (Vitis vinifera) canopies, whole-canopy transpiration (TrV) and canopy conductance to water vapor (gc) were calculated from whole-vine gas exchange near key stages of fruit development. The vines were ma...

  7. 77 FR 55829 - Western Area Power Administration; Grapevine Canyon Wind Project Record of Decision (DOE/EIS-0427)

    Science.gov (United States)

    2012-09-11

    ... DEPARTMENT OF ENERGY Western Area Power Administration; Grapevine Canyon Wind Project Record of... one or more phases, dependent on one or more power sale contracts. The proposed wind park would... that limit construction vehicle speed limits. Foresight indicated that the wind park contractor will...

  8. Identification of the female-produced sex pheromone of the leafminer Holocacista capensis infesting grapevine in South Africa

    NARCIS (Netherlands)

    Wang, H.-L.; Geertsema, H.; Nieukerken, van E.J.; Löfstedt, C.

    2015-01-01

    We report the first identification of a sex pheromone in a heliozelid moth, Holocacista capensis van Nieukerken & Geertsema. This leafminer recently infested grapevine in South Africa. Compared to solvent extraction of pheromone glands, solid phase microextraction (SPME) proved to be highly

  9. Restructuring of Endophytic Bacterial Communities in Grapevine Yellows-Diseased and Recovered Vitis vinifera L. Plants ▿

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

    2011-01-01

    Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response. PMID:21622794

  10. Review of invasive grapevine aphid, Aphis illinoisensis Shimer, and native parasitoids in the Mediterranean (Hemiptera, Aphididae; Hymenoptera, Braconidae, Aphidiinae)

    Czech Academy of Sciences Publication Activity Database

    Havelka, Jan; Shukshuk, A. H.; Ghaliow, M. E.; Laamari, M.; Kavallieratos, N. G.; Tomanović, Ž.; Rakhshani, E.; Pons, X.; Starý, Petr

    2011-01-01

    Roč. 63, č. 1 (2011), s. 269-274 ISSN 0354-4664 Grant - others:Ministry of Science and Technological Development of the Republic of Serbia(CS) 43001 Institutional research plan: CEZ:AV0Z50070508 Keywords : invasions * Aphis illinoisensis * grapevine Subject RIV: EH - Ecology, Behaviour Impact factor: 0.360, year: 2011

  11. Proteomic analysis of grapevine resistance induced by Trichoderma harzianum T39 reveals specific defence pathways activated against downy mildew

    Science.gov (United States)

    Perazzolli, Michele

    2012-01-01

    Downy mildew is caused by the oomycete Plasmopara viticola and is one of the most serious diseases of grapevine. The beneficial microorganism Trichoderma harzianum T39 (T39) has previously been shown to induce plant-mediated resistance and to reduce the severity of downy mildew in susceptible grapevines. In order to better understand the cellular processes associated with T39-induced resistance, the proteomic and histochemical changes activated by T39 in grapevine were investigated before and 1 day after P. viticola inoculation. A comprehensive proteomic analysis of T39-induced resistance in grapevine was performed using an eight-plex iTRAQ protocol, resulting in the identification and quantification of a total of 800 proteins. Most of the proteins directly affected by T39 were found to be involved in signal transduction, indicating activation of a complete microbial recognition machinery. Moreover, T39-induced resistance was associated with rapid accumulation of reactive oxygen species and callose at infection sites, as well as changes in abundance of proteins involved in response to stress and redox balance, indicating an active defence response to downy mildew. On the other hand, proteins affected by P. viticola in control plants mainly decreased in abundance, possibly reflecting the establishment of a compatible interaction. Finally, the high-throughput iTRAQ protocol allowed de novo peptide sequencing, which will be used to improve annotation of the Vitis vinifera cv. Pinot Noir proteome. PMID:23105132

  12. Treatment of grapevines with prohexadione calcium as a growth regulator. The influence on production, winemaking and sensory characteristics of wines

    Directory of Open Access Journals (Sweden)

    Luis Vaquero-Fernández

    2009-09-01

    Significance and impact of study: ProCa as a growth regulator may be an option for a quality vitiviniculture. No previous studies have been published on applications of ProCa in grapevines in either Europe or in cv. Tempranillo. Additionally, studies with other varieties have not demonstrated sensory improvements in wines obtained from treated vines.

  13. Response of grapevine leaves to plasmopara viticola infection by means of measurement of reflectance and fluorescence signals

    Czech Academy of Sciences Publication Activity Database

    Šebela, David; Olejníčková, Julie; Župčanová, A.; Sotolář, R.

    2012-01-01

    Roč. 27, č. 8 (2012), s. 229-237 ISSN 1211-8516 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : Plasmopara viticola * downy mildew * grapevine * leaf tissue * susceptible varieties * chlorophyll fluorescence imaging * reflectance Subject RIV: GM - Food Processing

  14. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the grapevine Vitis vinifera

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Newman, Janet; Dobson, Renwick C. J.; Perugini, Matthew A.

    2011-01-01

    Dihydrodipicolinate synthase from the common grapevine V. vinifera has been cloned, expressed, purified and crystallized in the presence of the substrate pyruvate by in-drop hexahistidine-tag cleavage. A diffraction data set has been collected to a resolution of 2.2 Å. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS from the grapevine Vitis vinifera (Vv-DHDPS). Following in-drop cleavage of the hexahistidine tag, cocrystals of Vv-DHDPS with the substrate pyruvate were grown in 0.1 M Bis-Tris propane pH 8.2, 0.2 M sodium bromide, 20%(w/v) PEG 3350. X-ray diffraction data in space group P1 at a resolution of 2.2 Å are presented. Preliminary diffraction data analysis indicated the presence of eight molecules per asymmetric unit (V M = 2.55 Å 3 Da −1 , 52% solvent content). The pending crystal structure of Vv-DHDPS will provide insight into the molecular evolution in quaternary structure of DHDPS enzymes

  15. SNP high-throughput screening in grapevine using the SNPlex™ genotyping system

    Directory of Open Access Journals (Sweden)

    Velasco Riccardo

    2008-01-01

    Full Text Available Abstract Background Until recently, only a small number of low- and mid-throughput methods have been used for single nucleotide polymorphism (SNP discovery and genotyping in grapevine (Vitis vinifera L.. However, following completion of the sequence of the highly heterozygous genome of Pinot Noir, it has been possible to identify millions of electronic SNPs (eSNPs thus providing a valuable source for high-throughput genotyping methods. Results Herein we report the first application of the SNPlex™ genotyping system in grapevine aiming at the anchoring of an eukaryotic genome. This approach combines robust SNP detection with automated assay readout and data analysis. 813 candidate eSNPs were developed from non-repetitive contigs of the assembled genome of Pinot Noir and tested in 90 progeny of Syrah × Pinot Noir cross. 563 new SNP-based markers were obtained and mapped. The efficiency rate of 69% was enhanced to 80% when multiple displacement amplification (MDA methods were used for preparation of genomic DNA for the SNPlex assay. Conclusion Unlike other SNP genotyping methods used to investigate thousands of SNPs in a few genotypes, or a few SNPs in around a thousand genotypes, the SNPlex genotyping system represents a good compromise to investigate several hundred SNPs in a hundred or more samples simultaneously. Therefore, the use of the SNPlex assay, coupled with whole genome amplification (WGA, is a good solution for future applications in well-equipped laboratories.

  16. Evaluation of antioxidant activity of grapevine leaves extracts (Vitis labrusca in liver of Wistar rats

    Directory of Open Access Journals (Sweden)

    THAYS K. SCHAFFER

    2016-03-01

    Full Text Available The aim of this study was to evaluate the hepatoprotection of organic and conventional grapevine leaves extract (Vitis labrusca. The total polyphenol content and the isolate polyphenols by HPLC were evaluate. The animals received intraperitoneal injections of saline or extracts (conventional or organic - 30 mg/kg for 14 days. On day 15, the rats received carbon tetrachloride (CCl4 or mineral oil (i.p.. After 4h, the animals were euthanized. The analysis of the liver enzymes activity (AST, ALT, GGT was performed using serum, obtained by blood and the levels of lipid peroxidation (TBARS, protein oxidation (carbonyl, and the activity of antioxidant enzymes superoxide dismutase and catalase were analyzed in the liver. The results showed that the organic extract is richer in polyphenol and resveratrol than the conventional one. Both extracts prevent lipid peroxidation and protein oxidation generated by CCl4. Moreover, the extracts demonstrated ability to modulate the activity of SOD and CAT, as well as to establish a balance in the ratio of SOD/CAT. We also found that the CCl4 increased the levels of AST and GGT, and that both extracts prevent this. These results indicate that grapevine leaves extracts, both, organic and conventional, can prevent liver disorders.

  17. Identification of Agrobacterium vitis as a causal agent of grapevine crown gall in Serbia

    Directory of Open Access Journals (Sweden)

    Kuzmanović N.

    2012-01-01

    Full Text Available In 2010, a serious outbreak of crown gall disease was observed on grapevines (Vitis vinifera L. cv. Cabernet Sauvignon in several commercial vineyards located in the Vojvodina province, Serbia. Bacteria were isolated from the young tumor tissue on nonselective YMA medium and five representative strains were selected for further identification. Tumorigenic (Ti plasmid was detected in all strains by PCR using primers designed to amplify the virC pathogenicity gene, producing a 414-bp PCR product. The strains were identified as Agrobacterium vitis using differential physiological and biochemical tests, and a multiplex PCR assay targeting 23S rRNA gene sequences. In the pathogenicity assay, all strains induced characteristic symptoms on inoculated tomato and grapevine plants. They were less virulent on tomato plants in comparison to the reference strains of A. tumefaciens and A. vitis. [Ministarstva nauke Republike Srbije, br. III46008: Development of integrated management of harmful organisms in plant production in order to overcome resistance and to improve food quality and safety

  18. Grapevine tissues and phenology differentially affect soluble carbohydrates determination by capillary electrophoresis.

    Science.gov (United States)

    Moreno, Daniela; Berli, Federico; Bottini, Rubén; Piccoli, Patricia N; Silva, María F

    2017-09-01

    Soluble carbohydrates distribution depends on plant physiology and, among other important factors, determines fruit yield and quality. In plant biology, the analysis of sugars is useful for many purposes, including metabolic studies. Capillary electrophoresis (CE) proved to be a powerful green separation technique with minimal sample preparation, even in complex plant tissues, that can provide high-resolution efficiency. Matrix effect refers to alterations in the analytical response caused by components of a sample other than the analyte of interest. Thus, the assessment and reduction of the matrix factor is fundamental for metabolic studies in different matrices. The present study evaluated the source and levels of matrix effects in the determination of most abundant sugars in grapevine tissues (mature and young leaves, berries and roots) at two phenological growth stages. Sucrose was the sugar that showed the least matrix effects, while fructose was the most affected analyte. Based on plant tissues, young leaves presented the smaller matrix effects, irrespectively of the phenology. These changes may be attributed to considerable differences at chemical composition of grapevine tissues with plant development. Therefore, matrix effect should be an important concern for plant metabolomics. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Grapevine fruit extract protects against radiation-induced oxidative stress and apoptosis in human lymphocyte

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar

    2015-01-01

    Ionizing radiation (IR) causes oxidative stress through overwhelming generation of reactive oxygen species (ROS) in the living cells leading the oxidative damage further to biomolecules. Grapevine (Vitis vinifera L.) posses several bioactive phytochemicals and is the richest source of antioxidants. In this study, we investigated V. vinifera for its phytochemical content, enzymes profile and, ROS-and oxidant-scavenging activities. We have also studied the fruit extract of four different grapevine viz., Thompson seedless, Flame seedless, Kishmish chorni and Red globe for their radioprotective actions in human lymphocytes. The activities of ascorbic acid oxidase and catalase significantly (P < 0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. Pretreatment with grape extracts attenuated the oxidative stress induced by 4 Gy γ-radiation in human lymphocytes in vitro. Further, γ-radiation-induced increase in caspase 3/7 activity was significantly attenuated by grape extracts. These results suggest that grape extract serve as a potential source of natural antioxidants against the IR-induced oxidative stress and also inhibit apoptosis. Furthermore, the protective action of grape depends on the source of extract (seed, skin or pulp) and type of the cultivars. (author)

  20. Production of Polyclonal Antibody against Grapevine fanleaf virus Movement Protein Expressed in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Davoud Koolivand

    2016-10-01

    Full Text Available The genomic region of Grapevine fanleaf virus (GFLV encoding the movement protein (MP was cloned into pET21a and transformed into Escherichia coli strain BL21 (DE3 to express the protein. Induction was made with a wide range of isopropyl-β-D-thiogalactopyranoside (IPTG concentrations (1, 1.5, and 2 mM each for duration of 4, 6, or 16 h. However, the highest expression level was achieved with 1 mM IPTG for 4 h. Identity of the expressed protein was confirmed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE followed by Western blotting. The expressed 41 kDa protein was purified under denaturing condition by affinity chromatography, reconfirmed by Western blotting and plate-trapped antigen enzyme-linked immunosorbent assay (PTA-ELISA before being used as a recombinant antigen to raise polyclonal antibodies in rabbits. Purified anti-GFLV MP immunoglobulines (IgGs and conjugated IgGs detected the expressed MP and GFLV virions in infected grapevines when used in PTA-ELISA, double antibody sandwich-ELISA, and Western blotting. This is the first report on the production of anti-GFLV MP polyclonal antibodies and application for the virus detection.

  1. Climate Change and Crop Exposure to Adverse Weather: Changes to Frost Risk and Grapevine Flowering Conditions.

    Science.gov (United States)

    Mosedale, Jonathan R; Wilson, Robert J; Maclean, Ilya M D

    2015-01-01

    The cultivation of grapevines in the UK and many other cool climate regions is expected to benefit from the higher growing season temperatures predicted under future climate scenarios. Yet the effects of climate change on the risk of adverse weather conditions or events at key stages of crop development are not always captured by aggregated measures of seasonal or yearly climates, or by downscaling techniques that assume climate variability will remain unchanged under future scenarios. Using fine resolution projections of future climate scenarios for south-west England and grapevine phenology models we explore how risks to cool-climate vineyard harvests vary under future climate conditions. Results indicate that the risk of adverse conditions during flowering declines under all future climate scenarios. In contrast, the risk of late spring frosts increases under many future climate projections due to advancement in the timing of budbreak. Estimates of frost risk, however, were highly sensitive to the choice of phenology model, and future frost exposure declined when budbreak was calculated using models that included a winter chill requirement for dormancy break. The lack of robust phenological models is a major source of uncertainty concerning the impacts of future climate change on the development of cool-climate viticulture in historically marginal climatic regions.

  2. Abiotic stresses affect Trichoderma harzianum T39-induced resistance to downy mildew in grapevine.

    Science.gov (United States)

    Roatti, Benedetta; Perazzolli, Michele; Gessler, Cesare; Pertot, Ilaria

    2013-12-01

    Enhancement of plant defense through the application of resistance inducers seems a promising alternative to chemical fungicides for controlling crop diseases but the efficacy can be affected by abiotic factors in the field. Plants respond to abiotic stresses with hormonal signals that may interfere with the mechanisms of induced systemic resistance (ISR) to pathogens. In this study, we exposed grapevines to heat, drought, or both to investigate the effects of abiotic stresses on grapevine resistance induced by Trichoderma harzianum T39 (T39) to downy mildew. Whereas the efficacy of T39-induced resistance was not affected by exposure to heat or drought, it was significantly reduced by combined abiotic stresses. Decrease of leaf water potential and upregulation of heat-stress markers confirmed that plants reacted to abiotic stresses. Basal expression of defense-related genes and their upregulation during T39-induced resistance were attenuated by abiotic stresses, in agreement with the reduced efficacy of T39. The evidence reported here suggests that exposure of crops to abiotic stress should be carefully considered to optimize the use of resistance inducers, especially in view of future global climate changes. Expression analysis of ISR marker genes could be helpful to identify when plants are responding to abiotic stresses, in order to optimize treatments with resistance inducers in field.

  3. Inheritance of downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) resistance in grapevines.

    Science.gov (United States)

    Poolsawat, O; Mahanil, S; Laosuwan, P; Wongkaew, S; Tharapreuksapong, A; Reisch, B I; Tantasawat, P A

    2013-12-13

    Downy mildew (Plasmopara viticola) and anthracnose (Sphaceloma ampelinum) are two of the major diseases of most grapevine (Vitis vinifera L.) cultivars grown in Thailand. Therefore, breeding grapevines for improved downy mildew and anthracnose resistance is crucial. Factorial crosses were made between three downy mildew and/or anthracnose resistant lines ('NY88.0517.01', 'NY65.0550.04', and 'NY65.0551.05'; male parents) and two or three susceptible cultivars of V. vinifera ('Black Queen', 'Carolina Black Rose', and/or 'Italia'; female parents). F1 hybrid seedlings were evaluated for downy mildew and anthracnose resistance using a detached/excised leaf assay. For both diseases, the general combining ability (GCA) variance among male parents was significant, while the variance of GCA among females and the specific combining ability (SCA) variance were not significant, indicating the prevalence of additive over non-additive gene actions. The estimated narrow sense heritabilities of downy mildew and anthracnose resistance were 55.6 and 79.2%, respectively, suggesting that downy mildew/anthracnose resistance gene(s) were highly heritable. The 'Carolina Black Rose x NY65.0550.04' cross combination is recommended for future use.

  4. VitiCanopy: A Free Computer App to Estimate Canopy Vigor and Porosity for Grapevine.

    Science.gov (United States)

    De Bei, Roberta; Fuentes, Sigfredo; Gilliham, Matthew; Tyerman, Steve; Edwards, Everard; Bianchini, Nicolò; Smith, Jason; Collins, Cassandra

    2016-04-23

    Leaf area index (LAI) and plant area index (PAI) are common and important biophysical parameters used to estimate agronomical variables such as canopy growth, light interception and water requirements of plants and trees. LAI can be either measured directly using destructive methods or indirectly using dedicated and expensive instrumentation, both of which require a high level of know-how to operate equipment, handle data and interpret results. Recently, a novel smartphone and tablet PC application, VitiCanopy, has been developed by a group of researchers from the University of Adelaide and the University of Melbourne, to estimate grapevine canopy size (LAI and PAI), canopy porosity, canopy cover and clumping index. VitiCanopy uses the front in-built camera and GPS capabilities of smartphones and tablet PCs to automatically implement image analysis algorithms on upward-looking digital images of canopies and calculates relevant canopy architecture parameters. Results from the use of VitiCanopy on grapevines correlated well with traditional methods to measure/estimate LAI and PAI. Like other indirect methods, VitiCanopy does not distinguish between leaf and non-leaf material but it was demonstrated that the non-leaf material could be extracted from the results, if needed, to increase accuracy. VitiCanopy is an accurate, user-friendly and free alternative to current techniques used by scientists and viticultural practitioners to assess the dynamics of LAI, PAI and canopy architecture in vineyards, and has the potential to be adapted for use on other plants.

  5. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

    Science.gov (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

    1990-07-01

    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  6. Genetic diversity and geographical dispersal in grapevine clones revealed by microsatellite markers.

    Science.gov (United States)

    Moncada, Ximena; Pelsy, Frédérique; Merdinoglu, Didier; Hinrichsen, Patricio

    2006-11-01

    Intravarietal genetic diversification associated with geographical dispersal of a vegetatively propagated species was studied using grapevine Vitis vinifera L. 'Cabernet Sauvignon' as a model. Fifty-nine clonal samples obtained from 7 countries (France, Chile, Spain, Australia, Hungary, USA, and Italy) were analyzed using 84 microsatellite markers. Eighteen polymorphic microsatellite loci (21.4%) were detected, finding 22 different genotypes in the population analyzed with a genetic similarity of over 97%. The presence of chimeric clones was evidenced at locus VMC5g7 by means of a segregation analysis of descendants by self-pollination of a triallelic Chilean clone and by somatic embryogenesis analysis, showing a mutation in L2 cell layer. Only 2 clones (obtained from France and Australia) presented the ancestral genotype, and the most divergent genotype was exhibited by another French clone, which had accumulated 5 somatic mutations. The 2 largest populations considered (from France and Chile) showed a clear divergency in the polymorphisms detected. These antecedents enabled the tracing of geographical dispersal with a phylogenetic hypothesis supporting France as the center of origin of diversification of Cabernet Sauvignon. The results obtained could help to explain diversification processes in other grapevine cultivars. The possibility that this kind of genetic variability occurs in other vegetatively propagated species is discussed, focusing on possible fingerprinting applications.

  7. Characterization of the largest relic Eurasian wild grapevine reservoir in Southern Iberian Peninsula

    Energy Technology Data Exchange (ETDEWEB)

    Arroyo-García, R.; Cantos, M.; Lara, M.; López, M.A.; Gallardo, A.; Ocete, C.A.; Pérez, A.; Bánáti, B.; García, J.L.; Ocete, R.

    2016-11-01

    Wild grapevine is becoming a threatened species in the Iberian Peninsula due to human impacts. The aim of this work was to carry out a holistic study for six years of the largest wild grapevine population found up to date in SW Iberian Peninsula. This population has 115 vines. Ampelographic and soil characteristics have been studied. Evaluation of its environment has also been studied by describing the main parasitic species and natural enemies of pests. The ability of this plant material for its micropropagation and storage in slow-growth conditions has been tested. Microvinification resulted in a wine with good acidity and medium color intensity, two interesting characteristics under a warm climatology. Finally, the identification of private alleles in this wild population, absent in other locations from the Northern and Southern Iberian territories, is a very valuable feature and confirms the importance of establishing conservation programs. The population here studied is genetically unique and potentially useful for commercial rootstocks and cultivars breeding that would improve viticulture and enology. (Author)

  8. Statistical modelling of grapevine yield in the Port Wine region under present and future climate conditions

    Science.gov (United States)

    Santos, João A.; Malheiro, Aureliano C.; Karremann, Melanie K.; Pinto, Joaquim G.

    2011-03-01

    The impact of projected climate change on wine production was analysed for the Demarcated Region of Douro, Portugal. A statistical grapevine yield model (GYM) was developed using climate parameters as predictors. Statistically significant correlations were identified between annual yield and monthly mean temperatures and monthly precipitation totals during the growing cycle. These atmospheric factors control grapevine yield in the region, with the GYM explaining 50.4% of the total variance in the yield time series in recent decades. Anomalously high March rainfall (during budburst, shoot and inflorescence development) favours yield, as well as anomalously high temperatures and low precipitation amounts in May and June (May: flowering and June: berry development). The GYM was applied to a regional climate model output, which was shown to realistically reproduce the GYM predictors. Finally, using ensemble simulations under the A1B emission scenario, projections for GYM-derived yield in the Douro Region, and for the whole of the twenty-first century, were analysed. A slight upward trend in yield is projected to occur until about 2050, followed by a steep and continuous increase until the end of the twenty-first century, when yield is projected to be about 800 kg/ha above current values. While this estimate is based on meteorological parameters alone, changes due to elevated CO2 may further enhance this effect. In spite of the associated uncertainties, it can be stated that projected climate change may significantly benefit wine yield in the Douro Valley.

  9. Physiological behaviors and recovery responses of four galician grapevine (Vitis vinifera L. cultivars under water stress

    Directory of Open Access Journals (Sweden)

    Islam M. T.

    2012-11-01

    Full Text Available Gas exchange parameters and chlorophyll fluorescence of four pot grown Galician grapevines (Vitis vinifera L. cv. Albariño, Brancellao, Godello and Treixadura were examined under different levels of water stress in greenhouse. After extreme stress, gas exchange recovery responses were evaluated. Average ΨPD for control and stressed plants were -0.4MPa and -1.45MPa respectively. All varieties showed gradual declining of all gas exchange parameters (gs, E and A with increasing of stress periods. Under stressed conditions, Albariño and Godello showed higher CO2 assimilation rate. At the end of stress period leaf defoliation was found in Albariño and Brancellao. Gas exchange recovery was higher for both Godello and Treixadura. A better response of auxiliary bud recovery was present in Albariño than in Brancellao. Close correlations between water stress and gas exchange parameters were found and it varies on genotype. Albariño, Godello and Treixadura followed same diurnal patterns of gas exchange rate for control and stressed plant respectively. Diurnal pattern of CO2 assimilation rate of all tested varieties followed gs and E. Only Brancellao showed treatment effect on mid-day Fv/Fm. Among four varieties photoinhibition was only found in Brancellao. At stressed condition physiological responses of grapevines were genotype depended.

  10. Kaolin modulates ABA and IAA dynamics and physiology of grapevine under Mediterranean summer stress.

    Science.gov (United States)

    Dinis, L-T; Bernardo, S; Luzio, A; Pinto, G; Meijón, M; Pintó-Marijuan, M; Cotado, A; Correia, C; Moutinho-Pereira, J

    2018-01-01

    The foliar exogenous application of kaolin, a radiation-reflecting inert mineral, has proven to be an effective short-term climate change mitigation strategy for Mediterranean vineyards. In this work, we address the hypothesis that kaolin could improve both the hormonal dynamics and physiological responses of grapevines growing in Douro Region, northern Portugal. For this purpose, the leaf water potential, gas exchange and chlorophyll a fluorescence parameters were monitored, as well as the abscisic acid (ABA) and indole-3-acetic acid (IAA) quantification and immunolocalization were assessed. The study revealed a slight decrease in ABA and an increase in IAA in the kaolin treatment, which in turn were associated with the improvement of physiological performance. A month after spraying, kaolin improves the water potential respectively, 30% and 17% in the predawn and midday periods. Besides, plants treated with kaolin showed higher values of stomatal conductance, net CO 2 assimilation rate and intrinsic water use efficiency. Kaolin also ameliorates the effective PSII efficiency (67%), as well as the maximum quantum efficiency of photosystem II and the photosynthetic electron transport rate (>73%). These results were consistent with the higher photochemical quenching and the lower non-photochemical quenching observed in treated leaves and with the better performance obtained by the JIP test parameters. Physiological and hormonal analysis confirmed that kaolin effectively enhance grapevine summer stress tolerance. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Grapevine yield components and composition of Isabel grape produced according to the organic and conventional systems

    Directory of Open Access Journals (Sweden)

    Miele Alberto

    2016-01-01

    Full Text Available There is an increasing demand for organic grapes by the juice industry of Serra Gaúcha, Brazil. This region presents a humid and hot summer, ideal climatic conditions for the development of a number of diseases. To control such diseases and problems brought about by other organisms, growers apply pesticides on the grapevines which may leave residues in grapes. However, in general, grapes produced by organic system have lower yield, but there is a lack of research data on this subject. Thus, an experiment was carried out over three years in order to compare the yield components and the physicochemical composition of the must of Isabel grapes conducted in both production systems. When the grapes were ripe, variables related to yield components were evaluated, such as the number of clusters/vine, yield/vine and weight/cluster. Then the grapes were sampled and taken to the laboratory where they were crushed and the musts were centrifuged and analyzed. The 3-year data mean were submitted to correlation analysis and Principal Component Analysis. The results show that conventional grapevines produced 2.18 times more than organic. However, the grapes from the organic system had higher density, Brix, pH, Brix/titratable acidity ratio, P and Mg but lower K, and Ca varied little between both production systems.

  12. Reduced nighttime transpiration is a relevant breeding target for high water-use efficiency in grapevine.

    Science.gov (United States)

    Coupel-Ledru, Aude; Lebon, Eric; Christophe, Angélique; Gallo, Agustina; Gago, Pilar; Pantin, Florent; Doligez, Agnès; Simonneau, Thierry

    2016-08-09

    Increasing water scarcity challenges crop sustainability in many regions. As a consequence, the enhancement of transpiration efficiency (TE)-that is, the biomass produced per unit of water transpired-has become crucial in breeding programs. This could be achieved by reducing plant transpiration through a better closure of the stomatal pores at the leaf surface. However, this strategy generally also lowers growth, as stomatal opening is necessary for the capture of atmospheric CO2 that feeds daytime photosynthesis. Here, we considered the reduction in transpiration rate at night (En) as a possible strategy to limit water use without altering growth. For this purpose, we carried out a genetic analysis for En and TE in grapevine, a major crop in drought-prone areas. Using recently developed phenotyping facilities, potted plants of a cross between Syrah and Grenache cultivars were screened for 2 y under well-watered and moderate soil water deficit scenarios. High genetic variability was found for En under both scenarios and was primarily associated with residual diffusion through the stomata. Five quantitative trait loci (QTLs) were detected that underlay genetic variability in En Interestingly, four of them colocalized with QTLs for TE. Moreover, genotypes with favorable alleles on these common QTLs exhibited reduced En without altered growth. These results demonstrate the interest of breeding grapevine for lower water loss at night and pave the way to breeding other crops with this underexploited trait for higher TE.

  13. Learn About Stem Cells

    Science.gov (United States)

    ... Patient Handbook Stem Cell Glossary Search Toggle Nav Stem Cell Basics Stem cells are the foundation from which ... original cell’s DNA, cytoplasm and cell membrane. About stem cells Stem cells are the foundation of development in ...

  14. Production of polyclonal antisera using recombinant coat proteins of Grapevine leafroll-associated virus 2 and Grapevine virus B Produção de anti-soros policlonais a partir de proteínas capsidiais recombinantes de Grapevine leafroll-associated virus 2 e Grapevine virus B

    Directory of Open Access Journals (Sweden)

    Paula Radaelli

    2008-10-01

    Full Text Available The objective of this work was to produce and characterize specific antisera against Brazilian isolates of Grapevine leafroll-associated virus 2 (GLRaV-2 and Grapevine virus B (GVB, developed from expressed coat proteins (CPs in Escherichia coli, and to test their possible use for the detection of these two viruses in diseased grapevines. The coat protein (CP genes were RT-PCR-amplified, cloned and sequenced. The CP genes were subsequently subcloned, and the recombinant plasmids were used to transform E. coli cells and express the coat proteins. The recombinant coat proteins were purified, and their identities were confirmed by SDS-PAGE and Western blot and used for rabbit immunizations. Antisera raised against these proteins were able to recognize the corresponding recombinant proteins in Western blots and to detect GLRaV-2 and GVB in infected grapevine tissues, by indirect ELISA, discriminating healthy and infected grapevines with absorbances (A405 of 0.08/1.15 and 0.12/1.30, respectively. Expressing CP genes can yield high amount of viral protein with high antigenicity, and GLRaV-2 and GVB antisera obtained in this study can allow reliable virus disease diagnosis.O objetivo deste trabalho foi produzir e caracterizar anti-soros específicos contra isolados brasileiros do Vírus do enrolamento-da-folha da videira 2 (GLRaV-2 e do Vírus B da videira (GVB, desenvolvidos a partir das proteínas capsidiais expressas em Escherichia coli, e testar seu possível uso para a detecção destes dois vírus em videiras infectadas. Os genes da proteína capsidial (CP foram amplificados via RT-PCR, clonados e seqüenciados. Foram, subseqüentemente, subclonados, e os plasmídeos recombinantes foram empregados na transformação das células de E. coli e na expressão das proteínas capsidiais. As proteínas capsidiais recombinantes foram purificadas, e suas identidades foram confirmadas em SDS-PAGE e "Western blot" e utilizadas para imunizar coelhos. Os anti

  15. A complex protein derivative acts as biogenic elicitor of grapevine resistance against powdery mildew under field conditions

    Directory of Open Access Journals (Sweden)

    Andrea eNesler

    2015-09-01

    Full Text Available Powdery mildew caused by Erysiphe necator is one of the most important grapevine diseases in several viticulture areas, and high fungicide input is required to control it. However, numerous synthetic chemical pesticides are under scrutiny due to concerns about their impact on human health and the environment. Biopesticides, such as biogenic elicitors, are a promising alternative to chemical fungicides. Although several studies have reported on effective elicitors against grapevine diseases, their efficacy under field conditions has not been investigated extensively or has occurred at rather limited levels. Our goal was to examine the efficacy of a protein-based composition, namely nutrient broth (NB, against powdery mildew under field conditions and to characterize its mechanism of action. Weekly treatments with NB was highly effective in controlling powdery mildew on grapevine across seasons with different disease pressures. The level of disease control achieved with NB was comparable to standard fungicide treatments both on leaves and bunches across three different years. NB has no direct toxic effect on the germination of E. necator conidia, and it activates plant resistance with both systemic and translaminar effect in experiments with artificial inoculation under controlled conditions. NB induced the expression of defense-related genes in grapevine, demonstrating stimulation of plant defense mechanisms, prior to and in the early stages of pathogen infection. NB is a natural derivative from meat and yeast, substances that tend not to raise concerns about toxicological and ecotoxicological properties. NB represents a valid control tool for integrated plant protection programs against powdery mildew, to reduce the use of synthetic pesticides on grapevine.

  16. A complex protein derivative acts as biogenic elicitor of grapevine resistance against powdery mildew under field conditions.

    Science.gov (United States)

    Nesler, Andrea; Perazzolli, Michele; Puopolo, Gerardo; Giovannini, Oscar; Elad, Yigal; Pertot, Ilaria

    2015-01-01

    Powdery mildew caused by Erysiphe necator is one of the most important grapevine diseases in several viticulture areas, and high fungicide input is required to control it. However, numerous synthetic chemical pesticides are under scrutiny due to concerns about their impact on human health and the environment. Biopesticides, such as biogenic elicitors, are a promising alternative to chemical fungicides. Although several studies have reported on effective elicitors against grapevine diseases, their efficacy under field conditions has not been investigated extensively or has occurred at rather limited levels. Our goal was to examine the efficacy of a protein-based composition, namely nutrient broth (NB), against powdery mildew under field conditions and to characterize its mechanism of action. Weekly treatments with NB was highly effective in controlling powdery mildew on grapevine across seasons with different disease pressures. The level of disease control achieved with NB was comparable to standard fungicide treatments both on leaves and bunches across three different years. NB has no direct toxic effect on the germination of E. necator conidia, and it activates plant resistance with both systemic and translaminar effect in experiments with artificial inoculation under controlled conditions. NB induced the expression of defense-related genes in grapevine, demonstrating stimulation of plant defense mechanisms, prior to and in the early stages of pathogen infection. NB is a natural derivative from meat and yeast, substances that tend not to raise concerns about toxicological and ecotoxicological properties. NB represents a valid control tool for integrated plant protection programs against powdery mildew, to reduce the use of synthetic pesticides on grapevine.

  17. Grapevine rootstock effects on scion sap phenolic levels, resistance to Xylella fastidiosa infection, and progression of Pierce’s disease

    Directory of Open Access Journals (Sweden)

    Christopher Michael Wallis

    2013-12-01

    Full Text Available The xylem-limited bacterium Xylella fastidiosa (Xf causes Pierce’s disease (PD, an important disease of grapevine, Vitis vinifera L.. Grapevine rootstocks were developed to provide increased resistance to root disease, but rootstock effects on cane and vine diseases remain unclear. Grapevines that consisted of Cabernet Sauvignon or Chardonnay grafted to 13 different rootstocks were inoculated with Xf and evaluated for PD severity and Xf titer after six months. A subset of six rootstock/scion combinations had xylem sap phenolic levels assessed in non-infected and Xf-infected grapevines. Vigor also was analyzed by measuring root lengths and masses. Cabernet Sauvignon grafted to 101-14MG, 1103P, 420A, or Schwarzmann had reduced PD severity compared to Cabernet Sauvignon grafted to 110R, 5BB, or SO4. Chardonnay grafted to Salt Creek or Freedom had reduced PD severity compared to Chardonnay grafted to RS3 or Schwarzmann. Chardonnay grafted to RS3 had greater Xf titer than Chardonnay grafted to 101-14MG, Freedom, or Salt Creek. No other differences in Xf titer among rootstocks were observed. Of the six scion/rootstock combinations which had xylem sap phenolics analyzed, Chardonnay/ RS3 had the highest levels of most phenolics whereas Cabernet Sauvignon/101-14MG had the lowest phenolic levels. However, Chardonnay/101-14MG, which had mild PD symptoms, had greater sap levels of caftaric acid than other scion/rootstock combinations. Sap levels of caftaric acid, methyl salicylate, a procyanidin trimer, and quinic acid were greater in Xf-infected versus non-infected grapevines. Chardonnay on 101-14MG or Salt Creek had greater root mass than Chardonnay on RS3. Cabernet Sauvignon on 101-14MG had greater root mass than Cabernet Sauvignon on 110R. These results identified rootstocks with the capacity for reducing PD symptom progression. Rootstocks also were shown to affect Xf titer, xylem sap phenolic levels, and plant vigor.

  18. A DNA based method to detect the grapevine root-rotting fungus Roesleria subterranea in soil and root samples

    Directory of Open Access Journals (Sweden)

    S. Neuhauser

    2009-05-01

    Full Text Available Roesleria subterranea causes root rot in grapevine and fruit trees. The fungus has long been underestimated as a weak parasite, but during the last years it has been reported to cause severe damages in German vineyards. Direct, observation-based detection of the parasite is time consuming and destructive, as large parts of the rootstocks have to be uprooted and screened for the tiny, stipitate, hypogeous ascomata of R. subterranea. To facilitate rapid detection in vineyards, protocols to extract DNA from soil samples and grapevine roots, and R.-subterranea-specific PCR primers were designed. Twelve DNA-extraction protocols for soil samples were tested in small-scale experiments, and selected parameters were optimised. A protocol based on ball-mill homogenization, DNA extraction with SDS, skim milk, chloroform, and isopropanol, and subsequent purifi cation of the raw extracts with PVPP-spin-columns was most effective. This DNA extraction protocol was found to be suitable for a wide range of soil-types including clay, loam and humic-rich soils. For DNA extraction from grapevine roots a CTAB-based protocol was more reliable for various grapevine rootstock varieties. Roesleria-subterranea-specific primers for the ITS1-5.8S-ITS2 rDNA region were developed and tested for their specifi city to DNA extracts from eleven R. subterranea strains isolated from grapevine and fruit trees. No cross reactions were detected with DNA extracts from 44 different species of fungi isolated from vineyard soils. The sensitivity of the species-specifi c primers in combination with the DNA extraction method for soil was high: as little as 100 fg μl-1 R.-subterranea-DNA was suffi cient for a detection in soil samples and plant material. Given that specifi c primers are available, the presented method will also allow quick and large-scale testing for other root pathogens.

  19. The sulfated laminarin triggers a stress transcriptome before priming the SA- and ROS-dependent defenses during grapevine's induced resistance against Plasmopara viticola.

    Directory of Open Access Journals (Sweden)

    Adrien Gauthier

    Full Text Available Grapevine (Vitis vinifera is susceptible to many pathogens which cause significant losses to viticulture worldwide. Chemical control is available, but agro-ecological concerns have raised interest in alternative methods, especially in triggering plant immunity by elicitor treatments. The β-glucan laminarin (Lam and its sulfated derivative (PS3 have been previously demonstrated to induce resistance in grapevine against downy mildew (Plasmopara viticola. However, if Lam elicits classical grapevine defenses such as oxidative burst, pathogenesis-related (PR-proteins and phytoalexin production, PS3 triggered grapevine resistance via a poorly understood priming phenomenon. The aim of this study was to identify the molecular mechanisms of the PS3-induced resistance. For this purpose we studied i the signaling events and transcriptome reprogramming triggered by PS3 treatment on uninfected grapevine, ii grapevine immune responses primed by PS3 during P. viticola infection. Our results showed that i PS3 was unable to elicit reactive oxygen species (ROS production, cytosolic Ca(2+ concentration variations, mitogen-activated protein kinase (MAPK activation but triggered a long lasting plasma membrane depolarization in grapevine cells, ii PS3 and Lam shared a common stress-responsive transcriptome profile that partly overlapped the salicylate- (SA and jasmonate-(JA-dependent ones. After P. viticola inoculation, PS3 specifically primed the SA- and ROS-dependent defense pathways leading to grapevine induced resistance against this biotroph. Interestingly pharmacological approaches suggested that the plasma membrane depolarization and the downstream ROS production are key events of the PS3-induced resistance.

