Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei
2018-02-01
The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rubin, S J; Lyons, R W; Murcia, A J
1978-01-01
A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378
Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard
2013-06-01
We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.
Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard
2013-01-01
We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.
Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard
2013-01-01
We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682
Effect of ionophores on phosphate and arsenate transport in Micrococcus lysodeikticus
Energy Technology Data Exchange (ETDEWEB)
Friedberg, I
1977-09-01
The effects of ionophores on P/sub i/ and arsenate transport, at acid and alkaline environment, were investigated in whole cells of Micrococcus lysodeikticus, a Gram positive obligatory aerobic bacterium. The results suggest that both ..delta.. Psi and ..delta.. pH contribute to the driving force of P/sub i/ transport; ..delta.. Psi seems to be predominant at pH 7.8, whereas at pH 5.5, the transport is primarily driven by ..delta.. pH. 12 references, 1 figure.
A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.
Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright
2005-12-30
A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.
Methods for targetted mutagenesis in gram-positive bacteria
Yang, Yunfeng
2014-05-27
The present invention provides a method of targeted mutagenesis in Gram-positive bacteria. In particular, the present invention provides a method that effectively integrates a suicide integrative vector into a target gene in the chromosome of a Gram-positive bacterium, resulting in inactivation of the target gene.
Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.
Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen
2014-01-01
Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.
Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.
Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo
2009-04-01
In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.
Endocarditis due to Micrococcus sedentarius incertae sedis.
Old, D C; McNeill, G P
1979-01-01
The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056
Probing interaction of Gram-positive and Gram-negative bacterial cells with ZnO nanorods
Energy Technology Data Exchange (ETDEWEB)
Jain, Aanchal; Bhargava, Richa; Poddar, Pankaj, E-mail: p.poddar@ncl.res.in
2013-04-01
In the present work, the physiological effects of the ZnO nanorods on the Gram positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli and Aerobacter aerogenes) bacterial cells have been studied. The analysis of bacterial growth curves for various concentrations of ZnO nanorods indicates that Gram positive and Gram negative bacterial cells show inhibition at concentrations of ∼ 64 and ∼ 256 μg/mL respectively. The marked difference in susceptibility towards nanorods was also validated by spread plate and disk diffusion methods. In addition, the scanning electron micrographs show a clear damage to the cells via changed morphology of the cells from rod to coccoid etc. The confocal optical microscopy images of these cells also demonstrate the reduction in live cell count in the presence of ZnO nanorods. These, results clearly indicate that the antibacterial activity of ZnO nanorods is higher towards Gram positive bacterium than Gram negative bacterium which indicates that the structure of the cell wall might play a major role in the interaction with nanostructured materials and shows high sensitivity to the particle concentration. Highlights: ► Effect of ZnO nanorods on the growth cycles of four bacterial strains. ► A relation has been established between growth rate of bacteria and concentration. ► Serious damage in the morphology of bacterial cells in the presence of ZnO nanorods. ► Microscopic studies to see the time dependent effect on bacterial cells.
Jeotgalibacillus soli sp. nov., a Gram-stain-positive bacterium isolated from soil.
Cunha, Sofia; Tiago, Igor; Paiva, Gabriel; Nobre, Fernanda; da Costa, Milton S; Veríssimo, António
2012-03-01
A Gram-staining-positive, motile, rod-shaped, spore-forming bacterium, designated P9(T), was isolated from soil in Portugal. This organism was aerobic and catalase- and oxidase-positive. It had an optimum growth temperature of about 35 °C and an optimum growth pH of about 8.0-8.5, and grew in medium with 0-9% (w/v) NaCl. The cell-wall peptidoglycan was of the A1α type, with L-lysine as the diagnostic diamino acid. The major respiratory quinone was menaquinone 7 (MK-7) and the major fatty acids were anteiso-C(15:0) (45.4%), iso-C(15:0) (22.0%) and anteiso-C(17:0) (11.2%). The genomic DNA G+C content was about 39.4 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain P9(T) was most closely related to Jeotgalibacillus campisalis DSM 18983(T) (96.8%) and Jeotgalibacillus marinus DSM 1297(T) (96.5%). These two recognized species formed a coherent cluster with strain P9(T) that was supported by a bootstrap value of 99%. On the basis of the phylogenetic analysis and physiological and biochemical characteristics, strain P9(T) (=DSM 23228(T)=LMG 25523(T)) represents a novel species of the genus Jeotgalibacillus, for which the name Jeotgalibacillus soli sp. nov. is proposed.
Diversity of pigmented Gram-positive bacteria associated with marine macroalgae from Antarctica.
Leiva, Sergio; Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio
2015-12-01
Little is known about the diversity and roles of Gram-positive and pigmented bacteria in Antarctic environments, especially those associated with marine macroorganisms. This work is the first study about the diversity and antimicrobial activity of culturable pigmented Gram-positive bacteria associated with marine Antarctic macroalgae. A total of 31 pigmented Gram-positive strains were isolated from the surface of six species of macroalgae collected in the King George Island, South Shetland Islands. On the basis of 16S rRNA gene sequence similarities ≥99%, 18 phylotypes were defined, which were clustered into 11 genera of Actinobacteria (Agrococcus, Arthrobacter, Brachybacterium, Citricoccus, Kocuria, Labedella, Microbacterium, Micrococcus, Rhodococcus, Salinibacterium and Sanguibacter) and one genus of the Firmicutes (Staphylococcus). It was found that five isolates displayed antimicrobial activity against a set of macroalgae-associated bacteria. The active isolates were phylogenetically related to Agrococcus baldri, Brachybacterium rhamnosum, Citricoccus zhacaiensis and Kocuria palustris. The results indicate that a diverse community of pigmented Gram-positive bacteria is associated with Antartic macroalgae and suggest its potential as a promising source of antimicrobial and pigmented natural compounds. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Heavy Metal uptake Potentials of Pseudomonas aeruginosa and ...
African Journals Online (AJOL)
Uptake of heavy metals, silver and cadmium by Pseudomonas aeruginosa (a Gram negative bacterium) and Micrococcus luteus (a Gram positive bacterium) was investigated in Cadmium and Silver stock solution using ion selective electrodes. Silver and cadmium uptake by the two organisms was described by Langmuir ...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Directory of Open Access Journals (Sweden)
Yang Fu
2018-02-01
Full Text Available C-di-GMP has been well investigated to play significant roles in the physiology of many Gram-negative bacteria. However, its effect on Gram-positive bacteria is less known. In order to more understand the c-di-GMP functions in Gram-positive bacteria, we have carried out a detailed study on the c-di-GMP-metabolizing enzymes and their physiological functions in Bacillus thuringiensis, a Gram-positive entomopathogenic bacterium that has been applied as an insecticide successfully. We performed a systematic study on the ten putative c-di-GMP-synthesizing enzyme diguanylate cyclases (DGCs and c-di-GMP-degrading enzyme phosphodiesterases (PDEs in B. thuringiensis BMB171, and artificially elevated the intracellular c-di-GMP level in BMB171 by deleting one or more pde genes. We found increasing level of intracellular c-di-GMP exhibits similar activities as those in Gram-negative bacteria, including altered activities in cell motility, biofilm formation, and cell-cell aggregation. Unexpectedly, we additionally found a novel function exhibited by the increasing level of c-di-GMP to promote the insecticidal activity of this bacterium against Helicoverpa armigera. Through whole-genome transcriptome profile analyses, we found that 4.3% of the B. thuringiensis genes were differentially transcribed when c-di-GMP level was increased, and 77.3% of such gene products are involved in some regulatory pathways not reported in other bacteria to date. In summary, our study represents the first comprehensive report on the c-di-GMP-metabolizing enzymes, their effects on phenotypes, and the transcriptome mediated by c-di-GMP in an important Gram-positive bacterium.
