7 CFR 205.506 - Granting accreditation.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Accreditation of Certifying Agents § 205.506 Granting accreditation. (a... accreditation as provided in § 205.510(c), the certifying agent voluntarily ceases its certification activities...
7 CFR 205.404 - Granting certification.
2010-01-01
... PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.404 Granting certification. (a) Within a reasonable... certified operation; (2) Effective date of certification; (3) Categories of organic operation, including... operation's organic certification continues in effect until surrendered by the organic operation or...
Barrière, Quentin; Guefrachi, Ibtissem; Gully, Djamel; Lamouche, Florian; Pierre, Olivier; Fardoux, Joël; Chaintreuil, Clémence; Alunni, Benoît; Timchenko, Tatiana; Giraud, Eric; Mergaert, Peter
2017-08-22
Legumes harbor in their symbiotic nodule organs nitrogen fixing rhizobium bacteria called bacteroids. Some legumes produce Nodule-specific Cysteine-Rich (NCR) peptides in the nodule cells to control the intracellular bacterial population. NCR peptides have antimicrobial activity and drive bacteroids toward terminal differentiation. Other legumes do not produce NCR peptides and their bacteroids are not differentiated. Bradyrhizobia, infecting NCR-producing Aeschynomene plants, require the peptide uptake transporter BclA to cope with the NCR peptides as well as a specific peptidoglycan-modifying DD-carboxypeptidase, DD-CPase1. We show that Bradyrhizobium diazoefficiens strain USDA110 forms undifferentiated bacteroids in NCR-lacking soybean nodules. Unexpectedly, in Aeschynomene afraspera nodules the nitrogen fixing USDA110 bacteroids are hardly differentiated despite the fact that this host produces NCR peptides, suggesting that USDA110 is insensitive to the host peptide effectors and that nitrogen fixation can be uncoupled from differentiation. In agreement with the absence of bacteroid differentiation, USDA110 does not require its bclA gene for nitrogen fixing symbiosis with these two host plants. Furthermore, we show that the BclA and DD-CPase1 act independently in the NCR-induced morphological differentiation of bacteroids. Our results suggest that BclA is required to protect the rhizobia against the NCR stress but not to induce the terminal differentiation pathway.
NCR1+ cells in dogs show phenotypic characteristics of natural killer cells.
Grøndahl-Rosado, Christine; Bønsdorff, Tina B; Brun-Hansen, Hege C; Storset, Anne K
2015-03-01
No specific markers for natural killer (NK) cells in dogs have currently been described. NCR1 (NKp46, CD355) has been considered a pan species NK cell marker and is expressed on most or all NK cells in all species investigated except for the pig which has both a NCR1(+) and a NCR1(-) population. In this study peripheral blood mononuclear cells (PBMC) from 14 healthy dogs, 37 dogs with a clinical diagnosis, including a dog diagnosed with LGL leukemia, and tissue samples from 8 dogs were evaluated for NCR1(+) expression by a cross reacting anti bovine NCR1 antibody. CD3(-)NCR1(+) cells were found in the blood of 93 % of healthy dogs and comprised up to 2.5 % of lymphocytes in PBMC. In a selection of healthy dogs, sampling and immunophenotyping were repeated throughout a period of 1 year revealing a substantial variation in the percentage of CD3(-)NCR1(+) over time. Dogs allocated to 8 disease groups had comparable amounts of CD3(-)NCR1(+) cells in PBMC to the healthy individuals. All organs examined including liver, spleen and lymph nodes contained CD3(-)NCR1(+) cells. Circulating CD3(-)NCR1(+) cells were further characterized as CD56(-)GranzymeB(+)CD8(-). A CD3(+)NCR1(+) population was observed in PBMC in 79 % of the healthy dogs examined representing at the most 4.8 % of the lymphocyte population. In canine samples examined for CD56 expression, CD56(+) cells were all CD3(+) and NCR1(-). To our knowledge, this is the first examination of NCR1 expression in the dog. The study shows that this NK cell associated receptor is expressed both on populations of CD3(+) and CD3(-) blood lymphocytes in dogs and the receptor is found on a CD3(+) GranzymeB(+) CD8(+) leukemia. Our results support that CD56 is expressed only on CD3(+) cells in dogs and shows that NCR1 defines a different CD3(+) lymphocyte population than CD56(+)CD3(+) cells in this species. CD3(-)NCR1(+) cells may represent canine NK cells.
32 CFR 724.120 - National Capital Region (NCR).
2010-07-01
... 32 National Defense 5 2010-07-01 2010-07-01 false National Capital Region (NCR). 724.120 Section 724.120 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY PERSONNEL NAVAL DISCHARGE REVIEW BOARD Definitions § 724.120 National Capital Region (NCR). The District of Columbia; Prince...
NCR-days 2004; research for managing rivers: present and future issues
Makaske, B.; Os, van A.G.
2005-01-01
These proceedings are the product of the NCR days 2004, held 46 November 2004 in Wageningen.The NCR days are a yearly conference at which mainly young scientists present their ongoing research on a wide variety of fluvial subjects. The 46 contributions (oral presentations and posters) to the
Horváth, Beatrix; Domonkos, Ágota; Kereszt, Attila; Szűcs, Attila; Ábrahám, Edit; Ayaydin, Ferhan; Bóka, Károly; Chen, Yuhui; Chen, Rujin; Murray, Jeremy D; Udvardi, Michael K; Kondorosi, Éva; Kaló, Péter
2015-12-08
Host compatible rhizobia induce the formation of legume root nodules, symbiotic organs within which intracellular bacteria are present in plant-derived membrane compartments termed symbiosomes. In Medicago truncatula nodules, the Sinorhizobium microsymbionts undergo an irreversible differentiation process leading to the development of elongated polyploid noncultivable nitrogen fixing bacteroids that convert atmospheric dinitrogen into ammonia. This terminal differentiation is directed by the host plant and involves hundreds of nodule specific cysteine-rich peptides (NCRs). Except for certain in vitro activities of cationic peptides, the functional roles of individual NCR peptides in planta are not known. In this study, we demonstrate that the inability of M. truncatula dnf7 mutants to fix nitrogen is due to inactivation of a single NCR peptide, NCR169. In the absence of NCR169, bacterial differentiation was impaired and was associated with early senescence of the symbiotic cells. Introduction of the NCR169 gene into the dnf7-2/NCR169 deletion mutant restored symbiotic nitrogen fixation. Replacement of any of the cysteine residues in the NCR169 peptide with serine rendered it incapable of complementation, demonstrating an absolute requirement for all cysteines in planta. NCR169 was induced in the cell layers in which bacteroid elongation was most pronounced, and high expression persisted throughout the nitrogen-fixing nodule zone. Our results provide evidence for an essential role of NCR169 in the differentiation and persistence of nitrogen fixing bacteroids in M. truncatula.
42 CFR 50.205 - Consent form requirements.
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Consent form requirements. 50.205 Section 50.205 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS POLICIES OF GENERAL APPLICABILITY Sterilization of Persons in Federally Assisted Family Planning Projects § 50.205 Consent form...
Impedance spectroscopy studies on lead free (Ba0.85Ca0.15(Ti0.9Zr0.1O3 ceramics
Directory of Open Access Journals (Sweden)
Ahcène Chaouchi
2012-12-01
Full Text Available The AC complex impedance spectroscopy technique has been used to obtain the electrical parameters of polycrystalline sample of (Ba0.85Ca0.15(Ti0.9Zr0.1O3 in a wide frequency range at different temperatures. This sample was prepared by a high temperature solid-state reaction technique and single phase formation was confirmed by X-ray diffraction technique. This study was carried out by the means of simultaneous analysis of impedance, modulus, and electrical conductivity. The Cole-Cole (Nyquist plots suggest that the grains and grain boundaries are responsible in the conduction mechanism of the material at high temperature. The ColeCole (Nyquist plot studies revealed the presence of grain and grain boundary effect at 485 °C. On the other hand, it showed only the presence of grain boundary component of the resistivity at 535 °C. Complex impedance analysis indicated the presence of non-Debye type dielectric relaxation. The bulk resistance of the material decreases with rise in temperature similar to a semiconductor, and the Cole-Cole (Nyquist plot showed the negative temperature coefficient of resistance (NTCR character of (Ba0.85Ca0.15(Ti0.9Zr0.1O3. The value of activation energy is found to be 0.7433 eV, which suggests that the conduction may be the result of defect and charge carriers present in the materials.
Viswanath, Pamarti; Prashanth, Sadhu Sai Pavan; Molli, Muralikrishna; Wicram, Jaschin Prem; Sai Muthukumar, V.
2018-04-01
Glass ceramics are excellent replacement for single crystalline materials which are expensive and difficult to fabricate. In this context, we have attempted to fabricate glass nanocomposites comprising of Lithium Borate glass matrix embedded with lead free ferroelectric Ba0.85Ca0.15Zr0.1Ti0.9O3 (BCZT). Both of these functional materials are known to exhibit excellent ferroelectric behavior and are currently explored for various device applications. We have prepared these novel glass nanocomposite using melt-quenching techniquein various chemical composition involving different molar ratio. x(Ba0.85Ca0.15Zr0.1Ti0.9O3)-(1-x)(Li2O.2B2O3) where (x=0.1,0.2,0.3,0.4). The as-quenched samples exhibited amorphous nature as revealed by X-ray Diffraction studies. With the increase in BCZT content we have observed significant alteration in optical bandgap and Urbach energy. The tailoring of optical properties by tuning the structure was probed by Raman vibrational spectroscopy which confirmed the dominant role played by BCZT as a network modifier in these borate glasses. Concomitantly, these glass nanocomposites were found to be excellent UV absorbers.
Synthesis and characterization of Ge–Cr-based intermetallic compounds: GeCr3, GeCCr3, and GeNCr3
International Nuclear Information System (INIS)
Lin, S.; Tong, P.; Wang, B.S.; Huang, Y.N.; Song, W.H.; Sun, Y.P.
2014-01-01
Highlights: • Polycrystalline samples of GeCr 3 , GeCCr 3 , and GeNCr 3 are synthesized by using solid state reaction method. • A good quality of our samples is verified by the Rietveld refinement and electrical transport measurement. • We present a comprehensive understanding of physical properties of GeCr 3 , GeCCr 3 , and GeNCr 3 . -- Abstract: We report the synthesis of GeCr 3 , GeCCr 3 , and GeNCr 3 polycrystalline compounds, and present a systematic study of this series by the measurements of X-ray diffraction (XRD), magnetism, electrical/thermal transport, specific heat, and Hall coefficient. Good quality of our samples is verified by quite small value of residual resistivity and considerably large residual resistivity ratio. Based on the Rietveld refinement of XRD data, the crystallographic parameters are obtained, and, correspondingly, the sketches of crystal structure are plotted for all the samples. The ground states of GeCr 3 , GeCCr 3 , and GeNCr 3 are paramagnetic/antiferromagnetic metal, and even a Fermi-liquid behavior is observed in electrical transport at low temperatures. Furthermore, the analysis of the thermal conductivity data suggests the electron thermal conductivity plays a major role in total thermal conductivity for GeCr 3 at low temperatures, while the phonon thermal conductivity is dominant for GeCCr 3 and GeNCr 3 at high temperatures. The negative value of Seebeck coefficient and Hall coefficient indicate that the charge carriers are electron-type for GeCr 3 , GeCCr 3 , and GeNCr 3
Observation of magnetization reversal behavior in Sm0.9Gd0.1Cr0.85Mn0.15O3 orthochromites
Panwar, Neeraj; Joby, Jostin P.; Kumar, Surendra; Coondoo, Indrani; Vasundhara, M.; Kumar, Nitu; Palai, Ratnakar; Singhal, Rahul; Katiyar, Ram S.
2018-05-01
Impact of co-doping (Gd and Mn) on the magnetic properties has been systematically investigated in SmCrO3 compound. For the synthesized compound Sm0.9Gd0.1Cr0.85Mn0.15O3 (SGCMO), below the Neel transition temperature and under low applied magnetic field, temperature induced magnetization reversal at 105 K (crossover temperature) was noticed in the field cooled magnetization curve. Magnetization reversal attained maximum value of -1.03 emu/g at 17 K where spin reorientation occurred. The magnetization reversal disappeared under higher applied field. From the M-H plots an enhancement in the magnetization was observed due to Gd doping. Magnetocaloric effect at low temperatures measured through the magnetic entropy change was found sixteen times higher for this compound as compared to pristine SmCrO3 and twice to that of SmCr0.85Mn0.15O3 compound. The study reveals the importance of co-doping in tailoring the magnetic properties of rare-earth chromites.
Effect of N+Cr alloying on the microstructures and tensile properties of Hadfield steel
International Nuclear Information System (INIS)
Chen, C.; Zhang, F.C.; Wang, F.; Liu, H.; Yu, B.D.
2017-01-01
The microstructures and tensile behaviors of traditional Hadfield steel, named Mn12 steel, and Hadfield steel alloyed with N+Cr, named Mn12CrN steel were studied through optical microscopy, transmission electron microscopy, and scanning electron microscopy, among others. Three different tensile strain rates of 5×10 −4 , 5×10 −3 , and 5×10 −2 s −1 were selected in the tensile test. The deformation microstructures and fracture morphologies of the two steels after fracture in the tensile test were observed to analyze the tensile deformation response to different tensile strain rates. Results showed that the grain size of Mn12CrN steel was evidently refined after alloying with N+Cr. The grain would not become abnormally coarse even with increasing austenitizing temperature. During tensile deformation, the strength and plasticity of Mn12CrN steel were superior to those of Mn12 steel at the same strain rate. With increasing the strain rate, the changes in strength and plasticity of Mn12CrN steel were less sensitive to tensile strain rate compared with Mn12 steel. The effects of grain refinement and N+Cr alloying on dynamic strain aging and deformation twining behaviors were responsible for this lack of sensitivity to strain rate.
Effect of N+Cr alloying on the microstructures and tensile properties of Hadfield steel
Energy Technology Data Exchange (ETDEWEB)
Chen, C. [State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China); Zhang, F.C., E-mail: zfc@ysu.edu.cn [State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China); National Engineering Research Center for Equipment and Technology of Cold Strip Rolling, Yanshan University, Qinhuangdao 066004 (China); Wang, F. [State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao 066004 (China); Liu, H.; Yu, B.D. [China Railway Shanhaiguan Bridge Group Co. LTD, Qinhuangdao 066205 (China)
2017-01-02
The microstructures and tensile behaviors of traditional Hadfield steel, named Mn12 steel, and Hadfield steel alloyed with N+Cr, named Mn12CrN steel were studied through optical microscopy, transmission electron microscopy, and scanning electron microscopy, among others. Three different tensile strain rates of 5×10{sup −4}, 5×10{sup −3}, and 5×10{sup −2} s{sup −1} were selected in the tensile test. The deformation microstructures and fracture morphologies of the two steels after fracture in the tensile test were observed to analyze the tensile deformation response to different tensile strain rates. Results showed that the grain size of Mn12CrN steel was evidently refined after alloying with N+Cr. The grain would not become abnormally coarse even with increasing austenitizing temperature. During tensile deformation, the strength and plasticity of Mn12CrN steel were superior to those of Mn12 steel at the same strain rate. With increasing the strain rate, the changes in strength and plasticity of Mn12CrN steel were less sensitive to tensile strain rate compared with Mn12 steel. The effects of grain refinement and N+Cr alloying on dynamic strain aging and deformation twining behaviors were responsible for this lack of sensitivity to strain rate.
Olsen, Line; Boysen, Preben; Åkesson, Caroline Piercey; Gunnes, Gjermund; Connelley, Timothy; Storset, Anne K; Espenes, Arild
2013-11-13
Natural killer (NK) cells are important for immune protection of the gut mucosa. Previous studies have shown that under pathologic conditions NK cells, T cells and dendritic cells are found co-localised in secondary lymphoid organs where their interaction coordinates immune responses. However, in the gut-associated lymphoid tissues (GALTs), there are few detailed reports on the distribution of NK cells. Sheep harbour several types of organised lymphoid tissues in the gut that have different functions. The ileal Peyer's patch (IPP) functions as a primary lymphoid tissue for B cell generation, while the jejunal Peyer's patches (JPPs) and colon patches (CPs) are considered secondary lymphoid tissues. In the present study, we analysed tissues from healthy lambs by flow cytometry and in situ multicolour immunofluorescence, using recently described NCR1 antibodies to identify ovine NK cells. Most NCR1+ cells isolated from all tissues were negative for the pan T cell marker CD3, and thus comply with the general definition of NK cells. The majority of NCR1+ cells in blood as well as secondary lymphoid organs expressed CD16, but in the GALT around half of the NCR1+ cells were negative for CD16. A semi-quantitative morphometric study on tissue sections was used to compare the density of NK cells in four compartments of the IPPs, JPP and CPs. NCR1+ cells were found in all gut segments. Statistical analysis revealed significant differences between compartments of the primary lymphoid organ IPP and the secondary lymphoid organs of the JPPs and CP. NK cells co-localised and made close contact with T cells, dendritic cells and other NK cells, but did not show signs of proliferation. We conclude that NK cells are present in all investigated segments of the sheep gut, but that presence of other innate lymphoid cells expressing NCR1 cannot be excluded.
DEFF Research Database (Denmark)
Yap, Emily W.; Glaum, Julia; Oddershede, Jette
2018-01-01
The ferroelectric and piezoelectric properties of (Ba0.85Ca0.15)(Zr0.1Ti0.9)O3 (BCZT) ceramics were measured as a function of porosity. Porous BCZT ceramics were fabricated using the sacrificial fugitive technique. Two different pore morphologies were induced by adding polymeric microspheres...... and fibres as the pore-forming agents. Increasing porosity led to decreasing ferroelectric and piezoelectric properties due to a reduction of polarisable BCZT ceramic available. With the benefit of being a lead-free piezoelectric material, porous BCZT ceramics may be considered for acoustic impedance...
Sharma, Sarita; Sharma, Hakikat; Negi, N. S.
2018-05-01
Lead free Ba0.85Ca0.15Zr0.1Ti0.9O3(BCTZ) ceramic has been synthesized by sol-gel method. Properties of material are studied at different sintering temperatures for 5 hours. Structural and microstructural properties are analyzed by using X-ray diffractrometer (XRD) and scanning electron microscopy (SEM) at annealing temperature of 850°C and 1050°C XRD pattern confirm the perovskite structure of the material without any unwanted phases crystalinity increased with increase of sintering temperature so as roughness and porosity is decreased as shown by SEM micrographs. There is large improvement in density with rise of sintering temperature which also leads to drastic change in ferroelectric and dielectric properties.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Fees. 205.205 Section 205.205 Animals and Animal Products GRAIN INSPECTION, PACKERS AND STOCKYARDS ADMINISTRATION (PACKERS AND STOCKYARDS... can be set in any manner provided by the law of the State in which such EFS is filed. The basis for...
Czech Academy of Sciences Publication Activity Database
Šafránková, J.; Hayosh, Mykhaylo; Gutynska, O.; Němeček, Z.; Přech, L.
2009-01-01
Roč. 114, - (2009), A12213/1-A12213/7 ISSN 0148-0227 R&D Projects: GA ČR GA205/09/0170 Grant - others:GA ČR(CZ) GA205/09/0112 Institutional research plan: CEZ:AV0Z30420517 Keywords : IMF * magnetosheath Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.082, year: 2009
48 CFR 31.205-48 - Research and development costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Research and development... Organizations 31.205-48 Research and development costs. Research and development, as used in this subsection... grant for research and development effort, the excess is unallowable under any other Government contract...
Directory of Open Access Journals (Sweden)
Sam Sheppard
2018-03-01
Full Text Available Summary: TRAIL is an apoptosis-inducing ligand constitutively expressed on liver-resident type 1 innate lymphoid cells (ILC1s and a subset of natural killer (NK cells, where it contributes to NK cell anti-tumor, anti-viral, and immunoregulatory functions. However, the intrinsic pathways involved in TRAIL expression in ILCs remain unclear. Here, we demonstrate that the murine natural cytotoxic receptor mNKp46/NCR1, expressed on ILC1s and NK cells, controls TRAIL protein expression. Using NKp46-deficient mice, we show that ILC1s lack constitutive expression of TRAIL protein and that NK cells activated in vitro and in vivo fail to upregulate cell surface TRAIL in the absence of NKp46. We show that NKp46 regulates TRAIL expression in a dose-dependent manner and that the reintroduction of NKp46 in mature NK cells deficient for NKp46 is sufficient to restore TRAIL surface expression. These studies uncover a link between NKp46 and TRAIL expression in ILCs with potential implications in pathologies involving NKp46-expressing cells. : Sheppard et al. find that mice deficient in the activating receptor NCR1/NKp46 (Ncr1−/− fail to express the apoptosis-inducing ligand TRAIL at the surface of group 1 innate lymphoid cells (ILC1s. Keywords: NK cell, natural killer cell, NKp46, ILC1, TRAIL, IL-15, IL-2
Shi, Jing; Zhu, Rongfeng; Liu, Xing; Yuan, Ningyi; Ding, Jianning; Luo, Haosu
2017-01-01
The 1 wt % Li-doped (Ba0.85Ca0.15)(Zr0.1Ti0.9)O3 (BCZT-Li) ceramics prepared by the citrate method exhibit improved phase purity, densification and electrical properties, which provide prospective possibility to develop high-performance electrocaloric materials. The electrocaloric effect was evaluated by phenomenological method, and the BCZT-Li ceramics present large electrocaloric temperature change ∆T, especially large electrocaloric responsibility ξ = ∆Tmax/∆Emax, which can be comparable to the largest values reported in the lead-free piezoelectric ceramics. The excellent electrocaloric effect is considered as correlating with the coexistence of polymorphic ferroelectric phases, which are detected by the Raman spectroscopy. The large ξ value accompanied by decreased Curie temperature (around 73 °C) of the BCZT-Li ceramics prepared by the citrate method presents potential applications as the next-generation solid-state cooling devices. PMID:28927004
Directory of Open Access Journals (Sweden)
Jing Shi
2017-09-01
Full Text Available The 1 wt % Li-doped (Ba0.85Ca0.15(Zr0.1Ti0.9O3 (BCZT-Li ceramics prepared by the citrate method exhibit improved phase purity, densification and electrical properties, which provide prospective possibility to develop high-performance electrocaloric materials. The electrocaloric effect was evaluated by phenomenological method, and the BCZT-Li ceramics present large electrocaloric temperature change ∆T, especially large electrocaloric responsibility ξ = ∆Tmax/∆Emax, which can be comparable to the largest values reported in the lead-free piezoelectric ceramics. The excellent electrocaloric effect is considered as correlating with the coexistence of polymorphic ferroelectric phases, which are detected by the Raman spectroscopy. The large ξ value accompanied by decreased Curie temperature (around 73 °C of the BCZT-Li ceramics prepared by the citrate method presents potential applications as the next-generation solid-state cooling devices.
In situ XAS study of Li{sub x}Ni{sub 0.7}Fe{sub 0.15}Co{sub 0.15}O{sub 2} cathode material
Energy Technology Data Exchange (ETDEWEB)
Mansour, A.N. [Naval Surface Warfare Center, West Bethesda, MD (United States); Croguennec, L.; Prado, G.; Delmas, C. [Inst. de Chimie de la Matiere Condensee de Bordeaus-CNRS and Ecole Nationale Superieure de Chimie et Physique de Bordeaux, Pesssac Cedex (France)
2001-03-01
We have examined the oxidation states and local atomic structures of Ni, Fe, and Co in Li{sub x}Ni{sub 0.7}Fe{sub 0.15}Co{sub 0.15}O{sub 2} as a function of Li content during the first charge in a Li//Li{sub x}Ni{sub 0.7}Fe{sub 0.15}Co{sub 0.}1{sub 5O2} nonaqueous cell. We show that the composition of the material in the pristine state is more accurately described by Li{sub 0.95}Ni(II){sub 0.09}Ni(III){sub 0.66}Fe(III){sub 0.15}Co(III){sub 0.15}O{sub 2}. Half Ni(II) resides in Li-vacant sites. Both Fe and Co substitute for Ni within the NiO{sub 2} slabs with no significant amounts of Fe or Co that can be attributed to Li-vacant sites. The local structure parameters are consistent with oxidation states observed on the basis of the XANES data. The Ni {kappa}-edge energy continuously shifts to a higher energy with decrease in Li content due to oxidation of Ni( II) to Ni( III) and Ni( III) to Ni( IV). After the complete oxidation of Ni( III) to Ni( IV), the Fe KAPPA(-edge energy begins to increase with further decrease in Li content indicating the oxidation of Fe( III) to Fe( IV). The Co )KAPPA-edge energy at half-height, on the other hand, is unchanged during the whole range of Li de-intercalation indicating that no significant change in the oxidation state of Co occurs upon the complete removal of Li. (au)
Spin vector and shape of (6070) Rheinland and their implications
Czech Academy of Sciences Publication Activity Database
Vokrouhlický, D.; Ďurech, J.; Polishook, D.; Krugly, Yu. N.; Gaftonyuk, N. M.; Burkhonov, O.A.; Ehgamberdiev, S.A.; Karimov, R.; Molotov, I.E.; Pravec, Petr; Hornoch, Kamil; Kušnirák, Peter; Oey, J.; Galád, A.; Žižka, J.
2011-01-01
Roč. 142, č. 5 (2011), 159/1-159/8 ISSN 0004-6256 R&D Projects: GA ČR GA205/09/1107 Grant - others:GA ČR(CZ) GA205/08/0064 Institutional research plan: CEZ:AV0Z10030501 Keywords : minor planets * asteroids * ganeral Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.035, year: 2011
Directory of Open Access Journals (Sweden)
Shailendra Kumar
2013-06-01
Full Text Available This paper aims to determine the preference and use of electronic information and resources by blind/visually impaired users in the leading National Capital Region (NCR libraries of India. Survey methodology has been used as the basic research tool for data collection with the help of questionnaires. The 125 in total users surveyed in all the five libraries were selected randomly on the basis of willingness of the users with experience of working in digital environments to participate in the survey. The survey results were tabulated and analyzed with descriptive statistics methods using Excel software and 'Stata version 11'. The findings reveal that ICT have a positive impact in the lives of people with disabilities as it helps them to work independently and increases the level of confidence among them. The Internet is the most preferred medium of access to information among the majority of blind/visually impaired users. The 'Complexity of content available on the net' is found as the major challenge faced during Internet use by blind users of NCR libraries. 'Audio books on CDs/DVDs and DAISY books' are the most preferred electronic resources among the majority of blind/visually impaired users. This study will help the library professionals and organizations/institutions serving people with disabilities to develop effective library services for blind/visually impaired users in the digital environment on the basis of findings on information usage behavior in the study.
Double-Station Automatic Video Observation of the Meteors
Czech Academy of Sciences Publication Activity Database
Vítek, S.; Koten, Pavel; Páta, P.; Fliegel, K.
2010-01-01
Roč. 2010, - (2010), 943145/1-943145/4 ISSN 1687-7969 R&D Projects: GA ČR GA205/09/1302 Grant - others:GA ČR(CZ) GA102/09/0997 Institutional research plan: CEZ:AV0Z10030501 Keywords : double station observation * video technique Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics
Modeling of H alpha Eruptive Events Observed at the Solar Limb
Czech Academy of Sciences Publication Activity Database
Kotrč, Pavel; Bárta, Miroslav; Schwartz, Pavol; Kupryakov, Yu. A.; Kashapova, L. K.; Karlický, Marian
2013-01-01
Roč. 284, č. 2 (2013), s. 447-466 ISSN 0038-0938 R&D Projects: GA ČR GA205/09/1705; GA ČR(CZ) GA205/09/1469; GA ČR GAP209/10/1706; GA ČR GAP209/10/1680; GA ČR GAP209/12/1652; GA ČR GAP209/12/0103 Grant - others:EU(XE) PCIG-GA-2011-304265; EU(XE) People-2011-IRES 295272 Institutional support: RVO:67985815 Keywords : flares * eruptions * spectrum Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.805, year: 2013
Nathani, Neelam M.; Duggirala, Srinivas M.; M., Chandra Shekar; Kothari, Ramesh K.; Joshi, Chaitanya G.
2015-01-01
Genomic analysis of Clostridium sp. NCR, an anaerobic Gram positive bacterium which was isolated from rumen fluid of Mehsani breed of buffalo revealed presence of various environmental gene tags (EGTs) involved in pathways for utilizing a wide range of substrates. Here we report the sequence of this rumen isolate, its whole genome sequence has been deposited in DDBJ/EMBL/GenBank under the accession number JQHY00000000. The genome comprises of a 3.62-Mb draft genome with a G + C content of 28....
Czech Academy of Sciences Publication Activity Database
Galád, Adrián
2010-01-01
Roč. 514, May (2010), A55/1-A55/10 ISSN 0004-6361 R&D Projects: GA ČR GA205/09/1107 Grant - others:Vega(SK) 2/0016/09 Institutional research plan: CEZ:AV0Z10030501 Keywords : minor planets * asteroids * photometric Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010
BROAD-LINE REVERBERATION IN THE KEPLER-FIELD SEYFERT GALAXY Zw 229-015
International Nuclear Information System (INIS)
Barth, Aaron J.; Nguyen, My L.; Malkan, Matthew A.; Filippenko, Alexei V.; Li, Weidong; Cenko, S. Bradley; Choi, Jieun; Duchene, Gaspard; Ganeshalingam, Mohan; Gorjian, Varoujan; Joner, Michael D.; Bennert, Vardha Nicola; Botyanszki, Janos; Childress, Michael; Cucciara, Antonino; Comerford, Julia M.; Da Silva, Robert; Fumagalli, Michele; Gates, Elinor L.; Gerke, Brian F.
2011-01-01
The Seyfert 1 galaxy Zw 229-015 is among the brightest active galaxies being monitored by the Kepler mission. In order to determine the black hole mass in Zw 229-015 from Hβ reverberation mapping, we have carried out nightly observations with the Kast Spectrograph at the Lick 3 m telescope during the dark runs from 2010 June through December, obtaining 54 spectroscopic observations in total. We have also obtained nightly V-band imaging with the Katzman Automatic Imaging Telescope at Lick Observatory and with the 0.9 m telescope at the Brigham Young University West Mountain Observatory over the same period. We detect strong variability in the source, which exhibited more than a factor of two change in broad Hβ flux. From cross-correlation measurements, we find that the Hβ light curve has a rest-frame lag of 3.86 +0.69 -0.90 days with respect to the V-band continuum variations. We also measure reverberation lags for Hα and Hγ and find an upper limit to the Hδ lag. Combining the Hβ lag measurement with a broad Hβ width of σ line = 1590 ± 47 km s -1 measured from the rms variability spectrum, we obtain a virial estimate of M BH = 1.00 +0.19 -0.24 x 10 7 M sun for the black hole in Zw 229-015. As a Kepler target, Zw 229-015 will eventually have one of the highest-quality optical light curves ever measured for any active galaxy, and the black hole mass determined from reverberation mapping will serve as a benchmark for testing relationships between black hole mass and continuum variability characteristics in active galactic nuclei.
Energy Technology Data Exchange (ETDEWEB)
Kuepferling, M., E-mail: m.kuepferling@inrim.it; Basso, V. [Istituto Nazionale di Ricerca Metrologica (INRIM), Strada delle Cacce 91, 10135 Turin (Italy); Bennati, C. [Istituto Nazionale di Ricerca Metrologica (INRIM), Strada delle Cacce 91, 10135 Turin (Italy); Department of Applied Science and Technology, Politecnico di Torino, C.so Duca degli Abruzzi 24, 10129 Turin (Italy); Laviano, F.; Ghigo, G. [Department of Applied Science and Technology, Politecnico di Torino, C.so Duca degli Abruzzi 24, 10129 Turin (Italy)
2014-05-07
We investigate the temperature induced ferromagnetic to paramagnetic phase transition in Co substituted La(Fe{sub x}Co{sub y}Si{sub 1−x−y}){sub 13} with x = 0.9 and low Co content of y = 0.015 (T{sub c}≃200 K) by means of magneto-optical imaging with indicator film and by calorimetry at very low temperature rates. We were able to visualize the motion of the ferromagnetic (FM)/paramagnetic (PM) front which is forming reproducible patterns independently of the temperature rate. The average velocity of the FM/PM front was calculated to be 10{sup −4} m/s during the continuous propagation and 4×10{sup −3} m/s during an avalanche. The heat flux was measured at low temperature rates by a differential scanning calorimeter and shows a reproducible sequence of individual and separated avalanches which occurs independently of the rate. We interpret the observed effects as the result of the athermal character of the phase transition.
Czech Academy of Sciences Publication Activity Database
Franěk, J.; Schulmann, K.; Lexa, O.; Ulrich, Stanislav; Štípská, P.; Haloda, J.; Týcová, P.
2011-01-01
Roč. 29, č. 1 (2011), s. 103-130 ISSN 0263-4929 R&D Projects: GA ČR GA205/09/0539 Grant - others:GA ČR(CZ) GA205/05/2187 Institutional research plan: CEZ:AV0Z30120515 Keywords : felsic granulites * Moldanubian domain * quantitative microstructural analysis * quartz and feldspar rheology * Variscan belt Subject RIV: DB - Geology ; Mineralogy Impact factor: 2.990, year: 2011
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Yoshiyuki, T.; Sychrovský, Vladimír
2011-01-01
Roč. 13, č. 1 (2011), s. 100-103 ISSN 1463-9076 R&D Projects: GA ČR GA203/09/2037; GA ČR GAP205/10/0228 Grant - others:European Reintegration Grant(XE) 230955 Institutional research plan: CEZ:AV0Z40550506 Keywords : metal lophilic attraction * nucleic acid * mercury Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.573, year: 2011
Radar and optical observations and physical modeling of triple near-Earth Asteroid (136617) 1994 CC
Czech Academy of Sciences Publication Activity Database
Brozovic, M.; Benner, L. A. M.; Taylor, P.A.; Nolan, M. C.; Howell, E. S.; Magri, C.; Scheeres, D.J.; Giorgini, J. D.; Pollock, J.; Pravec, Petr; Galád, Adrián; Fang, J.; Margot, J. L.; Busch, M.W.; Shepard, M.K.; Reichart, D. E.; Ivarsen, K.M.; Haislip, J.B.; LaCluyze, A.; Jao, J.; Slade, M. A.; Lawrence, K. J.; Hicks, M. D.
2011-01-01
Roč. 216, č. 1 (2011), s. 241-256 ISSN 0019-1035 R&D Projects: GA ČR GA205/09/1107 Grant - others:SAV(SK) Vega 2/0016/09 Institutional research plan: CEZ:AV0Z10030501 Keywords : asteroids * radar observations * near-Earth objects * satellites of asteroids Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.385, year: 2011
Czech Academy of Sciences Publication Activity Database
Chum, Jaroslav; Šindelářová, Tereza; Laštovička, Jan; Hruška, František; Burešová, Dalia; Baše, Jiří
2010-01-01
Roč. 115, - (2010), A11322/1-A11322/13 ISSN 0148-0227 R&D Projects: GA ČR GA205/07/1367; GA ČR GA205/09/1253 Grant - others:AV ČR(CZ) M100420901 Institutional research plan: CEZ:AV0Z30420517 Keywords : Ionosphere * gravity waves * wave propagation * remote sensing Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.303, year: 2010
Czech Academy of Sciences Publication Activity Database
Modrý, David; Šlapeta, Jan Roger; Koudela, Břetislav
2005-01-01
Roč. 52, č. 3 (2005), s. 205-208 ISSN 0015-5683 Grant - others:GA ČR(CZ) GP524/03/D104; GA ČR(CZ) GA524/00/P015 Institutional research plan: CEZ:AV0Z60220518 Keywords : Coccidia * Eimeriidae * Caryospora duszynskii * transmission * paratenic host Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 1.138, year: 2005
Czech Academy of Sciences Publication Activity Database
Gunár, Stanislav; Schwartz, Pavol; Schmieder, B.; Heinzel, Petr; Anzer, U.