  20. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  1. STEM Education

    Science.gov (United States)

    & Development (LDRD) National Security Education Center (NSEC) Office of Science Programs Richard P Databases National Security Education Center (NSEC) Center for Nonlinear Studies Engineering Institute Scholarships STEM Education Programs Teachers (K-12) Students (K-12) Higher Education Regional Education

  2. Comparison of RNA Extraction Methods for the Identification of Grapevine fan leaf virus

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-06-01

    Full Text Available Introduction: To now, more than 70 viral diseases have been reported from grapevine. Serological methods are regular diagnostic tools of grapevine viruses, however, their sensitivity has affected by seasonal fluctuations of the virus. Reverse transcription polymerase chain reaction provides significant improvement in detection of grapevine viruses. Extraction of high-quality RNA is essential for the successful application of many molecular techniques, such as RT-PCR. Extraction of high-quality RNA from the leaves of woody plants, such as grapevine, is particularly challenging because of high concentrations of polysaccharides, polyphenols, and other secondary metabolites. Some RNA extraction methods yield pellets that are poorly soluble, indicating the presence of unknown contaminants, whereas others are gelatinous, indicating the presence of polysaccharides. RNA can make complexes with polysaccharides and phenolic compounds render the RNA unusable for applications such as reverse transcription. Grapevine fanleaf virus is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single stranded RNAs. The genome has a poly (A tail at the 3´ terminus and a covalently linked VPG protein at the 5´ terminus. Several extraction methods had been reported to be used for identification of GFLV in grapevine. Some of them require harmful chemical material; disadvantages of other are high costs. Immunocapture-RT-PCR requires preparation of specific antibody and direct binding RT-PCR (DB-RT-PCR has a high contamination risk. In this study, four RNA extraction protocols were compared with a commercial isolation kit to explore the most efficient RNA isolation method for grapevines. Material and Methods: 40 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme linked immunosorbent assay (ELISA Using specific antibodies raised against Iranian

  3. Cytoplasmic- and extracellular-proteome analysis of Diplodia seriata: a phytopathogenic fungus involved in grapevine decline

    Directory of Open Access Journals (Sweden)

    Cobos Rebeca

    2010-09-01

    Full Text Available Abstract Background The phytopathogenic fungus Diplodia seriata, whose genome remains unsequenced, produces severe infections in fruit trees (fruit blight and grapevines. In this crop is recognized as one of the most prominent pathogens involved in grapevine trunk disease (or grapevine decline. This pathology can result in the death of adult plants and therefore it produces severe economical losses all around the world. To date no genes or proteins have been characterized in D. seriata that are involved in the pathogenicity process. In an effort to help identify potential gene products associated with pathogenicity and to gain a better understanding of the biology of D. seriata, we initiated a proteome-level study of the fungal mycelia and secretome. Results Intracellular and secreted proteins from D. seriata collected from liquid cultures were separated using two-dimensional gel electrophoresis. About 550 cytoplasmic proteins were reproducibly present in 3 independent extractions, being 53 identified by peptide mass fingerprinting and tandem mass spectrometry. The secretome analysis showed 75 secreted proteins reproducibly present in 3 biological replicates, being 16 identified. Several of the proteins had been previously identified as virulence factors in other fungal strains, although their contribution to pathogenicity in D. seriata remained to be analyzed. When D. seriata was grown in a medium supplemented with carboxymethylcellulose, 3 proteins were up-regulated and 30 down-regulated. Within the up-regulated proteins, two were identified as alcohol dehydrogenase and mitochondrial peroxyrredoxin-1, suggesting that they could play a significant role in the pathogenicity process. As for the 30 down-regulated proteins, 9 were identified being several of them involved in carbohydrate metabolism. Conclusions This study is the first report on proteomics on D. seriata. The proteomic data obtained will be important to understand the pathogenicity

  4. Resistance to Plasmopara viticola in a grapevine segregating population is associated with stilbenoid accumulation and with specific host transcriptional responses

    Directory of Open Access Journals (Sweden)

    Delledonne Massimo

    2011-08-01

    Full Text Available Abstract Background Downy mildew, caused by the oomycete Plasmopara viticola, is a serious disease in Vitis vinifera, the most commonly cultivated grapevine species. Several wild Vitis species have instead been found to be resistant to this pathogen and have been used as a source to introgress resistance into a V. vinifera background. Stilbenoids represent the major phytoalexins in grapevine, and their toxicity is closely related to the specific compound. The aim of this study was to assess the resistance response to P. viticola of the Merzling × Teroldego cross by profiling the stilbenoid content of the leaves of an entire population and the transcriptome of resistant and susceptible individuals following infection. Results A three-year analysis of the population's response to artificial inoculation showed that individuals were distributed in nine classes ranging from total resistance to total susceptibility. In addition, quantitative metabolite profiling of stilbenoids in the population, carried out using HPLC-DAD-MS, identified three distinct groups differing according to the concentrations present and the complexity of their profiles. The high producers were characterized by the presence of trans-resveratrol, trans-piceid, trans-pterostilbene and up to thirteen different viniferins, nine of them new in grapevine. Accumulation of these compounds is consistent with a resistant phenotype and suggests that they may contribute to the resistance response. A preliminary transcriptional study using cDNA-AFLP selected a set of genes modulated by the oomycete in a resistant genotype. The expression of this set of genes in resistant and susceptible genotypes of the progeny population was then assessed by comparative microarray analysis. A group of 57 genes was found to be exclusively modulated in the resistant genotype suggesting that they are involved in the grapevine-P. viticola incompatible interaction. Functional annotation of these transcripts

  5. Peptidoglycan from Fermentation By-Product Triggers Defense Responses in Grapevine

    Science.gov (United States)

    Chen, Yang; Takeda, Taito; Aoki, Yoshinao; Fujita, Keiko; Suzuki, Shunji; Igarashi, Daisuke

    2014-01-01

    Plants are constantly under attack from a variety of microorganisms, and rely on a series of complex detection and response systems to protect themselves from infection. Here, we found that a by-product of glutamate fermentation triggered defense responses in grapevine, increasing the expression of defense response genes in cultured cells, foliar chitinase activity, and resistance to infection by downy mildew in leaf explants. To identify the molecule that triggered this innate immunity, we fractionated and purified candidates extracted from Corynebacterium glutamicum, a bacterium used in the production of amino acids by fermentation. Using hydrolysis by lysozyme, a silkworm larva plasma detection system, and gel filtration analysis, we identified peptidoglycan as inducing the defense responses. Peptidoglycans of Escherichia coli, Bacillus subtilis, and Staphylococcus aureus also generated similar defensive responses. PMID:25427192

  6. Grape yield, and must compounds of 'Cabernet Sauvignon' grapevine in sandy soil with potassium contents increasing

    Directory of Open Access Journals (Sweden)

    Marlise Nara Ciotta

    2016-08-01

    Full Text Available ABSTRACT: Content of exchangeable potassium (K in t soil may influence on its content in grapevines leaves, grape yield, as well as, in must composition. The study aimed to assess the interference of exchangeable K content in the soil on its leaf content, production and must composition of 'Cabernet Sauvignon' cultivar. In September 2011, in Santana do Livramento (RS five vineyards with increasing levels of exchangeable K in the soil were selected. In the 2012/13 and 2013/14 harvests, the grape yield, yield components, total K content in the leaves in full bloom and berries veraison were evaluated. Values of total soluble sugar (TSS, pH, total titratable acidity (TTA, total polyphenols and anthocyanins were evaluated in the must. Exchangeable K content increase in soil with sandy surface texture increased its content in leaves collected during full flowering and in berries and must pH; however, it did not affect production of the 'Cabernet Sauvignon'.

  7. MANAGING NEWLY ESTABLISHED PESTS: Growers, scientists and regulators collaborate on European grapevine moth program

    Directory of Open Access Journals (Sweden)

    Monica Cooper

    2014-10-01

    Full Text Available The first detection of the European grapevine moth in North America triggered the establishment of federal and state regulatory programs that (1 identified the insect's geographic range in California, (2 developed and implemented detection and management programs, (3 regulated the movement of plant material and equipment to minimize the threat of dispersal, (4 incorporated research-based information developed by subject-matter experts into policy decisions and (5 promoted a wide-reaching educational program for grape growers, the public and local officials. The action plan, developed and carried out through a coordinated program that included multiple government agencies, university scientists and the agricultural community, drastically reduced insect populations and limited the distribution in California vineyards such that some previously infested areas were removed from quarantine regulation.

  8. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  9. Preliminary Trials on Treatment of Esca-Infected Grapevines with Trunk Injection of Fungicides

    Directory of Open Access Journals (Sweden)

    T. Dula

    2007-04-01

    Full Text Available An increase in trunk diseases (due to esca, Agrobacterium, rugose wood virus, leaf roll viruses, phytoplasma etc. leading to young vines death is a very serious worry in vineyards in Hungary, as it is in other countries. In response to a demand expressed by grapevine growers, a method was tested for the direct treatment of pathogens in wood tissue. An experiment based on trunk injection was carried out in an esca infected vineyard. The various fungicides (propiconazole, difenoconazole, thiabendazole; propiconazole+ thiabendazole were injected into the trunk before the beginning of the xylem sap flow at high pressure. As a result the number of symptomatic plants was decreased, and the vigour of the plants was not impaired by the fungicide ingredients. The combination difenoconazole+ thiabendazole showed the best result.

  10. Modelling Growth and Partitioning of Annual Above-Ground Vegetative and Reproductive Biomass of Grapevine

    Science.gov (United States)

    Meggio, Franco; Vendrame, Nadia; Maniero, Giovanni; Pitacco, Andrea

    2014-05-01

    In the current climate change scenarios, both agriculture and forestry inherently may act as carbon sinks and consequently can play a key role in limiting global warming. An urgent need exists to understand which land uses and land resource types have the greatest potential to mitigate greenhouse gas (GHG) emissions contributing to global change. A common believe is that agricultural fields cannot be net carbon sinks due to many technical inputs and repeated disturbances of upper soil layers that all contribute to a substantial loss both of the old and newly-synthesized organic matter. Perennial tree crops (vineyards and orchards), however, can behave differently: they grow a permanent woody structure, stand undisturbed in the same field for decades, originate a woody pruning debris, and are often grass-covered. In this context, reliable methods for quantifying and modelling emissions and carbon sequestration are required. Carbon stock changes are calculated by multiplying the difference in oven dry weight of biomass increments and losses with the appropriate carbon fraction. These data are relatively scant, and more information is needed on vineyard management practices and how they impact vineyard C sequestration and GHG emissions in order to generate an accurate vineyard GHG footprint. During the last decades, research efforts have been made for estimating the vineyard carbon budget and its allocation pattern since it is crucial to better understand how grapevines control the distribution of acquired resources in response to variation in environmental growth conditions and agronomic practices. The objective of the present study was to model and compare the dynamics of current year's above-ground biomass among four grapevine varieties. Trials were carried out over three growing seasons in field conditions. The non-linear extra-sums-of-squares method demonstrated to be a feasible way of growth models comparison to statistically assess significant differences among

  11. Contribution of soil electric resistivity measurements to the studies on soil/grapevine water relations

    Directory of Open Access Journals (Sweden)

    Etienne Goulet

    2006-06-01

    Full Text Available The classical techniques that allow to quantify the soil water status such as the gravimetric method or the use of neutrons probes do not give access to the volume of soil explored by the plant root system. On the contrary, electric tomography can be used to have a global vision on the water exchange area between soil and plant. The measurement of soil electric resistivity, as a non destructive, spatially integrative technique, has recently been introduced into viticulture. The use of performing equipment and adapted software allows for rapid data processing and gives the possibility to spatialize the variations of soil texture or humidity in two or three dimensions. Soil electric resistivity has been tested for the last three years at the Experimental Unit on Grapevine and Vine, INRA, Angers, France, to study the water supply to the vine in different “terroir” conditions. Resistivity measurements were carried out with the resistivity meter Syscal R1+ (Iris Instruments, France equipped with 21 electrodes. Those electrodes were lined up on the soil surface in a direction perpendiculary to 5 grapevine rows with an electrode spacing of 0.5 m. and a dipole-dipole arrangement. Resistivity measurements were performed on the same place at different times in order to study soil moisture variations. This experimental set up has permitted to visualise the soil stratification and individualize some positive electric anomalies corresponding to preferential drying ; this desiccation could be attributed to grapevine root activity. The soil bulk subject to the water up-take could be defined more precisely and in some types of soil, available water may even be quantified. Terroir effect on grapevine root activity has also been shown up on two different experimental parcels through electric tomography and first results indicate that it is possible to monitor the effects of soil management (inter-row grassing or different rootstocks on the water supply to the

  12. Selection and evaluation of phosphate-solubilizing bacteria from grapevine rhizospheres for use as biofertilizers

    Energy Technology Data Exchange (ETDEWEB)

    Liu, M.; Liu, X.; Cheng, B.S.; Ma, X.L.; Lyu, X.; Zhao, X.; Ju, Y.; Min, Z.; Fang, Y.

    2016-07-01

    Phosphate-solubilizing bacteria (PSB) have the ability to solubilize insoluble phosphorus (P) and release soluble P. Extensive research has been performed with respect to PSB isolation from the rhizospheres of various plants, but little is known about the prevalence of PSB in the grapevine rhizosphere. In this study, we aimed to isolate and identify PSB from the grapevine rhizosphere in five vineyards of Northwest China, to characterize their plant-growth-promoting (PGP) traits, evaluate the effect of stress on their phosphate-solubilizing activity (PSA), and test their ability to stimulate the growth of Vitis vinifera L. cv. Cabernet Sauvignon. From the vineyard soils, 66 PSB isolates were screened, and 10 strains with high PSA were identified by 16S rRNA sequencing. Sequence analysis revealed that these 10 strains belonged to 4 genera and 5 species: Bacillus aryabhattai, B. megaterium, Klebsiella variicola, Stenotrophomonas rhizophila, and Enterobacter aerogenes. The selected PSB strains JY17 (B. aryabhattai) and JY22 (B. aryabhattai) were positive for multiple PGP traits, including nitrogen fixation and production of indole acetic acid (IAA), siderophores, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, and protease. JY17 and JY22 showed strong PSA under stress conditions of high pH, high salt, and high temperature. Therefore, these two isolates can be used as biofertilizers in saline-alkaline soils. The inoculation with PSB significantly facilitated the growth of V. vinifera cv. Cabernet Sauvignon under greenhouse conditions. Use of these PSB as biofertilizers will increase the available P content in soils, minimize P-fertilizer application, reduce environmental pollution, and promote sustainable agriculture.

  13. Selection and evaluation of phosphate-solubilizing bacteria from grapevine rhizospheres for use as biofertilizers

    International Nuclear Information System (INIS)

    Liu, M.; Liu, X.; Cheng, B.S.; Ma, X.L.; Lyu, X.; Zhao, X.; Ju, Y.; Min, Z.; Fang, Y.

    2016-01-01

    Phosphate-solubilizing bacteria (PSB) have the ability to solubilize insoluble phosphorus (P) and release soluble P. Extensive research has been performed with respect to PSB isolation from the rhizospheres of various plants, but little is known about the prevalence of PSB in the grapevine rhizosphere. In this study, we aimed to isolate and identify PSB from the grapevine rhizosphere in five vineyards of Northwest China, to characterize their plant-growth-promoting (PGP) traits, evaluate the effect of stress on their phosphate-solubilizing activity (PSA), and test their ability to stimulate the growth of Vitis vinifera L. cv. Cabernet Sauvignon. From the vineyard soils, 66 PSB isolates were screened, and 10 strains with high PSA were identified by 16S rRNA sequencing. Sequence analysis revealed that these 10 strains belonged to 4 genera and 5 species: Bacillus aryabhattai, B. megaterium, Klebsiella variicola, Stenotrophomonas rhizophila, and Enterobacter aerogenes. The selected PSB strains JY17 (B. aryabhattai) and JY22 (B. aryabhattai) were positive for multiple PGP traits, including nitrogen fixation and production of indole acetic acid (IAA), siderophores, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, and protease. JY17 and JY22 showed strong PSA under stress conditions of high pH, high salt, and high temperature. Therefore, these two isolates can be used as biofertilizers in saline-alkaline soils. The inoculation with PSB significantly facilitated the growth of V. vinifera cv. Cabernet Sauvignon under greenhouse conditions. Use of these PSB as biofertilizers will increase the available P content in soils, minimize P-fertilizer application, reduce environmental pollution, and promote sustainable agriculture.

  14. Enhanced salt-induced antioxidative responses involve a contribution of polyamine biosynthesis in grapevine plants.

    Science.gov (United States)

    Ikbal, Fatima Ezzohra; Hernández, José Antonio; Barba-Espín, Gregorio; Koussa, Tayeb; Aziz, Aziz; Faize, Mohamed; Diaz-Vivancos, Pedro

    2014-06-15

    The possible involvement of polyamines in the salt stress adaptation was investigated in grapevine (Vitis vinifera L.) plantlets focusing on photosynthesis and oxidative metabolism. Salt stress resulted in the deterioration of plant growth and photosynthesis, and treatment of plantlets with methylglyoxal-bis(guanylhydrazone) (MGBG), a S-adenosylmethionine decarboxylase (SAMDC) inhibitor, enhanced the salt stress effect. A decrease in PSII quantum yield (Fv/Fm), effective PSII quantum yield (Y(II)) and coefficient of photochemical quenching (qP) as well as increases in non-photochemical quenching (NPQ) and its coefficient (qN) was observed by these treatments. Salt and/or MGBG treatments also triggered an increase in lipid peroxidation and reactive oxygen species (ROS) accumulation as well as an increase of superoxide dismutase (SOD) and peroxidase (POX) activities, but not ascorbate peroxidase (APX) activity. Salt stress also resulted in an accumulation of oxidized ascorbate (DHA) and a decrease in reduced glutathione. MGBG alone or in combination with salt stress increased monodehydroascorbate reductase (MDHAR), SOD and POX activities and surprisingly no accumulation of DHA was noticed following treatment with MGBG. These salt-induced responses correlated with the maintaining of high level of free and conjugated spermidine and spermine, whereas a reduction of agmatine and putrescine levels was observed, which seemed to be amplified by the MGBG treatment. These results suggest that maintaining polyamine biosynthesis through the enhanced SAMDC activity in grapevine leaf tissues under salt stress conditions could contribute to the enhanced ROS scavenging activity and a protection of photosynthetic apparatus from oxidative damages. Copyright © 2014 Elsevier GmbH. All rights reserved.

  15. Free amino acids of leaves and berries of Cabernet Sauvignon grapevines

    Directory of Open Access Journals (Sweden)

    Alberto Miele

    2000-03-01

    Full Text Available The composition of free amino acids was studied from leaves, pericarps, skins, musts and seeds of Vitis vinifera L. cv. Cabernet Sauvignon. Vineyards were in the Bordeaux region and the grapevines were conducted in espalier and lyre systems. Grapes were collected at maturity and lyophilized after sampling. Extraction of free amino acids was done with a hydroalcoholic solution and their analysis was performed with an autoanalyzer. A standard of 34 amino acids was utilized for the qualitative analysis. The results showed that, for both espalier and lyre training systems, respectively, the free amino acids were predominant in the pericarps (12.85 and 11.21 mg/g dw - 16.88 and 15.12 mg/g dw in skins and 3.29 and 2.88 g/l in musts -, followed by the seeds (2.37 and 2.32 mg/g dw and leaves (1.87 and 1.98 mg/g dw. The most abundant free amino acids in leaves were glutamic acid (23.8 and 28.8 p. cent, aspartic acid (8.8 and 11.1 p. cent, and glutamine (10.1 and 9.4 p. cent. Proline (41.8 and 41.5 p. cent and arginine (22.8 and 22.4 p. cent predominated in the pericarps. In seeds, the main amino acids were proline (14.5 and 15.8 p. cent, arginine (11.0 and 11.8 p. cent, histidine (11.2 and 8.7 p. cent, and glutamic acid (11.3 and 8.2 p. cent. Grapevine training system showed some differences in the total amount and in the percentages of each free amino acid, but the pattern of these compounds for each tissue was similar for both training systems.

  16. A physical map of the heterozygous grapevine 'Cabernet Sauvignon' allows mapping candidate genes for disease resistance

    Directory of Open Access Journals (Sweden)

    Scalabrin Simone

    2008-06-01

    Full Text Available Abstract Background Whole-genome physical maps facilitate genome sequencing, sequence assembly, mapping of candidate genes, and the design of targeted genetic markers. An automated protocol was used to construct a Vitis vinifera 'Cabernet Sauvignon' physical map. The quality of the result was addressed with regard to the effect of high heterozygosity on the accuracy of contig assembly. Its usefulness for the genome-wide mapping of genes for disease resistance, which is an important trait for grapevine, was then assessed. Results The physical map included 29,727 BAC clones assembled into 1,770 contigs, spanning 715,684 kbp, and corresponding to 1.5-fold the genome size. Map inflation was due to high heterozygosity, which caused either the separation of allelic BACs in two different contigs, or local mis-assembly in contigs containing BACs from the two haplotypes. Genetic markers anchored 395 contigs or 255,476 kbp to chromosomes. The fully automated assembly and anchorage procedures were validated by BAC-by-BAC blast of the end sequences against the grape genome sequence, unveiling 7.3% of chimerical contigs. The distribution across the physical map of candidate genes for non-host and host resistance, and for defence signalling pathways was then studied. NBS-LRR and RLK genes for host resistance were found in 424 contigs, 133 of them (32% were assigned to chromosomes, on which they are mostly organised in clusters. Non-host and defence signalling genes were found in 99 contigs dispersed without a discernable pattern across the genome. Conclusion Despite some limitations that interfere with the correct assembly of heterozygous clones into contigs, the 'Cabernet Sauvignon' physical map is a useful and reliable intermediary step between a genetic map and the genome sequence. This tool was successfully exploited for a quick mapping of complex families of genes, and it strengthened previous clues of co-localisation of major NBS-LRR clusters and

  17. Influence of climate cycles on grapevine domestication and ancient migrations in Eurasia.

    Science.gov (United States)

    Mariani, Luigi; Cola, Gabriele; Maghradze, David; Failla, Osvaldo; Zavatti, Franco

    2018-09-01

    The objective of this work is to investigate the Holocenic climate cycles that may have influenced the domestication of grapevine in the Subcaucasian area and its subsequent spread in Eurasia. The analysis covered the longitudinal belt ranging from the Iberian Peninsula to Japan, seen as the preferential pathway for the Holocenic spread of grapevine and many other crops in Eurasia. Spectral analysis was considered as the criterion of investigation and the Holocenic cycles were analyzed considering different geochemical and biological proxies, of which seven are directly referred to vine. In this context the relation of the abovementioned proxies with spectral peaks of possible causal factors like Solar activity (SA), North Atlantic oceanic factors (Atlantic Multidecadal Oscillation - AMO and North Atlantic Oscillation - NAO), and subtropical oceanic factors (El Nino Southern Oscillation - ENSO) was also analyzed. In order to acquire a sufficiently wide number of proxies sensitive to the causal factors, we referred to a latitudinal belt wider than the one colonized by vine, also acquiring proxy from the Scandinavian area, notoriously susceptible to North Atlantic forcings. The analysis of the proxy spectral peaks, considering 20 classes with a 50-years step in the 0-1000 years range, showed that the 50% of the classes have a higher frequency of peaks at East than West, the 20% a higher frequency at West than East and the 10% an equal frequency, showing the efficiency of the propagation of Western signals towards the center of Eurasia. The search of the causal factors spectral peaks in the proxy series showed that AMO, NAO and SA acted with a certain regularity on the entire belt investigated both latitudinally and longitudinally, while spectral peaks linked to ENSO underwent a considerable attenuation moving northward. Finally, the specific analysis on viticultural proxies showed common peaks with causal factors. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. A candidate gene association study on muscat flavor in grapevine (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Boursiquot Jean-Michel

    2010-11-01

    Full Text Available Abstract Background The sweet, floral flavor typical of Muscat varieties (Muscats, due to high levels of monoterpenoids (geraniol, linalool and nerol, is highly distinct and has been greatly appreciated both in table grapes and in wine since ancient times. Muscat flavor determination in grape (Vitis vinifera L. has up to now been studied by evaluating monoterpenoid levels through QTL analysis. These studies have revealed co-localization of 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS with the major QTL positioned on chromosome 5. Results We resequenced VvDXS in an ad hoc association population of 148 grape varieties, which included muscat-flavored, aromatic and neutral accessions as well as muscat-like aromatic mutants and non-aromatic offsprings of Muscats. Gene nucleotide diversity and intragenic linkage disequilibrium (LD were evaluated. Structured association analysis revealed three SNPs in moderate LD to be significantly associated with muscat-flavored varieties. We identified a putative causal SNP responsible for a predicted non-neutral substitution and we discuss its possible implications for flavor metabolism. Network analysis revealed a major star-shaped cluster of reconstructed haplotypes unique to muscat-flavored varieties. Moreover, muscat-like aromatic mutants displayed unique non-synonymous mutations near the mutated site of Muscat genotypes. Conclusions This study is a crucial step forward in understanding the genetic regulation of muscat flavor in grapevine and it also sheds light on the domestication history of Muscats. VvDXS appears to be a possible human-selected locus in grapevine domestication and post-domestication. The putative causal SNP identified in Muscat varieties as well as the unique mutations identifying the muscat-like aromatic mutants under study may be immediately applied in marker-assisted breeding programs aimed at enhancing fragrance and aroma complexity respectively in table grape and wine cultivars.

  19. Salicylic acid alleviates decreases in photosynthesis under heat stress and accelerates recovery in grapevine leaves

    Directory of Open Access Journals (Sweden)

    Cheng Jian-Shan

    2010-02-01

    Full Text Available Abstract Background Although the effect of salicylic acid (SA on photosynthesis of plants including grapevines has been investigated, very little is yet known about the effects of SA on carbon assimilation and several components of PSII electron transport (donor side, reaction center and acceptor side. In this study, the impact of SA pretreatment on photosynthesis was evaluated in the leaves of young grapevines before heat stress (25°C, during heat stress (43°C for 5 h, and through the following recovery period (25°C. Photosynthetic measures included gas exchange parameters, PSII electron transport, energy dissipation, and Rubisco activation state. The levels of heat shock proteins (HSPs in the chloroplast were also investigated. Results SA did not significantly (P Pn of leaves before heat stress. But, SA did alleviate declines in Pn and Rubisco activition state, and did not alter negative changes in PSII parameters (donor side, acceptor side and reaction center QA under heat stress. Following heat treatment, the recovery of Pn in SA-treated leaves was accelerated compared with the control (H2O-treated leaves, and, donor and acceptor parameters of PSII in SA-treated leaves recovered to normal levels more rapidly than in the controls. Rubisco, however, was not significantly (P Conclusion SA pretreatment alleviated the heat stress induced decrease in Pn mainly through maintaining higher Rubisco activition state, and it accelerated the recovery of Pn mainly through effects on PSII function. These effects of SA may be related in part to enhanced levels of HSP21.

  20. Omics Approaches for Understanding Grapevine Berry Development: Regulatory Networks Associated with Endogenous Processes and Environmental Responses

    Directory of Open Access Journals (Sweden)

    Alejandra Serrano

    2017-09-01

    Full Text Available Grapevine fruit development is a dynamic process that can be divided into three stages: formation (I, lag (II, and ripening (III, in which physiological and biochemical changes occur, leading to cell differentiation and accumulation of different solutes. These stages can be positively or negatively affected by multiple environmental factors. During the last decade, efforts have been made to understand berry development from a global perspective. Special attention has been paid to transcriptional and metabolic networks associated with the control of grape berry development, and how external factors affect the ripening process. In this review, we focus on the integration of global approaches, including proteomics, metabolomics, and especially transcriptomics, to understand grape berry development. Several aspects will be considered, including seed development and the production of seedless fruits; veraison, at which anthocyanin accumulation begins in the berry skin of colored varieties; and hormonal regulation of berry development and signaling throughout ripening, focusing on the transcriptional regulation of hormone receptors, protein kinases, and genes related to secondary messenger sensing. Finally, berry responses to different environmental factors, including abiotic (temperature, water-related stress and UV-B radiation and biotic (fungi and viruses stresses, and how they can significantly modify both, development and composition of vine fruit, will be discussed. Until now, advances have been made due to the application of Omics tools at different molecular levels. However, the potential of these technologies should not be limited to the study of single-level questions; instead, data obtained by these platforms should be integrated to unravel the molecular aspects of grapevine development. Therefore, the current challenge is the generation of new tools that integrate large-scale data to assess new questions in this field, and to support

  1. VitiCanopy: A Free Computer App to Estimate Canopy Vigor and Porosity for Grapevine

    Directory of Open Access Journals (Sweden)

    Roberta De Bei

    2016-04-01

    Full Text Available Leaf area index (LAI and plant area index (PAI are common and important biophysical parameters used to estimate agronomical variables such as canopy growth, light interception and water requirements of plants and trees. LAI can be either measured directly using destructive methods or indirectly using dedicated and expensive instrumentation, both of which require a high level of know-how to operate equipment, handle data and interpret results. Recently, a novel smartphone and tablet PC application, VitiCanopy, has been developed by a group of researchers from the University of Adelaide and the University of Melbourne, to estimate grapevine canopy size (LAI and PAI, canopy porosity, canopy cover and clumping index. VitiCanopy uses the front in-built camera and GPS capabilities of smartphones and tablet PCs to automatically implement image analysis algorithms on upward-looking digital images of canopies and calculates relevant canopy architecture parameters. Results from the use of VitiCanopy on grapevines correlated well with traditional methods to measure/estimate LAI and PAI. Like other indirect methods, VitiCanopy does not distinguish between leaf and non-leaf material but it was demonstrated that the non-leaf material could be extracted from the results, if needed, to increase accuracy. VitiCanopy is an accurate, user-friendly and free alternative to current techniques used by scientists and viticultural practitioners to assess the dynamics of LAI, PAI and canopy architecture in vineyards, and has the potential to be adapted for use on other plants.

  2. European grapevine moth (Lobesia botrana Denis and Schiff. (Lepidoptera: Totricidae – occurence and management in Istrian vineyards

    Directory of Open Access Journals (Sweden)

    Renata Bažok

    2016-02-01

    Full Text Available The aim of this paper was to identify European grapevine moths (Lobesia botrana Denis and Schiff. flight dynamics, larvae occurrence and degree-day accumulations (DDA for each moth generation in two Istrian vineyards with different pest management practices. The moth has developed three generations. During the third generation there was a significant flight peak in the vineyard without pest management. Predictions about larvae number and possible damage must be based on both, visual monitoring of grapevine and weekly adults catch. Developmental time with lower thermal threshold of 7 °C was calculated. The flight of the first generation was between 217.9 and 406.6 °C, second generation between 786.3 and 1329.8 °C, third generation between 1452.8 and 2108.2 °C.

  3. Drought adaptation strategies of four grapevine cultivars (Vitis vinifera L.: modification of the properties of the leaf area

    Directory of Open Access Journals (Sweden)

    María Gómez-del-Campo

    2003-09-01

    Full Text Available This essay studies the morphological and anatomical properties of the leaves of Garnacha tinta, Tempranillo, Chardonnay and Airén grapevines in order to discover the drought adaptation strategies present in Vitis vinifera L. The grapevines were grown under two water availability conditions: water limitation and non-water limitation. There was a significantly lower development of leaf area under conditions of water limitation compared to non-water limitation due to a reduction in the size of main and lateral shoot leaves, and a smaller number of leaves on lateral shoots. The development of the leaf area under water limitation conditions occurred on earlier dates than under non-water limitation conditions. Significantly lower stomatal density was observed under water limitation conditions rather than non-water limitation conditions exclusively in the Airén cultivar.

  4. Stem Cell Basics

    Science.gov (United States)

    ... Tips Info Center Research Topics Federal Policy Glossary Stem Cell Information General Information Clinical Trials Funding Information Current ... Basics » Stem Cell Basics I. Back to top Stem Cell Basics I. Introduction: What are stem cells, and ...

  5. Stem Cells

    DEFF Research Database (Denmark)

    Sommerlund, Julie

    2004-01-01

    In his influential essay on markets, An essay on framing and overflowing (1998), Michel Callon writes that `the growing complexity of industrialized societies [is] due in large part to the movements of the technosciences, which are causing connections and interdependencies to proliferate'. This p...... and tantalizing than stem cells, in research, in medicine, or as products.......'. This paper is about tech-noscience, and about the proliferation of connections and interdependencies created by it.More specifically, the paper is about stem cells. Biotechnology in general has the power to capture the imagination. Within the field of biotechnology nothing seems more provocative...

  6. Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (vitis vinifera) fruit.

    Science.gov (United States)

    Rienth, Markus; Torregrosa, Laurent; Luchaire, Nathalie; Chatbanyong, Ratthaphon; Lecourieux, David; Kelly, Mary T; Romieu, Charles

    2014-04-28

    Global climate change will noticeably affect plant vegetative and reproductive development. The recent increase in temperatures has already impacted yields and composition of berries in many grapevine-growing regions. Physiological processes underlying temperature response and tolerance of the grapevine fruit have not been extensively investigated. To date, all studies investigating the molecular regulation of fleshly fruit response to abiotic stress were only conducted during the day, overlooking possible critical night-specific variations. The present study explores the night and day transcriptomic response of grapevine fruit to heat stress at several developmental stages. Short heat stresses (2 h) were applied at day and night to vines bearing clusters sequentially ordered according to the developmental stages along their vertical axes. The recently proposed microvine model (DRCF-Dwarf Rapid Cycling and Continuous Flowering) was grown in climatic chambers in order to circumvent common constraints and biases inevitable in field experiments with perennial macrovines. Post-véraison berry heterogeneity within clusters was avoided by constituting homogenous batches following organic acids and sugars measurements of individual berries. A whole genome transcriptomic approach was subsequently conducted using NimbleGen 090818 Vitis 12X (30 K) microarrays. Present work reveals significant differences in heat stress responsive pathways according to day or night treatment, in particular regarding genes associated with acidity and phenylpropanoid metabolism. Precise distinction of ripening stages led to stage-specific detection of malic acid and anthocyanin-related transcripts modulated by heat stress. Important changes in cell wall modification related processes as well as indications for heat-induced delay of ripening and sugar accumulation were observed at véraison, an effect that was reversed at later stages. This first day - night study on heat stress adaption of the

  7. Characterization of the Xylella fastidiosa PD1311 gene mutant and its suppression of Pierce's disease on grapevines.

    Science.gov (United States)

    Hao, Lingyun; Johnson, Kameka; Cursino, Luciana; Mowery, Patricia; Burr, Thomas J

    2017-06-01

    Xylella fastidiosa causes Pierce's disease (PD) on grapevines, leading to significant economic losses in grape and wine production. To further our understanding of X. fastidiosa virulence on grapevines, we examined the PD1311 gene, which encodes a putative acyl-coenzyme A (acyl-CoA) synthetase, and is highly conserved across Xylella species. It was determined that PD1311 is required for virulence, as the deletion mutant, ΔPD1311, was unable to cause disease on grapevines. The ΔPD1311 strain was impaired in behaviours known to be associated with PD development, including motility, aggregation and biofilm formation. ΔPD1311 also expressed enhanced sensitivity to H 2 O 2 and polymyxin B, and showed reduced survival in grapevine sap, when compared with wild-type X. fastidiosa Temecula 1 (TM1). Following inoculation, ΔPD1311 could not be detected in grape shoots, which may be related to its altered growth and sensitivity phenotypes. Inoculation with ΔPD1311 2 weeks prior to TM1 prevented the development of PD in a significant fraction of vines and eliminated detectable levels of TM1. In contrast, vines inoculated simultaneously with TM1 and ΔPD1311 developed disease at the same level as TM1 alone. In these vines, TM1 populations were distributed similarly to populations in TM1-only inoculated plants. These findings suggest that, through an indirect mechanism, pretreatment of vines with ΔPD1311 suppresses pathogen population and disease. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  8. Downy mildew resistance induced by Trichoderma harzianum T39 in susceptible grapevines partially mimics transcriptional changes of resistant genotypes

    Science.gov (United States)

    2012-01-01

    Background Downy mildew, caused by Plasmopara viticola, is one of the most severe diseases of grapevine and is commonly controlled by fungicide treatments. The beneficial microorganism Trichoderma harzianum T39 (T39) can induce resistance to downy mildew, although the molecular events associated with this process have not yet been elucidated in grapevine. A next generation RNA sequencing (RNA-Seq) approach was used to study global transcriptional changes associated with resistance induced by T39 in Vitis vinifera Pinot Noir leaves. The long-term aim was to develop strategies to optimize the use of this agent for downy mildew control. Results More than 14.8 million paired-end reads were obtained for each biological replicate of T39-treated and control leaf samples collected before and 24 h after P. viticola inoculation. RNA-Seq analysis resulted in the identification of 7,024 differentially expressed genes, highlighting the complex transcriptional reprogramming of grapevine leaves during resistance induction and in response to pathogen inoculation. Our data show that T39 has a dual effect: it directly modulates genes related to the microbial recognition machinery, and it enhances the expression of defence-related processes after pathogen inoculation. Whereas several genes were commonly affected by P. viticola in control and T39-treated plants, opposing modulation of genes related to responses to stress and protein metabolism was found. T39-induced resistance partially inhibited some disease-related processes and specifically activated defence responses after P. viticola inoculation, causing a significant reduction of downy mildew symptoms. Conclusions The global transcriptional analysis revealed that defence processes known to be implicated in the reaction of resistant genotypes to downy mildew were partially activated by T39-induced resistance in susceptible grapevines. Genes identified in this work are an important source of markers for selecting novel

  9. Efficacy of a copper-based bactericide in controlling bacterial blight of grapevines caused by Xylophilus ampelinus

    OpenAIRE

    Komatsu, Tsutomu; Kondo, Norio

    2015-01-01

    We investigated the efficacy of a microbial copper agent to protect against bacterial blight of grapevine caused by Xylophilus ampelinus from 2012 to 2014 in Hokkaido, Japan. A solution of the basic copper wettable powder sulfate was sprayed at 10-day intervals in two processing plots, using two application protocols: seven rounds of application immediately after leaf development and three or four applications at the initial onset of the disease. Due to the low disease incidence for the durat...

  10. Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

    OpenAIRE

    Grimplet, Jérôme; Tello, Javier; Laguna Ullán, Natalia; Ibáñez Marcos, Javier

    2017-01-01

    Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compa...

  11. Identification and utilization of a new Erysiphe necator isolate NAFU1 to quickly evaluate powdery mildew resistance in wild Chinese grapevine species using detached leaves.

    Science.gov (United States)

    Gao, Yu-Rong; Han, Yong-Tao; Zhao, Feng-Li; Li, Ya-Juan; Cheng, Yuan; Ding, Qin; Wang, Yue-Jin; Wen, Ying-Qiang

    2016-01-01

    The most economically important disease of cultivated grapevines worldwide is powdery mildew caused by the biotrophic fungal pathogen Erysiphe necator. To integrate effective genetic resistance into cultivated grapevines, numerous disease resistance screens of diverse Vitis germplasm, including wild species, have been conducted to identify powdery mildew resistance, but the results have been inconsistent. Here, a new powdery mildew isolate that is infectious on grapevines, designated Erysiphe necator NAFU1 (En. NAFU1), was identified and characterized by phylogeny inferred from the internal transcribed spacer (ITS) of pathogen ribosomal DNA sequences. Three classical methods were compared for the maintenance of En. NAFU1, and the most convenient method was maintenance on detached leaves and propagation by contact with infected leaves. Furthermore, controlled inoculations of En. NAFU1 were performed using detached leaves from 57 wild Chinese grapevine accessions to quickly evaluate powdery mildew resistance based on trypan blue staining of leaf sections. The results were compared with previous natural epidemics in the field. Among the screened accessions inoculated with En. NAFU1, 22.8% were resistant, 33.3% were moderately resistant, and 43.9% were susceptible. None of the accessions assessed herein were immune from infection. These results support previous findings documenting the presence of race-specific resistance to E. necator in wild Chinese grapevine. The resistance of wild Chinese grapevine to En. NAFU1 could be due to programmed cell death. The present results suggest that En. NAFU1 isolate could be used for future large-scale screens of resistance to powdery mildew in diverse Vitis germplasms and investigations of the interaction between grapevines and pathogens. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. Impact of an arbuscular mycorrhizal fungus versus a mixed microbial inoculum on the transcriptome reprogramming of grapevine roots.

    Science.gov (United States)

    Balestrini, Raffaella; Salvioli, Alessandra; Dal Molin, Alessandra; Novero, Mara; Gabelli, Giovanni; Paparelli, Eleonora; Marroni, Fabio; Bonfante, Paola

    2017-07-01

    Grapevine, cultivated for both fruit and beverage production, represents one of the most economically important fruit crops worldwide. With the aim of better understanding how grape roots respond to beneficial microbes, a transcriptome sequencing experiment has been performed to evaluate the impact of a single arbuscular mycorrhizal (AM) fungal species (Funneliformis mosseae) versus a mixed inoculum containing a bacterial and fungal consortium, including different AM species, on Richter 110 rootstock. Results showed that the impact of a single AM fungus and of a complex microbial inoculum on the grapevine transcriptome differed. After 3 months, roots exclusively were colonized after the F. mosseae treatment and several AM marker genes were found to be upregulated. The mixed inoculum led only to traces of colonization by AM fungi, but elicited an important transcriptional regulation. Additionally, the expression of genes belonging to categories such as nutrient transport, transcription factors, and cell wall-related genes was significantly altered in both treatments, but the exact genes affected differed in the two conditions. These findings advance our understanding about the impact of soil beneficial microbes on the root system of a woody plant, also offering the basis for novel approaches in grapevine cultivation.

  13. Plant Growth Promotion Potential Is Equally Represented in Diverse Grapevine Root-Associated Bacterial Communities from Different Biopedoclimatic Environments

    Directory of Open Access Journals (Sweden)

    Ramona Marasco

    2013-01-01

    Full Text Available Plant-associated bacteria provide important services to host plants. Environmental factors such as cultivar type and pedoclimatic conditions contribute to shape their diversity. However, whether these environmental factors may influence the plant growth promoting (PGP potential of the root-associated bacteria is not widely understood. To address this issue, the diversity and PGP potential of the bacterial assemblage associated with the grapevine root system of different cultivars in three Mediterranean environments along a macrotransect identifying an aridity gradient were assessed by culture-dependent and independent approaches. According to 16S rRNA gene PCR-DGGE, the structure of endosphere and rhizosphere bacterial communities was highly diverse (P=0.03 and was associated with a cultivar/latitudinal/climatic effect. Despite being diverse, the bacterial communities associated with Egyptian grapevines shared a higher similarity with the Tunisian grapevines than those cultivated in North Italy. A similar distribution, according to the cultivar/latitude/aridity gradients, was observed for the cultivable bacteria. Many isolates (23% presented in vitro multiple stress resistance capabilities and PGP activities, the most frequent being auxin synthesis (82%, insoluble phosphate solubilisation (61%, and ammonia production (70%. The comparable numbers and types of potential PGP traits among the three different environmental settings indicate a strong functional homeostasis of beneficial bacteria associated with grape root.

  14. Why STEM?

    Science.gov (United States)

    Mitts, Charles R.

    2016-01-01

    The International Technology and Engineering Educators Association (ITEEA) defines STEM as a new transdisciplinary subject in schools that integrates the disciplines of science, technology, engineering, and mathematics into a single course of study. There are three major problems with this definition: There is no consensus in support of the ITEEA…

  15. Hydraulics and gas exchange recover more rapidly from severe drought stress in small pot-grown grapevines than in field-grown plants.