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.
Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S
1984-01-01
Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1983-01-01
of additional higher order structure in the renatured free RNA. It can be concluded that a high level of conservation of higher order structure has occurred during the evolution of the gram negative and gram positive eubacteria and the eukaryote in both the double helical regions and the "unstructured" regions...
Extrachromosomal genetic elements in Micrococcus.
Dib, Julián Rafael; Liebl, Wolfgang; Wagenknecht, Martin; Farías, María Eugenia; Meinhardt, Friedhelm
2013-01-01
Micrococci are Gram-positive G + C-rich, nonmotile, nonspore-forming actinomycetous bacteria. Micrococcus comprises ten members, with Micrococcus luteus being the type species. Representatives of the genus play important roles in the biodegradation of xenobiotics, bioremediation processes, production of biotechnologically important enzymes or bioactive compounds, as test strains in biological assays for lysozyme and antibiotics, and as infective agents in immunocompromised humans. The first description of plasmids dates back approximately 28 years, when several extrachromosomal elements ranging in size from 1.5 to 30.2 kb were found in Micrococcus luteus. Up to the present, a number of circular plasmids conferring antibiotic resistance, the ability to degrade aromatic compounds, and osmotolerance are known, as well as cryptic elements with unidentified functions. Here, we review the Micrococcus extrachromosomal traits reported thus far including phages and the only quite recently described large linear extrachromosomal genetic elements, termed linear plasmids, which range in size from 75 kb (pJD12) to 110 kb (pLMA1) and which confer putative advantageous capabilities, such as antibiotic or heavy metal resistances (inferred from sequence analyses and curing experiments). The role of the extrachromosomal elements for the frequently proven ecological and biotechnological versatility of the genus will be addressed as well as their potential for the development and use as genetic tools.
Directory of Open Access Journals (Sweden)
T. AKAYLI
2015-09-01
Full Text Available In this manuscript, thirty yellow-pigmented Gram-positive bacteria were isolated from natural intestine microflora and from sea water around the marine cage of a rearing tank of common dentex (Dentex dentex, in the Aegean Sea on the Turkish coast and were characterized. Eighteen isolates were assigned to the species Micrococcus luteus, the other twelve to the species Bacillus marisflavi. Eight representative strains, six from B. marisflavi and two from M. luteus, were chosen for further 16S rDNA analyses. A pathogenicity assay for the isolated bacterial strains was carried out in rainbow trout and it evidenced absence of pathogenicity in the tested strains. The isolated strains were tested for in vitro antagonistic activity against Listonella anguillarum, a pathogen bacterium diffused in Mediterranean aquaculture and affecting various fish species. The isolated bacterial strains showed antagonistic activity against the pathogenic bacterium, suggesting a possible role of isolates as probiotics. In this study, for the first time, bacterial strains of the species B. marisflavi, known as an environmental species, were recovered in the gut microbiota of a healthy fish. The use of the isolates characterized in this study, mainly the yellow-pigmented bacterium, is suggested as possible probiotics to improve fish health, along with alternative methods of maintaining a healthy environment.
The complete genome sequence of the Gram-positive bacterium Bacillus subtilis
Kunst, F; Ogasawara, N; Moszer, [No Value; Albertini, AM; Alloni, G; Azevedo, [No Value; Bertero, MG; Bessieres, P; Bolotin, A; Borchert, S; Borriss, R; Boursier, L; Brans, A; Brignell, SC; Bron, S; Brouillet, S; Bruschi, CV; Caldwell, B; Capuano, [No Value; Carter, NM; Choi, SK; Codani, JJ; Connerton, IF; Cummings, NJ; Daniel, RA; Denizot, F; Devine, KM; Dusterhoft, A; Ehrlich, SD; Emmerson, PT; Entian, KD; Errington, J; Fabret, C; Ferrari, E; Foulger, D; Fujita, M; Fujita, Y; Fuma, S; Galizzi, A; Galleron, N; Ghim, SY; Glaser, P; Goffeau, A; Golightly, EJ; Grandi, G; Guiseppi, G; Guy, BJ; Haga, K; Haiech, J; Harwood, CR; Henaut, A; Hilbert, H; Holsappel, S; Hosono, S; Hullo, MF; Itaya, M; Jones, L; Joris, B; Karamata, D; Kasahara, Y; KlaerrBlanchard, M; Klein, C; Kobayashi, Y; Koetter, P; Koningstein, G; Krogh, S; Kumano, M; Kurita, K; Lapidus, A; Lardinois, S; Lauber, J; Lazarevic, [No Value; Lee, SM; Levine, A; Liu, H; Masuda, S; Mauel, C; Medigue, C; Medina, N; Mellado, RP; Mizuno, M; Moestl, D; Nakai, S; Noback, M; Noone, D; OReilly, M; Ogawa, K; Ogiwara, A; Oudega, B; Park, SH; Parro, [No Value; Pohl, TM; Portetelle, D; Porwollik, S; Prescott, AM; Presecan, E; Pujic, P; Purnelle, B; Rapoport, G; Rey, M; Reynolds, S; Rieger, M; Rivolta, C; Rocha, E; Roche, B; Rose, M; Sadaie, Y; Sato, T; Scanlan, E; Schleich, S; Schroeter, R; Scoffone, F; Sekiguchi, J; Sekowska, A; Seror, SJ; Serror, P; Shin, BS; Soldo, B; Sorokin, A; Tacconi, E; Takagi, T; Takahashi, H; Takemaru, K; Takeuchi, M; Tamakoshi, A; Tanaka, T; Terpstra, P; Tognoni, A; Tosato, [No Value; Uchiyama, S; Vandenbol, M; Vannier, F; Vassarotti, A; Viari, A; Wambutt, R; Wedler, E; Wedler, H; Weitzenegger, T; Winters, P; Wipat, A; Yamamoto, H; Yamane, K; Yasumoto, K; Yata, K; Yoshida, K; Yoshikawa, HF; Zumstein, E; Yoshikawa, H; Danchin, A
1997-01-01
Bacillus subtilis is the best-characterized member of the Gram-positive bacteria. Its genome of 4,214,810 base pairs comprises 4,100 protein-coding genes. Of these protein-coding genes, 53% are represented once, while a quarter of the genome corresponds to several gene families that have been
Cardiolipin, a major phospholipid of gram-positive bacteria that is not readily extractable
Filgueiras, M.H.; Kamp, J.A.F. op den
1980-01-01
Extraction of phospholipids from stationary phase grown cells of the Gram+ bacteria, Bacillus megaterium, Bacillus subtilis, Bacillus cereus and Micrococcus lysodeikticus was found to be incomplete with various commonly used extraction procedures. Phosphatidylglycerol and phosphatidyl-ethanolamine
Protein synthesis in vitro by Micrococcus luteus.