2010-01-01
Roč. 514, May (2010), A43/1-A43/11 ISSN 0004-6361 R&D Projects: GA ČR GP205/09/P554; GA ČR GA205/07/1100; GA AV ČR 1QS300120506 Grant - others:ESA(XE) ESA- PECS project No. 98030 Institutional research plan: CEZ:AV0Z10030501 Keywords : Sun filaments * prominences * radiative transfer Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010
Novel Algorithms for Astronomical Plate Analyses
Czech Academy of Sciences Publication Activity Database
Hudec, René; Hudec, L.
2011-01-01
Roč. 32, 1-2 (2011), s. 121-123 ISSN 0250-6335. [Conference on Multiwavelength Variability of Blazars. Guangzhou, 22,09,2010-24,09,2010] R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; MŠMT(CZ) ME09027 Institutional research plan: CEZ:AV0Z10030501 Keywords : astronomical plates * plate archives archives * astronomical algorithms Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.400, year: 2011
Astronomical Plate Archives and Binary Blazars Studies
Czech Academy of Sciences Publication Activity Database
Hudec, René
2011-01-01
Roč. 32, 1-2 (2011), s. 91-95 ISSN 0250-6335. [Conference on Multiwavelength Variability of Blazars. Guangzhou, 22,09,2010-24,09,2010] R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; MŠMT(CZ) ME09027 Institutional research plan: CEZ:AV0Z10030501 Keywords : astronomical plates * plate archives archives * binary blazars Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.400, year: 2011
Interleaver Optimization using Population-Based Metaheuristics
Czech Academy of Sciences Publication Activity Database
Snášel, V.; Platoš, J.; Krömer, P.; Abraham, A.; Ouddane, N.; Húsek, Dušan
2010-01-01
Roč. 20, č. 5 (2010), s. 591-608 ISSN 1210-0552 R&D Projects: GA ČR GA205/09/1079 Grant - others:GA ČR(CZ) GA102/09/1494 Institutional research plan: CEZ:AV0Z10300504 Keywords : turbo codes * global optimization * genetic algorithms * differential evolution * noisy communication channel Subject RIV: IN - Informatics, Computer Science Impact factor: 0.511, year: 2010
Warm absorber and truncated accretion disc in IRAS 05078+1626
Czech Academy of Sciences Publication Activity Database
Svoboda, Jiří; Guainazzi, M.; Karas, Vladimír
2010-01-01
Roč. 512, Mar-Apr (2010), A62/1-A62/8 ISSN 0004-6361 R&D Projects: GA ČR GD205/09/H033; GA ČR GA205/07/0052 Grant - others:ESA(XE) ESA- PECS project No. 98040; Univerzita Karlova(CZ) GAUK 33308 Institutional research plan: CEZ:AV0Z10030501 Keywords : galaxies: active * galaxies: Seyfert * galaxies: individual: IRAS 05078+1626 Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010
47 CFR 0.15 - Functions of the Office.
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Functions of the Office. 0.15 Section 0.15 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL COMMISSION ORGANIZATION Organization Office of Media Relations § 0.15 Functions of the Office. (a) Enhance public understanding of and compliance with the...
Czech Academy of Sciences Publication Activity Database
Magri, C.; Howell, E. S.; Nolan, M. C.; Taylor, P.A.; Fernandez, Y.R.; Mueller, M.; Vervack, R.J.; Benner, L. A. M.; Giorgini, J. D.; Ostro, S. J.; Scheeres, D.J.; Hicks, M. D.; Rhoades, H.; Somers, J.M.; Gaftonyuk, N. M.; Kouprianov, V.V.; Krugly, Yu. N.; Molotov, I.E.; Busch, M.W.; Margot, J. L.; Benishek, V.; Protitch-Benishek, V.; Galád, Adrián; Higgins, D.; Kušnirák, Peter; Pray, D. P.
2011-01-01
Roč. 214, č. 1 (2011), s. 210-227 ISSN 0019-1035 R&D Projects: GA ČR GA205/09/1107 Grant - others:SAV(SK) Vega2/0016/09; NASA (US) NNX10AP87G; NASA (US) NNX10AP87G Institutional research plan: CEZ:AV0Z10030501 Keywords : asteroids * photometry * radar observations Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.385, year: 2011
Really focused stellar winds in X-ray binaries
Czech Academy of Sciences Publication Activity Database
Hadrava, Petr; Čechura, Jan
2012-01-01
Roč. 542, June (2012), A42/1-A42/11 ISSN 0004-6361 R&D Projects: GA MŠk(CZ) LC06014; GA ČR GA202/09/0772; GA ČR GD205/09/H033 Grant - others:GAUK(CZ) 139810 Institutional research plan: CEZ:AV0Z10030501 Keywords : accretion disk * hydrodynamics * numerical methods Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 5.084, year: 2012
Czech Academy of Sciences Publication Activity Database
Lochman, J.; Balcar, V. J.; Šťastný, F.; Šerý, Omar
2013-01-01
Roč. 205, 1-2 (2013), s. 7-12 ISSN 0165-1781 Grant - others:GA ČR(CZ) GP309/09/P361 Program:GP Institutional support: RVO:67985904 Keywords : schizophrenia * adrenergic receptor * dopamine receptor Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.682, year: 2013
20 CFR 668.860 - What cash management procedures apply to INA grant funds?
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What cash management procedures apply to INA... Administrative Requirements § 668.860 What cash management procedures apply to INA grant funds? INA grantees must... implement the Cash Management Improvement Act, found at 31 CFR part 205, apply by law to most recipients of...
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 205.55 Section 205.55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.55 Requirements. ...
International Nuclear Information System (INIS)
Henning, W.; Kutschera, W.; Ernst, H.
1984-01-01
205 Tl has been previously proposed as a geological detector for solar neutrinos, making use of the reaction 205 Tl(nu, e - ) 205 Pb with a neutrino threshold of only approx. = 43 keV. We report on an experiment performed to study the feasibility of detecting radioactive 205 Pb nuclei (T/sub 1/2/ = 15 million years) at very low concentrations using the recently developed technique of accelerator mass spectrometry. Employing the high-energy ion beams of good quality from the UNILAC heavy-ion accelerator at the GSI Darmstadt, we are able to demonstrate a suppression of neighbouring isotopes to better than 1 in 10 16 and of neighbouring elements to about 1 in 10 3 . While these results are very encouraging, the minimum number of atoms detectable is still severely limited by the efficiency of producing multiply-charged ions from present ion sources. Future improvements in ion-source performance are briefly discussed
40 CFR 205.50 - Applicability.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Applicability. 205.50 Section 205.50 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.50 Applicability. (a) Except as otherwise...
Magnetic-entropy change in Mn1.1Fe0.9P0.7As0.3-xGe x
International Nuclear Information System (INIS)
Tegus, O.; Fuquan, B.; Dagula, W.; Zhang, L.; Brueck, E.; Si, P.Z.; Boer, F.R. de; Buschow, K.H.J.
2005-01-01
We have studied the magnetic properties and magnetic-entropy changes of Mn 1.1 Fe 0.9 P 0.7 As 0.3-x Ge x compounds with x = 0, 0.05, 0.1, 0.15 and 0.3. X-ray diffraction (XRD) study shows all the compounds crystallize in the Fe 2 P-type structure. Magnetic measurements show that the Curie temperature increases from 150 K for Mn 1.1 Fe 0.9 P 0.7 As 0.3 to 380 K for Mn 1.1 Fe 0.9 P 0.7 Ge 0.3 . A field-induced first-order magnetic phase transition is observed above the Curie temperature for the compounds with x up to 0.15. There exists an optimal composition in which the first-order phase transition is the sharpest. The optimal composition for this system is x = 0.1. The maximal magnetic-entropy change derived from the magnetization data is about 40 J/(kg K) for a field change from 0 to 3 T
2010-07-01
... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Banking. 91.205 Section 91.205... EMISSIONS FROM MARINE SPARK-IGNITION ENGINES Averaging, Banking, and Trading Provisions § 91.205 Banking. (a... banking. (i) For outboard engines in model year (MY) 1997, a manufacturer may bank positive emission...
2010-07-01
... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Banking. 89.205 Section 89.205... EMISSIONS FROM NEW AND IN-USE NONROAD COMPRESSION-IGNITION ENGINES Averaging, Banking, and Trading Provisions § 89.205 Banking. (a) Requirements for Tier 1 engines rated at or above 37 kW. (1) A manufacturer...
2010-07-01
... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Banking. 90.205 Section 90.205... EMISSIONS FROM NONROAD SPARK-IGNITION ENGINES AT OR BELOW 19 KILOWATTS Certification Averaging, Banking, and Trading Provisions § 90.205 Banking. (a)(1) Beginning August 1, 2007, a manufacturer of a Class I engine...
2010-01-01
... authorizes a financial institution to debit or credit a consumer's account. Generally, this part applies to financial institutions. For purposes of §§ 205.3(b)(2) and (b)(3), 205.10(b), (d), and (e) and 205.13, this..., or magnetic tape for the purpose of ordering, instructing, or authorizing a financial institution to...
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Discovery. 205.198 Section 205.198 Energy DEPARTMENT OF... of Proposed Disallowance, and Order of Disallowance § 205.198 Discovery. (a) If a person intends to file a Motion for Discovery, he must file it at the same time that he files his Statement of Objections...
Gangwar, L.S.; Saran, Sandeep; Kumar, Sarvesh
2010-01-01
The marketing of broilers/chicken meat in the National Capital Region (NCR) Delhi has been compared in two distinct kinds of markets, viz. organized (shopping malls, organized multi-product retailers) and unorganized or primarily wet markets (exclusive chicken dressers, poultry meat retailers, etc.). Data have been collected from various functionaries involved in marketing of broilers/poultry meat in the NCR Delhi during the year 2008-09 through primary survey. The most prominent channel in t...
28 CFR 0.15 - Deputy Attorney General.
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Deputy Attorney General. 0.15 Section 0... the Deputy Attorney General § 0.15 Deputy Attorney General. (a) The Deputy Attorney General is authorized to exercise all the power and authority of the Attorney General, unless any such power or...
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Air quality. 240.205 Section 240.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.205 Air quality. ...
40 CFR 205.54 - Test procedures.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test procedures. 205.54 Section 205.54 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.54 Test procedures. The procedures described...
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Tampering. 205.58-2 Section 205.58-2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.58-2 Tampering. (a) For each configuration...
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Warranty. 205.58-1 Section 205.58-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.58-1 Warranty. (a) The vehicle manufacturer...
Analysis list: Su(var)205 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Su(var)205 Adult,Embryo,Larvae + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3.../target/Su(var)205.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Su(var)205.5.tsv http://dbarc...hive.biosciencedbc.jp/kyushu-u/dm3/target/Su(var)205.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/c...olo/Su(var)205.Adult.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Su(var)205.Embryo.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Su(var)205.Larvae.tsv http://dbarchive
20 CFR 655.205 - Recruitment period.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Recruitment period. 655.205 Section 655.205... FOREIGN WORKERS IN THE UNITED STATES Labor Certification Process for Logging Employment and Non-H-2A Agricultural Employment § 655.205 Recruitment period. (a) If the OFLC Administrator determines that the...
22 CFR 20.5 - Survivor benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Survivor benefits. 20.5 Section 20.5 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR CERTAIN FORMER SPOUSES § 20.5 Survivor benefits. (a) Type of benefits. A former spouse who meets the eligibility requirements of § 20.3 is entitled to...
A study of visual and musculoskeletal health disorders among computer professionals in NCR Delhi
Directory of Open Access Journals (Sweden)
Talwar Richa
2009-01-01
Full Text Available Objective: To study the prevalence of health disorders among computer professionals and its association with working environment conditions. Study design: Cross sectional. Materials and Methods: A sample size of 200 computer professionals, from Delhi and NCR which included software developers, call centre workers, and data entry workers. Result: The prevalence of visual problems in the study group was 76% (152/200, and musculoskeletal problems were reported by 76.5% (153/200. It was found that there was a gradual increase in visual complaints as the number of hours spent for working on computers daily increased and the same relation was found to be true for musculoskeletal problems as well. Visual problems were less in persons using antiglare screen, and those with adequate lighting in the room. Musculoskeletal problems were found to be significantly lesser among those using cushioned chairs and soft keypad. Conclusion: A significant proportion of the computer professionals were found to be having health problems and this denotes that the occupational health of the people working in the computer field needs to be emphasized as a field of concern in occupational health.
2010-10-01
... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Sea turtles. 223.205 Section 223.205... Threatened Marine and Anadromous Species § 223.205 Sea turtles. (a) The prohibitions of section 9 of the Act (16 U.S.C. 1538) relating to endangered species apply to threatened species of sea turtle, except as...
Directory of Open Access Journals (Sweden)
Toubai Tomomi
2008-02-01
Full Text Available Abstract Background The mouse is an important and widely utilized animal model for bone marrow transplant (BMT translational studies. Here, we document the course of an unexpected increase in mortality of congenic mice that underwent BMT. Methods Thirty five BMTs were analyzed for survival differences utilizing the Log Rank test. Affected animals were evaluated by physical examination, necropsy, histopathology, serology for antibodies to infectious disease, and bacterial cultures. Results Severe bacteremia was identified as the main cause of death. Gastrointestinal (GI damage was observed in histopathology. The bacteremia was most likely caused by the translocation of bacteria from the GI tract and immunosuppression caused by the myeloablative irradiation. Variability in groups of animals affected was caused by increased levels of gamma and X-ray radiation and the differing sensitivity of the two nearly genetically identical mouse strains used in the studies. Conclusion Our retrospective analysis of thirty five murine BMTs performed in three different laboratories, identified C57BL/6NCr (Ly5.1 as being more radiation sensitive than B6.Cg-Ptprca/NCr (Ly5.2. This is the first report documenting a measurable difference in radiation sensitivity and its effects between an inbred strain of mice and its congenic counterpart eventually succumbing to sepsis after BMT.
The Diagnostics of the kappa-Distributions from EUV Spectra
Czech Academy of Sciences Publication Activity Database
Dzifčáková, Elena; Kulinová, Alena
2010-01-01
Roč. 263, 1-2 (2010), s. 25-41 ISSN 0038-0938 R&D Projects: GA ČR GA205/09/1705 Grant - others:VEGA(SK) 1/0069/08 Institutional research plan: CEZ:AV0Z10030501 Keywords : EUV spectra * non- thermal distributions * plasma diagnostics Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.386, year: 2010
Czech Academy of Sciences Publication Activity Database
Zeman, Antonín; Šmíd, M.; Havelcová, Martina; Coufalová, L.; Kučková, S.; Velčovská, M.; Hynek, R.
2013-01-01
Roč. 77, November (2013), s. 311-317 ISSN 1367-9120 Grant - others:GA ČR(CZ) GA205/09/1162 Program:GA Institutional support: RVO:68378297 ; RVO:67985891 Keywords : aortic stenosis * degenerative (calcification–sclerotic) changes * hydroxyapatite * proteins * cholesterol Subject RIV: DB - Geology ; Mineralogy Impact factor: 2.831, year: 2013 http://www.sciencedirect.com/science/journal/13679120/77
Petrophysical and geochemical constraints on alteration processes in granites
Czech Academy of Sciences Publication Activity Database
Machek, Matěj; Roxerová, Zuzana; Janoušek, V.; Staněk, Martin; Petrovský, Eduard; René, Miloš
2013-01-01
Roč. 57, č. 4 (2013), s. 710-740 ISSN 0039-3169 R&D Projects: GA ČR GA205/09/0540 Grant - others:FCT(PT) PTDC/CTE-GIX/098696/2008 Institutional support: RVO:67985530 ; RVO:67985891 Keywords : feldspathization * greisenization * anisotropy of magnetic susceptibility * porosity Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.752, year: 2013
Automatic Video System for Continues Monitoring of the Meteor Activity
Czech Academy of Sciences Publication Activity Database
Koten, Pavel; Fliegel, K.; Vítek, S.; Páta, P.
2011-01-01
Roč. 108, č. 1 (2011), s. 69-76 ISSN 0167-9295 R&D Projects: GA ČR GA205/09/1302 Grant - others:GA ČR(CZ) GAP102/10/1320 Institutional research plan: CEZ:AV0Z10030501 Keywords : meteor * meteor showers * instrumentation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.667, year: 2011
Influence of frame-dragging on magnetic null points near rotating black holes
Czech Academy of Sciences Publication Activity Database
Karas, Vladimír; Kopáček, Ondřej; Kunneriath, Devaky
2012-01-01
Roč. 29, č. 3 (2012), 035010/1-035010/12 ISSN 0264-9381 R&D Projects: GA MŠk ME09036 Grant - others:GA ČR(CZ) GA205/09/H033 Institutional research plan: CEZ:AV0Z10030501 Keywords : Magnetic fields * Reconnection * Black holes Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.562, year: 2012
7 CFR 205.406 - Continuation of certification.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.406 Continuation of certification. (a) To continue... 7 Agriculture 3 2010-01-01 2010-01-01 false Continuation of certification. 205.406 Section 205.406...
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Vacancies. 1280.205 Section 1280.205 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... INFORMATION ORDER Lamb Promotion, Research, and Information Order Lamb Promotion, Research, and Information...
48 CFR 2131.205-3 - Bad debts.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Bad debts. 2131.205-3 Section 2131.205-3 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT, FEDERAL... PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 2131.205-3 Bad debts. Erroneous benefit...
40 CFR 205.57-4 - Testing procedures.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Testing procedures. 205.57-4 Section 205.57-4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.57-4 Testing...
40 CFR 205.55-1 - General requirements.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false General requirements. 205.55-1 Section 205.55-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.55-1 General...
40 CFR 205.55-4 - Labeling-compliance.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Labeling-compliance. 205.55-4 Section 205.55-4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.55-4 Labeling...
40 CFR 205.55-3 - Configuration identification.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Configuration identification. 205.55-3 Section 205.55-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.55-3 Configuration...
40 CFR 205.58 - In-use requirements.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false In-use requirements. 205.58 Section 205.58 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.58 In-use requirements. ...
40 CFR 205.57-8 - Continued testing.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Continued testing. 205.57-8 Section 205.57-8 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.57-8 Continued...
International Nuclear Information System (INIS)
Geissel, H.; Gilg, H.; Gillitzer, A.
2001-06-01
We observed well separated 1s and 2p π - states in 205 Pb in the 206 Pb(d, 3 He) reaction at T d = 604.3 MeV. The binding energies and the widths determined are: B 1s = 6.768 ± 0.044 (stat) ± 0.041 (syst) MeV, Γ 1s = 0.778 -0.130 +0.150 (stat) ± 0.055 (syst) MeV, B 2p = 5.110 ± 0.015 (stat) ± 0.042 (syst) MeV, and Γ 2p = 0.371 ± 0.037 (stat) ± 0.048 (syst) MeV. They are used to deduce the real and imaginary strengths of the s-wave part of the pion-nucleus interaction, yielding 26.1 -1.5 +1.7 MeV as a pion mass shift in the center of 205 Pb. (orig.)
7 CFR 205.239 - Livestock living conditions.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Livestock living conditions. 205.239 Section 205.239... PROVISIONS NATIONAL ORGANIC PROGRAM Organic Production and Handling Requirements § 205.239 Livestock living conditions. (a) The producer of an organic livestock operation must establish and maintain livestock living...
7 CFR 205.405 - Denial of certification.
2010-01-01
... PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.405 Denial of certification. (a) When the certifying... organic program. (e) An applicant for certification who has received a written notification of... 7 Agriculture 3 2010-01-01 2010-01-01 false Denial of certification. 205.405 Section 205.405...
7 CFR 205.401 - Application for certification.
2010-01-01
... PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.401 Application for certification. A person seeking... certification to a certifying agent. The application must include the following information: (a) An organic... 7 Agriculture 3 2010-01-01 2010-01-01 false Application for certification. 205.401 Section 205.401...
7 CFR 62.205 - Conflict of interest.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Conflict of interest. 62.205 Section 62.205 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... Definitions Service § 62.205 Conflict of interest. No USDA official shall review any program documentation or...
10 CFR 205.371 - Definition of emergency.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Definition of emergency. 205.371 Section 205.371 Energy...; Applications; Administrative Procedures and Sanctions Emergency Interconnection of Electric Facilities and the Transfer of Electricity to Alleviate An Emergency Shortage of Electric Power § 205.371 Definition of...
46 CFR 164.015-4 - Inspections and tests.
2010-10-01
... determined in a standard tensile testing machine with a rate of separation of jaws set at 2 inches per minute....015-4(g)(2) Inches per minute 4 Tensile strength (minimum) 164.015-4(h) P.s.i. 30 20 60 Ultimate... accordance with American Society for Testing Materials Designation D-1692T specification standard. (h...
48 CFR 731.205-46 - Travel costs.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Travel costs. 731.205-46 Section 731.205-46 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT GENERAL....205-46 Travel costs. It is USAID policy to require prior written approval of international travel by...
33 CFR 107.205 - Purpose and delegation.
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Purpose and delegation. 107.205 Section 107.205 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY MARITIME... Cuban Territorial Waters § 107.205 Purpose and delegation. The purpose of this subpart is to implement...
40 CFR 205.57-1 - Test request.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test request. 205.57-1 Section 205.57-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.57-1 Test request. (a) The...
29 CFR 780.205 - Nursery activities generally.
2010-07-01
... 29 Labor 3 2010-07-01 2010-07-01 false Nursery activities generally. 780.205 Section 780.205 Labor... as It Relates to Specific Situations Nursery and Landscaping Operations § 780.205 Nursery activities generally. The employees of a nursery who are engaged in the following activities are employed in...
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Offers. 12.205 Section 12... ACQUISITION OF COMMERCIAL ITEMS Special Requirements for the Acquisition of Commercial Items 12.205 Offers. (a) Where technical information is necessary for evaluation of offers, agencies should, as part of market...
Czech Academy of Sciences Publication Activity Database
Grüner, Bohumír; Kvíčalová, Magdalena; Selucký, P.; Lučaníková, M.
2010-01-01
Roč. 695, č. 9 (2010), s. 1261-1264 ISSN 0022-328X R&D Projects: GA MŠk LC523; GA ČR GA104/09/0668 Grant - others:European Commision(XE) F16W-CT-2003-508854 Institutional research plan: CEZ:AV0Z40320502 Keywords : carboranes * metallaboranes * dicarbollides * TODGA Subject RIV: CA - Inorganic Chemistry Impact factor: 2.205, year: 2010
Czech Academy of Sciences Publication Activity Database
Dzifčáková, Elena; Homola, M.; Dudík, Jaroslav
2011-01-01
Roč. 531, July (2011), A111/1-A111/5 ISSN 0004-6361 R&D Projects: GA ČR GA205/09/1705 Grant - others:SAV(SK) Vega 1/0240/11 Institutional research plan: CEZ:AV0Z10030501 Keywords : atomic processes * non- thermal radiation mechanisms * solar flares Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.587, year: 2011
Possible wave modes of wideband nonthermal continuum radiation in its source region
Czech Academy of Sciences Publication Activity Database
Grimald, S.; Santolík, Ondřej
2010-01-01
Roč. 115, - (2010), A06209/1-A06209/8 ISSN 0148-0227 R&D Projects: GA ČR GA205/09/1253; GA MŠk ME09107 Grant - others:ESA(XE) PECS98025 Institutional research plan: CEZ:AV0Z30420517 Keywords : nonthermal continuum * NTC * wave modes Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.303, year: 2010
7 CFR 205.509 - Peer review panel.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Peer review panel. 205.509 Section 205.509 Agriculture... PROVISIONS NATIONAL ORGANIC PROGRAM Accreditation of Certifying Agents § 205.509 Peer review panel. The Administrator shall establish a peer review panel pursuant to the Federal Advisory Committee Act (FACA) (5 U.S.C...
48 CFR 931.205 - Selected costs.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Selected costs. 931.205... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 931.205 Selected costs. ...
48 CFR 1231.205 - Selected costs.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Selected costs. 1231.205... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1231.205 Selected costs. ...
48 CFR 31.205 - Selected costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Selected costs. 31.205... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205 Selected costs. ...
48 CFR 1331.205 - Selected costs.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Selected costs. 1331.205... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1331.205 Selected costs. ...
48 CFR 631.205 - Selected costs.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Selected costs. 631.205... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts with Commercial Organizations 631.205 Selected costs. ...
Czech Academy of Sciences Publication Activity Database
Shklyar, D. R.; Storey, L. R. O.; Chum, Jaroslav; Jiříček, František; Němec, F.; Parrot, M.; Santolík, Ondřej; Titova, E. E.
2012-01-01
Roč. 117, A12 (2012), A12206/1-A12206/16 ISSN 0148-0227 R&D Projects: GA ČR GA205/09/1253; GA ČR GAP205/10/2279; GA MŠk ME09107 Grant - others:GA ČR(CZ) GPP209/12/P658 Program:GP Institutional support: RVO:68378289 Keywords : Plasma waves analysis * ion cyclotron waves * satellite observation and numerical simulation * geometrical optics * multi-component measurements * simulation * spectrogram * wave propagation Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.174, year: 2012 http://onlinelibrary.wiley.com/doi/10.1029/2012JA018016/abstract
7 CFR 205.1 - Meaning of words.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Meaning of words. 205.1 Section 205.1 Agriculture... PROVISIONS NATIONAL ORGANIC PROGRAM Definitions § 205.1 Meaning of words. For the purpose of the regulations in this subpart, words in the singular form shall be deemed to impart the plural and vice versa, as...
2010-07-01
... respect to the parameters listed in § 205.168 of this subpart. (2) Exhaust header pipe means any tube of... be “exhaust header pipes.” (3) Failing exhaust system means that, when installed on any Federally... EQUIPMENT NOISE EMISSION CONTROLS Motorcycle Exhaust Systems § 205.165 Definitions. (a) As used in this...
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Marriage. 3.205 Section 3..., Compensation, and Dependency and Indemnity Compensation Evidence Requirements § 3.205 Marriage. (a) Proof of marriage. Marriage is established by one of the following types of evidence: (1) Copy or abstract of the...
48 CFR 53.205-1 - Paid advertisements.
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Paid advertisements. 53.205-1 Section 53.205-1 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.205-1 Paid advertisements. SF 1449, prescribed in 53.212, shall be used to place orders for paid...
40 CFR 205.3 - Number and gender.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Number and gender. 205.3 Section 205.3... EQUIPMENT NOISE EMISSION CONTROLS General Provisions § 205.3 Number and gender. As used in this part, words in the -singular shall be deemed to import -the plural, and words in the masculine -gender shall be...
7 CFR 58.205 - Meaning of words.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Meaning of words. 58.205 Section 58.205 Agriculture... Whole Milk, and Dry Buttermilk § 58.205 Meaning of words. For the purpose of the regulations in this subpart, words in the singular form shall be deemed to impart the plural and vice versa, as the case may...
48 CFR 231.205 - Selected costs.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Selected costs. 231.205... OF DEFENSE GENERAL CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 231.205 Selected costs. ...
miRNA-205 affects infiltration and metastasis of breast cancer
International Nuclear Information System (INIS)
Wang, Zhouquan; Liao, Hehe; Deng, Zhiping; Yang, Po; Du, Ning; Zhanng, Yunfeng; Ren, Hong
2013-01-01
Highlights: •We detected expression of miR-205 in breast cancer cell lines and tissue samples. •We suggest miR-205 is downregulated in human breast cancer tissues and MCF7 cells. •We suggest the lower expression of miR-205 play a role in breast cancer onset. •These data suggest that miR-205 directly targets HER3 in human breast cancer. -- Abstract: Background: An increasing number of studies have shown that miRNAs are commonly deregulated in human malignancies, but little is known about the function of miRNA-205 (miR-205) in human breast cancer. The present study investigated the influence of miR-205 on breast cancer malignancy. Methods: The expression level of miR-205 in the MCF7 breast cancer cell line was determined by quantitative (q)RT-PCR. We then analyzed the expression of miR-205 in breast cancer and paired non-tumor tissues. Finally, the roles of miR-205 in regulating tumor proliferation, apoptosis, migration, and target gene expression were studied by MTT assay, flow cytometry, qRT-PCR, Western blotting and luciferase assay. Results: miR-205 was downregulated in breast cancer cells or tissues compared with normal breast cell lines or non-tumor tissues. Overexpression of miR-205 reduced the growth and colony-formation capacity of MCF7 cells by inducing apoptosis. Overexpression of miR-205 inhibited MCF7 cell migration and invasiveness. By bioinformation analysis, miR-205 was predicted to bind to the 3′ untranslated regions of human epidermal growth factor receptor (HER)3 mRNA, and upregulation of miR-205 reduced HER3 protein expression. Conclusion: miR-205 is a tumor suppressor in human breast cancer by post-transcriptional inhibition of HER3 expression
40 CFR 300.205 - Planning and coordination structure.
2010-07-01
... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Planning and coordination structure. 300.205 Section 300.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... POLLUTION CONTINGENCY PLAN Planning and Preparedness § 300.205 Planning and coordination structure. (a...
48 CFR 31.205-8 - Contributions or donations.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contributions or donations. 31.205-8 Section 31.205-8 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Organizations 31.205-8 Contributions or donations. Contributions or donations, including cash, property and...
28 CFR 16.205 - Closed meetings-Informal procedures.
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Closed meetings-Informal procedures. 16.205 Section 16.205 Judicial Administration DEPARTMENT OF JUSTICE PRODUCTION OR DISCLOSURE OF MATERIAL OR INFORMATION Public Observation of Parole Commission Meetings § 16.205 Closed meetings—Informal...
40 CFR 205.59 - Recall of noncomplying vehicles.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recall of noncomplying vehicles. 205.59 Section 205.59 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.59 Recall...
45 CFR 1230.205 - Professional and technical services.
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Professional and technical services. 1230.205 Section 1230.205 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE NEW RESTRICTIONS ON LOBBYING Activities by Own Employees § 1230.205...
45 CFR 604.205 - Professional and technical services.
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Professional and technical services. 604.205 Section 604.205 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION NEW RESTRICTIONS ON LOBBYING Activities by Own Employees § 604.205 Professional and technical...
41 CFR 101-6.205-3 - Elementary and secondary schools.
2010-07-01
... schools. 101-6.205-3 Section 101-6.205-3 Public Contracts and Property Management Federal Property...-Nondiscrimination in Programs Receiving Federal Financial Assistance § 101-6.205-3 Elementary and secondary schools. The requirements of §§ 101-6.205-1 and 101-6.205-2 with respect to any elementary or secondary school...
48 CFR 1851.205 - Contract clause.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Contract clause. 1851.205 Section 1851.205 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND SPACE ADMINISTRATION CONTRACT MANAGEMENT USE OF GOVERNMENT SOURCES BY CONTRACTORS Contractor Use of Interagency Fleet Management...
33 CFR 136.205 - Compensation allowable.
2010-07-01
...) MARINE POLLUTION FINANCIAL RESPONSIBILITY AND COMPENSATION OIL SPILL LIABILITY TRUST FUND; CLAIMS PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.205 Compensation... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.205...
48 CFR 1631.205-71 - FEHBP bad debts.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true FEHBP bad debts. 1631.205-71 Section 1631.205-71 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT FEDERAL... AND PROCEDURES Contracts With Commercial Organizations 1631.205-71 FEHBP bad debts. Erroneous benefit...
40 CFR 205.56 - Testing by the Administrator.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Testing by the Administrator. 205.56 Section 205.56 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.56 Testing by the...
40 CFR 205.55-5 - Labeling-exterior. [Reserved
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Labeling-exterior. [Reserved] 205.55-5 Section 205.55-5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.55-5 Labeling...
48 CFR 31.205-28 - Other business expenses.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Other business expenses. 31.205-28 Section 31.205-28 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Organizations 31.205-28 Other business expenses. The following types of recurring costs are allowable (a...
Czech Academy of Sciences Publication Activity Database
Adamová, Petra; Šílený, Jan
2010-01-01
Roč. 100, č. 2 (2010), s. 447-457 ISSN 0037-1106 R&D Projects: GA ČR GA205/09/0724 Grant - others:GA MŠk(CZ) specifický-výzkum Institutional research plan: CEZ:AV0Z30120515 Keywords : non-double-couple earthquake mechanism * moment tensor * finite-extent focus Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.027, year: 2010
Diagnostics of the κ-distribution using Si III lines in the solar transition region
Czech Academy of Sciences Publication Activity Database
Dzifčáková, Elena; Kulinová, Alena
2011-01-01
Roč. 531, July (2011), A122/1-A122/10 ISSN 0004-6361 R&D Projects: GA ČR GA205/09/1705 Grant - others:SAV(SK) Vega 1/0240/11; EU(XE) ESA- PECS project No. 98030 Institutional research plan: CEZ:AV0Z10030501 Keywords : Sun * transition region * UV-radiation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.587, year: 2011
Four Years of Real-Time GRB Followup by BOOTES-1B (2005-2008)
Czech Academy of Sciences Publication Activity Database
Jelínek, M.; Castro-Tirado, A.J.; de Ugarte Postigo, A.; Kubánek, P.; Guziy, S.; Gorosabel, J.; Cunniffe, R.; Vítek, S.; Hudec, René; Reglero, V.; Sabau-Graziati, L.
2010-01-01
Roč. 2010, č. 1 (2010), 432172/1-432172/10 ISSN 1687-7969 R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; ESA(XE) PECS project No. 98023 Institutional research plan: CEZ:AV0Z10030501 Keywords : observing * GRB * Spain Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics OBOR OECD: Astronomy (including astrophysics,space science)
Measuring the spin of the primary black hole in OJ287
Czech Academy of Sciences Publication Activity Database
Valtonen, M.J.; Mikkola, S.; Merritt, D.; Gopakumar, A.; Lehto, H.J.; Hyvönen, L. T.; Rampadarath, H.; Saunders, R.; Bašta, Milan; Hudec, R.
2010-01-01
Roč. 709, č. 2 (2010), s. 725-732 ISSN 0004-637X R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997 Institutional research plan: CEZ:AV0Z10030501 Keywords : black hole physics * BL Lacertae objects * individual (OJ287) Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 7.436, year: 2010
Non–double-couple mechanisms of microearthquakes induced by hydraulic fracturing
Czech Academy of Sciences Publication Activity Database
Šílený, Jan; Hill, D. P.; Eisner, L.; Cornet, F. H.