    Science.gov (United States)

    Romero, Pascual; Botía, Pablo; Keller, Markus

    2017-09-01

    Modifications of plant hydraulics and shoot resistances (R shoot ) induced by water withholding followed by rewatering, and their relationships with plant water status, leaf gas exchange and water use efficiency at the leaf level, were investigated in pot-grown and field-grown, own-rooted Syrah grapevines in an arid climate. Water stress induced anisohydric behavior, gradually reducing stomatal conductance (g s ) and leaf photosynthesis (A) in response to decreasing midday stem water potential (Ψ s ). Water stress also rapidly increased intrinsic water-use efficiency (A/g s ); this effect persisted for many days after rewatering. Whole-plant (K plant ), canopy (K canopy ), shoot (K shoot ) and leaf (K leaf ) hydraulic conductances decreased during water stress, in tune with the gradual decrease in Ψ s , leaf gas exchange and whole plant water use. Water-stressed vines also had a lower Ψ gradient between stem and leaf (ΔΨ l ), which was correlated with lower leaf transpiration rate (E). E and ΔΨ l increased with increasing vapour pressure deficit (VPD) in non-stressed control vines but not in stressed vines. Perfusion of xylem-mobile dye showed that water flow to petioles and leaves was substantially reduced or even stopped under moderate and severe drought stress. Leaf blade hydraulic resistance accounted for most of the total shoot resistance. However, hydraulic conductance of the whole root system (K root ) was not significantly reduced until water stress became very severe in pot-grown vines. Significant correlations between K plant , K canopy and Ψ s , K canopy and leaf gas exchange, K leaf and Ψ s , and K leaf and A support a link between water supply, leaf water status and gas exchange. Upon re-watering, Ψ s recovered faster than gas exchange and leaf-shoot hydraulics. A gradual recovery of hydraulic functionality of plant organs was also observed, the leaves being the last to recover after rewatering. In pot-grown vines, K canopy recovered rather

  16. Method validation for determination of metals in Vitis labrusca L. grapevine leaf extracts by inductively coupled plasma mass spectrometry (ICP-MS

    Directory of Open Access Journals (Sweden)

    LIANE V.V. BOKOWSKI

    Full Text Available ABSTRACT Vitis labrusca L. is the main species used for wine and juice production in Brazil. The grapevine leaves can be used both as functional foods and as cheapest sources for the extraction of phenolic compounds. Besides the antioxidant activity, grapevine leaves exhibited significant anti-inflammatory activity. Therefore, the aim of this study was to develop and validate an analytical methodology to determine the metals selenium (96Se, chromium (53Cr, nickel (62Ni, cadmium (111Cd and lead (206Pb in 30 samples of grapevine leaf extracts (Vitis labrusca, Bordo cultivar using inductively coupled plasma mass spectrometry (ICP-MS. To obtain the grapevine leaf extracts the samples were milled, weighed and digested in microwave oven with nitric acid. The method showed linearity, precision, accuracy and limits of quantification and detection acceptable for INMETRO protocol validation of analytical methods. Therefore, the method using ICP-MS was developed and validated to determine metals concentrations in grapevine leaves of Vitis labrusca L. and the proposed method could be applied in routine analytical laboratory.

  17. Solar ultraviolet radiation is necessary to enhance grapevine fruit ripening transcriptional and phenolic responses.

    Science.gov (United States)

    Carbonell-Bejerano, Pablo; Diago, Maria-Paz; Martínez-Abaigar, Javier; Martínez-Zapater, José M; Tardáguila, Javier; Núñez-Olivera, Encarnación

    2014-07-09

    Ultraviolet (UV) radiation modulates secondary metabolism in the skin of Vitis vinifera L. berries, which affects the final composition of both grapes and wines. The expression of several phenylpropanoid biosynthesis-related genes is regulated by UV radiation in grape berries. However, the complete portion of transcriptome and ripening processes influenced by solar UV radiation in grapes remains unknown. Whole genome arrays were used to identify the berry skin transcriptome modulated by the UV radiation received naturally in a mid-altitude Tempranillo vineyard. UV radiation-blocking and transmitting filters were used to generate the experimental conditions. The expression of 121 genes was significantly altered by solar UV radiation. Functional enrichment analysis of altered transcripts mainly pointed out that secondary metabolism-related transcripts were induced by UV radiation including VvFLS1, VvGT5 and VvGT6 flavonol biosynthetic genes and monoterpenoid biosynthetic genes. Berry skin phenolic composition was also analysed to search for correlation with gene expression changes and UV-increased flavonols accumulation was the most evident impact. Among regulatory genes, novel UV radiation-responsive transcription factors including VvMYB24 and three bHLH, together with known grapevine UV-responsive genes such as VvMYBF1, were identified. A transcriptomic meta-analysis revealed that genes up-regulated by UV radiation in the berry skin were also enriched in homologs of Arabidopsis UVR8 UV-B photoreceptor-dependent UV-B -responsive genes. Indeed, a search of the grapevine reference genomic sequence identified UV-B signalling pathway homologs and among them, VvHY5-1, VvHY5-2 and VvRUP were up-regulated by UV radiation in the berry skin. Results suggest that the UV-B radiation-specific signalling pathway is activated in the skin of grapes grown at mid-altitudes. The biosynthesis and accumulation of secondary metabolites, which are appreciated in winemaking and

  18. Microscope image based fully automated stomata detection and pore measurement method for grapevines

    Directory of Open Access Journals (Sweden)

    Hiranya Jayakody

    2017-11-01

    Full Text Available Abstract Background Stomatal behavior in grapevines has been identified as a good indicator of the water stress level and overall health of the plant. Microscope images are often used to analyze stomatal behavior in plants. However, most of the current approaches involve manual measurement of stomatal features. The main aim of this research is to develop a fully automated stomata detection and pore measurement method for grapevines, taking microscope images as the input. The proposed approach, which employs machine learning and image processing techniques, can outperform available manual and semi-automatic methods used to identify and estimate stomatal morphological features. Results First, a cascade object detection learning algorithm is developed to correctly identify multiple stomata in a large microscopic image. Once the regions of interest which contain stomata are identified and extracted, a combination of image processing techniques are applied to estimate the pore dimensions of the stomata. The stomata detection approach was compared with an existing fully automated template matching technique and a semi-automatic maximum stable extremal regions approach, with the proposed method clearly surpassing the performance of the existing techniques with a precision of 91.68% and an F1-score of 0.85. Next, the morphological features of the detected stomata were measured. Contrary to existing approaches, the proposed image segmentation and skeletonization method allows us to estimate the pore dimensions even in cases where the stomatal pore boundary is only partially visible in the microscope image. A test conducted using 1267 images of stomata showed that the segmentation and skeletonization approach was able to correctly identify the stoma opening 86.27% of the time. Further comparisons made with manually traced stoma openings indicated that the proposed method is able to estimate stomata morphological features with accuracies of 89.03% for area

  19. Genetic and functional diversity of soil microbial communities associated to grapevine plants and wine quality

    Science.gov (United States)

    Mocali, Stefano; Fabiani, Arturo; Kuramae, Eiko; de Hollander, Mattias; Kowalchuk, George A.; Vignozzi, Nadia; Valboa, Giuseppe; Costantini, Edoardo

    2013-04-01

    Despite the economic importance of vineyards in Italy, the wine sector is facing severe challenges from increased global competition and climate changes. The quality of the grape at harvest has a strong direct impact on wine final quality and the strong relationship between wine composition, aroma, taste, and soil properties has been outlined in the "Terroir concept". However, information on the impact of soil microbial communities on soil functions, grapevine plants, and wine quality is generally lacking. In the current study, soils from two close sites in Central Tuscany (BRO11 and BRO12) cultivated with the same grapevine cultivar Sangiovese, but with contrasting wine quality, were examined. Although the BRO12 site provided a better wine quality than the BRO11, the two soils showed similar physical, chemical, and hydrological properties. Also soil humidity, as determined by FDR (Frequency Domain Reflectometry) sensors, indicated a similar water availability in the first 75 cm during a three years trial (2000-2010). Interestingly, the mean three years value of the ratio between the two stable carbon isotopes 13C/12C, measured in the alcohol of the wines, was significantly higher in BRO12 than in BRO11 (-28,3‰ and -24,4‰, respectively), indicating the presence of a relatively higher water stress in the BRO11 soil. Functional GeoChip microarray analyses revealed higher presence of Actinobacteria in the BRO12 than in the BRO11 soil, where the alfa-Proteobacteria were more abundant. Furthermore, a consistent difference in genes involved in S cycling, with a significant overrepresentation of sulphur-oxidation genes in BRO11 and increased levels of sulphate reduction genes BRO12 was detected. These results are consistent with the high content of sulphates and the abundance of Firmicutes such as Sulfobacillus thermosulfidooxidans in the BRO11 soil. Therefore, the different microbiology of the two soils could be related to the different redox conditions of the two

  20. Effects of grapevine root density and reinforcement on slopes prone to shallow slope instability

    Science.gov (United States)

    Meisina, Claudia; Bordoni, Massimiliano; Bischetti, Gianbattista; Vercesi, Alberto; Chiaradia, Enrico; Cislaghi, Alessio; Valentino, Roberto; Bittelli, Marco; Vergani, Chiara; Chersich, Silvia; Giuseppina Persichillo, Maria; Comolli, Roberto

    2016-04-01

    Slope erosion and shallow slope instabilities are the major factors of soil losses in cultivated steep terrains. These phenomena also cause loss of organic matter and plants nutrients, together with the partial or total destruction of the structures, such as the row tillage pattern of the vineyards, which allow for the plants cultivation. Vegetation has long been used as an effective tool to decrease the susceptibility of a slope to erosion and to shallow landslides. In particular, the scientific research focused on the role played by the plant roots, because the belowground biomass has the major control on the potential development of soil erosion and of shallow failures. Instead, a comprehensive study that analyzes the effects of the roots of agricultural plants on both soil erosion and slope instability has not been carried out yet. This aspect should be fundamental where sloped terrains are cultivated with plants of great economical relevance, as grapevine. To contribute to fill this gap, in this study the features of root density in the soil profile have been analyzed in slopes cultivated with vineyards, located on a sample hilly area of Oltrepò Pavese (northern Italy). In this area, the viticulture is the most important branch of the local economy. Moreover, several events of rainfall-induced slope erosion and shallow landslides have occurred in this area in the last 6 years, causing several economical damages linked to the destruction of the vineyards and the loss of high productivity soils. Grapevine root distribution have been measured in different test-site slopes, representative of the main geological, geomorphological, pedological, landslides distribution, agricultural features, in order to identify particular patterns on root density that can influence the development of slope instabilities. Roots have been sampled in each test-site for characterizing their strength, in terms of the relation between root diameter and root force at rupture. Root

  1. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  2. Abstracts of oral and poster presentations given at the 8th International Workshop on Grapevine Trunk Diseases, Valencia, Spain, 18–21 June 2012

    Directory of Open Access Journals (Sweden)

    AA. VV.

    2012-09-01

    Full Text Available The 8th International Workshop on Grapevine Trunk Diseases was held in Valencia, Spain, on June 18–21 2012. The meeting was attended by 120 participants and 103 papers were presented either as oral or poster presentations in four sessions: Pathogen Detection and Characterization, Epidemiology, Host-Pathogen Interaction and Disease Management. A special session was dedicated on implications of trunk diseases for grapevine nurseries with five invited presentations, followed by several oral and poster presentations. A field trip to the Utiel-Requena wine-producing area was undertaken on June the 20th, including visits to vineyards and a winery. The workshop is the 8th organised by members of the International Council on Grapevine Trunk Diseases (www.icgtd.org, a subject matter committee of the International Society for Plant Pathology (www.isppweb.org.

  3. Stem cell biobanks.

    Science.gov (United States)

    Bardelli, Silvana

    2010-04-01

    Stem cells contribute to innate healing and harbor a promising role for regenerative medicine. Stem cell banking through long-term storage of different stem cell platforms represents a fundamental source to preserve original features of stem cells for patient-specific clinical applications. Stem cell research and clinical translation constitute fundamental and indivisible modules catalyzed through biobanking activity, generating a return of investment.

  4. Bioavailability of potentially toxic elements in soil-grapevine (leaf, skin, pulp and seed) system and environmental and health risk assessment.

    Science.gov (United States)

    Milićević, Tijana; Urošević, Mira Aničić; Relić, Dubravka; Vuković, Gordana; Škrivanj, Sandra; Popović, Aleksandar

    2018-06-01

    Monitoring of potentially toxic elements in agricultural soil represents the first measure of caution regarding food safety, while research into element bioavailability should be a step forward in understanding the element transportation chain. This study was conducted in the grapevine growing area ("Oplenac Wine Route") for investigating element bioavailability in the soil-grapevine system accompanied by an assessment of the ecological implications and human health risk. Single extraction procedures (CH 3 COOH, Na 2 EDTA, CaCl 2 , NH 4 NO 3 and deionised H 2 O) and digestion were performed to estimate the bioavailability of 22 elements (Al, As, B, Ba, Be, Ca, Cd, Co, Cr, Cu, Fe, K, Li, Mg, Mn, Na, Ni, Pb, Sb, Sr, V and Zn) from the topsoil (0-30 cm) and subsoil (30-60 cm) to the grapevine parts (leaf, skin, pulp and seed) and wine. The extractants were effective comparing to the pseudo-total concentrations in following order Na 2 EDTA ˃ CH 3 COOH ˃ NH 4 NO 3  ˃ CaCl 2 , H 2 O 2 h and 16 h. The most suitable extractants for assessing the bioavailability of the elements from the soil to the grapevine parts were CaCl 2 , NH 4 NO 3 and Na 2 EDTA, but deionised H 2 O could be suitable, as well. The results showed that Ba was the most bioavailable element in the soil-grapevine system. Contamination factor implied a moderate contamination (1  1), the influence of atmospheric deposition on the aerial grapevine parts (leaves and grape skin) was observed. Nevertheless, low adverse health risk effects (HI wine consumers. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Effect of a grapevine shoot waste extract on red wine aromatic properties.

    Science.gov (United States)

    Ruiz-Moreno, María J; Raposo, Rafaela; Puertas, Belén; Cuevas, Francisco J; Chinnici, Fabio; Moreno-Rojas, José M; Cantos-Villar, Emma

    2018-04-26

    The use of a grapevine shoot extract (VIN) is being studied as an alternative to sulfur dioxide (SO 2 ). VIN stabilizes anthocyanins and preserves polyphenolic compounds, and thus improves chromatic wine properties. In the current work, selected aroma compounds (esters, C13-norisoprenoids, oxidation and vine shoot related compounds), sensory analysis and the olfactometric profile were determined in the wines treated with VIN at two concentrations. Treatment with VIN hardly modified the content of esters and oxidation-related compounds in the wines. However, the high β-damascenone and isoeugenol content, and the increase in astringency at tasting in VIN wines were noteworthy, as were some odorant zones. All above were established as VIN markers after the chemometric data analysis. These date revealed that only the lowest dose tested may be recommended as a suitable alternative to SO 2 . Although some aromatic properties of these wines may change, these changes are not considered to affect negatively to the quality of the wines. These results are useful for wineries, which face to uncover aroma-related processes in the challenge of producing SO 2 free wines without detriment of its sensory properties. This article is protected by copyright. All rights reserved.

  6. A multimodal image sensor system for identifying water stress in grapevines

    Science.gov (United States)

    Zhao, Yong; Zhang, Qin; Li, Minzan; Shao, Yongni; Zhou, Jianfeng; Sun, Hong

    2012-11-01

    Water stress is one of the most common limitations of fruit growth. Water is the most limiting resource for crop growth. In grapevines, as well as in other fruit crops, fruit quality benefits from a certain level of water deficit which facilitates to balance vegetative and reproductive growth and the flow of carbohydrates to reproductive structures. A multi-modal sensor system was designed to measure the reflectance signature of grape plant surfaces and identify different water stress levels in this paper. The multi-modal sensor system was equipped with one 3CCD camera (three channels in R, G, and IR). The multi-modal sensor can capture and analyze grape canopy from its reflectance features, and identify the different water stress levels. This research aims at solving the aforementioned problems. The core technology of this multi-modal sensor system could further be used as a decision support system that combines multi-modal sensory data to improve plant stress detection and identify the causes of stress. The images were taken by multi-modal sensor which could output images in spectral bands of near-infrared, green and red channel. Based on the analysis of the acquired images, color features based on color space and reflectance features based on image process method were calculated. The results showed that these parameters had the potential as water stress indicators. More experiments and analysis are needed to validate the conclusion.

  7. Uptake and transport of radioactive cesium and strontium into grapevines after leaf contamination

    Science.gov (United States)

    Zehnder, H. J.; Kopp, P.; Eikenberg, J.; Feller, U.; Oertli, J. J.

    1995-07-01

    From 1989 to 1993 the foliar uptake of radioactive strontium (Sr-85) and cesium (Cs-134) by selected leaves of grapevine plants and the subsequent redistribution within the plants was examined under controlled conditions in a greenhouse. The radionuclides were applied as chlorides. These plants were grown in large pots containing a mixture of local soil and peat. Plant and soil samples were analyzed throughout the growing season and also during the following vegetation period. Only traces of the applied radiostrontium were taken up by the leaves. This element was essentially not redistributed within the plants. In contrast, radiocesium was easily taken up through the leaf surface, transported to other plant parts and to some extent released from the roots into the soil. Cesium reaching the soil may interact with clay particles causing a very reduced availability for plants. Therefore the soil may act as a long-term sink for radiocesium. On the other hand, grape berries represent transient sinks. The cesium levels in the berries decreased again in a late phase of maturation, but the mechanisms causing this loss are not yet identified. During the second vegetation period, only a very minor proportion of the radiocesium taken up previously by the plants was present in the above ground parts.

  8. Gamma-ray mutagenesis on grapevine rootstocks cultivated in vitro (1

    Directory of Open Access Journals (Sweden)

    A. Lima da Silva

    1995-03-01

    Full Text Available The efficiency of γ-irradiation as a tool for breeding grapevine rootstocks was investigated. One-bud cuttings from vitroplants of two varieties (Fercal and Gravesac were subjected to gamma rays from Cs137 source at rates from 10 to 60 Grays (Gy at intervals of 10. All the parameters observed were affected at 20 Gy and upwards. Varietal susceptibility to irradiation was different since the maximum withstanding dose was 40 Gy for Gravesac and only 30 for Fercal. Besides, shoot development was more lowered than root development. The results showed that an increase of the irradiation dose decreased the rate of survival, the rhizogenesis and the growth of in vitro plants. On the V2 vegetative generation ofGravesac vitroplants changes in size, in leafform, in plant habits, in growth and chlorophyll deficient mutations were recorded. Moreover, after a 30 Gy irradiation variations of growth, dry weight, leaf area, number of stomata and photosynthesis rates were shown on the V3 generation. Accordingly this irradiation method is efficient to develop an in vitro variability. A sample of the surviving plants was established in the greenhouse for further screening. (1 Communication faite au 6'®me Symposium International sur l'Amélioration de la Vigne, à Yalta (Crimée, Ukraine, du 4 au 10 septembre 1994

  9. New approaches for the management of European grapevine moth (Lobesia botrana Den. & Schiff.

    Directory of Open Access Journals (Sweden)

    Altindisli Ferhunde Ozlem

    2014-01-01

    Full Text Available European Grapevine Moth (EGVM, Lobesia botrana (Den. & Schiff. (Lepidoptera: Tortricidae is the key pest of grape in Turkey. It damages grape berries directly and requires strict control measures producing 3 or 4 generations per year. Since the ‘80s, farmers often preferred chemical control with organophosphorus insecticides against the pest because it is wieldy, very effective and cheap. Tendency to use environmentally friendly pesticides began at the beginning of the nineties because chemicals sprayed next to grape harvest threaten environment and consumer health, causing residue problem in export. Consequently, a bioinsecticide, Bacillus thuringiensis Berl., was put into practice against the pest. Forecasting System timing according to the larvicides against EGVM was reviewed as a result of the registration of an ovicide at the end of nineties. Modifications have been made in standard biological efficacy test method and Forecasting System taking the biological stages of EGVM into account to get optimal results from ovicides. Mating disruption and auto-confusion techniques against EGVM were tested and put into practice for the first time in the Aegean Region to decrease insecticide applications. Since 2005, mating disruption has been gradually preferred by the growers and firms because it is very effective and easy to apply.

  10. Application of 2D and 3D image technologies to characterise morphological attributes of grapevine clusters.

    Science.gov (United States)

    Tello, Javier; Cubero, Sergio; Blasco, José; Tardaguila, Javier; Aleixos, Nuria; Ibáñez, Javier

    2016-10-01

    Grapevine cluster morphology influences the quality and commercial value of wine and table grapes. It is routinely evaluated by subjective and inaccurate methods that do not meet the requirements set by the food industry. Novel two-dimensional (2D) and three-dimensional (3D) machine vision technologies emerge as promising tools for its automatic and fast evaluation. The automatic evaluation of cluster length, width and elongation was successfully achieved by the analysis of 2D images, significant and strong correlations with the manual methods being found (r = 0.959, 0.861 and 0.852, respectively). The classification of clusters according to their shape can be achieved by evaluating their conicity in different sections of the cluster. The geometric reconstruction of the morphological volume of the cluster from 2D features worked better than the direct 3D laser scanning system, showing a high correlation (r = 0.956) with the manual approach (water displacement method). In addition, we constructed and validated a simple linear regression model for cluster compactness estimation. It showed a high predictive capacity for both the training and validation subsets of clusters (R(2)  = 84.5 and 71.1%, respectively). The methodologies proposed in this work provide continuous and accurate data for the fast and objective characterisation of cluster morphology. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  11. Effects of fudioxonil on Botrytis cinerea and on grapevine defence response

    Directory of Open Access Journals (Sweden)

    Anne-Noëlle PETIT

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 Botrytis bunch rot of grapes is mainly controlled by applying fungicides at three crop stages: the end of flowering (BBCH 68, bunch closure (BBCH 77 and the beginning of veraison (BBCH 81. The phenylpyrroles derivative fudioxonil is among the most effective fungicides registered to control Botrytis cinerea. Its effectiveness was investigated in relation to spray timing, fungicide resistance and defence responses of grapevine. Frequencies of B. cinerea strains which were resistant to fungicides were evaluated at harvest. The frequencies of resistant phenotypes were similar in all treatments except for a class of multidrug resistant strains (MDR 1 whose frequency increased after fudioxonil applications. None of the treatments tested induced defence responses in flowers/berries after fungicide application, suggesting that fudioxonil effectiveness was not related to a stimulation of plant defence processes. The standard program of three fungicide applications provided the best control of B. cinerea  in the Champagne region in comparison with a single treatment of fudioxonil at any of the crop stages tested.

  12. The impact of high temperatures on Vitis vinifera cv. Semillon grapevine performance and berry ripening

    Directory of Open Access Journals (Sweden)

    Dennis H Greer

    2013-12-01

    Full Text Available The heat event that occurred in many parts of Australia in 2009 was the worst on record for the past decade, with air temperatures exceeding 40oC for 14 days. Our aim was to assess the impacts of this heat event on vine performance, including ripening, yield and gas exchange of Vitis vinifera cv. Semillon grown in a Riverina vineyard. To assess the affect of high temperatures on Semillon grapevines, the vines were covered with a protective layer to reduce radiant heating and were compared with vines exposed to ambient conditions. The heat event had major effects on ripening; reducing the rate by 50% and delaying harvest ripeness and causing a high incidence of berry shrivel and sunburn. Yield was not affected. Photosynthesis was reduced 35% by the heat event while transpiration increased nearly 3-fold and was accounted for by increased stomatal conductance. The conclusion of this study was that heat events delayed ripening in Semillon berries and caused a significant reduction in berry quality. Strategies to minimise the radiant load during heat events are required and this study has confirmed a protective layer can reduce canopy temperatures and enhance berry quality.

  13. GLOBAL SOLAR RADIATION INTERCEPTION BY GRAPEVINES TRAINED TO A VERTICAL TRELLIS SYSTEM

    Directory of Open Access Journals (Sweden)

    CLAUDIA GUIMARÃES CAMARGO CAMPOS

    2016-01-01

    Full Text Available ABSTRACT In this paper we assess the utilization of radiant energy in the growing of grapevines (Cabernet Sauvignon trained to a vertical trellis system, and estimate the global solar radiation interception taking into account the physical characteristics of the training system at different phenological stages. The experiment was based on daily measurements of global solar radiation made by an automatic weather station placed at the vineyard of a winery located in the municipality of São Joaquim, in the southern Brazilian State of Santa Catarina (Villa Francioni winery, 28º 15’ 14” S, 49º 57’ 02” W, 1294m a.s.l.. Growth and phenological development of the shoots were evaluated. The global solar radiation is intercepted by the canopy (trained to a vertical trellis system in different orientations and the accumulated total is slightly greater on the east than on the west face of the canopy, especially after flowering. The daily variability of global solar radiation intercepted by the canopy is greater after flowering. The accumulated solar energy incident on the canopy increases until the onset of ripening. From the results, vineyards trained to a vertical trellis system in the north-south direction provide favorable sunlight exposure to leaves and fruits and are promising in quality and productivity.

  14. Statistical analysis of grapevine mortality associated with esca or Eutypa dieback foliar expression

    Directory of Open Access Journals (Sweden)

    Lucia GUERIN-DUBRANA

    2013-09-01

    Full Text Available Esca and Eutypa dieback are two major wood diseases of grapevine in France. Their widespread distribution in vineyards leads to vine decline and to a loss in productivity. However, little is known either about the temporal dynamics of these diseases at plant level, and equally, the relationships between foliar expression of the diseases and vine death is relatively unknown too.  To investigate this last question, the vines of six vineyards cv. Cabernet Sauvignon in the Bordeaux region were surveyed, by recording foliar symptoms, dead arms and dead plants from 2004 to 2010. In 2008, 2009 and 2010, approximately five percent of the asymptomatic vines died but the percentage of dead vines which had previously expressed esca foliar symptoms was higher, and varied between vineyards. A logistic regression model was used to determine the previous years of symptomatic expression associated with vine mortality. The mortality of esca is always associated with the foliar symptom expression of the year preceding vine death. One or two other earlier years of expression frequently represented additional risk factors. The Eutypa dieback symptom was also a risk factor of death, superior or equal to that of esca. The study of the internal necroses of vines expressing esca or Eutypa dieback is discussed in the light of these statistical results.

  15. Reinforcement of the radiative and thermic stresses of the grapevine. Repercussions on yeast surface microflora

    International Nuclear Information System (INIS)

    Salmon, J.M.; Mailhac, N.; Sauvage, F.X.; Biron, M.J.; Robin, J.P.

    1997-01-01

    All along the ripening period, the radiative and thermic stresses of the grapevine may be reinforced by the use of a reflective soil cover (aluminized film). Such a treatment leads to repercussions on the berries, on the must composition and finally on the wine quality. During such a preliminary experiment, we demonstrated that the temperature increase and/or the reinforcement of the reflected ultraviolet radiations (measured at 254 nm) at the level of grape berries severely impaired the development of yeast cells at their surfaces. By means of an artificial inoculation of grapes at the beginning of the ripening period with a mixture of four different yeast genera (Saccharomyces cerevisiae, Hanseniaspora uvarum, Pichia fermentans and Schizosaccharomyces pombe), we demonstrated that the repartition of yeast genera amongst this population was affected by the treatment of stocks with the aluminized film: during the experiment presented in this paper, the Saccharomyces genus was favoured. One may consider by extension similar effects resulting from the reflective properties of some natural soils. Such effects may considerably influence the distribution of wild yeast flora during the spontaneous fermentation of musts. If such an hypothesis is confirmed at a local or regional level, it will represent a first significant piece of the definition of one of the aspects of the ''terroir'' effect on the characteristics of wines [fr

  16. Estimation of the base temperature and growth phase duration in terms of thermal time for four grapevine cultivars

    Science.gov (United States)

    Zapata, D.; Salazar, M.; Chaves, B.; Keller, M.; Hoogenboom, G.

    2015-12-01

    Thermal time models have been used to predict the development of many different species, including grapevine ( Vitis vinifera L.). These models normally assume that there is a linear relationship between temperature and plant development. The goal of this study was to estimate the base temperature and duration in terms of thermal time for predicting veraison for four grapevine cultivars. Historical phenological data for four cultivars that were collected in the Pacific Northwest were used to develop the thermal time model. Base temperatures ( T b) of 0 and 10 °C and the best estimated T b using three different methods were evaluated for predicting veraison in grapevine. Thermal time requirements for each individual cultivar were evaluated through analysis of variance, and means were compared using the Fisher's test. The methods that were applied to estimate T b for the development of wine grapes included the least standard deviation in heat units, the regression coefficient, and the development rate method. The estimated T b varied among methods and cultivars. The development rate method provided the lowest T b values for all cultivars. For the three methods, Chardonnay had the lowest T b ranging from 8.7 to 10.7 °C, while the highest T b values were obtained for Riesling and Cabernet Sauvignon with 11.8 and 12.8 °C, respectively. Thermal time also differed among cultivars, when either the fixed or estimated T b was used. Predictions of the beginning of ripening with the estimated temperature resulted in the lowest variation in real days when compared with predictions using T b = 0 or 10 °C, regardless of the method that was used to estimate the T b.

  17. Grapevine fatty acid hydroperoxide lyase generates actin-disrupting volatiles and promotes defence-related cell death

    Science.gov (United States)

    Wang, Hao; Claudel, Patricia; Riemann, Michael; Hause, Bettina; Hugueney, Philippe; Nick, Peter

    2018-01-01

    Abstract Fatty acid hydroperoxides can generate short-chained volatile aldehydes that may participate in plant defence. A grapevine hydroperoxide lyase (VvHPL1) clustering to the CYP74B class was functionally characterized with respect to a role in defence. In grapevine leaves, transcripts of this gene accumulated rapidly to high abundance in response to wounding. Cellular functions of VvHPL1 were investigated upon heterologous expression in tobacco BY-2 cells. A C-terminal green fluorescent protein (GFP) fusion of VvHPL1 was located in plastids. The overexpression lines were found to respond to salinity stress or the bacterial elicitor harpin by increasing cell death. This signal-dependent mortality response was mitigated either by addition of exogenous jasmonic acid or by treatment with diphenyleneiodonium (DPI), an inhibitor of NADPH oxidases. By feeding different substrates to recombinantly expressed enzyme, VvHPL1 could also be functionally classified as true 13-HPL. The cognate products generated by this 13-HPL were cis-3-hexenal and trans-2-hexenal. Using a GFP-tagged actin marker line, one of these isomeric products, cis-3-hexenal, was found specifically to elicit a rapid disintegration of actin filaments. This response was not only observed in the heterologous system (tobacco BY-2), but also in a grapevine cell strain expressing this marker, as well as in leaf discs from an actin marker grape used as a homologous system. These results are discussed in the context of a role for VvHPL1 in a lipoxygenase-dependent signalling pathway triggering cell death-related defence that bifurcates from jasmonate-dependent basal immunity. PMID:29659985

  18. An abundant 'Candidatus Phytoplasma solani' tuf b strain is associated with grapevine, stinging nettle and Hyalesthes obsoletus.

    Science.gov (United States)

    Aryan, A; Brader, G; Mörtel, J; Pastar, M; Riedle-Bauer, M

    2014-10-01

    Bois noir (BN) associated with ' Candidatus Phytoplasma solani' (Stolbur) is regularly found in Austrian vine growing regions. Investigations between 2003 and 2008 indicated sporadic presence of the confirmed disease vector Hyalesthes obsoletus and frequent infections of bindweed and grapevine. Infections of nettles were rare. In contrast present investigations revealed a mass occurrence of H. obsoletus almost exclusively on stinging nettle. The high population densities of H. obsoletus on Urtica dioica were accompanied by frequent occurrence of ' Ca. P. solani' in nettles and planthoppers. Sequence analysis of the molecular markers secY, stamp, tuf and vmp1 of stolbur revealed a single genotype named CPsM4_At1 in stinging nettles and more than 64 and 90 % abundance in grapevine and H. obsoletus , respectively. Interestingly, this genotype showed tuf b type restriction pattern previously attributed to bindweed associated ' Ca. P. solani' strains, but a different sequence assigned as tuf b2 compared to reference tuf b strains. All other marker genes of CPsM4_At1 clustered with tuf a and nettle derived genotypes verifying distinct nettle phytoplasma genotypes. Transmission experiments with H. obsoletus and Anaceratagallia ribauti resulted in successful transmission of five different strains including the major genotype to Catharanthus roseus and in transmission of the major genotype to U. dioica . Altogether, five nettle and nine bindweed associated genotypes were described. Bindweed types were verified in 34 % of grapevine samples, in few positive Reptalus panzeri , rarely in bindweeds and occasionally in Catharanthus roseus infected by H. obsoletus or A. ribauti . ' Candidatus Phytoplasma convolvuli' (bindweed yellows) was ascertained in nettle and bindweed samples.

  19. Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size

    Directory of Open Access Journals (Sweden)

    Jérôme Grimplet

    2017-04-01

    Full Text Available Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc., fruitfulness (number of berries, number of seeds and berry size (length, width contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair. Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

  20. ABA Represses the Expression of Cell Cycle Genes and May Modulate the Development of Endodormancy in Grapevine Buds

    Directory of Open Access Journals (Sweden)

    Ricardo Vergara

    2017-05-01

    Full Text Available Recently, the plant hormone abscisic acid (ABA has been implicated as a key player in the regulation of endodormancy (ED in grapevine buds (Vitis vinifera L. In this study, we show that in the vine, the expression of genes related to the biosynthesis of ABA (VvNCED1; VvNCED2 and the content of ABA are significantly higher in the latent bud than at the shoot apex, while the expression of an ABA catabolic gene (VvA8H3 showed no significant difference between either organ. A negative correlation between the content of ABA and transcript levels of cell cycle genes (CCG was found in both tissues. This result suggested that ABA may negatively regulate the expression of CCG in meristematic tissues of grapevines. To test this proposition, the effect of ABA on the expression of CCG was analyzed in two meristematic tissues of the vine: somatic embryos and shoot apexes. The results indicated that cell cycle progression is repressed by ABA in both organs, since it down-regulated the expression of genes encoding cyclin-dependent kinases (VvCDKB1, VvCDKB2 and genes encoding cyclins of type A (VvCYCA1, VvCYCA2, VvCYCA3, B (VvCYCB, and D (VvCYCD3.2a and up-regulated the expression of VvICK5, a gene encoding an inhibitor of CDKs. During ED, the content of ABA increased, and the expression of CCG decreased. Moreover, the dormancy-breaking compound hydrogen cyanamide (HC reduced the content of ABA and up-regulated the expression of CCG, this last effect was abolished when HC and ABA were co-applied. Taken together, these results suggest that ABA-mediated repression of CCG transcription may be part of the mechanism through which ABA modulates the development of ED in grapevine buds.

  1. Differences in Flower Transcriptome between Grapevine Clones Are Related to Their Cluster Compactness, Fruitfulness, and Berry Size.

    Science.gov (United States)

    Grimplet, Jérôme; Tello, Javier; Laguna, Natalia; Ibáñez, Javier

    2017-01-01

    Grapevine cluster compactness has a clear impact on fruit quality and health status, as clusters with greater compactness are more susceptible to pests and diseases and ripen more asynchronously. Different parameters related to inflorescence and cluster architecture (length, width, branching, etc.), fruitfulness (number of berries, number of seeds) and berry size (length, width) contribute to the final level of compactness. From a collection of 501 clones of cultivar Garnacha Tinta, two compact and two loose clones with stable differences for cluster compactness-related traits were selected and phenotyped. Key organs and developmental stages were selected for sampling and transcriptomic analyses. Comparison of global gene expression patterns in flowers at the end of bloom allowed identification of potential gene networks with a role in determining the final berry number, berry size and ultimately cluster compactness. A large portion of the differentially expressed genes were found in networks related to cell division (carbohydrates uptake, cell wall metabolism, cell cycle, nucleic acids metabolism, cell division, DNA repair). Their greater expression level in flowers of compact clones indicated that the number of berries and the berry size at ripening appear related to the rate of cell replication in flowers during the early growth stages after pollination. In addition, fluctuations in auxin and gibberellin signaling and transport related gene expression support that they play a central role in fruit set and impact berry number and size. Other hormones, such as ethylene and jasmonate may differentially regulate indirect effects, such as defense mechanisms activation or polyphenols production. This is the first transcriptomic based analysis focused on the discovery of the underlying gene networks involved in grapevine traits of grapevine cluster compactness, berry number and berry size.

  2. Genome-wide prediction methods in highly diverse and heterozygous species: proof-of-concept through simulation in grapevine.

    Directory of Open Access Journals (Sweden)

    Agota Fodor

    Full Text Available Nowadays, genome-wide association studies (GWAS and genomic selection (GS methods which use genome-wide marker data for phenotype prediction are of much potential interest in plant breeding. However, to our knowledge, no studies have been performed yet on the predictive ability of these methods for structured traits when using training populations with high levels of genetic diversity. Such an example of a highly heterozygous, perennial species is grapevine. The present study compares the accuracy of models based on GWAS or GS alone, or in combination, for predicting simple or complex traits, linked or not with population structure. In order to explore the relevance of these methods in this context, we performed simulations using approx 90,000 SNPs on a population of 3,000 individuals structured into three groups and corresponding to published diversity grapevine data. To estimate the parameters of the prediction models, we defined four training populations of 1,000 individuals, corresponding to these three groups and a core collection. Finally, to estimate the accuracy of the models, we also simulated four breeding populations of 200 individuals. Although prediction accuracy was low when breeding populations were too distant from the training populations, high accuracy levels were obtained using the sole core-collection as training population. The highest prediction accuracy was obtained (up to 0.9 using the combined GWAS-GS model. We thus recommend using the combined prediction model and a core-collection as training population for grapevine breeding or for other important economic crops with the same characteristics.

  3. Relative Prevalence of Grapevine Leafroll-Associated Virus Species in Wine Grape-Growing Regions of California.

    Directory of Open Access Journals (Sweden)

    Abhineet M Sharma

    Full Text Available Some diseases manifest as one characteristic set of symptoms to the host, but can be caused by multiple pathogens. Control treatments based on plant symptoms can make it difficult to effectively manage such diseases, as the biology of the underlying pathogens can vary. Grapevine leafroll disease affects grapes worldwide, and is associated with several viral species in the family Closteroviridae. Whereas some of the viruses associated with this disease are transmitted by insect vectors, others are only graft-transmissible. In three regions of California, we surveyed vineyards containing diseased vines and screened symptomatic plants for all known viral species associated with grapevine leafroll disease. Relative incidence of each virus species differed among the three regions regions, particularly in relation to species with known vectors compared with those only known to be graft-transmitted. In one region, the pathogen population was dominated by species not known to have an insect vector. In contrast, populations in the other surveyed regions were dominated by virus species that are vector-transmissible. Our survey did not detect viruses associated with grapevine leafroll disease at some sites with characteristic disease symptoms. This could be explained either by undescribed genetic diversity among these viruses that prevented detection with available molecular tools at the time the survey was performed, or a misidentification of visual symptoms that may have had other underlying causes. Based on the differences in relative prevalence of each virus species among regions and among vineyards within regions, we expect that region and site-specific management strategies are needed for effective disease control.

  4. Support Vector Machine and Artificial Neural Network Models for the Classification of Grapevine Varieties Using a Portable NIR Spectrophotometer.

    Science.gov (United States)

    Gutiérrez, Salvador; Tardaguila, Javier; Fernández-Novales, Juan; Diago, María P

    2015-01-01

    The identification of different grapevine varieties, currently attended using visual ampelometry, DNA analysis and very recently, by hyperspectral analysis under laboratory conditions, is an issue of great importance in the wine industry. This work presents support vector machine and artificial neural network's modelling for grapevine varietal classification from in-field leaf spectroscopy. Modelling was attempted at two scales: site-specific and a global scale. Spectral measurements were obtained on the near-infrared (NIR) spectral range between 1600 to 2400 nm under field conditions in a non-destructive way using a portable spectrophotometer. For the site specific approach, spectra were collected from the adaxial side of 400 individual leaves of 20 grapevine (Vitis vinifera L.) varieties one week after veraison. For the global model, two additional sets of spectra were collected one week before harvest from two different vineyards in another vintage, each one consisting on 48 measurement from individual leaves of six varieties. Several combinations of spectra scatter correction and smoothing filtering were studied. For the training of the models, support vector machines and artificial neural networks were employed using the pre-processed spectra as input and the varieties as the classes of the models. The results from the pre-processing study showed that there was no influence whether using scatter correction or not. Also, a second-degree derivative with a window size of 5 Savitzky-Golay filtering yielded the highest outcomes. For the site-specific model, with 20 classes, the best results from the classifiers thrown an overall score of 87.25% of correctly classified samples. These results were compared under the same conditions with a model trained using partial least squares discriminant analysis, which showed a worse performance in every case. For the global model, a 6-class dataset involving samples from three different vineyards, two years and leaves

  5. Radiosensitivity of grapevines. Empirical modelling of the radiosensitivity of some clones to x-ray irradiation. Pt. 1

    International Nuclear Information System (INIS)

    Koeroesi, F.; Jezierska-Szabo, E.

    1999-01-01

    Empirical and formal (Poisson) models were utilized, applying experimental growth data to characterize the radiosensitivity of six grapevine clones to X-ray irradiation. According to the radiosensitivity constants (k), target numbers (n) and volumes, GR 37 doses and energy deposition, the following radiosensitivity order has been found for various vine brands: Chardonnay clone type < Harslevelue K. 9 < Koevidinka K. 8 < Muscat Ottonel clone type < Irsai Oliver K. 11 < Cabernet Sauvignon E. 153. The model can be expanded to describe the radiosensitivity of other plant species and varieties, and also the efficiency of various radioprotecting agents and conditions. (author)

  6. Modulation of flavonoid biosynthetic pathway genes and anthocyanins due to virus infection in grapevine (Vitis vinifera L. leaves

    Directory of Open Access Journals (Sweden)

    Gutha Linga R

    2010-08-01

    Full Text Available Abstract Background Symptoms of grapevine leafroll disease (GLRD in red-fruited wine grape (Vitis vinifera L. cultivars consist of green veins and red and reddish-purple discoloration of inter-veinal areas of leaves. The reddish-purple color of symptomatic leaves may be due to the accumulation of anthocyanins and could reflect an up-regulation of genes involved in their biosynthesis. Results We examined six putative constitutively expressed genes, Ubiquitin, Actin, GAPDH, EF1-a, SAND and NAD5, for their potential as references for normalization of gene expression in reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR. Using the geNorm program, a combination of two genes (Actin and NAD5 was identified as the stable set of reference genes for normalization of gene expression data obtained from grapevine leaves. By using gene-specific RT-qPCR in combination with a reliable normalization factor, we compared relative expression of the flavonoid biosynthetic pathway genes between leaves infected with Grapevine leafroll-associated virus 3 (GLRaV-3 and exhibiting GLRD symptoms and virus-free green leaves obtained from a red-fruited wine grape cultivar (cv. Merlot. The expression levels of these different genes ranged from two- to fifty-fold increase in virus-infected leaves. Among them, CHS3, F3'5'H, F3H1, LDOX, LAR1 and MybA1 showed greater than 10-fold increase suggesting that they were expressed at significantly higher levels in virus-infected symptomatic leaves. HPLC profiling of anthocyanins extracted from leaves indicated the presence of cyanidin-3-glucoside and malvidin-3-glucoside only in virus-infected symptomatic leaves. The results also showed 24% higher levels of flavonols in virus-infected symptomatic leaves than in virus-free green leaves, with quercetin followed by myricetin being the predominant compounds. Proanthocyanidins, estimated as total tannins by protein precipitation method, were 36% higher in virus

  7. Support Vector Machine and Artificial Neural Network Models for the Classification of Grapevine Varieties Using a Portable NIR Spectrophotometer.