Farwell, M A; Rabinowitz, J C
1991-01-01
Bacillus subtilis and related gram-positive bacteria which have low to moderate genomic G + C contents are unable to efficiently translate mRNA derived from gram-negative bacteria, whereas Escherichia coli and other gram-negative bacteria are able to translate mRNA from both types of organisms. This phenomenon has been termed translational species specificity. Ribosomes from the low-G + C-content group (low-G + C group) of gram-positive organisms (B. subtilis and relatives) lack an equivalent to Escherichia ribosomal protein S1. The requirement for S1 for translation in E. coli (G. van Dieijen, P. H. van Knippenberg, J. van Duin, B. Koekman, and P. H. Pouwels, Mol. Gen. Genet. 153:75-80, 1977) and its specific role (A.R. Subramanian, Trends Biochem. Sci. 9:491-494, 1984) have been proposed. The group of gram-positive bacteria characterized by high genomic G + C content (formerly Actinomyces species and relatives) contain S1, in contrast to the low-G + C group (K. Mikulik, J. Smardova, A. Jiranova, and P. Branny, Eur. J. Biochem. 155:557-563, 1986). It is not known whether members of the high-G + C group are translationally specific, although there is evidence that one genus, Streptomyces, can express Escherichia genes in vivo (M. J. Bibb and S. N. Cohen, Mol. Gen. Genet. 187:265-277, 1985; J. L. Schottel, M. J. Bibb, and S. N. Cohen, J. Bacteriol. 146:360-368, 1981). In order to determine whether the organisms of this group are translationally specific, we examined the in vitro translational characteristics of a member of the high-G + C group, Micrococcus luteus, whose genomic G + C content is 73%. A semipurified coupled transcription-translation system of M. luteus translates Escherichia mRNA as well as Bacillus and Micrococcus mRNA. Therefore, M. luteus is translationally nonspecific and resembles E. coli rather than B. subtilis in its translational characteristics. Images PMID:2045372
Micrococcus lactis sp. nov., isolated from dairy industry waste.
Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh
2011-12-01
A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).
Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.
Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T
2017-08-10
We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.
Directory of Open Access Journals (Sweden)
Beatriz García
2016-11-01
Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.
García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.
2016-01-01
The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938
Directory of Open Access Journals (Sweden)
Subrata Pal
2014-01-01
Full Text Available Thermoanaerobacter indiensis BSB-33 has been earlier shown to reduce Fe(III and Cr(VI anaerobically at 60°C optimally. Further, the Gram-positive thermophilic bacterium contains Cr(VI reduction activity in both the membrane and cytoplasm. The soluble fraction prepared from T. indiensis cells grown at 60°C was found to contain the majority of Fe(III reduction activity of the microorganism and produced four distinct bands in nondenaturing Fe(III reductase activity gel. Proteins from each of these bands were partially purified by chromatography and identified by mass spectrometry (MS with the help of T. indiensis proteome sequences. Two paralogous dihydrolipoamide dehydrogenases (LPDs, thioredoxin reductase (Trx, NADP(H-nitrite reductase (Ntr, and thioredoxin disulfide reductase (Tdr were determined to be responsible for Fe(III reductase activity. Amino acid sequence and three-dimensional (3D structural similarity analyses of the T. indiensis Fe(III reductases were carried out with Cr(VI reducing proteins from other bacteria. The two LPDs and Tdr showed very significant sequence and structural identity, respectively, with Cr(VI reducing dihydrolipoamide dehydrogenase from Thermus scotoductus and thioredoxin disulfide reductase from Desulfovibrio desulfuricans. It appears that in addition to their iron reducing activity T. indiensis LPDs and Tdr are possibly involved in Cr(VI reduction as well.
Joshi, Rajesh K; Badakar, Vijayalaxmi M; Kholkute, Sanjiva D; Khatib, Nayeem
2011-01-01
The essential oil of the leaves of Feronia elephantum Corr. was analyzed by gas chromatography and gas chromatography/mass spectrometry. The main constituents were beta-pinene (28.4%), Z-anethole (22.1%), methyl chavicol (12.0%) and E-anethole (8.1%), among thirty-three identified compounds, which represented 92.6% of the total oil. The antimicrobial activity was tested against five Gram-positive and eight Gram-negative bacteria, and four fungi. The oil was active against Micrococcus luteus (Gram-positive bacterium), Proteus mirabilis (Gram-negative bacterium), Penicillium chrysogenum and Aspergillus niger (fungi) with MIC values of 0.31 +/- 0.06, 0.52 +/- 0.10, 0.20 +/- 0.50 and 0.26 +/- 0.52 mg/mL, respectively.
Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.
Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun
2009-05-01
A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).
International Nuclear Information System (INIS)
Koshikawa, Tomihiko
2004-01-01
The part II in this title series describes details of the commercially available BBL CRYSTAL GP Identification Kit with the software (Becton, Dickinson and Co., Ltd.), by which identification of Gram positive bacteria as well as their number becoming easier in the radiation sterilization of medical devices. Isolation of a bacterium has to be confirmed by microscopy and its Gram positive property, by the Gram staining. The exponentially growing bacteria are to be inoculated in the Kit and cultured for 18-24 hr at 37 deg C with the lid attached by substrates for identification. Reactions to substrates are to be judged by CRYSTAL auto-reader, which is further to be searched by the computer software (code-book) for final identification. For possible misidentification, re-isolation of the bacterium, prolonged culture, concentrated inoculation and re-consideration for ranking of identification the software provides are necessary as well as other identification approaches. Representative bacteria as the bioburden are spp. of Bacilli, Corynebacteria, Staphylococci and Micrococci. (N.I.)
Directory of Open Access Journals (Sweden)
Anne Elyse Otwell
2016-02-01
Full Text Available The proteomes of the metabolically versatile and poorly characterized Gram-positive bacterium Desulfotomaculum reducens MI-1 were compared across four cultivation conditions including sulfate reduction, soluble Fe(III reduction, insoluble Fe(III reduction, and pyruvate fermentation. Collectively across conditions, we observed at high confidence ~38% of genome-encoded proteins. Here, we focus on proteins that display significant differential abundance on conditions tested. To the best of our knowledge, this is the first full-proteome study focused on a Gram-positive organism grown either on sulfate or metal-reducing conditions. Several proteins with uncharacterized function encoded within heterodisulfide reductase (hdr-containing loci were upregulated on either sulfate (Dred_0633-4, Dred_0689-90, and Dred_1325-30 or Fe(III-citrate-reducing conditions (Dred_0432-3 and Dred_1778-84. Two of these hdr-containing loci display homology to recently described flavin-based electron bifurcation (FBEB pathways (Dred_1325-30 and Dred_1778-84. Additionally, we propose that a cluster of proteins, which is homologous to a described FBEB lactate dehydrogenase (LDH complex, is performing lactate oxidation in D. reducens (Dred_0367-9. Analysis of the putative sulfate reduction machinery in D. reducens revealed that most of these proteins are constitutively expressed across cultivation conditions tested. In addition, peptides from the single multiheme c-type cytochrome (MHC in the genome were exclusively observed on the insoluble Fe(III condition, suggesting that this MHC may play a role in reduction of insoluble metals.
Bio sorption of some Rare Earth Elements and Yttrium by Gram Positive and Gram Negative Bacteria
International Nuclear Information System (INIS)
Ibrahim, H.A.
2012-01-01
The separate bio sorption of the REEs La, Sm, Eu and Dy together with yttrium upon the Gram positive bacteria Bacillus subtilis (B.subtilis) and Bacillus Licheniformis (B. Licheniformis),the Gram negative bacterium Escherichia coli (E. coli ) and Saccharomyces cervisiae (Yeast) was studied. The revelant factors of ph 1-6, contact time (30-180 min), the initial rare earth concentration (50-200 mg/l) have been studied. The amount of the accumulated element was strongly affected by its concentration.In addition, bio sorptive fractionation of Y and the studied REEs from a solution containing a mixture of these elements was also studied. From the obtained data, it was found that Langmuir isotherm model for both B.licheniformis and E.coli gives a best fit for the studied elements over the working range of concentration (50-200 mg/I). Transmission electron microscopy exhibited accumulation throughout the bacterial cell with some granular deposits in both the cell periphery and cytoplasm
Septicemia caused by the gram-negative bacterium CDC IV c-2 in an immunocompromised human.