2009-01-01
Roč. 114, B8 (2009), B08307/1-B08307/15 ISSN 0148-0227 R&D Projects: GA AV ČR IAA300120502; GA ČR GA205/09/0724 Grant - others:EC(XE) MTKI-CT-2004-517242 Institutional research plan: CEZ:AV0Z30120515 Keywords : microearthquakes * source mechanisms * hydraulic fracturing Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 3.082, year: 2009
Effects of brief milling and acid treatment on two ordered and disordered kaolinite structures
Czech Academy of Sciences Publication Activity Database
Valášková, M.; Barabaszová, K.; Hundáková, M.; Ritz, M.; Plevová, Eva
2011-01-01
Roč. 54, č. 1 (2011), s. 70-76 ISSN 0169-1317 R&D Projects: GA ČR GA105/08/1398 Grant - others:GA ČR(CZ) GA205/09/0352 Institutional research plan: CEZ:AV0Z30860518 Keywords : kaolinite * milling * hydrochloric acid Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.474, year: 2011 http://www.sciencedirect.com/science/article/pii/S0169131711002675
Czech Academy of Sciences Publication Activity Database
Schwarz, Jaroslav; Štefancová, Lucia; Maenhaut, W.; Smolík, Jiří; Ždímal, Vladimír
2012-01-01
Roč. 437, OCT 15 (2012), s. 348-362 ISSN 0048-9697 R&D Projects: GA ČR GA205/09/2055; GA ČR GAP209/11/1342; GA MŠk ME 941 Grant - others:SRF GU(BE) 01S01306 Institutional support: RVO:67985858 Keywords : atmospheric aerosols * mass size distribution * chemical composition Subject RIV: DI - Air Pollution ; Quality Impact factor: 3.258, year: 2012
46 CFR 205.5 - Contracts containing disputes article.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Contracts containing disputes article. 205.5 Section 205... AUDIT APPEALS; POLICY AND PROCEDURE § 205.5 Contracts containing disputes article. When a contract contains a disputes article, the disputes article will govern the bases for negotiating disputes regarding...
2010-07-01
... FEDERAL PROPERTY MANAGEMENT REGULATIONS AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.2-GSA Interagency Fleet Management System Services § 101-39.205 [Reserved] ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true [Reserved] 101-39.205...
31 CFR 536.205 - Exempt transactions.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Exempt transactions. 536.205 Section 536.205 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... creation of information and informational materials, and payment of royalties to a specially designated...
19 CFR 201.205 - Salary adjustments.
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Salary adjustments. 201.205 Section 201.205 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION GENERAL RULES OF GENERAL APPLICATION Debt... of coverage, or a change in coverage, under a Federal benefits program requiring periodic deductions...
7 CFR 3430.205 - Funding restrictions.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Funding restrictions. 3430.205 Section 3430.205... Funding restrictions. (a) Prohibition against construction. Funds made available under this subpart shall not be used for the construction of a new building or facility or the acquisition, expansion...
40 CFR 205.153 - Engine displacement.
2010-07-01
..., in accordance with American Society for Testing Materials (ASTM) E 29-67. (b) For rotary engines... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Engine displacement. 205.153 Section... TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycles § 205.153 Engine displacement. (a) Engine...
7 CFR 205.301 - Product composition.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Product composition. 205.301 Section 205.301 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards..., Except, that, wine containing added sulfites may be labeled “made with organic grapes”; (6) Be produced...
12 CFR 411.205 - Professional and technical services.
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Professional and technical services. 411.205 Section 411.205 Banks and Banking EXPORT-IMPORT BANK OF THE UNITED STATES NEW RESTRICTIONS ON LOBBYING Activities by Own Employees § 411.205 Professional and technical services. (a) The prohibition on the use of...
48 CFR 1631.205-10 - Cost of money.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Cost of money. 1631.205-10... AND PROCEDURES Contracts With Commercial Organizations 1631.205-10 Cost of money. For the purposes of FAR 31.205-10(b)(3), the estimated facilities capital cost of money is specifically identified if it...
10 CFR 205.350 - General purpose.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false General purpose. 205.350 Section 205.350 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and Reports....350 General purpose. The purpose of this rule is to establish a procedure for the Office of...
49 CFR 1560.205 - Redress process.
2010-10-01
... 49 Transportation 9 2010-10-01 2010-10-01 false Redress process. 1560.205 Section 1560.205... Redress process. (a) If an individual believes he or she has been improperly or unfairly delayed or... individual may seek assistance through the redress process established under this section. (b) An individual...
48 CFR 31.205-11 - Depreciation.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Depreciation. 31.205-11....205-11 Depreciation. (a) Depreciation on a contractor's plant, equipment, and other capital facilities... method of depreciation or the class life asset depreciation range system is used, the residual value need...
40 CFR 205.57-3 - Test vehicle preparation.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test vehicle preparation. 205.57-3... PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.57-3 Test vehicle preparation. (a) Prior to the official test, the test vehicle selected in accordance with § 205-57-2 shall not...
40 CFR 205.171 - Selective enforcement auditing (SEA) requirements.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Selective enforcement auditing (SEA) requirements. 205.171 Section 205.171 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 205.171 Selective enforcement auditing (SEA) requirements. ...
Chang, Chih-Jung; Chen, Yi-Yuan M; Lu, Chia-Chen; Lin, Chuan-Sheng; Martel, Jan; Tsai, Sheng-Hui; Ko, Yun-Fei; Huang, Tsung-Teng; Ojcius, David M; Young, John D; Lai, Hsin-Chih
2014-04-01
Ganoderma lucidum (G. lucidum) is a medicinal mushroom long used in Asia as a folk remedy to promote health and longevity. Recent studies indicate that G. lucidum activates NK cells, but the molecular mechanism underlying this effect has not been studied so far. To address this question, we prepared a water extract of G. lucidum and examined its effect on NK cells. We observed that G. lucidum treatment increases NK cell cytotoxicity by stimulating secretion of perforin and granulysin. The mechanism of activation involves an increased expression of NKG2D and natural cytotoxicity receptors (NCRs), as well as increased phosphorylation of intracellular MAPKs. Our results indicate that G. lucidum induces NK cell cytotoxicity against various cancer cell lines by activating NKG2D/NCR receptors and MAPK signaling pathways, which together culminate in exocytosis of perforin and granulysin. These observations provide a cellular and molecular mechanism to account for the reported anticancer effects of G. lucidum extracts in humans.
15 CFR 970.205 - Vessel safety.
2010-01-01
... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Vessel safety. 970.205 Section 970.205... safety. In order to provide a basis for the necessary determinations with respect to the safety of life... Safety of Life at Sea, 1974 (SOLAS 74) possesses current valid SOLAS 74 certificates; (2) That any...
47 CFR 25.205 - Minimum angle of antenna elevation.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Minimum angle of antenna elevation. 25.205 Section 25.205 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Standards § 25.205 Minimum angle of antenna elevation. (a) Earth station...
Routine individual monitoring of aircraft crew exposure; Czech experience and results 1998-2008
Czech Academy of Sciences Publication Activity Database
Malušek, Alexandr; Ploc, Ondřej; Kovář, Ivan; Brabcová, Kateřina; Spurný, František
2011-01-01
Roč. 144, 1-4 (2011), s. 684-687 ISSN 0144-8420 R&D Projects: GA ČR GA205/09/0171 Grant - others:Evropské společenství ILSRA(XE) FIGM-CT2000-00068 $c; JSPS(JP) P09753 Institutional research plan: CEZ:AV0Z10480505 Keywords : aircraft * crew exposure * monitoring Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 0.822, year: 2011
Testing the Black Hole No-hair Theorem with OJ287
Czech Academy of Sciences Publication Activity Database
Valtonen, M.J.; Mikkola, S.; Lehto, H.J.; Gopakumar, A.; Hudec, René; Poledníková, J.
2011-01-01
Roč. 742, č. 1 (2011), 22/1-22/12 ISSN 0004-637X R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; GA MŠk(CZ) ME09027 Institutional research plan: CEZ:AV0Z10030501 Keywords : black hole physics * BL Lacertae objects Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 6.024, year: 2011
Czech Academy of Sciences Publication Activity Database
Horálek, Josef; Jechumtálová, Zuzana; Dorbath, L.; Šílený, Jan
2010-01-01
Roč. 181, č. 3 (2010), s. 1547-1565 ISSN 0956-540X R&D Projects: GA AV ČR IAA300120911; GA ČR GA205/09/0724 Grant - others:EU(XE) MTKI-CT-2004-517242 Institutional research plan: CEZ:AV0Z30120515 Keywords : downhole methods * hydrogeophysics * controlled source seismology * earthquake source observations * fracture and flow Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.411, year: 2010
Photometry and Low Dispersion Spectroscopy with ESA Gaia
Czech Academy of Sciences Publication Activity Database
Hudec, R.; Šimon, Vojtěch; Hudec, L.
2010-01-01
Roč. 2010, - (2010), 781421/1-781421/7 ISSN 1687-7969 R&D Projects: GA ČR GA205/08/1207 Grant - others:GA AV ČR(CZ) GA102/09/0997; GA MŠk(CZ) ME09027; ESA(XE) ESA- PECS project No. Institutional research plan: CEZ:AV0Z10030501 Keywords : high-energy sources * cataclysmic variables * low-dispersion spectra Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics
Survey of Poynting flux of whistler mode chorus in the outer zone
Czech Academy of Sciences Publication Activity Database
Santolík, Ondřej; Pickett, J. S.; Gurnett, D. A.; Menietti, J. D.; Tsurutani, B. T.; Verkhoglyadova, O.
2010-01-01
Roč. 115, - (2010), A00F13/1-A00F13/13 ISSN 0148-0227 R&D Projects: GA AV ČR IAA301120601; GA ČR GA205/09/1253 Grant - others:GA MŠk(CZ) ME 842 Institutional research plan: CEZ:AV0Z30420517 Keywords : chorus * Polar spacecraft * Poynting flux Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.303, year: 2010
Complicated variations in the early optical afterglow of GRB 090726
Czech Academy of Sciences Publication Activity Database
Šimon, Vojtěch; Polášek, Cyril; Jelínek, M.; Hudec, René; Štrobl, Jan
2010-01-01
Roč. 510, February (2010), A49/1-A49/5 ISSN 0004-6361 R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; ESA(XE) ESA-PECS project No. 98058 Institutional research plan: CEZ:AV0Z10030501 Keywords : gamma-ray burst * radiation mechanisms * plasmas Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010
48 CFR 2131.205-71 - Reinsurer administrative expense costs.
2010-10-01
... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 2131.205-71... as set forth in the contract is an allowable cost when documented through an internal accounting... expense costs. 2131.205-71 Section 2131.205-71 Federal Acquisition Regulations System OFFICE OF PERSONNEL...
9 CFR 113.205 - Newcastle Disease Vaccine, Killed Virus.
2010-01-01
... Virus. 113.205 Section 113.205 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.205 Newcastle Disease Vaccine, Killed Virus. Newcastle Disease Vaccine...
12 CFR 205.7 - Initial disclosures.
2010-01-01
... electronic fund transfers or for the right to make transfers. (6) Documentation. A summary of the consumer's... transfers as provided in §§ 205.10(a), and 205.10(d). (7) Stop payment. A summary of the consumer's right to... shall make the disclosures required by this section at the time a consumer contracts for an electronic...
40 CFR 205.54-2 - Sound data acquisition system.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Sound data acquisition system. 205.54-2 Section 205.54-2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.54-2 Sound...
Energy Technology Data Exchange (ETDEWEB)
Kumar, Ajith S; Lekha, C.S. Chitra; Vivek, S. [Department of Physics, Central University of Kerala, Kasaragod 671314 (India); Saravanan, Venkata [Department of Physics, Central University of Tamil Nadu, Thiruvarur 610101 (India); Nandakumar, K. [School of Pure and Applied Physics, Mahatma Gandhi University, Kottayam 686560 (India); Nair, Swapna S., E-mail: swapna.s.nair@gmail.com [Department of Physics, Central University of Kerala, Kasaragod 671314 (India)
2016-11-15
Lead-free magnetoelectric (ME) composites with remarkable ME coupling are required for the realization of eco-friendly multifunctional devices. This work demonstrates the ME properties of Ba{sub 0.85}Ca{sub 0.15}Zr{sub 0.1}Ti{sub 0.9}O{sub 3}–CoFe{sub 2}O{sub 4} (BCZT–CFO) core–shell composites synthesized via co-sol–gel technique. Room temperature ferroelectric and ferromagnetic characterization have shown that the samples are magnetic and ferroelectric along with an adequate magnetoelectric coupling of 12.15 mV/(cm Oe). The strong dependence of electric parameters on applied magnetic DC bias fields demonstrated in ferroelectric and magnetoelectric measurements provide a framework for the development of potential magnetoelectric devices. Also, the high sensitivity of magnetoelectric coupling towards the applied AC magnetic field can be used for its application in magnetoelectric sensors. - Highlights: • The magnetoelectric multiferroic BCZT–CFO nanocomposite is synthesized via sol–gel route. • The XRD measurements show no phases other than BCZT and CFO. • The microstructure analysis employing TEM indicates that the majority of particles formed are having core–shell structure. • The capacitance, resistance and ferroelectric polarization are magnetically tunable. • The composite showed a high magnetoelectric response.
48 CFR 31.205-23 - Losses on other contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Losses on other contracts. 31.205-23 Section 31.205-23 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Organizations 31.205-23 Losses on other contracts. An excess of costs over income under any other contract...
40 CFR 205.157-3 - Configuration identification.
2010-07-01
...-3 Section 205.157-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycles § 205.157-3 Configuration...) intake ducting; and (iii) air cleaner element. (3) Vehicle drive train: (i) Chain; and (ii) shaft. (4...
48 CFR 615.205-70 - Use of English language.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Use of English language. 615.205-70 Section 615.205-70 Federal Acquisition Regulations System DEPARTMENT OF STATE CONTRACTING... Information 615.205-70 Use of English language. The requirements of DOSAR 614.201-70 also apply when...
2010-05-24
... accessed information for [Insert Number] issued securities and money market instruments through Internet... the arranger will, among other things, disclose on a password-protected Internet Web site the... SECURITIES AND EXCHANGE COMMISSION [Release No. 34-62120; File No. S7-04-09] Order Granting...
48 CFR 31.205-32 - Precontract costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Precontract costs. 31.205... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-32 Precontract costs. Precontract costs means costs incurred before the effective date of the...
48 CFR 31.205-27 - Organization costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Organization costs. 31.205... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-27 Organization costs. (a) Except as provided in paragraph (b) of this section, expenditures in...
48 CFR 31.205-26 - Material costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Material costs. 31.205-26... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-26 Material costs. (a) Material costs include the costs of such items as raw materials, parts...
48 CFR 31.205-4 - Bonding costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Bonding costs. 31.205-4... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-4 Bonding costs. (a) Bonding costs arise when the Government requires assurance against financial loss to itself...
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Bad debts. 31.205-3... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-3 Bad debts. Bad debts, including actual or estimated losses arising from uncollectible accounts receivable due...
48 CFR 31.205-36 - Rental costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Rental costs. 31.205-36... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-36 Rental costs. (a) This subsection is applicable to the cost of renting or leasing real or...
37 CFR 205.3 - Waiver of rules.
2010-07-01
... procedural, enforceable at law by a party against the Copyright Office, the Library of Congress, or the... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Waiver of rules. 205.3 Section 205.3 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT OFFICE...
45 CFR 205.101 - Organization for administration.
2010-10-01
... 45 Public Welfare 2 2010-10-01 2010-10-01 false Organization for administration. 205.101 Section... ADMINISTRATION-PUBLIC ASSISTANCE PROGRAMS § 205.101 Organization for administration. (a) A State plan for... description of the organization and functions of the single State agency and an organizational chart of the...
48 CFR 31.205-34 - Recruitment costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Recruitment costs. 31.205....205-34 Recruitment costs. (a) Subject to paragraph (b) of this subsection, the following costs are... positions; or (2) Includes material that is not relevant for recruitment purposes, such as extensive...
40 CFR 205.57 - Selective enforcement auditing requirements.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Selective enforcement auditing requirements. 205.57 Section 205.57 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE... Selective enforcement auditing requirements. ...
48 CFR 31.205-46 - Travel costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Travel costs. 31.205-46....205-46 Travel costs. (a) Costs for transportation, lodging, meals, and incidental expenses. (1) Costs... at the time of travel as set forth in the— (i) Federal Travel Regulation, prescribed by the General...
7 CFR 205.236 - Origin of livestock.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Origin of livestock. 205.236 Section 205.236... livestock. (a) Livestock products that are to be sold, labeled, or represented as organic must be from livestock under continuous organic management from the last third of gestation or hatching: Except, That: (1...
37 CFR 205.21 - Scope and purpose.
2010-07-01
... Section 205.21 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT OFFICE... in Which the Office Is Not a Party § 205.21 Scope and purpose. (a) This subpart prescribes policies... opinions of Office employees with Office policy; (4) To avoid spending the time and money of the United...
48 CFR 31.205-20 - Interest and other financial costs.
2010-10-01
... financial costs. 31.205-20 Section 31.205-20 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-20 Interest and other financial costs. Interest on borrowings (however represented), bond...
17 CFR 205.3 - Issuer as client.
2010-04-01
... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Issuer as client. 205.3... ISSUER § 205.3 Issuer as client. (a) Representing an issuer. An attorney appearing and practicing before...'s clients. (b) Duty to report evidence of a material violation. (1) If an attorney, appearing and...
48 CFR 31.205-30 - Patent costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent costs. 31.205-30....205-30 Patent costs. (a) The following patent costs are allowable to the extent that they are incurred... patent application where title or royalty-free license is to be conveyed to the Government. (b) General...
40 CFR 205.57-6 - Acceptance and rejection of batches.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Acceptance and rejection of batches. 205.57-6 Section 205.57-6 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.57-6...
40 CFR 205.57-5 - Reporting of the test results.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Reporting of the test results. 205.57-5 Section 205.57-5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.57-5...
49 CFR 40.205 - How are drug test problems corrected?
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false How are drug test problems corrected? 40.205 Section 40.205 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Drug Tests § 40.205 How are drug test problems...
Feasibility studies of the geochemical Ti-205 solar neutrino experiment
Neumaier, S; Nolte, E; Morinaga, H
1991-01-01
New investigations on the signal to background ratio of the geochemical 205Tl( v., e-)205Pb solar neutrino experiment are presented. The neutrino capture rate of 205Tl and a possible reduction of the neutrino signal due to neutrino oscillations in matter are discussed. The contributions of natural radioactivity, stopped negative muons and fast muons to the background of 205Pb are estimated. The production of radioisotopes in the lead region induced by cosmic ray muons was studied at the high energy muon beam (M2) of CERN with 120, 200 and 280 GeV muons. The background contribution of cosmic ray muons is found to be significantly higher than expected by former estimations and restricts the feasibility of the 205Tl solar neutrino experiment.
29 CFR 99.205 - Basis for determining Federal awards expended.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Basis for determining Federal awards expended. 99.205 Section 99.205 Labor Office of the Secretary of Labor AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 99.205 Basis for determining Federal awards expended. (a) Determining Federal awards...
7 CFR 205.400 - General requirements for certification.
2010-01-01
...) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.400 General requirements for certification. A person seeking to receive or maintain organic certification under the... 7 Agriculture 3 2010-01-01 2010-01-01 false General requirements for certification. 205.400...
2010-12-09
... Platinum Solutions, Inc. 20110099 G Gammon Gold Inc. G Capital Gold Corporation. G Capital Gold Corporation..., L.P. G New Mountain Partners II, L.P. G MailSouth, Inc. Transaction Granted Early Termination 09-NOV...
Multiferroic properties of nanocrystalline BiFe1−xNixO3 (x=0.0–0.15) perovskite ceramics
International Nuclear Information System (INIS)
Chaudhari, Yogesh; Mahajan, Chandrashekhar M.; Singh, Amrita; Jagtap, Prashant; Chatterjee, Ratnamala; Bendre, Subhash
2015-01-01
Ni doped BiFeO 3 (x=0, 0.05, 0.1 and 0.15) nanocrystalline ceramics were synthesized by the solution combustion method (SCM) to obtain optimal multiferroic properties. The effect of Ni doping on structural, morphological, ferroelectric, magnetic and dielectric properties of BiFeO 3 was studied. The structural investigations by using X-ray diffraction (XRD) pattern confirmed that BiFe 1−x Ni x O 3 ceramics have rhombhohedral perovskite structure. The ferroelectric hysteresis measurements for BiFe 1−x Ni x O 3 (x=0, 0.05, 0.1, 0.15) compound at room temperature found to exhibit unsaturated behavior and presents partial reversal of polarization. The magnetic measurements demonstrated an enhancement of ferromagnetic property due to Ni doping in BiFeO 3 when compared with undoped BiFeO 3 . The variation of dielectric constant with temperature in BiFe 0.9 Ni 0.1 O 3 and BiFe 0.85 Ni 0.15 O 3 samples evidenced an apparent dielectric anomaly around 350 °C and 300 °C which corresponds to antiferromagnetic to paramagnetic phase transition of (T N ) of BiFeO 3 . The dependence of room temperature dielectric properties on frequency signifies that both dielectric constant (ε) and dielectric loss (tan δ) are the strong function of frequency. The results show that solution combustion method leads to synthesis of an excellent and reproducible BiFe 1−x Ni x O 3 multiferroic ceramics. - Highlights: • Synthesis of BiFe 1−x Ni x O 3 (x=0, 0.05, 0.1 and 0.15) multiferroic ceramics. • Solution Combustion Method (SCM). • Ferroelectric and dielectric properties of undoped and Ni doped BiFeO 3 ceramics. • High temperature synthesis of BiFe 1−x Ni x O 3 multiferroic ceramics. • First detailed report about SCM synthesized the BiFe 1−x Ni x O 3 ceramics
40 CFR 240.205-2 - Recommended procedures: Design.
2010-07-01
... air pollution control technology. (b) All emissions, including dust from vents, should be controlled. ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Design. 240.205-2 Section 240.205-2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID...
The Košice meteorite fall: Atmospheric trajectory, fragmentation, and orbit
Czech Academy of Sciences Publication Activity Database
Borovička, Jiří; Tóth, J.; Igaz, A.; Spurný, Pavel; Kalenda, Pavel; Haloda, J.; Svoreň, J.; Kornoš, L.; Silber, E.; Brown, P.; Husárik, M.
2013-01-01
Roč. 48, č. 10 (2013), s. 1757-1779 ISSN 1086-9379 R&D Projects: GA ČR(CZ) GAP209/11/1382; GA ČR GA205/08/0411 Grant - others:SAV(SK) Vega /0636/09; SAV(SK) Vega 2/0022/10; SRDA(SK) APVV-0516- 10 Institutional support: RVO:67985815 ; RVO:67985891 Keywords : meteors * meteoritics * meteoroids Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics; DB - Geology ; Mineralogy (USMH-B) Impact factor: 2.827, year: 2013
Location and size of the global source region of whistler-mode chorus
Czech Academy of Sciences Publication Activity Database
Hayosh, Mykhaylo; Santolík, Ondřej; Parrot, M.
2010-01-01
Roč. 115, - (2010), A00F06/1-A00F06/8 ISSN 0148-0227 R&D Projects: GA MŠk ME09107; GA ČR GA205/09/1253; GA AV ČR IAA301120601 Grant - others:ESA PECS (XE) 98025; CNRS/DREI(FR) PICS 3725 Institutional research plan: CEZ:AV0Z30420517 Keywords : CLUSTER * ray-tracing * chorus Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.303, year: 2010
Czech Academy of Sciences Publication Activity Database
Píša, David; Němec, F.; Parrot, M.; Santolík, Ondřej
2012-01-01
Roč. 55, č. 1 (2012), s. 157-163 ISSN 1593-5213 R&D Projects: GA MŠk ME09107; GA ČR GA205/09/1253 Grant - others:European Community(XE) FP7:262005 Institutional research plan: CEZ:AV0Z30420517 Keywords : DEMETER satellite * pre- seismic activity * statistical study * waves and wave analysis Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.138, year: 2012 http://www.annalsofgeophysics.eu/index.php/annals/article/view/5276
Czech Academy of Sciences Publication Activity Database
Bobrov, P.; Húsek, Dušan; Korshakov, A.V.; Frolov, A. A.
-, č. 12 (2011), s. 3-15 ISSN 1999-8554 R&D Projects: GA ČR GAP202/10/0262; GA ČR GA205/09/1079 Grant - others:GA MŠk(CZ) ED1.1.00/02.0070 Program:ED Institutional research plan: CEZ:AV0Z10300504 Keywords : brain-computer interface * independent component analysis * EEG pattern classifying * motor imagination Subject RIV: IN - Informatics, Computer Science http://www.radiotec.ru/catalog.php?cat=jr7&art=9529
Robotic telescopes for high energy astrophysics in Ondřejov
Czech Academy of Sciences Publication Activity Database
Nekola, Martin; Hudec, René; Jelínek, M.; Kocka, Matúš; Münz, F.; Kubánek, P.; Polášek, Cyril; Šimon, Vojtěch; Štrobl, Jan
2010-01-01
Roč. 28, č. 1 (2010), s. 79-85 ISSN 0922-6435. [400 Years of Astronomical Telescopes: A Review of History, Science and Technology. Noordwijk, 29.09.2008-02.10.2008] R&D Projects: GA ČR GA205/08/1207 Grant - others:ESA(XE) ESA-PECS project No. 98023 Institutional research plan: CEZ:AV0Z10030501 Keywords : robotic telescopes * BART * D50 Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 2.140, year: 2010
Preliminary Design, Vertical Stores Handling Conveyor
1977-05-01
74.09 - 250 x 74.09 - 1C6 x 79.093 = 775243.382 -- - 864 3 Z Required 775243.38 = 28.71 in. standard section is not strong 27003 enough. See Pg. 8 By...4.33 7119 slit 0.15 5.32 2.24 .2 0.5 31 2 201110 121D 150 SW0 3 ISO 57 1 .15 6.35 27 95 2 .25 533 2 06 5.32 0.2238 7M 3.01 .50 25 66 63 210 .4 235 250...230 ISO 3 lips 77 31.2 , .i 6.35 30 g 600 400 22 72374 12 1107 0.139 1063 4.00 2.00 6 SA-10 0.32 215 94 560 05 2W0 3205 205 3 270 202 W08 5,23 54 Note
1982-03-01
SO3 t 1.90 2.05 1.86 Na 2OS 0.09 0.21 0.15 Na2 Ott 0.12 0.11 0.12 K 2OS 0.49 0.47 0.51 K 2Ott 0.47 0.46 0.51 TiO 2S 0.19 0.18 0.18 TiO 2tt 0.19 0.20...ths ctibatiti.basI o Ot 81 ialdepencdcni ivieasiarcinctits, is 0.004 jam tafrdClstancN from I to 5 pim and 0.CtO pmr tar distatices trunm 10 to 50 pmi
Directory of Open Access Journals (Sweden)
Ian MacLaren
2014-06-01
Full Text Available Stepped antiphase boundaries are frequently observed in Ti-doped Bi0.85Nd0.15FeO3, related to the novel planar antiphase boundaries reported recently. The atomic structure and chemistry of these steps are determined by a combination of high angle annular dark field and bright field scanning transmission electron microscopy imaging, together with electron energy loss spectroscopy. The core of these steps is found to consist of 4 edge-sharing FeO6 octahedra. The structure is confirmed by image simulations using a frozen phonon multislice approach. The steps are also found to be negatively charged and, like the planar boundaries studied previously, result in polarisation of the surrounding perovskite matrix.
20 CFR 422.205 - Review by Appeals Council.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Review by Appeals Council. 422.205 Section 422.205 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ORGANIZATION AND PROCEDURES Procedures of... the Council. In the event of disagreement between a panel composed of only two members, the Chairman...
45 CFR 1158.205 - Professional and technical services.
2010-10-01
... advice and analysis directly applying any professional or technical discipline. For example, drafting of... 45 Public Welfare 3 2010-10-01 2010-10-01 false Professional and technical services. 1158.205... Own Employees § 1158.205 Professional and technical services. (a) The prohibition on the use of...
7 CFR 3018.205 - Professional and technical services.
2010-01-01
... and analysis directly applying any professional or technical discipline. For example, drafting of a... 7 Agriculture 15 2010-01-01 2010-01-01 false Professional and technical services. 3018.205 Section....205 Professional and technical services. (a) The prohibition on the use of appropriated funds, in...
20 CFR 438.205 - Professional and technical services.
2010-04-01
... advice and analysis directly applying any professional or technical discipline. For example, drafting of... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Professional and technical services. 438.205... Own Employees § 438.205 Professional and technical services. (a) The prohibition on the use of...
40 CFR 205.52 - Vehicle noise emission standards.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Vehicle noise emission standards. 205... ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.52 Vehicle noise emission standards. (a) Low Speed Noise Emission Standard. Vehicles which are manufactured after...
49 CFR 228.205 - Access to electronic records.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Access to electronic records. 228.205 Section 228... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HOURS OF SERVICE OF RAILROAD EMPLOYEES Electronic Recordkeeping § 228.205 Access to electronic records. (a) FRA inspectors and State inspectors participating under 49...
20 CFR 725.205 - Determination of dependency; spouse.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Determination of dependency; spouse. 725.205 Section 725.205 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR FEDERAL COAL... Determination of dependency; spouse. For the purposes of augmenting benefits, an individual who is the miner's...
22 CFR 311.205 - Professional and technical services.
2010-04-01
... and analysis directly applying any professional or technical discipline. For example, drafting of a... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Professional and technical services. 311.205... § 311.205 Professional and technical services. (a) The prohibition on the use of appropriated funds, in...
40 CFR 205.5-2 - National security exemptions.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false National security exemptions. 205.5-2... PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS General Provisions § 205.5-2 National security... a national security exemption is required. (c) For purposes of section 11(d) of the Act, any...
10 CFR 205.326 - Filing procedures and fees.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Filing procedures and fees. 205.326 Section 205.326 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and Reports.... The application fee will be charged irrespective of the ERA's disposition of the application. Fee...
40 CFR 205.160 - Selective enforcement auditing (SEA) requirements.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Selective enforcement auditing (SEA) requirements. 205.160 Section 205.160 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Selective enforcement auditing (SEA) requirements. ...
48 CFR 6.205 - Set-asides for HUBZone small business concerns.
2010-10-01
... small business concerns. 6.205 Section 6.205 Federal Acquisition Regulations System FEDERAL ACQUISITION... 6.205 Set-asides for HUBZone small business concerns. (a) To fulfill the statutory requirements... (see 19.1302) may set aside solicitations to allow only qualified HUBZone small business concerns to...
48 CFR 16.205 - Fixed-price contracts with prospective price redetermination.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Fixed-price contracts with prospective price redetermination. 16.205 Section 16.205 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Fixed-Price Contracts 16.205...
2010-02-03
... DEPARTMENT OF AGRICULTURE Agricultural Marketing Service [Doc. No. AMS-FV-09-0072] Notice of Funds...) AGENCY: Agricultural Marketing Service, USDA. ACTION: Notice. SUMMARY: The Agricultural Marketing Service (AMS) announces the availability, of $55,000,000 in grant funds, less USDA administrative costs, to...
49 CFR 20.205 - Professional and technical services.
2010-10-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 49 Transportation 1 2010-10-01 2010-10-01 false Professional and technical services. 20.205... Activities by Own Employees § 20.205 Professional and technical services. (a) The prohibition on the use of...
22 CFR 519.205 - Professional and technical services.
2010-04-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Professional and technical services. 519.205... by Own Employees § 519.205 Professional and technical services. (a) The prohibition on the use of...
38 CFR 45.205 - Professional and technical services.
2010-07-01
... or technical discipline. For example, drafting of a legal document accompanying a bid or proposal by... technical services. 45.205 Section 45.205 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS... technical services. (a) The prohibition on the use of appropriated funds, in § 45.100(a), does not apply in...
48 CFR 1631.205-73 - FEHBP interest expense.
2010-10-01
.... 1631.205-73 Section 1631.205-73 Federal Acquisition Regulations System OFFICE OF PERSONNEL MANAGEMENT... carrier's entire FEHBP investment portfolio; (2) FEHBP funds are tied up in long-term securities; (3... approval of the interest cost as a charge to the contract. (c) If the interest charge is allowed, the risk...
7 CFR 1726.205 - Multiparty lump sum quotations.
2010-01-01
... 7 Agriculture 11 2010-01-01 2010-01-01 false Multiparty lump sum quotations. 1726.205 Section 1726....205 Multiparty lump sum quotations. The borrower or its engineer must contact a sufficient number of... basis of written lump sum quotations, the borrower will select the supplier or contractor based on the...
40 CFR 205.54-1 - Low speed sound emission test procedures.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Low speed sound emission test procedures. 205.54-1 Section 205.54-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205...
40 CFR 205.57-7 - Acceptance and rejection of batch sequence.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Acceptance and rejection of batch sequence. 205.57-7 Section 205.57-7 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205...
21 CFR 137.205 - Bromated whole wheat flour.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Bromated whole wheat flour. 137.205 Section 137... Cereal Flours and Related Products § 137.205 Bromated whole wheat flour. Bromated whole wheat flour... of ingredients, prescribed for whole wheat flour by § 137.200, except that potassium bromate is added...
10 CFR 601.205 - Professional and technical services.
2010-01-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 10 Energy 4 2010-01-01 2010-01-01 false Professional and technical services. 601.205 Section 601... Activities by Own Employees § 601.205 Professional and technical services. (a) The prohibition on the use of...
45 CFR 1168.205 - Professional and technical services.
2010-10-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 45 Public Welfare 3 2010-10-01 2010-10-01 false Professional and technical services. 1168.205... Activities by Own Employees § 1168.205 Professional and technical services. (a) The prohibition on the use of...
22 CFR 138.205 - Professional and technical services.
2010-04-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Professional and technical services. 138.205... Activities by Own Employees § 138.205 Professional and technical services. (a) The prohibition on the use of...
34 CFR 82.205 - Professional and technical services.
2010-07-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 34 Education 1 2010-07-01 2010-07-01 false Professional and technical services. 82.205 Section 82... by Own Employees § 82.205 Professional and technical services. (a) The prohibition on the use of...
22 CFR 227.205 - Professional and technical services.
2010-04-01
..., drafting of a legal document accompanying a bid or proposal by a lawyer is allowable. Similarly, technical... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Professional and technical services. 227.205... Activities by Own Employees § 227.205 Professional and technical services. (a) The prohibition on the use of...
29 CFR 93.205 - Professional and technical services.
2010-07-01
... professional or technical discipline. For example, drafting of a legal document accompanying a bid or proposal... 29 Labor 1 2010-07-01 2010-07-01 true Professional and technical services. 93.205 Section 93.205... Professional and technical services. (a) The prohibition on the use of appropriated funds, in § 93.100 (a...
24 CFR 983.205 - Term of HAP contract.
2010-04-01
... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Term of HAP contract. 983.205... DEVELOPMENT PROJECT-BASED VOUCHER (PBV) PROGRAM Housing Assistance Payments Contract § 983.205 Term of HAP contract. (a) Ten-year initial term. The PHA may enter into a HAP contract with an owner for an initial...
Infrasound pulses from lightning and electrostatic field changes: Observation and discussion
Czech Academy of Sciences Publication Activity Database
Chum, Jaroslav; Diendorfer, G.; Šindelářová, Tereza; Baše, Jiří; Hruška, František
2013-01-01
Roč. 118, č. 19 (2013), s. 10653-10664 ISSN 2169-897X R&D Projects: GA ČR GA205/09/1253; GA ČR(CZ) GAP209/12/2440; GA MŠk 7E12020 Grant - others:RF EU(XE) ARISE 284387 Institutional support: RVO:68378289 Keywords : Infrasound * Lightning * Thunder * Slowness method * Electrostatic mechanism Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 3.440, year: 2013 http://onlinelibrary.wiley.com/doi/10.1002/jgrd.50805/abstract
Properties of unipolar magnetic field pulse trains generated by lightning discharges
Czech Academy of Sciences Publication Activity Database
Kolmašová, Ivana; Santolík, Ondřej
2013-01-01
Roč. 40, č. 8 (2013), 1637–1641 ISSN 0094-8276 R&D Projects: GA ČR GA205/09/1253 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100421206 Institutional support: RVO:68378289 Keywords : train of pulses * dart-stepped leader * K change Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 4.456, year: 2013 http://onlinelibrary.wiley.com/doi/10.1002/grl.50366/abstract
Czech Academy of Sciences Publication Activity Database
Straňák, V.; Wulff, H.; Bogdanowicz, R.; Drache, S.; Hubička, Zdeněk; Čada, Martin; Tichý, M.; Hippler, R.