    Directory of Open Access Journals (Sweden)

    Salvador Gutiérrez

    Full Text Available The identification of different grapevine varieties, currently attended using visual ampelometry, DNA analysis and very recently, by hyperspectral analysis under laboratory conditions, is an issue of great importance in the wine industry. This work presents support vector machine and artificial neural network's modelling for grapevine varietal classification from in-field leaf spectroscopy. Modelling was attempted at two scales: site-specific and a global scale. Spectral measurements were obtained on the near-infrared (NIR spectral range between 1600 to 2400 nm under field conditions in a non-destructive way using a portable spectrophotometer. For the site specific approach, spectra were collected from the adaxial side of 400 individual leaves of 20 grapevine (Vitis vinifera L. varieties one week after veraison. For the global model, two additional sets of spectra were collected one week before harvest from two different vineyards in another vintage, each one consisting on 48 measurement from individual leaves of six varieties. Several combinations of spectra scatter correction and smoothing filtering were studied. For the training of the models, support vector machines and artificial neural networks were employed using the pre-processed spectra as input and the varieties as the classes of the models. The results from the pre-processing study showed that there was no influence whether using scatter correction or not. Also, a second-degree derivative with a window size of 5 Savitzky-Golay filtering yielded the highest outcomes. For the site-specific model, with 20 classes, the best results from the classifiers thrown an overall score of 87.25% of correctly classified samples. These results were compared under the same conditions with a model trained using partial least squares discriminant analysis, which showed a worse performance in every case. For the global model, a 6-class dataset involving samples from three different vineyards, two years

  8. A transient expression assay for the in planta efficacy screening of an antimicrobial peptide against grapevine bacterial pathogens.

    Science.gov (United States)

    Visser, M; Stephan, D; Jaynes, J M; Burger, J T

    2012-06-01

    Natural and synthetic antimicrobial peptides (AMPs) are of increasing interest as potential resistance conferring elements in plants against pathogen infection. The efficacy of AMPs against pathogens is prescreened by in vitro assays, and promising AMP candidates are introduced as transgenes into plants. As in vitro and in planta environments differ, a prescreening procedure of the AMP efficacy in the plant environment is desired. Here, we report the efficacy of the purified synthetic peptide D4E1 against the grapevine-infecting bacterial pathogens Agrobacterium vitis and Xylophilus ampelinus in vitro and describe for the first time an in planta prescreening procedure based on transiently expressed D4E1. The antimicrobial effect of D4E1 against Ag. vitis and X. ampelinus was shown by a reduction in colony-forming units in vitro in a traditional plate-based assay and by a reduction in bacterial titres in planta as measured by quantitative real-time PCR (qPCR) in grapevine leaves transiently expressing D4E1. A statistically significant reduction in titre was shown for X. ampelinus, but for Ag. vitis, a significant reduction in titre was only observed in a subset of plants. The titres of both grapevine-infecting bacterial pathogens were reduced in an in vitro assay and for X. ampelinus in an in planta assay by D4E1 application. This widens the applicability of D4E1 as a potential resistance-enhancing element to additional pathogens and in a novel plant species. D4E1 is a promising candidate to confer enhanced resistance against the two tested grapevine bacterial pathogens, and the applied transient expression system proved to be a valuable tool for prescreening of D4E1 efficacy in an in planta environment. The described prescreening procedure can be used for other AMPs and might be adapted to other plant species and pathogens before the expensive and tedious development of stably transgenic lines is started. © 2012 The Authors. Letters in Applied Microbiology © 2012

  9. Performance of a New Model for Predicting End of Flowering Date (bbch 69) of Grapevine (Vitis Vinifera L.)

    Science.gov (United States)

    Gentilucci, Matteo

    2017-04-01

    The end of flowering date (BBCH 69) is an important phenological stage for grapevine (Vitis Vinifera L.), in fact up to this date the growth is focused on the plant and gradually passes on the berries through fruit set. The aim of this study is to perform a model to predict the date of the end of flowering (BBCH69) for some grapevine varieties. This research carried out using three cultivars of grapevine (Maceratino, Montepulciano, Sangiovese) in three different locations (Macerata, Morrovalle and Potenza Picena), places of an equal number of wine farms for the time interval between 2006 and 2013. In order to have reliable temperatures for each location, the data of 6 weather stations near these farms have been interpolated using cokriging methods with elevation as independent variable. The procedure to predict the end of flowering date starts with an investigation of cardinal temperatures typical of each grapevine cultivar. In fact the analysis is characterized by four temperature thresholds (cardinals): minimum activity temperature (TCmin = below this temperature there is no growth for the plant), lower optimal temperature (TLopt = above this temperature there is maximum growth), upper optimal temperature (TUopt = below this temperature there is maximum growth) and maximum activity temperature (TC max = above this temperature there is no growth). Thus this model take into consideration maximum, mean and minimum daily temperatures of each location, relating them with the four above mentioned cultivar temperature thresholds. In this way it has been obtained some possible cases (32) corresponding to as many equations, depending on the position of temperatures compared with the thresholds, in order to calculate the amount of growing degree units (GDU) for each day. Several iterative tests (about 1000 for each cultivar) have been performed, changing the values of temperature thresholds and GDU in order to find the best possible combination which minimizes error

  10. The sequencing of the complete genome of a Tomato black ring virus (TBRV) and of the RNA2 of three Grapevine chrome mosaic virus (GCMV) isolates from grapevine reveals the possible recombinant origin of GCMV.

    Science.gov (United States)

    Digiaro, M; Yahyaoui, E; Martelli, G P; Elbeaino, T

    2015-02-01

    The complete genome of a Tomato black ring virus isolate (TBRV-Mirs) (RNA1, 7,366 nt and RNA2, 4,640 nt) and the RNA2 sequences (4,437; 4,445; and 4,442 nts) of three Grapevine chrome mosaic virus isolates (GCMV-H6, -H15, and -H27) were determined. All RNAs contained a single open reading frame encoding polyproteins of 254 kDa (p1) and 149 kDa (p2) for TBRV-Mirs RNA1 and RNA2, respectively, and 146 kDa for GCMV RNA2. p1 of TBRV-Mirs showed the highest identity with TBRV-MJ (94 %), Beet ringspot virus (BRSV, 82 %), and Grapevine Anatolian ringspot virus (GARSV, 66 %), while p2 showed the highest identity with TBRV isolates MJ (89 %) and ED (85 %), followed by BRSV (65 %), GCMV (58 %), and GARSV (57 %). The amino acid identity of RNA2 sequences of four GCMV isolates (three from this study and one from GenBank) ranged from 91 to 98 %, the homing protein being the most variable. The RDP3 program predicted putative intra-species recombination events for GCMV-H6 and recognized GCMV as a putative inter-species recombinant between GARSV and TBRV. In both cases, the recombination events were at the movement protein level.

  11. HEAVY METALS AND MICRONUTRIENTS IN THE SOIL AND GRAPEVINE UNDER DIFFERENT IRRIGATION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Vanessa de Souza Oliveira

    2015-02-01

    Full Text Available Soils under natural conditions have heavy metals in variable concentrations and there may be an increase in these elements as a result of the agricultural practices adopted. Transport of heavy metals in soil mainly occurs in forms dissolved in the soil solution or associated with solid particles, water being their main means of transport. In this context, the aim of this study was to evaluate the heavy metal and micronutrient content in the soil and in the grapevine plant and fruit under different irrigation strategies. The experiment was carried out in Petrolina, PE, Brazil. The treatments consisted of three irrigation strategies: full irrigation (FI, regulated deficit irrigation (RDI, and deficit irrigation (DI. During the period of grape maturation, soil samples were collected at the depths of 0-10, 10-20, 20-40, 40-60, and 60-80 cm. In addition, leaves were collected at the time of ripening of the bunches, and berries were collected at harvest. Thus, the heavy metal and micronutrient contents were determined in the soil, leaves, and berries. The heavy metal and micronutrient contents in the soil showed a stochastic pattern in relation to the different irrigation strategies. The different irrigation strategies did not affect the heavy metal and micronutrient contents in the vine leaves, and they were below the contents considered toxic to the plant. In contrast, the greater availability of water in the FI treatment favored a greater Cu content in the grape, which may be a risk to vines, causing instability and turbidity. Thus, adoption of deficit irrigation is recommended so as to avoid compromising the stability of tropical wines of the Brazilian Northeast.

  12. Developing a phenological model for grapevine to assess future frost risk in Luxembourg

    Science.gov (United States)

    Caffarra, A.; Molitor, D.; Pertot, I.; Sinigoy, P.; Junk, J.

    2012-04-01

    Late frost damage represents a significant hazard to grape production in cool climate viticulture regions such as Luxembourg. The main aim of our study is to analyze the frequency of these events for the Luxembourg's winegrowing region in the future. Spring frost injuries on grape may occur when young green parts are exposed to air temperature below 0°C. The potential risk is determined by: (i) minimum air temperature conditions and the (ii) the timing of bud burst. Therefore, we developed and validated a model for budburst of the grapevine (*Vitis vinifera)* cultivar Rivaner, the most grown local variety, based on multi-annual data from 7 different sites across Europe and the US. An advantage of this approach is, that it could be applied to a wide range of climate conditions. Higher spring temperatures were projected for the future and could lead to earlier dates of budburst as well as earlier dates of last frost events in the season. However, so far it is unknown if this will increase or decrease the risk of severe late frost damages for Luxembourg's winegrowing region. To address this question results of 10 regional climate change projections from the FP6 ENSEMBLES project (spatial resolution = 25km; A1B emission scenario) were combined with the new bud burst model. The use of a multi model ensemble of climate change projections allows for a better quantification of the uncertainties. A bias corrections scheme, based on local observations, was applied to the model output. Projected daily minimum air temperatures, up to 2098, were compared to the projected date of bud burst in order to quantify the future frost risk for Luxembourg.

  13. Structural insights into viral determinants of nematode mediated Grapevine fanleaf virus transmission.

    Directory of Open Access Journals (Sweden)

    Pascale Schellenberger

    2011-05-01

    Full Text Available Many animal and plant viruses rely on vectors for their transmission from host to host. Grapevine fanleaf virus (GFLV, a picorna-like virus from plants, is transmitted specifically by the ectoparasitic nematode Xiphinema index. The icosahedral capsid of GFLV, which consists of 60 identical coat protein subunits (CP, carries the determinants of this specificity. Here, we provide novel insight into GFLV transmission by nematodes through a comparative structural and functional analysis of two GFLV variants. We isolated a mutant GFLV strain (GFLV-TD poorly transmissible by nematodes, and showed that the transmission defect is due to a glycine to aspartate mutation at position 297 (Gly297Asp in the CP. We next determined the crystal structures of the wild-type GFLV strain F13 at 3.0 Å and of GFLV-TD at 2.7 Å resolution. The Gly297Asp mutation mapped to an exposed loop at the outer surface of the capsid and did not affect the conformation of the assembled capsid, nor of individual CP molecules. The loop is part of a positively charged pocket that includes a previously identified determinant of transmission. We propose that this pocket is a ligand-binding site with essential function in GFLV transmission by X. index. Our data suggest that perturbation of the electrostatic landscape of this pocket affects the interaction of the virion with specific receptors of the nematode's feeding apparatus, and thereby severely diminishes its transmission efficiency. These data provide a first structural insight into the interactions between a plant virus and a nematode vector.

  14. CRYOTHERAPY: A NEW TECHNIQUE TO OBTAIN GRAPEVINE PLANTS FREE OF VIRUSES

    Directory of Open Access Journals (Sweden)

    JEAN CARLOS BETTONI

    2016-01-01

    Full Text Available ABSTRACT Through in vitro tissue culture techniques it is possible to propagate high quality nursery plants faster. Cryotherapy is a promising tool, based on in vitro culture techniques, for achieving in a short time, high frequency of regenerating plants free of viruses. The objective of this review is to present and analyze the results of research conducted in cryotherapy methods based on cryopreservation protocols for recovery of cultivars free of micro-organisms with potential agronomic interest. The main methods employed in cryotherapy are encapsulation-dehydration, vitrification, encapsulation-vitrification and droplet vitrification, which are based on the immersion of preconditioned shoot tips in liquid nitrogen, followed by their recovery in vitro on to culture media for regeneration of healthy plantlets. Improvements to cryotherapy protocols used for grapevine are still needed, since there are variations in response according to the genotype. The published research mostly relates to Vitis vinifera and the few studies applied to other species show that the protocols need to be improved. This specificity goes beyond species, with different responses among cultivars, limiting the broader application of the technology. On the other hand, traditional methods used for virus removal from infected plant materials also have limitations and therefore investment in research for the development and application of cryopreservation techniques is highly justified, considering its efficiency and low-cost, once the protocols are developed. High frequency of virus-free plants among regenerants within a short time frame is the most desirable aspect of cryotherapy. Therefore, these advantages make the technique a promising tool for institutions mandated to the development of high-health planting materials with high genetic and agronomic potential for viticulture.

  15. Structural Changes Induced in Grapevine (Vitis vinifera L. DNA by Femtosecond IR Laser Pulses: A Surface-Enhanced Raman Spectroscopic Study

    Directory of Open Access Journals (Sweden)

    Nicoleta E. Dina

    2016-05-01

    Full Text Available In this work, surface-enhanced Raman spectra of ten genomic DNAs extracted from leaf tissues of different grapevine (Vitis vinifera L. varieties, respectively, are analyzed in the wavenumber range 300–1800 cm−1. Furthermore, structural changes induced in grapevine genomic nucleic acids upon femtosecond (170 fs infrared (IR laser pulse irradiation (λ = 1100 nm are discussed in detail for seven genomic DNAs, respectively. Surface-enhanced Raman spectroscopy (SERS signatures, vibrational band assignments and structural characterization of genomic DNAs are reported for each case. As a general observation, the wavenumber range between 1500 and 1660 cm−1 of the spectra seems to be modified upon laser treatment. This finding could reflect changes in the base-stacking interactions in DNA. Spectral shifts are mainly attributed to purines (dA, dG and deoxyribose. Pyrimidine residues seem to be less affected by IR femtosecond laser pulse irradiation. Furthermore, changes in the conformational properties of nucleic acid segments are observed after laser treatment. We have found that DNA isolated from Feteasca Neagra grapevine leaf tissues is the most structurally-responsive system to the femtosecond IR laser irradiation process. In addition, using unbiased computational resources by means of principal component analysis (PCA, eight different grapevine varieties were discriminated.

  16. Potency of Stem Cells

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Potency of Stem Cells. Totipotent Stem Cells (Zygote + first 2 divisions). -Can form placenta, embryo, and any cell of the body. Pluripotent (Embryonic Stem Cells). -Can form any cell of the body but can not form placenta, hence no embryo. Multipotent (Adult stem cells).

  17. Two shikimate dehydrogenases, VvSDH3 and VvSDH4, are involved in gallic acid biosynthesis in grapevine.

    Science.gov (United States)

    Bontpart, Thibaut; Marlin, Thérèse; Vialet, Sandrine; Guiraud, Jean-Luc; Pinasseau, Lucie; Meudec, Emmanuelle; Sommerer, Nicolas; Cheynier, Véronique; Terrier, Nancy

    2016-05-01

    In plants, the shikimate pathway provides aromatic amino acids that are used to generate numerous secondary metabolites, including phenolic compounds. In this pathway, shikimate dehydrogenases (SDH) 'classically' catalyse the reversible dehydrogenation of 3-dehydroshikimate to shikimate. The capacity of SDH to produce gallic acid from shikimate pathway metabolites has not been studied in depth. In grapevine berries, gallic acid mainly accumulates as galloylated flavan-3-ols. The four grapevine SDH proteins have been produced in Escherichia coli In vitro, VvSDH1 exhibited the highest 'classical' SDH activity. Two genes, VvSDH3 and VvSDH4, mainly expressed in immature berry tissues in which galloylated flavan-3-ols are accumulated, encoded enzymes with lower 'classical' activity but were able to produce gallic acid in vitro The over-expression of VvSDH3 in hairy-roots increased the content of aromatic amino acids and hydroxycinnamates, but had little or no effect on molecules more distant from the shikimate pathway (stilbenoids and flavan-3-ols). In parallel, the contents of gallic acid, β-glucogallin, and galloylated flavan-3-ols were increased, attesting to the influence of this gene on gallic acid metabolism. Phylogenetic analysis from dicotyledon SDHs opens the way for the examination of genes from other plants which accumulate gallic acid-based metabolites. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Phenological behavior of the grapevine (vitis vinifera l., cv cabernet sauvignon in Sutamarchán - Boyacá.

    Directory of Open Access Journals (Sweden)

    Diana Carolina Vargas Herrera

    2013-12-01

    Full Text Available In tropical cold weather, the grapevine presents phenological disorders, difficult agronomic disfavoring vintage quality. With the purpose of establishing phenological cycles determined the duration of the different phases of the development cycle of the grapevine, cv "Cabernet Sauvignon" (Vitis vinifera L. in the vineyard Ain-Karim (5º39` N, 73º95' W, 2110 masl. We determined the average duration of sprouting (SP, flowering (FL, veraison (VE and vintage (VI periods from pruning, and the total cycle of growth, according to the phenological scale Biologische Bundesanstalt Bundessortenamt Chemise (BBCH. To set the average of the process was considered when the plants reached 50% of each event. Determining growing degree days (GDD support the temperature record by a datalogger. Phenological data were subjected to a descriptive analysis as means and standard deviation. The duration of the period between pruning (PR and vintage (VI, with average temperature of 17.87 ° C, had a duration of 183 days after pruning (DAP, accumulating growing degree days 1458.1 (GDD. Flowering occurred at 50 days after pruning (DAP, accumulating 397.7 GDD. Veraison 122 was presented to the accumulation of 578.2 DAP with GDD. While from veraison to maturity 478.9 GDD accumulated in 62 days. Under Sutamarchán agro-climatic conditions, during the investigation, collects, on average, 7.98 degrees daily growth, which implies that for the Cabernet Sauvignon, the total duration of the phenological cycle is 184 days, accumulating 1458.1 GDD.

  19. Effects of moderate and high rates of biochar and compost on grapevine growth in a greenhouse experiment

    Directory of Open Access Journals (Sweden)

    Arianna Bozzolo

    2017-03-01

    Full Text Available Biochar is used as soil amendment and enhancer of plant growth, but the mechanisms involved in grapevine are not understood. In this study, the short-term effects of amendments were evaluated in a trial combining three substrates (biochar, compost, peat-based media with three doses (30, 70, 100% along a time sequence on 1-year-old bare root cuttings of grapevine. Amendments were analyzed for elemental composition. Soil pH, electrical conductivity (EC, chlorophyll (CHL, flavonoids (FL, anthocyans (ANT and nitrogen balance index (NBI were measured.Biochar differed from other amendments for stable C structures, where nutrients and lignin residues were high in compost. Biochar increased soil pH, whereas biochar plus compost mixture augmented EC. The amended plants had detrimental effects on root, true and lateral leaves. Nevertheless, at the lowest rate biochar increased the primary shoot and total scion to root biomass ratio. Among biochemicals, ANT and NBI were mostly affected by biochar, while compost gave only slight increments. Thus, although biochar rate was not adequate for the shedding in open field our results suggest that biochar might be useful in nursery when used at low dosages.

  20. A preliminary survey on the presence of Xylella fastidiosa in olive, citrus and grapevine groves in Morocco

    Directory of Open Access Journals (Sweden)

    Ahmed AARABE

    2018-03-01

    Full Text Available The bacterium Xylella fastidiosa is gram negative, xylem-inhabiting, devastating pathogen which causes various diseases on more than 300 plant hosts. Given the recent confirmed findings of X. fastidiosa in the European Union, this bacterium is becoming a serious threat to the Moroccan agricultural sector. A survey was conducted during May-September 2015 on the presence of X. fastidiosa in several commercial groves, covering olive, citrus and grapevine growing areas. In a few trees, severe symptoms which could be associated to the bacterium were observed. A total of 900 samples of different crops from different regions were randomly collected: 220 olive trees (cv. Picholine Marocaine from two regions, 410 citrus trees belonging to 7 different cultivars collected in 4 regions and 270 grapevine plants belonging to 6 different cultivars from 3 regions; all these samples were tested for the presence of X. fastidiosa by using an ELISA commercial kit. The obtained results did not show any positive sample. These preliminary results are taken as an encouraging indication, considering that X. fastidiosa was not found in Morocco, at least in the surveyed crops. However, frequent extensive surveys in different regions are needed to prevent its entrance into the country.

  1. Pollination: a key event controlling the expression of genes related to phytohormone biosynthesis during grapevine berry formation.

    Science.gov (United States)

    Kühn, Nathalie; Arce-Johnson, Patricio

    2012-01-01

    Berry formation is the process of ovary conversion into a functional fruit, and is characterized by abrupt changes in the content of several phytohormones, associated with pollination and fertilization. Much effort has been made in order to improve our understanding of berry development, particularly from veraison to post-harvest time. However, the period of berry formation has been poorly investigated, despite its importance. Phytohormones are involved in the control of fruit formation; hence it is important to understand the regulation of their content at this stage. Grapevine is an excellent fleshy-fruit plant model since its fruits have particularities that differentiate them from those of commonly studied organisms. For instance, berries are prepared to cope with stress by producing several antioxidants and they are non-climacteric fruits. Also its genome is fully sequenced, which allows to identify genes involved in developmental processes. In grapevine, no link has been established between pollination and phytohormone biosynthesis, until recently. Here we highlight relevant findings regarding pollination effect on gene expression related to phytohormone biosynthesis, and present unpublished results showing how quickly this effect is achieved.

  2. Vegetative, productive and qualitative performance of grapevine "Cabernet Sauvignon" according to the use of winter cover crops

    Directory of Open Access Journals (Sweden)

    Jean Carlos Bettoni

    Full Text Available ABSTRACT To study the effect of winter cover crops on the vegetative, productive and qualitative behavior of "Cabernet Sauvignon" grapevines, an experiment was conducted in two wine harvests by sowing different species of winter cover crops and additional treatments with manual weeding and mechanical mowing in an experimental vineyard located at the Experimental Station of Epagri in Videira, state of Santa Catarina, Brazil. Plant attributes of the grapevine, such as number of rods and weight of pruned material and number of branches per plant. At the time of skin color change, petioles of recently matured leaves were collected for analysis of the levels of N, P, K, Ca, Mg, Fe, Mn, Zn and B. Moments before harvest, 100 grape berries were collected randomly to determine the total soluble solids, titratable acidity and pH. At harvest, the number of bunches per branch, the number and mass of clusters per plant and the average mass of clusters per plot were determined. Fresh and dry matter yields of the cover crop and weed plants were also determined when coverage reached full bloom. The winter cover crops did not alter the yield and quality of "Cabernet Sauvignon" grapes and showed no differences from each other for the management of spontaneous vegetation by hand weeding or mechanical mowing. Rye and ryegrass are effective alternatives for weed control alternatives. The species of white and red clover present difficulty in initial establishment, producing a small amount of biomass.

  3. Characterization of an Antioxidant-Enriched Beverage from Grape Musts and Extracts of Winery and Grapevine By-Products

    Directory of Open Access Journals (Sweden)

    Tabita Aguilar

    2018-01-01

    Full Text Available The recovery of antioxidants from complex winery and grapevine by-products into Vitis vinifera must offers new opportunities for wine grapes by the development of a new, enriched fruit juice. However, this demands the search for new valorization methods to get hold of additional antioxidant compounds. The objective of this study was to find a novel functionality for grape pomace, grapevine leaves, and canes by its reuse as a functional matrix for the extraction of antioxidants into grape must. After thermomaceration, 22 polyphenols were identified by high performance liquid chromatography and mass spectrometry. Grape pomace was a good source of anthocyanins (malvidin-3-glucoside, while flavonols (quercetin-3-hexoside and phenolic acids (caftaric acid were the main phenolic compounds in leaf extracts. Catechin dimer was the only polyphenol compound present in all of the matrices. Enriched grape juice comprised by 40:20:40 (v/v/v of pomace, leaf, and cane extracts, yielded an oxygen radical absorbance capacity of pirogallol red and fluorescein ratio of 0.70, indicating that the reactivity of antioxidants present in enriched grape juice was at least as efficient as other polyphenol-rich beverages. Thus, pomace, leaves and canes supply additional polyphenols to grape must that results into a beverage with promissory antioxidant activity and potential health benefits.

  4. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  5. Characterization of epiphytic bacterial communities from grapes, leaves, bark and soil of grapevine plants grown, and their relations.

    Directory of Open Access Journals (Sweden)

    Guilherme Martins

    Full Text Available Despite its importance in plant health and crop quality, the diversity of epiphytic bacteria on grape berries and other plant parts, like leaves and bark, remains poorly described, as does the role of telluric bacteria in plant colonization. In this study, we compare the bacterial community size and structure in vineyard soils, as well as on grapevine bark, leaves and berries. Analyses of culturable bacteria revealed differences in the size and structure of the populations in each ecosystem. The highest bacteria population counts and the greatest diversity of genera were found in soil samples, followed by bark, grapes and leaves. The identification of isolates revealed that some genera - Pseudomonas, Curtobacterium, and Bacillus - were present in all ecosystems, but in different amounts, while others were ecosystem-specific. About 50% of the genera were common to soil and bark, but absent from leaves and grapes. The opposite was also observed: grape and leaf samples presented 50% of genera in common that were absent from trunk and soil. The bacterial community structure analyzed by T-RFLP indicated similarities between the profiles of leaves and grapes, on the one hand, and bark and soil, on the other, reflecting the number of shared T-RFs. The results suggest an interaction between telluric bacterial communities and the epiphytic bacteria present on the different grapevine parts.

  6. Pathogenicity and molecular detection of Uruguayan isolates of Greeneria uvicola and Cadophora luteo-olivacea associated with grapevine trunk diseases

    Directory of Open Access Journals (Sweden)

    Fernando NAVARRETE

    2011-12-01

    Full Text Available Normal 0 21 MicrosoftInternetExplorer4 Species from different fungal genera have been indicated as responsible for the development of trunk diseases of grapevines. Greeneria uvicola is responsible for the bitter rot of Vitis vinifera grape bunchesnear harvest, and can also attack other Vitis species. In Uruguay, G. uvicola was isolated from dead arm affected grapevines and as an endophyte from healthy canes. Cadophora luteo-olivacea is a phialophora-likeascomycete with a wide distribution that was isolated from asymptomatic wood tissues in Vitis and Petridisease-affected nursery plants in Uruguay. Pathogenicity of isolates of both species was evaluated on Vitis vinifera cv. Tannat and Cabernet Sauvignon, and rootstocks SO4 and 3309C. Specific primers were developed for the ITS rDNA region for both species. Number of plants showing discoloration, length of discoloration, number of re-isolations and amplifications confirmed the pathogenicity of G. uvicola isolates. Pathogenicityof the isolate of C. luteo-olivacea obtained from symptomatic tissues is discussed. Specific primers can be usedto detect the presence of these fungi in asymptomatic tissues.

  7. Using Image Texture and Spectral Reflectance Analysis to Detect Yellowness and Esca in Grapevines at Leaf-Level

    Directory of Open Access Journals (Sweden)

    Hania Al-Saddik

    2018-04-01

    Full Text Available Plant diseases are one of the main reasons behind major economic and production losses in the agricultural field. Current research activities enable large fields monitoring and plant disease detection using innovative and robust technologies. French grapevines have a reputation for producing premium quality wines, however, these major fruit crops are susceptible to many diseases, including Esca, Downy mildew, Powdery mildew, Yellowing, and many others. In this study, we focused on two main infections (Esca and Yellowing, and data were gathered from fields that were located in Aquitaine and Burgundy regions, France. Since plant diseases can be diagnosed from the properties of the leaf, we acquired both Red-Green-Blue (RGB digital image and hyperspectral reflectance data from infected and healthy leaves. Biophysical parameters that were produced by the PROSPECT model inversion together with texture parameters compiled from the literature were deduced. Then we investigated their relationship to damage caused by Yellowing and Esca. This study examined whether spectral and textural data can identify the two diseases through the use of Neural Networks. We obtained an overall accuracy of 99% for both of the diseases when textural and spectral data are combined. These results suggest that, first, biophysical parameters present a valid dimension reduction tool that could replace the use of complete hyperspectral data. Second, remote sensing using spectral reflectance and digital images can make an overall nondestructive, rapid, cost-effective, and reproducible technique to determine diseases in grapevines with a good level of accuracy.

  8. Influence on wine biogenic amine composition of modifications to soil N availability and grapevine N by cover crops.

    Science.gov (United States)

    Pérez-Álvarez, Eva P; Garde-Cerdán, Teresa; Cabrita, Maria João; García-Escudero, Enrique; Peregrina, Fernando

    2017-11-01

    Vineyard soil management can modify the nitrogen soil availability and, therefore, grape amino acid content. These compounds are precursors of biogenic amines, which have negative effects on wine quality and human health. The objective was to study whether the effect of conventional tillage and two cover crops (barley and clover) on grapevine nitrogen status could be related to wine biogenic amines. Over 4 years, soil NO 3 - -N, nitrogen content in leaf and wine biogenic amine concentration were determined. Barley reduced soil NO 3 - -N availability and clover increased it. In 2011, at bloom, nitrogen content decreased with barley treatment in both blade and petiole. In 2012, nitrogen content in both leaf tissues at bloom was greater with clover than with tillage and barley treatments. Also, total biogenic amines decreased in barley with respect to tillage and clover treatments. There were correlations between some individual and total biogenic amine concentrations with respect to nitrogen content in leaf tissues. Wine biogenic amine concentration can be affected by the grapevine nitrogen status, provoked by changes in the soil NO 3 - -N availability with both cover crop treatments. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  9. Phenolic compounds and properties of antioxidants in grapevine roots (Vitis vinifera L. under low-temperature stress followed by recovery

    Directory of Open Access Journals (Sweden)

    Stanisław Weidner

    2011-01-01

    Full Text Available The research has been performed on roots of Vitis vinifera, cv. Himrod, obtained from seedlings grown under chill stress conditions (+10oC in the day and +7oC at night, under optimum conditions (+25oC in the day and +18oC at night and from seedling which underwent a recover period after the chill stress treatment. The purpose of the study has been to determine quantitative and qualitative changes in phenolic compounds as well as to demonstrate changes in antiradical properties of extracts from grapevine roots, which appeared as a result of chill stress and during recovery under the optimum conditions following the stress. Phenolic compounds from grapevine roots were extracted using 80% acetone. The total content of phenolics was determined by colorimetry. The content of tannins was tested by precipitation with bovine serum albumin. The reducing power as well as DPPH• free radical and ABTS+• cation radical scavenging activity of the extracts were also tested. In order to identify phenolic compounds present in the extracts the RP-HPLC technique was employed. The tested material was found to contain tannins and three identified phenolic acids: ferulic, caffeic and p-coumaric ones. The latter occurred in the highest concentrations (from 4.46 to 6.28 µg/g fresh matter. Ferulic acid appeared in smaller amounts (from 1.68 to 2.65 µg/g fresh matter, followed by caffeic acid (from 0.87 to 1.55 µg/g fresh matter. Significantly less total phenolic compounds occurred in roots of seedlings subjected to chill stress. However, the total content of these compounds increased significantly in roots of plants which underwent recovery after chill stress. Concentration of tannins was determined by two methods. The content of condensed tannins was depressed in roots as a result of low temperature stress, whereas the content of condensed and hydrolysing tannins (determined via the BSA method rose under chill stress conditions. A significant increase in tannins

  10. RUN1 and REN1 Pyramiding in Grapevine (Vitis vinifera cv. Crimson Seedless) Displays an Improved Defense Response Leading to Enhanced Resistance to Powdery Mildew (Erysiphe necator)

    Science.gov (United States)

    Agurto, Mario; Schlechter, Rudolf O.; Armijo, Grace; Solano, Esteban; Serrano, Carolina; Contreras, Rodrigo A.; Zúñiga, Gustavo E.; Arce-Johnson, Patricio

    2017-01-01

    Fungal pathogens are the cause of the most common diseases in grapevine and among them powdery mildew represents a major focus for disease management. Different strategies for introgression of resistance in grapevine are currently undertaken in breeding programs. For example, introgression of several resistance genes (R) from different sources for making it more durable and also strengthening the plant defense response. Taking this into account, we cross-pollinated P09-105/34, a grapevine plant carrying both RUN1 and REN1 pyramided loci of resistance to Erysiphe necator inherited from a pseudo-backcrossing scheme with Muscadinia rotundifolia and Vitis vinifera ‘Dzhandzhal Kara,’ respectively, with the susceptible commercial table grape cv. ‘Crimson Seedless.’ We developed RUN1REN1 resistant genotypes through conventional breeding and identified them by marker assisted selection. The characterization of defense response showed a highly effective defense mechanism against powdery mildew in these plants. Our results reveal that RUN1REN1 grapevine plants display a robust defense response against E. necator, leading to unsuccessful fungal establishment with low penetration rate and poor hypha development. This resistance mechanism includes reactive oxygen species production, callose accumulation, programmed cell death induction and mainly VvSTS36 and VvPEN1 gene activation. RUN1REN1 plants have a great potential as new table grape cultivars with durable complete resistance to E. necator, and are valuable germplasm to be included in grape breeding programs to continue pyramiding with other sources of resistance to grapevine diseases. PMID:28553300

  11. Survey of potential sharpshooter and spittlebug vectors of Xylella fastidiosa to grapevines at the São Francisco River Valley, Brazil

    Directory of Open Access Journals (Sweden)

    Rudiney Ringenberg

    2014-06-01

    Full Text Available Survey of potential sharpshooter and spittlebug vectors of Xylella fastidiosa to grapevines at the São Francisco River Valley, Brazil. Pierce's disease of grapevines, caused by Xylella fastidiosa, is a serious problem in some regions of North America, not yet reported in Brazil. In this study, a survey of potential sharpshooter (Hemiptera, Cicadellidae, Cicadellinae and spittlebug (Hemiptera, Cercopidae vectors of X. fastidiosa was conducted in vineyards at the São Francisco River Valley, a major grape growing region in Brazil. Four vineyards of Vitis vinifera L. were sampled fortnightly from June/2005 to June/2007, using yellow sticky cards, each placed at two different heights (45 cm aboveground and 45 cm above the crop canopy in 10 sampling localities. A total of 4,095 specimens of sharpshooters were collected, nearly all from 3 Proconiini species, Homalodisca spottii Takiya, Cavichioli & McKamey, 2006 (96.8% of the specimens, Tapajosa fulvopunctata (Signoret, 1854 (3.1%, and Tretogonia cribrata Melichar, 1926 (1 specimen. Hortensia similis (Walker, 1851 (2 specimens was the only Cicadellini species. Only 1 cercopid specimen, belonging to Aeneolamia colon (Germar, 1821, was trapped. Even though they are not considered potential Xylella vectors, 2 Gyponini leafhoppers were collected: Curtara samera DeLong & Freytag, 1972 (11 specimens and Curtara inflata DeLong & Freytag, 1976 (1 specimen. Homalodisca spottii was observed feeding and mating on green branches of grapevines, in addition to egg masses. Because of its prevalence on the crop canopy, occurrence throughout the year (with peaks from February to August, and ability to colonize grapevines, H. spottii could be an important vector if a X. fastidiosa strain pathogenic to grapevines becomes introduced at the São Francisco River Valley.

  12. Cane pruning on Chardonnay grapevine in the high-altitude regions of Southern Brazil

    Directory of Open Access Journals (Sweden)

    Filho José Luiz Marcon

    2016-01-01

    Full Text Available High-altitude regions of southern Brazil, located above 900 m above sea level, the cordon training with spur pruning is widely used because of easier application. In these regions, Chardonnay wine grape shows potential to produce quality wines, however, in commercial vineyards, the training system used has not provided productivities that makes economically viable the cultivation of this variety. Given this, the present study aimed to evaluate the effect of different cane-pruning systems on the vegetative, productive and enological potential of Chardonnay grapevines grown in the high-altitude region of Southern Brazil. The experiment was conducted in a commercial Chardonnay vineyard, located in São Joaquim – Santa Catarina State (28o17 ′39”S and 49∘ 55′56” W, to 1230 m a.s.l during 2015 and 2016 vintages. Chardonnay vines (grafted on 1103 Paulsen were planted in 2010, with a 3.0 m (row × 1.0 m (vine spacing. The treatments consisted of different cane-pruning systems: Cordon spur-pruning (control; Sylvoz; Cazenave; Capovolto; single Guyot and double Guyot. Pruning was performed in August of each year when the buds were in the green tip developmental stage. Data was analyzed by Scott Knott test (p < 0.05 following a randomized block design with four replicates, each consisting of 12 vines per plot. We observed higher yield in the Cazenave and double Guyot training system with three and two more tons of grapes than spur-pruning respectively. The bud fertility was higher in plants trained in double Guyot. Vines spur-pruned showed higher relation of leaf area: production, with values above 100 cm2 g−1 grape at 2016 vintage. Commercial maturity of grapes (soluble solids, acidity and polyphenols did not differ among training systems studied. The results suggest that cane-pruning systems could be an alternative to increase production efficiency of Chardonnay in high-altitude region of southern Brazil.

  13. Grapevine rootstocks shape underground bacterial microbiome and networking but not potential functionality.

    Science.gov (United States)

    Marasco, Ramona; Rolli, Eleonora; Fusi, Marco; Michoud, Grégoire; Daffonchio, Daniele

    2018-01-03

    between the root compartments and the rootstock exerted a unique selective pressure that enhanced niche differentiation, but rootstock-specific bacterial communities were still recruited with conserved PGP traits. While the rootstock significantly influences the taxonomy, structure and network properties of the bacterial community in grapevine roots, a homeostatic effect on the distribution of the predicted and potential functional PGP traits was found.

  14. Hyperspectral-based predictive modelling of grapevine water status in the Portuguese Douro wine region

    Science.gov (United States)

    Pôças, Isabel; Gonçalves, João; Costa, Patrícia Malva; Gonçalves, Igor; Pereira, Luís S.; Cunha, Mario

    2017-06-01

    In this study, hyperspectral reflectance (HySR) data derived from a handheld spectroradiometer were used to assess the water status of three grapevine cultivars in two sub-regions of Douro wine region during two consecutive years. A large set of potential predictors derived from the HySR data were considered for modelling/predicting the predawn leaf water potential (Ψpd) through different statistical and machine learning techniques. Three HySR vegetation indices were selected as final predictors for the computation of the models and the in-season time trend was removed from data by using a time predictor. The vegetation indices selected were the Normalized Reflectance Index for the wavelengths 554 nm and 561 nm (NRI554;561), the water index (WI) for the wavelengths 900 nm and 970 nm, and the D1 index which is associated with the rate of reflectance increase in the wavelengths of 706 nm and 730 nm. These vegetation indices covered the green, red edge and the near infrared domains of the electromagnetic spectrum. A large set of state-of-the-art analysis and statistical and machine-learning modelling techniques were tested. Predictive modelling techniques based on generalized boosted model (GBM), bagged multivariate adaptive regression splines (B-MARS), generalized additive model (GAM), and Bayesian regularized neural networks (BRNN) showed the best performance for predicting Ψpd, with an average determination coefficient (R2) ranging between 0.78 and 0.80 and RMSE varying between 0.11 and 0.12 MPa. When cultivar Touriga Nacional was used for training the models and the cultivars Touriga Franca and Tinta Barroca for testing (independent validation), the models performance was good, particularly for GBM (R2 = 0.85; RMSE = 0.09 MPa). Additionally, the comparison of Ψpd observed and predicted showed an equitable dispersion of data from the various cultivars. The results achieved show a good potential of these predictive models based on vegetation indices to support

  15. Grapevine rootstocks shape underground bacterial microbiome and networking but not potential functionality

    KAUST Repository

    Marasco, Ramona; Rolli, Eleonora; Fusi, Marco; Michoud, Gregoire; Daffonchio, Daniele

    2018-01-01

    between the root compartments and the rootstock exerted a unique selective pressure that enhanced niche differentiation, but rootstock-specific bacterial communities were still recruited with conserved PGP traits.While the rootstock significantly influences the taxonomy, structure and network properties of the bacterial community in grapevine roots, a homeostatic effect on the distribution of the predicted and potential functional PGP traits was found.

  16. Grapevine rootstocks shape underground bacterial microbiome and networking but not potential functionality

    KAUST Repository

    Marasco, Ramona

    2018-01-03

    between the root compartments and the rootstock exerted a unique selective pressure that enhanced niche differentiation, but rootstock-specific bacterial communities were still recruited with conserved PGP traits.While the rootstock significantly influences the taxonomy, structure and network properties of the bacterial community in grapevine roots, a homeostatic effect on the distribution of the predicted and potential functional PGP traits was found.