Dan, M; Berger, S A; Aderka, D; Levo, Y
1986-01-01
A 37-year-old man with plasma cell leukemia developed nonfatal septicemia caused by the gram-negative bacterium CDC IV c-2. Recovery followed appropriate treatment with antibiotics. The biochemical features of this organism are reviewed.
International Nuclear Information System (INIS)
Pereira, Jose H.; Goh, Ee-Been; Keasling, Jay D.; Beller, Harry R.; Adams, Paul D.
2012-01-01
In an effort to better understand the control of the formation of branched fatty acids in Micrococcus luteus, the structure of β-ketoacyl-ACP synthase III, which catalyzes the initial step of fatty-acid biosynthesis, has been determined. Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition
Janssen, Peter H; Hugenholtz, Philip
2003-05-01
The component bacteria of a three-membered mixed culture able to ferment glycolate to acetate, propionate and CO(2) were isolated in pure culture. All three strains were strict anaerobes that, on the basis of comparative 16S rRNA gene sequence analysis, belonged to the order Clostridiales in the phylum Firmicutes (low G+C gram-positive bacteria). Two of the strains were not involved in glycolate metabolism. The third, the glycolate-fermenting strain 19gly4 (DSM 11261), was related to members of the family Lachnospiraceae. The cells of strain 19gly4 were oval- to lemon-shaped, 0.85 microm long and 0.65 microm in diameter, occurring singly, in pairs, or in chains of up to 30 cells. Strain 19gly4 fermented glycolate or fumarate to acetate, succinate, and CO(2). Hydrogen was not formed, and strain 19gly4 was able to grow on glycolate in pure culture without any syntrophic hydrogen transfer and without the use of an external electron acceptor. There was no evidence for homoacetogenic metabolism. This bacterium therefore differs in metabolism from previously reported glycolate-utilising anaerobes.
Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.
Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang
2007-01-01
Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).
Procalcitonin levels in gram-positive, gram-negative, and fungal bloodstream infections.
Leli, Christian; Ferranti, Marta; Moretti, Amedeo; Al Dhahab, Zainab Salim; Cenci, Elio; Mencacci, Antonella
2015-01-01
Procalcitonin (PCT) can discriminate bacterial from viral systemic infections and true bacteremia from contaminated blood cultures. The aim of this study was to evaluate PCT diagnostic accuracy in discriminating Gram-positive, Gram-negative, and fungal bloodstream infections. A total of 1,949 samples from patients with suspected bloodstream infections were included in the study. Median PCT value in Gram-negative (13.8 ng/mL, interquartile range (IQR) 3.4-44.1) bacteremias was significantly higher than in Gram-positive (2.1 ng/mL, IQR 0.6-7.6) or fungal (0.5 ng/mL, IQR 0.4-1) infections (P Gram-negatives from Gram-positives at the best cut-off value of 10.8 ng/mL and an AUC of 0.944 (95% CI 0.919-0.969, P Gram-negatives from fungi at the best cut-off of 1.6 ng/mL. Additional results showed a significant difference in median PCT values between Enterobacteriaceae and nonfermentative Gram-negative bacteria (17.1 ng/mL, IQR 5.9-48.5 versus 3.5 ng/mL, IQR 0.8-21.5; P Gram-negative from Gram-positive and fungal bloodstream infections. Nevertheless, its utility to predict different microorganisms needs to be assessed in further studies.
Prakash, Om; Nimonkar, Yogesh; Munot, Hitendra; Sharma, Avinash; Vemuluri, Venkata Ramana; Chavadar, Mahesh S; Shouche, Yogesh S
2014-10-01
A yellow Gram-stain-positive, non-motile, non-endospore -forming, spherical endophytic actinobacterium, designated strain AE-6(T), was isolated from the inner fleshy leaf tissues of Aloe barbadensis (Aloe vera) collected from Pune, Maharashtra, India. Strain AE-6(T) grew at high salt concentrations [10% (w/v) NaCl], temperatures of 15-41 °C and a pH range of 5-12. It showed highest (99.7%) 16S rRNA gene sequence similarity with Micrococcus yunnanensis YIM 65004(T) followed by Micrococcus luteus NCTC 2665(T) (99.6%) and Micrococcus endophyticus YIM 56238(T) (99.0%). Ribosomal protein profiling by MALDI-TOF/MS also showed it was most closely related to M. yunnanensis YIM 65004(T) and M. luteus NCTC 2665(T). Like other members of the genus Micrococcus, strain AE-6(T) had a high content of branched chain fatty acids (iso-C15:0 and anteiso-C15:0). MK-8(H2) and MK-8 were the predominant isoprenoid quinones. Cell wall analysis showed an 'A2 L-Lys-peptide subunit' type of peptidoglycan and ribose to be the major cell wall sugar. The DNA G+C content was 70 mol%. Results of DNA-DNA hybridization of AE-6(T) with its closest relatives from the genus Micrococcus produced a value of less than 70%. Based on the results of this study, strain AE-6(T) could be clearly differentiated from other members of the genus Micrococcus. We propose that it represents a novel species of the genus Micrococcus and suggest the name Micrococcus aloeverae sp. nov., with strain AE-6(T) ( = MCC 2184(T) = DSM 27472(T)) as the type strain of the species. © 2014 IUMS.
Micrococcus cohnii sp. nov., isolated from the air in a medical practice.
Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike
2013-01-01
Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).
Antibacterial activity of oregano (Origanum vulgare Linn.) against gram positive bacteria.
Saeed, Sabahat; Tariq, Perween
2009-10-01
The present investigation is focused on antibacterial potential of infusion, decoction and essential oil of oregano (Origanum vulgare) against 111 Gram-positive bacterial isolates belonging to 23 different species related to 3 genera. Infusion and essential oil exhibited antibacterial activity against Staphylococcus saprophyticus, S. aureus, Micrococcus roseus, M. kristinae, M. nishinomiyaensis, M. lylae, M. luteus, M. sedentarius, M. varians, Bacillus megaterium, B. thuringiensis, B. alvei, B. circulans, B. brevis, B. coagulans, B. pumilus, B. laterosporus, B. polymyxa, B. macerans, B. subtilis, B. firmus, B. cereus and B. lichiniformis. The infusion exhibited maximum activity against B. laterosporus (17.5 mm mean zone of inhibition+/-1.5 Standard deviation) followed by B. polymyxa (17.0 mm+/-2.0 SD) and essential oil of oregano exhibited maximum activity against S. saprophyticus (16.8 mm+/-1.8 SD) followed by B. circulans (14.5 mm+/-0.5 SD). While all these tested isolates were found resistant to decoction of oregano.