2011-01-01
Roč. 64, 2-3 (2011), 427-435 ISSN 1434-6060 R&D Projects: GA ČR(CZ) GAP205/11/0386; GA ČR GP202/09/P159; GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Grant - others:AVČR(CZ) M100100915 Institutional research plan: CEZ:AV0Z10100522 Keywords : dual magnetron * Ti-Cu film * HiPIMS * diagnostics * ion energy Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.476, year: 2011
The 2010 Source Test was performed during the atmospheric depressurization step of the delayed coking process prior to the removal of petroleum coke from the coke drum. The 205 DCU was operated under a variety of conditions during the 2010 Source Test.
31 CFR 205.7 - Can a Treasury-State agreement be amended?
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Can a Treasury-State agreement be amended? 205.7 Section 205.7 Money and Finance: Treasury Regulations Relating to Money and Finance... Treasury-State Agreement § 205.7 Can a Treasury-State agreement be amended? (a) We or a State may amend a...
7 CFR 3565.205 - Eligible uses of loan proceeds.
2010-01-01
... essential tenant service type facilities, such as laundry rooms, that are not otherwise conveniently... 7 Agriculture 15 2010-01-01 2010-01-01 false Eligible uses of loan proceeds. 3565.205 Section 3565.205 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE...
Advanced Power Batteries for Renewable Energy Applications 3.09
Energy Technology Data Exchange (ETDEWEB)
Shane, Rodney [East Penn Manufacturing Company, Inc., Lyon Station, PA (United States)
2011-12-01
This report describes the research that was completed under project title Advanced Power Batteries for Renewable Energy Applications 3.09, Award Number DE-EE0001112. The report details all tasks described in the Statement of Project Objectives (SOPO). The SOPO includes purchasing of test equipment, designing tooling, building cells and batteries, testing all variables and final evaluation of results. The SOPO is included. There were various types of tests performed during the project, such as; gas collection, float current monitoring, initial capacity, high rate partial state of charge (HRPSoC), hybrid pulse power characterization (HPPC), high rate capacity, corrosion, software modeling and solar life cycle tests. The grant covered a period of two years starting October 1, 2009 and ending September 30, 2011.
48 CFR 31.205-10 - Cost of money.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Cost of money. 31.205-10....205-10 Cost of money. (a) General. Cost of money— (1) Is an imputed cost that is not a form of...) Refers to— (i) Facilities capital cost of money (48 CFR 9904.414); and (ii) Cost of money as an element...
Construction of 0.15 Tesla Overhauser Enhanced MRI.
Tokunaga, Yuumi; Nakao, Motonao; Naganuma, Tatsuya; Ichikawa, Kazuhiro
2017-01-01
Overhauser enhanced MRI (OMRI) is one of the free radical imaging technologies and has been used in biomedical research such as for partial oxygen measurements in tumor, and redox status in acute oxidative diseases. The external magnetic field of OMRI is frequently in the range of 5-10 mTesla to ensure microwave penetration into small animals, and the S/N ratio is limited. In this study, a 0.15 Tesla OMRI was constructed and tested to improve the S/N ratio for a small sample, or skin measurement. Specification of the main magnet was as follows: 0.15 Tesla permanent magnet; gap size 160 mm; homogenous spherical volume of 80 mm in diameter. The OMRI resonator was designed based on TE 101 cavity mode and machined from a phosphorus deoxidized copper block for electron spin resonance (ESR) excitation and a solenoid transmission/receive resonator for NMR detection. The resonant frequencies and Q values were 6.38 MHz/150 and 4.31-4.41 GHz/120 for NMR and ESR, respectively. The Q values were comparable to those of conventional low field OMRI resonators at 15 mTesla. As expected, the MRI S/N ratio was improved by a factor of 30. Triplet dynamic nuclear polarization spectra were observed for 14 N carboxy-PROXYL, along the excitation microwave sweep. In the current setup, the enhancement factor was ca. 0.5. In conclusion, the results of this preliminary evaluation indicate that the 0.15 Tesla OMRI could be useful for free radical measurement for small samples.
31 CFR 545.205 - Prohibited importation of goods, software, technology, or services.
2010-07-01
..., software, technology, or services. 545.205 Section 545.205 Money and Finance: Treasury Regulations Relating..., software, technology, or services owned or controlled by the Taliban or persons whose property or interests... (AFGHANISTAN) SANCTIONS REGULATIONS Prohibitions § 545.205 Prohibited importation of goods, software...
40 CFR 205.171-3 - Test motorcycle sample selection.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test motorcycle sample selection. 205... ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycle Exhaust Systems § 205.171-3 Test motorcycle sample selection. A test motorcycle to be used for selective enforcement audit testing...
48 CFR 731.205-6 - Compensation for personal services.
2010-10-01
... Organizations 731.205-6 Compensation for personal services. (a) General. When establishing the workweek for... base salary plus overseas recruitment incentive, if any (see AIDAR 731.205-70) exceeds the USAID... such approval after internal Agency procedures for review/approval of salaries in excess of the USAID...
40 CFR 141.205 - Content of the public notice.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Content of the public notice. 141.205 Section 141.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS..., especially those who may not have received this notice directly (for example, people in apartments, nursing...
7 CFR 205.101 - Exemptions and exclusions from certification.
2010-01-01
... is exempt from certification under subpart E of this part and from submitting an organic system plan... 7 Agriculture 3 2010-01-01 2010-01-01 false Exemptions and exclusions from certification. 205.101...) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Applicability § 205.101 Exemptions and...
49 CFR 1546.205 - Acceptance and screening of cargo.
2010-10-01
... 49 Transportation 9 2010-10-01 2010-10-01 false Acceptance and screening of cargo. 1546.205... SECURITY Operations § 1546.205 Acceptance and screening of cargo. (a) Preventing or deterring the carriage... aircraft. (2) Prevents access by unauthorized persons other than an authorized foreign air carrier employee...
12 CFR 205.16 - Disclosures at automated teller machines.
2010-01-01
... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Disclosures at automated teller machines. 205... SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.16 Disclosures at automated teller machines. (a) Definition. Automated teller machine operator means any person that operates an automated teller machine at...
40 CFR 205.57-9 - Prohibition on distribution in commerce; manufacturer's remedy.
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Prohibition on distribution in commerce; manufacturer's remedy. 205.57-9 Section 205.57-9 Protection of Environment ENVIRONMENTAL... Medium and Heavy Trucks § 205.57-9 Prohibition on distribution in commerce; manufacturer's remedy. (a...
49 CFR 1542.205 - Security of the security identification display area (SIDA).
2010-10-01
... area (SIDA). 1542.205 Section 1542.205 Transportation Other Regulations Relating to Transportation... AIRPORT SECURITY Operations § 1542.205 Security of the security identification display area (SIDA). (a... one SIDA, as follows: (1) Each secured area must be a SIDA. (2) Each part of the air operations area...
40 CFR 205.171-2 - Test exhaust system sample selection and preparation.
2010-07-01
... Systems § 205.171-2 Test exhaust system sample selection and preparation. (a)(1) Exhaust systems... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Test exhaust system sample selection and preparation. 205.171-2 Section 205.171-2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY...
45 CFR 205.52 - Furnishing of social security numbers.
2010-10-01
... 45 Public Welfare 2 2010-10-01 2010-10-01 false Furnishing of social security numbers. 205.52... GENERAL ADMINISTRATION-PUBLIC ASSISTANCE PROGRAMS § 205.52 Furnishing of social security numbers. The... furnish to the State or local agency a social security account number, hereinafter referred to as the SSN...
41 CFR 105-69.205 - Professional and technical services.
2010-07-01
... any professional or technical discipline. For example, drafting of a legal document accompanying a bid... technical services. 105-69.205 Section 105-69.205 Public Contracts and Property Management Federal Property... technical services. (a) The prohibition on the use of appropriated funds, in § 105-69.100 (a), does not...
7 CFR 205.271 - Facility pest management practice standard.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Facility pest management practice standard. 205.271... Requirements § 205.271 Facility pest management practice standard. (a) The producer or handler of an organic facility must use management practices to prevent pests, including but not limited to: (1) Removal of pest...
Electron acceleration in a wavy shock front
Czech Academy of Sciences Publication Activity Database
Vandas, Marek; Karlický, Marian
2011-01-01
Roč. 531, July (2011), A55/1-A55/8 ISSN 0004-6361 R&D Projects: GA AV ČR(CZ) IAA300030701; GA MŠk(CZ) ME09009; GA ČR GA205/09/0170; GA ČR GAP209/10/1680 Grant - others:EU(XE) EC FP7 SWIFF 263340 Institutional research plan: CEZ:AV0Z10030501 Keywords : shock waves * acceleration of particles * magnetic fields * solar radio radiation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.587, year: 2011
Czech Academy of Sciences Publication Activity Database
Píša, David; Němec, F.; Santolík, Ondřej; Parrot, M.; Rycroft, M.
2013-01-01
Roč. 118, č. 8 (2013), s. 5286-5295 ISSN 2169-9380 R&D Projects: GA ČR(CZ) GAP209/11/2280; GA ČR GA205/09/1253 Grant - others:European Community Seventh Framework Programme (FP7/2007-2013),(XE) 262005; AV ČR(CZ) M100431206. Institutional support: RVO:68378289 Keywords : DEMETER * VLF waves * preseismic activity * Earth-ionosphere waveguide Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 3.440, year: 2013 http://onlinelibrary.wiley.com/doi/10.1002/jgra.50469/abstract
Electron acceleration above thunderclouds
Czech Academy of Sciences Publication Activity Database
Füllekrug, M.; Kolmašová, Ivana; Santolík, Ondřej; Farges, T.; Bór, J.; Bennett, A.; Parrot, M.; Rison, W.; Zanotti, F.; Arnone, E.; Mezentsev, A.; Lán, Radek; Uhlíř, Luděk; Harrison, G.; Soula, S.; van der Velde, O.; Pincon, J. L.; Helling, C.; Diver, D.
2013-01-01
Roč. 8, č. 3 (2013), 035027/1-035027/6 ISSN 1748-9326 R&D Projects: GA ČR GA205/09/1253 Grant - others:Rada Programu interní podpory projektů mezinárodní spolupráce AV ČR(CZ) M100421206 Institutional support: RVO:68378289 Keywords : atmospheric electricity * lightning * electromagnetic wave propagation * storms Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 4.090, year: 2013 http://iopscience.iop.org/1748-9326/8/3/035027/pdf/1748-9326_8_3_035027.pdf
Problematika předpovědi výroby elektrické energie z fotovoltaických farem
Czech Academy of Sciences Publication Activity Database
Pelikán, Emil; Juruš, Pavel
-, č. 2 (2010), s. 47-49 ISSN 1338-0524 R&D Projects: GA ČR GA205/09/1079 Grant - others:GA AV ČR(CZ) M100300904 Institutional research plan: CEZ:AV0Z10300504 Keywords : fotovoltaická energie * predikční metody * krátkodobá předpověď * numerický model počasí Subject RIV: JE - Non-nuclear Energetics, Energy Consumption ; Use http://www.solartechnika.sk/solartechnika-22010/problematika-predpovedi-vyroby-elektricke-energie-z-fotovoltaickych-farem.html
46 CFR 109.205 - Inspection of boilers and machinery.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Inspection of boilers and machinery. 109.205 Section 109... OPERATIONS Tests, Drills, and Inspections § 109.205 Inspection of boilers and machinery. The chief engineer or engineer in charge, before he assumes charge of the boilers and machinery of a unit shall inspect...
2010-01-01
... Secretary. (1) If the Administrator or State organic program sustains a certification applicant's or..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Administrative Adverse Action Appeal Process § 205.681 Appeals. (a...
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Administrative Compliance § 205.663 Mediation. Any dispute with respect to denial of certification or proposed suspension or revocation of certification under this part may...
7 CFR 205.201 - Organic production and handling system plan.
2010-01-01
... MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED... or handling operation, except as exempt or excluded under § 205.101, intending to sell, label, or... implemented to comply with the requirements established in § 205.103; (5) A description of the management...
40 CFR 1033.205 - Applying for a certificate of conformity.
2010-07-01
... conformity. 1033.205 Section 1033.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Applying for a certificate of conformity. (a) Send the Designated Compliance Officer a complete application for each engine family for which you are requesting a certificate of conformity. (b) [Reserved] (c...
20 CFR 726.205 - Other forms of endorsement and policies.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Other forms of endorsement and policies. 726.205 Section 726.205 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, AS AMENDED BLACK LUNG BENEFITS; REQUIREMENTS FOR COAL...
48 CFR 2131.205-1 - Public relations and advertising costs.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Public relations and... REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 2131.205-1 Public relations and advertising costs. The provisions of FAR 31.205-1 shall be modified to include the following...
7 CFR 205.642 - Fees and other charges for certification.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Fees and other charges for certification. 205.642...) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Administrative Fees § 205.642 Fees and other charges for certification. Fees charged by a certifying agent must be reasonable, and a certifying...
31 CFR 205.2 - What definitions apply to this part?
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false What definitions apply to this part? 205.2 Section 205.2 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE RULES AND PROCEDURES FOR...
Investigation of high-energy sources in optical light by ESA Gaia
Czech Academy of Sciences Publication Activity Database
Hudec, R.; Šimon, Vojtěch; Hudec, L.; Hudcová, Věra
2010-01-01
Roč. 81, č. 1 (2010), s. 476-481 ISSN 0037-8720. [Multifrequency behaviour of high energy cosmic sources. Vulcano, 25.05.2009-30.05. 2009] R&D Projects: GA ČR GA205/08/1207 Grant - others:ESA(XE) ESA- PECS project No. 98058; GA ČR(CZ) GA102/09/0997; GA MŠk(CZ) ME09027; ESA(XE) ESA- PECS project No. 98023 Institutional research plan: CEZ:AV0Z10030501 Keywords : high-energy sources * cataclysmic variables * low-dispersion spectra Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics
How do fits of simulated magnetic clouds correspond to their real shapes in 3D?
Czech Academy of Sciences Publication Activity Database
Vandas, Marek; Romashets, E. P.; Geranios, A.
2010-01-01
Roč. 28, č. 8 (2010), s. 1581-1588 ISSN 0992-7689. [STEREO-3/SOHO-22 Workshop: Three Eyes on the Sun, Multi-spacecraft studies of the corona and impacts on the heliosphere. Bournemouth, 27.04.2009-01.05.2009] R&D Projects: GA ČR GA205/09/0170; GA MŠk ME09032 Grant - others:ESA(XE) ESA- PECS project No.98068 Institutional research plan: CEZ:AV0Z10030501 Keywords : interplanetary magnetic fields * magnetic clouds * numerical simulations Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 1.620, year: 2010
Department of Transportation — The Grants Center of Excellence The Grants Center of Excellence (COE) delivers end-to-end grants management products and support to over 17 Federal partner agencies....
Measurement of low energy neutrino absorption probability in thallium 205
International Nuclear Information System (INIS)
Freedman, M.S.
1986-01-01
A major aspect of the P-P neutrino flux determination using thallium 205 is the very difficult problem of experimentally demonstrating the neutrino reaction cross section with about 10% accuracy. One will soon be able to completely strip the electrons from atomic thallium 205 and to maintain the bare nucleus in this state in the heavy storage ring to be built at GSI Darmstadt. This nucleus can decay by emitting a beta-minus particle into the bound K-level of the daughter lead 205 ion as the only energetically open decay channel, (plus, of course, an antineutrino). This single channel beta decay explores the same nuclear wave functions of initial and final states as does the neutrino capture in atomic thallium 205, and thus its probability or rate is governed by the same nuclear matrix elements that affect both weak interactions. Measuring the rate of accumulation of lead 205 ions in the circulating beam of thallium 205 ions gives directly the cross section of the neutrino capture reaction. The calculations of the expected rates under realistic experimental conditions will be shown to be very favorable for the measurement. A special calibration experiment to verify this method and check the theoretical calculations will be suggested. Finally, the neutrino cross section calculation based on the observed rate of the single channel beta-minus decay reaction will be shown. Demonstrating bound state beta decay may be the first verification of the theory of this very important process that influences beta decay rates of several isotopes in stellar interiors, e.g., Re-187, that play important roles in geologic and cosmologic dating and nucleosynthesis. 21 refs., 2 figs
Prognostic and Clinical Significance of miRNA-205 in Endometrioid Endometrial Cancer.
Directory of Open Access Journals (Sweden)
Milosz Wilczynski
Full Text Available Endometrial cancer is one of the most common malignancies of the reproductive female tract, with endometrioid endometrial cancer being the most frequent type. Despite the relatively favourable prognosis in cases of endometrial cancer, there is a necessity to evaluate clinical and prognostic utility of new molecular markers. MiRNAs are small, non-coding RNA molecules that take part in RNA silencing and post-transcriptional regulation of gene expression. Altered expression of miRNAs may be associated with cancer initiation, progression and metastatic capabilities. MiRNA-205 seems to be one of the key regulators of gene expression in endometrial cancer. In this study, we investigated clinical and prognostic role of miRNA-205 in endometrioid endometrial cancer. After total RNA extraction from 100 archival formalin-fixed paraffin-embedded tissues, real-time quantitative RT-PCR was used to define miRNA-205 expression levels. The aim of the study was to evaluate miRNA-205 expression levels in regard to patients' clinical and histopathological features, such as: survival rate, recurrence rate, staging, myometrial invasion, grading and lymph nodes involvement. Higher levels of miRNA-205 expression were observed in tumours with less than half of myometrial invasion and non-advanced cancers. Kaplan-Maier analysis revealed that higher levels of miRNA-205 were associated with better overall survival (p = 0,034. These results indicate potential clinical utility of miRNA-205 as a prognostic marker.
31 CFR 205.27 - How are Interest Calculation Costs calculated?
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false How are Interest Calculation Costs calculated? 205.27 Section 205.27 Money and Finance: Treasury Regulations Relating to Money and Finance... this subpart A, other than Interest Calculation Costs, are subject to the procedures and principles of...
2010-04-01
... SECRETARY FOR EQUAL OPPORTUNITY, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT EMPLOYMENT AND BUSINESS OPPORTUNITY CONSOLIDATED HUD HEARING PROCEDURES FOR CIVIL RIGHTS MATTERS Administrative Law Judge § 180.205... authorized by law; and (j) Exercise any other powers necessary and appropriate for the purpose and conduct of...
41 CFR 50-205.3 - Agreement with a State agency.
2010-07-01
..., consideration may be given to the State laws or regulations administered by the State agency providing safety... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Agreement with a State agency. 50-205.3 Section 50-205.3 Public Contracts and Property Management Other Provisions Relating to...
Prognostic significance of miR-205 in endometrial cancer.
Directory of Open Access Journals (Sweden)
Mihriban Karaayvaz
Full Text Available microRNAs have emerged as key regulators of gene expression, and their altered expression has been associated with tumorigenesis and tumor progression. Thus, microRNAs have potential as both cancer biomarkers and/or potential novel therapeutic targets. Although accumulating evidence suggests the role of aberrant microRNA expression in endometrial carcinogenesis, there are still limited data available about the prognostic significance of microRNAs in endometrial cancer. The goal of this study is to investigate the prognostic value of selected key microRNAs in endometrial cancer by the analysis of archival formalin-fixed paraffin-embedded tissues.Total RNAs were extracted from 48 paired normal and endometrial tumor specimens using Trizol based approach. The expression of miR-26a, let-7g, miR-21, miR-181b, miR-200c, miR-192, miR-215, miR-200c, and miR-205 were quantified by real time qRT-PCR expression analysis. Targets of the differentially expressed miRNAs were quantified using immunohistochemistry. Statistical analysis was performed by GraphPad Prism 5.0.The expression levels of miR-200c (P<0.0001 and miR-205 (P<0.0001 were significantly increased in endometrial tumors compared to normal tissues. Kaplan-Meier survival analysis revealed that high levels of miR-205 expression were associated with poor patient overall survival (hazard ratio, 0.377; Logrank test, P = 0.028. Furthermore, decreased expression of a miR-205 target PTEN was detected in endometrial cancer tissues compared to normal tissues.miR-205 holds a unique potential as a prognostic biomarker in endometrial cancer.
46 CFR 160.015-4 - Capacity of lifeboat winches.
2010-10-01
...-4 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND... has been demonstrated by detailed calculations that this working load can be carried with a minimum... conduct the tests specified in § 160.015-5. (b) [Reserved] [CGFR 49-18, 14 FR 5111, Aug. 17, 1949] ...
38 CFR 1.205 - Notification to the Attorney General or United States Attorney's Office.
2010-07-01
... Attorney General or United States Attorney's Office. 1.205 Section 1.205 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS GENERAL PROVISIONS Referrals of Information Regarding Criminal Violations § 1.205 Notification to the Attorney General or United States Attorney's Office. VA police and/or...
African Journals Online (AJOL)
User
used as an oxidant for cleaning, bleachin disinfection purpose (US-EPA, 1984). the environment arises from both natura anthropogenic source. Manganese is pres drinking water, food, soil, air, dust and. (Catharine et al., 2011). It can be adsorbed on ber 1 June, 2016. Journal of Pure and Applied Sciences, 9(1): 197 - 205.
Natural Killer Receptor 1 Dampens the Development of Allergic Eosinophilic Airway Inflammation.
Directory of Open Access Journals (Sweden)
Shirin Elhaik Goldman
Full Text Available The function of NCR1 was studied in a model of experimental asthma, classified as a type 1 hypersensitivity reaction, in mice. IgE levels were significantly increased in the serum of OVA immunized NCR1 deficient (NCR1gfp/gfp mice in comparison to OVA immunized wild type (NCR1+/+ and adjuvant immunized mice. Histological analysis of OVA immunized NCR1gfp/gfp mice revealed no preservation of the lung structure and overwhelming peribronchial and perivascular granulocytes together with mononuclear cells infiltration. OVA immunized NCR+/+ mice demonstrated preserved lung structure and peribronchial and perivascular immune cell infiltration to a lower extent than that in NCR1gfp/gfp mice. Adjuvant immunized mice demonstrated lung structure preservation and no immune cell infiltration. OVA immunization caused an increase in PAS production independently of NCR1 presence. Bronchoalveolar lavage (BAL revealed NCR1 dependent decreased percentages of eosinophils and increased percentages of lymphocytes and macrophages following OVA immunization. In the OVA immunized NCR1gfp/gfp mice the protein levels of eosinophils' (CCL24 and Th2 CD4+ T-cells' chemoattractants (CCL17, and CCL24 in the BAL are increased in comparison with OVA immunized NCR+/+ mice. In the presence of NCR1, OVA immunization caused an increase in NK cells numbers and decreased NCR1 ligand expression on CD11c+GR1+ cells and decreased NCR1 mRNA expression in the BAL. OVA immunization resulted in significantly increased IL-13, IL-4 and CCL17 mRNA expression in NCR1+/+ and NCR1gfp/gfp mice. IL-17 and TNFα expression increased only in OVA-immunized NCR1+/+mice. IL-6 mRNA increased only in OVA immunized NCR1gfp/gfp mice. Collectively, it is demonstrated that NCR1 dampens allergic eosinophilic airway inflammation.
42 CFR 418.205 - Special requirements for hospice pre-election evaluation and counseling services.
2010-10-01
... evaluation and counseling services. 418.205 Section 418.205 Public Health CENTERS FOR MEDICARE & MEDICAID... Services § 418.205 Special requirements for hospice pre-election evaluation and counseling services. (a... evaluation and counseling services as specified in § 418.304(d) may be made to a hospice on behalf of a...
Determination of spin, magnetic moment and isotopic shift of neutron rich 205Hg by optical pumping
International Nuclear Information System (INIS)
Rodriguez, J.; Bonn, J.; Huber, G.; Kluge, H.J.; Otten, E.W.; European Organisation for Nuclear Research, Geneva
1975-01-01
Neutron rich 205 Hg(Tsub(1/2) = 5.2 min) was produced and on-line mass separated at the ISOLDE facility at CERN. The polarization achieved by optical pumping via the atomic line (6s 21 S 0 - 6s6p 3 P 1 , lambda = 2,537 A) was monitored by the β decay asymmetry. Hyperfine structure and isotopic shift of the 205 Hg absorption line was determined by Zeeman scanning. In addition a magnetic resoncance was performed on the polarized 205 Hg nuclei in the atomic ground state. The results are: I( 205 Hg) = 1/2 (confirmed); μ(I, 205 Hg) = 0.5915(1)μ(N) (uncorrected for diamagnetism); isotopic shift deltaν(204/205) = ν( 205 Hg) - ν( 204 Hg) = -1.8(1)GHz. μ(I) and IS are discussed briefly in the frame of current literature. (orig.) [de
Nuclear orientation and NMR/ON of sup(205,207)Po
International Nuclear Information System (INIS)
Herzog, P.; Walitzki, H.; Freitag, K.; Hildebrand, H.; Schloesser, K.
1983-01-01
sup(205,207)Po have been implanted with an isotope separator on-line into cold host matrices of Fe, Ni, Zn and Be. Nuclear magnetic resonance of oriented 207 Po has been observed in Fe and Ni, of 205 Po in Fe. From the dependence of the resonance frequency on external magnetic field the g-factor of 207 Po was derived. Using this value the magnetic hyperfine fields of Po in Fe and Ni were obtained. From the temperature dependence of the anisotropies of #betta#-lines in the decay of sup(205,207)Po the multipole mixing of several transitions was derived. The electric interaction frequencies #betta#sub(Q)=eQVsub(zz)/h in the hosts Zn and Be were measured. (orig./WL)
Effectivity of 0.15% benzydamine on radiation-induced oral mucositis in nasopharynx carcinoma
Directory of Open Access Journals (Sweden)
Remita Adya Prasetyo
2011-06-01
Full Text Available Background: Nasopharynx carcinoma is the most common malignant tumour in head and neck region. Radiotherapy is the first choice of treatment for nasopharynx carcinoma that had not been metastases. The most common oral complications in radiotherapy is mucositis (± 80%. 0.15% benzydamine hydrochloride (HCl oral rinse can be used to prevent radiation-induced oral mucositis. Purpose: The aim of this research was to study the effectivity of 0.15% benzydamine HCl oral rinse for prevention of radiation-induced oral mucositis in nasopharynx carcinoma. Methods: Samples were divided into 2 groups. Group A was using 0.15% benzydamine HCl oral rinse for 10 days. Group B was using placebo oral rinse for 10 days. Evaluation was conducted 3 times: first day, fifth day and tenth day of radiotherapy. The scoring used Spijkervet’s mucositis α score. Results: Independent t test analysis for initial occurrence of oral mucositis showed no significant difference between 2 groups. Paired t test analysis showed significant difference between initial mucositis α score and mucositis α score in tenth day in each group. Independent t test analysis showed no significant difference in mucositis α score in tenth day between 2 groups. Conclusion: In conclusion 0.15% benzydamine HCl oral rinse was not effective to prevent radiation-induced oral mucositis in nasopharynx carcinoma.Latar belakang: Karsinoma nasofaring (KNF merupakan tumor ganas terbanyak di daerah kepala-leher. Radioterapi merupakan terapi pilihan utama KNF yang belum mempunyai metastasis jauh. Komplikasi akibat radioterapi dalam rongga mulut yang terbanyak adalah mukositis (± 80%. Salah satu obat untuk pencegahan mukositis akibat radioterapi adalah benzydamine hydrochloride (HCl 0,15%. Tujuan: Tujuan penelitian ini adalah untuk mempelajari efektivitas penggunaan obat kumur benzydamine HCl 0,15% sebagai pencegah mukositis akibat radioterapi pada karsinoma nasofaring. Metode: Sampel dibagi ke dalam 2
7 CFR 766.205 - Shared Appreciation Payment Agreement rates and terms.
2010-01-01
... 7 Agriculture 7 2010-01-01 2010-01-01 false Shared Appreciation Payment Agreement rates and terms. 766.205 Section 766.205 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN SERVICING-SPECIAL Servicing Shared Appreciation Agreements and Net Recovery...
7 CFR 205.503 - Applicant information.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Accreditation of Certifying Agents § 205.503 Applicant information. A... certification activities under the Act and the regulations in this part, (2) A private entity, documentation...
25 CFR 11.205 - Are there standards for the appearance of attorneys and lay counselors?
2010-04-01
... lay counselors? 11.205 Section 11.205 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW...; Administration § 11.205 Are there standards for the appearance of attorneys and lay counselors? (a) No defendant... professional attorneys and lay counselors. ...
7 CFR 205.237 - Livestock feed.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Organic Production and Handling Requirements § 205.237 Livestock feed. (a... specific stage of life; (3) Feed plastic pellets for roughage; (4) Feed formulas containing urea or manure...
Novelli, Joan
1994-01-01
Presents strategies to help elementary teachers win grants for the classroom. The article includes information on grant sources, where to find out more about grants, and how to write winning grants. Examples of successful grant projects are provided, and announcement of a $500 Instructor grant competition is included. (SM)
29 CFR 778.205 - Premiums for weekend and holiday work-example.
2010-07-01
... 29 Labor 3 2010-07-01 2010-07-01 false Premiums for weekend and holiday work-example. 778.205....205 Premiums for weekend and holiday work—example. The application of section 7(e)(6) may be illustrated by the following example: Suppose an agreement of employment calls for the payment of $7.50 an...
45 CFR 205.35 - Mechanized claims processing and information retrieval systems; definitions.
2010-10-01
... claims processing and information retrieval systems; definitions. Section 205.35 through 205.38 contain...: (a) A mechanized claims processing and information retrieval system, hereafter referred to as an automated application processing and information retrieval system (APIRS), or the system, means a system of...
Energy Technology Data Exchange (ETDEWEB)
Chaudhari, Yogesh [Department of Physics, School of Physical Sciences, North Maharashtra University, Jalgaon 425001, Maharastra (India); Department of Physics, Shri. Pancham Khemaraj Mahavidyalaya, Sawantwadi 416510, Maharastra (India); Mahajan, Chandrashekhar M. [Department of Engineering Sciences and Humanities (DESH), Vishwakarma Institute of Technology, Pune 411 016, Maharastra (India); Singh, Amrita [Magnetics and Advanced Ceramics Laboratory, Indian Institute of Technology Delhi, Hauz Khas, New Delhi 110016 (India); Jagtap, Prashant [Department of Physics, School of Physical Sciences, North Maharashtra University, Jalgaon 425001, Maharastra (India); Chatterjee, Ratnamala [Magnetics and Advanced Ceramics Laboratory, Indian Institute of Technology Delhi, Hauz Khas, New Delhi 110016 (India); Bendre, Subhash, E-mail: bendrest@gmail.com [Department of Physics, School of Physical Sciences, North Maharashtra University, Jalgaon 425001, Maharastra (India)
2015-12-01
Ni doped BiFeO{sub 3} (x=0, 0.05, 0.1 and 0.15) nanocrystalline ceramics were synthesized by the solution combustion method (SCM) to obtain optimal multiferroic properties. The effect of Ni doping on structural, morphological, ferroelectric, magnetic and dielectric properties of BiFeO{sub 3} was studied. The structural investigations by using X-ray diffraction (XRD) pattern confirmed that BiFe{sub 1−x}Ni{sub x}O{sub 3} ceramics have rhombhohedral perovskite structure. The ferroelectric hysteresis measurements for BiFe{sub 1−x}Ni{sub x}O{sub 3} (x=0, 0.05, 0.1, 0.15) compound at room temperature found to exhibit unsaturated behavior and presents partial reversal of polarization. The magnetic measurements demonstrated an enhancement of ferromagnetic property due to Ni doping in BiFeO{sub 3} when compared with undoped BiFeO{sub 3}. The variation of dielectric constant with temperature in BiFe{sub 0.9}Ni{sub 0.1}O{sub 3} and BiFe{sub 0.85}Ni{sub 0.15}O{sub 3} samples evidenced an apparent dielectric anomaly around 350 °C and 300 °C which corresponds to antiferromagnetic to paramagnetic phase transition of (T{sub N}) of BiFeO{sub 3}. The dependence of room temperature dielectric properties on frequency signifies that both dielectric constant (ε) and dielectric loss (tan δ) are the strong function of frequency. The results show that solution combustion method leads to synthesis of an excellent and reproducible BiFe{sub 1−x}Ni{sub x}O{sub 3} multiferroic ceramics. - Highlights: • Synthesis of BiFe{sub 1−x}Ni{sub x}O{sub 3} (x=0, 0.05, 0.1 and 0.15) multiferroic ceramics. • Solution Combustion Method (SCM). • Ferroelectric and dielectric properties of undoped and Ni doped BiFeO{sub 3} ceramics. • High temperature synthesis of BiFe{sub 1−x}Ni{sub x}O{sub 3} multiferroic ceramics. • First detailed report about SCM synthesized the BiFe{sub 1−x}Ni{sub x}O{sub 3} ceramics.
10 CFR 205.84 - DOE evaluation.
2010-01-01
... determines that there is insufficient information upon which to base a decision and if upon request... ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Interpretation § 205.84 DOE evaluation. (a) Processing... relevant to any request for interpretation provided that the person making the request is afforded an...
7 CFR 205.203 - Soil fertility and crop nutrient management practice standard.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Soil fertility and crop nutrient management practice standard. 205.203 Section 205.203 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT...
Fabrication and characterization of MCC approved testing material: ATM-WV/205 glass
International Nuclear Information System (INIS)
Maupin, G.D.; Bowen, W.M.; Daniel, J.L.
1988-08-01
The ATM-WV/205 glass was produced in accordance with PNL's QA Manual for License-Related Programs, MCC technical procedures, and MCC QA Plan that were in effect during the course of this work. The method and procedure to be used in the fabrication and characterization of the ATM-WV/205 glass were specified in two run plans for glass preparation and a characterization plan. The ATM-WV/205 glass meets all specifications. The elemental composition and oxidation state of the glass are within the sponsor's specifications. Visually, the ATM-WV/205 glass bars appear uniformly glassy and generally without exterior features. Microscopic examination and x-ray diffraction revealed low (about 0.5 wt %) concentrations of 3-μm iron chrome spinel crystals and 1-μm ruthenium inclusions scattered randomly throughout the glassy matrix. Closed porosity, with pores ranging in diameter from 20 to 135 μm, was observed in all samples. 3 refs., 10 figs., 21 tabs
12 CFR 205.10 - Preauthorized transfers.
2010-01-01
.... The person that obtains the authorization shall provide a copy to the consumer. (c) Consumer's right... shall inform the consumer of the right to receive notice of all varying transfers, but may give the... FUND TRANSFERS (REGULATION E) § 205.10 Preauthorized transfers. (a) Preauthorized transfers to consumer...
48 CFR 251.205 - Contract clause.
2010-10-01
... Fleet Management System (IFMS) Vehicles 251.205 Contract clause. Use the clause at 252.251-7001, Use of Interagency Fleet Management System (IFMS)Vehicles and Related Services, in solicitations and contracts which include the clause at FAR 52.251-2, Interagency Fleet Management System (IFMS) Vehicles and Related...