  17. Grapevine yellows diseases in Spain: eight year survey of disease spread and molecular characterization of phytoplasmas involved

    Directory of Open Access Journals (Sweden)

    Torres, Ester

    2005-12-01

    Full Text Available Among grapevine yellows phytoplasma diseases in Europe, flavescence dorée (FD is the most devastating and in the last decade has reached Spanish vineyards, mainly in Catalonia. An eight-year survey was carried out in the areas where the disease has spread (Alt Empordà, Catalonia, Northern Spain and in the remaining vine-growing areas of Catalonia. Sequence analyses of a portion of the 16S-23S ribosomal DNA cistron, from selected grapevine samples from Catalonia, showed that the phytoplasmas involved in grapevine yellows belong to 16S ribosomal subgroups V-D (flavescence dorée, FD and XII-A (bois noir, BN. A set of Spanish FD isolates collected during these years were further studied by RFLP analyses of the 16S-23S ribosomal DNA fragment, as well as the rpS3 and SecY genes. All the FD phytoplasma strains studied were related to phytoplasmas belonging to ribosomal protein subgroup rp-E.La flavescencia dorada (FD es la enfermedad más agresiva de entre todas las enfermedades de fitoplasmas que causan amarilleos de vid en Europa, y que en la última década ha alcanzado también a los viñedos de España, principalmente en Cataluña. Se ha realizado un seguimiento durante ocho años en las zonas donde la enfermedad se había difundido (Alt Empordà, Cataluña y en el resto de zonas con cultivo de vid de Cataluña. El análisis del fragmento del gen DNA ribosomal 16S-23S, de una selección de muestras de vides de Cataluña, indica que los fitoplasmas que están implicados en los amarilleos de vid pertenecen a los subgrupos ribosomales 16S V-D (flavescencia dorada, FD y XII-A (bois noir, BN. Una selección de aislados españoles de FD obtenidos durante estos años se ha examinado mediante análisis RFLP del fragmento del gen ribosomal 16S-23S, y de los genes rpS3 y SecY. Todos los aislamientos de fitoplasmas FD estudiados están relacionados con fitoplasmas pertenecientes al subgrupo de proteína ribosomal rp-E.

  18. Stem Cell Transplant

    Science.gov (United States)

    ... Graft-versus-host disease: A potential risk when stem cells come from donors If you receive a transplant ... medications and blood products into your body. Collecting stem cells for transplant If a transplant using your own ...

  19. Stem Cell Information: Glossary

    Science.gov (United States)

    ... Tips Info Center Research Topics Federal Policy Glossary Stem Cell Information General Information Clinical Trials Funding Information Current ... here Home » Glossary Back to top Glossary Adult stem cell Astrocyte Blastocoel Blastocyst Bone marrow stromal cells Bone ...

  20. Plant stem cell niches.

    Science.gov (United States)

    Stahl, Yvonne; Simon, Rüdiger

    2005-01-01

    Stem cells are required to support the indeterminate growth style of plants. Meristems are a plants stem cell niches that foster stem cell survival and the production of descendants destined for differentiation. In shoot meristems, stem cell fate is decided at the populational level. The size of the stem cell domain at the meristem tip depends on signals that are exchanged with cells of the organizing centre underneath. In root meristems, individual stem cells are controlled by direct interaction with cells of the quiescent centre that lie in the immediate neighbourhood. Analysis of the interactions and signaling processes in the stem cell niches has delivered some insights into the molecules that are involved and revealed that the two major niches for plant stem cells are more similar than anticipated.

  1. Amino acid content in red wines obtained from grapevine nitrogen foliar treatments: consumption during the alcoholic fermentation

    Directory of Open Access Journals (Sweden)

    Javier Portu

    2014-12-01

    Full Text Available Nitrogen is an important element for grapevine and winemaking which affects the development of the plant and yeast, and therefore it is important for wine quality. The aim of this work was to study the influence of foliar application to vineyard of proline, phenylalanine and urea and two commercial nitrogen fertilizers, without and with amino acids in their formulation, on the wine amino acid content and their consumption during the alcoholic fermentation. The results showed that these treatments did not affect the amino acid composition in wines. The differences observed for certain amino acids were so small that the concentration of total amino acids was not significantly different among wines. Moreover, it was observed that the higher the content of amino acids in the medium, the greater their consumption during the alcoholic fermentation.

  2. Elicitors as alternative strategy to pesticides in grapevine? Current knowledge on their mode of action from controlled conditions to vineyard.

    Science.gov (United States)

    Delaunois, Bertrand; Farace, Giovanni; Jeandet, Philippe; Clément, Christophe; Baillieul, Fabienne; Dorey, Stéphan; Cordelier, Sylvain

    2014-04-01

    Development and optimisation of alternative strategies to reduce the use of classic chemical inputs for protection against diseases in vineyard is becoming a necessity. Among these strategies, one of the most promising consists in the stimulation and/or potentiation of the grapevine defence responses by the means of elicitors. Elicitors are highly diverse molecules both in nature and origins. This review aims at providing an overview of the current knowledge on these molecules and will highlight their potential efficacy from the laboratory in controlled conditions to vineyards. Recent findings and concepts (especially on plant innate immunity) and the new terminology (microbe-associated molecular patterns, effectors, etc.) are also discussed in this context. Other objectives of this review are to highlight the difficulty of transferring elicitors use and results from the controlled conditions to the vineyard, to determine their practical and effective use in viticulture and to propose ideas for improving their efficacy in non-controlled conditions.

  3. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  4. Variations in early response of grapevine wood depending on wound and inoculation combinations with Phaeoacremonium aleophilum and Phaeomoniella chlamydospora

    Directory of Open Access Journals (Sweden)

    Romain J. G. PIERRON

    2016-03-01

    Full Text Available Defense mechanisms in woody tissue are poorly understood, especially in vine colonized by trunk pathogens. However, several investigations suggest that molecular mechanisms in the central tissue of Vitis vinifera L. may be involved in trunk-defense reactions. In this work, the perception of Phaeoacremonium aleophilum and Phaeomoniella chlamydospora alone or together were investigated in cuttings of Cabernet Sauvignon trunks. Plant responses were analyzed at the tissue level via optical microscopy and at the cellular level via plant-gene expression. The microscopy results revealed that, six weeks after pathogen inoculation, newly formed vascular tissue is less developed in plants inoculated with P. chlamydospora than in plants inoculated with P. aleophilum. Co-inoculation with both pathogens resulted in an intermediate phenotype. Further analysis showed the relative expression of the following grapevine genes: PAL, PR10.3, TL, TLb, Vv17.3, STS, STS8, CWinv, PIN, CAM, LOX at 10, 24, 48, and 120 h post-inoculation (hpi. The gene set was induced by wounding before inoculation with the different pathogens, except for the genes CAM and LOX. This response generated significant noise, but the expression of the grapevine genes (PAL, PR10.3, TL, TLb, Vv17.3, STS, STS8, CWinv, and PIN still differed due to perception of mycelium by the plant. Furthermore, at 48 hpi, the induction of PAL and STS8 differs depending on the pathogen, and a specific pattern emerges from the different inductions associated with the different treatments. Based on these results, we conclude that Vitis vinifera L. trunk perceives the presence of pathogens differently depending on the inoculated pathogen or even on the combination of co-inoculated pathogens, suggesting a defense orchestration in the perennial organs of woody plants.

  5. Genetic dissection of powdery mildew resistance in interspecific half-sib grapevine families using SNP-based maps.

    Science.gov (United States)

    Teh, Soon Li; Fresnedo-Ramírez, Jonathan; Clark, Matthew D; Gadoury, David M; Sun, Qi; Cadle-Davidson, Lance; Luby, James J

    2017-01-01

    Quantitative trait locus (QTL) identification in perennial fruit crops is impeded largely by their lengthy generation time, resulting in costly and labor-intensive maintenance of breeding programs. In a grapevine (genus Vitis ) breeding program, although experimental families are typically unreplicated, the genetic backgrounds may contain similar progenitors previously selected due to their contribution of favorable alleles. In this study, we investigated the utility of joint QTL identification provided by analyzing half-sib families. The genetic control of powdery mildew was studied using two half-sib F 1 families, namely GE0711/1009 (MN1264 × MN1214; N  = 147) and GE1025 (MN1264 × MN1246; N  = 125) with multiple species in their ancestry. Maternal genetic maps consisting of 1077 and 1641 single nucleotide polymorphism (SNP) markers, respectively, were constructed using a pseudo-testcross strategy. Ratings of field resistance to powdery mildew were obtained based on whole-plant evaluation of disease severity. This 2-year analysis uncovered two QTLs that were validated on a consensus map in these half-sib families with improved precision relative to the parental maps. Examination of haplotype combinations based on the two QTL regions identified strong association of haplotypes inherited from 'Seyval blanc', through MN1264, with powdery mildew resistance. This investigation also encompassed the use of microsatellite markers to establish a correlation between 206-bp (UDV-015b) and 357-bp (VViv67) fragment sizes with resistance-carrying haplotypes. Our work is one of the first reports in grapevine demonstrating the use of SNP-based maps and haplotypes for QTL identification and tagging of powdery mildew resistance in half-sib families.

  6. Investigation of Catalase, Proxidase and Total Protein Level in Some Cold Treated Grapevine Cultivars Cold Stress Response

    Directory of Open Access Journals (Sweden)

    M. Karimi Alavijeh

    2016-02-01

    Full Text Available Chilling is an important environmental stress that influences the yield and quality of many agricultural crops. Different plants use different systems to endure this stress and minimize its effects. One of these systems is enzymatic reaction. To find out more about responses of different grapevine species and cultivars to the low temperature conditions, their enzymatic changes were evaluated in a factorial experiment based on randomized complete design with 3 replication during different periods after chilling stress. Leaf samples of plants under cold stress had been taken and maintained in -80 °C until enzyme extraction. Low temperature around 4 °C is sufficient to induce genes that produce chilling acclimatization proteins. In the present study, leaf samples were collected from the plants that were kept at 4 °C during different time intervals, and then total proteins as well as two main antioxidant enzymes (catalase and guaiacolperoxidase activities were measured. Results showed that as temperature decreased, enzymatic activities were increased in six Iranian grapevine cultivars (‘Atabaki’, ‘Khalili-Danedar’, ‘Shahroodi’, ‘Rajabi-Siah’, ‘Askari’ and ‘Bidane-Sefid’ as well as ‘Riparia’, an American species. The highest enzymatic activities of catalase and ceroxidase were recorded in ‘Khalili-Danedar’ and ‘Riparia’. However,the lowest activities were recorded in ‘Rajabi-Siah’, ‘Bidane-Sefid’ and ‘Shahroodi’. For all studied cultivars, peroxidase showed its highest activity at 12 h after chilling stress, then remained constant, while, the highest activity of catalase were recorded at 8 h. In addition, cold stress increased the total protein content for all studied cultivars, in which ‘Khalili-Danedar’ had the highest protein content amongstudied cultivars. Also, the highest proteins content were recorded at 12 h after exposing plants to cold.

  7. Influence of constitutive phenolic compounds on the response of grapevine (Vitis vinifera L.) leaves to infection by Plasmopara viticola.

    Science.gov (United States)

    Latouche, Gwendal; Bellow, Sébastien; Poutaraud, Anne; Meyer, Sylvie; Cerovic, Zoran G

    2013-01-01

    Flavonols and hydroxycinnamic acids are known to contribute to plant resistance against pathogens, but there are few reports on the implication of flavonols in the resistance of grapevine against Plasmopara viticola, and none on the involvement of hydroxycinnamic acids. In order to analyze the effect of flavonols on P. viticola infection, variable amounts of flavonols were induced by different light conditions in otherwise phenologically identical leaves. Differences in content of leaf hydroxycinnamic acids were induced at the same time. A non-invasive monitoring of flavonols and hydroxycinnamic acids was performed with Dualex leaf-clip optical sensors. Whatever the light condition, there were no significant changes in flavonol or in hydroxycinnamic acid contents for control and inoculated leaves during the development of P. viticola until 6 days after inoculation. The violet-blue autofluorescence of stilbenes, the main phytoalexins of grapevine that accumulate in inoculated leaves, was used as an indicator of infection by P. viticola. The implication of leaf constitutive flavonols and hydroxycinnamic acids in the defence of Vitis vinifera against P. viticola could be investigated in vivo thanks to this indicator. The increase in stilbene violet-blue autofluorescence started earlier for leaves with low flavonol content than for leaves with higher content, suggesting that constitutive flavonols are able to slow down the infection by P. viticola. On the contrary, constitutive hydroxycinnamic acids did not seem to play a role in defence against P. viticola. The non-destructive nature of the methods used alleviates the major problem of destructive experiments: the large variability in leaf phenolic contents.

  8. Endocytic pathways involved in PLGA nanoparticle uptake by grapevine cells and role of cell wall and membrane in size selection.

    Science.gov (United States)

    Palocci, Cleofe; Valletta, Alessio; Chronopoulou, Laura; Donati, Livia; Bramosanti, Marco; Brasili, Elisa; Baldan, Barbara; Pasqua, Gabriella

    2017-12-01

    PLGA NPs' cell uptake involves different endocytic pathways. Clathrin-independent endocytosis is the main internalization route. The cell wall plays a more prominent role than the plasma membrane in NPs' size selection. In the last years, many studies on absorption and cell uptake of nanoparticles by plants have been conducted, but the understanding of the internalization mechanisms is still largely unknown. In this study, polydispersed and monodispersed poly(lactic-co-glycolic) acid nanoparticles (PLGA NPs) were synthesized, and a strategy combining the use of transmission electron microscopy (TEM), confocal analysis, fluorescently labeled PLGA NPs, a probe for endocytic vesicles (FM4-64), and endocytosis inhibitors (i.e., wortmannin, ikarugamycin, and salicylic acid) was employed to shed light on PLGA NP cell uptake in grapevine cultured cells and to assess the role of the cell wall and plasma membrane in size selection of PLGA NPs. The ability of PLGA NPs to cross the cell wall and membrane was confirmed by TEM and fluorescence microscopy. A strong adhesion of PLGA NPs to the outer side of the cell wall was observed, presumably due to electrostatic interactions. Confocal microscopy and treatment with endocytosis inhibitors suggested the involvement of both clathrin-dependent and clathrin-independent endocytosis in cell uptake of PLGA NPs and the latter appeared to be the main internalization pathway. Experiments on grapevine protoplasts revealed that the cell wall plays a more prominent role than the plasma membrane in size selection of PLGA NPs. While the cell wall prevents the uptake of PLGA NPs with diameters over 50 nm, the plasma membrane can be crossed by PLGA NPs with a diameter of 500-600 nm.

  9. Creative Teaching in STEM

    Science.gov (United States)

    Pollard, Vikki; Hains-Wesson, Rachael; Young, Karen

    2018-01-01

    If Science, Technology, Engineering and Mathematics (STEM) disciplines in higher education are to retain students, there needs to be a shift towards teaching in more enriching and interesting ways. Creative teaching needs to become more prominent in STEM. This article presents a study that defines creative teaching in the STEM context and…

  10. Colonization of Vitis vinifera by a Green Fluorescence Protein-Labeled, gfp-Marked Strain of Xylophilus ampelinus, the Causal Agent of Bacterial Necrosis of Grapevine

    OpenAIRE

    Grall, Sophie; Manceau, Charles

    2003-01-01

    The dynamics of Xylophilus ampelinus were studied in Vitis vinifera cv. Ugni blanc using gfp-marked bacterial strains to evaluate the relative importance of epiphytic and endophytic phases of plant colonization in disease development. Currently, bacterial necrosis of grapevine is of economic importance in vineyards in three regions in France: the Cognac, Armagnac, and Die areas. This disease is responsible for progressive destruction of vine shoots, leading to their death. We constructed gfp-...

  11. The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine1

    Science.gov (United States)

    Cavallini, Erika; Matus, José Tomás; Finezzo, Laura; Zenoni, Sara; Loyola, Rodrigo; Guzzo, Flavia; Schlechter, Rudolf; Ageorges, Agnès; Arce-Johnson, Patricio

    2015-01-01

    Because of the vast range of functions that phenylpropanoids possess, their synthesis requires precise spatiotemporal coordination throughout plant development and in response to the environment. The accumulation of these secondary metabolites is transcriptionally controlled by positive and negative regulators from the MYB and basic helix-loop-helix protein families. We characterized four grapevine (Vitis vinifera) R2R3-MYB proteins from the C2 repressor motif clade, all of which harbor the ethylene response factor-associated amphiphilic repression domain but differ in the presence of an additional TLLLFR repression motif found in the strong flavonoid repressor Arabidopsis (Arabidopsis thaliana) AtMYBL2. Constitutive expression of VvMYB4a and VvMYB4b in petunia (Petunia hybrida) repressed general phenylpropanoid biosynthetic genes and selectively reduced the amount of small-weight phenolic compounds. Conversely, transgenic petunia lines expressing VvMYBC2-L1 and VvMYBC2-L3 showed a severe reduction in petal anthocyanins and seed proanthocyanidins together with a higher pH of crude petal extracts. The distinct function of these regulators was further confirmed by transient expression in tobacco (Nicotiana benthamiana) leaves and grapevine plantlets. Finally, VvMYBC2-L3 was ectopically expressed in grapevine hairy roots, showing a reduction in proanthocyanidin content together with the down-regulation of structural and regulatory genes of the flavonoid pathway as revealed by a transcriptomic analysis. The physiological role of these repressors was inferred by combining the results of the functional analyses and their expression patterns in grapevine during development and in response to ultraviolet B radiation. Our results indicate that VvMYB4a and VvMYB4b may play a key role in negatively regulating the synthesis of small-weight phenolic compounds, whereas VvMYBC2-L1 and VvMYBC2-L3 may additionally fine tune flavonoid levels, balancing the inductive effects of

  12. Plant stem cell niches.

    Science.gov (United States)

    Aichinger, Ernst; Kornet, Noortje; Friedrich, Thomas; Laux, Thomas

    2012-01-01

    Multicellular organisms possess pluripotent stem cells to form new organs, replenish the daily loss of cells, or regenerate organs after injury. Stem cells are maintained in specific environments, the stem cell niches, that provide signals to block differentiation. In plants, stem cell niches are situated in the shoot, root, and vascular meristems-self-perpetuating units of organ formation. Plants' lifelong activity-which, as in the case of trees, can extend over more than a thousand years-requires that a robust regulatory network keep the balance between pluripotent stem cells and differentiating descendants. In this review, we focus on current models in plant stem cell research elaborated during the past two decades, mainly in the model plant Arabidopsis thaliana. We address the roles of mobile signals on transcriptional modules involved in balancing cell fates. In addition, we discuss shared features of and differences between the distinct stem cell niches of Arabidopsis.

  13. Stem Cell Pathology.

    Science.gov (United States)

    Fu, Dah-Jiun; Miller, Andrew D; Southard, Teresa L; Flesken-Nikitin, Andrea; Ellenson, Lora H; Nikitin, Alexander Yu

    2018-01-24

    Rapid advances in stem cell biology and regenerative medicine have opened new opportunities for better understanding disease pathogenesis and the development of new diagnostic, prognostic, and treatment approaches. Many stem cell niches are well defined anatomically, thereby allowing their routine pathological evaluation during disease initiation and progression. Evaluation of the consequences of genetic manipulations in stem cells and investigation of the roles of stem cells in regenerative medicine and pathogenesis of various diseases such as cancer require significant expertise in pathology for accurate interpretation of novel findings. Therefore, there is an urgent need for developing stem cell pathology as a discipline to facilitate stem cell research and regenerative medicine. This review provides examples of anatomically defined niches suitable for evaluation by diagnostic pathologists, describes neoplastic lesions associated with them, and discusses further directions of stem cell pathology.

  14. The Type II Secreted Lipase/Esterase LesA is a Key Virulence Factor Required for Xylella fastidiosa Pathogenesis in Grapevines.

    Science.gov (United States)

    Nascimento, Rafael; Gouran, Hossein; Chakraborty, Sandeep; Gillespie, Hyrum W; Almeida-Souza, Hebréia O; Tu, Aye; Rao, Basuthkar J; Feldstein, Paul A; Bruening, George; Goulart, Luiz R; Dandekar, Abhaya M

    2016-01-12

    Pierce's disease (PD) of grapevines is caused by Xylella fastidiosa (Xf), a xylem-limited gamma-proteobacterium that is responsible for several economically important crop diseases. The occlusion of xylem elements and interference with water transport by Xf and its associated biofilm have been posited as the main cause of PD symptom development; however, Xf virulence mechanisms have not been described. Analysis of the Xf secretome revealed a putative lipase/esterase (LesA) that was abundantly secreted in bacterial culture supernatant and was characterized as a protein ortholog of the cell wall-degrading enzyme LipA of Xanthomonas strains. LesA was secreted by Xf and associated with a biofilm filamentous network. Additional proteomic analysis revealed its abundant presence in outer membrane vesicles (OMVs). Accumulation of LesA in leaf regions associated positively with PD symptoms and inversely with bacterial titer. The lipase/esterase also elicited a hypersensitive response in grapevine. Xf lesA mutants were significantly deficient for virulence when mechanically inoculated into grapevines. We propose that Xf pathogenesis is caused by LesA secretion mediated by OMV cargos and that its release and accumulation in leaf margins leads to early stages of observed PD symptoms.

  15. Over-expression of VvWRKY1 in grapevines induces expression of jasmonic acid pathway-related genes and confers higher tolerance to the downy mildew.

    Directory of Open Access Journals (Sweden)

    Chloé Marchive

    Full Text Available Most WRKY transcription factors activate expression of defence genes in a salicylic acid- and/or jasmonic acid-dependent signalling pathway. We previously identified a WRKY gene, VvWRKY1, which is able to enhance tolerance to fungal pathogens when it is overexpressed in tobacco. The present work analyzes the effects of VvWRKY1 overexpression in grapevine. Microarray analysis showed that genes encoding defence-related proteins were up-regulated in the leaves of transgenic 35S::VvWRKY1 grapevines. Quantitative RT-PCR analysis confirmed that three genes putatively involved in jasmonic acid signalling pathway were overexpressed in the transgenic grapes. The ability of VvWRKY1 to trans-activate the promoters of these genes was demonstrated by transient expression in grape protoplasts. The resistance to the causal agent of downy mildew, Plasmopara viticola, was enhanced in the transgenic plants. These results show that VvWRKY1 can increase resistance of grapevine against the downy mildew through transcriptional reprogramming leading to activation of the jasmonic acid signalling pathway.

  16. Grapevine species from varied native habitats exhibit differences in embolism formation/repair associated with leaf gas exchange and root pressure.

    Science.gov (United States)

    Knipfer, Thorsten; Eustis, Ashley; Brodersen, Craig; Walker, Andrew M; McElrone, Andrew J

    2015-08-01

    Drought induces xylem embolism formation, but grapevines can refill non-functional vessels to restore transport capacity. It is unknown whether vulnerability to embolism formation and ability to repair differ among grapevine species. We analysed in vivo embolism formation and repair using x-ray computed microtomography in three wild grapevine species from varied native habitats (Vitis riparia, V. arizonica, V. champinii) and related responses to measurements of leaf gas exchange and root pressure. Vulnerability to embolism formation was greatest in V. riparia, intermediate in V. arizonica and lowest in V. champinii. After re-watering, embolism repair was rapid and pronounced in V. riparia and V. arizonica, but limited or negligible in V. champinii even after numerous days. Similarly, root pressure measured after re-watering was positively correlated with drought stress severity for V. riparia and V. arizonica (species exhibiting embolism repair) but not for V. champinii. Drought-induced reductions in transpiration were greatest for V. riparia and least in V. champinii. Recovery of transpiration after re-watering was delayed for all species, but was greatest for V. champinii and most rapid in V. arizonica. These species exhibit varied responses to drought stress that involve maintenance/recovery of xylem transport capacity coordinated with root pressure and gas exchange responses. © 2014 John Wiley & Sons Ltd.

  17. vitisFlower®: Development and Testing of a Novel Android-Smartphone Application for Assessing the Number of Grapevine Flowers per Inflorescence Using Artificial Vision Techniques.

    Science.gov (United States)

    Aquino, Arturo; Millan, Borja; Gaston, Daniel; Diago, María-Paz; Tardaguila, Javier

    2015-08-28

    Grapevine flowering and fruit set greatly determine crop yield. This paper presents a new smartphone application for automatically counting, non-invasively and directly in the vineyard, the flower number in grapevine inflorescence photos by implementing artificial vision techniques. The application, called vitisFlower(®), firstly guides the user to appropriately take an inflorescence photo using the smartphone's camera. Then, by means of image analysis, the flowers in the image are detected and counted. vitisFlower(®) has been developed for Android devices and uses the OpenCV libraries to maximize computational efficiency. The application was tested on 140 inflorescence images of 11 grapevine varieties taken with two different devices. On average, more than 84% of flowers in the captures were found, with a precision exceeding 94%. Additionally, the application's efficiency on four different devices covering a wide range of the market's spectrum was also studied. The results of this benchmarking study showed significant differences among devices, although indicating that the application is efficiently usable even with low-range devices. vitisFlower is one of the first applications for viticulture that is currently freely available on Google Play.

  18. Antioxidant Activity of Grapevine Leaf Extracts against Oxidative Stress Induced by Carbon Tetrachloride in Cerebral Cortex, Hippocampus and Cerebellum of Rats

    Directory of Open Access Journals (Sweden)

    Mariane Wohlenberg

    2014-04-01

    Full Text Available In recent years, it has become increasingly important to study the beneficial properties of derivatives of grapes and grapevine. The objective of this study was to determine the antioxidant activity of Vitis labrusca leaf extracts, comparing conventional and organic grapevines, in different brain areas of rats. We used male Wistar rats treated with grapevine leaf extracts for a period of 14 days, and on the 15th day, we administered in half of the rats, mineral oil and the other half, carbon tetrachloride (CCl4. The animals were euthanized by decapitation and the cerebral cortex, hippocampus and cerebellum were removed to assess oxidative stress parameters and the activity of antioxidant enzymes. Lipid peroxidation levels (TBARS were unchanged. However, CCl4 induced oxidative damage to proteins in all tissues studied, and this injury was prevented by both extracts. Superoxide dismutase (SOD activity was increased by CCl4 in the cerebral cortex and decreased in other tissues. However, CCl4 increased catalase (CAT activity in the cerebellum and decreased it in the cerebral cortex. The SOD/CAT ratio was restored in the cerebellum by both extracts and only in the cerebral cortex by the organic extract.

  19. The bouquet of grapevine (Vitis vinifera L. cv. Cabernet Sauvignon) flowers arises from the biosynthesis of sesquiterpene volatiles in pollen grains

    Science.gov (United States)

    Martin, Diane M.; Toub, Omid; Chiang, Angela; Lo, Bernard C.; Ohse, Sebastian; Lund, Steven T.; Bohlmann, Jörg

    2009-01-01

    Terpenoid volatiles are important information molecules that enable pollinators to locate flowers and may protect reproductive tissues against pathogens or herbivores. Inflorescences of grapevine (Vitis vinifera L.) are composed of tiny green flowers that produce an abundance of sesquiterpenoid volatiles. We demonstrate that male flower parts of grapevines are responsible for sesquiterpenoid floral scent formation. We describe temporal and spatial patterns of biosynthesis and release of floral volatiles throughout the blooming of V. vinifera L. cv. Cabernet Sauvignon. The biosynthesis of sesquiterpene volatiles, which are emitted with a light-dependent diurnal pattern early in the morning at prebloom and bloom, is localized to anthers and, more specifically, within the developing pollen grains. Valencene synthase (VvValCS) enzyme activity, which produces the major sesquiterpene volatiles of grapevine flowers, is present in anthers. VvValCS transcripts are most abundant in flowers at prebloom stages. Western blot analysis identified VvValCS protein in anthers, and in situ immunolabeling located VvValCS protein in pollen grains during bloom. Histochemical staining, as well as immunolabeling analysis by fluorescent microscopy and transmission electron microscopy, indicated that VvValCS localizes close to lipid bodies within the maturing microspore. PMID:19359488

  20. vitisFlower®: Development and Testing of a Novel Android-Smartphone Application for Assessing the Number of Grapevine Flowers per Inflorescence Using Artificial Vision Techniques

    Directory of Open Access Journals (Sweden)

    Arturo Aquino

    2015-08-01

    Full Text Available Grapevine flowering and fruit set greatly determine crop yield. This paper presents a new smartphone application for automatically counting, non-invasively and directly in the vineyard, the flower number in grapevine inflorescence photos by implementing artificial vision techniques. The application, called vitisFlower®, firstly guides the user to appropriately take an inflorescence photo using the smartphone’s camera. Then, by means of image analysis, the flowers in the image are detected and counted. vitisFlower® has been developed for Android devices and uses the OpenCV libraries to maximize computational efficiency. The application was tested on 140 inflorescence images of 11 grapevine varieties taken with two different devices. On average, more than 84% of flowers in the captures were found, with a precision exceeding 94%. Additionally, the application’s efficiency on four different devices covering a wide range of the market’s spectrum was also studied. The results of this benchmarking study showed significant differences among devices, although indicating that the application is efficiently usable even with low-range devices. vitisFlower is one of the first applications for viticulture that is currently freely available on Google Play.

  1. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  2. Use of thermal and visible imagery for estimating crop water status of irrigated grapevine.

    Science.gov (United States)

    Möller, M; Alchanatis, V; Cohen, Y; Meron, M; Tsipris, J; Naor, A; Ostrovsky, V; Sprintsin, M; Cohen, S

    2007-01-01

    Achieving high quality wine grapes depends on the ability to maintain mild to moderate levels of water stress in the crop during the growing season. This study investigates the use of thermal imaging for monitoring water stress. Experiments were conducted on a wine-grape (Vitis vinifera cv. Merlot) vineyard in northern Israel. Irrigation treatments included mild, moderate, and severe stress. Thermal and visible (RGB) images of the crop were taken on four days at midday with a FLIR thermal imaging system and a digital camera, respectively, both mounted on a truck-crane 15 m above the canopy. Aluminium crosses were used to match visible and thermal images in post-processing and an artificial wet surface was used to estimate the reference wet temperature (T(wet)). Monitored crop parameters included stem water potential (Psi(stem)), leaf conductance (g(L)), and leaf area index (LAI). Meteorological parameters were measured at 2 m height. CWSI was highly correlated with g(L) and moderately correlated with Psi(stem). The CWSI-g(L) relationship was very stable throughout the season, but for that of CWSI-Psi(stem) both intercept and slope varied considerably. The latter presumably reflects the non-direct nature of the physiological relationship between CWSI and Psi(stem). The highest R(2) for the CWSI to g(L) relationship, 0.91 (n=12), was obtained when CWSI was computed using temperatures from the centre of the canopy, T(wet) from the artificial wet surface, and reference dry temperature from air temperature plus 5 degrees C. Using T(wet) calculated from the inverted Penman-Monteith equation and estimated from an artificially wetted part of the canopy also yielded crop water-stress estimates highly correlated with g(L) (R(2)=0.89 and 0.82, respectively), while a crop water-stress index using 'theoretical' reference temperatures computed from climate data showed significant deviations in the late season. Parameter variability and robustness of the different CWSI estimates

  3. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid

    2010-10-01

    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  4. Global Collaborative STEM Education

    Science.gov (United States)

    Meabh Kelly, Susan; Smith, Walter

    2016-04-01

    Global Collaborative STEM Education, as the name suggests, simultaneously supports two sets of knowledge and skills. The first set is STEM -- science, technology, engineering and math. The other set of content knowledge and skills is that of global collaboration. Successful global partnerships require awareness of one's own culture, the biases embedded within that culture, as well as developing awareness of the collaborators' culture. Workforce skills fostered include open-mindedness, perseverance when faced with obstacles, and resourceful use of technological "bridges" to facilitate and sustain communication. In respect for the 2016 GIFT Workshop focus, Global Collaborative STEM Education projects dedicated to astronomy research will be presented. The projects represent different benchmarks within the Global Collaborative STEM Education continuum, culminating in an astronomy research experience that fully reflects how the global STEM workforce collaborates. To facilitate wider engagement in Global Collaborative STEM Education, project summaries, classroom resources and contact information for established international collaborative astronomy research projects will be disseminated.

  5. What is the Optimal Water Productivity Index for Irrigated Grapevines? Case of 'Godello' and 'Albariño' cultivars

    Science.gov (United States)

    Fandiño, María; Martínez, Emma M.; Rey, Benjamín J.; Cancela, Javier J.

    2015-04-01

    Different studies have tackled the conceptual and terminological study of crop water use indicators, mainly water use efficiency (WUE) and water productivity (WP) (Pereira et al., 2012; Scheierling et al., 2014). The high number of stakeholders, working about agricultural water use (hydrology and hydrogeology, civil and irrigation engineering, agronomy and crop physiology, economics), has hindered the real improvement thereof, from a multidisciplinary perspective. For example, Flexas et al. (2010) reviewed the future improvements in water use efficiency in grapevines, from a physiological approach. In this study, two grapevine cultivars, priority in Galicia (Spain): 'Godello' (DO Valdeorras) and 'Albariño' (DO Rías Baixas, two locations), was assessed in relation to four water productivity index, focus on irrigation systems, agronomy and crop physiology aspects, during a wet year (2012). All WP index was referred to farm yield level (kg ha-1); where the denominator applied to WPTWU, include all components of soil water balance; to WPTWUfarm, introduced rainfall and irrigation depth; to WPIrrig, only irrigation depth applied; and to WPT, crop transpiration was used. In the last index, SIMDualKc model was used to partitioning crop evapotranspiration and cover crop transpiration. Different ranges of values was obtained for both cultivars, WPTWUfarm was higher in cv 'Godello' than in cv 'Albariño', 3.8 and 0.9 kg m-3 respectively. Average value to WPIrrig has showed: 17.6 kg m-3 for cv 'Albariño' and 15.5 kg m-3 for cv 'Godello', due to a reduction of 60% of irrigation depth in DO Rías Baixas. However, for both locations, higher WPIrrig was obtained to drip irrigation system versus subsurface drip irrigation. WPT showed a different tendency, rain-fed 'Godello' and surface drip irrigation 'Albariño' treatments obtained higher values (6.8 and 3.6 kg m-3), with higher WPT to cv 'Godello' for all treatments versus 'Albariño'. Results had showed that water

  6. Dental pulp stem cells

    DEFF Research Database (Denmark)

    Ashri, N. Y.; Ajlan, S. A.; Aldahmash, Abdullah M.

    2015-01-01

    scaffold, and guided through signaling molecules. Dental pulp stem cells have been used in an increasing number of studies in dental tissue engineering. Those cells show mesenchymal (stromal) stem cell-like properties including self-renewal and multilineage differentiation potentials, aside from...... an updated review on dental pulp stem cells and their applications in periodontal regeneration, in combination with different scaffolds and growth factors....

  7. Integrative STEM Education Defined

    OpenAIRE

    Sanders, Mark E.

    2015-01-01

    “My work with integrative STEM education began in 1990 with the NSF-funded Technology, Science, Mathematics Integration Project… By 2008, I was convinced “STEM Education” was (and always would be) a hopelessly ambiguous phrase, and therefore felt we absolutely needed to rename our “STEM Education” graduate program and develop a tight operational definition of the central idea underlying our program, in hopes of preventing the sort of hopeless ambiguity that ruined the term “STEM education” fr...

  8. Stem Cells and Aging.

    Science.gov (United States)

    Koliakos, George

    2017-02-01

    The article is a presentation at the 4th Conference of ESAAM, which took place on October 30-31, 2015, in Athens, Greece. Its purpose was not to cover all aspects of cellular aging but to share with the audience of the Conference, in a 15-minute presentation, current knowledge about the rejuvenating and repairing somatic stem cells that are distinct from other stem cell types (such as embryonic or induced pluripotent stem cells), emphasize that our body in old age cannot take advantage of these rejuvenating cells, and provide some examples of novel experimental stem cell applications in the field of rejuvenation and antiaging biomedical research.

  9. SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects.

    Science.gov (United States)

    Dereeper, Alexis; Nicolas, Stéphane; Le Cunff, Loïc; Bacilieri, Roberto; Doligez, Agnès; Peros, Jean-Pierre; Ruiz, Manuel; This, Patrice

    2011-05-05

    High-throughput re-sequencing, new genotyping technologies and the availability of reference genomes allow the extensive characterization of Single Nucleotide Polymorphisms (SNPs) and insertion/deletion events (indels) in many plant species. The rapidly increasing amount of re-sequencing and genotyping data generated by large-scale genetic diversity projects requires the development of integrated bioinformatics tools able to efficiently manage, analyze, and combine these genetic data with genome structure and external data. In this context, we developed SNiPlay, a flexible, user-friendly and integrative web-based tool dedicated to polymorphism discovery and analysis. It integrates:1) a pipeline, freely accessible through the internet, combining existing softwares with new tools to detect SNPs and to compute different types of statistical indices and graphical layouts for SNP data. From standard sequence alignments, genotyping data or Sanger sequencing traces given as input, SNiPlay detects SNPs and indels events and outputs submission files for the design of Illumina's SNP chips. Subsequently, it sends sequences and genotyping data into a series of modules in charge of various processes: physical mapping to a reference genome, annotation (genomic position, intron/exon location, synonymous/non-synonymous substitutions), SNP frequency determination in user-defined groups, haplotype reconstruction and network, linkage disequilibrium evaluation, and diversity analysis (Pi, Watterson's Theta, Tajima's D).Furthermore, the pipeline allows the use of external data (such as phenotype, geographic origin, taxa, stratification) to define groups and compare statistical indices.2) a database storing polymorphisms, genotyping data and grapevine sequences released by public and private projects. It allows the user to retrieve SNPs using various filters (such as genomic position, missing data, polymorphism type, allele frequency), to compare SNP patterns between populations, and to

  10. The impact of cluster thinning on fertility and berry and wine composition of 'Blauer Portugieser' (Vitis vinifera L. grapevine variety

    Directory of Open Access Journals (Sweden)

    Jan Reščič

    2015-12-01

    Full Text Available Aim: Two different yield reductions based on cluster thinning (CT were performed to determine their impact on vine growth, yield, and grape and wine composition of 'Blauer Portugieser' grapevine variety. Methods and results: Two levels of cluster thinning (limited CT1 – 20-30 % and severe CT2 – 40-50 % cluster reduction were applied at the pea-size berry (BBCH 75 phenological stage in 2007, 2008 and 2011. The potential impact of CT was determined by measurements of vine growth and fertility potential, berry weight, berry colour, soluble solids content, titratable acidity, pH and total phenolics. Additionally, for the first time, individual phenolic compounds were identified and quantified in berry skin and wine by HPLC-MS. In general, CT of 'Blauer Portugieser' significantly decreased titratable acidity in grape and wine, and increased pH and chromatic parameters in grape and alcohol content and volatile acidity in wine. A significant decrease in yield per vine (of 0.92 kg of grape/vine, together with an increase in soluble solids (of 2.8 °Brix in grape and pH and total extract content in wine was only observed in severe CT (CT2. Furthermore, CT2 significantly increased the content of total anthocyanins, flavonols and hydroxycinnamic acids, but not total flavanols, in grape and wine. CT2 significantly increased the content and proportion of p-coumaroyl pentose in grape and wine, catechin in grape, epicatechin in wine, quercetin-3-glucuronide (the main flavonol in 'Blauer Portugieser' in grape and wine, the content of myricetin-3-glucoside in grape, and the content of 3-glucosides of laricitrin, myricetin and quercetin in wine. Finally, CT2 increased the content and the proportion of 3-glucosides of delphinidin, petunidin and peonidin but decreased the proportion of malvidin-3-glucoside in grape and wine. Conclusion: A significant impact on yield and grape and wine composition was observed, particularly in the CT2 treatment, in which the

  11. Photosynthetic responses to heat treatments at different temperatures and following recovery in grapevine (Vitis amurensis L.) leaves.

    Science.gov (United States)

    Luo, Hai-Bo; Ma, Ling; Xi, Hui-Feng; Duan, Wei; Li, Shao-Hua; Loescher, Wayne; Wang, Jun-Fang; Wang, Li-Jun

    2011-01-01

    The electron transport chain, Rubisco and stomatal conductance are important in photosynthesis. Little is known about their combined responses to heat treatment at different temperatures and following recovery in grapevines (Vitis spp.) which are often grown in climates with high temperatures. The electron transport function of photosystem II, the activation state of Rubisco and the influence of stomatal behavior were investigated in grapevine leaves during heat treatments and following recovery. High temperature treatments included 35, 40 and 45°C, with 25°C as the control and recovery temperature. Heat treatment at 35°C did not significantly (P>0.05) inhibit net photosynthetic rate (P(n)). However, with treatments at 40 and 45°C, P(n) was decreased, accompanied by an increase in substomatal CO(2) concentration (C(i)), decreases in stomatal conductance (g(s)) and the activation state of Rubisco, and inhibition of the donor side and the reaction center of PSII. The acceptor side of PSII was inhibited at 45°C but not at 40°C. When grape leaves recovered following heat treatment, P(n), g(s) and the activation state of Rubisco also increased, and the donor side and the reaction center of PSII recovered. The increase in P(n) during the recovery period following the second 45°C stress was slower than that following the 40°C stress, and these increases corresponded to the donor side of PSII and the activation state of Rubisco. Heat treatment at 35°C did not significantly (P>0.05) influence photosynthesis. The decrease of P(n) in grape leaves exposed to more severe heat stress (40 or 45°C) was mainly attributed to three factors: the activation state of Rubisco, the donor side and the reaction center of PSII. However, the increase of P(n) in grape leaves following heat stress was also associated with a stomatal response. The acceptor side of PSII in grape leaves was responsive but less sensitive to heat stress.

  12. The stem factor challenge

    International Nuclear Information System (INIS)

    Russell, M.J.; Steele, R. Jr.; DeWall, K.G.; Watkins, J.C.; Bramwell, D.

    1994-01-01

    One of the most important challenges that still needs to be met in the effort to understand the operation of motor-operated, rising-stem valves is the ability to determine stem factor throughout the valve's load range. The stem factor represents the conversion of operator torque to stem thrust. Determining the stem factor is important because some motor-operated valves (MOVs) cannot be tested in the plant at design basis conditions. The ability of these valves to perform their design basis function (typically, to operate against specified flow and pressure loads) must be ensured by analytical methods or by extrapolating from the results of tests conducted at lower loads. Because the stem factor tends to vary in response to friction and lubrication phenomena that occur during loading and wedging, analytical methods and extrapolation methods have been difficult to develop and implement. Early investigations into variability in the stem factor tended to look only at the tip of the iceberg; they focused on what was happening at torque switch trip, which usually occurs at full wedging. In most stems, the stem factor is better (lower) in the wedging transient than before wedging, so working with torque switch trip data alone led many early researchers to false conclusions about the relationship between stem factor and load. However, research at the Idaho National Engineering Laboratory (INEL) has taken a closer look at what happens during the running portion of the closing stroke along with the wedging portion. This shift in focus is important, because functional failure of a valve typically consists of a failure to isolate flow, not a failure to achieve full wedging. Thus, the stem factor that must be determined for a valve's design basis closing requirements is the one that corresponds with the running load before wedging

  13. Donating Peripheral Blood Stem Cells

    Science.gov (United States)

    ... Print this page My Cart Donating peripheral blood stem cells Peripheral blood stem cell (PBSC) donation is a nonsurgical procedure to collect ... Donating bone marrow Donor experiences videos Peripheral blood stem cell (PBSC) donation is one of two methods of ...