Enhanced Cadmium (Cd Phytoextraction from Contaminated Soil using Cd-Resistant Bacterium
Directory of Open Access Journals (Sweden)
Kunchaya Setkit
2014-01-01
Full Text Available A cadmium (Cd-resistant bacterium, Micrococcus sp. MU1, is able to produce indole-3-acetic acid and promotes root elongation and plant growth. The potential of this bacterium on enhancement of Cd uptake and bioaccumulation of Cd in Helianthus annuus L. planted in Cd-contaminated soil was evaluated in greenhouse condition. The results showed that Micrococcus sp. MU1promoted the growth of H. annuus L. by increasing the root length, stem height, dry biomass, root to shoot ratio and also significantly increased Cd accumulation in the root and above-ground tissues of H. annuus L. compared to uninoculated control. Re-inoculation with Micrococcus sp. MU1in contaminated soil helped in promoting plant growth and Cd phytoextraction throughout the cultivation period. In addition, phytoextraction coefficient and translocation factor (TF of H. annuus L. inoculated with Micrococcus sp. MU1were higher than that of uninoculated control and TF continuously increased with time. Our results suggested that Micrococcus sp. MU1 has an ability to enhance plant growth and Cd uptake in H. annuus L. Synergistic interaction between Micrococcus sp. MU1 and H. annuus L. could be further applied for Cd phytoextraction in polluted areas.
Albuquerque, Luciana; Tiago, Igor; Rainey, Fred A; Taborda, Marco; Nobre, M Fernanda; Veríssimo, António; da Costa, Milton S
2007-07-01
A low-G+C, Gram-positive bacterium, designated CVS-14(T), was recovered from a sea salt evaporation pond on the island of Sal in the Cape Verde Archipelago. This organism was catalase- and oxidase-positive. Cells were motile, spore-forming aerobic rods, with an optimum growth temperature of about 35-40 degrees C and optimum pH between 7.0 and 8.5. Optimal growth occurred in media containing 4-6 % (w/v) NaCl, although the organism was able to grow in medium without added NaCl and in medium containing 16 % NaCl. The cell-wall peptidoglycan was of A1 gamma type and the major respiratory quinone was menaquinone 7 (MK-7). Major fatty acids were iso-15 : 0, anteiso-15 : 0, iso-17 : 0 and anteiso-17 : 0. The DNA G+C content was 37.0 mol%. Phylogenetic analysis of the 16S rRNA gene sequence indicated that strain CVS-14(T) formed a distinct new branch within the radiation of the moderately halophilic bacilli group, forming a separate lineage from species of the genera Salinibacillus, Paucisalibacillus, Oceanobacillus, Lentibacillus and Virgibacillus. Strain CVS-14(T) showed 16S rRNA gene pairwise similarity values of approximately 95 % with species of the genus Salinibacillus. On the basis of morphological, physiological, chemotaxonomic and phylogenetic characteristics, strain CVS-14(T) is considered to represent a novel species in a new genus, for which the name Salirhabdus euzebyi gen. nov., sp. nov. is proposed. The type strain is CVS-14(T) (=LMG 22839(T)=CIP 108577(T)).
Gram-negative, but not Gram-positive, bacteria elicit strong PGE2 production in human monocytes.
Hessle, Christina C; Andersson, Bengt; Wold, Agnes E
2003-12-01
Gram-positive and Gram-negative bacteria induce different cytokine patterns in human mononuclear cells. We have seen that Gram-positives preferentially induce IL-12 and TNF-alpha, whereas Gram-negatives induce more IL-10, IL-6, and IL-8. In this study, we compared the capacity of these two groups of bacteria to induce PGE2. Monocytes stimulated with Gram-negative bacterial species induced much more PGE2 than did Gram-positive bacteria (5600 +/- 330 vs. 1700 +/- 670 pg/mL, p Gram-positive and Gram-negative bacteria. We suggest that Gram-positive and Gram-negative bacteria may stimulate different innate effector functions; Gram-positive bacteria promoting cell-mediated effector functions whereas Gram-negative bacteria inducing mediators inhibiting the same.
Directory of Open Access Journals (Sweden)
Lirong Shen
Full Text Available The antibacterial activity of royalisin, an antimicrobial peptide from the royal jelly produced by honeybees, has been addressed extensively. However, its mechanism of action remains unclear. In this study, a recombinant royalisin, RAcc-royalisin from the royal jelly of Asian honeybee Apis cerana cerana, was expressed by fusing with glutathione S-transferase (GST in Escherichia coli BL21, isolated and purified. The agar dilution assays with inhibition zone showed that RAcc-royalisin, similar to nisin, inhibits the growth of Gram-positive bacteria. The antibacterial activity of RAcc-royalisin was associated with its concentration, and was weakened by heat treatment ranging from 55°C to 85°C for 15 min. Both RAcc-royalisin and nisin exhibited the minimum inhibitory concentrations (MIC of 62.5 µg/ml, 125 µg/ml, and 250 µg/ml against Gram-positive bacterial strains, Bacillus subtilis and Micrococcus flavus and Staphyloccocus aureus in the microplate assay, respectively. However, RAcc-royalisin did not show antimicrobial activity against tested Gram-negative bacterial and fungal strains. The antibacterial activity of RAcc-royalisin agrees well with the decrease in bacterial cell hydrophobicity, the leakage of 260-nm absorbing materials, and the observation by transmission electron microscopy, all indicating that RAcc-royalisin induced the disruption and dysfunction of cell walls and membranes. This is the first report detailing the antibacterial mechanism of royalisin against Gram-positive bacteria, and provides insight into the application of recombinant royalisin in food and pharmaceutical industries as an antimicrobial agent.
Procalcitonin Levels in Gram-Positive, Gram-Negative, and Fungal Bloodstream Infections
Directory of Open Access Journals (Sweden)
Christian Leli
2015-01-01
Full Text Available Procalcitonin (PCT can discriminate bacterial from viral systemic infections and true bacteremia from contaminated blood cultures. The aim of this study was to evaluate PCT diagnostic accuracy in discriminating Gram-positive, Gram-negative, and fungal bloodstream infections. A total of 1,949 samples from patients with suspected bloodstream infections were included in the study. Median PCT value in Gram-negative (13.8 ng/mL, interquartile range (IQR 3.4–44.1 bacteremias was significantly higher than in Gram-positive (2.1 ng/mL, IQR 0.6–7.6 or fungal (0.5 ng/mL, IQR 0.4–1 infections (P<0.0001. Receiver operating characteristic analysis showed an area under the curve (AUC for PCT of 0.765 (95% CI 0.725–0.805, P<0.0001 in discriminating Gram-negatives from Gram-positives at the best cut-off value of 10.8 ng/mL and an AUC of 0.944 (95% CI 0.919–0.969, P<0.0001 in discriminating Gram-negatives from fungi at the best cut-off of 1.6 ng/mL. Additional results showed a significant difference in median PCT values between Enterobacteriaceae and nonfermentative Gram-negative bacteria (17.1 ng/mL, IQR 5.9–48.5 versus 3.5 ng/mL, IQR 0.8–21.5; P<0.0001. This study suggests that PCT may be of value to distinguish Gram-negative from Gram-positive and fungal bloodstream infections. Nevertheless, its utility to predict different microorganisms needs to be assessed in further studies.
Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn
2016-01-01
Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.
Transformation of gram positive bacteria by sonoporation
Yang, Yunfeng; Li, Yongchao
2014-03-11
The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.
Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira
2012-01-01
The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.
Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J
2004-07-01
To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require
Diagnosing periprosthetic infection: false-positive intraoperative Gram stains.