International Nuclear Information System (INIS)
Narsinga Rao, G; Chen, J W; Neeleshwar, S; Chen, Y Y; Wu, M K
2009-01-01
Structural, magnetic and electrical properties of the La 0.7 Ca 0.15 Sr 0.15 Mn 1-x Mo x O 3 (0 ≤ x ≤ 0.05) compounds have been investigated. Powder x-ray analysis reveals that the sample with x = 0 crystallizes in the rhombohedral (R 3-bar c) structure, whereas in the Mo doped samples the structure can be indexed by an orthorhombic (Pbnm) structure. The important observations of the magnetic and transport properties are: (i) the Mo substitution induces a distinct suppression of the metal-insulator (T MI ) and ferromagnetic (FM)-paramagnetic transition (T C ) and the temperature of T MI was found to be higher than T C in the Mo-doped samples, (ii) the substitution of Mo enhances the magnetoresistance at room temperature, (iii) a large deviation from the Curie-Weiss law well above T C in the Mo substituted samples indicates the existence of a Griffiths phase and (iv) long-range FM order persists in all samples with a linear decrease of saturation moment as x increases. These results are discussed in terms of the Mn-site disorder and opening of strong FM coupling between Mn 2+ -O-Mn 3+ , due to the Mn 2+ ions induced by Mo 6+ at the expense of Mn 4+ ions in the La 0.7 Ca 0.15 Sr 0.15 Mn 1-x Mo x O 3 system.
The novel sRNA s015 improves nisin yield by increasing acid tolerance of Lactococcus lactis F44.
Qi, Jiakun; Caiyin, Qinggele; Wu, Hao; Tian, Kairen; Wang, Binbin; Li, Yanni; Qiao, Jianjun
2017-08-01
Nisin, a polycyclic antibacterial peptide produced by Lactococcus lactis, is stable at low pH. Improving the acid tolerance of L. lactis could thus enhance nisin yield. Small non-coding RNAs (sRNAs) play essential roles in acid tolerance by regulating their target mRNAs at the post-transcriptional level. In this study, a novel sRNA, s015, was identified in L. lactis F44 via the use of RNA sequencing, qRT-PCR analysis, and Northern blotting. s015 improved the acid tolerance of L. lactis and boosted nisin yield at low pH. In silico predictions enabled us to construct a library of possible s015 target mRNAs. Statistical analysis and validation suggested that s015 contains a highly conserved region (5'-GAAAAAAAC-3') that likely encompasses the regulatory core of the sRNA. atpG, busAB, cysD, ilvB, tcsR, ung, yudD, and ywdA were verified as direct targets of s015, and the interactions between s015 and its target genes were elucidated. This work provided new insight into the adaptation mechanism of L. lactis under acid stress.
Directory of Open Access Journals (Sweden)
N. Cayetano-Castro
2015-01-01
Full Text Available The Ostwald ripening process was studied in Fe0.75Ni0.10Al0.15 and Fe0.74Ni0.10Al0.15Cr0.01 alloys after aging at 750, 850, and 950°C for different times. The microstructural evolution shows a rounded cube morphology (Fe, NiAl β′ precipitates aligned in the ferrite matrix, which changes to elongated plates after prolonged aging. The variation of the equivalent radii of precipitates with time follows the modified Lifshitz-Slyozov-Wagner theory for diffusion-controlled coarsening. Thermo-Calc analysis shows that the chromium content is richer in the matrix than in the precipitates which causes higher hardness and coarsening resistance in the aged Fe0.74Ni0.10Al0.15Cr0.01 alloy.
20 CFR 661.205 - What is the role of the State Board?
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What is the role of the State Board? 661.205 Section 661.205 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR STATEWIDE... the Governor in the: (a) Development of the State Plan; (b) Development and continuous improvement of...
48 CFR 31.205-13 - Employee morale, health, welfare, food service, and dormitory costs and credits.
2010-10-01
... AND PROCEDURES Contracts With Commercial Organizations 31.205-13 Employee morale, health, welfare... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Employee morale, health, welfare, food service, and dormitory costs and credits. 31.205-13 Section 31.205-13 Federal Acquisition...
7 CFR 205.603 - Synthetic substances allowed for use in organic livestock production.
2010-01-01
... livestock production. 205.603 Section 205.603 Agriculture Regulations of the Department of Agriculture... organic livestock production. In accordance with restrictions specified in this section the following synthetic substances may be used in organic livestock production: (a) As disinfectants, sanitizer, and...
27 CFR 46.205 - Guidelines to determine title to articles in transit.
2010-04-01
... title to articles in transit. 46.205 Section 46.205 Alcohol, Tobacco Products and Firearms ALCOHOL AND... determine title to articles in transit. The dealer may use the following guidelines to establish who holds title to articles in transit. (a) If State law mandates the change in title, then no agreement or...
Cholestane derivatives as antitumor and antiangiogenic drugs
Czech Academy of Sciences Publication Activity Database
Hoffmannová, L.; Steigerová, J.; Oklešťková, J.; Kohout, Ladislav; Chodounská, Hana; Hniličková, Jaroslava; Kasal, Alexander; Černý, Ivan; Kolář, Z.; Strnad, M.
2010-01-01
Roč. 35, SA (2010), s. 205-205 ISSN 0377-8282. [EFMC-ISMC 2010. International Symposium on Medicinal Chemistry /21./. 05.09.2010-09.09.2010, Brussels] R&D Projects: GA MŠk(CZ) LC06077; GA AV ČR KAN200200651 Institutional research plan: CEZ:AV0Z40550506 Keywords : cholestane derivatives * anticancer drugs Subject RIV: CC - Organic Chemistry
Optimization of the Fermentation Process of Actinomycete Strain Hhs.015T
Directory of Open Access Journals (Sweden)
Xinxuan Wang
2010-01-01
inoculation volume of 15.8%. The antimicrobial activity was increased by 20% by optimizing the environmental parameters. The results obtained allow an efficient production of components with antimicrobial activity by strain Hhs.015T on a large scale at low costs.
16 CFR 0.9 - Organization structure.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...
48 CFR 31.205-14 - Entertainment costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Entertainment costs. 31... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-14 Entertainment costs. Costs of amusement, diversions, social activities, and any directly...
7 CFR 205.505 - Statement of agreement.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Accreditation of Certifying Agents § 205.505 Statement of agreement. (a... regulations in this part, including: (1) Accept the certification decisions made by another certifying agent...
7 CFR 205.402 - Review of application.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.402 Review of application. (a) Upon acceptance of an application for certification, a certifying agent must: (1) Review the application to ensure completeness...
29 CFR 779.205 - Enterprise must consist of “related activities.”
2010-07-01
... 29 Labor 3 2010-07-01 2010-07-01 false Enterprise must consist of ârelated activities.â 779.205... STANDARDS ACT AS APPLIED TO RETAILERS OF GOODS OR SERVICES Employment to Which the Act May Apply; Enterprise Coverage Related Activities § 779.205 Enterprise must consist of “related activities.” The enterprise must...
30 CFR 210.205 - What reports must I submit to claim allowances on Indian coal leases?
2010-07-01
... on Indian coal leases? 210.205 Section 210.205 Mineral Resources MINERALS MANAGEMENT SERVICE... Minerals § 210.205 What reports must I submit to claim allowances on Indian coal leases? General. You must... coal leases: (1) Form MMS-4292, Coal Washing Allowance Report, to claim an allowance for the reasonable...
7 CFR 205.604 - Nonsynthetic substances prohibited for use in organic livestock production.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Nonsynthetic substances prohibited for use in organic livestock production. 205.604 Section 205.604 Agriculture Regulations of the Department of Agriculture... organic livestock production. The following nonsynthetic substances may not be used in organic livestock...
31 CFR 205.9 - What is included in a Treasury-State agreement?
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false What is included in a Treasury-State agreement? 205.9 Section 205.9 Money and Finance: Treasury Regulations Relating to Money and Finance... must include, at a minimum, a clear indication of: (1) The data used; (2) The sources of the data; (3...
48 CFR 1331.205-32 - Precontract costs.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Precontract costs. 1331... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1331.205-32 Precontract costs. If precontract costs are anticipated, pursuant to negotiations and in...
7 CFR 205.403 - On-site inspections.
2010-01-01
..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.403 On-site inspections. (a) On-site inspections. (1... site that produces or handles organic products and that is included in an operation for which...
Field plated 0.15 μm GaN HEMTs for millimeter-wave application
International Nuclear Information System (INIS)
Ren Chunjiang; Li Zhonghui; Yu Xuming; Wang Quanhui; Wang Wen; Chen Tangsheng; Zhang Bin
2013-01-01
SiN dielectrically-defined 0.15 μm field plated GaN HEMTs for millimeter-wave application have been presented. The AlGaN/GaN hetero-structure epitaxial material for HEMTs fabrication was grown on a 3-inch SiC substrate with an Fe doped GaN buffer layer by metal-organic chemical deposition. Electron beam lithography was used to define both the gate footprint and the cap of the gate with an integrated field plate. Gate recessing was performed to control the threshold voltage of the devices. The fabricated GaN HEMTs exhibited a unit current gain cut-off frequency of 39 GHz and a maximum frequency of oscillation of 63 GHz. Load-pull measurements carried out at 35 GHz showed a power density of 4 W/mm with associated power gain and power added efficiency of 5.3 dB and 35%, respectively, for a 0.15 mm gate width device operated at a 24 V drain bias. The developed 0.15 μm gate length GaN HEMT technology is suitable for Ka band applications and is ready for millimeter-wave power MMICs development. (semiconductor devices)
Si0.85Ge0.15 oxynitridation in nitric oxide/nitrous oxide ambient
International Nuclear Information System (INIS)
Dasgupta, Anindya; Takoudis, Christos G.; Lei Yuanyuan; Browning, Nigel D.
2003-01-01
Low temperature, nitric oxide (NO)/nitrous oxide (N 2 O) aided, sub-35 Aa Si 0.85 Ge 0.15 oxynitrides have been grown at 550 and 650 deg. C, while the oxynitridation feed gases have been preheated to 900 and 1000 deg. C, respectively, before entering the reaction zone. X-ray photoelectron spectroscopy and secondary ion mass spectroscopy (SIMS) data suggest that NO-assisted oxynitridation incorporates more nitrogen than the N 2 O-assisted one, while there is minimal Ge segregation towards the dielectric/substrate interface in both oxynitridation processes. Moreover, SIMS results suggest that nitrogen is distributed throughout the film in contrast to high temperature Si oxynitridation, where nitrogen incorporation takes place near the dielectric/substrate interface. Z-contrast imaging with scanning transmission electron microscopy shows that the oxynitride grown in NO at 650 degree sign C has a sharp interface with the bulk Si 0.85 Ge 0.15 , while the roughness of the dielectric/Si 0.85 Ge 0.15 substrate interface is less than 2 Aa. These results are discussed in the context of an overall mechanism of SiGe oxynitridation
Energy Technology Data Exchange (ETDEWEB)
Gaur, Roopam; Dhingra, Apurva; Pal, Soham; Chandramani Singh, K., E-mail: kongbam@gmail.com
2015-03-15
Highlights: • (K{sub 0.485}Na{sub 0.5}Li{sub 0.015})(Nb{sub 0.9−x}Ta{sub 0.1}V{sub x}) O{sub 3}(x = 0, 0.01, 0.02, 0.03) ceramics were prepared. • These ceramics were synthesized from 35-nm powders. • Density, microstrain, crystallite size, tetragonality were high at x = 0.02. • Dielectric, ferroelectric and piezoelectric properties were enhanced at x = 0.02. • The increased properties are attributed to crystal structure and microstructure. - Abstract: Enhancing the piezoelectric properties of lead-free piezoceramics like alkaline niobate system has been an important research topic in our search for an alternative to widely used but highly toxic lead-based PZT piezoceramics system. In the present study, lead-free alkaline niobate-based compositions (K{sub 0.485}Na{sub 0.5}Li{sub 0.015})(Nb{sub 0.9−x}Ta{sub 0.1}V{sub x})O{sub 3} (x = 0, 0.01, 0.02 and 0.03) were synthesized using conventional solid state reaction method. Nanocrystalline powders of these compositions, produced by high energy ball milling, were sintered at 1050 °C for 4 h to produce corresponding ceramics. Increasing V{sup 5+} content in the ceramics from x = 0 to 0.02 results in a gradual increase in the room temperature dielectric constant (ε{sub r}) from 1185 to 1336, remnant polarization (P{sub r}) from 13.4 μC/cm{sup 2} to 17.1 μC/cm{sup 2}, electromechanical coupling factor (k{sub p}) from 0.37 to 0.40, and piezoelectric charge constant (d{sub 33}) from 156 pC/N to 185 pC/N. Further increase in x to 0.03 lowers these values to 1082, 13.4 μC/cm{sup 2}, 0.36 and 128 pC/N respectively. Correspondingly, the coercive field (E{sub c}) first shows a gradual decline from 8.5 kV/cm to 7.9 kV/cm and then a rise to 9.2 kV/cm, as x increases from 0 to 0.02 and then to 0.03. The enhancement of piezoelectric properties in (K{sub 0.485}Na{sub 0.5}Li{sub 0.015})(Nb{sub 0.88}Ta{sub 0.1}V{sub 0.02})O{sub 3} ceramics is attributed to the associated higher values of density, tetragonality and
48 CFR 1231.205-32 - Precontract costs.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Precontract costs. 1231... CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1231.205-32 Precontract costs. (a) The decision to incur precontract costs is that of the contractor. No...
9 CFR 93.205 - Certificate for poultry.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Certificate for poultry. 93.205... AGRICULTURE EXPORTATION AND IMPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS IMPORTATION OF CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS...
24 CFR 881.205 - Limitation on distributions.
2010-04-01
... set aside for payment, and all reserve requirements have been met. The first year's distribution may... project funds are more than the amount needed for project operations, reserve requirements and permitted... REHABILITATION Definitions and Other Requirements § 881.205 Limitation on distributions. (a) Non-profit owners...
24 CFR 880.205 - Limitation on distributions.
2010-04-01
... payment, and all reserve requirements have been met. The first year's distribution may not be made until... more than the amount needed for project operations, reserve requirements and permitted distribution... Definitions and Other Requirements § 880.205 Limitation on distributions. (a) Non-profit owners are not...
9 CFR 205.105 - Master list and portion thereof distributed to registrants-format.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Master list and portion thereof distributed to registrants-format. 205.105 Section 205.105 Animals and Animal Products GRAIN INSPECTION... means recording on paper by any technology in a form that can be read by humans without special...
miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes
Energy Technology Data Exchange (ETDEWEB)
McKenna, Declan J., E-mail: dj.mckenna@ulster.ac.uk [Biomedical Sciences Research Institute, University of Ulster, Coleraine, Co. Derry BT52 1SA (United Kingdom); Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); Patel, Daksha, E-mail: d.patel@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); McCance, Dennis J., E-mail: d.mccance@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom)
2014-01-05
A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes.
miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes
International Nuclear Information System (INIS)
McKenna, Declan J.; Patel, Daksha; McCance, Dennis J.
2014-01-01
A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes
Solar quiescent prominences. Filamentary structure and energetics
Czech Academy of Sciences Publication Activity Database
Heinzel, Petr; Anzer, U.; Gunár, Stanislav
2010-01-01
Roč. 81, č. 2 (2010), s. 654-661 ISSN 0037-8720. [Chromospheric structure and dynamics: From old wisdom to new insights. Sunspot,, 31.08.2009-4.09.2009] R&D Projects: GA ČR GA205/09/1705; GA ČR GP205/09/P554 Institutional research plan: CEZ:AV0Z10030501 Keywords : line formation * line profiles * radiative transfer Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics
Cambrian and Ordovician Fossil-Lagerstätten in the Barrandian area
Czech Academy of Sciences Publication Activity Database
Fatka, O.; Budil, P.; Kraft, P.; Mergl, M.; Mikuláš, Radek; Valent, M.; Lajblová, K.; Rak, Š.; Steinová, M.; Szabad, M.; Micka, V.; Aubrechtová, M.; Lajbl, L.; Nohejlová, M.; Vodička, J.
2012-01-01
Roč. 18, č. 1 (2012), s. 22-25 ISSN 1212-6209. [Congress of CGS and SGS. Moninec, 2011.09.22-2011.09.25] R&D Projects: GA ČR GA205/06/0395; GA ČR GA205/09/1521 Institutional research plan: CEZ:AV0Z30130516 Keywords : Cambrian * Ordovician * Fossil-Lagerstätten Subject RIV: DB - Geology ; Mineralogy http://www.sci.muni.cz/gap/casop/
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS
7 CFR 3550.205 - Delinquency workout agreements.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Delinquency workout agreements. 3550.205 Section 3550... Delinquency workout agreements. Borrowers with past due accounts may be offered the opportunity to avoid liquidation by entering into a delinquency workout agreement that specifies a plan for bringing the account...
33 CFR 151.09 - Applicability.
2010-07-01
....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...
Mabuchi, Miyuki; Shimizu, Tadashi; Ueda, Masahiro; Sasakawa, Yuka; Nakao, Syuhei; Ueda, Yuko; Kawamura, Akio; Tsujikawa, Kazutake; Tanaka, Akito
2015-01-01
Prostate cancer antigen (PCA)-1/AlkB homologue 3 (ALKBH3) has been identified as a clinically significant factor and siRNA of PCA-1 inhibits DU145 proliferation both in vitro and in vivo. HUHS015 ( 1: ), a previous reported PCA-1 small-molecule inhibitor, was also effective without any obvious side-effects or toxicity. The potency of HUHS015, however, is not satisfying. We thought the reason is poor solubility of HUHS015 because insoluble material remained at the injection site after subcutaneous administration. To improve this inhibitor's solubility, we prepared various salts of HUHS015 and examined their solubility, which resulted in the selection of HUHS015 sodium salt ( 2: ) for further studies in vivo. Next, we compared the pharmacokinetics of 1: and 2: via several administration routes. We observed significant improvements in the pharmacokinetic parameters. For example, subcutaneous administration of 2: increased the area under the curve (AUC)0-24 by 8-fold compared to 1 and increased the suppressive effect on the proliferation of DU145 cells in a xenograft model. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Gupta, Gyan Prakash; Singh, Sudha; Kumar, Bablu; Kulshrestha, U C
2015-03-01
Abundance of CaCO3 rich soil dust is a typical feature of atmospheric environment in the Indian region. During prevailing dry weather conditions, dustfall is deposited onto the foliar surfaces of plant affecting their morphology, stomata and the levels of biochemical constituents. This study reports the chemical characteristics of dustfall, its effect on foliar morphology and biochemical constituents of a medicinal plant (Morus alba) at two sites which are differentiated on the basis of landuse pattern, viz., (i) residential, Jawaharlal Nehru University (JNU), and (ii) industrial, Sahibabad (SB), located in the National Capital Region (NCR) of Delhi. Dustfall was characterized for major anions (F(-), Cl(-), NO3 (-) and SO4 (--)) and cations (Na(+), NH4 (+), K(+), Mg(++) and Ca(++)). Biochemical parameters such as chlorophyll a, chlorophyll b, total chlorophyll, carotenoid, proline and ascorbic acid were determined in foliar samples. The results showed that the dustfall fluxes of all the major ions were found to be higher at the industrial site (SB) as compared to the residential site (JNU). Foliar analysis revealed that the levels of biochemical parameters were more affected at SB site due to higher levels of dust SO4 (--) contributed by various anthropogenic sources resulting in more stressful conditions affecting the biochemistry of the plant. The possible entry pathways for dust SO4 (--) into foliar cells are also discussed in the paper. It was noticed that the deposition of urban dust was responsible for the damage of trichome, epidermis, cuticle and stomatal guard cells significantly affecting foliar morphology. SB exhibited more damage to these morphological parts suggesting that industrial dust is harmful to the plants.
40 CFR 266.205 - Standards applicable to the storage of solid waste military munitions.
2010-07-01
... solid waste military munitions. 266.205 Section 266.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR THE MANAGEMENT OF SPECIFIC HAZARDOUS... applicable to the storage of solid waste military munitions. (a) Criteria for hazardous waste regulation of...
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik
2010-01-01
... minimum wage requirements in determining prevailing rates. 532.205 Section 532.205 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PREVAILING RATE SYSTEMS Prevailing Rate Determinations § 532.205 The use of Federal, State, and local minimum wage requirements in determining prevailing...
Dipole response of the odd-proton nucleus 205Tl up to the neutron-separation energy
Benouaret, N.; Beller, J.; Pai, H.; Pietralla, N.; Ponomarev, V. Yu; Romig, C.; Schnorrenberger, L.; Zweidinger, M.; Scheck, M.; Isaak, J.; Savran, D.; Sonnabend, K.; Raut, R.; Rusev, G.; Tonchev, A. P.; Tornow, W.; Weller, H. R.; Kelley, J. H.
2016-11-01
The low-lying electromagnetic dipole strength of the odd-proton nuclide 205Tl has been investigated up to the neutron separation energy exploiting the method of nuclear resonance fluorescence. In total, 61 levels of 205Tl have been identified. The measured strength distribution of 205Tl is discussed and compared to those of even-even and even-odd mass nuclei in the same mass region as well as to calculations that have been performed within the quasi-particle phonon model.
Dipole response of the odd-proton nucleus 205Tl up to the neutron-separation energy
International Nuclear Information System (INIS)
Benouaret, N; Beller, J; Pai, H; Pietralla, N; Ponomarev, V Yu; Romig, C; Schnorrenberger, L; Zweidinger, M; Scheck, M; Isaak, J; Savran, D; Sonnabend, K; Raut, R; Rusev, G; Tonchev, A P; Tornow, W; Weller, H R; Kelley, J H
2016-01-01
The low-lying electromagnetic dipole strength of the odd-proton nuclide 205 Tl has been investigated up to the neutron separation energy exploiting the method of nuclear resonance fluorescence. In total, 61 levels of 205 Tl have been identified. The measured strength distribution of 205 Tl is discussed and compared to those of even–even and even–odd mass nuclei in the same mass region as well as to calculations that have been performed within the quasi-particle phonon model. (paper)
7 CFR 765.205 - Subordination of liens.
2010-01-01
... AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN SERVICING-REGULAR Protecting the Agency's Security Interest § 765.205..., expenses, and debt repayment plan; and (6) Verification of all debts. (b) Real estate security. For loans... loan security will be increased by an amount at least equal to the advance to be made under the...
48 CFR 31.205-42 - Termination costs.
2010-10-01
... nonrecurring labor, material, and related overhead costs incurred in the early part of production and result... the settlement proposal as a direct charge, such costs shall not also be included in overhead. Initial... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Termination costs. 31.205...
Energy Technology Data Exchange (ETDEWEB)
Lu, Nanyao; Zhao, Yinghe; Xu, C. Kevin; Howell, Justin; Mazzarella, Joseph M.; Schulz, Bernhard [Infrared Processing and Analysis Center, California Institute of Technology, MS 100-22, Pasadena, CA 91125 (United States); Gao, Yu; Liu, Lijie [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Díaz-Santos, Tanio; Armus, Lee [Spitzer Science Center, California Institute of Technology, MS 220-6, Pasadena, CA 91125 (United States); Charmandaris, Vassilis [Department of Physics, University of Crete, GR-71003 Heraklion (Greece); Inami, Hanae [National Optical Astronomy Observatory, Tucson, AZ 85719 (United States); Privon, George C. [Departamento de Astronomía, Universidad de Concepción, Casilla 160 C, Concepción (Chile); Lord, Steven D. [The SETI Institute, 189 Bernardo Avenue Suite 100, Mountain View, CA 94043 (United States); Sanders, David B. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Van der Werf, Paul P., E-mail: lu@ipac.caltech.edu [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands)
2015-03-20
To better characterize the global star formation activity in a galaxy, one needs to know not only the star formation rate (SFR) but also the rest-frame, far-infrared color (e.g., the 60–100 μm color, C(60/100)) of the dust emission. The latter probes the average intensity of the dust heating radiation field and scales statistically with the effective SFR surface density in star-forming galaxies including (ultra-)luminous infrared galaxies ((U)LIRGs). To this end, here we exploit a new spectroscopic approach involving only two emission lines: CO(7–6) at 372 μm and [N ii] at 205 μm([N ii]{sub 205μm}). For local (U)LIRGs, the ratios of the CO(7–6) luminosity (L{sub CO(7–6)}) to the total infrared luminosity (L{sub IR}; 8–1000 μm) are fairly tightly distributed (to within ∼0.12 dex) and show little dependence on C(60/100). This makes L{sub CO(7–6)} a good SFR tracer, which is less contaminated by active galactic nuclei than L{sub IR} and may also be much less sensitive to metallicity than L{sub CO(1–0)}. Furthermore, the logarithmic [N ii]{sub 205μm}/CO(7–6) luminosity ratio depends fairly strongly (at a slope of ∼ −1.4) on C(60/100), with a modest scatter (∼0.23 dex). This makes it a useful estimator on C(60/100) with an implied uncertainty of ∼0.15 (or ≲4 K in the dust temperature (T{sub dust}) in the case of a graybody emission with T{sub dust} ≳ 30 K and a dust emissivity index β ≥ 1). Our locally calibrated SFR and C(60/100) estimators are shown to be consistent with the published data of (U)LIRGs of z up to ∼6.5.
30 CFR 220.015 - Pricing of materiel purchases, transfers, and dispositions.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Pricing of materiel purchases, transfers, and... CONTINENTAL SHELF OIL AND GAS LEASES § 220.015 Pricing of materiel purchases, transfers, and dispositions. (a... shall be priced under the provisions for tubular goods pricing in paragraph (a)(2)(i)(A) of this section...
9 CFR 381.205 - Labeling of immediate containers of poultry products offered for entry.
2010-01-01
... PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Labeling of immediate containers of poultry products offered for entry. 381.205 Section 381.205 Animals and Animal Products FOOD SAFETY AND...
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
MicroRNA-205 downregulates mixed-lineage-AF4 oncogene expression in acute lymphoblastic leukemia
Directory of Open Access Journals (Sweden)
Dou L
2013-08-01
Full Text Available Liping Dou,1,* Jingxin Li,1,* Dehua Zheng,2,* Yonghui Li,1 Xiaoning Gao,1 Chengwang Xu,1 Li Gao,1 Lili Wang,1 Li Yu1 1Department of Hematology, Chinese PLA General Hospital, Beijing, People's Republic of China; 2Department of Hepatobiliary Surgery, Organ Transplant Center, Chinese PLA 309th Hospital, Beijing, People's Republic of China*These authors contributed equally to this workAbstract: Myeloid/lymphoid or mixed-lineage AF4 acute lymphoblastic leukemia (MLL-AF4 ALL is a pediatric leukemia that occurs rarely in adults. MLL-AF4 ALL is typically characterized by the presence of chromosomal translocation (t(4;11(q21;q23, leading to expression of MLL-AF4 fusion protein. Although MLL-AF4 fusion protein triggers a molecular pathogenesis and hematological presentations that are unique to leukemias, the precise role of this oncogene in leukemogenesis remains unclear. Previous studies have indicated that microRNAs (miRs might modulate the expression of MLL-AF4 ALL fusion protein, thereby suggesting the involvement of miR in progression or suppression of MLL-AF4 ALL. We have previously demonstrated that miR-205 negatively regulates transcription of an MLL-AF4 luciferase reporter. Here, we report that exogenous expression of miR-205 in MLL-AF4 human cell lines (RS4;11 and MV4-11 inversely regulates the expression of MLL-AF4 at both messenger RNA (mRNA and protein level. Furthermore, miR-205 significantly induced apoptosis in MLL-AF4 cells as evidenced by Annexin V staining using fluorescence-activated cell sorting (FACS analysis. The proliferative capacity of leukemic cells was suppressed by miR-205. The addition of an miR-205 inhibitor was able to restore the observed effects. In conclusion, these findings demonstrate that miR-205 may have potential value as a novel therapeutic agent in the treatment of MLL-AF4 ALL.Keywords: miR-205, MLL-AF4, leukemia, microRNA, oncogene expression, untranslated regions, proliferation
22 CFR 1203.735-205 - Financial interests.
2010-04-01
... RESPONSIBILITIES AND CONDUCT Ethical and Other Conduct and Responsibilities of Employees § 1203.735-205 Financial..., bonds, or policies in a mutual fund, investment company, bank or insurance company, provided that in the case of a mutual fund, investment company, or bank, the fair value of such stock or bond holding does...
Epstein-Barr virus miR-BART20-5p regulates cell proliferation and apoptosis by targeting BAD.
Kim, Hyoji; Choi, Hoyun; Lee, Suk Kyeong
2015-01-28
Although Epstein-Barr virus (EBV) BamHI A rightward transcript (BART) microRNAs (miRNAs) are ubiquitously expressed in EBV-associated tumors, the role of most BART miRNAs is unclear. In this study, we showed that Bcl-2-associated death promoter (BAD) expression was significantly lower in EBV-infected AGS-EBV cells than in EBV-negative AGS cells and investigated whether BART miRNAs target BAD. Using bioinformatics analysis, five BART miRNAs showing seed match with the 3' untranslated region (3'-UTR) of BAD were selected. Of these, only miR-BART20-5p reduced BAD expression when individually transfected into AGS cells. A luciferase assay revealed that miR-BART20-5p directly targets BAD. The expression of BAD mRNA and protein was decreased by miR-BART20-5p and increased by an inhibitor of miR-BART20-5p. PE-Annexin V staining and cell proliferation assays showed that miR-BART20-5p reduced apoptosis and enhanced cell growth. Furthermore, miR-BART20-5p increased chemoresistance to 5-fluorouracil and docetaxel. Our data suggest that miR-BART20-5p contributes to tumorigenesis of EBV-associated gastric carcinoma by directly targeting the 3'-UTR of BAD. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
2010-04-01
... environmental design and policy-planning-management-capacity building activities. 570.205 Section 570.205..., urban environmental design and policy-planning-management-capacity building activities. (a) Planning... known or suspected environmental contamination. (5) [Reserved] (6) Policy—planning—management—capacity...
2010-04-01
... environmental design and policy-planning-management-capacity building activities. 1003.205 Section 1003.205... planning, urban environmental design and policy-planning-management-capacity building activities. (a... plans, general environmental studies, and strategies and action programs to implement plans, including...
5 CFR 880.205 - Determinations of death.
2010-01-01
... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Determinations of death. 880.205 Section... Determinations of death. OPM does not make findings of presumed death. A claimant for CSRS, FERS, or FEGLI death... § 880.207 must submit a death certificate or other legal certification of death issued by an authorized...
2010-07-01
... round log or timber product originating in Liberia. 593.205 Section 593.205 Money and Finance: Treasury... on the importation of any round log or timber product originating in Liberia. Except as otherwise... product originating in Liberia is prohibited. Note to § 593.205: See section 593.510, which authorizes...
21 CFR 111.205 - What is the requirement to establish a master manufacturing record?
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false What is the requirement to establish a master manufacturing record? 111.205 Section 111.205 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING PRACTICE IN...
10 CFR 205.282 - Evaluation of petition by the Office of Hearings and Appeals.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Evaluation of petition by the Office of Hearings and Appeals. 205.282 Section 205.282 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS... and Appeals or his designee shall issue a final Decision and Order which shall govern the disposition...
48 CFR 31.205-12 - Economic planning costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Economic planning costs... GENERAL CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 31.205-12 Economic planning costs. Economic planning costs are the costs of general long-range...
2010-04-01
... INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Identification and Measurement of Countervailable Subsidies § 351.504 Grants. (a) Benefit. In the case of a grant, a benefit exists in the amount of the grant. (b) Time of receipt of benefit. In the case of a grant, the...
Main design and safety features of a 200MW nuclear heating reactor
International Nuclear Information System (INIS)
Zheng, Wenxiang; Gao, Zuying; Wang, Dazhong
1992-01-01
Inept has been in charge of the development of a nuclear heating reactor since 1980s, which is one of the national key R and D Programs in China. A 5MWt experimental NCR was completed at Inept in 1989 and has operated successfully for space heating since then. In order to realize the commercialization of the NCR, it has been decided to construct a 200MW demonstration NCR in 1993. A number of advanced features, including natural circulation, integrated arrangement, self-pressurized performance, dual vessel structure, hydraulic control rod drive and passive safety systems, have been incorporated into the NCR-200 to achieve its safety goal and economic viability. This makes the NCR safe, simple, reliable, easy-constructed and maintained. At present, the design work of the NCR-200 have shown that its safety characteristics are excellent. The NCR could play an important role in resolving future energy and environmental problems in China. The paper will mainly cover the key design considerations, main technical features and safety analysis results of the NCR-200
Fukaya, Tomohiro; Murakami, Ryuichi; Takagi, Hideaki; Sato, Kaori; Sato, Yumiko; Otsuka, Haruna; Ohno, Michiko; Hijikata, Atsushi; Ohara, Osamu; Hikida, Masaki; Malissen, Bernard; Sato, Katsuaki
2012-07-10
Dendritic cells (DCs) are composed of multiple subsets that play a dual role in inducing immunity and tolerance. However, it is unclear how CD205(+) conventional DCs (cDCs) control immune responses in vivo. Here we generated knock-in mice with the selective conditional ablation of CD205(+) cDCs. CD205(+) cDCs contributed to antigen-specific priming of CD4(+) T cells under steady-state conditions, whereas they were dispensable for antigen-specific CD4(+) T-cell responses under inflammatory conditions. In contrast, CD205(+) cDCs were required for antigen-specific priming of CD8(+) T cells to generate cytotoxic T lymphocytes (CTLs) mediated through cross-presentation. Although CD205(+) cDCs were involved in the thymic generation of CD4(+) regulatory T cells (Tregs), they maintained the homeostasis of CD4(+) Tregs and CD4(+) effector T cells in peripheral and mucosal tissues. On the other hand, CD205(+) cDCs were involved in the inflammation triggered by Toll-like receptor ligand as well as bacterial and viral infections. Upon microbial infections, CD205(+) cDCs contributed to the cross-priming of CD8(+) T cells for generating antimicrobial CTLs to efficiently eliminate pathogens, whereas they suppressed antimicrobial CD4(+) T-cell responses. Thus, these findings reveal a critical role for CD205(+) cDCs in the regulation of T-cell immunity and homeostasis in vivo.
Multifold polar states in Zn-doped Sr0.9Ba0.1TiO3 ceramics
Guo, Yan-Yan; Guo, Yun-Jun; Wei, Tong; Liu, Jun-Ming
2015-12-01
We investigate the effect of Zn doping on the dielectricity and ferroelectricity of a series of polycrystalline Sr0.9-xZnxBa0.1TiO3 (0.0% ≤ x ≤ 5.0%) ceramics. It is surprisingly observed that the Zn doping will produce the multifold polar states, i.e., the Zn-doped ceramic will convert a reduced polar state into an enhanced polar state, and eventually into a stabilized polar state with increasing the doping level x. It is revealed that in the background of quantum fluctuations, the competition between the Zn-doping-induced lattice contraction and the Ba-doping-induced lattice expansion is responsible for both the reduced polar state and the enhanced polar state coming into being. Also, the addition of the antiferrodistortive effect, which is the antipolar interaction originating from the opposite tilted-TiO6 octahedra rotation, represents the core physics behind the stabilized polar state. Project supported by the National Natural Science Foundation of China (Grant Nos. 11304158, 51431006, 51102277, and 11104118), the Scientific Research Foundation of Nanjing University of Posts and Telecommunications, China (Grant No. NY213020), and the Qing Lan Project of Jiangsu Province, China.