  14. Stem Cell Transplants (For Teens)

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Stem Cell Transplants KidsHealth / For Teens / Stem Cell Transplants What's ... Take to Recover? Coping Print What Are Stem Cells? As you probably remember from biology class, every ...

  15. Colorectal cancer stem cells.

    Science.gov (United States)

    Salama, Paul; Platell, Cameron

    2009-10-01

    Somatic stem cells reside at the base of the crypts throughout the colonic mucosa. These cells are essential for the normal regeneration of the colonic epithelium. The stem cells reside within a special 'niche' comprised of intestinal sub-epithelial myofibroblasts that tightly control their function. It has been postulated that mutations within these adult colonic stem cells may induce neoplastic changes. Such cells can then dissociate from the epithelium and travel into the mesenchyme and thus form invasive cancers. This theory is based on the observation that within a colon cancer, less than 1% of the neoplastic cells have the ability to regenerate the tumour. It is this group of cells that exhibits characteristics of colonic stem cells. Although anti-neoplastic agents can induce remissions by inhibiting cell division, the stem cells appear to be remarkably resistant to both standard chemotherapy and radiotherapy. These stem cells may therefore persist after treatment and form the nucleus for cancer recurrence. Hence, future treatment modalities should focus specifically on controlling the cancer stem cells. In this review, we discuss the biology of normal and malignant colonic stem cells.

  16. Aneuploidy in stem cells

    NARCIS (Netherlands)

    Garcia-Martinez, Jorge; Bakker, Bjorn; Schukken, Klaske M; Simon, Judith E; Foijer, Floris

    2016-01-01

    Stem cells hold enormous promise for regenerative medicine as well as for engineering of model systems to study diseases and develop new drugs. The discovery of protocols that allow for generating induced pluripotent stem cells (IPSCs) from somatic cells has brought this promise steps closer to

  17. Dazlin' pluripotent stem cells

    NARCIS (Netherlands)

    Welling, M.A.

    2014-01-01

    Pluripotent embryonic stem cells (ESCs) can be isolated from the inner cell mass (ICM) of blastocyst embryos and differentiate into all three germ layers in vitro. However, despite their similar origin, mouse embryonic stem cells represent a more naïve ICM-like pluripotent state whereas human

  18. Cancer stem cells revisited

    NARCIS (Netherlands)

    Batlle, Eduard; Clevers, Hans

    2017-01-01

    The cancer stem cell (CSC) concept was proposed four decades ago, and states that tumor growth, analogous to the renewal of healthy tissues, is fueled by small numbers of dedicated stem cells. It has gradually become clear that many tumors harbor CSCs in dedicated niches, and yet their

  19. The Hidden STEM Economy

    Science.gov (United States)

    Rothwell, Jonathan

    2013-01-01

    Workers in STEM (science, technology, engineering, and math) fields play a direct role in driving economic growth. Yet, because of how the STEM economy has been defined, policymakers have mainly focused on supporting workers with at least a bachelor's (BA) degree, overlooking a strong potential workforce of those with less than a BA. This report…

  20. First steps in translating human cognitive processes of cane pruning grapevines into AI rules for automated robotic pruning

    Directory of Open Access Journals (Sweden)

    Saxton Valerie

    2014-01-01

    Full Text Available Cane pruning of grapevines is a skilled task for which, internationally, there is a dire shortage of human pruners. As part of a larger project developing an automated robotic pruner, we have used artificial intelligence (AI algorithms to create an expert system for selecting new canes and cutting off unwanted canes. A domain and ontology has been created for AI, which reflects the expertise of expert human pruners. The first step in the creation of an expert system was to generate virtual vines, which were then ‘pruned’ by human pruners and also by the expert system in its infancy. Here we examined the decisions of 12 human pruners, for consistency of decision, on 60 virtual vines. 96.7% of the 12 pruners agreed on at least one cane choice after which there was diminishing agreement on which further canes to select for laying. Our results indicate that techniques developed in computational intelligence can be used to co-ordinate and synthesise the expertise of human pruners into a best practice format. This paper describes first steps in this knowledge elicitation process, and discusses the fit between cane pruning expertise and the expertise that can be elicited using AI based expert system techniques.

  1. The DinJ/RelE Toxin-Antitoxin System Suppresses Bacterial Proliferation and Virulence of Xylella fastidiosa in Grapevine.

    Science.gov (United States)

    Burbank, Lindsey P; Stenger, Drake C

    2017-04-01

    Xylella fastidiosa, the causal agent of Pierce's disease of grapes, is a slow-growing, xylem-limited, bacterial pathogen. Disease progression is characterized by systemic spread of the bacterium through xylem vessel networks, causing leaf-scorching symptoms, senescence, and vine decline. It appears to be advantageous to this pathogen to avoid excessive blockage of xylem vessels, because living bacterial cells are generally found in plant tissue with low bacterial cell density and minimal scorching symptoms. The DinJ/RelE toxin-antitoxin system is characterized here for a role in controlling bacterial proliferation and population size during plant colonization. The DinJ/RelE locus is transcribed from two separate promoters, allowing for coexpression of antitoxin DinJ with endoribonuclease toxin RelE, in addition to independent expression of RelE. The ratio of antitoxin/toxin expressed is dependent on bacterial growth conditions, with lower amounts of antitoxin present under conditions designed to mimic grapevine xylem sap. A knockout mutant of DinJ/RelE exhibits a hypervirulent phenotype, with higher bacterial populations and increased symptom development and plant decline. It is likely that DinJ/RelE acts to prevent excessive population growth, contributing to the ability of the pathogen to spread systemically without completely blocking the xylem vessels and increasing probability of acquisition by the insect vector.

  2. Vanillylacetone up-regulates anthocyanin accumulation and expression of anthocyanin biosynthetic genes by inducing endogenous abscisic acid in grapevine tissues.

    Science.gov (United States)

    Enoki, Shinichi; Hattori, Tomoki; Ishiai, Shiho; Tanaka, Sayumi; Mikami, Masachika; Arita, Kayo; Nagasaka, Shu; Suzuki, Shunji

    2017-12-01

    We investigated the effect of vanillylacetone (VA) on anthocyanin accumulation with aim of improving grape berry coloration. Spraying Vitis vinifera cv. Muscat Bailey A berries with VA at veraison increased sugar/acid ratio, an indicator of maturation and total anthocyanin accumulation. To elucidate the molecular mechanism underlying the effect of VA on anthocyanin accumulation, in vitro VA treatment of a grapevine cell culture was carried out. Endogenous abscisic acid (ABA) content was higher in the VA-treated cell cultures than in control at 3h after treatment. Consistent with this, the relative expression levels of anthocyanin-synthesis-related genes, including DFR, LDOX, MybA1 and UFGT, in VA-treated cell cultures were much higher than those in control, and high total anthocyanin accumulation was noted in the VA-treated cell cultures as well. These results suggest that VA up-regulates the expression of genes leading to anthocyanin accumulation by inducing endogenous ABA. In addition, VA increased total anthocyanin content in a dose-dependent manner. Although VA treatment in combination with exogenous ABA did not exhibit any synergistic effect, treatment with VA alone showed an equivalent effect to that with exogenous ABA alone on total anthocyanin accumulation. These findings point to the possibility of using VA for improving grape berry coloration. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. A UDP-Glucose:Monoterpenol Glucosyltransferase Adds to the Chemical Diversity of the Grapevine Metabolome1[W

    Science.gov (United States)

    Bönisch, Friedericke; Frotscher, Johanna; Stanitzek, Sarah; Rühl, Ernst; Wüst, Matthias; Bitz, Oliver; Schwab, Wilfried

    2014-01-01

    Terpenoids represent one of the major classes of natural products and serve different biological functions. In grape (Vitis vinifera), a large fraction of these compounds is present as nonvolatile terpene glycosides. We have extracted putative glycosyltransferase (GT) sequences from the grape genome database that show similarity to Arabidopsis (Arabidopsis thaliana) GTs whose encoded proteins glucosylate a diversity of terpenes. Spatial and temporal expression levels of the potential VvGT genes were determined in five different grapevine varieties. Heterologous expression and biochemical assays of candidate genes led to the identification of a UDP-glucose:monoterpenol β-d-glucosyltransferase (VvGT7). The VvGT7 gene was expressed in various tissues in accordance with monoterpenyl glucoside accumulation in grape cultivars. Twelve allelic VvGT7 genes were isolated from five cultivars, and their encoded proteins were biochemically analyzed. They varied in substrate preference and catalytic activity. Three amino acids, which corresponded to none of the determinants previously identified for other plant GTs, were found to be important for enzymatic catalysis. Site-specific mutagenesis along with the analysis of allelic proteins also revealed amino acids that impact catalytic activity and substrate tolerance. These results demonstrate that VvGT7 may contribute to the production of geranyl and neryl glucoside during grape ripening. PMID:24784757

  4. Grapevine rootstocks differentially affect the rate of ripening and modulate auxin-related genes in Cabernet Sauvignon berries

    Directory of Open Access Journals (Sweden)

    Massimiliano eCorso

    2016-02-01

    Full Text Available In modern viticulture, grafting commercial grapevine varieties on interspecific rootstocks is a common practice required for conferring resistance to many biotic and abiotic stresses. Nevertheless, the use of rootstocks to gain these essential traits is also known to impact grape berry development and quality, although the underlying mechanisms are still poorly understood. In grape berries, the onset of ripening (véraison is regulated by a complex network of mobile signals including hormones such as auxins, ethylene, abscisic acid and brassinosteroids. Recently, a new rootstock, designated M4, was selected based on its enhanced tolerance to water stress and medium vigour. This study investigates the effect of M4 on Cabernet Sauvignon (CS berry development in comparison to the commercial 1103P rootstock. Physical and biochemical parameters showed that the ripening rate of CS berries is faster when grafted onto M4. A multifactorial analysis performed on mRNA-Seq data obtained from skin and pulp of berries grown in both graft combinations revealed that genes controlling auxin action (ARF and Aux/IAA represent one of main categories affected by the rootstock genotype. Considering that the level of auxin tightly regulates the transcription of these genes, we investigated the behaviour of the main gene families involved in auxin biosynthesis and conjugation. Molecular and biochemical analyses confirmed a link between the rate of berry development and the modulation of auxin metabolism. Moreover the data indicate that this phenomenon appears to be particularly pronounced in skin tissue in comparison to the flesh.

  5. Grapevine Rootstocks Differentially Affect the Rate of Ripening and Modulate Auxin-Related Genes in Cabernet Sauvignon Berries.

    Science.gov (United States)

    Corso, Massimiliano; Vannozzi, Alessandro; Ziliotto, Fiorenza; Zouine, Mohamed; Maza, Elie; Nicolato, Tommaso; Vitulo, Nicola; Meggio, Franco; Valle, Giorgio; Bouzayen, Mondher; Müller, Maren; Munné-Bosch, Sergi; Lucchin, Margherita; Bonghi, Claudio

    2016-01-01

    In modern viticulture, grafting commercial grapevine varieties on interspecific rootstocks is a common practice required for conferring resistance to many biotic and abiotic stresses. Nevertheless, the use of rootstocks to gain these essential traits is also known to impact grape berry development and quality, although the underlying mechanisms are still poorly understood. In grape berries, the onset of ripening (véraison) is regulated by a complex network of mobile signals including hormones such as auxins, ethylene, abscisic acid, and brassinosteroids. Recently, a new rootstock, designated M4, was selected based on its enhanced tolerance to water stress and medium vigor. This study investigates the effect of M4 on Cabernet Sauvignon (CS) berry development in comparison to the commercial 1103P rootstock. Physical and biochemical parameters showed that the ripening rate of CS berries is faster when grafted onto M4. A multifactorial analysis performed on mRNA-Seq data obtained from skin and pulp of berries grown in both graft combinations revealed that genes controlling auxin action (ARF and Aux/IAA) represent one of main categories affected by the rootstock genotype. Considering that the level of auxin tightly regulates the transcription of these genes, we investigated the behavior of the main gene families involved in auxin biosynthesis and conjugation. Molecular and biochemical analyses confirmed a link between the rate of berry development and the modulation of auxin metabolism. Moreover, the data indicate that this phenomenon appears to be particularly pronounced in skin tissue in comparison to the flesh.

  6. The effect of strobilurins on leaf gas exchange, water use efficiency and ABA content in grapevine under field conditions.

    Science.gov (United States)

    Diaz-Espejo, Antonio; Cuevas, María Victoria; Ribas-Carbo, Miquel; Flexas, Jaume; Martorell, Sebastian; Fernández, José Enrique

    2012-03-01

    Strobilurins are one of the most important classes of agricultural fungicides. In addition to their anti-fungal effect, strobilurins have been reported to produce simultaneous effects in plant physiology. This study investigated whether the use of strobilurin fungicide improved water use efficiency in leaves of grapevines grown under field conditions in a Mediterranean climate in southern Spain. Fungicide was applied three times in the vineyard and measurements of leaf gas exchange, plant water status, abscisic acid concentration in sap ([ABA]), and carbon isotope composition in leaves were performed before and after applications. No clear effect on stomatal conductance, leaf water potential and intrinsic water use efficiency was found after three fungicide applications. ABA concentration was observed to increase after fungicide application on the first day, vanishing three days later. Despite this transient effect, evolution of [ABA] matched well with the evolution of leaf carbon isotope ratio, which can be used as a surrogate for plant water use efficiency. Morning stomatal conductance was negatively correlated to [ABA]. Yield was enhanced in strobilurin treated plants, whereas fruit quality remained unaltered. Published by Elsevier GmbH.

  7. Anti-Cancer Activity of Resveratrol and Derivatives Produced by Grapevine Cell Suspensions in a 14 L Stirred Bioreactor

    Directory of Open Access Journals (Sweden)

    Laetitia Nivelle

    2017-03-01

    Full Text Available In the present study, resveratrol and various oligomeric derivatives were obtained from a 14 L bioreactor culture of elicited grapevine cell suspensions (Vitis labrusca L.. The crude ethyl acetate stilbene extract obtained from the culture medium was fractionated by centrifugal partition chromatography (CPC using a gradient elution method and the major stilbenes contained in the fractions were subsequently identified by using a 13C-NMR-based dereplication procedure and further 2D NMR analyses including HSQC, HMBC, and COSY. Beside δ-viniferin (2, leachianol F (4 and G (4′, four stilbenes (resveratrol (1, ε-viniferin (5, pallidol (3 and a newly characterized dimer (6 were recovered as pure compounds in sufficient amounts to allow assessment of their biological activity on the cell growth of three different cell lines, including two human skin malignant melanoma cancer cell lines (HT-144 and SKMEL-28 and a healthy human dermal fibroblast HDF line. Among the dimers obtained in this study, the newly characterized resveratrol dimer (6 has never been described in nature and its biological potential was evaluated here for the first time. ε-viniferin as well as dimer (6 showed IC50 values on the three tested cell lines lower than the ones exerted by resveratrol and pallidol. However, activities of the first two compounds were significantly decreased in the presence of fetal bovine serum although that of resveratrol and pallidol was not. The differential tumor activity exerted by resveratrol on healthy and cancer lines was also discussed.

  8. Effect of grapevine latent buds (Vitis vinifera L., cv. Merlot chilling on their starch content: biochimical and cytological approachs

    Directory of Open Access Journals (Sweden)

    Tayeb Koussa

    2001-12-01

    Full Text Available Biochimical analysis and photonic microscopy observations of starch were investigated in latent buds of Vitis vinifera L. (cv. Merlot collected during their dormancy phase and during their cold storage at 2°C. Biochimical analysis showed that starch levels of grapevine latent buds was high (70 mg/g DW. Microscopical observations confirmed this result and showed a gradient of starch content in different regions of bud in which the foliars primordiums and scales were the starch richer. Buds conservation at 2°C reduced their starch content but this decrease begun only after 9 days of chilling corresponding to the time necessary for budbreak and for the beginning of increase the bud burst ability. The hydrolysis of starch seems begun at the first in apex and then propaged to the other regions of bud. In the scales, the most exposed region to cold, storage at 2°C during 56 days induced an increase of cellular tannins content and cell walls polysaccharides. These results were discuted in relation to the increase of bud burst ability and to their cold acclimatation.

  9. The effects of callus age, UV irradiation and incubation time on trans-resveratol production in grapevine callus culture

    International Nuclear Information System (INIS)

    Keskin, N.; Kunter, B.

    2009-01-01

    In this study, the effects of callus age, ultraviolet (UV) irradiation and incubation time were investigated for the induction of trans-resveratrol production in callus cultures of Kalecik karası (Clone 12) Vitis vinifera L. grape cultivar. Part of leaves (~1 cm 2 ) were taken from one year old grapevines grown in greenhouse and then were cultured in Gamborg B-5 media including 2% saccarose, 0.8% agar, 1.0 μM BAP (6-benzylaminopurine) and 0.1 μM 2, 4-D (2, 4-dichlorophenoxy-acetic acid). After the second subculture, 12 and 15 days old callus tissues were exposed to 254 nm UV light at 10 cm distance from the source for 10 and 15 min. Trans-resveratrol was measured at 0, 24, 48 and 72 hours of incubation by using High Pressure Liquid Chromatography (HPLC). Trans-resveratrol concentration of control callus ranged from 0.56 to 0.96 μg g fw -1 . The highest trans-resveratrol production was obtained from 12 and 15 days-old callus irradiated for 10 min. at the 48th hours of incubation (2.42 μg g fw -1 ). Considering the highest value of trans-resveratrol concentration in controls and experiments, it was determined that UV irraditation in Kalecik karası elicitated the trans-resveratrol production by 2.5 times. (author) [tr

  10. Quantification of abscisic acid in grapevine leaf (Vitis vinifera) by isotope-dilution liquid chromatography-mass spectrometry.

    Science.gov (United States)

    Vilaró, Francisca; Canela-Xandri, Anna; Canela, Ramon

    2006-09-01

    A specific, sensitive, precise, and accurate method for the determination of abscisic acid (ABA) in grapevine leaf tissues is described. The method employs high-performance liquid chromatography and electrospray ionization-mass spectrometry (LC-ESI-MS) in selected ion monitoring mode (SIM) to analyze ABA using a stable isotope-labeled ABA as an internal standard. Absolute recoveries ranged from 72% to 79% using methanol/water pH 5.5 (50:50 v/v) as an extraction solvent. The best efficiency was obtained when the chromatographic separation was carried out by using a porous graphitic carbon (PGC) column. The statistical evaluation of the method was satisfactory in the work range. A relative standard deviation (RDS) of < 5.5% and < 6.0% was obtained for intra-batch and inter-batch comparisons, respectively. As for accuracy, the relative error (%Er) was between -2.7 and 4.3%, and the relative recovery ranged from 95% to 107%.

  11. Hot Water Treatment, Trunk Diseases and Other Critical Factors in the Production of High-Quality Grapevine Planting Material

    Directory of Open Access Journals (Sweden)

    H. Waite

    2007-04-01

    Full Text Available This review describes the critical factors on which successful grapevine propagation depends and discusses the steps that can be taken to improve the quality of planting material available to growers. Spasmodic occurrences of young vine decline and the failure of planting material have plagued the wine industry since the 1990s. The syndrome now described as Petri disease has been identified as the probable cause of many of the failures, but hot water treatment (HWT of dormant cuttings (50°C/30 min, for the control of Phaeomoniella chlamydospora and other endogenous pathogens, has also been implicated in the losses. HWT is known to cause a temporary switch to fermentative respiration and early retarded growth in treated material, particularly in Pinot Noir, but the effects of HWT on dormant vine tissue are not yet fully understood. Poor nursery hygiene and poor storage and handling practices during propagation and planting have also been implicated in vine failure. Demand for planting material has exceeded supply and there has been little incentive for nurseries to improve their standards. The quality of planting material could be significantly improved by changing nursery practices, particularly by discontinuing the practice of soaking cuttings in water, treated or untreated, and by improving general standards of nursery hygiene and the management of cool rooms. There is a need to develop a set of universal quality standards for cuttings and rooted vines. Growers also need to be made aware of the characteristics and benefits of high quality planting material.

  12. The p19 protein of Grapevine Algerian latent virus is a determinant of systemic infection of Chenopodium quinoa.

    Science.gov (United States)

    Kim, Semin; Cho, Won Kyong; Lee, Hyeok-Geun; Park, Sang-Ho; Sohn, Seong-Han; Kim, Kook-Hyung

    2012-04-01

    A previous study showed that both Grapevine Algerian latent virus (GALV) and Tomato bushy stunt virus (TBSV) systemically infect Nicotiana benthamiana, but GALV causes systemic infection whereas TBSV causes only local lesions in Chenopodium quinoa (C. quinoa). We recently isolated GALV strain Naju (GALV-N) from Limonium sinense and TBSV strain Sacheon (TBSV-S) from tomato. Both viruses belong to the genus Tombusvirus and have a similar genome organization. To identify determinants of systemic infection of GALV-N in C. quinoa in the current study, we generated infectious clones and capsid protein (CP)-deletion clones for the two viruses and confirmed that CP of GALV-N is required for systemic infection of C. quinoa due to its primary structural role in virus assembly. Through the use of chimeras, we identified a viral factor in addition to CP that contributes to systemic infection by GALV-N. Inactivation of the p19 demonstrated that host-specific activities of p19 are necessary for efficient systemic infection of C. quinoa by GALV-N. Our study is the first report to determine the viral factors required for systemic infection of GALV in C. quinoa. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. The grapevine VvWRKY2 gene enhances salt and osmotic stress tolerance in transgenic Nicotiana tabacum.

    Science.gov (United States)

    Mzid, Rim; Zorrig, Walid; Ben Ayed, Rayda; Ben Hamed, Karim; Ayadi, Mariem; Damak, Yosra; Lauvergeat, Virginie; Hanana, Mohsen

    2018-06-01

    Our study aims to assess the implication of WRKY transcription factor in the molecular mechanisms of grapevine adaptation to salt and water stresses. In this respect, a full-length VvWRKY2 cDNA, isolated from a Vitis vinifera grape berry cDNA library, was constitutively over-expressed in Nicotiana tabacum seedlings. Our results showed that transgenic tobacco plants exhibited higher seed germination rates and better growth, under both salt and osmotic stress treatments, when compared to wild type plants. Furthermore, our analyses demonstrated that, under stress conditions, transgenic plants accumulated more osmolytes, such as soluble sugars and free proline, while no changes were observed regarding electrolyte leakage, H 2 O 2 , and malondialdehyde contents. The improvement of osmotic adjustment may be an important mechanism underlying the role of VvWRKY 2 in promoting tolerance and adaptation to abiotic stresses. Principal component analysis of our results highlighted a clear partition of plant response to stress. On the other hand, we observed a significant adaptation behaviour response for transgenic lines under stress. Taken together, all our findings suggest that over-expression of VvWRKY2 gene has a compelling role in abiotic stress tolerance and, therefore, would provide a useful strategy to promote abiotic stress tolerance in grape via molecular-assisted breeding and/or new biotechnology tools.

  14. Vascular development of the grapevine (Vitis vinifera L.) inflorescence rachis in response to flower number, plant growth regulators and defoliation.

    Science.gov (United States)

    Gourieroux, Aude M; Holzapfel, Bruno P; McCully, Margaret E; Scollary, Geoffrey R; Rogiers, Suzy Y

    2017-09-01

    The grapevine inflorescence is a determinate panicle and as buds emerge, shoot, flower and rachis development occur simultaneously. The growth and architecture of the rachis is determined by genetic and environmental factors but here we examined the role of flower and leaf number as well as hormones on its elongation and vascular development. The consequences of rachis morphology and vascular area on berry size and composition were also assessed. One week prior to anthesis, Merlot and Cabernet Sauvignon field vines were exposed to manual flower removal, exogenous plant growth regulators or pre-bloom leaf removal. Manual removal of half the flowers along the vertical axis of the inflorescence resulted in a shorter rachis in both cultivars. Conversely, inflorescences treated with gibberellic acid (GA 3 ) and the synthetic cytokinin, 6-benzylaminopurine (BAP) resulted in a longer rachis while pre-bloom removal of all leaves on the inflorescence-bearing shoot did not alter rachis length relative to untreated inflorescences. Across the treatments, the cross-sectional areas of the conducting xylem and phloem in the rachis were positively correlated to rachis girth, flower number at anthesis, bunch berry number, bunch berry fresh mass and bunch sugar content at harvest. Conversely, average berry size and sugar content were not linked to rachis vascular area. These data indicate that the morphological and vascular development of the rachis was more responsive to flower number and plant growth regulators than to leaf removal.

  15. Effects of Bois noir on carbon assimilation, transpiration, stomatal conductance of leaves and yield of grapevine (Vitis vinifera) cv. Chardonnay.

    Science.gov (United States)

    Endeshaw, Solomon T; Murolo, Sergio; Romanazz, Gianfranco; Neri, Davide

    2012-06-01

    Bois noir (BN) is one of the main phytoplasma diseases of grapevine (Vitis vinifera). It is widespread, and can cause severe losses in European vineyards. The infective agent colonizes phloem elements and induces visible symptoms of leaf yellowing or reddening after a relatively long incubation period. As the most sensitive cultivars to BN, Chardonnay plants were grouped as healthy or symptomatic in spring, based on the records from the previous year. Leaf gas exchange and chlorophyll a fluorescence were measured weekly from July to September in healthy plants, and in symptomatic and asymptomatic leaves from symptomatic plants. The midday relative water content (mRWC) was measured once per month. The detection of phytoplasma DNA by nested-polymerase chain reaction revealed BN infection in symptomatic leaf samples at the end of September. A significant decrease in pigment content and maximum quantum efficiency of photosystem II (Fv/Fm) of these symptomatic leaves was detected from July to September, although in the asymptomatic leaves of the symptomatic plants the net photosynthesis (Pn) decrease was not significant. In the leaves from the healthy plants, Pn and transpiration were relatively stable. Of note, in July, an initially healthy plant showed a strong Pn reduction that was followed by visible leaf yellowing symptoms only in August. The phytoplasma infection also stimulated significant reductions in mRWC of the symptomatic leaves, with a final large decrease in yield.

  16. Distribution and reproduction of the reef fish Petrus rupestris (Pisces ...

    African Journals Online (AJOL)

    1988-05-06

    May 6, 1988 ... functional sexes, and the occurrence of sexual dichromatism, are described. Sexual maturity ... noted that spawning fish are found off the east coast of. South Africa. ...... species arid ecosystem approach to conservation. If sited.

  17. What is a stem cell?

    Science.gov (United States)

    Slack, Jonathan M W

    2018-05-15

    The historical roots of the stem cell concept are traced with respect to its usage in embryology and in hematology. The modern consensus definition of stem cells, comprising both pluripotent stem cells in culture and tissue-specific stem cells in vivo, is explained and explored. Methods for identifying stem cells are discussed with respect to cell surface markers, telomerase, label retention and transplantability, and properties of the stem cell niche are explored. The CreER method for identifying stem cells in vivo is explained, as is evidence in favor of a stochastic rather than an obligate asymmetric form of cell division. In conclusion, it is found that stem cells do not possess any unique and specific molecular markers; and stem cell behavior depends on the environment of the cell as well as the stem cell's intrinsic qualities. Furthermore, the stochastic mode of division implies that stem cell behavior is a property of a cell population not of an individual cell. In this sense, stem cells do not exist in isolation but only as a part of multicellular system. This article is categorized under: Adult Stem Cells, Tissue Renewal, and Regeneration > Tissue Stem Cells and Niches Adult Stem Cells, Tissue Renewal, and Regeneration > Methods and Principles Adult Stem Cells, Tissue Renewal, and Regeneration > Environmental Control of Stem Cells. © 2018 Wiley Periodicals, Inc.

  18. Effectiveness of inorganic and organic mulching for soil salinity and sodicity control in a grapevine orchard drip-irrigated with moderately saline waters

    Directory of Open Access Journals (Sweden)

    Ramón Aragüés

    2014-05-01

    Full Text Available Soil mulching is a sensible strategy to reduce evaporation, accelerate crop development, reduce erosion and assist in weed control, but its efficiency for soil salinity control is not as well documented. The benefits of inorganic (plastic and organic (grapevine pruning residues mulching for soil salinity and sodicity control were quantified in a grapevine orchard (cultivars ‘Autumn’ Royal and ‘Crimson’ drip-irrigated with moderately saline waters. Soil samples were taken at the beginning and end of the 2008 and 2009 irrigation seasons in six vines of each cultivar and mulching treatment. Soil saturation extract electrical conductivity (ECe, chloride (Cle and sodium adsorption ratio (SARe values increased in all treatments of both grapevines along the irrigation seasons, but the increases were much lower in the mulched than in the bare soils due to reduced evaporation losses and concomitant decreases in salt evapo-concentration. The absolute salinity and sodicity daily increases in ‘Autumn’ and ‘Crimson’ 2008 and in ‘Crimson’ 2009 were on the average 44% lower in the plastic and 76% lower in the organic mulched soils than in the bare soil. The greater efficiency of the organic than the plastic mulch in ‘Crimson’ 2009 was attributed to the leaching of salts by a precipitation of 104 mm that infiltrated the organic mulch but was intercepted by the plastic mulch. Although further work is needed to substantiate these results, the conclusion is that the plastic mulch and, particularly, the organic mulch were more efficient than the bare soil for soil salinity and sodicity control.

  19. Inspection of the grapevine BURP superfamily highlights an expansion of RD22 genes with distinctive expression features in berry development and ABA-mediated stress responses.

    Directory of Open Access Journals (Sweden)

    José Tomás Matus

    Full Text Available The RESPONSIVE TO DEHYDRATION 22 (RD22 gene is a molecular link between abscisic acid (ABA signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses

  20. Low level of pollen-mediated gene flow from cultivated to wild grapevine: consequences for the evolution of the endangered subspecies Vitis vinifera L. subsp. silvestris.

    Science.gov (United States)

    Di Vecchi-Staraz, Manuel; Laucou, Valérie; Bruno, Gérard; Lacombe, Thierry; Gerber, Sophie; Bourse, Thibaut; Boselli, Maurizio; This, Patrice

    2009-01-01

    A parentage and a paternity-based approach were tested for estimation of pollen-mediated gene flow in wild grapevine (Vitis vinifera L. subsp. silvestris), a wind-pollinated species occurring in Mediterranean Europe and southwestern Asia. For this purpose, 305 seedlings collected in 2 years at 2 locations in France from 4 wild female individuals and 417 wild individuals prospected from France and Italy were analyzed using 20 highly polymorphic microsatellite loci. Their profiles were compared with a database consisting of 3203 accessions from the Institut National de la Recherche Agronomique Vassal collection including cultivars, rootstocks, interspecific hybrids, and other wild individuals. Paternity was assigned for 202 (66.2%) of the 305 seedlings, confirming the feasibility of the method. Most of the fertilizing pollen could be assigned to wild males growing nearby. Estimates of pollen immigration from the cultivated compartment (i.e., the totality of cultivars) ranged from 4.2% to 26% from nearby vineyards and from hidden pollinators such as cultivars and rootstocks that had escaped from farms. In an open landscape, the pollen flow was correlated to the distance between individuals, the main pollinator being the closest wild male (accounting for 51.4-86.2% of the pollen flow). In a closed landscape, more complex pollination occurred. Analysis of the parentage of the 417 wild individuals also revealed relationships between nearby wild individuals, but in the case of 12 individuals (3%), analysis revealed pollen immigration from vineyards, confirming the fitness of the hybrid seedlings. These pollen fluxes may have a significant effect on the evolution of wild populations: on the one hand, the low level of pollen-mediated gene flow from cultivated to wild grapevine could contribute to a risk of extinction of the wild compartment (i.e., the totality of the wild individuals). On the other hand, pollen dispersal within the wild populations may induce inbreeding

  1. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  2. A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

    Science.gov (United States)

    Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

    2016-10-01

    Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  3. Inspection of the grapevine BURP superfamily highlights an expansion of RD22 genes with distinctive expression features in berry development and ABA-mediated stress responses.

    Science.gov (United States)

    Matus, José Tomás; Aquea, Felipe; Espinoza, Carmen; Vega, Andrea; Cavallini, Erika; Dal Santo, Silvia; Cañón, Paola; Rodríguez-Hoces de la Guardia, Amparo; Serrano, Jennifer; Tornielli, Giovanni Battista; Arce-Johnson, Patricio

    2014-01-01

    The RESPONSIVE TO DEHYDRATION 22 (RD22) gene is a molecular link between abscisic acid (ABA) signalling and abiotic stress responses. Its expression has been used as a reliable ABA early response marker. In Arabidopsis, the single copy RD22 gene possesses a BURP domain also located at the C-terminus of USP embryonic proteins and the beta subunit of polygalacturonases. In grapevine, a RD22 gene has been identified but putative paralogs are also found in the grape genome, possibly forming a large RD22 family in this species. In this work, we searched for annotations containing BURP domains in the Vitis vinifera genome. Nineteen proteins were defined by a comparative analysis between the two genome predictions and RNA-Seq data. These sequences were compared to other plant BURPs identified in previous genome surveys allowing us to reconceive group classifications based on phylogenetic relationships and protein motif occurrence. We observed a lineage-specific evolution of the RD22 family, with the biggest expansion in grapevine and poplar. In contrast, rice, sorghum and maize presented highly expanded monocot-specific groups. The Vitis RD22 group may have expanded from segmental duplications as most of its members are confined to a region in chromosome 4. The inspection of transcriptomic data revealed variable expression of BURP genes in vegetative and reproductive organs. Many genes were induced in specific tissues or by abiotic and biotic stresses. Three RD22 genes were further studied showing that they responded oppositely to ABA and to stress conditions. Our results show that the inclusion of RNA-Seq data is essential while describing gene families and improving gene annotations. Robust phylogenetic analyses including all BURP members from other sequenced species helped us redefine previous relationships that were erroneously established. This work provides additional evidence for RD22 genes serving as marker genes for different organs or stresses in grapevine.

  4. Bacteria in a woody fungal disease: characterization of bacterial communities in wood tissues of esca-foliar symptomatic and asymptomatic grapevines

    Directory of Open Access Journals (Sweden)

    Emilie eBruez

    2015-10-01

    Full Text Available Esca is a grapevine trunk disease (GTD associated with different pathogenic fungi inhabiting the woody tissues. Bacteria can also be found in such tissues and they may interact with these fungal colonizers. Although such types of microbial interaction have been observed for wood diseases in many trees, this has never been studied for grapevine. In this study, the bacterial microflora of different vine status (esca-symptomatic and asymptomatic, different anatomical part (trunk and cordon and different type of tissues (necrotic or not have been studied. Based on Single Strand Conformation Polymorphism (SSCP analyses, data showed that (i specific complexes of bacterial microflora colonize the wood of both necrotic and non-necrotic tissues of esca-foliar symptomatic and asymptomatic vines, and also that (ii depending on the anatomical part of the plant, cordon or trunk, differences could be observed between the bacterial communities. Such differences were also revealed through the Community-Level Physiological Profiling (CLPP with Biolog Ecoplates™. Two hundred seventeen bacterial strains were also isolated from plants samples and then assigned to bacterial species based on the 16S rRNA genes. Although Bacillus spp. and Pantoea agglomerans were the two most commonly isolated species from all kinds of tissues, various other taxa were also isolated. Inoculation of vine cuttings with 14 different bacterial species, and one GTD fungus, Neofusicoccum parvum, showed no impact of these bacteria on the size of the wood necroses caused by N. parvum. This study showed, therefore, that bacterial communities differ according to the anatomical part (trunk or cordon and/or the type of tissue (necrotic or non necrotic of wood of grapevine plants showing external symptoms of esca disease. However, research into bacteria having a role in GTD development needs further studies.

  5. Melatonin-producing endophytic bacteria from grapevine roots promote the abiotic stress-induced production of endogenous melatonin in their hosts

    Directory of Open Access Journals (Sweden)

    Jian Jiao

    2016-09-01

    Full Text Available Endophytes form symbiotic relationships with plants and constitute an important source of phytohormones and bioactive secondary metabolites for their hosts. To date, most studies of endophytes have focused on the influence of these microorganisms on plant growth and physiology and their role in plant defenses against biotic and abiotic stressors; however, to the best of our knowledge, the ability of endophytes to produce melatonin has not been reported. In the present study, we isolated and identified root-dwelling bacteria from three grapevine varieties and found that, when cultured under laboratory conditions, some of the bacteria strains secreted melatonin and tryptophan-ethyl ester. The endophytic bacterium Bacillus amyloliquefaciens SB-9 exhibited the highest level of in vitro melatonin secretion and also produced three intermediates of the melatonin biosynthesis pathway: 5-hydroxytryptophan, serotonin, and N-acetylserotonin. After B. amyloliquefaciens SB-9 colonization, the plantlets exhibited increased plant growth. Additionally, we found that, in grapevine plantlets exposed to salt or drought stress, colonization by B. amyloliquefaciens SB-9 increased the upregulation of melatonin synthesis, as well as that of its intermediates, but reduced the upregulation of grapevine tryptophan decaboxylase genes (VvTDCs and a serotonin N-acetyltransferase gene (VvSNAT transcription, when compared to the un-inoculated control. Colonization by B. amyloliquefaciens SB-9 was also able to counteract the adverse effects of salt- and drought-induced stress by reducing the production of malondialdehyde and reactive oxygen species (H2O2 and O2− in roots. Therefore, our findings demonstrate the occurrence of melatonin biosynthesis in endophytic bacteria and provide evidence for a novel form of communication between beneficial endophytes and host plants via melatonin.

  6. Environmental plasticity of Pinot noir grapevine leaves: A trans-European study of morphological and biochemical changes along a 1,500-km latitudinal climatic gradient

    Czech Academy of Sciences Publication Activity Database

    Castagna, A.; Csepregi, K.; Neugart, S.; Zipoli, G.; Večeřová, Kristýna; Jakab, G.; Jug, T.; Llorens, L.; Martínez-Abaigar, J.; Martínez-Lüscher, J.; Núñez-Olivera, E.; Ranieri, A.; Schoedl-Hummel, K.; Schreiner, M.; Teszlák, P.; Tittmann, S.; Urban, Otmar; Verdaguer, D.; Jansen, M. A. K.; Hideg, É.

    2017-01-01

    Roč. 40, č. 11 (2017), s. 2790-2805 ISSN 0140-7791 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LM2015061 Institutional support: RVO:86652079 Keywords : hydroxycinnamic acid- derivatives * oleracea var. sabellica * uv-b radiation * photosynthetically active radiation * different flavonol glycosides * alpha-tocopherol * arabidopsis-thaliana * phenolic-compounds * ultraviolet-radiation * natural-populations * alpha-tocopherol * carotenoids * climate * global radiation * grapevine * latitude * morphology * phenolic compounds * plasticity * ultraviolet radiation Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 6.173, year: 2016

  7. A new image-based tool for the high throughput phenotyping of pollen viability: evaluation of inter- and intra-cultivar diversity in grapevine.

    Science.gov (United States)

    Tello, Javier; Montemayor, María Ignacia; Forneck, Astrid; Ibáñez, Javier

    2018-01-01

    Low pollen viability may limit grapevine yield under certain conditions, causing relevant economic losses to grape-growers. It is usually evaluated by the quantification of the number of viable and non-viable pollen grains that are present in a sample after an adequate pollen grain staining procedure. Although the manual counting of both types of grains is the simplest and most sensitive approach, it is a laborious and time-demanding process. In this regard, novel image-based approaches can assist in the objective, accurate and cost-effective phenotyping of this trait. Here, we introduce PollenCounter, an open-source macro implemented as a customizable Fiji tool for the high-throughput phenotyping of pollen viability. This tool splits RGB images of stained pollen grains into its primary channels, retaining red and green color fractionated images (which contain information on total and only viable pollen grains, respectively) for the subsequent isolation and counting of the regions of interest (pollen grains). This framework was successfully used for the analysis of pollen viability of a high number of samples collected in a large collection of grapevine cultivars. Results revealed a great genetic variability, from cultivars having very low pollen viability (like Corinto Bianco; viability: 14.1 ± 1.3%) to others with a very low presence of sterile pollen grains (Cuelga; viability: 98.2 ± 0.5%). A wide range of variability was also observed among several clones of cv. Tempranillo Tinto (from 97.9 ± 0.9 to 60.6 ± 5.9%, in the first season). Interestingly, the evaluation of this trait in a second season revealed differential genotype-specific sensitivity to environment. The use of PollenCounter is expected to aid in different areas, including genetics research studies, crop improvement and breeding strategies that need of fast, precise and accurate results. Considering its flexibility, it can be used not only in grapevine, but also in other species showing

  8. Fox grape cv. Bordô (Vitis labrusca L.) and grapevine cv. Chardonnay (Vitis vinifera L.) cultivated in vitro under different carbohydrates, amino acids and 6-Benzylaminopurine levels

    OpenAIRE

    Carvalho, Dayse Cristina de; Silva, André Luís Lopes da; Schuck, Mariane Ruzza; Purcino, Marivel; Tanno, Guilherme Nakao; Biasi, Luiz Antonio

    2013-01-01

    The aim of this work was to study the influence of sucrose and glucose, amino acids and BAP (6-Benzylaminopurine) levels on in vitro shoot regeneration of fox grape cv. Bordô and grapevine cv. Chardonnay. The nodal segments from micropropagated material were used as explants and half-strength MS medium as the basal medium. Sucrose and glucose at 15, 30 and 45 g.L-1 were tested as a carbon source and the supplementation of adenine, asparagine, alanine, glycine, cysteine, glutamine, arginine wa...