Oethinger, Margret; Warner, Debra K; Schindler, Susan A; Kobayashi, Hideo; Bauer, Thomas W
2011-04-01
Intraoperative Gram stains have a reported low sensitivity but high specificity when used to help diagnose periprosthetic infections. In early 2008, we recognized an unexpectedly high frequency of apparent false-positive Gram stains from revision arthroplasties. The purpose of this report is to describe the cause of these false-positive test results. We calculated the sensitivity and specificity of all intraoperative Gram stains submitted from revision arthroplasty cases during a 3-month interval using microbiologic cultures of the same samples as the gold standard. Methods of specimen harvesting, handling, transport, distribution, specimen processing including tissue grinding/macerating, Gram staining, and interpretation were studied. After a test modification, results of specimens were prospectively collected for a second 3-month interval, and the sensitivity and specificity of intraoperative Gram stains were calculated. The retrospective review of 269 Gram stains submitted from revision arthroplasties indicated historic sensitivity and specificity values of 23% and 92%, respectively. Systematic analysis of all steps of the procedure identified Gram-stained but nonviable bacteria in commercial broth reagents used as diluents for maceration of periprosthetic membranes before Gram staining and culture. Polymerase chain reaction and sequencing showed mixed bacterial DNA. Evaluation of 390 specimens after initiating standardized Millipore filtering of diluent fluid revealed a reduced number of positive Gram stains, yielding 9% sensitivity and 99% specificity. Clusters of false-positive Gram stains have been reported in other clinical conditions. They are apparently rare related to diagnosing periprosthetic infections but have severe consequences if used to guide treatment. Even occasional false-positive Gram stains should prompt review of laboratory methods. Our observations implicate dead bacteria in microbiologic reagents as potential sources of false-positive Gram
Senghor, Bruno; Bassène, Hubert; Khelaifia, Saber; Robert, Catherine; Fournier, Pierre-Edouard; Ruimy, Raymond; Sokhna, Cheikh; Raoult, Didier; Lagier, Jean-Christophe
2018-07-01
A Gram-positive, moderately halophilic bacterium, referred to as strain Marseille-P3518 T , was isolated from a stool sample with 2% NaCl concentration from a healthy 15-year-old male living in Dielmo, a village in Senegal. Cells are aerobic, rod-shaped and motile and display endospore formation. Strain Marseille-P3518 T can grow in a medium with 0-20% (w/v) sodium chloride (optimally at 5-7.5% w/v). The major fatty acids were 12-methyl-tetradecanoic acid (45.8%), 13-methyl-tetradecanoic acid (26.9%) and 12-methyl-tridecanoic acid (12.8%). The genome is 4,347,479 bp long with 42.1% G+C content. It contains 4282 protein-coding and 107 RNA genes. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that strain Marseille-P3518 T is a member of the Bacillaceae family and is closely related to Sediminibacillus albus (97.4% gene sequence similarity). Strain Marseille-P3518 T was clearly differentiated from its phylogenetic neighbors on the basis of phenotypic and genotypic features. Strain Marseille-P3518 T is, therefore, considered to be a novel representative of the genus Sediminibacillus, for which the name Sediminibacillus massiliensis sp. nov. is proposed, and the type strain is Marseille-P3518 T (CSUR P3518T, DSM69894).
Kurtaran, Behice; Kuscu, Ferit; Ulu, Aslihan; Inal, Ayse Seza; Komur, Suheyla; Kibar, Filiz; Cetinalp, Nuri Eralp; Ozsoy, Kerem Mazhar; Arslan, Yusuf Kemal; Aksu, Hasan Salih; Tasova, Yesim
2017-06-20
In this study, we aim to determine the microbiological etiology in critically ill neurosurgical patients with nosocomial meningitis (NM) and show the impact of Gram-negative rods and differences of patient's characteristics, clinical and prognostic measures between Gram-negative and Gram-positive meningitis. In this prospective, one center study we reviewed all adult patients hospitalized during a 12-year period and identified pathogens isolated from post-neurosurgical cases of NM. Demographic, clinical, and treatment characteristics were noted from the medical records. Of the 134 bacterial NM patients, 78 were male and 56 were female, with a mean age of 46±15.9 and median age of 50 (18-80) years. 141 strains isolated; 82 (58.2%) were Gram negative, 59 (41.8%) were Gram positive. Most common isolated microorganism was Acinetobacter baumannii (%34.8). In comparison of mortality data shows that the patients who have meningitis with Gram-negative pathogens have higher mortality than with Gram positives (p=0.034). The duration between surgery and meningitis was shorter in Gram negative meningitis cases compared to others (p=0.045) but the duration between the diagnosis and death was shorter in Gram-positive meningitis cases compared to Gram negatives (p= 0.017). CSF protein and lactate level were higher and glucose level was lower in cases of NM with Gram negatives (p value were respectively, 0.022, 0.039 and 0.049). As conclusions; in NM, Gram-negative pathogens were seen more frequently; A.baumanni was the predominant pathogen; and NM caused by Gram negatives had worse clinical and laboratory characteristic and prognostic outcome than Gram positives.
Polymers for binding of the gram-positive oral pathogen Streptococcus mutans
Magennis, Eugene P.; Francini, Nora; Mastrotto, Francesca; Catania, Rosa; Redhead, Martin; Fernandez-Trillo, Francisco; Bradshaw, David; Churchley, David; Winzer, Klaus; Alexander, Cameron
2017-01-01
Streptococcus mutans is the most significant pathogenic bacterium implicated in the formation of dental caries and, both directly and indirectly, has been associated with severe conditions such as multiple sclerosis, cerebrovascular and peripheral artery disease. Polymers able to selectively bind S. mutans and/or inhibit its adhesion to oral tissue in a non-lethal manner would offer possibilities for addressing pathogenicity without selecting for populations resistant against bactericidal agents. In the present work two libraries of 2-(dimethylamino)ethyl methacrylate (pDMAEMA)-based polymers were synthesized with various proportions of either N,N,N-trimethylethanaminium cationic- or sulfobetaine zwitterionic groups. These copolymers where initially tested as potential macromolecular ligands for S. mutans NCTC 10449, whilst Escherichia coli MG1655 was used as Gram-negative control bacteria. pDMAEMA-derived materials with high proportions of zwitterionic repeating units were found to be selective for S. mutans, in both isolated and S. mutans–E. coli mixed bacterial cultures. Fully sulfobetainized pDMAEMA was subsequently found to bind/cluster preferentially Gram-positive S. mutans and S. aureus compared to Gram negative E. coli and V. harveyi. A key initial stage of S. mutans pathogenesis involves a lectin-mediated adhesion to the tooth surface, thus the range of potential macromolecular ligands was further expanded by investigating two glycopolymers bearing α-mannopyranoside and β-galactopyranoside pendant units. Results with these polymers indicated that preferential binding to either S. mutans or E. coli can be obtained by modulating the glycosylation pattern of the chosen multivalent ligands without incurring unacceptable cytotoxicity in a model gastrointestinal cell line. Overall, our results allowed to identify a structure–property relationship for the potential antimicrobial polymers investigated, and suggest that preferential binding to Gram-positive S
Mid-infrared spectroscopic assessment of nanotoxicity in gram-negative vs. gram-positive bacteria.