41 CFR 105-74.205 - What must I include in my drug-free workplace statement?
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What must I include in my drug-free workplace statement? 105-74.205 Section 105-74.205 Public Contracts and Property Management Federal Property Management Regulations System (Continued) GENERAL SERVICES ADMINISTRATION...
2010-07-01
... reexportation of goods, technology, or services to Sudan. 538.205 Section 538.205 Money and Finance: Treasury... goods, technology, or services to Sudan. Except as otherwise authorized, the exportation or reexportation, directly or indirectly, to Sudan of any goods, technology (including technical data, software, or...
The S-Process Branching-Point at 205PB
Tonchev, Anton; Tsoneva, N.; Bhatia, C.; Arnold, C. W.; Goriely, S.; Hammond, S. L.; Kelley, J. H.; Kwan, E.; Lenske, H.; Piekarewicz, J.; Raut, R.; Rusev, G.; Shizuma, T.; Tornow, W.
2017-09-01
Accurate neutron-capture cross sections for radioactive nuclei near the line of beta stability are crucial for understanding s-process nucleosynthesis. However, neutron-capture cross sections for short-lived radionuclides are difficult to measure due to the fact that the measurements require both highly radioactive samples and intense neutron sources. We consider photon scattering using monoenergetic and 100% linearly polarized photon beams to obtain the photoabsorption cross section on 206Pb below the neutron separation energy. This observable becomes an essential ingredient in the Hauser-Feshbach statistical model for calculations of capture cross sections on 205Pb. The newly obtained photoabsorption information is also used to estimate the Maxwellian-averaged radiative cross section of 205Pb(n,g)206Pb at 30 keV. The astrophysical impact of this measurement on s-process nucleosynthesis will be discussed. This work was performed under the auspices of US DOE by LLNL under Contract DE-AC52-07NA27344.
Nuclear resonance fluorescence of {sup 203,205}Tl
Energy Technology Data Exchange (ETDEWEB)
Pfeifer, Fabian; Fritzsche, Matthias; Pietralla, Norbert; Savran, Deniz; Weller, Henry; Zweidinger, Markus [Institut fuer Kernphysik, Technische Universitaet, Darmstadt (Germany); Rusev, Gencho; Tonchev, Anton P.; Tornow, Werner [Triangle Universities Nuclear Laboratory, Duke University, Durham (United States); Zilges, Andreas [Institut fuer Kernphysik, Universitaet Koeln (Germany)
2009-07-01
In order to investigate the dipole strength distribution in Thalium isotopes we have studied Nuclear Resonance Fluorescence of a sample composed of natural Thallium (consisting of 30% {sup 203}Tl and 70% {sup 205}Tl). Unpolarized bremsstrahlung with photo energies up to 7.5 MeV was used at the High Intensity Photon Setup (HIPS) at S-DALINAC at the IKP Darmstadt. 24 fluorescent {gamma}-ray transitions were observed, 19 of them for the first time. For the assignment of the polarity of two prominent {gamma}-ray transitions, one at 4.7 MeV and one at 4.9 MeV, the polarized photon beam of the High Intensity {gamma}-ray Source (HI{gamma}S) at Duke University was used. The experiment at HI{gamma}S revealed the existence of a photo-excited state of {sup 205}Tl at an excitation energy of 4.971 MeV that exhibits a transition to the first excited state at 203 keV.
46 CFR 27.205 - What are the requirements for internal communication systems on towing vessels?
2010-10-01
... systems on towing vessels? 27.205 Section 27.205 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... fitted with a communication system between the engine room and the operating station that— (1) Consists... required to have internal communication systems. (c) When the operating-station's engine controls and the...
FEMA Grants Program Directorate - Preparedness (Non-Disaster) and Assistance to Firefighter Grants
Department of Homeland Security — The Grant Programs Directorate (GPD) strategically and effectively administers and manages FEMA grants to ensure critical and measurable results for customers and...
Liang, Huihuang; Tang, Bin; Zhao, Pengpeng; Deng, Mingyong; Yan, Lili; Zhai, Pan; Wei, Zigong
2018-02-01
Streptococcus equi ssp. zooepidemicus (SEZ) is an important pathogen of swine streptococcal diseases and can infect a wide range of animals as well as human beings. The absence of effective vaccine confounds the control of SEZ infection. Sec_205, a novel protein identified in the previous study, was inducibly over-expressed in Escherichia coli in the present study. The purified recombinant protein could elicit a significant humoral antibody response and provide efficient protection against lethal challenge of SEZ C55138 in mouse model. The protection against SEZ infection was mediated by specific antibodies to Sec_205 to some extent and was identified by the passive protection assay. The Sec_205 was an in vivo-induced antigen confirmed by the real-time PCR and could adhere to the Hep-2 cells by the inhibition assay. These suggest that Sec_205 may play a vital role in pathogenicity and serve as a new vaccine candidate against SEZ infection. Copyright © 2018 Elsevier Ltd. All rights reserved.
41 CFR 50-205.1 - Purpose and scope.
2010-07-01
... health and safety of employees engaged in the performance of the contract, and the enforcement of the safety and health standards interpreting and applying that stipulation published in Part 50-204 of this... Contracts PUBLIC CONTRACTS, DEPARTMENT OF LABOR 205-ENFORCEMENT OF SAFETY AND HEALTH STANDARDS BY STATE...
33 CFR 401.205 - Civil and criminal penalties.
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Civil and criminal penalties. 401... § 401.205 Civil and criminal penalties. (a) If the violation of the Seaway Regulations carries a... criminal proceedings shall not bar the initiation of civil penalty proceedings by the Associate...
31 CFR 575.205 - Prohibited exportation and reexportation of goods, technology, or services to Iraq.
2010-07-01
... reexportation of goods, technology, or services to Iraq. 575.205 Section 575.205 Money and Finance: Treasury... goods, technology, or services to Iraq. Except as otherwise authorized, no goods, technology (including technical data or other information), or services may be exported from the United States, or, if subject to...
42 CFR 51b.605 - How will grant applications be evaluated and the grants awarded?
2010-10-01
... HUMAN SERVICES GRANTS PROJECT GRANTS FOR PREVENTIVE HEALTH SERVICES Grants for Research, Demonstrations... has potential to directly benefit the national venereal disease control effort? (2) Are the project...
ELIMED, future hadrontherapy applications of laser-accelerated beams
Czech Academy of Sciences Publication Activity Database
Cirrone, Giuseppe A.P.; Carpinelli, M.; Cuttone, G.; Gammino, S.; Jia, S.B.; Korn, Georg; Maggiore, Mario; Manti, L.; Margarone, Daniele; Prokůpek, Jan; Renis, M.; Romano, F.; Schillaci, Francesco; Tomasello, B.; Torrisi, L.; Tramontana, A.; Velyhan, Andriy
2013-01-01
Roč. 730, Dec (2013), s. 174-177 ISSN 0168-9002. [International Conference on Radiation Effects on Semiconductor Materials, Detectors and Devices /9./(RESMDD). Florence, 09.10.2012-12.10.2012] R&D Projects: GA ČR(CZ) GAP205/11/1165; GA MŠk ED1.1.00/02.0061; GA MŠk EE.2.3.20.0087 Grant - others:ELI Beamlines(XE) CZ.1.05/1.1.00/02.0061; OP VK 2 LaserGen(XE) CZ.1.07/2.3.00/20.0087 Institutional support: RVO:68378271 Keywords : laser acceleration * cancer treatment * particle selection * Monte Carlo simulation * beam handling Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.316, year: 2013
Wetland Program Development Grants (WPDGs)
U.S. Environmental Protection Agency — The Wetland Grant Database (WGD) houses grant data for Wetland Program Development Grants (created by EPA in 1990 under the Clean Water Act Section 104(b)(3)...
7 CFR 205.665 - Noncompliance procedure for certifying agents.
2010-01-01
... applicable State organic program's governing State official all records concerning its certification...) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Administrative Compliance § 205.665... agent. (f) Cessation of certification activities. A certifying agent whose accreditation is suspended or...
5 CFR 846.205 - Reconsideration and appeal rights.
2010-01-01
... circumstances beyond his or her control from making the request within the time limit. (d) OPM's decision. After... REGULATIONS (CONTINUED) FEDERAL EMPLOYEES RETIREMENT SYSTEM-ELECTIONS OF COVERAGE Elections § 846.205 Reconsideration and appeal rights. (a) Who may file. An individual may request OPM to reconsider a decision of an...
Economic Analyses and Potential Market of the 200MW Nuclear Heating Reactor
International Nuclear Information System (INIS)
Wang, Yongqing; Wang, Guiying
1992-01-01
Based on the 5MW experimental nuclear heating reactor, Intent has developed a 200MW demonstration nuclear heating reactor. Owing to its simplified systems and low operating parameters, the NCR-200 has preferable investment in comparison with that of a nuclear power plant. The pre-feasibility studies for several cities in Northern China have shown that the heat cost of a NCR-200 can be competitive with a coal fired heating plant. As a safe, clean and economic heat source, the NCR could pose a large market in replacement of coal for heating. The R and D work performed up to now has demonstrated that the NCR-200 operating under the present parameters can supply low pressure steam for industrial process and co-generation to enhance it economic benefit. The NCR-200 could also serve a heat source for air condition by using Li Br refrigerator, this application is very interesting to some cities in Central and Southern China. The applications of the NCR in oil recovery by injecting hot water and transportation are very promising for some oil fields in North China. In addition, the study on sea water desalination using the NCR-200 is being carried out at present under international cooperation. All of these will expansion the possible application of the NCR. The paper presents the economic analysis and the potential market of the NCR-200
14 CFR 67.205 - Ear, nose, throat, and equilibrium.
2010-01-01
... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Ear, nose, throat, and equilibrium. 67.205..., nose, throat, and equilibrium. Ear, nose, throat, and equilibrium standards for a second-class airman..., vertigo or a disturbance of equilibrium. ...
7 CFR 205.504 - Evidence of expertise and ability.
2010-01-01
... handling techniques; its ability to fully comply with and implement the organic certification program... SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Accreditation of Certifying Agents § 205.504 Evidence of...
21 CFR 99.205 - Application for exemption from the requirement to file a supplemental application.
2010-04-01
... minus the costs of goods sold and marketing and administrative expenses attributable to the new use of... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Application for exemption from the requirement to file a supplemental application. 99.205 Section 99.205 Food and Drugs FOOD AND DRUG ADMINISTRATION...
31 CFR 515.205 - Holding of certain types of blocked property in interest-bearing accounts.
2010-07-01
... property in interest-bearing accounts. 515.205 Section 515.205 Money and Finance: Treasury Regulations... interest-bearing accounts. (a) Except as provided by paragraphs (d), (e) and (f) of this section, or as... to any such property, unless it is held in an interest-bearing account in a domestic bank. (b) Any...
31 CFR 500.205 - Holding of certain types of blocked property in interest-bearing accounts.
2010-07-01
... property in interest-bearing accounts. 500.205 Section 500.205 Money and Finance: Treasury Regulations... interest-bearing accounts. (a) Except as provided by paragraphs (d), (e) and (f) of this section, or as... to any such property, unless it is held in an interest-bearing account in a domestic bank. (b) Any...
2010-07-01
... forfeited distilled spirits, wine, and beer to GSA for disposal? 102-41.205 Section 102-41.205 Public..., and Beer § 102-41.205 Do we report all forfeited distilled spirits, wine, and beer to GSA for disposal? (a) Yes, except do not report distilled spirits, wine, and beer not fit for human consumption or for...
207Pb and 205Tl NMR on Perovskite Type Crystals APbX3 (A = Cs, Tl, X = Br, I)
Sharma, Surendra; Weiden, Norbert; Weiss, Alarich
1987-11-01
By 205Tl and 207Pb NM R the chemical shift in polycrystalline samples of binary halides AX, BX2 and ternary halides ABX3 (A = Cs, Tl; B = Pb; X = Br, I) was studied at room temperature. The chemical shift tensors δ ( 205Tl) and δ (207Pb) were determined in magnitude and orientation on single crystals of the orthorhombic TlPbI3. The components of the δ(205Tl) tensor are δx (205Tl) || a = 611ppm; δy (205Tl) || b = 680 ppm; δZ(205Tl) || c = 1329 ppm; δiso(205Tl) = 873.3 ppm (with respect to 3.4 molar aqueous solution of TlOOCCH3). The chemical shift tensor of 207Pb in TlPbI3 shows two orientations. One of them is: δx (207Pb) = 3760 ppm, inclined 30° from b towards c, δy(207Pb) || a = 3485 ppm, δz(207Pb) = 2639 ppm inclined 120° from b towards c. δiso(207Pb) = 3295 ppm (with respect to saturated aqueous solution of Pb(NO3)2). The results are discussed with respect to the crystal structure and a model to explain orientation and anisotropy of the tensors δ(205Tl) and δ(207Pb) in TlPbI3 is proposed. In the system CsPbBr3-x Ix δ(207Pb) was studied on polycrystalline samples. The chemical shift increases with increasing x and negative excess shift is observed.
Directory of Open Access Journals (Sweden)
Molly Rosenberg
Full Text Available Social protection programs issuing cash grants to caregivers of young children may influence fertility. Grant-related income could foster economic independence and/or increase access to job prospects, education, and health services, resulting in lower pregnancy rates. In the other direction, these programs may motivate family expansion in order to receive larger grants. Here, we estimate the net effect of these countervailing mechanisms among rural South African women.We constructed a retrospective cohort of 4845 women who first became eligible for the Child Support Grant with the birth of their first child between 1998 and 2008, with data originally collected by the Agincourt Health and Socio-Demographic Surveillance System in Mpumalanga province, South Africa. We fit Cox regression models to estimate the hazard of second pregnancy in women who reported grant receipt after birth of first child, relative to non-recipients. As a secondary analysis to explore the potential for grant loss to incentivize second pregnancy, we exploited a natural experiment created by a 2003 expansion of the program's age eligibility criterion from age seven to nine. We compared second pregnancy rates between (i women with children age seven or eight in 2002 (recently aged out of grant eligibility to (ii women with children age seven or eight in 2003 (remained grant-eligible.The adjusted hazard ratio for the association between grant exposure and second pregnancy was 0.66 (95% CI: 0.58, 0.75. Women with first children who aged out of grant eligibility in 2002 had similar second pregnancy rates to women with first children who remained grant-eligible in 2003 [IRR (95% CI: 0.9 (0.5, 1.4].Across both primary and secondary analyses, we found no evidence that the Child Support Grant incentivizes pregnancy. In harmony with South African population policy, receipt of the Child Support Grant may result in longer spacing between pregnancies.
32 CFR 28.205 - Professional and technical services.
2010-07-01
... or technical discipline. For example, drafting of a legal document accompanying a bid or proposal by... 32 National Defense 1 2010-07-01 2010-07-01 false Professional and technical services. 28.205... technical services. (a) The prohibition on the use of appropriated funds, in § 28.100 (a), does not apply in...
48 CFR 731.205-70 - Overseas recruitment incentive.
2010-10-01
... Organizations 731.205-70 Overseas recruitment incentive. Note: the term employee as used in this section means... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Overseas recruitment... of the U.S. Internal Revenue Code (26 U.S.C. 911), such employee is eligible to receive an overseas...
Effect of Sb and Si doping on the superconducting properties of FeSe0.9
International Nuclear Information System (INIS)
Sudesh,; Rani, S.; Varma, G.D.
2013-01-01
Highlights: ► We synthesized all the samples using two-step solid state reaction method. ► Si and Sb doping is done at the Se site of the compound FeSe 0.9 . ► H c2 (0) is calculated with GL-Fit and also using WHH model. ► Behavior of activation energy is studied with applied field. -- Abstract: In the present work, we have studied the effect of doping Sb and Si at the Se-site of FeSe 0.9 on the superconducting properties, such as transition temperature (T c ), upper critical field (H c2 ) and irreversibility field (H irr ). The polycrystalline samples have been synthesized via two step solid state reaction route with nominal compositions Fe[Se 1−x (Sb/Si) x ] 0.9 (x = 0.0, 0.05, 0.10, 0.15 and 0.20). The X-ray diffraction results show the presence of tetragonal α-FeSe phase with the P4/nmm space group symmetry in all the samples. The highest superconducting onset temperatures, T c onset ∼9.42Kand9.20K, respectively, for Si and Sb doped samples have been found for x = 0.05. The temperature dependence of H c2 (T) and H irr (T) have been calculated from the magnetoresistance data using the criteria of 90% and 10% of normal state resistivity (ρ n ) values, respectively. The values of H c2 (0) estimated from Werthamer–Helfand–Hohenberg (WHH) and Ginzburg–Landau (GL) theories are found to follow the same trends and maximum H c2 (0) is found for the composition x = 0.10 for both the Si and Sb doped samples. The irreversibility field, H irr and activation energy, U 0 have also been calculated to study the vortex motion behavior of the samples. A clear cut correlation between H irr and U 0 has been found
2010-10-01
... beneficiaries for food stamps or surplus commodities. 205.25 Section 205.25 Public Welfare Regulations Relating....25 Eligibility of supplemental security income beneficiaries for food stamps or surplus commodities... XVI of the Social Security Act, the State agency shall make the following determinations: (1) The...
Superfund Technical Assistance Grants
U.S. Environmental Protection Agency — This asset includes data related to the Superfund Technical Assistance Grant program, including grant number, award amounts, award dates, period of performance,...
Fabrication and Thermoelectric Properties of n-Type CoSb2.85Te0.15 Using Selective Laser Melting.
Yan, Yonggao; Ke, Hongquan; Yang, Jihui; Uher, Ctirad; Tang, Xinfeng
2018-04-25
We report a nonequilibrium fabrication method of n-type CoSb 2.85 Te 0.15 skutterudites using selective laser melting (SLM) technology. A powder of CoSb 2.85 Te 0.15 was prepared by self-propagating high-temperature synthesis (SHS) and served as the raw material for the SLM process. The effect of SLM processing parameters such as the laser power and scanning speed on the quality of the forming CoSb 2.85 Te 0.15 thin layers was systematically analyzed, and the optimal processing window for SLM was determined. A brief postannealing at 450 °C for 4 h, following the SLM process, has resulted in a phase-pure CoSb 2.85 Te 0.15 bulk material deposited on a Ti substrate. The Seebeck coefficient of the annealed SLM prepared bulk material is close to that of the sample prepared by the traditional sintering method, and its maximum ZT value reached 0.56 at 823 K. Moreover, a Ti-Co-Sb ternary compound transition layer of about 70 μm in thickness was found at a dense interface between CoSb 2.85 Te 0.15 and the Ti substrate. The contact resistivity was measured as 37.1 μΩcm 2 . The results demonstrate that SLM, coupled with postannealing, can be used for fabrication of incongruently melting skutterudite compounds on heterogeneous substrates. This lays an important foundation for the follow-up research utilizing energy efficient SHS and SLM processes in rapid printing of thermoelectric modules.
Registration of 'CP 09-2392' Sugarcane
CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...
El-Boghdadly, K; Docherty, A B; Klein, A A
2018-06-01
The National Institute of Academic Anaesthesia (NIAA) was founded in 2008 to lead a UK strategy for developing academic anaesthesia. We aimed to assess the distribution of applications and quantify the academic returns of NIAA-supported research grants, as this has hitherto not been analysed. We sought data on the baseline characteristics of all grant applicants and recipients. Every grant recipient from 2008 to 2015 was contacted to ascertain the status of their supported research projects. We also examined Google Scholar, Scopus ® database and InCites Journal Citation Reports for citation, author and journal metrics, respectively. In total, 495 research project applications were made, with 150 grants being awarded. Data on 121 out of 150 (80.7%) grant awards, accounting for £3.5 million, were collected, of which 91 completed studies resulted in 140 publications and 2759 citations. The median (IQR [range]) time to first or only publication was 3 (2-4 [0-9]) years. The overall cost per publication was £14,970 (£7457-£24,998 [£2212-£73,755]) and the cost per citation was £1515 (£323-£3785 [£70-£36,182]), with 1 (0-2 [0-8]) publication and 4 (0-25 [0-265]) citations resulting per grant. The impact factor of journals in which publications arose was 4.7 (2.5-6.2 [0-47.8]), with the highest impact arising from clinical and basic science studies, particularly in the fields of pain and peri-operative medicine. Grants were most frequently awarded to clinical and basic science categories of study, but in terms of specialty, critical care medicine and peri-operative medicine received the greatest number of grants. Superficially, there seemed a geographical disparity, with 123 (82%) grants being awarded to researchers in England, London receiving 48 (32%) of these. However, this was in proportion to the number of grant applications received by country or city of application, such that there was no significant difference in overall success rates. There was no
19 CFR 205.6 - Investigations under section 301(e)(3) of the Trade Act of 1974.
2010-04-01
... Trade Act of 1974. 205.6 Section 205.6 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION...) INTERNATIONAL TRADE OR OF TAKING RETALIATORY ACTIONS TO OBTAIN THE ELIMINATION OF UNJUSTIFIABLE OR UNREASONABLE FOREIGN ACTS OR POLICIES WHICH RESTRICT U.S. COMMERCE Investigations Concerning the Probable Impact on the...
Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds
International Nuclear Information System (INIS)
Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.
2007-01-01
The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound
Czech Academy of Sciences Publication Activity Database
Gunár, Stanislav; Parenti, S.; Anzer, U.; Heinzel, Petr; Vial, J. C.
2011-01-01
Roč. 535, November (2011), A122/1-A122/11 ISSN 0004-6361 R&D Projects: GA ČR GP205/09/P554; GA ČR GA205/09/1705; GA ČR GAP209/10/1706 Institutional research plan: CEZ:AV0Z10030501 Keywords : Sun * filaments * prominences Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.587, year: 2011
DEFF Research Database (Denmark)
Schroter, Sara; Groves, Trish; Højgaard, Liselotte
2010-01-01
The objectives of this research were (a) to describe the current status of grant review for biomedical projects and programmes from the perspectives of international funding organisations and grant reviewers, and (b) to explore funders' interest in developing uniform requirements for grant review...
48 CFR 1631.205-78 - FEHBP printed material costs.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true FEHBP printed material... carrier orders printed material that is available from the Government Printing Office (GPO) under the... COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1631.205-78 FEHBP printed...
Zhao, Xiaomeng; Zhang, Yang; Guan, Min; Cui, Lijie; Wang, Baoqiang; Zhu, Zhanping; Zeng, Yiping
2017-07-01
The effect of InSb/In0.9Al0.1Sb buffer layers on InSb thin films grown on GaAs (0 0 1) substrate by molecular beam epitaxy (MBE) is investigated. The crystal quality and the surface morphology of InSb are characterized by XRD and AFM. The carrier transport property is researched through variable temperature hall test. The sharp interface between InSb/In0.9Al0.1Sb is demonstrated important for the high quality InSb thin film. We try different superlattice buffer layers by changing ratios, 2-0.5, thickness, 300-450 nm, and periods, 20-50. According to the function of the dislocation density to the absolute temperature below 150 K with different periods of SL buffers, we can find that the number of periods of superlattice is a major factor to decrease the density of threading dislocations. With the 50 periods SL buffer layer, the electron mobility of InSb at the room temperature and liquid nitrogen cooling temperature is ∼63,000 and ∼4600 cm2/V s, respectively. We deduce that the interface in the SL structure works as a filter layer to prevent the dislocation propagating to the upper InSb thin films.
41 CFR 101-27.205 - Shelf-life codes.
2010-07-01
... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Shelf-life codes. 101-27...-Management of Shelf-Life Materials § 101-27.205 Shelf-life codes. Shelf-life items shall be identified by use of a one-digit code to provide for uniform coding of shelf-life materials by all agencies. (a) The...
Force to Fail Reactions With Monoethanolamine: Application to the Explosive Destruction System
2014-02-01
200 20 0.16 0.18 0.19 NA a 0.15 0.14 0.17 NAa 1000 300 30 0.49 0.29 0.19 NA a 0.54 0.31 0.32 NAa 1000 400 40 2.04 0.54 0.41 NA a 1.56 0.95 0.54... NAa 1000 500 50 1.95 1.11 0.89 0.96 1.57 0.97 0.81 0.93 1000 600 60 1.48 1.25 0.81 0.79 1.35 1.08 0.85 0.85 1000 700 70 2.61 1.84 1.74 1.61 2.39 1.97...mg/L) 2 h 4 h 6 h 24 h 1000 200 20 0.09 0.09 0.15 NAa 0.11 0.09 0.10 NAa 1000 300 30 0.15 0.17 0.14 NAa 0.15 0.15 0.15 NAa 1000 400 40 0.33
Mohrman, Kathryn, Ed.
Each of 13 authors, all experienced in obtaining grants, examines a separate element of the grantsgetting process. The essays include: The Characteristics of an Effective Grants Officer (Julia B. Leverenz); The Grants Office (Morton Cooper); Working with the Academic Dean (Robert C. Nordvall); Working with the Development Office (Barbara A.…
Wang, Wei; Wang, Huasheng; Hu, Hongbo; Peng, Huasong; Zhang, Xuehong
2015-05-01
As a global regulatory gene in Streptomyces, afsR can activate the biosynthesis of many secondary metabolites. The effect of afsR on the biosynthesis of a phenazine metabolite, lomofungin, was studied in Streptomyces lomondensis S015. There was a 2.5-fold increase of lomofungin production in the afsR-overexpressing strain of S. lomondensis S015 N1 compared with the wild-type strain. Meanwhile, the transcription levels of afsR and two important genes involved in the biosynthesis of lomofungin (i.e., phzC and phzE) were significantly upregulated in S. lomondensis S015 N1. The optimization of metal chlorides was investigated to further increase the production of lomofungin in the afsR-overexpressing strain. The addition of different metal chlorides to S. lomondensis S015 N1 cultivations showed that CaCl2, FeCl2, and MnCl2 led to an increase in lomofungin biosynthesis. The optimum concentrations of these metal chlorides were obtained using response surface methodology. CaCl2 (0.04 mM), FeCl2 (0.33 mM), and MnCl2 (0.38 mM) gave a maximum lomofungin production titer of 318.0 ± 10.7 mg/l, which was a 4.1-fold increase compared with that of S. lomondensis S015 N1 without the addition of a metal chloride. This work demonstrates that the biosynthesis of phenazine metabolites can be induced by afsR. The results also indicate that metal chlorides addition might be a simple and useful strategy for improving the production of other phenazine metabolites in Streptomyces.
41 CFR 301-75.205 - Is the interviewee required to submit a travel claim to us?
2010-07-01
... required to submit a travel claim to us? 301-75.205 Section 301-75.205 Public Contracts and Property Management Federal Travel Regulation System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES AGENCY RESPONSIBILITIES 75... reimbursed, then he or she must submit a travel claim in accordance with your agency procedures in order to...
This tutorial will help give your organization a broad but succinct analysis of what the SRA grant program is about. This self-paced tutorial is organized under two segments: Overview of Grant Program and Program Details.
Influence of Dy addition on the magnetocaloric effect of La0.67Ca0.33Mn0.9V0.1O3 ceramics
International Nuclear Information System (INIS)
Nisha, P.; Savitha Pillai, S.; Suresh, K.G.; Raama Varma, Manoj
2012-01-01
The influence of partial substitution of La by Dy on the magnetocaloric response of (La 1-x Dy x ) 0.67 Ca 0.33 Mn 0.9 V 0.1 O 3 , where x=0.03, 0.15 and 0.25 is studied. Rietveld refinement of X-ray diffraction pattern using GSAS method shows that the compounds adopt the orthorhombic structure with Pnma space group. The systematic change in lattice parameters and magnetic phase transition indicates the substitution effect of Dy. From the magnetization isotherms at different temperatures, magnetic entropy change close to their respective transition temperatures (T C ) has been evaluated. The maximum value of entropy change near T C is found to be about 4.8 J/kg K at 187.5 K for LCMVDy 0.03 , 2.45 J/kg K at 107.5 K for LCMVDy 0.15 and 2.15 J/kg K at 92.5 K for LCMVDy 0.25 at 4 T. Dy addition produces a reduction in T C and in magnitude of the magnetic entropy change. Even though the entropy change decreases with increasing Dy substitution the refrigerant temperature range, ΔT, is found to be 10 K for LCMVDy 0.03 , 31 K for LCMVDy 0.15 and 35 K for LCMVDy 0.25 compounds [90%] at 4 T. The field dependence of the magnetic entropy change is also analyzed showing the power law dependence, ΔS M ∞H n where n=0.75(2) for LCMVDy 0.03 , n=0.80(4) for LCMVDy 0.15 and n=0.92(8) for LCMVDy 0.25 compounds at their respective transition temperatures. The relative cooling power and its field dependance are also analyzed. - Highlights: → Studied magnetocaloric response of Dy substituted solid state synthesized LCMVO. → Studied the field dependence of the magnetic entropy change (ΔS M ∞H n ). → Studied the field dependence of Relative cooling power (RCP∞H 1+1/δ ). → Considerably large magnetocaloric effect and moderate relative cooling power.
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.
Energy Technology Data Exchange (ETDEWEB)
Han, Ru-shuai; Qi, Li-qian; Hou, Xue; Liu, Li-hu; Liu, Hui-yuan [College of Physics Science & Information Engineering, Hebei Normal University, Shijiazhuang 050024 (China); Key Laboratory of Advanced Films of Hebei Province, Shijiazhuang, Hebei 050024 (China); Xian, Xiao-Ning [Department of Information technology, Yuncheng Agricultural College, Shanxi 044000 (China); Guo, Ge-Xin [College of Physics Science & Information Engineering, Hebei Normal University, Shijiazhuang 050024 (China); Key Laboratory of Advanced Films of Hebei Province, Shijiazhuang, Hebei 050024 (China); Sun, Hui-yuan, E-mail: huiyuansun@126.com [College of Physics Science & Information Engineering, Hebei Normal University, Shijiazhuang 050024 (China); Key Laboratory of Advanced Films of Hebei Province, Shijiazhuang, Hebei 050024 (China)
2016-12-15
In this work, a solid phase reaction method was used to fabricate (1−x)Bi{sub 0.85}La{sub 0.15}FeO{sub 3}–xCoFe{sub 2}O{sub 4} (x=0.1, 0.2, 0.3, 0.4) composite powders. X-ray diffraction patterns showed that no chemical reaction occurred between the separate Bi{sub 0.85}La{sub 0.15}FeO{sub 3} and CoFe{sub 2}O{sub 4} phases and indicated that the powder samples had two distinct phases with a CoFe{sub 2}O{sub 4} spinel phase and a Bi{sub 0.85}La{sub 0.15}FeO{sub 3} perovskite phase. The average crystallite sizes of the Bi{sub 0.85}La{sub 0.15}FeO{sub 3} in the composite powder were almost unchanged as the CoFe{sub 2}O{sub 4} content was increased. By comparing the experimental and theoretical values for the magnetization, we found that the Bi{sub 0.85}La{sub 0.15}FeO{sub 3} phase contributed to the magnetization of the composite powders. In addition, it also provides a new way to prove the existence of magnetoelectric coupling in the sample. - Highlights: • Theoretical magnetic value of the samples was calculated. • The experimental value of the magnetism was greater than the theoretical value. • The effect of the crystallite sizes on the magnetism was eliminated by calculating the crystallite sizes of BLFO. • The BLFO contributed to the magnetic moment through the magnetoelectric coupling.
Ulysses S. Grant and Reconstruction.
Wilson, David L.
1989-01-01
Discusses the role played by Ulysses S. Grant during the four years of Reconstruction before he became President of the United States. Describes the dynamics of the relationship between Grant and Andrew Johnson. Points out that Grant's attitude of service to the laws created by Congress submerged his desire to create a new South. (KO)
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...
Structural studies of Nd1.85Ce0.15CuO4 + Ag superconducting ...
Indian Academy of Sciences (India)
Nd1.85Ce0.15CuO4, on its crystal structure and local structural features, using synchrotron X-ray diffraction. (SXRD) and ..... extended X-ray absorption fine structure (EXAFS). ... [1] Zhang and Chongmin 1991 Thesis, University of British.
Unconventional superconductivity in CaFe0.85Co0.15AsF evidenced by torque measurements
Xiao, Hong; Li, X. J.; Mu, G.; Hu, T.
Out-of-plane angular dependent torque measurements were performed on CaFe0.85Co0.15AsF single crystals. Abnormal superconducting fluctuation, featured by enhanced diamagnetism with magnetic field, is detected up to about 1.5 times superconducting transition temperature Tc. Compared to cuprate superconductors, the fluctuation effect in iron-based superconductor is less pronounced. Anisotropy parameter γ is obtained from the mixed state torque data and it is found that γ shows both magnetic field and temperature depenence, pointing to multiband superconductivity. The temperature dependence of penetration depth λ (T) suggests unconventional superconductivity in CaFe0.85Co0.15AsF.
48 CFR 1631.205-74 - FEHBP losses on other contracts.
2010-10-01
... carry forward” principle that is fundamental to continuing insurance contracts that are based on... MANAGEMENT FEDERAL EMPLOYEES HEALTH BENEFITS ACQUISITION REGULATION GENERAL CONTRACTING REQUIREMENTS CONTRACT COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1631.205-74 FEHBP losses on...
DEFF Research Database (Denmark)
Cheng, Shiyang; Chatzichristodoulou, Christodoulos; Søgaard, Martin
2017-01-01
Pr. A series of compositions of PrxGd0.1Ce0.9-xO1.95-δ (x = 0, 0.02, 0.05, 0.08, 0.15, 0.25, 0.3 and 0.4) was prepared by solid state reaction. X-ray powder diffraction (XPD) indicates that Pr is completely dissolved in the fluorite structure up to 40 at.%. Pronounced nonlinear thermal expansion...... behavior was observed as a function of temperature, due to the simultaneous contributions of both thermal and chemical expansion. The electronic and ionic conductivities were measured as a function of temperature and oxygen partial pressure. Within the range from 10 to 15 at.% Pr, a drastic drop...
QPM Analysis of 205Tl Nuclear Excitations below the Giant Dipole Resonance
Directory of Open Access Journals (Sweden)
Benouaret N.
2015-01-01
Full Text Available We analysed our experimental recent findings of the dipole response of the odd-mass stable nucleus 205Tl within the quasi-particle phonon model. Using the phonon basis constructed for the neighbouring 204Hg and wave function configurations for 205Tl consisting of a mixture of quasiparticle ⊗ N-phonon configurations (N=0,1,2, only one group of fragmented dipole excited states has been reproduced at 5.5 MeV in comparison to the experimental distribution which shows a second group at about 5 MeV. The computed dipole transition strengths are mainly of E1 character which could be associated to the pygmy dipole resonance.
QPM Analysis of 205Tl Nuclear Excitations below the Giant Dipole Resonance
Benouaret, N.; Beller, J.; Isaak, J.; Kelley, J. H.; Pai, H.; Pietralla, N.; Ponomarev, V. Yu.; Raut, R.; Romig, C.; Rusev, G.; Savran, D.; Scheck, M.; Schnorrenberger, L.; Sonnabend, K.; Tonchev, A. P.; Tornow, W.; Weller, H. R.; Zweidinger, M.