  9. Transfer of the 3' non-translated region of grapevine chrome mosaic virus RNA-1 by recombination to tomato black ring virus RNA-2 in pseudorecombinant isolates.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1995-05-01

    In grapevine chrome mosaic and tomato black ring viruses (GCMV and TBRV), as in many other nepoviruses, the 3' non-translated regions (3'NTR) are identical between the two genomic RNAs. We have investigated the structure of the 3'NTR of two recombinant isolates which contain GCMV RNA-1 and TBRV RNA-2. In these isolates, the 3'NTR of RNA-1 was transferred to RNA-2, thus restoring the 3' identity. The transfer occurred within three passages, and probably contributes to the spread of randomly appearing mutations from one genomic RNA to the other. The site of recombination is near the 3' end of the open reading frame.

  10. Effect of osmotic stress and post-stress recovery on the content of phenolics and properties of antioxidants in germinating seeds of grapevine Vitis californica

    Directory of Open Access Journals (Sweden)

    Stanisław Weidner

    2011-05-01

    Full Text Available The tested material consisted of grapevine Vitis californica stratified seeds germinated under optimum conditions (+25°C in water, under osmotic stress (-0.2 MPa in PEG solution and submitted to recovery after stress (+25°C in water. The germinating seeds were determined to contain tannins, catechins and the following phenolic acids: gallic, caffeic, p-coumaric and ferulic. The acids occurred in free, ester- and glycoside-bound forms. The dominant form of phenolic acids was the ester-bound fraction. Gallic acid was the most abundant phenolic acid in germinating seeds, while ferulic acid appeared in the smallest amounts. Our analysis of tannins demonstrated that osmotic stress depressed their concentration. Presence of catechin group compounds such as catechin and epicatechin was also determined. In each sample epicatechin was dominant. The total concentration of catechin increased under stress conditions and declined during post-stress recovery. Catechins are a constituent of tannins and their increase under osmotic stress is most probably caused by the breakdown of some tannins in seeds germinating under stress conditions. Samples submitted to osmotic stress were also found to contain less of total phenolic compounds, whereas in samples which underwent post-stress recovery the total level of phenolic compounds increased. Compared to extracts from seeds germinating under optimum conditions, osmotic stress depressed the capacity of extract to scavenge DPPH● (2,2-diphenyl-1-picrylhydrazyl and ABTS●+ – 2,2-Azino-bis (3-etylbenzothiazoline-6-sulfonic acid free radicals, but the antioxidant activity rose in seeds submitted to recovery after stress. Positive correlation was therefore demonstrated between the total content of phenolic acids in germinating grapevine seeds and the reducing power of extracts obtained from these seeds and their free radical scavenging activity. The results suggest that osmotic stress inhibits the activity of

  11. Use of digital Munsell color space to assist interretation of imaging spectrometer data: Geologic examples from the northern Grapevine Mountains, California and Nevada

    Science.gov (United States)

    Kruse, F. A.; Knepper, D. H., Jr.; Clark, R. N.

    1986-01-01

    Techniques using Munsell color transformations were developed for reducing 128 channels (or less) of Airborne Imaging Spectrometer (AIS) data to a single color-composite-image suitable for both visual interpretation and digital analysis. Using AIS data acquired in 1984 and 1985, limestone and dolomite roof pendants and sericite-illite and other clay minerals related to alteration were mapped in a quartz monzonite stock in the northern Grapevine Mountains of California and Nevada. Field studies and laboratory spectral measurements verify the mineralogical distributions mapped from the AIS data.

  12. Leaf and stem water potential as vine water status indicators, in Tempranillo grapevine, under different water regimes in the Duero valley

    Directory of Open Access Journals (Sweden)

    Jesús Yuste

    2004-03-01

    The measurement of water potential of the leaf has been easier to take, because it is not necessary to cover the leaves prior to taking the measurement (except in the measurement before dawn, in which case one must be in the vineyard at an unpleasant hour. However, using the potential of the xylem it has been possible to make better observations of the differences between treatments, when these differences are not very important.

  13. Water and salinity stress in grapevines: early and late changes in transcript and metabolite profiles.

    Science.gov (United States)

    Cramer, Grant R; Ergül, Ali; Grimplet, Jerome; Tillett, Richard L; Tattersall, Elizabeth A R; Bohlman, Marlene C; Vincent, Delphine; Sonderegger, Justin; Evans, Jason; Osborne, Craig; Quilici, David; Schlauch, Karen A; Schooley, David A; Cushman, John C

    2007-04-01

    Grapes are grown in semiarid environments, where drought and salinity are common problems. Microarray transcript profiling, quantitative reverse transcription-PCR, and metabolite profiling were used to define genes and metabolic pathways in Vitis vinifera cv. Cabernet Sauvignon with shared and divergent responses to a gradually applied and long-term (16 days) water-deficit stress and equivalent salinity stress. In this first-of-a-kind study, distinct differences between water deficit and salinity were revealed. Water deficit caused more rapid and greater inhibition of shoot growth than did salinity at equivalent stem water potentials. One of the earliest responses to water deficit was an increase in the transcript abundance of RuBisCo activase (day 4), but this increase occurred much later in salt-stressed plants (day 12). As water deficit progressed, a greater number of affected transcripts were involved in metabolism, transport, and the biogenesis of cellular components than did salinity. Salinity affected a higher percentage of transcripts involved in transcription, protein synthesis, and protein fate than did water deficit. Metabolite profiling revealed that there were higher concentrations of glucose, malate, and proline in water-deficit-treated plants as compared to salinized plants. The metabolite differences were linked to differences in transcript abundance of many genes involved in energy metabolism and nitrogen assimilation, particularly photosynthesis, gluconeogenesis, and photorespiration. Water-deficit-treated plants appear to have a higher demand than salinized plants to adjust osmotically, detoxify free radicals (reactive oxygen species), and cope with photoinhibition.

  14. Evaluation of a Trunk Injection Technique to Control Grapevine Wood Diseases

    Directory of Open Access Journals (Sweden)

    G. Darrieutort

    2007-04-01

    Full Text Available Vineyard experiments were conducted over five years in the Bordeaux area to evaluate the effectiveness of trunk injections in controlling Eutypa dieback (4 trials and esca (1 trial. Single treatments were applied in winter 2001 or 2002 using the tree injector StemJect®. Three compounds were tested: two triazole-derived fungicides, propiconazole and difenoconazole, and one elicitor, 2-hydroxybenzoïc acid. Symptomatic vines of two susceptible cultivars, Cabernet Sauvignon and Cabernet Franc, had first been identified in summer in the year before the treatments were started. A disease scale was used to rate the severity of the foliar symptoms. After treatment, disease development was recorded on the same vines in the following years, from 2002 to 2005. Analyses were based on the evolution of foliar symptoms and on the development of wood symptoms (% area of dead wood. This novel procedure made it possible to determine the sanitary status of each vine in terms of three classes of disease severity: remission of symptoms, stability or worsening. No treatment had a significantly durable effect on disease expression irrespective of the site, the compound or the disease studied. Some phytotoxic effects with the triazole fungicides were noticed. Prospects for trunk injections as a means to solve these insidious problems in viticulture are discussed.

  15. Innovation and STEM Schools

    Science.gov (United States)

    Roberts, Julia Link

    2015-01-01

    How do schools with a focus on science, technology, engineering, and mathematics (STEM) fit in with state goals to increase innovation and to boost the economy? This article briefly discusses how educators can encourage creativity and innovation.

  16. [STEM on Station Education

    Science.gov (United States)

    Lundebjerg, Kristen

    2016-01-01

    The STEM on Station team is part of Education which is part of the External Relations organization (ERO). ERO has traditional goals based around BHAG (Big Hairy Audacious Goal). The BHAG model is simplified to a saying: Everything we do stimulates actions by others to advance human space exploration. The STEM on Station education initiate is a project focused on bringing off the earth research and learning into classrooms. Educational resources such as lesson plans, activities to connect with the space station and STEM related contests are available and hosted by the STEM on Station team along with their partners such as Texas Instruments. These educational activities engage teachers and students in the current happenings aboard the international space station, inspiring the next generation of space explorers.

  17. STEM Education Programs

    Science.gov (United States)

    & Development (LDRD) National Security Education Center (NSEC) Office of Science Programs Richard P Databases National Security Education Center (NSEC) Center for Nonlinear Studies Engineering Institute Scholarships STEM Education Programs Teachers (K-12) Students (K-12) Higher Education Regional Education

  18. Myeloproliferative neoplasm stem cells.

    Science.gov (United States)

    Mead, Adam J; Mullally, Ann

    2017-03-23

    Myeloproliferative neoplasms (MPNs) arise in the hematopoietic stem cell (HSC) compartment as a result of the acquisition of somatic mutations in a single HSC that provides a selective advantage to mutant HSC over normal HSC and promotes myeloid differentiation to engender a myeloproliferative phenotype. This population of somatically mutated HSC, which initiates and sustains MPNs, is termed MPN stem cells. In >95% of cases, mutations that drive the development of an MPN phenotype occur in a mutually exclusive manner in 1 of 3 genes: JAK2 , CALR , or MPL The thrombopoietin receptor, MPL, is the key cytokine receptor in MPN development, and these mutations all activate MPL-JAK-STAT signaling in MPN stem cells. Despite common biological features, MPNs display diverse disease phenotypes as a result of both constitutional and acquired factors that influence MPN stem cells, and likely also as a result of heterogeneity in the HSC in which MPN-initiating mutations arise. As the MPN clone expands, it exerts cell-extrinsic effects on components of the bone marrow niche that can favor the survival and expansion of MPN stem cells over normal HSC, further sustaining and driving malignant hematopoiesis. Although developed as targeted therapies for MPNs, current JAK2 inhibitors do not preferentially target MPN stem cells, and as a result, rarely induce molecular remissions in MPN patients. As the understanding of the molecular mechanisms underlying the clonal dominance of MPN stem cells advances, this will help facilitate the development of therapies that preferentially target MPN stem cells over normal HSC. © 2017 by The American Society of Hematology.

  19. Skeletal (stromal) stem cells

    DEFF Research Database (Denmark)

    Abdallah, Basem M; Kermani, Abbas Jafari; Zaher, Walid

    2015-01-01

    Skeletal (marrow stromal) stem cells (BMSCs) are a group of multipotent cells that reside in the bone marrow stroma and can differentiate into osteoblasts, chondrocytes and adipocytes. Studying signaling pathways that regulate BMSC differentiation into osteoblastic cells is a strategy....../preadipocyte factor 1 (Dlk1/Pref-1), the Wnt co-receptor Lrp5 and intracellular kinases. This article is part of a Special Issue entitled: Stem Cells and Bone....

  20. Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation

    Science.gov (United States)

    Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella

    2011-01-01

    Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399

  1. Jasmonic acid-isoleucine formation in grapevine (Vitis vinifera L.) by two enzymes with distinct transcription profiles.

    Science.gov (United States)

    Böttcher, Christine; Burbidge, Crista A; di Rienzo, Valentina; Boss, Paul K; Davies, Christopher

    2015-07-01

    The plant hormone jasmonic acid (JA) is essential for stress responses and the formation of reproductive organs, but its role in fruit development and ripening is unclear. Conjugation of JA to isoleucine is a crucial step in the JA signaling pathway since only JA-Ile is recognized by the jasmonate receptor. The conjugation reaction is catalyzed by JA-amido synthetases, belonging to the family of Gretchen Hagen3 (GH3) proteins. Here, in vitro studies of two grapevine (Vitis vinifera L. cv Shiraz) GH3 enzymes, VvGH3-7 and VvGH3-9, demonstrated JA-conjugating activities with an overlapping range of amino acid substrates, including isoleucine. Expression studies of the corresponding genes in grape berries combined with JA and JA-Ile measurements suggested a primary role for JA signaling in fruit set and cell division and did not support an involvement of JA in the ripening process. In response to methyl JA (MeJA) treatment, and in wounded and unwounded (distal) leaves, VvGH3-9 transcripts accumulated, indicating a participation in the JA response. In contrast, VvGH3-7 was unresponsive to MeJA and local wounding, demonstrating a differential transcriptional regulation of VvGH3-7 and VvGH3-9. The transient induction of VvGH3-7 in unwounded, distal leaves was suggestive of the involvement of an unknown mobile wound signal. © 2014 Institute of Botany, Chinese Academy of Sciences.

  2. Genetic relatedness and recombination analysis of Allorhizobium vitis strains associated with grapevine crown gall outbreaks in Europe.

    Science.gov (United States)

    Kuzmanović, N; Biondi, E; Bertaccini, A; Obradović, A

    2015-09-01

    To analyse genetic diversity and epidemiological relationships among 54 strains of Allorhizobium vitis isolated in Europe during an 8-year period and to assess the relative contribution of mutation and recombination in shaping their diversity. By using random amplified polymorphic DNA (RAPD) PCR, strains studied were distributed into 12 genetic groups. Sequence analysis of dnaK, gyrB and recA housekeeping genes was employed to characterize a representative subcollection of 28 strains. A total of 15 different haplotypes were found. Nucleotide sequence analysis suggested the presence of recombination events in A. vitis, particularly affecting dnaK locus. Although prevalence of mutation over recombination was found, impact of recombination was about two times greater than mutation in the evolution of the housekeeping genes analysed. The RAPD analysis indicated high degree of genetic diversity among the strains. However, the most abundant RAPD group was composed of 35 strains, which could lead to the conclusion that they share a common origin and were distributed by the movement of infected grapevine planting material as a most common way of crossing long distances. Furthermore, it seems that recombination is acting as an important driving force in the evolution of A. vitis. As no substantial evidence of recombination was detected within recA gene fragment, this phylogenetic marker could be reliable to characterize phylogenetic relationships among A. vitis strains. We demonstrated clear epidemiological relationship between majority of strains studied, suggesting a need for more stringent phytosanitary measures in international trade. Moreover, this is the first study to report recombination in A. vitis. © 2015 The Society for Applied Microbiology.

  3. Soil mineral concentrations and soil microbial activity in grapevine inoculated with arbuscular mycorrhizal (AM fungus in Chile

    Directory of Open Access Journals (Sweden)

    Eduardo von Bennewitz

    2008-01-01

    Full Text Available A two year-experiment was carried out to study an effect of root inoculation with arbuscular mycorrhizal (AM fungus on soil mineral concentrations and soil microbial activity in grapevine (Vitis vi­ni­fe­ra cv. “Cabernet Sauvignon” cultivated in Chile. Plants were inoculated with a commercial granular inoculant (Mycosym Tri-ton® and cultivated in 20 L plastic pots filled with an unsterilized sandy clay soil from the Vertisols class under climatic conditions of Curicó (34°58´ S; 71°14´ W; 228 m ASL, Chile.Soil analyses were carried out at the beginning of the study and after two years (four samples of rhizospheric soil for each treatment to assess the effects of mycorrhizal infection on soil mineral concentration and physical properties. Soil microbial activity was measured by quantifying the soil production of CO2 in ten replications of 50 g of soil from each treatment. Root mycorrhizal infection was assessed through samples of fresh roots collected during 2005 and 2006. Fifty samples for each treatment were analyzed and the percentage of root length containing arbuscules and vesicles was assessed.During both years (2005 and 2006 all treatments showed mycorrhizal infection, even the Control treatment where no AM was applied. Mycorrhizal colonization did not affect the soil concentrations of N, P, K, Ca, Mg, K, Ca, Mg, Mn, Zn, Cu, Fe, B, organic matter, pH/KCl and ECe. Soil CO2-C in vitro production markedly decreased during the period of the study. No significant differences where detected among treatments in most cases.

  4. Mulch and groundcover effects on soil temperature and moisture, surface reflectance, grapevine water potential, and vineyard weed management

    Directory of Open Access Journals (Sweden)

    Christina M. Bavougian

    2018-06-01

    Full Text Available The objectives of this research were to identify alternatives to glyphosate for intra-row (under-trellis vineyard floor management and to evaluate the potential for intra-row and inter-row (alleyway groundcovers to reduce vegetative vigor of ‘Marquette’ grapevines (Vitis spp. in a southeast Nebraska vineyard. The experiment was a randomized factorial design with five intra-row treatments (crushed glass mulch [CG], distillers’ grain mulch [DG], creeping red fescue [CRF], non-sprayed control [NSC], and glyphosate [GLY] and three inter-row treatments (creeping red fescue [CRF], Kentucky bluegrass [KB], and resident vegetation [RV]. Treatments were established in 2010–2011 and measurements were conducted during 2012 and 2013 on 5- and 6-year-old vines. Soil temperatures were mostly higher under mulches and lower under intra-row groundcovers, compared to GLY. Weed cover in CG, DG, and CRF treatments was the same or less than GLY. At most sampling dates, inter-row soil moisture was lowest under KB. Intra-row soil moisture was highest under DG mulch and lowest under CRF and NSC; CG had the same or lower soil moisture than GLY. Surprisingly, we did not detect differences in mid-day photosynthetically active radiation (PAR reflectance, despite visual differences among the intra-row treatments. Mid-day vine water potential did not differ among treatments. We concluded it is not necessary to maintain a bare soil strip under established vines in this region, where soil fertility and moisture are non-limiting.

  5. Historical introgression of the downy mildew resistance gene Rpv12 from the Asian species Vitis amurensis into grapevine varieties.

    Directory of Open Access Journals (Sweden)

    Silvia Venuti

    Full Text Available The Amur grape (Vitis amurensis Rupr. thrives naturally in cool climates of Northeast Asia. Resistance against the introduced pathogen Plasmopara viticola is common among wild ecotypes that were propagated from Manchuria into Chinese vineyards or collected by Soviet botanists in Siberia, and used for the introgression of resistance into wine grapes (Vitis vinifera L.. A QTL analysis revealed a dominant gene Rpv12 that explained 79% of the phenotypic variance for downy mildew resistance and was inherited independently of other resistance genes. A Mendelian component of resistance-a hypersensitive response in leaves challenged with P. viticola-was mapped in an interval of 0.2 cM containing an array of coiled-coil NB-LRR genes on chromosome 14. We sequenced 10-kb genic regions in the Rpv12(+ haplotype and identified polymorphisms in 12 varieties of V. vinifera using next-generation sequencing. The combination of two SNPs in single-copy genes flanking the NB-LRR cluster distinguished the resistant haplotype from all others found in 200 accessions of V. vinifera, V. amurensis, and V. amurensis x V. vinifera crosses. The Rpv12(+ haplotype is shared by 15 varieties, the most ancestral of which are the century-old 'Zarja severa' and 'Michurinets'. Before this knowledge, the chromosome segment around Rpv12(+ became introgressed, shortened, and pyramided with another downy mildew resistance gene from North American grapevines (Rpv3 only by phenotypic selection. Rpv12(+ has an additive effect with Rpv3(+ to protect vines against natural infections, and confers foliar resistance to strains that are virulent on Rpv3(+ plants.

  6. Expression of a putative grapevine hexose transporter in tobacco alters morphogenesis and assimilate partitioning.

    Science.gov (United States)

    Leterrier, Marina; Atanassova, Rossitza; Laquitaine, Laurent; Gaillard, Cécile; Coutos-Thévenot, Pierre; Delrot, Serge

    2003-04-01

    Tobacco plants were transformed by leaf disc regeneration with the VvHT1 (Vitis vinifera hexose transporter 1) cDNA under the control of the constitutive CaMV 35S promoter in a sense or antisense orientation. Among the 20 sense plants and 10 antisense plants obtained, two sense plants showed a mutant phenotype when grown in vitro, with stunted growth and an increase in the (leaves+stem)/roots dry weight ratio. The rate of [(3)H]-glucose uptake in leaf discs from these plants was decreased to 25% of the value measured in control plants. The amount of VvHT1 transgene and of host monosaccharide transporter MST transcripts in the leaves were studied by RNA gel blot analysis. The VvHT1 transcripts were usually present, but the amount of MST transcripts was the lowest in the plants that exhibited the most marked phenotype. Although the phenotype was lost when the plants were transferred from in vitro to greenhouse conditions, it was found again in vitro in the progeny obtained by self-pollination or by back-cross. The data show that VvHT1 sense expression resulted in unidirectional post-transcriptional gene inactivation of MST in some of the transformants, with dramatic effects on growth. They provide the first example of plants modified for hexose transport by post-transcriptional gene silencing. Some of the antisense plants also showed reduced expression of MST, and decreased growth. These results indicate that, like the sucrose transporters, hexose transporters play an important role in assimilate transport and in morphogenesis.

  7. Mature seeds for in vitro sanitation of the Grapevine leafroll associated virus (GLRaV-1 and GLRaV-3) from grape (Vitis vinifera L.)

    Energy Technology Data Exchange (ETDEWEB)

    Peiró, R.; Gammoudi, N.; Yuste, A.; Olmos, A.; Gisbert, C.

    2015-07-01

    The conservation of old grapevine varieties is important since they are adapted to specific climate conditions and may carry genes interesting to breeders. As virus infection is common in grapevine varieties, the use of virus free materials is of great importance. In this work, we used somatic embryogenesis for the sanitation of GLRaV-1 and GLRaV-3 viruses that were found after analyzing the putative presence of the five most common, economically important grape viruses by real-time multiplex RT-PCR in the old cultivar “Grumet Negre”. Unopened and opened inflorescences, fecundated ovaries, and, also, mature seeds were used as starting explants. Explants were cultured on plates with two embryogenesis induction media (Nitsch & McCown Woody plant medium) that contained the growth regulator thidiazuron and differed in their salt and vitamin compositions. One half of each kind of explant was cut prior to being cultured. After five months of culture, embryos had only developed from seeds that were cut previous to sowing. To the best of our knowledge, this is the first time that mature seeds have been used for inducing embryogenesis in grape. A total of 42% of the embryos transferred to tubes for germination regenerated into normal plantlets. The absence of both the GLRaV-1 and GLRaV-3 viruses in all regenerated plants was confirmed by real-time uniplex RT-PCR. So, this protocol can be used for sanitation and also for micropropagation. (Author)

  8. Grape and wine amino acid composition from Carignan noir grapevines growing under rainfed conditions in the Maule Valley, Chile: Effects of location and rootstock.

    Science.gov (United States)

    Gutiérrez-Gamboa, G; Carrasco-Quiroz, M; Martínez-Gil, A M; Pérez-Álvarez, E P; Garde-Cerdán, T; Moreno-Simunovic, Y

    2018-03-01

    Nitrogen compounds play a key role on grape and wine quality. Their composition in grapes depends mainly on variety, viticultural management, and terroir, and affects fermentation kinetics and the volatile compound formation. The aim of this work was to study grape and wine amino acid composition of ungrafted or grafted onto cv. País Carignan grapevines growing under rainfed conditions in ten sites of the Maule Valley (Chile). The results showed that proline was the most abundant amino acid in grapes and wines. In general, Carignan noir grapevines grafted over País showed lower grape amino acid content respect to ungrafted vines. Cool night index (CI) was inversely correlated to several amino acids, showing that their plant synthesis or accumulation increased with lower minimum temperatures during the last month before harvest. Truquilemu (Tru) and Ciénaga de Name (Cdn) sites showed the highest concentration for several amino acids and total amino acid content in grapes, which led to a faster alcoholic fermentation. Copyright © 2017. Published by Elsevier Ltd.

  9. Research concerning the influence of soil type and fertilization prescriptions on nitrogen and phosphorus absorption by grapevine from fertilizers using 15N and 32P

    International Nuclear Information System (INIS)

    Serdinescu, A.

    1994-01-01

    A pot experiment was conducted with the aim to study the effect of two types of soils (reddish-brown and podzol) fertilized with different N, P, K rates and ratios, on nitrogen and phosphorus absorption by grapevine from fertilizers. The mineral fertilizers were applied in pots as binary and ternary combinations between N, P and K. In case of each combination there were applied different levels for each nutrient (two levels for nitrogen and three levels for phosphorus and potassium). Nitrogen was applied at 3 mg NO 3 /100 g soil (N 1 ) as 2.375% 15 N atom excess labelled ammonium nitrate, phosphorus at 5 mg P 2 O 5 /100 g soil (P 1 ) as monosodium phosphate labelled with 32 P (0.30 mCi/pot) and potassium at 10 mg K 2 0/100 g soil (K 1 ) as potassium sulphate. Nitrogen and phosphorus absorption was estimated by means of Ndff% and Pdff% values, established in grapevine at blooming and at the beginning of ripening. The experimental data indicated a higher nitrogen and phosphorus absorption from mineral fertilizers in the reddish-brown soil, as compared to podzol. In both soils the nitrogen absorption was positively influenced by the increase of the nitrogen rate and by the simultaneous administration of phosphorus and potassium. Phosphorus absorption was not thoroughly influenced by the use of nitrogen and potassium. (author)

  10. VvGONST-A and VvGONST-B are Golgi-localised GDP-sugar transporters in grapevine (Vitis vinifera L.).

    Science.gov (United States)

    Utz, Daniella; Handford, Michael

    2015-02-01

    Plant nucleotide-sugar transporters (NSTs) are responsible for the import of nucleotide-sugar substrates into the Golgi lumen, for subsequent use in glycosylation reactions. NSTs are specific for either GDP- or UDP-sugars, and almost all transporters studied to date have been isolated from Arabidopsis thaliana L. In order to determine the conservation of the import mechanism in other higher plant species, here we report the identification and characterisation of VvGONST-A and VvGONST-B from grapevine (Vitis vinifera L. cv. Thompson Seedless), which are the orthologues of the GDP-sugar transporters GONST3 and GONST4 in Arabidopsis. Both grapevine NSTs possess the molecular features characteristic of GDP-sugar transporters, including a GDP-binding domain (GXL/VNK) towards the C-terminal. VvGONST-A and VvGONST-B expression is highest at berry setting and decreases throughout berry development and ripening. Moreover, we show using green fluorescent protein (GFP) tagged versions and brefeldin A treatments, that both are localised in the Golgi apparatus. Additionally, in vitro transport assays after expression of both NSTs in tobacco leaves indicate that VvGONST-A and VvGONST-B are capable of transporting GDP-mannose and GDP-glucose, respectively, but not a range of other UDP- and GDP-sugars. The possible functions of these NSTs in glucomannan synthesis and/or glycosylation of sphingolipids are discussed. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Mature seeds for in vitro sanitation of the Grapevine leafroll associated virus (GLRaV-1andGLRaV-3 from grape (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Rosa Peiró

    2015-06-01

    Full Text Available The conservation of old grapevine varieties is important since they are adapted to specific climate conditions and may carry genes interesting to breeders. As virus infection is common in grapevine varieties, the use of virus free materials is of great importance. In this work, we used somatic embryogenesis for the sanitation of GLRaV-1 and GLRaV-3 viruses that were found after analyzing the putative presence of the five most common, economically important grape viruses by real-time multiplex RT-PCR in the old cultivar “Grumet Negre”. Unopened and opened inflorescences, fecundated ovaries, and, also, mature seeds were used as starting explants. Explants were cultured on plates with two embryogenesis induction media (Nitsch & McCown Woody plant medium that contained the growth regulator thidiazuron and differed in their salt and vitamin compositions. One half of each kind of explant was cut prior to being cultured. After five months of culture, embryos had only developed from seeds that were cut previous to sowing. To the best of our knowledge, this is the first time that mature seeds have been used for inducing embryogenesis in grape. A total of 42% of the embryos transferred to tubes for germination regenerated into normal plantlets. The absence of both the GLRaV-1 and GLRaV-3 viruses in all regenerated plants was confirmed by real-time uniplex RT-PCR. So, this protocol can be used for sanitation and also for micropropagation.

  12. Unmanned Aerial Vehicle (UAV-based remote sensing to monitor grapevine leaf stripe disease within a vineyard affected by esca complex

    Directory of Open Access Journals (Sweden)

    Salvatore F. DI GENNARO

    2016-07-01

    Full Text Available Foliar symptoms of grapevine leaf stripe disease (GLSD, a disease within the esca complex are linked to drastic alteration of photosynthetic function and activation of defense responses in affected grapevines several days before the appearance of the first visible symptoms on leaves. The present study suggests a methodology to investigate the relationships between high-resolution multispectral images (0.05 m/pixel acquired using an Unmanned Aerial Vehicle (UAV, and GLSD foliar symptoms monitored by ground surveys. This approach showed high correlation between Normalized Differential Vegetation Index (NDVI acquired by the UAV and GLSD symptoms, and discrimination between symptomatic from asymptomatic plants. High-resolution multispectral images were acquired during June and July of 2012 and 2013, in an experimental vineyard heavily affected by GLSD, located in Tuscany (Italy, where vines had been surveyed and mapped since 2003. Each vine was located with a global positioning system, and classified for appearance of foliar symptoms and disease severity at weekly intervals from the beginning of each season. Remote sensing and ground observation data were analyzed to promptly identify the early stages of disease, even before visual detection. This work suggests an innovative methodology for quantitative and qualitative analysis of spatial distribution of symptomatic plants. The system may also be used for exploring the physiological bases of GLSD, and predicting the onset of this disease. 

  13. Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

    Science.gov (United States)

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

    2014-12-01

    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

  14. The Oral Bioavailability of Trans-Resveratrol from a Grapevine-Shoot Extract in Healthy Humans is Significantly Increased by Micellar Solubilization.

    Science.gov (United States)

    Calvo-Castro, Laura A; Schiborr, Christina; David, Franziska; Ehrt, Heidi; Voggel, Jenny; Sus, Nadine; Behnam, Dariush; Bosy-Westphal, Anja; Frank, Jan

    2018-05-01

    Grapevine-shoot extract Vineatrol30 contains abundant resveratrol monomers and oligomers with health-promoting potential. However, the oral bioavailability of these compounds in humans is low (˂1-2%). The aim of this study was to improve the oral bioavailability of resveratrol from vineatrol by micellar solubilization. Twelve healthy volunteers (six women, six men) randomly ingested a single dose of 500 mg vineatrol (30 mg trans-resveratrol, 75 mg trans-ε-viniferin) as native powder or liquid micelles. Plasma and urine were collected at baseline and over 24 h after intake. Resveratrol and viniferin were analyzed by HPLC. The area under the plasma concentration-time curve (AUC) and mean maximum plasma trans-resveratrol concentrations were 5.0-fold and 10.6-fold higher, respectively, after micellar supplementation relative to the native powder. However, no detectable amounts of trans-ε-viniferin were found in either plasma or urine. The transepithelial permeability of trans-resveratrol and trans-ε-viniferin across differentiated Caco-2 monolayers was consistent to the absorbed fractions in vivo. The oral bioavailability of trans-resveratrol from the grapevine-shoot extract Vineatrol30 was significantly increased using a liquid micellar formulation, without any treatment-related adverse effects, making it a suitable system for improved supplementation of trans-resveratrol. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Functional diversification of grapevine MYB5a and MYB5b in the control of flavonoid biosynthesis in a petunia anthocyanin regulatory mutant.

    Science.gov (United States)

    Cavallini, Erika; Zenoni, Sara; Finezzo, Laura; Guzzo, Flavia; Zamboni, Anita; Avesani, Linda; Tornielli, Giovanni Battista

    2014-03-01

    Flavonoids play a key role in grapevine physiology and also contribute substantially to the quality of berries and wines. VvMYB5a and VvMYB5b are R2R3-MYB transcription factors previously proposed to control the spatiotemporal expression of flavonoid structural genes during berry development. We investigated the functions of these two proteins in detail by heterologous expression in a petunia an2 mutant, which has negligible anthocyanin levels in the petals because it lacks the MYB protein PhAN2. We also expressed VvMYBA1, the grapevine ortholog of petunia PhAN2, in the same genetic background. The anthocyanin profiles induced by expressing these transgenes in the petals revealed that VvMYBA1 is the functional ortholog of PhAN2 and that, unlike VvMYB5a, VvMYB5b can partially complement the an2 mutation. Transcriptomic analysis of petals by microarray hybridization and quantitative PCR confirmed that VvMYB5b up-regulates a subset of anthocyanin structural genes, whereas VvMYB5a has a more limited impact on the expression of genes related to anthocyanin biosynthesis. Furthermore, we identified additional specific and common targets of these two regulators, related to vacuolar acidification and membrane remodeling. Taken together, these data provide insight into the role of VvMYB5a and VvMYB5b in flavonoid biosynthesis and provide evidence for additional regulatory roles in distinct pathways.

  16. Comportamento vegetativo e produtivo de videiras 'Cabernet sauvignon' cultivadas sob cobertura plástica Vegetative growth and yield of 'Cabernet sauvignon' grapevine under overhead plastic covering

    Directory of Open Access Journals (Sweden)

    Clenilso Sehnen Mota

    2008-03-01

    Full Text Available O uso de cobertura plástica no cultivo de videira encontra-se em expansão no Rio Grande do Sul, por ser uma alternativa que visa a proteger as plantas da precipitação pluvial e do granizo. O objetivo deste estudo foi avaliar os impactos de uma cobertura plástica translúcida e impermeável sobre a fenologia, o crescimento (de ramos, folhas, cachos e bagas e a produtividade em videiras 'Cabernet Sauvignon' (Vitis vinifera L., com cinco anos de idade, conduzidas em sistema 'Y', sobre porta-enxerto Paulsen 1103. O experimento, conduzido no município de Caxias do Sul-RS, seguiu o delineamento em blocos ao acaso, tendo os tratamentos sem e com cobertura plástica, com quatro repetições de 15 plantas (unidade experimental. As alterações microclimáticas impostas pela cobertura plástica não foram expressivas para alterar a fenologia da videira. As plantas cultivadas sob cobertura plástica apresentaram maiores valores de comprimento e massa fresca de ramos e de área, e massa seca foliar em comparação às plantas descobertas. O peso e o diâmetro de bagas foram superiores nas videiras cobertas apenas no início do ciclo e não diferiram próximo da colheita. As demais variáveis analisadas não foram afetadas pela cobertura plástica. A cobertura plástica interferiu no crescimento vegetativo das plantas, mas não afetou a produção.There is an increasing adoption of overhead plastic covering for grapevines in the State of Rio Grande do Sul, Southern Brazil, to protect the plants from rain and hail storms. This study was carried out to evaluate the impacts of overhead plastic covering with a translucent and water-proof plastic film on phenological, growth (of branch, leaves, clusters, and berries, and yield attributes of five years old 'Cabernet Sauvignon' grapevines (Vitis vinifera L. on Paulsen 1103 rootstock raised as 'Y' management system. The experiment was carried out in Caxias do Sul, State of Rio Grande do Sul, and followed a

  17. Advancing Stem Cell Biology toward Stem Cell Therapeutics

    OpenAIRE

    Scadden, David; Srivastava, Alok

    2012-01-01

    Here, the International Society for Stem Cell Research (ISSCR) Clinical Translation Committee introduces a series of articles outlining the current status, opportunities, and challenges surrounding the clinical translation of stem cell therapeutics for specific medical conditions.

  18. Stem cell plasticity.

    Science.gov (United States)

    Lakshmipathy, Uma; Verfaillie, Catherine

    2005-01-01

    The central dogma in stem cell biology has been that cells isolated from a particular tissue can renew and differentiate into lineages of the tissue it resides in. Several studies have challenged this idea by demonstrating that tissue specific cell have considerable plasticity and can cross-lineage restriction boundary and give rise to cell types of other lineages. However, the lack of a clear definition for plasticity has led to confusion with several reports failing to demonstrate that a single cell can indeed differentiate into multiple lineages at significant levels. Further, differences between results obtained in different labs has cast doubt on some results and several studies still await independent confirmation. In this review, we critically evaluate studies that report stem cell plasticity using three rigid criteria to define stem cell plasticity; differentiation of a single cell into multiple cell lineages, functionality of differentiated cells in vitro and in vivo, robust and persistent engraft of transplanted cells.

  19. Mesenchymal Stem Cells

    DEFF Research Database (Denmark)

    Horwood, Nicole J.; Dazzi, Francesco; Zaher, Walid

    2012-01-01

    Mesenchymal stem cells (MSC) are stem cell populations present among the bone marrow stroma and a number of other tissues that are capable of multi-lineage differentiation into mesoderm-type cells such as osteoblasts, adipocytes and chondrocytes. MSC provide supportive stroma for growth...... and differentiation of hematopoietic stem cells (HSC) and hematopoiesis. These cells have been described as important immunoregulators due to their ability to suppress T cells proliferation. MSC can also directly contribute to tissue repair by migrating to sites of injury and providing a source of cells...... for differentiation and/or providing bystander support for resident stromal cells. This chapter discusses the cellular and molecular properties of MSC, the mechanisms by which they can modulate immune responses and the clinical applications of MSC in disorders such as graft-versus-host disease and aplastic anaemia...

  20. Stem Properties of Autobacteria

    Directory of Open Access Journals (Sweden)

    Boris A. Berdichevskyy

    2014-03-01

    Full Text Available This paper discusses the stem properties of the autobacteria as part of the activation syndrome and persistence of the endogenous microflora in the adaptation process of the macroorganism to stress, as well as the ability of the bacteria to stimulate the cells of the macroorganism to manifest stem properties. The essence of this syndrome involves testing the tissue with the autobacteria of their "host" body to identify the foci of cellular insolvency with the subsequent inclusion of the autostrains in the implementation phase of the catabolic and anabolic inflammations. Considering the genetic tropism of the microbes to the organ-specific tissue of the area affected, the existence of the stem properties of the autobacteria is assumed to be realized in the process of reparative regeneration. The great clinical significance of further study of this phenomenon is not excluded.

  1. Mammary gland stem cells

    DEFF Research Database (Denmark)

    Fridriksdottir, Agla J R; Petersen, Ole W; Rønnov-Jessen, Lone

    2011-01-01

    Distinct subsets of cells, including cells with stem cell-like properties, have been proposed to exist in normal human breast epithelium and breast carcinomas. The cellular origins of epithelial cells contributing to gland development, tissue homeostasis and cancer are, however, still poorly...... and differences between mouse and human gland development with particular emphasis on the identity and localization of stem cells, and the influence of the surrounding microenvironment. It is concluded that while recent advances in the field have contributed immense insight into how the normal mammary gland...... develops and is maintained, significant discrepancies exist between the mouse and human gland which should be taken into consideration in current and future models of mammary stem cell biology....

  2. International Society for Stem Cell Research

    Science.gov (United States)

    ... renowned stem cell and regenerative medicine community. More stem cell research Take a closer look Recent Blogs View ... story independent nonprofit organization & the voice of the stem cell research community The International Society for Stem Cell ...

  3. Human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Abdallah, Basem; Kassem, Moustapha

    2008-01-01

    Mesenchymal stem cells (MSC) are a group of clonogenic cells present among the bone marrow stroma and capable of multilineage differentiation into mesoderm-type cells such as osteoblasts, adipocytes and chondrocytes. Due to their ease of isolation and their differentiation potential, MSC are being...... introduced into clinical medicine in variety of applications and through different ways of administration. Here, we discuss approaches for isolation, characterization and directing differentiation of human mesenchymal stem cells (hMSC). An update of the current clinical use of the cells is also provided....

  4. Brain stem cavernous angioma

    International Nuclear Information System (INIS)

    Delcarpio-O'Donovan, R.; Melanson, D.; Tampieri, D.; Ethier, R.

    1988-01-01

    Twenty-two cases of cavernous angioma of the brain stem were definitely diagnosed by means of magnetic resonance (MR) imaging. In many cases, the diagnosis had remained elusive for several years. Clinically, some cases behaved like multiple sclerosis or brain stem tumor. Others, usually associated with bleeding, caused increased intracranial pressure or subarachnoid hemorrhage. The diagnostic limitations of computed tomography in the posterior fossa are well known. Angiography fails to reveal abnormalities, since this malformation has neither a feeding artery nor a draining vein. Diagnosticians' familiarity with the MR appearance of this lesion may save patients from invasive diagnostic studies and potentially risky treatment

  5. Biomechanics of stem cells

    Science.gov (United States)

    Spector, A. A.; Yuan, D.; Somers, S.; Grayson, W. L.

    2018-04-01

    Stem cells play a key role in the healthy development and maintenance of organisms. They are also critically important in medical treatments of various diseases. It has been recently demonstrated that the mechanical factors such as forces, adhesion, stiffness, relaxation, etc. have significant effects on stem cell functions. Under physiological conditions, cells (stem cells) in muscles, heart, and blood vessels are under the action of externally applied strains. We consider the stem cell microenvironment and performance associated with their conversion (differentiation) into skeletal muscle cells. Two problems are studied by using mathematical models whose parameters are then optimized by fitting experiments. First, we present our analysis of the process of stem cell differentiation under the application of cyclic unidirectional strain. This process is interpreted as a transition through several (six) stages where each of them is defined in terms of expression of a set of factors typical to skeletal muscle cells. The stem cell evolution toward muscle cells is described by a system of nonlinear ODEs. The parameters of the model are determined by fitting the experimental data on the time course of expression of the factors under consideration. Second, we analyse the mechanical (relaxation) properties of a scaffold that serves as the microenvironment for stem cells differentiation into skeletal muscle cells. This scaffold (surrounded by a liquid solution) is composed of unidirectional fibers with pores between them. The relaxation properties of the scaffold are studied in an experiment where a long cylindrical specimen is loaded by the application of ramp displacement until the strain reaches a prescribed value. The magnitude of the corresponding load is recorded. The specimen is considered as transversely isotropic poroelastic cylinder whose force relaxation is associated with liquid diffusion through the pores. An analytical solution for the total force applied to

  6. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  7. Stem cell therapy for diabetes

    Directory of Open Access Journals (Sweden)

    K O Lee

    2012-01-01

    Full Text Available Stem cell therapy holds immense promise for the treatment of patients with diabetes mellitus. Research on the ability of human embryonic stem cells to differentiate into islet cells has defined the developmental stages and transcription factors involved in this process. However, the clinical applications of human embryonic stem cells are limited by ethical concerns, as well as the potential for teratoma formation. As a consequence, alternative forms of stem cell therapies, such as induced pluripotent stem cells, umbilical cord stem cells and bone marrow-derived mesenchymal stem cells, have become an area of intense study. Recent advances in stem cell therapy may turn this into a realistic treatment for diabetes in the near future.

  8. Engineering stem cell niches in bioreactors

    OpenAIRE

    Liu, Meimei; Liu, Ning; Zang, Ru; Li, Yan; Yang, Shang-Tian

    2013-01-01

    Stem cells, including embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells and amniotic fluid stem cells have the potential to be expanded and differentiated into various cell types in the body. Efficient differentiation of stem cells with the desired tissue-specific function is critical for stem cell-based cell therapy, tissue engineering, drug discovery and disease modeling. Bioreactors provide a great platform to regulate the stem cell microenvironment, known as “ni...