Heys, Kelly A; Riding, Matthew J; Strong, Rebecca J; Shore, Richard F; Pereira, M Glória; Jones, Kevin C; Semple, Kirk T; Martin, Francis L
2014-03-07
Nanoparticles appear to induce toxic effects through a variety of mechanisms including generation of reactive oxygen species (ROS), physical contact with the cell membrane and indirect catalysis due to remnants from manufacture. The development and subsequent increasing usage of nanomaterials has highlighted a growing need to characterize and assess the toxicity of nanoparticles, particularly those that may have detrimental health effects such as carbon-based nanomaterials (CBNs). Due to interactions of nanoparticles with some reagents, many traditional toxicity tests are unsuitable for use with CBNs. Infrared (IR) spectroscopy is a non-destructive, high throughput technique, which is unhindered by such problems. We explored the application of IR spectroscopy to investigate the effects of CBNs on Gram-negative (Pseudomonas fluorescens) and Gram-positive (Mycobacterium vanbaalenii PYR-1) bacteria. Two types of IR spectroscopy were compared: attenuated total reflection Fourier-transform infrared (ATR-FTIR) and synchrotron radiation-based FTIR (SR-FTIR) spectroscopy. This showed that Gram-positive and Gram-negative bacteria exhibit differing alterations when exposed to CBNs. Gram-positive bacteria appear more resistant to these agents and this may be due to the protection afforded by their more sturdy cell wall. Markers of exposure also vary according to Gram status; Amide II was consistently altered in Gram-negative bacteria and carbohydrate altered in Gram-positive bacteria. ATR-FTIR and SR-FTIR spectroscopy could both be applied to extract biochemical alterations induced by each CBN that were consistent across the two bacterial species; these may represent potential biomarkers of nanoparticle-induced alterations. Vibrational spectroscopy approaches may provide a novel means of fingerprinting the effects of CBNs in target cells.
Pereira, Jose H; Goh, Ee-Been; Keasling, Jay D; Beller, Harry R; Adams, Paul D
2012-10-01
Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition.
Gram positive and Gram negative bacteria differ in their sensitivity to cold plasma
Mai-Prochnow, Anne; Clauson, Maryse; Hong, Jungmi; Murphy, Anthony B.
2016-12-01
Cold atmospheric-pressure plasma (CAP) is a relatively new method being investigated for antimicrobial activity. However, the exact mode of action is still being explored. Here we report that CAP efficacy is directly correlated to bacterial cell wall thickness in several species. Biofilms of Gram positive Bacillus subtilis, possessing a 55.4 nm cell wall, showed the highest resistance to CAP, with less than one log10 reduction after 10 min treatment. In contrast, biofilms of Gram negative Pseudomonas aeruginosa, possessing only a 2.4 nm cell wall, were almost completely eradicated using the same treatment conditions. Planktonic cultures of Gram negative Pseudomonas libanensis also had a higher log10 reduction than Gram positive Staphylococcus epidermidis. Mixed species biofilms of P. aeruginosa and S. epidermidis showed a similar trend of Gram positive bacteria being more resistant to CAP treatment. However, when grown in co-culture, Gram negative P. aeruginosa was more resistant to CAP overall than as a mono-species biofilm. Emission spectra indicated OH and O, capable of structural cell wall bond breakage, were present in the plasma. This study indicates that cell wall thickness correlates with CAP inactivation times of bacteria, but cell membranes and biofilm matrix are also likely to play a role.
Enkh-Amgalan, Jigjiddorj; Kawasaki, Hiroko; Seki, Tatsuji
2006-01-01
A major nif cluster was detected in the strictly anaerobic, Gram-positive phototrophic bacterium Heliobacterium chlorum. The cluster consisted of 11 genes arranged within a 10 kb region in the order nifI1, nifI2, nifH, nifD, nifK, nifE, nifN, nifX, fdx, nifB and nifV. The phylogenetic position of Hbt. chlorum was the same in the NifH, NifD, NifK, NifE and NifN trees; Hbt. chlorum formed a cluster with Desulfitobacterium hafniense, the closest neighbour of heliobacteria based on the 16S rRNA phylogeny, and two species of the genus Geobacter belonging to the Deltaproteobacteria. Two nifI genes, known to occur in the nif clusters of methanogenic archaea between nifH and nifD, were found upstream of the nifH gene of Hbt. chlorum. The organization of the nif operon and the phylogeny of individual and concatenated gene products showed that the Hbt. chlorum nif operon carrying nifI genes upstream of the nifH gene was an intermediate between the nif operon with nifI downstream of nifH (group II and III of the nitrogenase classification) and the nif operon lacking nifI (group I). Thus, the phylogenetic position of Hbt. chlorum nitrogenase may reflect an evolutionary stage of a divergence of the two nitrogenase groups, with group I consisting of the aerobic diazotrophs and group II consisting of strictly anaerobic prokaryotes.
Lemmen, S W; Häfner, H; Zolldann, D; Stanzel, S; Lütticken, R
2004-03-01
We prospectively studied the difference in detection rates of multi-resistant Gram-positive and multi-resistant Gram-negative bacteria in the inanimate environment of patients harbouring these organisms. Up to 20 different locations around 190 patients were surveyed. Fifty-four patients were infected or colonized with methicillin-resistant Staphylococcus aureus (MRSA) or vancomycin-resistant enterococci (VRE) and 136 with multi-resistant Gram-negative bacteria. The environmental detection rate for MRSA or VRE was 24.7% (174/705 samples) compared with 4.9% (89/1827 samples) for multi-resistant Gram-negative bacteria (PGram-positive bacteria were isolated more frequently than Gram-negatives from the hands of patients (PGram-positive and Gram-negative isolates. Our results suggest that the inanimate environment serves as a secondary source for MRSA and VRE, but less so for Gram-negative bacteria. Thus, strict contact isolation in a single room with complete barrier precautions is recommended for MRSA or VRE; however, for multi-resistant Gram-negative bacteria, contact isolation with barrier precautions for close contact but without a single room seems sufficient. This benefits not only the patients, but also the hospital by removing some of the strain placed on already over-stretched resources.
Directory of Open Access Journals (Sweden)
Azam Mehraban
2016-05-01
Full Text Available Abstract Background and Objectives: Development of bacterial resistance to antibiotics has led to an increased tendency to development of new more effective and non-toxic antimicrobial compounds. In this study, the inhibitory and lethal effects of aqueous, ethanolic, and hydroalcoholic extracts of aerial parts of Salvia chorassanica were evaluated against Listeria monocytogenes, Bacillus cereus, Salmonella typhi, and Escherichia coli O:157. Methods: In this study, Kirby–Bauer disk diffusion method was used to evaluate antimicrobial activity. In this method, bacteria were cultivated as grass culture in Mueller Hinton Agar (MHA media. To determine the minimum inhibitory concentration and minimum bactericidal concentration, micro-dilution method with ELISA and addition of phenyl tetrazolium chloride reagent, were used. Data were analyzed using one-way ANOVA and Duncan’s test at the significance level of p<0.05. Results: The highest diameter of inhibition in agar diffusion method was related to hydroalcoholic extract of aerial parts of Salvia chorassanica against Gram-positive bacteria Bacillus cereus. The amount of calculated MIC of hydro-alcoholic extract for Gram-positive bacteria was 30mg/ml. This amount was the lowest among other measured MIC. Conclusion: Based on the results of this study, Gram-negative bacteria showed more resistance to different extracts of aerial parts of Salvia chorassanica as compared to Gram-positive bacteria, so that Salmonella typhi was found to be the most resistant bacterium among the tested bacteria.