2015-05-01
We analysed our experimental recent findings of the dipole response of the odd-mass stable nucleus 205Tl within the quasi-particle phonon model. Using the phonon basis constructed for the neighbouring 204Hg and wave function configurations for 205Tl consisting of a mixture of quasiparticle ⊗ N-phonon configurations (N=0,1,2), only one group of fragmented dipole excited states has been reproduced at 5.5 MeV in comparison to the experimental distribution which shows a second group at about 5 MeV. The computed dipole transition strengths are mainly of E1 character which could be associated to the pygmy dipole resonance.
Yang, Jing-Jing; Wang, Gang; Du, Wen-Han; Xiong, Chao
2017-07-01
The electrical transport properties are the key factors to determine the performance of ZnO-based quantum effect device. ZnMgO is a typical material to regulate the band of ZnO. In order to investigate the electrical properties of the interface of ZnO/Zn0.85Mg0.15O films, three kinds of ZnO/Zn0.85Mg0.15O films have been fabricated with different thickness. After comparing the structural and electrical properties of the samples, we found that the independent Zn0.85Mg0.15O hexagonal wurtzite structure (002) peak can be detected in XRD spectra. Hall-effect test data confirmed that the two-dimensional electron gas (2DEG) became lower because of the decrease of thickness of Zn0.85Mg0.15O films, increase of impurity scattering and lattice structure distortion caused by the increase of Mg content.
Measurement of $V^0$ production ratios in $pp$ collisions at $\\sqrt{s}$ = 0.9 and 7 TeV
Aaij, R.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Alkhazov, G.; Alvarez Cartelle, P.; Alves Jr, A.A.; Amato, S.; Amhis, Y.; Anderson, J.; Appleby, R.B.; Aquines Gutierrez, O.; Arrabito, L.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Bachmann, S.; Back, J.J.; Bailey, D.S.; Balagura, V.; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Bates, A.; Bauer, C.; Bauer, Th.; Bay, A.; Bediaga, I.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Benayoun, M.; Bencivenni, G.; Benson, S.; Bernet, R.; Bettler, M.O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bizzeti, A.; Bjornstad, P.M.; Blake, T.; Blanc, F.; Blanks, C.; Blouw, J.; Blusk, S.; Bobrov, A.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T.J.V.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Brisbane, S.; Britsch, M.; Britton, T.; Brook, N.H.; Buchler-Germann, A.; Burducea, I.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Caicedo Carvajal, J.M.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cattaneo, M.; Charles, M.; Charpentier, Ph.; Chiapolini, N.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Collins, P.; Constantin, F.; Conti, G.; Contu, A.; Coombes, M.; Corti, G.; Cowan, G.A.; Currie, R.; D'Almagne, B.; D'Ambrosio, C.; David, P.; De Bonis, I.; De Capua, S.; De Cian, M.; De Lorenzi, F.; De Miranda, J.M.; De Paula, L.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Degaudenzi, H.; Deissenroth, M.; Del Buono, L.; Deplano, C.; Deschamps, O.; Dettori, F.; Dickens, J.; Dijkstra, H.; Diniz Batista, P.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Dzhelyadin, R.; Eames, C.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisele, F.; Eisenhardt, S.; Ekelhof, R.; Eklund, L.; Elsasser, Ch.; d'Enterria, D.G.; Esperante Pereira, D.; Esteve, L.; Falabella, A.; Fanchini, E.; Farber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Fave, V.; Fernandez Albor, V.; Ferro-Luzzi, M.; Filippov, S.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garnier, J-C.; Garofoli, J.; Garra Tico, J.; Garrido, L.; Gaspar, C.; Gauvin, N.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Gligorov, V.V.; Gobel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gordon, H.; Grabalosa Gandara, M.; Graciani Diaz, R.; Granado Cardoso, L.A.; Grauges, E.; Graziani, G.; Grecu, A.; Gregson, S.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Haefeli, G.; Haen, C.; Haines, S.C.; Hampson, T.; Hansmann-Menzemer, S.; Harji, R.; Harnew, N.; Harrison, J.; Harrison, P.F.; He, J.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J.A.; van Herwijnen, E.; Hofmann, W.; Holubyev, K.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Huston, R.S.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Ilten, P.; Imong, J.; Jacobsson, R.; Jaeger, A.; Jahjah Hussein, M.; Jans, E.; Jansen, F.; Jaton, P.; Jean-Marie, B.; Jing, F.; John, M.; Johnson, D.; Jones, C.R.; Jost, B.; Kandybei, S.; Karacson, M.; Karbach, T.M.; Keaveney, J.; Kerzel, U.; Ketel, T.; Keune, A.; Khanji, B.; Kim, Y.M.; Knecht, M.; Koblitz, S.; Koppenburg, P.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kruzelecki, K.; Kucharczyk, M.; Kukulak, S.; Kumar, R.; Kvaratskheliya, T.; La Thi, V.N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R.W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Le Gac, R.; van Leerdam, J.; Lees, J.P.; Lefevre, R.; Leflat, A.; Lefrancois, J.; Leroy, O.; Lesiak, T.; Li, L.; Li, Y.Y.; Li Gioi, L.; Lieng, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lopes, J.H.; Lopez Asamar, E.; Lopez-March, N.; Luisier, J.; Machefert, F.; Machikhiliyan, I.V.; Maciuc, F.; Maev, O.; Magnin, J.; Malde, S.; Mamunur, R.M.D.; Manca, G.; Mancinelli, G.; Mangiafave, N.; Marconi, U.; Marki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martin, L.; Martin Sanchez, A.; Martinez Santos, D.; Massafferri, A.; Mathe, Z.; Matteuzzi, C.; Matveev, M.; Maurice, E.; Maynard, B.; Mazurov, A.; McGregor, G.; McNulty, R.; Mclean, C.; Meissner, M.; Merk, M.; Merkel, J.; Messi, R.; Miglioranzi, S.; Milanes, D.A.; Minard, M.N.; Monteil, S.; Moran, D.; Morawski, P.; Morris, J.V.; Mountain, R.; Mous, I.; Muheim, F.; Muller, K.; Muresan, R.; Muryn, B.; Musy, M.; Naik, P.; Nakada, T.; Nandakumar, R.; Nardulli, J.; Nasteva, I.; Nedos, M.; Needham, M.; Neufeld, N.; Nguyen-Mau, C.; Nicol, M.; Nies, S.; Niess, V.; Nikitin, N.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J.M.; Owen, P.; Pal, B.; Palacios, J.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C.J.; Passaleva, G.; Patel, G.D.; Patel, M.; Paterson, S.K.; Patrick, G.N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perego, D.L.; Perez Trigo, E.; Perez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pessina, G.; Petrella, A.; Petrolini, A.; Pie Valls, B.; Pietrzyk, B.; Pilar, T.; Pinci, D.; Plackett, R.; Playfer, S.; Plo Casasus, M.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; Pree, T.du; Prisciandaro, J.; Pugatch, V.; Puig Navarro, A.; Qian, W.; Rademacker, J.H.; Rakotomiaramanana, B.; Raniuk, I.; Raven, G.; Redford, S.; Reid, M.M.; Reis, A.C.dos; Ricciardi, S.; Rinnert, K.; Roa Romero, D.A.; Robbe, P.; Rodrigues, E.; Rodrigues, F.; Rodriguez Perez, P.; Rogers, G.J.; Romanovsky, V.; Rouvinet, J.; Ruf, T.; Ruiz, H.; Sabatino, G.; Saborido Silva, J.J.; Sagidova, N.; Sail, P.; Saitta, B.; Salzmann, C.; Sannino, M.; Santacesaria, R.; Santinelli, R.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schleich, S.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.H.; Schwemmer, R.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shao, B.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Skottowe, H.P.; Skwarnicki, T.; Smith, A.C.; Smith, N.A.; Sobczak, K.; Soler, F.J.P.; Solomin, A.; Soomro, F.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Styles, N.; Swientek, S.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Topp-Joergensen, S.; Tran, M.T.; Tsaregorodtsev, A.; Tuning, N.; Ukleja, A.; Urquijo, P.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; Velthuis, J.J.; Veltri, M.; Vervink, K.; Viaud, B.; Videau, I.; Vilasis-Cardona, X.; Visniakov, J.; Vollhardt, A.; Voong, D.; Vorobyev, A.; Voss, H.; Wacker, K.; Wandernoth, S.; Wang, J.; Ward, D.R.; Webber, A.D.; Websdale, D.; Whitehead, M.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, F.F.; Wishahi, J.; Witek, M.; Witzeling, W.; Wotton, S.A.; Wyllie, K.; Xie, Y.; Xing, F.; Yang, Z.; Young, R.; Yushchenko, O.; Zavertyaev, M.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zhong, L.; Zverev, E.
2011-01-01
The $\\bar{\\Lambda} / \\Lambda$ and $\\bar{\\Lambda} / K^0_\\mathrm{S}$ production ratios are measured by the LHCb detector from $0.3\\,\\mathrm{nb}^{-1}$ of $pp$ collisions delivered by the LHC at $\\sqrt{s} = 0.9$\\,TeV and $1.8\\,\\mathrm{nb}^{-1}$ at $\\sqrt{s} = 7$\\,TeV. Both ratios are presented as a function of transverse momentum, $p_\\mathrm{T}$, and rapidity, $y$, in the ranges {$0.15 < p_\\mathrm{T} < 2.50\\,\\mathrm{GeV}/c$} and {$2.0
41 CFR 101-6.205-4 - Applicability of assurances.
2010-07-01
... of higher education, hospital, or any other institution, insofar as the assurance relates to the... benefits to such individuals, shall be applicable to the entire institution. (c) Where an installation or... required under this § 101-6.205 shall be applicable to the entire installation or facility. [29 FR 16287...
5 CFR 2635.205 - Proper disposition of prohibited gifts.
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Proper disposition of prohibited gifts... STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE EXECUTIVE BRANCH Gifts From Outside Sources § 2635.205 Proper disposition of prohibited gifts. (a) An employee who has received a gift that cannot be accepted...
International Nuclear Information System (INIS)
Beltracchi, L.
1994-01-01
This paper identifies and describes safety issues related to the design, development, and qualification of reliable digital computer systems for nuclear power plants. It also describes the U.S. Nuclear Regulatory Commission's research program on these issues. The paper discusses an evaluation of the initial standards for hard-wired based safety systems. The lessons learned in developing these standards provides guidance in the design and use of digital technology in nuclear power plants. Also, this evaluation discusses how the content of the standards should lead to a framework of design criteria and the related acceptance criteria that can be used for computer-based safety systems. The opinions and viewpoints expressed herein are the author's personal ones and they do not necessarily reflect the criteria, requirements, and guidelines of the U.S. Nuclear Regulatory Commission (NRC)
Noguchi, K; Matsuzaki, T; Ojiri, Y; Koyama, T; Nakasone, J; Sakanashi, M
1998-01-01
Comparative hemodynamic effects of nicorandil (NCR), nitroglycerin (NTG) and cromakalim (CRM) were examined in a canine model of acute congestive heart failure (CHF). CHF was produced by injections of saponin into coronary arteries of anesthetized dogs followed by volume loading and continuous i.v. infusion of methoxamine. After the treatment, aortic blood flow (AoF), left ventricular dP/dt and myocardial segment shortening (SS) markedly decreased, while the left ventricular end-diastolic pressure (LVEDP), the right atrial pressure (RAP) and the systemic vascular resistance (SVR) increased. NCR (n = 6), NTG (n = 6) and CRM (n = 8), which were administered i.v. after production of CHF, caused a comparable reduction in LVEDP. NCR and CRM profoundly increased AoF and SS but NTG did only slightly. On the other hand, NTG and NCR but not CRM significantly reduced RAP. Intracoronary NCR (n = 8) exerted no or similar effects on SS as well as systemic hemodynamic indices to those observed with i.v. NCR despite distinct coronary vasodilation. These results indicate that NCR may exert beneficial hemodynamic effects in an experimental CHF mainly due to lessening both afterload and preload rather than the coronary vasodilating effect.
Bulk and nanocrystalline electron doped Gd0.15Ca0.85MnO3: Synthesis and magnetic characterization
Dhal, Lakshman; Chattarpal; Nirmala, R.; Santhosh, P. N.; Kumary, T. Geetha; Nigam, A. K.
2014-09-01
Polycrystalline Gd0.15Ca0.85MnO3 sample was prepared by solid state reaction method and nanocrystalline samples of different grain sizes of the same were prepared by sol-gel method. Phase purity and composition were verified by room temperature X-ray diffraction and SEM-EDAX analysis. Magnetization data of bulk Gd0.15Ca0.85MnO3 in 5 kOe field shows a peak at 119 K (TN) suggesting an antiferromagnetic transition. Nanocrystalline Gd0.15Ca0.85MnO3 sample ( 54 nm size) also shows a cusp at 107 K and a broad thermal hysteresis between field cooled cooling (FCC) and field cooled warming (FCW) data around this temperature. This thermal hysteresis suggests possible crystal structural transition. Field variation of magnetization of bulk Gd0.15Ca0.85MnO3 at 5 K shows a tendency to saturate, but yields a magnetic moment value of only 1.12 μB/f.u. in 70 kOe. The value of magnetization of nanocrystalline sample at 5 K in 70 kOe field is slightly larger and is 1.38 μB/f.u. which is probably due to the surface moments of the nanoparticle samples. Both the samples show Curie-Weiss-like behaviour in their paramagnetic state.
Wadwa, Munisch; Klopfleisch, Robert; Buer, Jan; Westendorf, Astrid M.
2016-01-01
The endocytotic c-type lectin receptor DEC-205 is highly expressed on immature dendritic cells. In previous studies, it was shown that antigen-targeting to DEC-205 is a useful tool for the induction of antigen-specific Foxp3+ regulatory T cells and thereby can prevent inflammatory processes. However, whether this approach is sufficient to mediate tolerance in mucosal tissues like the gut is unknown. In this study, we established a new mouse model in which the adoptive transfer of naive hemagglutinin (HA)-specific CD4+Foxp3– T cells into VILLIN-HA transgenic mice leads to severe colitis. To analyze if antigen-targeting to DEC-205 could protect against inflammation of the gut, VILLIN-HA transgenic mice were injected with an antibody–antigen complex consisting of the immunogenic HA110–120 peptide coupled to an α-DEC-205 antibody (DEC-HA) before adoptive T cell transfer. DEC-HA-treated mice showed significantly less signs of intestinal inflammation as was demonstrated by reduced loss of body weight and histopathology in the gut. Strikingly, abrogated intestinal inflammation was mediated via the conversion of naive HA-specific CD4+Foxp3– T cells into HA-specific CD4+Foxp3+ regulatory T cells. In this study, we provide evidence that antigen-targeting to DEC-205 can be utilized for the induction of tolerance in mucosal organs that are confronted with large numbers of exogenous antigens. PMID:27141310
International Nuclear Information System (INIS)
Zender, S.N.; Crapo, H.S.; Jensen, M.F.; Sackett, K.E.
1975-04-01
Recorded test data are presented for Test S-01-5 of the semiscale Mod-1 isothermal blowdown test series. Test S-01-5 is one of several semiscale Mod-1 experiments which are counterparts of the LOFT nonnuclear experiments. System hardware is representative of LOFT with the design based on volumetric scaling methods and with initial conditions duplicating those identified for LOFT nonnuclear tests. Test S-01-5 was conducted with the secondary side of the steam generator pressurized with nitrogen gas in order to effectively eliminate heat transfer from the steam generator during blowdown and thereby to investigate the effect on overall system behavior of heat transfer from the steam generator. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. The test was initiated at isothermal conditions of 2270 psig and 540 0 F by a simulated offset shear of the cold leg broken loop piping. During system depressurization, coolant was injected into the cold leg of the operating loop to simulate emergency core cooling (ECC). Following the blowdown portion of the test, coolant spray was introduced into the pressure suppression tank to determine the response of the pressure suppression system. The uninterpreted data from Test S-01-5 and the reference material needed for future data analysis and test results reporting activities are presented. The data, presented in the form of graphs in engineering units, have been analyzed only to the extent necessary to assure that they are reasonable and consistent. (U.S.)
Directory of Open Access Journals (Sweden)
Alessandro Poggi
2006-01-01
Full Text Available Human natural killer (NK lymphocytes should not damage autologous cells due to the engagement of inhibitory receptor superfamily (IRS members by HLA-I. Nevertheless, NK cells kill self cells expressing low levels or lacking HLA-I, as it may occur during viral infections (missing-self hypothesis. Herein, we show that human NK cells can be activated upon binding with self antigen presenting cells or stromal cells despite the expression of HLA-I. Indeed, NK cells can kill and produce pro-inflammatory and regulating cytokines as IFN-γ, TNF-α and IL10 during interaction with autologous dendritic cells or bone marrow stromal cells or skin fibroblasts. The killing of antigen presenting and stromal cells is dependent on LFA1/ICAM1 interaction. Further, the natural cytotoxicity receptors (NCR NKp30 and NKp46 are responsible for the delivery of lethal hit to DC, whereas NKG2D activating receptor, the ligand of the MHC-related molecule MIC-A and the UL16 binding protein, is involved in stromal cell killing. These findings indicate that different activating receptors are involved in cell to self cell interaction. Finally, NK cells can revert the veto effect of stromal cells on mixed lymphocyte reaction further supporting the idea that NK cells may alter the interaction between T lymphocytes and microenvironment leading to autoreactivity.
Motions of Supergranular Structures on the Solar Surface
Czech Academy of Sciences Publication Activity Database
Švanda, Michal; Klvaňa, Miroslav; Sobotka, Michal
2005-01-01
Roč. 29, č. 1 (2005), s. 39-48 ISSN 0351-2657. [Hvar astrophysical colloquium /7./: Solar activity cycle and global phenomena. Hvar, 20.09.2004-24.09.2004] R&D Projects: GA ČR GA205/04/2129; GA ČR GD205/03/H144; GA AV ČR KSK2043105 Institutional research plan: CEZ:AV0Z10030501 Keywords : solar photosphere * velocity fields * tidal waves Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics
Excitation and dissociation of molecules by low-energy (0-15 eV) electrons
International Nuclear Information System (INIS)
Verhaart, G.J.
1980-01-01
The author deals with excitation and dissociation processes which result from the interaction between low-energy (0.15 eV) electrons and molecules. Low-energy electron-impact spectroscopy is used to gain a better knowledge of the electronic structure of halomethanes, ethylene and some of its halogen substituted derivatives, and some more complex organic molecules. (Auth.)
Federal health services grants, 1985.
Zwick, D I
1986-01-01
Federal health services grants amounted to about $1.8 billion in fiscal year 1985. The total amount was about $100 million less, about 6 percent, than in 1980. Reductions in the health planning program accounted for most of the decline in absolute dollars. The four formula grants to State agencies amounted to about $1.0 billion in 1985, about 60 percent of the total. The largest formula grants were for maternal and child health services and for alcohol, drug abuse, and mental health services. Project grants to selected State and local agencies amounted to about $.8 billion. There was 12 such grants in 1985 (compared with 34 in 1980). The largest, for community health services, equaled almost half the total. In real, inflation-adjusted dollars, the decline in Federal funds for these programs exceeded a third during the 5-year period. The overall dollar total in real terms in 1985 approximated the 1970 level. The ratio of formula grants to project grants in 1985 was similar to that in 1965. Studies of the impact of changes in Federal grants have found that while the development of health programs has been seriously constrained in most cases, their nature has not been substantially altered. In some cases broader program approaches and allocations have been favored. Established modes of operations and administration have generally been strengthened. Some efficiencies but few savings in administration have been identified. Replacement of reduced Federal funding by the States has been modest but has increased over time, especially for direct service activities. These changes reflect the important influence of professionalism in the health fields and the varying strengths of political interest and influence among program supporters. The long-term impact on program innovation is not yet clear.
Akdogan, E. K.; Hall, A.; Simon, W. K.; Safari, A.
2007-01-01
We investigate the nonlinear dielectric properties of 0.9Pb(Mg1/3,Nb2/3)O3•0.1PbTiO3 (PMN-PT) and Ba[Ti0.85,Sn0.15]O3 (BTS) paraelectrics experimentally and theoretically. We measure the nonlinear dielectric response in the parallel plate capacitor configuration, whereby we obtain the low frequency linear permittivity (ε33), and the higher order permittivities (ε3333,ε333333) at 298K as ε33PMN-PT=2.1×10-7 and ε33BTS=4.1×10-8F /m, ε3333PMN-PT=-4.9×10-20 and ε3333BTS=-7.3×10-21F3m /C2, and ε333333PMN-PT=7.6×10-33 and ε333333BTS=9.85×10-34F5m3/C4. By using a self-consistent thermodynamic theory in conjunction with the experimental data, we compute the E3 dependence of electrostatic free energy ΔG, the field-induced polarization P3, and the thermodynamic tunability ∂2P3/∂E32, and prove that electrostatic free energy has to be expanded at least up to the sixth order in the electric field to define the critical field ∣E3*∣ at which maximum tunability is attained. We also show that ∣E3*∣ is a function on ∣ε3333∣/ε333333 only. Consequently, we find ∣E3*∣PMN-PT=8.0×105V /m and ∣E3*∣BTS=8.6×105V/m. We compute the engineering tunabilities as ΓPMN-PT=65% and ΓBTS=55%, and then define a normalized tunability ξ to take into account the ∣E3*∣ parameter. Thereof, we determine ∣ξ ∣PMT-PT=8.1×10-5%/Vm-1 and ∣ξ∣BTS=6.4×10-5%/Vm-1. Our results reveal that ∣E3*∣BTS>∣E3*∣PMN-PT although ΓBTS<ΓPMN-PT, unequivocally showing the need for defining a critical field parameter in evaluating the nonlinear dielectric response and tunability, in particular, and in nonlinear dielectrics in general. The results also indicate that the nonlinear dielectric properties of PMN-PT are an order of magnitude higher than that of BTS, which we discuss in the context of structure-property relations of relaxors.
40 CFR 61.09 - Notification of startup.
2010-07-01
... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...
Welfare financing : Grant allocation and efficiency
Toolsema-Veldman, Linda; Allers, M.A.
2012-01-01
Welfare is often administered locally, but financed through grants from the central government. This raises the question how the central government can prevent local governments from spending more than necessary. Block grants are more efficient than matching grants, because the latter reduce the
7 CFR 205.640 - Fees and other charges for accreditation.
2010-01-01
... MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Administrative Fees § 205.640 Fees and other charges for accreditation. Fees and other charges equal as nearly as may be to the cost of the...
Tangi, Malleswarara
2017-08-31
The valence and conduction band offsets (VBO and CBO) at the semiconductor heterojunction are crucial parameters to design the active region of contemporary electronic and optoelectronic devices. In this report, to study the band alignment parameters at the In0.15Al0.85N/MoS2 lattice matched heterointerface, large area MoS2 single layers are chemical vapor deposited on molecular beam epitaxial grown In0.15Al0.85N films and vice versa. We grew InAlN having an in-plane lattice parameter closely matching with that of MoS2. We confirm that the grown MoS2 is a single layer from optical and structural analyses using micro-Raman spectroscopy and scanning transmission electron microscopy. The band offset parameters VBO and CBO at the In0.15Al0.85N/MoS2 heterojunction are determined to be 2.08 ± 0.15 and 0.60 ± 0.15 eV, respectively, with type-I band alignment using high-resolution x-ray photoelectron spectroscopy in conjunction with ultraviolet photoelectron spectroscopy. Furthermore, we design a MoS2 quantum well structure by growing an In0.15Al0.85N layer on MoS2/In0.15Al0.85N type-I heterostructure. By reducing the nitrogen plasma power and flow rate for the overgrown In0.15Al0.85N layers, we achieve unaltered structural properties and a reasonable preservation of photoluminescence intensity with a peak width of 70 meV for MoS2 quantum well (QW). The investigation provides a pathway towards realizing large area, air-stable, lattice matched, and eventual high efficiency In0.15Al0.85N/MoS2/In0.15Al0.85N QW-based light emitting devices.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...
Exon: CBRC-MMUS-09-0206 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...
ECCS evaluation of B and W's 205-FA NSS
International Nuclear Information System (INIS)
Lowe, R.J.; Anderson, G.E. Jr.; Dunn, B.M.
1975-06-01
The effectiveness of the ECCS for B and W's 205-fuel assembly plants is evaluated and shown to meet all the requirements of 10 CFR 50.46. The results of various sensitivity studies, a spectrum of breaks, and an analysis to determine allowable linear heat rates under 10 CFR 50.46 are presented. (14 references) (U.S.)
2010-07-01
... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Grant. 105-74.650 Section 105-74.650 Public Contracts and Property Management Federal Property Management Regulations System...-GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 105-74.650 Grant. Grant...
Reed, Gregory K; Piazza, Cathleen C; Patel, Meeta R; Layer, Stacy A; Bachmeyer, Melanie H; Bethke, Stephanie D; Gutshall, Katharine A
2004-01-01
In the current investigation, we evaluated the relative effects of noncontingent reinforcement (NCR), escape extinction, and a combination of NCR and escape extinction as treatment for the feeding problems exhibited by 4 children. For each participant, consumption increased only when escape extinction was implemented, independent of whether NCR was present or absent. These results were consistent with prior research suggesting that positive reinforcement alone is insufficient for increasing consumption, and that escape extinction often is necessary to increase and maintain food acceptance. However, NCR appeared to decrease inappropriate behavior for some participants.
30 CFR 90.205 - Approved sampling devices; operation; air flowrate.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Approved sampling devices; operation; air... LABOR COAL MINE SAFETY AND HEALTH MANDATORY HEALTH STANDARDS-COAL MINERS WHO HAVE EVIDENCE OF THE DEVELOPMENT OF PNEUMOCONIOSIS Sampling Procedures § 90.205 Approved sampling devices; operation; air flowrate...
48 CFR 31.205-1 - Public relations and advertising costs.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Public relations and... Organizations 31.205-1 Public relations and advertising costs. (a) Public relations means all functions and...; or (2) Maintaining or promoting reciprocal understanding and favorable relations with the public at...
48 CFR 231.205-1 - Public relations and advertising costs.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Public relations and... PROCEDURES Contracts With Commercial Organizations 231.205-1 Public relations and advertising costs. (e) See... public relations and advertising costs also include monies paid to the Government associated with the...
32 CFR 22.205 - Distinguishing assistance from procurement.
2010-07-01
... procurement contract, is the appropriate instrument, based on the following: (a) Purpose. (1) The grants... purpose is acquisition, then the grants officer shall judge that a procurement contract is the appropriate... 32 National Defense 1 2010-07-01 2010-07-01 false Distinguishing assistance from procurement. 22...
Markin, Karen M.
2012-01-01
It is not news that software exists to check undergraduate papers for plagiarism. What is less well known is that some federal grant agencies are using technology to detect plagiarism in grant proposals. That variety of research misconduct is a growing problem, according to federal experts. The National Science Foundation, in its most recent…
CY205 conversion of the NAMMU program
International Nuclear Information System (INIS)
Lindewall, L.
1986-02-01
The NAMMU program has been converted from an IBM double precision version to a CY205 single precision version. Due to different dialects among compilers, differences on system levels and machine dependencies some changes to the code have been made. They are documented in this report. A scalar optimized version is delivered. Direct vectorization did not improve performance. Changes in program logic is necessary to take advantage of the the vector capabilities. That and a study of the input-output operations are needed to improve performance. (author)
Infrared anisotropy of La/sub 1.85/Sr/sub 0.15/CuO/sub 4-//sub y/
International Nuclear Information System (INIS)
Doll, G.L.; Steinbeck, J.; Dresselhaus, G.; Dresselhaus, M.S.; Strauss, A.J.; Zeiger, H.J.
1987-01-01
By calculating the infrared reflectance R(ω) for a collection of randomly oriented crystallites, we fit the reflectance of polycrystalline La/sub 1.85/Sr/sub 0.15/CuO/sub 4-//sub y/. From this calculation, the normal state of La/sub 1.85/Sr/sub 0.15/CuO/sub 4-//sub y/ is found to be metallic in the Cu-O planes and nonmetallic out-of-plane. The deconvolution of R(ω) into R/sub X/ and R/sub perpendicular/ allows the anisotropy of the system to be examined and provides a method by which infrared measurements of polycrystalline materials can be interpreted
7 CFR 1948.95 - Grant monitoring.
2010-01-01
... 7 Agriculture 13 2010-01-01 2009-01-01 true Grant monitoring. 1948.95 Section 1948.95 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS-COOPERATIVE... § 1948.95 Grant monitoring. Each grant will be monitored by FmHA or its successor agency under Public Law...
2010-07-01
... reexportation of goods, technology, or services to the FRY (S&M). 585.205 Section 585.205 Money and Finance... exportation and reexportation of goods, technology, or services to the FRY (S&M). Except as otherwise authorized, no goods, technology (including technical data or other information controlled for export...
Sun Grant Initiative Regional Biomass Feedstock Partnership Competitive Grants Program
Energy Technology Data Exchange (ETDEWEB)
Owens, Vance [South Dakota State Univ., Brookings, SD (United States). North Central Regional Sun Grant Center
2016-12-30
The Sun Grant Initiative partnered with the US Department of Energy (DOE) in 2008 to create the Regional Biomass Feedstock Partnership Competitive Grants Program. The overall goal of this project was to utilize congressionally directed funds to leverage the North Central Regional Sun Grant’s Competitive Grant program at South Dakota State University (SDSU) to address key issues and research gaps related to development of the bioeconomy. Specific objectives of this program were to: 1. Identify research projects through a Regional Competitive Grants program that were relevant to the sustainable production, harvest, transport, delivery, and processing/conversion of cost-competitive, domestically grown biomass. 2. Build local expertise and capacity at the North Central Regional Sun Grant Center at SDSU through an internal selection of key bioenergy research projects. To achieve these, three nationwide Request for Applications (RFA) were developed: one each in 2008, 2009, and 2010. Internal, capacity building projects at SDSU were also selected during each one of these RFAs. In 2013 and 2015, two additional Proof of Concept RFAs were developed for internal SDSU projects. Priority areas for each RFA were 1) Biomass feedstock logistics including biomass harvesting, handling, transportation, storage, and densification; 2) Sustainable biomass feedstock production systems including biomass crop development, production, and life-cycle analysis; 3) Biomass production systems that optimize biomass feedstock yield and economic return across a diverse landscape while minimizing negative effects on the environment and food/feed production; and 4) Promotion of knowledge-based economic development in science and technology and to advance commercialization of inventions that meet the mission of the Sun Grant Initiative. A total of 33 projects were selected for funding through this program. Final reports for each of these diverse projects are included in this summary report
2010-10-01
... grant to those applicants whose approved projects will in the Secretary's judgment best promote the..., the grant will initially be for one year and subsequent continuation awards will also be for one year... application nor the award of any grant commits or obligates the United States in any way to make any...
Kaltman, Jonathan R; Evans, Frank J; Danthi, Narasimhan S; Wu, Colin O; DiMichele, Donna M; Lauer, Michael S
2014-09-12
We previously demonstrated absence of association between peer-review-derived percentile ranking and raw citation impact in a large cohort of National Heart, Lung, and Blood Institute cardiovascular R01 grants, but we did not consider pregrant investigator publication productivity. We also did not normalize citation counts for scientific field, type of article, and year of publication. To determine whether measures of investigator prior productivity predict a grant's subsequent scientific impact as measured by normalized citation metrics. We identified 1492 investigator-initiated de novo National Heart, Lung, and Blood Institute R01 grant applications funded between 2001 and 2008 and linked the publications from these grants to their InCites (Thompson Reuters) citation record. InCites provides a normalized citation count for each publication stratifying by year of publication, type of publication, and field of science. The coprimary end points for this analysis were the normalized citation impact per million dollars allocated and the number of publications per grant that has normalized citation rate in the top decile per million dollars allocated (top 10% articles). Prior productivity measures included the number of National Heart, Lung, and Blood Institute-supported publications each principal investigator published in the 5 years before grant review and the corresponding prior normalized citation impact score. After accounting for potential confounders, there was no association between peer-review percentile ranking and bibliometric end points (all adjusted P>0.5). However, prior productivity was predictive (Pcitation counts, we confirmed a lack of association between peer-review grant percentile ranking and grant citation impact. However, prior investigator publication productivity was predictive of grant-specific citation impact. © 2014 American Heart Association, Inc.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...
Financial Development in 205 Economies, 1960 to 2010
Martin Čihák; Asli Demirgüč-Kunt; Erik Feyen; Ross Levine
2013-01-01
This paper describes our construction of the Global Financial Development Database and uses the data to compare financial systems around the world. The database provides information on financial systems in 205 economies over the period from 1960 to 2010 and includes measures of (1) size of financial institutions and markets (financial depth), (2) degree to which individuals and firms can and do use financial services (access), (3) efficiency of financial intermediaries and markets in intermed...
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Two-year restriction on any former very senior employee's representations to former agency or certain officials concerning any matter, regardless of prior involvement. 2641.205 Section 2641.205 Administrative Personnel OFFICE OF GOVERNMENT ETHICS GOVERNMENT ETHICS POST-EMPLOYMENT CONFLICT...
Granting silence to avoid wireless collisions
Choi, Jung Il
2010-10-01
We describe grant-to-send, a novel collision avoidance algorithm for wireless mesh networks. Rather than announce packets it intends to send, a node using grant-to-send announces packets it expects to hear others send. We present evidence that inverting collision avoidance in this way greatly improves wireless mesh performance. Evaluating four protocols from 802.11 meshes and 802.15.4 sensor networks, we find that grant-to-send matches or outperforms CSMA and RTS/CTS in all cases. For example, in a 4-hop UDP flow, grantto- send can achieve 96% of the theoretical maximum throughput while maintaining a 99.9% packet delivery ratio. Grant-tosend is also general enough to replace protocol-specific collision avoidance mechanisms common to sensor network protocols. Grant-to-send is simple. For example, incorporating it into 802.11 requires only 11 lines of driver code and no hardware changes. Furthermore, as it reuses existing 802.11 mechanisms, grant-to-send inter-operates with current networks and can be incrementally deployed. © 2010 IEEE.
Granting silence to avoid wireless collisions
Choi, Jung Il; Jain, Mayank; Kazandjieva, Maria A.; Levis, Philip
2010-01-01
We describe grant-to-send, a novel collision avoidance algorithm for wireless mesh networks. Rather than announce packets it intends to send, a node using grant-to-send announces packets it expects to hear others send. We present evidence that inverting collision avoidance in this way greatly improves wireless mesh performance. Evaluating four protocols from 802.11 meshes and 802.15.4 sensor networks, we find that grant-to-send matches or outperforms CSMA and RTS/CTS in all cases. For example, in a 4-hop UDP flow, grantto- send can achieve 96% of the theoretical maximum throughput while maintaining a 99.9% packet delivery ratio. Grant-tosend is also general enough to replace protocol-specific collision avoidance mechanisms common to sensor network protocols. Grant-to-send is simple. For example, incorporating it into 802.11 requires only 11 lines of driver code and no hardware changes. Furthermore, as it reuses existing 802.11 mechanisms, grant-to-send inter-operates with current networks and can be incrementally deployed. © 2010 IEEE.
38 CFR 61.41 - Special needs grants application.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Special needs grants... (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.41 Special needs grants application. (a) To apply for a special needs grant, an applicant must obtain from VA a special needs grant application...
49 CFR 110.110 - After-grant requirements.
2010-10-01
... PUBLIC SECTOR TRAINING AND PLANNING GRANTS § 110.110 After-grant requirements. The Associate... must submit all financial, performance, and other reports required as a condition of the grant, within...