  9. Linkage of within vineyard soil properties, grapevine physiology, grape composition and sensory characteristics in a premium wine grape vineyard.

    Science.gov (United States)

    Smart, David; Hess, Sallie; Ebeler, Susan; Heymann, Hildegarde; Plant, Richard

    2014-05-01

    Analysis of numerous vineyards has revealed a very high degree of variation exists at the within vineyard scale and may outweigh in some cases broader mesoclimatic and geological factors. For this reason, selective harvest of high quality wine grapes is often conducted and based on subjective field sensory analysis (taste). This is an established practice in many wine growing regions. But the relationships between these subjective judgments to principle soil and grapevine physiological characteristics are not well understood. To move toward greater understanding of the physiological factors related to field sensory evaluation, physiological data was collected over the 2007 and 2008 growing seasons in a selectively harvested premium production Napa Valley estate vineyard, with a history of selective harvesting based on field sensory evaluation. Data vines were established and remained as individual study units throughout the data gathering and analysis phase, and geographic information systems science (GIS) was used to geographically scale physiological and other data at the vineyard level. Areas yielding grapes with perceived higher quality (subjective analysis) were characterized by vines with 1) statistically significantly lower (P grape berry diameter (R2 = 0.616 in 2007 and 0.413 in 2008) and similar strong correlations existed for berry weight (R2 = 0.626 in 2007 and 0.554 in 2008). A trained sensory panel performed a sensory analysis and characterized fruit using and a multivariate, principal components, analysis (PCA). This approach indicated that grapes from vines with lowest midday leaf water potential at veraison (grapes from vines of > -1.5 MPa were characterized by vegetal flavors and astringent and bitter seeds and skins. Data from vines were grouped into vines experiencing MD at veraison of -1.5 MPa and subjected to single factor analysis of variance. This analysis revealed statistically significant differences (P less than 0.05) in many of the above

  10. Investigation of grapevine photosynthesis using hyperspectral techniques and development of hyperspectral band ratio indices sensitive to photosynthesis.

    Science.gov (United States)

    Ozelkan, Emre; Karaman, Muhittin; Candar, Serkan; Coskun, Zafer; Ormeci, Cankut

    2015-01-01

    The photosynthetic rate of 9 different grapevines were analyzed with simultaneous photosynthesis and spectroradiometric measurements on 08.08.2012 (veraison) and 06.09.2012 (harvest). The wavelengths and spectral regions, which most properly express photosynthetic rate, were determined using correlation and regression analysis. In addition, hyperspectral band ratio (BR) indices sensitive to photosynthesis were developed using optimum band ratio (OBRA) method. The relation of BR results with photosynthesis values are presented with the correlation matrix maps created in this study. The examinations were performed for both specific dates (i.e., veraison and harvest) and also in aggregate (i.e., correlation between total spectra and photosynthesis data). For specific dates wavelength based analysis, the photosynthesis were best determined with -0.929 correlation coefficient (r) 609 nm of yellow region at veraison stage, and -0.870 at 641 nm of red region at harvest stage. For wavelength based aggregate analysis, 640 nm of red region was found to be correlated with 0.921 and -0.867 r values respectively and red edge (RE) (695 nm) was found to be correlated with -0.922 and -0.860 r values, respectively. When BR indices results were analyzed with photosynthetic values for specific dates, -0.987 r with R8../R, at veraison stage and -0.911 r with R696/R944 at harvest stage were found most correlated. For aggregate analysis of BR, common BR presenting great correlation with photosynthesis for both measurements was found to be R632/R971 with -0.974, -0.881 r values, respectively and other R610/R760 with -0.976, -0.879 r values. The final results of this study indicate that the proportion of RE region to a region with direct or indirect correlation with photosynthetic provides information about rate of photosynthesis. With the indices created in this study, the photosynthesis rate of vineyards can be determined using in-situ hyperspectral remote sensing. The findings of this

  11. A 3-D functional-structural grapevine model that couples the dynamics of water transport with leaf gas exchange.

    Science.gov (United States)

    Zhu, Junqi; Dai, Zhanwu; Vivin, Philippe; Gambetta, Gregory A; Henke, Michael; Peccoux, Anthony; Ollat, Nathalie; Delrot, Serge

    2017-12-23

    Predicting both plant water status and leaf gas exchange under various environmental conditions is essential for anticipating the effects of climate change on plant growth and productivity. This study developed a functional-structural grapevine model which combines a mechanistic understanding of stomatal function and photosynthesis at the leaf level (i.e. extended Farqhuhar-von Caemmerer-Berry model) and the dynamics of water transport from soil to individual leaves (i.e. Tardieu-Davies model). The model included novel features that account for the effects of xylem embolism (fPLC) on leaf hydraulic conductance and residual stomatal conductance (g0), variable root and leaf hydraulic conductance, and the microclimate of individual organs. The model was calibrated with detailed datasets of leaf photosynthesis, leaf water potential, xylem sap abscisic acid (ABA) concentration and hourly whole-plant transpiration observed within a soil drying period, and validated with independent datasets of whole-plant transpiration under both well-watered and water-stressed conditions. The model well captured the effects of radiation, temperature, CO2 and vapour pressure deficit on leaf photosynthesis, transpiration, stomatal conductance and leaf water potential, and correctly reproduced the diurnal pattern and decline of water flux within the soil drying period. In silico analyses revealed that decreases in g0 with increasing fPLC were essential to avoid unrealistic drops in leaf water potential under severe water stress. Additionally, by varying the hydraulic conductance along the pathway (e.g. root and leaves) and changing the sensitivity of stomatal conductance to ABA and leaf water potential, the model can produce different water use behaviours (i.e. iso- and anisohydric). The robust performance of this model allows for modelling climate effects from individual plants to fields, and for modelling plants with complex, non-homogenous canopies. In addition, the model provides a

  12. Changing risk of spring frost damage in grapevines due to climate change? A case study in the Swiss Rhone Valley

    Science.gov (United States)

    Meier, Michael; Fuhrer, Jürg; Holzkämper, Annelie

    2018-01-01

    Late spring frost is a severe risk during early plant development. It may cause important economic damage to grapevine production. In a warming climate, late frost risk either could decline due to the reduction in frost days and an advancement of the last day of frost or increase due to a more pronounced shift forward of the start of the active growing period of the plants. These possibilities were analyzed in a case study for two locations in the lower Swiss Rhone Valley (Sion, Aigle) where viticulture is an important part of agriculture. Twelve phenology models were calibrated for the developmental stage BBCH09 (bud burst) using measured or reconstructed temperature data for two vineyards in Changins (1958 to 2012) and Leytron (1977 to 2014) together with observed phenological data. The day of year (DOY) for BBCH09 was then modelled for the years 1951 to 2050 using the best performing phenology model in combination with ten downscaled and bias-corrected climate scenarios. A 100-day period starting with BBCH09 was defined, during which daily mean and minimum temperatures were used to calculate three frost risk indices in each year. These indices were compared between the periods 1961-1990 (reference) and 2021-2050 (climate change scenario). Based on the average of the ensemble of climate model chains, BBCH09 advanced by 9 (range 7-11) (Aigle) and 7 (range 5-8) (Sion) days between the two time periods, similar to the shift in the last day of frost. The separate results of the different model chains suggest that, in the near future, late spring frost risk may increase or decrease, depending on location and climate change projections. While for the reference, the risk is larger at the warmer site (Sion) compared to that at the cooler site (Aigle), for the period 2021-2050, small shifts in both phenology and occurrence of frost (i.e., days with daily minimum temperature below 0 °C) lead to a small decrease in frost risk at the warmer but an increase at the cooler

  13. Changing risk of spring frost damage in grapevines due to climate change? A case study in the Swiss Rhone Valley.

    Science.gov (United States)

    Meier, Michael; Fuhrer, Jürg; Holzkämper, Annelie

    2018-06-01

    Late spring frost is a severe risk during early plant development. It may cause important economic damage to grapevine production. In a warming climate, late frost risk either could decline due to the reduction in frost days and an advancement of the last day of frost or increase due to a more pronounced shift forward of the start of the active growing period of the plants. These possibilities were analyzed in a case study for two locations in the lower Swiss Rhone Valley (Sion, Aigle) where viticulture is an important part of agriculture. Twelve phenology models were calibrated for the developmental stage BBCH09 (bud burst) using measured or reconstructed temperature data for two vineyards in Changins (1958 to 2012) and Leytron (1977 to 2014) together with observed phenological data. The day of year (DOY) for BBCH09 was then modelled for the years 1951 to 2050 using the best performing phenology model in combination with ten downscaled and bias-corrected climate scenarios. A 100-day period starting with BBCH09 was defined, during which daily mean and minimum temperatures were used to calculate three frost risk indices in each year. These indices were compared between the periods 1961-1990 (reference) and 2021-2050 (climate change scenario). Based on the average of the ensemble of climate model chains, BBCH09 advanced by 9 (range 7-11) (Aigle) and 7 (range 5-8) (Sion) days between the two time periods, similar to the shift in the last day of frost. The separate results of the different model chains suggest that, in the near future, late spring frost risk may increase or decrease, depending on location and climate change projections. While for the reference, the risk is larger at the warmer site (Sion) compared to that at the cooler site (Aigle), for the period 2021-2050, small shifts in both phenology and occurrence of frost (i.e., days with daily minimum temperature below 0 °C) lead to a small decrease in frost risk at the warmer but an increase at the cooler

  14. Potencial produtivo de videiras cultivadas sob cobertura de plástico Yield potential of grapevine cultivated under plastic cover

    Directory of Open Access Journals (Sweden)

    Geraldo Chavarria

    2009-02-01

    Full Text Available O objetivo deste trabalho foi avaliar a influência do uso de cobertura de plástico sobre os componentes do rendimento da videira (Vitis vinifera L. cultivar Moscato Giallo. O experimento foi realizado nas safras 2005/2006 e 2006/2007, em Flores da Cunha, RS, em duas áreas de vinhedo, uma com cobertura de plástico impermeável e outra sem cobertura (controle. O microclima foi avaliado quanto à temperatura e umidade relativa do ar, radiação fotossinteticamente ativa e velocidade do vento próximo ao dossel vegetativo e a os cachos. A avaliação dos componentes de rendimento ocorreu em delineamento experimental inteiramente ao acaso, e foram identificadas dez plantas marcadas aleatoriamente em cada área. Avaliaram-se a produção por planta e por hectare, o número de cachos por planta e por metro quadrado, o número de sarmentos por metro quadrado, a massa e comprimento de cacho, a massa de engaço, o número de bagas por cacho, o diâmetro transversal de bagas e a relação entre massa de película e massa de polpa. Acobertura de plástico possibilita aumento na produtividade, não afeta a relação entre massa de casca e massa de polpa das bagas e favorece a estabilidade de produção, independentemente das condições meteorológicas no ciclo.The objective of this work was to evaluate the effect of plastic cover on the yield components of grapevine (Vitis vinifera L. cultivar Moscato Giallo. The experiment was carried out in 2005/2006 and 2006/2007 crop seasons, in Flores da Cunha, RS, Brazil, in two vineyard areas, one covered with an impermeable plastic film and other without covering (control. The microclimate was evaluated in terms of air temperature, air relative humidity, photosynthetically active radiation and wind speed above canopy and close to clusters. The yield components were evaluated in a completely randomized design, in ten plants randomly selected in each area. Measures were made for production per plant, yield per

  15. Information on Stem Cell Research

    Science.gov (United States)

    ... Home » Current Research » Focus on Research Focus on Stem Cell Research Stem cells possess the unique ability to differentiate into ... virus infection. To search the complete list of stem cell research projects funded by NIH please go to NIH ...

  16. Stem Cells in Burn Eschar

    NARCIS (Netherlands)

    van der Veen, V. C.; Vlig, M.; van Milligen-Kummer, F.J.; de Vries, S.I.; Middelkoop, E.; Ulrich, M.

    2012-01-01

    This study compares mesenchymal cells isolated from excised burn wound eschar with adipose-derived stem cells (ASCs) and dermal fibroblasts in their ability to conform to the requirements for multipotent mesenchymal stem cells (MSCs). A population of multipotent stem cells in burn eschar could be an

  17. Stem cell organization in Arabidopsis

    NARCIS (Netherlands)

    Wendrich, J.R.

    2016-01-01

    Growth of plant tissues and organs depends on continuous production of new cells, by niches of stem cells. Stem cells typically divide to give rise to one differentiating daughter and one non-differentiating daughter. This constant process of self-renewal ensures that the niches of stem cells or

  18. ABA and GA3 regulate the synthesis of primary and secondary metabolites related to alleviation from biotic and abiotic stresses in grapevine.

    Science.gov (United States)

    Murcia, Germán; Fontana, Ariel; Pontin, Mariela; Baraldi, Rita; Bertazza, Gianpaolo; Piccoli, Patricia N

    2017-03-01

    Plants are able to synthesize a large number of organic compounds. Among them, primary metabolites are known to participate in plant growth and development, whereas secondary metabolites are mostly involved in defense and other facultative processes. In grapevine, one of the major fruit crops in the world, secondary metabolites, mainly polyphenols, are of great interest for the wine industry. Even though there is an extensive literature on the content and profile of those compounds in berries, scarce or no information is available regarding polyphenols in other organs. In addition, little is known about the effect of plant growth regulators (PGRs), ABA and GA 3 (extensively used in table grapes) on the synthesis of primary and secondary metabolites in wine grapes. In table grapes, cultural practices include the use of GA 3 sprays shortly before veraison, to increase berry and bunch size, and sugar content in fruits. Meanwhile, ABA applications to the berries on pre-veraison improve the skin coloring and sugar accumulation, anticipating the onset of veraison. Accordingly, the aim of this study was to assess and characterize primary and secondary metabolites in leaves, berries and roots of grapevine plants cv. Malbec at veraison, and changes in compositions after ABA and GA 3 aerial sprayings. Metabolic profiling was conducted using GC-MS, GC-FID and HPLC-MWD. A large set of metabolites was identified: sugars, alditols, organic acids, amino acids, polyphenols (flavonoids and non-flavonoids) and terpenes (mono-, sesqui-, di- and triterpenes). The obtained results showed that ABA applications elicited synthesis of mono- and sesquiterpenes in all assessed tissues, as well as L-proline, acidic amino acids and anthocyanins in leaves. Additionally, applications with GA 3 elicited synthesis of L-proline in berries, and mono- and sesquiterpenes in all the tissues. However, treatment with GA 3 seemed to block polyphenol synthesis, mainly in berries. In conclusion, ABA and GA

  19. Manejo do dossel vegetativo da videira e seu efeito na composição do vinho Merlot Grapevine canopy management effects on Merlot wine composition

    Directory of Open Access Journals (Sweden)

    Alberto Miele

    2009-05-01

    Full Text Available O objetivo deste trabalho foi avaliar o efeito de modalidades de poda verde da videira (Vitis vinifera L. na composição do vinho Merlot. Um experimento foi conduzido de 1993/1994 a 1996/1997, em Bento Gonçalves, RS, com uma testemunha e 11 modalidades de poda verde em vinhedo conduzido em latada. A análise de componentes principais mostrou que o efeito da poda verde variou conforme o ano. Considerando a média dos quatro anos avaliados, os três principais componentes foram responsáveis por 72% da variação total. Adesbrota, desponta e desfolha realizada no início da floração, com eliminação de todas as folhas abaixo dos cachos foi a modalidade de poda que apresentou os valores mais elevados de intensidade de cor, absorbâncias a 280 e 520 nm, antocianinas, taninos, álcool, 3-metil-1-butanol/2-metil-1-propanol, álcool em peso/extrato seco reduzido e fósforo, e foi a mais indicada para a produção de vinho Merlot.The objective of this work was to evaluate the effect of grapevine (Vitis vinifera L. summer pruning on Merlot wine composition. An experiment was carried out from 1993/1994 to 1996/1997 in Bento Gonçalves, RS, Brazil, using a control and 11 summer pruning in grapevines trained in pergola system. Principal component analysis showed that the summer pruning effects varied by year. Considering the average of the four years, the first three principal components were responsible for 72% of the total variation. Sprouting, topping, and removal of all leaves below grapevine clusters at the beginning of bloom had high values of color intensity, absorbances at 280 and 520 nm, anthocyanins, tannins, alcohol, 3-methyl-1-butanol/2-methyl-1-propanol, alcohol in weight/reduced dry extract, and phosphorus and was the best alternative for the production of quality Merlot wine.

  20. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  1. 3'-coterminal subgenomic RNAs and putative cis-acting elements of Grapevine leafroll-associated virus 3 reveals 'unique' features of gene expression strategy in the genus Ampelovirus

    Directory of Open Access Journals (Sweden)

    Dawson William O

    2010-08-01

    Full Text Available Abstract Background The family Closteroviridae comprises genera with monopartite genomes, Closterovirus and Ampelovirus, and with bipartite and tripartite genomes, Crinivirus. By contrast to closteroviruses in the genera Closterovirus and Crinivirus, much less is known about the molecular biology of viruses in the genus Ampelovirus, although they cause serious diseases in agriculturally important perennial crops like grapevines, pineapple, cherries and plums. Results The gene expression and cis-acting elements of Grapevine leafroll-associated virus 3 (GLRaV-3; genus Ampelovirus was examined and compared to that of other members of the family Closteroviridae. Six putative 3'-coterminal subgenomic (sg RNAs were abundantly present in grapevine (Vitis vinifera infected with GLRaV-3. The sgRNAs for coat protein (CP, p21, p20A and p20B were confirmed using gene-specific riboprobes in Northern blot analysis. The 5'-termini of sgRNAs specific to CP, p21, p20A and p20B were mapped in the 18,498 nucleotide (nt virus genome and their leader sequences determined to be 48, 23, 95 and 125 nt, respectively. No conserved motifs were found around the transcription start site or in the leader sequence of these sgRNAs. The predicted secondary structure analysis of sequences around the start site failed to reveal any conserved motifs among the four sgRNAs. The GLRaV-3 isolate from Washington had a 737 nt long 5' nontranslated region (NTR with a tandem repeat of 65 nt sequence and differed in sequence and predicted secondary structure with a South Africa isolate. Comparison of the dissimilar sequences of the 5'NTRs did not reveal any common predicted structures. The 3'NTR was shorter and more conserved. The lack of similarity among the cis-acting elements of the diverse viruses in the family Closteroviridae is another measure of the complexity of their evolution. Conclusions The results indicate that transcription regulation of GLRaV-3 sgRNAs appears to be different

  2. Limpeza clonal de mudas de videira infectadas por Xanthomonas campestris pv. viticola Clonal cleaning of grapevine plants infected by Xanthomonas campestris pv. viticola

    Directory of Open Access Journals (Sweden)

    Adriano Márcio Freire Silva

    2013-03-01

    Full Text Available O cancro bacteriano da videira é causado por Xanthomonas campestris pv. viticola (Xcv. Visando à limpeza clonal de mudas de 'Red Globe', foram estudados: tamanho ideal de ápices e gemas axilares para cultivo em meio de Galzy modificado (MGM; efeito da termoterapia (38ºC/30 dias; e ação de antibióticos na eliminação de Xcv em videiras infectadas. Os percentuais de contaminação por Xcv e de regeneração foram analisados, e as plantas obtidas foram indexadas em meio ágar nutritivo-dextrose-extrato de levedura-ampicilina (NYDAM, seguindo-se teste de patogenicidade. O cultivo de explantes com 3 mm possibilitou a obtenção de plantas livres da bactéria, com regeneração 14,3 vezes maior que explantes com 1 mm. A termoterapia de mudas infectadas, associada ao cultivo in vitro, não eliminou o patógeno. O cultivo de explantes com 10 mm, durante 40 dias em MGM + cefotaxima (300 mg L-1, proporcionou limpeza clonal das mudas. A indexação de plantas de videira regeneradas in vitro, quanto à infecção por Xcv utilizando NYDAM, seguida de teste de patogenicidade, é uma alternativa econômica e eficiente para produção de mudas de alta qualidade fitossanitária.Bacterial canker is caused by Xanthomonas campestris pv. viticola (Xcv. In order to eliminate Xcv from 'Red Globe' plants it was studied: optimal size of meristem tips and axillary buds for cultivation in modified Galzy's medium (MGM; effects of thermotherapy (38ºC/30 days; and action of antibiotics in the elimination of Xcv in infected grapevines. The percentages of contamination by Xcv and regeneration were analyzed and plants obtained were indexed using the semi-selective culture medium nutrient agar-dextrose-yeast extract-ampicilin (NYDAM followed by a pathogenicity test. The cultivation of 3 mm explants permitted to obtain plants free of bacteria with regeneration 14.3 times higher than 1 mm explants. The thermotherapy of infected plants associated to the in vitro culture

  3. Fake news portrayals of stem cells and stem cell research.

    Science.gov (United States)

    Marcon, Alessandro R; Murdoch, Blake; Caulfield, Timothy

    2017-10-01

    This study examines how stem cells and stem cell research are portrayed on websites deemed to be purveyors of distorted and dubious information. Content analysis was conducted on 224 articles from 2015 to 2016, compiled by searching with the keywords 'stem cell(s)' on a list of websites flagged for containing either 'fake' or 'junk science' news. Articles contained various exaggerated positive and negative claims about stem cells and stem cell science, health and science related conspiracy theories, and statements promoting fear and mistrust of conventional medicine. Findings demonstrate the existence of organized misinformation networks, which may lead the public away from accurate information and facilitate a polarization of public discourse.

  4. "Excellence" in STEM Education

    Science.gov (United States)

    Clark, Aaron C.

    2012-01-01

    So what does it take to achieve excellence in STEM education? That is the title of the author's presentation delivered at International Technology and Engineering Educators Association's (ITEEA's) FTEE "Spirit of Excellence" Breakfast on March 16, 2012, in Long Beach, California. In preparation for this presentation, the author went back and read…

  5. Stem cell heterogeneity revealed

    DEFF Research Database (Denmark)

    Andersen, Marianne S; Jensen, Kim B

    2016-01-01

    The skin forms a protective, water-impermeable barrier consisting of heavily crosslinked epithelial cells. However, the specific role of stem cells in sustaining this barrier remains a contentious issue. A detailed analysis of the interfollicular epidermis now proposes a model for how a composite...... of cells with different properties are involved in its maintenance....

  6. Paraneoplastic brain stem encephalitis.

    Science.gov (United States)

    Blaes, Franz

    2013-04-01

    Paraneoplastic brain stem encephalitis can occur as an isolated clinical syndrome or, more often, may be part of a more widespread encephalitis. Different antineuronal autoantibodies, such as anti-Hu, anti-Ri, and anti-Ma2 can be associated with the syndrome, and the most frequent tumors are lung and testicular cancer. Anti-Hu-associated brain stem encephalitis does not normally respond to immunotherapy; the syndrome may stabilize under tumor treatment. Brain stem encephalitis with anti-Ma2 often improves after immunotherapy and/or tumor therapy, whereas only a minority of anti-Ri positive patients respond to immunosuppressants or tumor treatment. The Opsoclonus-myoclonus syndrome (OMS) in children, almost exclusively associated with neuroblastoma, shows a good response to steroids, ACTH, and rituximab, some patients do respond to intravenous immunoglobulins or cyclophosphamide. In adults, OMS is mainly associated with small cell lung cancer or gynecological tumors and only a small part of the patients show improvement after immunotherapy. Earlier diagnosis and treatment seem to be one major problem to improve the prognosis of both, paraneoplastic brain stem encephalitis, and OMS.

  7. stem bark in rodents

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... The effect of the extract on the normal intestinal transit in mice was not significant. However, in the ... kunthianum stem bark was therefore investigated in mice and rats' in vivo ..... sons, London, 11: 544. Izzo AA, Nicoletti M, ...

  8. Porcine embryonic stem cells

    DEFF Research Database (Denmark)

    Hall, Vanessa Jane

    2008-01-01

    The development of porcine embryonic stem cell lines (pESC) has received renewed interest given the advances being made in the production of immunocompatible transgenic pigs. However, difficulties are evident in the production of pESCs in-vitro. This may largely be attributable to differences...

  9. Hollow stem in cauliflower

    NARCIS (Netherlands)

    Everaarts, A.P.; Putter, de H.

    2003-01-01

    The occurrence of, sometimes large, cavities in the stem of cauliflower formed a serious quality problem for Dutch cauliflower growers in recent years. The cause of the problem under the local conditions was not clear. In field experiments, the application of boron and variation in the growth rate

  10. Using laser to measure stem thickness and cut weed stems

    DEFF Research Database (Denmark)

    Heisel, T.; Schou, Jørgen; Andreasen, C.

    2002-01-01

    Stem thickness of the weed Solanum nigrum and the crop sugarbeet was determined with a He-Ne laser using a novel non-destructive technique measuring stem shadow. Thereafter, the stems were cut close to the soil surface with a CO2 laser. Treatments were carried out on pot plants, grown....... A binary model was also tested. The non-linear model incorporating stem thickness described the data best, indicating that it would be possible to optimize laser cutting by measuring stem thickness before cutting. The general tendency was that more energy was needed the thicker the stem. Energy uses...... in the greenhouse, at two different growth stages, and plant dry matter was measured 2-5 weeks after treatment. The relationship between plant dry weight and laser energy was analysed using two different non-linear dose-response regression models; one model included stem thickness as a variable, the other did not...

  11. Determination of the Three Main Components of the Grapevine Moth Pest Pheromone in Grape-Related Samples by Headspace-Gas Chromatography-Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    María del Carmen Alcudia-León

    2017-10-01

    Full Text Available The grapevine moth (Lobesia botrana is the most significant pest of viticulture. This article reports the development of an analytical method that allows the instrumental determination of the three main pheromone components of the pest ((E,Z-7,9-dodecadien-1-yl acetate, (E,Z-7,9-dodecadien-1-ol and (Z-9-dodecen-1-yl acetate in grape-related samples (must, table grape and wine grape. The combination of headspace, gas chromatography and mass spectrometry provides limits of detection in the range of 60–420 ng/Kg and precision, expressed as a relative standard deviation, better than 8.5%. This analytical approach is rapid and simple and opens a door to the study of the pest incidence on the final products.

  12. Abstracts of oral and poster presentation given at the first COST Action FA 1303 workshop on Grapevine Trunk Diseases, Cognac, France, 23-24 June 2015

    Directory of Open Access Journals (Sweden)

    2015-09-01

    Full Text Available The International COST Action FA1303 Workshop on “Sustainable control of Grapevine Trunk Diseases: current state and future prospects” was held in Cognac, France, on June 23-24 2015. The meeting was attended by 90 participants. Forty-eight oral and posterpapers were presented,in four sessions: Pathogen characterization, detection and epidemiology; Microbial ecology; Host-pathogen and fungus-fungus competitive interactions; and Disease management. A field trip to the nursery Mercier at Vix was undertaken on June the 22th and 25th, including a demonstration of the MYCORRAY detection tool in the nursery research lab. A second field trip was to the Hennessy cellar, on the  afternoon of June 23th.The workshop was organized by members of the COST Action FA1303 (www.managtd.eu, in collaboration with Hennessy.

  13. In vitro processing of the RNA-2-encoded polyprotein of two nepoviruses: tomato black ring virus and grapevine chrome mosaic virus.

    Science.gov (United States)

    Demangeat, G; Hemmer, O; Fritsch, C; Le Gall, O; Candresse, T

    1991-02-01

    In vitro translation of RNA-2 of each of two closely related nepoviruses, tomato black ring virus (TBRV) and grapevine chrome mosaic virus (GCMV), in a rabbit reticulocyte lysate resulted in the synthesis of single polypeptides of 150K and 146K respectively. Processing of these polyproteins occurred after the addition of translation products of homologous RNA-1. The positions of the cleavage products within the polyproteins were determined. From the N to the C terminus, Mr values for the proteins were 50K, 46K and 59K for TBRV and 44K, 46K and 56K for GCMV. TBRV RNA-1 translation products also cleaved the polyproteins encoded by GCMV RNA-2 which suggests that the cleavage sites in the two polyproteins are similar.

  14. Stem cell migration after irradiation

    International Nuclear Information System (INIS)

    Nothdurft, W.; Fliedner, T.M.

    1979-01-01

    The survival rate of irradiated rodents could be significantly improved by shielding only the small parts of hemopoietic tissues during the course of irradiation. The populations of circulating stem cells in adult organisms are considered to be of some importance for the homeostasis between the many sites of blood cell formation and for the necessary flexibility of hemopoietic response in the face of fluctuating demands. Pluripotent stem cells are migrating through peripheral blood as has been shown for several mammalian species. Under steady state conditions, the exchange of stem cells between the different sites of blood cell formation appears to be restricted. Their presence in blood and the fact that they are in balance with the extravascular stem cell pool may well be of significance for the surveilance of the integrity of local stem cell populations. Any decrease of stem cell population in blood below a critical size results in the rapid immigration of circulating stem cells in order to restore local stem cell pool size. Blood stem cells are involved in the regeneration after whole-body irradiation if the stem cell population in bone marrows is reduced to less than 10% of the normal state. In the animals subjected to partial-body irradiation, the circulating stem cells appear to be the only source for the repopulation of the heavily irradiated, aplastic sites of hemopoietic organs. (Yamashita, S.)

  15. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  17. [Perinatal sources of stem cells].

    Science.gov (United States)

    Piskorska-Jasiulewicz, Magdalena Maria; Witkowska-Zimny, Małgorzata

    2015-03-08

    Recently, stem cell biology has become an interesting topic. Several varieties of human stem cells have been isolated and identified in vivo and in vitro. Successful application of hematopoietic stem cells in hematology has led to the search for other sources of stem cells and expanding the scale of their application. Perinatal stem cells are a versatile cell population, and they are interesting for both scientific and practical objectives. Stem cells from perinatal tissue may be particularly useful in the clinic for autologous transplantation for fetuses and newborns, and after banking in later stages of life, as well as for in utero transplantation in the case of genetic disorders. In this review paper we focus on the extraction and therapeutic potential of stem cells derived from perinatal tissues such as the placenta, the amnion, amniotic fluid, umbilical cord blood and Wharton's jelly.

  18. Perinatal sources of stem cells

    Directory of Open Access Journals (Sweden)

    Magdalena Maria Piskorska-Jasiulewicz

    2015-03-01

    Full Text Available Recently, stem cell biology has become an interesting topic. Several varieties of human stem cells have been isolated and identified in vivo and in vitro. Successful application of hematopoietic stem cells in hematology has led to the search for other sources of stem cells and expanding the scale of their application. Perinatal stem cells are a versatile cell population, and they are interesting for both scientific and practical objectives. Stem cells from perinatal tissue may be particularly useful in the clinic for autologous transplantation for fetuses and newborns, and after banking in later stages of life, as well as for in utero transplantation in the case of genetic disorders. In this review paper we focus on the extraction and therapeutic potential of stem cells derived from perinatal tissues such as the placenta, the amnion, amniotic fluid, umbilical cord blood and Wharton’s jelly.

  19. Materials as stem cell regulators

    Science.gov (United States)

    Murphy, William L.; McDevitt, Todd C.; Engler, Adam J.

    2014-01-01

    The stem cell/material interface is a complex, dynamic microenvironment in which the cell and the material cooperatively dictate one another's fate: the cell by remodelling its surroundings, and the material through its inherent properties (such as adhesivity, stiffness, nanostructure or degradability). Stem cells in contact with materials are able to sense their properties, integrate cues via signal propagation and ultimately translate parallel signalling information into cell fate decisions. However, discovering the mechanisms by which stem cells respond to inherent material characteristics is challenging because of the highly complex, multicomponent signalling milieu present in the stem cell environment. In this Review, we discuss recent evidence that shows that inherent material properties may be engineered to dictate stem cell fate decisions, and overview a subset of the operative signal transduction mechanisms that have begun to emerge. Further developments in stem cell engineering and mechanotransduction are poised to have substantial implications for stem cell biology and regenerative medicine. PMID:24845994

  20. Sequence/structural analysis of xylem proteome emphasizes pathogenesis-related proteins, chitinases and β-1, 3-glucanases as key players in grapevine defense against Xylella fastidiosa

    Directory of Open Access Journals (Sweden)

    Sandeep Chakraborty

    2016-05-01

    Full Text Available Background. Xylella fastidiosa, the causative agent of various plant diseases including Pierce’s disease in the US, and Citrus Variegated Chlorosis in Brazil, remains a continual source of concern and economic losses, especially since almost all commercial varieties are sensitive to this Gammaproteobacteria. Differential expression of proteins in infected tissue is an established methodology to identify key elements involved in plant defense pathways. Methods. In the current work, we developed a methodology named CHURNER that emphasizes relevant protein functions from proteomic data, based on identification of proteins with similar structures that do not necessarily have sequence homology. Such clustering emphasizes protein functions which have multiple copies that are up/down-regulated, and highlights similar proteins which are differentially regulated. As a working example we present proteomic data enumerating differentially expressed proteins in xylem sap from grapevines that were infected with X. fastidiosa. Results. Analysis of this data by CHURNER highlighted pathogenesis related PR-1 proteins, reinforcing this as the foremost protein function in xylem sap involved in the grapevine defense response to X. fastidiosa. β-1, 3-glucanase, which has both anti-microbial and anti-fungal activities, is also up-regulated. Simultaneously, chitinases are found to be both up and down-regulated by CHURNER, and thus the net gain of this protein function loses its significance in the defense response. Discussion. We demonstrate how structural data can be incorporated in the pipeline of proteomic data analysis prior to making inferences on the importance of individual proteins to plant defense mechanisms. We expect CHURNER to be applicable to any proteomic data set.

  1. Molecular cloning and characterization of UDP-glucose: furaneol glucosyltransferase gene from grapevine cultivar Muscat Bailey A (Vitis labrusca × V. vinifera).

    Science.gov (United States)

    Sasaki, Kanako; Takase, Hideki; Kobayashi, Hironori; Matsuo, Hironori; Takata, Ryoji

    2015-10-01

    2,5-Dimethyl-4-hydroxy-3(2H)-furanone (furaneol) is an important aroma compound in fruits, such as pineapple and strawberry, and is reported to contribute to the strawberry-like note in some wines. Several grapevine species are used in winemaking, and furaneol is one of the characteristic aroma compounds in wines made from American grape (Vitis labrusca) and its hybrid grape. Furaneol glucoside was recently isolated as an important furaneol derivative from the hybrid grapevine cultivar, Muscat Bailey A (V. labrusca × V. vinifera), and this was followed by its isolation from some fruits such as strawberry and tomato. Furaneol glucoside is a significant 'aroma precursor of wine' because furaneol is liberated from it during alcoholic fermentation. In this study, a glucosyltransferase gene from Muscat Bailey A (UGT85K14), which is responsible for the glucosylation of furaneol was identified. UGT85K14 was expressed in the representative grape cultivars regardless of species, indicating that furaneol glucoside content is regulated by the biosynthesis of furaneol. On the other hand, furaneol glucoside content in Muscat Bailey A berry during maturation might be controlled by the expression of UGT85K14 along with the biosynthesis of furaneol. Recombinant UGT85K14 expressed in Escherichia coli is able to transfer a glucose moiety from UDP-glucose to the hydroxy group of furaneol, indicating that this gene might be UDP-glucose: furaneol glucosyltransferase in Muscat Bailey A. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Generic and sequence-variant specific molecular assays for the detection of the highly variable Grapevine leafroll-associated virus 3.

    Science.gov (United States)

    Chooi, Kar Mun; Cohen, Daniel; Pearson, Michael N

    2013-04-01

    Grapevine leafroll-associated virus 3 (GLRaV-3) is an economically important virus, which is found in all grapevine growing regions worldwide. Its accurate detection in nursery and field samples is of high importance for certification schemes and disease management programmes. To reduce false negatives that can be caused by sequence variability, a new universal primer pair was designed against a divergent sequence data set, targeting the open reading frame 4 (heat shock protein 70 homologue gene), and optimised for conventional one-step RT-PCR and one-step SYBR Green real-time RT-PCR assays. In addition, primer pairs for the simultaneous detection of specific GLRaV-3 variants from groups 1, 2, 6 (specifically NZ-1) and the outlier NZ2 variant, and the generic detection of variants from groups 1 to 5 were designed and optimised as a conventional one-step multiplex RT-PCR assay using the plant nad5 gene as an internal control (i.e. one-step hexaplex RT-PCR). Results showed that the generic and variant specific assays detected in vitro RNA transcripts from a range of 1×10(1)-1×10(8) copies of amplicon per μl diluted in healthy total RNA from Vitis vinifera cv. Cabernet Sauvignon. Furthermore, the assays were employed effectively to screen 157 germplasm and 159 commercial field samples. Thus results demonstrate that the GLRaV-3 generic and variant-specific assays are prospective tools that will be beneficial for certification schemes and disease management programmes, as well as biological and epidemiological studies of the divergent GLRaV-3 populations. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Impacts of Grapevine Leafroll Disease on Fruit Yield and Grape and Wine Chemistry in a Wine Grape (Vitis vinifera L. Cultivar.

    Directory of Open Access Journals (Sweden)

    Olufemi J Alabi

    Full Text Available Grapevine leafroll disease (GLD is an economically important virus disease affecting wine grapes (Vitis vinifera L., but little is known about its effect on wine chemistry and sensory composition of wines. In this study, impacts of GLD on fruit yield, berry quality and wine chemistry and sensory features were investigated in a red wine grape cultivar planted in a commercial vineyard. Own-rooted Merlot vines showing GLD symptoms and tested positive for Grapevine leafroll-associated virus 3 and adjacent non-symptomatic vines that tested negative for the virus were compared during three consecutive seasons. Number and total weight of clusters per vine were significantly less in symptomatic relative to non-symptomatic vines. In contrast to previous studies, a time-course analysis of juice from grapes harvested at different stages of berry development from symptomatic and non-symptomatic vines indicated more prominent negative impacts of GLD on total soluble solids (TSS and berry skin anthocyanins than in juice pH and titratable acidity. Differences in TSS between grapes of symptomatic and non-symptomatic vines were more pronounced after the onset of véraison, with significantly lower concentrations of TSS in grapes from symptomatic vines throughout berry ripening until harvest. Wines made from grapes of GLD-affected vines had significantly lower alcohol, polymeric pigments, and anthocyanins compared to corresponding wines from grapes of non-symptomatic vines. Sensory descriptive analysis of 2010 wines indicated significant differences in color, aroma and astringency between wines made from grapes harvested from GLD-affected and unaffected vines. The impacts of GLD on yield and fruit and wine quality traits were variable between the seasons, with greater impacts observed during a cooler season, suggesting the influence of host plant × environment interactions on overall impacts of the disease.

  4. Impacts of Grapevine Leafroll Disease on Fruit Yield and Grape and Wine Chemistry in a Wine Grape (Vitis vinifera L.) Cultivar.

    Science.gov (United States)

    Alabi, Olufemi J; Casassa, L Federico; Gutha, Linga R; Larsen, Richard C; Henick-Kling, Thomas; Harbertson, James F; Naidu, Rayapati A

    2016-01-01

    Grapevine leafroll disease (GLD) is an economically important virus disease affecting wine grapes (Vitis vinifera L.), but little is known about its effect on wine chemistry and sensory composition of wines. In this study, impacts of GLD on fruit yield, berry quality and wine chemistry and sensory features were investigated in a red wine grape cultivar planted in a commercial vineyard. Own-rooted Merlot vines showing GLD symptoms and tested positive for Grapevine leafroll-associated virus 3 and adjacent non-symptomatic vines that tested negative for the virus were compared during three consecutive seasons. Number and total weight of clusters per vine were significantly less in symptomatic relative to non-symptomatic vines. In contrast to previous studies, a time-course analysis of juice from grapes harvested at different stages of berry development from symptomatic and non-symptomatic vines indicated more prominent negative impacts of GLD on total soluble solids (TSS) and berry skin anthocyanins than in juice pH and titratable acidity. Differences in TSS between grapes of symptomatic and non-symptomatic vines were more pronounced after the onset of véraison, with significantly lower concentrations of TSS in grapes from symptomatic vines throughout berry ripening until harvest. Wines made from grapes of GLD-affected vines had significantly lower alcohol, polymeric pigments, and anthocyanins compared to corresponding wines from grapes of non-symptomatic vines. Sensory descriptive analysis of 2010 wines indicated significant differences in color, aroma and astringency between wines made from grapes harvested from GLD-affected and unaffected vines. The impacts of GLD on yield and fruit and wine quality traits were variable between the seasons, with greater impacts observed during a cooler season, suggesting the influence of host plant × environment interactions on overall impacts of the disease.

  5. Macro- and microclimate conditions may alter grapevine deacclimation: variation in thermal amplitude in two contrasting wine regions from North and South America

    Science.gov (United States)

    Antivilo, Francisco Gonzalez; Paz, Rosalía Cristina; Keller, Markus; Borgo, Roberto; Tognetti, Jorge; Juñent, Fidel Roig

    2017-12-01

    Low temperature is a limiting factor that affects vineyard distribution globally. The level of cold hardiness acquired during the dormant season by Vitis sp. is crucial for winter survival. Most research published on this topic has been generated beyond 40° N latitude, where daily mean temperatures may attain injurious levels during the dormant season resulting in significant damage to vines and buds. Symptoms of cold injury have been identified in Mendoza (32-35° S latitude), a Southern Hemisphere wine region characterized by a high thermal amplitude, and warm winds during the dormant season. These symptoms have usually been attributed to drought and/or pathogens, but not to rapid deacclimation followed by injurious low temperatures. Because local information on meteorological events as probable causes is scarce, this research was designed to test and study this assumption by comparing macro-, meso-, and microclimatic data from Mendoza, Argentina, and eastern Washington, USA. The goal was to unveil why freezing damage has occurred in both regions, despite the existence of large climatic differences. Because environmental parameters under field conditions may not correspond to data recorded by conventional weather stations, sensors were installed in vineyards for comparison. Microclimatic conditions on grapevines were also evaluated to assess the most vulnerable portions of field-grown grapevines. In order to better understand if it may be possible to modify cold hardiness status in a short period with high thermal amplitude conditions, deacclimation was induced using a thermal treatment. Hence, despite the fact that Mendoza is warmer, and temperatures are not as extreme as in Washington, high daily thermal amplitude might be partially involved in plant deacclimation, leading to a differential cold hardiness response.