GEF small grants programme - overview
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-01
This paper describes the GEF small grants program which seeks to enhance the role of households and communities in conserving global biodiversity, mitigating global climate change, and protecting international waters. Grants up to $50k have been granted for projects in 33 countries, with plans for 12 other countries. The author describes the framework that the program works under, and the methodology followed in developing and planning projects. The approach to climate change concerns is to emphasize the development of non-carbon energy development activities to provide energy sources and economic development.
Thermal cracking in Lac du Bonnet granite during slow heating to 205 degrees celsius
International Nuclear Information System (INIS)
Chernis, P.J.; Robertson, P.B.
1993-09-01
Acoustic emissions (AE) were recorded as drill core samples of Lac du Bonnet granite were slowly heated to between 66 and 205 degrees celsius to evaluate the effects of temperature on the properties of rock samples. Longitudinal and shear velocities of the samples were measured, and Young's moduli, shear moduli and Poisson's ratios were calculated. No significant AE activity was detected until temperatures reached approximately 73-80 degrees celsius. Above this 'threshold' temperature, calculated rock properties decreased, and at 205 degrees celsius calculated Young's modulus, shear modulus, and Poisson's ratio were reduced by 30, 26, and 29% respectively
Kitagawa, Hiroyuki; Matsuura, Tsukasa; Kato, Toshihito; Kamata, Kin-ya
2015-06-01
N-type Bi2Te2.85Se0.15 thermoelectric materials were prepared by liquid phase growth (LPG) using a sliding boat, a simple and short fabrication process for Bi2Te3-related materials. Cu was selected as a donor dopant, and its effect on thermoelectric properties was investigated. Thick sheets and bars of Cu x Bi2 Te2.85Se0.15 ( x=0-0.25) of 1-2mm in thickness were obtained using the process. X-ray diffraction patterns and scanning electron micrographs showed that the in-plane direction tended to correspond to the hexagonal c-plane, which is the preferred direction for thermoelectric conversion. Cu-doping was effective in controlling conduction type and carrier (electron) concentration. The conduction type was p-type for undoped Bi2Te2.85Se0.15 and became n-type after Cu-doping. The Hall carrier concentration was increased by Cu-doping. Small resistivity was achieved in Cu0.02Bi2Te2.85Se0.15 owing to an optimized amount of Cu-doping and high crystal orientation. As a result, the maximum power factor near 310K for Cu0.02Bi2Te2.85Se0.15 was approximately 4×10-3W/K2m and had good reproducibility. Furthermore, the thermal stability of Cu0.02Bi2Te2.85Se0.15 was also confirmed by thermal cycling measurements of electrical resistivity. Thus, n-type Bi2Te2.85Se0.15 with a large power factor was prepared using the present LPG process.
Cañueto, J; Cardeñoso-Álvarez, E; García-Hernández, J L; Galindo-Villardón, P; Vicente-Galindo, P; Vicente-Villardón, J L; Alonso-López, D; De Las Rivas, J; Valero, J; Moyano-Sanz, E; Fernández-López, E; Mao, J H; Castellanos-Martín, A; Román-Curto, C; Pérez-Losada, J
2017-07-01
Cutaneous squamous cell carcinoma (CSCC) is the second most widespread cancer in humans and its incidence is rising. These tumours can evolve as diseases of poor prognosis, and therefore it is important to identify new markers to better predict its clinical evolution. We aimed to identify the expression pattern of microRNAs (miRNAs or miRs) at different stages of skin cancer progression in a panel of murine skin cancer cell lines. Owing to the increasing importance of miRNAs in the pathogenesis of cancer, we considered the possibility that miRNAs could help to define the prognosis of CSCC and aimed to evaluate the potential use of miR-203 and miR-205 as biomarkers of prognosis in human tumours. Seventy-nine human primary CSCCs were collected at the University Hospital of Salamanca in Spain. We identified differential miRNA expression patterns at different stages of CSCC progression in a well-established panel of murine skin cancer cell lines, and then selected miR-205 and miR-203 to evaluate their association with the clinical prognosis and evolution of human CSCC. miR-205 was expressed in tumours with pathological features recognized as indicators of poor prognosis such as desmoplasia, perineural invasion and infiltrative growth pattern. miR-205 was mainly expressed in undifferentiated areas and in the invasion front, and was associated with both local recurrence and the development of general clinical events of poor evolution. miR-205 expression was an independent variable selected to predict events of poor clinical evolution using the multinomial logistic regression model described in this study. In contrast, miR-203 was mainly expressed in tumours exhibiting the characteristics associated with a good prognosis, was mainly present in well-differentiated zones, and rarely expressed in the invasion front. Therefore, the expression and associations of miR-205 and miR-203 were mostly mutually exclusive. Finally, using a logistic biplot we identified three clusters
10 CFR 205.328 - Environmental requirements for Presidential Permits-Alternative 1.
2010-01-01
... Facilities for Transmission of Electric Energy at International Boundaries § 205.328 Environmental... 10 Energy 3 2010-01-01 2010-01-01 false Environmental requirements for Presidential Permits... responsible for the costs of preparing any necessary environmental document, including an Environmental Impact...
10 CFR 205.329 - Environmental requirements for Presidential Permits-Alternative 2.
2010-01-01
... Facilities for Transmission of Electric Energy at International Boundaries § 205.329 Environmental... 10 Energy 3 2010-01-01 2010-01-01 false Environmental requirements for Presidential Permits... such Presidential Permits: (1) ERA will determine whether an Environmental Impact Statement (EIS) or an...
12 CFR 205.6 - Liability of consumer for unauthorized transfers.
2010-01-01
... extend the times specified above to a reasonable period. (5) Notice to financial institution. (i) Notice... only if the financial institution has provided the disclosures required by § 205.7(b)(1), (2), and (3... financial institution must have provided a means to identify the consumer to whom it was issued. (b...
Energy Technology Data Exchange (ETDEWEB)
Chen, Xiuhua [Division of Nanomaterials and Chemistry, Hefei National Laboratory for Physical Sciences at the Microscale, Department of Chemistry, University of Science and Technology of China, Hefei 230026 (China); Tang, Kaibin, E-mail: kbtang@ustc.edu.cn [Division of Nanomaterials and Chemistry, Hefei National Laboratory for Physical Sciences at the Microscale, Department of Chemistry, University of Science and Technology of China, Hefei 230026 (China); Zeng, Suyuan [Shandong Provincial Key Laboratory of Chemical Energy Storage and Novel Cell Technology, Department of Chemistry and Chemical Engineering, Liaocheng University, Liaocheng 252059 (China); Hao, Qiaoyan; Wang, Dake; Gao, Zhan; Wang, Yan [Division of Nanomaterials and Chemistry, Hefei National Laboratory for Physical Sciences at the Microscale, Department of Chemistry, University of Science and Technology of China, Hefei 230026 (China)
2015-03-25
Highlights: • Fluorination of La{sub 2−x}Sr{sub x}CuO{sub 4} (x = 0, 0.15, 0.3) by ZnF{sub 2} with few byproducts. • Less of impurities are benefit to research its structure and properties. • Suffering a phase transformation and unit cell expansion after fluorination. • Determining chemical formula and fluorine ions occupation of fluorinated product. - Abstract: Here we report using the transition metal difluoride ZnF{sub 2} to fluorinate K{sub 2}NiF{sub 4}-type cuprates La{sub 2−x}Sr{sub x}CuO{sub 4} (x = 0, 1.5, 0.3). Unlike other fluorinating agents, the technique is nontoxic, easy to handle and the byproduct ZnO can be removed. After fluorination, the fluorinated product of La{sub 2}CuO{sub 4} suffers a phase transformation and unit cell expansion. While La{sub 1.85}Sr{sub 0.15}CuO{sub 4} and La{sub 1.7}Sr{sub 0.3}CuO{sub 4} indicate no change in structure after fluorination, their space groups still are I/4mmm, however, their lattices become larger, too. We emphasis the structural characterizations for fluorinated product of La{sub 1.7}Sr{sub 0.3}CuO{sub 4} by high-resolution transmission electron microscopy (HRTEM) images and electron diffraction (ED) patterns. Moreover, we determine the chemical formula to be La{sub 1.54}Sr{sub 0.46}CuO{sub 3.1}F{sub 0.9} and the fluorine ions are prone to be located in the apical sites of the Cu(O, F){sub 6} octahedron in the structure of post-treated fluorinated product of La{sub 1.7}Sr{sub 0.3}CuO{sub 4}. Magnetization investigations demonstrate that partial replacement of the lanthanum by strontium changes the magnetism of post-treated fluorinated products of La{sub 2−x}Sr{sub x}CuO{sub 4} (x = 0, 0.15, 0.3) and they exhibit a paramagnetic behavior.
U.S. Environmental Protection Agency — This is a provisional dataset that contains point locations for all grants given out by the USEPA going back to the 1960s through today. There are many limitations...
High mobility ultrathin ZnO p–n homojunction modulated by Zn0.85Mg0.15O quantum barriers
Yang, Jing-Jing; Fang, Qing-Qing; Du, Wen-Han; Zhang, Ke-Ke; Dong, Da-Shun
2018-03-01
Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 61540071 and 11705016), Project of Natural Science Research of Higher Education in Jiangsu Province, China (Grant Nos. 17KJB510001 and 17KJB140002), Changzhou Sci&Tech Program, China (Grant No. CJ20160026), and Changzhou Institute of Technology Science Foundation, China (Grant No. YN1408).
48 CFR 731.205-71 - Salary supplements for Host Government employees.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Salary supplements for... Contracts With Commercial Organizations 731.205-71 Salary supplements for Host Government employees. (a... fifty percent of its financial support from the government. (b) General. Salary supplement occurs when...
Marcelloni De Oliveira, Claudia
2015-01-01
ATLAS PHd Grants - We are excited to announce the creation of a dedicated grant scheme (thanks to a donation from Fabiola Gianotti and Peter Jenni following their award from the Fundamental Physics Prize foundation) to encourage young and high-caliber doctoral students in particle physics research (including computing for physics) and permit them to obtain world class exposure, supervision and training within the ATLAS collaboration. This special PhD Grant is aimed at graduate students preparing a doctoral thesis in particle physics (incl. computing for physics) to spend one year at CERN followed by one year support also at the home Institute.
Kim, Jae-Sung; Park, Sun-Young; Lee, Seul Ah; Park, Min-Gyeong; Yu, Sun-Kyoung; Lee, Myoung-Hwa; Park, Mi-Ra; Kim, Su-Gwan; Oh, Ji-Su; Lee, Sook-Young; Kim, Chun Sung; Kim, Heung-Joong; Chun, Hong Sung; Kim, Jin-Soo; Moon, Sung-Min; Kim, Do Kyung
2014-02-01
MicroRNA (miRNA) is a small noncoding RNA molecule, 19-25 nucleotides in length, which regulates several pathways including cell development, cell proliferation, carcinogenesis, apoptosis, etc. In this study, the over-expression of microRNA-205 (miR-205) increased the number of apoptotic cells by at least 4 times compared to the control. In addition, over-expressed miRNA in KB oral cancer cells triggered apoptosis via the caspase cascade, including the cleavage of caspase-9, caspase-7, caspase-3, and PARP. Flow cytometry showed that apoptotic cell death was increased significantly by 35.33% in KB oral cancer cells with over-expressed miR-205 compared to the control. The microarray data showed that axis inhibitor protein 2 (Axin2) was down-regulated in KB oral cancer cells transfected with miR-205. In addition, Axin2 was down-regulated by approximately 50% by over-expressed miR-205 at both the mRNA and protein levels. Interestingly, Axin2 was up-regulated in KB oral cancer compared to human normal oral keratinocytes. Furthermore, the cell cytotoxicity and apoptotic population of KB oral cancer cells were increased significantly after Axin2 siRNA transfection. These results suggest that Axin2 is might be as potential oncogene in KB oral cancer cells. The luciferase assay showed that over-expressed miR-205 in KB oral cancer cells suppressed AXIN2 expression through an interaction with its own binding site at AXIN2 3'UTR (64-92). These results suggest that miR-205 is a novel anti-oncogenic miRNA in KB oral cancer cells, and may have potential applications in oral cancer therapy.
2010-01-01
... Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 3021.650 Grant. Grant means an award of financial assistance that, consistent with 31 U.S.C. 6304, is used to...
7 CFR 3550.102 - Grant and loan purposes.
2010-01-01
... Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF... Waste Disposal Grants § 3550.102 Grant and loan purposes. (a) Grant funds. Grant funds may be used only... repair or remodel dwellings to make them accessible and useable for household members with disabilities...
25 CFR 23.21 - Noncompetitive tribal government grants.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Noncompetitive tribal government grants. 23.21 Section 23... ACT Grants to Indian Tribes for Title II Indian Child and Family Service Programs § 23.21 Noncompetitive tribal government grants. (a) Grant application information and technical assistance. Information...
48 CFR 1631.205-70 - FEHBP public relations and advertising costs.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true FEHBP public relations and... COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1631.205-70 FEHBP public relations and advertising costs. (a) The cost of media messages that are directed at advising current FEHBP...
2010-03-26
...This announcement governs the proposed award of formula grants under the Family Violence Prevention and Services Act (FVPSA) to Native American Tribes (including Alaska Native Villages) and Tribal organizations. The purpose of these grants is to assist Tribes in establishing, maintaining, and expanding programs and projects to prevent family violence and to provide immediate shelter and related assistance for victims of family violence and their dependents (42 U.S.C. 10401). This announcement sets forth the application requirements, the application process, and other administrative and fiscal requirements for grants in Fiscal Year (FY) 2010. Grantees are to be mindful that although the expenditure period for grants is a two-year period, an application is required every year to provide continuity in the provision of services. (See Section II. Award Information, Expenditure Periods.)
2011-11-28
..., Spectrum Trim, LLC and Grant Products International, Inc. D/B/A Spectrum Grant De Mexico Including Workers Whose Unemployment Insurance (UI) Wages Are Paid Through Grant Products International, Inc... Brownsville, TX; Amended Certification Regarding Eligibility To Apply for Worker Adjustment Assistance In...
2010-07-01
... assignments. However, provisions are necessary to cover the GSA and customer relationship if an OA expires... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What happens if a customer agency continues occupancy after the expiration of an OA? 102-85.205 Section 102-85.205 Public...
2010-10-01
... identifiable intangible assets held for use, no loss shall be allowed for a write-down from carrying value to... disposition or impairment of depreciable property or other capital assets. 31.205-16 Section 31.205-16 Federal... or impairment of depreciable property or other capital assets. (a) Gains and losses from the sale...
25 CFR 23.51 - Grant carry-over authority.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Grant carry-over authority. 23.51 Section 23.51 Indians... Uniform Grant Administration Provisions and Requirements § 23.51 Grant carry-over authority. Unless... two years beyond the initial grant funding period and must be utilized only for the intent, purpose...
FEMA Hazard Mitigation Grants Program Summary
Department of Homeland Security — The Hazard Mitigation Grant Program (HMGP, CFDA Number: 97.039) provides grants to States and local governments to implement long-term hazard mitigation measures...
Attenuation vector in heterogeneous, weakly dissipative, anisotropic media
Czech Academy of Sciences Publication Activity Database
Červený, V.; Klimeš, L.; Pšenčík, Ivan
2008-01-01
Roč. 175, č. 1 (2008), s. 346-355 ISSN 0956-540X R&D Projects: GA ČR GA205/05/2182; GA ČR GA205/08/0332 Grant - others:GA ČR(CZ) GA205/07/0032 Institutional research plan: CEZ:AV0Z30120515 Keywords : seismic anisotropy * seismic attenuation * theoretical seismology * wave propagation Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.219, year: 2008
Fukamizo, T; Juffer, A H; Vogel, H J; Honda, Y; Tremblay, H; Boucher, I; Neugebauer, W A; Brzezinski, R
2000-08-18
Based on the crystal structure of chitosanase from Streptomyces sp. N174, we have calculated theoretical pK(a) values of the ionizable groups of this protein using a combination of the boundary element method and continuum electrostatics. The pK(a) value obtained for Arg(205), which is located in the catalytic cleft, was abnormally high (>20.0), indicating that the guanidyl group may interact strongly with nearby charges. Chitosanases possessing mutations in this position (R205A, R205H, and R205Y), produced by Streptomyces lividans expression system, were found to have less than 0.3% of the activity of the wild type enzyme and to possess thermal stabilities 4-5 kcal/mol lower than that of the wild type protein. In the crystal structure, the Arg(205) side chain is in close proximity to the Asp(145) side chain (theoretical pK(a), -1.6), which is in turn close to the Arg(190) side chain (theoretical pK(a), 17.7). These theoretical pK(a) values are abnormal, suggesting that both of these residues may participate in the Arg(205) interaction network. Activity and stability experiments using Asp(145)- and Arg(190)-mutated chitosanases (D145A and R190A) provide experimental data supporting the hypothesis derived from the theoretical pK(a) data and prompt the conclusion that Arg(205) forms a strong interaction network with Asp(145) and Arg(190) that stabilizes the catalytic cleft.
Directory of Open Access Journals (Sweden)
Pekka Ylipalosaari
2017-11-01
Full Text Available Abstract Background We compared in a single mixed intensive care unit (ICU patients with influenza A(H1N1 pdm09 between pandemic and postpandemic periods. Methods Retrospective analysis of prospectively collected data in 2009–2016. Data are expressed as median (25th–75th percentile or number (percentile. Results Seventy-six influenza A(H1N1 pdm09 patients were admitted to the ICU: 16 during the pandemic period and 60 during the postpandemic period. Postpandemic patients were significantly older (60 years vs. 43 years, p < 0.001 and less likely to have epilepsy or other neurological diseases compared with pandemic patients (5 [8.3%] vs. 6 [38%], respectively; p = 0.009. Postpandemic patients were more likely than pandemic patients to have cardiovascular disease (24 [40%] vs. 1 [6%], respectively; p = 0.015, and they had higher scores on APACHE II (17 [13–22] vs. 14 [10–17], p = 0.002 and SAPS II (40 [31–51] vs. 31 [25–35], p = 0.002 upon admission to the ICU. Postpandemic patients had higher maximal SOFA score (9 [5–12] vs. 5 [4–9], respectively; p = 0.03 during their ICU stay. Postpandemic patients had more often septic shock (40 [66.7%] vs. 8 [50.0%], p = 0.042, and longer median hospital stays (15.0 vs. 8.0 days, respectively; p = 0.006. During 2015–2016, only 18% of the ICU- treated patients had received seasonal influenza vaccination. Conclusions Postpandemic ICU-treated A(H1N1 pdm09 influenza patients were older and developed more often septic shock and had longer hospital stays than influenza patients during the 2009 pandemic.
38 CFR 61.40 - Special needs grants-general.
2010-07-01
... (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.40 Special needs grants—general. (a) VA provides special needs grants to capital grant and per diem recipients under this part to assist with... that would change significantly the scope of the project for which a capital grant or per diem was...
38 CFR 61.11 - Applications for capital grants.
2010-07-01
... (CONTINUED) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.11 Applications for capital grants. (a) To apply for a capital grant, an applicant must obtain from VA a capital grant application package and... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Applications for capital...
Magnetic and structural properties of Cu0.85Fe0.15O system synthesized by co-precipitation
International Nuclear Information System (INIS)
Colorado, H. D.; Pérez Alcázar, G. A.
2011-01-01
Cu 0.94 Fe 0.06 O and Cu 0.85 Fe 0.15 O samples were synthesized by using the co-precipitation chemical method. Starting from aqueous solutions of copper nitrate, CuO (NO 3 ) 2 3H 2 O, iron nitrate, Fe (NO 3 ) 3 9H 2 O and sodium hydroxide as precipitating agent, NaOH. The precipitate of three samples for Cu 0.94 Fe 0.06 O and five for Cu 0.85 Fe 0.15 O of fine powder were calcined for 5 h at different temperatures. The obtained X rays diffraction patterns refined by the Rietveld method show the CuO characteristic pattern, showing that the Fe atoms enter to replace Cu atoms. Furthermore, it was obtained that the crystallite size decreases with calcination temperatures for Cu 0.94 Fe 0.06 O. The transmission Mössbauer spectroscopy showed that the samples present a disordered paramagnetic behavior due to the big value of the half-width of line of the quadrupolar splitting. Vibrating sample magnetometry confirms the paramagnetic character. The XRD results indicate that the material is nanostructured, due that the crystallite sizes are of the order of 10 nm for Cu 0.94 Fe 0.06 O and 40 nm for Cu 0.85 Fe 0.15 O.
30 CFR 735.14 - Coverage of grants.
2010-07-01
... systems, including data processing systems; (6) A planning process including a data base and information... ADMINISTRATION AND ENFORCEMENT § 735.14 Coverage of grants. (a) Program development grants. An agency may use... the initial administration and enforcement grant to the extent not covered by indirect costs or other...
40 CFR 1045.205 - What must I include in my application?
2010-07-01
... 40 Protection of Environment 32 2010-07-01 2010-07-01 false What must I include in my application... Engine Families § 1045.205 What must I include in my application? This section specifies the information... system components for controlling exhaust emissions, including all auxiliary emission control devices...
Czech Academy of Sciences Publication Activity Database
Mihalik, M.; Zentková, M.; Antoňák, M.; Arnold, Zdeněk; Kamarád, Jiří; Skorokhod, Yuriy; Gritzner, G.; Kiss, L. F.
2012-01-01
Roč. 32, č. 1 (2012), s. 145-149 ISSN 0895-7959. [Conference of the European High Pressure Research Group (EHPRG) /49./. Budapest, 28.08.2011-02.09.2011] Grant - others:VEGA(SK) 2/0057/27 Institutional research plan: CEZ:AV0Z10100521 Keywords : magnetic transition: insulator-metal transition * hydrostatic pressure * manganite Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.901, year: 2012 www.tandfonline.com
Energy Technology Data Exchange (ETDEWEB)
Durand, M.T.; Mota, A.L. [Departamento de Fisiologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Barale, A.R. [Instituto de Ciências Biomédicas, Universidade Federal de Uberlândia, Uberlândia, MG (Brazil); Castania, J.A.; Fazan, R. Jr.; Salgado, H.C. [Departamento de Fisiologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)
2012-03-16
The time to reach the maximum response of arterial pressure, heart rate and vascular resistance (hindquarter and mesenteric) was measured in conscious male spontaneously hypertensive (SHR) and normotensive control rats (NCR; Wistar; 18-22 weeks) subjected to electrical stimulation of the aortic depressor nerve (ADN). The parameters of stimulation were 1 mA intensity and 2 ms pulse length applied for 5 s, using frequencies of 10, 30, and 90 Hz. The time to reach the hemodynamic responses at different frequencies of ADN stimulation was similar for SHR (N = 15) and NCR (N = 14); hypotension = NCR (4194 ± 336 to 3695 ± 463 ms) vs SHR (3475 ± 354 to 4494 ± 300 ms); bradycardia = NCR (1618 ± 152 to 1358 ± 185 ms) vs SHR (1911 ± 323 to 1852 ± 431 ms), and the fall in hindquarter vascular resistance = NCR (6054 ± 486 to 6550 ± 847 ms) vs SHR (4849 ± 918 to 4926 ± 646 ms); mesenteric = NCR (5574 ± 790 to 5752 ± 539 ms) vs SHR (5638 ± 648 to 6777 ± 624 ms). In addition, ADN stimulation produced baroreflex responses characterized by a faster cardiac effect followed by a vascular effect, which together contributed to the decrease in arterial pressure. Therefore, the results indicate that there is no alteration in the conduction of the electrical impulse after the site of baroreceptor mechanical transduction in the baroreflex pathway (central and/or efferent) in conscious SHR compared to NCR.
International Nuclear Information System (INIS)
Durand, M.T.; Mota, A.L.; Barale, A.R.; Castania, J.A.; Fazan, R. Jr.; Salgado, H.C.
2012-01-01
The time to reach the maximum response of arterial pressure, heart rate and vascular resistance (hindquarter and mesenteric) was measured in conscious male spontaneously hypertensive (SHR) and normotensive control rats (NCR; Wistar; 18-22 weeks) subjected to electrical stimulation of the aortic depressor nerve (ADN). The parameters of stimulation were 1 mA intensity and 2 ms pulse length applied for 5 s, using frequencies of 10, 30, and 90 Hz. The time to reach the hemodynamic responses at different frequencies of ADN stimulation was similar for SHR (N = 15) and NCR (N = 14); hypotension = NCR (4194 ± 336 to 3695 ± 463 ms) vs SHR (3475 ± 354 to 4494 ± 300 ms); bradycardia = NCR (1618 ± 152 to 1358 ± 185 ms) vs SHR (1911 ± 323 to 1852 ± 431 ms), and the fall in hindquarter vascular resistance = NCR (6054 ± 486 to 6550 ± 847 ms) vs SHR (4849 ± 918 to 4926 ± 646 ms); mesenteric = NCR (5574 ± 790 to 5752 ± 539 ms) vs SHR (5638 ± 648 to 6777 ± 624 ms). In addition, ADN stimulation produced baroreflex responses characterized by a faster cardiac effect followed by a vascular effect, which together contributed to the decrease in arterial pressure. Therefore, the results indicate that there is no alteration in the conduction of the electrical impulse after the site of baroreceptor mechanical transduction in the baroreflex pathway (central and/or efferent) in conscious SHR compared to NCR
Czech Academy of Sciences Publication Activity Database
Briestenský, Miloš; Thinová, L.; Stemberk, Josef; Rowberry, Matthew David
2011-01-01
Roč. 145, 2/3 (2011), s. 166-172 ISSN 0144-8420 R&D Projects: GA ČR GA205/05/2770; GA ČR GA205/06/1828; GA ČR GC205/08/J051; GA ČR GA205/09/2024; GA MŠk OC 625.10 Institutional research plan: CEZ:AV0Z30460519 Keywords : radon variations * show caves * fault displacements Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.822, year: 2011 http://rpd.oxfordjournals.org/content/145/2-3/166
2010-03-19
...-AL26 Federal Acquisition Regulation; FAR Case 2008-015, Payments Under Fixed-Price Architect-Engineer..., Payments Under Fixed-Price Architect-Engineer Contracts, currently requires contracting officers to... judgment regarding the amount of payment withheld to apply under fixed-price architect-engineer (A-E...
38 CFR 61.10 - Capital grants-general.
2010-07-01
...) VA HOMELESS PROVIDERS GRANT AND PER DIEM PROGRAM § 61.10 Capital grants—general. (a) VA provides capital grants to public or nonprofit private entities so they can assist homeless veterans by helping to... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Capital grants-general...
46 CFR 42.09-5 - All vessels-division into types.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...
Directory of Open Access Journals (Sweden)
Shiyo Muratsu-Ikeda
Full Text Available BACKGROUND: Oxidative stress and endoplasmic reticulum (ER stress play a crucial role in tubular damage in both acute kidney injury (AKI and chronic kidney disease (CKD. While the pathophysiological contribution of microRNAs (miRNA to renal damage has also been highlighted, the effect of miRNA on renal damage under oxidative and ER stresses conditions remains elusive. METHODS: We assessed changes in miRNA expression in the cultured renal tubular cell line HK-2 under hypoxia-reoxygenation-induced oxidative stress or ER stress using miRNA microarray assay and real-time RT-PCR. The pathophysiological effect of miRNA was evaluated by cell survival rate, intracellular reactive oxygen species (ROS level, and anti-oxidant enzyme expression in miRNA-inhibited HK-2 or miRNA-overexpressed HK-2 under these stress conditions. The target gene of miRNA was identified by 3'-UTR-luciferase assay. RESULTS: We identified 8 and 10 miRNAs whose expression was significantly altered by oxidative and ER stresses, respectively. Among these, expression of miR-205 was markedly decreased in both stress conditions. Functional analysis revealed that decreased miR-205 led to an increase in cell susceptibility to oxidative and ER stresses, and that this increase was associated with the induction of intracellular ROS and suppression of anti-oxidant enzymes. While increased miR-205 by itself made no change in cell growth or morphology, cell viability under oxidative or ER stress conditions was partially restored. Further, miR-205 bound to the 3'-UTR of the prolyl hydroxylase 1 (PHD1/EGLN2 gene and suppressed the transcription level of EGLN2, which modulates both intracellular ROS level and ER stress state. CONCLUSIONS: miR-205 serves a protective role against both oxidative and ER stresses via the suppression of EGLN2 and subsequent decrease in intracellular ROS. miR-205 may represent a novel therapeutic target in AKI and CKD associated with oxidative or ER stress in tubules.
Czech Academy of Sciences Publication Activity Database
Blahůt, Jan; Klimeš, Jan; Vařilová, Z.
2013-01-01
Roč. 118, č. 3 (2013), s. 205-220 ISSN 1212-0014 R&D Projects: GA ČR GP205/09/P383 Institutional support: RVO:67985891 Keywords : rockfall hazard and risk * quantitative risk * Cretaceous sandstones * CONEFALL Subject RIV: DE - Earth Magnetism, Geodesy, Geography Impact factor: 0.400, year: 2013 http://geography.cz/sbornik/wp-content/uploads/downloads/2013/10/g13-3-s205-220-blahút.pdf
77 FR 48976 - Certain New Chemicals; Receipt and Status Information
2012-08-15
... surface active agent. fluorinated alcohol, reaction products with phosphorus oxide (P205), amine salts. P.... fluorinated alcohol, reaction products with phosphorus oxide (P205), amine salts. P-12-0452...... 07/09/2012... hydroxy coatings, overprint aromatic monomer. varnishes, laminating adhesives and inks. P-12-0461...... 07...
Taking Soft Skills for Granted?
Dutton, Gail
2012-01-01
The U.S. Department of Labor will award a total of $2 billion over the next four years through the Trade Adjustment Assistance Community College and Career Training Grant Program. Grants will support the development and improvement of postsecondary programs of two years or less that use evidence-based or innovative strategies to prepare students…
Sjödin, Linda; Buchanan, Angus; Mundt, Beate; Karlsson, Emelie; Falkmer, Torbjörn
2012-02-01
A vast majority of the journeys made by children with disabilities in Sweden are in the family car, which usually is bought and adapted for the child with governmental subsidies. Despite the important philosophical views about accessible vehicles, little is known about the impact of vehicle adaptations on families' lives. The aim of the study was to investigate parent views about the impact of vehicle grants and vehicle adaptation grants on their children's transport mobility and community access. In total, 434 parents of children with disabilities in Sweden who had received vehicle grants and/or vehicle adaptation grants between 1998-2007 responded to a questionnaire comprising questions with both pre-selected and open-ended answers. A non-responder analysis was performed. Children with disabilities were found to increase their transport mobility and community access in society as vehicle grants and/or vehicle adaptation grants were given to their parents. Their travel patterns and their travel priorities with their family car indicated that family friends and relatives and leisure activities were frequently visited and prioritised destinations. The grants were linked to access to social and family activities, provided environmental gains and led to increased experienced security. The results also showed that the potential to make spontaneous trips had increased substantially and that families experienced feelings of freedom and enhanced community access. The non-responder analysis confirmed these results. According to parents, vehicle grants and vehicle adaptation grants for children with disabilities have a positive impact on the children's transport mobility and community access. © 2011 The Authors. Australian Occupational Therapy Journal © 2011 Occupational Therapy Australia.
Transport properties of Nd0.67Sr0.33Mn0.85Co0.15O3 manganite
Bhargav, Abhinav; Tank, Tejas M.; Sanyal, Sankar P.
2018-05-01
We have studied the structural and electrical transport properties of Nd0.67Sr0.33Mn0.85Co0.15O3 manganite prepared through conventional solid state reaction technique. The investigation of X-ray diffraction data and rietvield refinement show that the synthesized sample is single phase in nature and crystallizes in orthorhombic perovskite structure with Pbnm space group. The resistivity versus temperature measurement for sample Nd0.67Sr0.33Mn0.85Co0.15O3 was performed in the range 0-300K and at 0T field. The electrical transport mechanism of the sample is analyzed by different theoretical models, for temperatures below and above TP.
Nakada, Naoyuki; Oda, Kazuo
2015-01-01
1. Here, we elucidated the structure of metabolites of novel oral Janus kinase inhibitor ASP015K in rats and humans and evaluated the predictability of human metabolites using chimeric mice with humanized liver (PXB mice). 2. Rat biological samples collected after oral dosing of (14)C-labelled ASP015K were examined using a liquid chromatography-radiometric detector and mass spectrometer (LC-RAD/MS). The molecular weight of metabolites in human and the liver chimeric mouse biological samples collected after oral dosing of non-labelled ASP015K was also investigated via LC-MS. Metabolites were also isolated from rat bile samples and analyzed using nuclear magnetic resonance. 3. Metabolic pathways of ASP015K in rats and humans were found to be glucuronide conjugation, methyl conjugation, sulfate conjugation, glutathione conjugation, hydroxylation of the adamantane ring and N-oxidation of the 1H-pyrrolo[2,3-b]pyridine ring. The main metabolite of ASP015K in rats was the glucuronide conjugate, while the main metabolite in humans was the sulfate conjugate. Given that human metabolites were produced by human hepatocytes in chimeric mice with humanized liver, this human model mouse was believed to be useful in predicting the human metabolic profile of various drug candidates.
40 CFR 1054.205 - What must I include in my application?
2010-07-01
... 40 Protection of Environment 32 2010-07-01 2010-07-01 false What must I include in my application... Certifying Emission Families § 1054.205 What must I include in my application? This section specifies the... controlling exhaust emissions, including all auxiliary emission control devices (AECDs) and all fuel-system...
46 CFR 28.205 - Fireman's outfits and self-contained breathing apparatus.
2010-10-01
... 46 Shipping 1 2010-10-01 2010-10-01 false Fireman's outfits and self-contained breathing apparatus... the Boundary Lines or With More Than 16 Individuals On Board, or for Fish Tender Vessels Engaged in the Aleutian Trade § 28.205 Fireman's outfits and self-contained breathing apparatus. (a) Each vessel...
9 CFR 205.211 - Applicability of court decisions under the UCC.
2010-01-01
... OF FARM PRODUCTS Interpretive Opinions § 205.211 Applicability of court decisions under the UCC. (a) Court decisions under the Uniform Commercial Code (UCC), about the scope of the “farm products... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Applicability of court decisions under...
Directory of Open Access Journals (Sweden)
Lilla Ördögh
2014-01-01
Full Text Available The increasing number of multidrug-resistant microbes now emerging necessitates the identification of novel antimicrobial agents. Plants produce a great variety of antimicrobial peptides including hundreds of small, nodule-specific cysteine-rich NCR peptides that, in the legume Medicago truncatula, govern the differentiation of endosymbiotic nitrogen fixing bacteria and, in vitro, can display potent antibacterial activities. In this study, the potential candidacidal activity of 19 NCR peptides was investigated. Cationic NCR peptides having an isoelectric point above 9 were efficient in killing Candida albicans, one of the most common fungal pathogens of humans. None of the tested NCR peptides were toxic for immortalized human epithelial cells at concentrations that effectively killed the fungus; however, at higher concentrations, some of them inhibited the division of the cells. Furthermore, the cationic peptides successfully inhibited C. albicans induced human epithelial cell death in an in vitro coculture model. These results highlight the therapeutic potential of cationic NCR peptides in the treatment of candidiasis.
7 CFR 1776.12 - Use of HWWS grant proceeds.
2010-01-01
... recipient may not use grant funds in any manner inconsistent with the terms of the grant agreement. ... eligible individuals. (b) A grant recipient may use HWWS grant funds to pay administrative expenses...