Becerra, Sandra C; Roy, Daniel C; Sanchez, Carlos J; Christy, Robert J; Burmeister, David M
2016-04-12
Bacterial infections are a common clinical problem in both acute and chronic wounds. With growing concerns over antibiotic resistance, treatment of bacterial infections should only occur after positive diagnosis. Currently, diagnosis is delayed due to lengthy culturing methods which may also fail to identify the presence of bacteria. While newer costly bacterial identification methods are being explored, a simple and inexpensive diagnostic tool would aid in immediate and accurate treatments for bacterial infections. Histologically, hematoxylin and eosin (H&E) and Gram stains have been employed, but are far from optimal when analyzing tissue samples due to non-specific staining. The goal of the current study was to develop a modification of the Gram stain that enhances the contrast between bacteria and host tissue. A modified Gram stain was developed and tested as an alternative to Gram stain that improves the contrast between Gram positive bacteria, Gram negative bacteria and host tissue. Initially, clinically relevant strains of Pseudomonas aeruginosa and Staphylococcus aureus were visualized in vitro and in biopsies of infected, porcine burns using routine Gram stain, and immunohistochemistry techniques involving bacterial strain-specific fluorescent antibodies as validation tools. H&E and Gram stain of serial biopsy sections were then compared to a modification of the Gram stain incorporating a counterstain that highlights collagen found in tissue. The modified Gram stain clearly identified both Gram positive and Gram negative bacteria, and when compared to H&E or Gram stain alone provided excellent contrast between bacteria and non-viable burn eschar. Moreover, when applied to surgical biopsies from patients that underwent burn debridement this technique was able to clearly detect bacterial morphology within host tissue. We describe a modification of the Gram stain that provides improved contrast of Gram positive and Gram negative microorganisms within host
Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.
Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman
2010-11-01
A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.
Halophilic Nuclease from a Moderately Halophilic Micrococcus varians
Kamekura, Masahiro; Onishi, Hiroshi
1974-01-01
The moderately halophilic bacterium Micrococcus varians, isolated from soy sauce mash, produced extracellular nuclease when cultivated aerobically in media containing 1 to 4 M NaCl or KCl. The enzyme, purified to an electrophoretically homogeneous state, had both ribonuclease and deoxyribonuclease activities. The nuclease had maximal activity in the presence of 2.9 M NaCl or 2.1 M KCl at 40 C. The enzymatic activity was lost by dialysis against low-salt buffer, whereas when the inactivated enzyme was dialyzed against 3.4 M NaCl buffer as much as 77% of the initial activity could be restored. Images PMID:4852218
Duneau, David F; Kondolf, Hannah C; Im, Joo Hyun; Ortiz, Gerardo A; Chow, Christopher; Fox, Michael A; Eugénio, Ana T; Revah, J; Buchon, Nicolas; Lazzaro, Brian P
2017-12-21
Host sexual dimorphism is being increasingly recognized to generate strong differences in the outcome of infectious disease, but the mechanisms underlying immunological differences between males and females remain poorly characterized. Here, we used Drosophila melanogaster to assess and dissect sexual dimorphism in the innate response to systemic bacterial infection. We demonstrated sexual dimorphism in susceptibility to infection by a broad spectrum of Gram-positive and Gram-negative bacteria. We found that both virgin and mated females are more susceptible than mated males to most, but not all, infections. We investigated in more detail the lower resistance of females to infection with Providencia rettgeri, a Gram-negative bacterium that naturally infects D. melanogaster. We found that females have a higher number of phagocytes than males and that ablation of hemocytes does not eliminate the dimorphism in resistance to P. rettgeri, so the observed dimorphism does not stem from differences in the cellular response. The Imd pathway is critical for the production of antimicrobial peptides in response to Gram-negative bacteria, but mutants for Imd signaling continued to exhibit dimorphism even though both sexes showed strongly reduced resistance. Instead, we found that the Toll pathway is responsible for the dimorphism in resistance. The Toll pathway is dimorphic in genome-wide constitutive gene expression and in induced response to infection. Toll signaling is dimorphic in both constitutive signaling and in induced activation in response to P. rettgeri infection. The dimorphism in pathway activation can be specifically attributed to Persephone-mediated immune stimulation, by which the Toll pathway is triggered in response to pathogen-derived virulence factors. We additionally found that, in absence of Toll signaling, males become more susceptible than females to the Gram-positive Enterococcus faecalis. This reversal in susceptibility between male and female Toll
Glass bead transformation method for gram-positive bacteria
Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat
2009-01-01
A simple, inexpensive and reproducible transformation method was developed for Gram-positive bacteria. It was based on agitation of bacterial protoplasts with glass beads in the presence of DNA and polyethylene glycol. By using this method, introduction of pGK12 into protoplasts of several strains of Gram-positive bacteria was achieved.
Rossolini, Gian M; Dryden, Matthew S; Kozlov, Roman S; Quintana, Alvaro; Flamm, Robert K; Läuffer, Jörg M; Lee, Emma; Morrissey, Ian; CLASS Study Group
2011-01-01
to assess the in vitro activity of ceftobiprole and comparators against a recent collection of Gram-positive and Gram-negative pathogens, in order to detect potential changes in susceptibility patterns, and to evaluate the Etest assay for ceftobiprole susceptibility testing. contemporary Gram-positive and Gram-negative isolates (excluding extended-spectrum β-lactamase-producing isolates) from across Europe and the Middle East were collected, and their susceptibility to ceftobiprole, vancomycin, teicoplanin, linezolid, ceftazidime and cefepime was assessed using the Etest method. Quality testing [using Etest and broth microdilution (BMD)] was conducted at a central reference laboratory. some 5041 Gram-positive and 4026 Gram-negative isolates were included. Against Gram-positive isolates overall, ceftobiprole had the lowest MIC50 (0.5 mg/L), compared with 1 mg/L for its comparators (vancomycin, teicoplanin and linezolid). Against methicillin-resistant Staphylococcus aureus, all four agents had a similar MIC90 (2 mg/L), but ceftobiprole had a 4-fold better MIC90 (0.5 mg/L) against methicillin-susceptible strains. Only 38 Gram-positive isolates were confirmed as ceftobiprole resistant. Among Gram-negative strains, 86.9%, 91.7% and 95.2% were susceptible to ceftobiprole, ceftazidime and cefepime, respectively. Pseudomonas aeruginosa was less susceptible to all three antimicrobials than any other Gram-negative pathogen. There was generally good agreement between local Etest results and those obtained at the reference laboratory (for ceftobiprole: 86.8% with Gram-negatives; and 94.7% with Gram-positives), as well as between results obtained by BMD and Etest methods (for ceftobiprole: 98.2% with Gram-negatives; and 98.4% with Gram-positives). ceftobiprole exhibits in vitro activity against a wide range of Gram-positive and Gram-negative pathogens, including multidrug-resistant strains. No changes in its known susceptibility profile were identified.
Directory of Open Access Journals (Sweden)
Hsu Wei-Hsiu
2011-01-01
Full Text Available Abstract Background Monomicrobial necrotizing fasciitis is rapidly progressive and life-threatening. This study was undertaken to ascertain whether the clinical presentation and outcome for patients with this disease differ for those infected with a gram-positive as compared to gram-negative pathogen. Methods Forty-six patients with monomicrobial necrotizing fasciitis were examined retrospectively from November 2002 to January 2008. All patients received adequate broad-spectrum antibiotic therapy, aggressive resuscitation, prompt radical debridement and adjuvant hyperbaric oxygen therapy. Eleven patients were infected with a gram-positive pathogen (Group 1 and 35 patients with a gram-negative pathogen (Group 2. Results Group 2 was characterized by a higher incidence of hemorrhagic bullae and septic shock, higher APACHE II scores at 24 h post-admission, a higher rate of thrombocytopenia, and a higher prevalence of chronic liver dysfunction. Gouty arthritis was more prevalent in Group 1. For non-survivors, the incidences of chronic liver dysfunction, chronic renal failure and thrombocytopenia were higher in comparison with those for survivors. Lower level of serum albumin was also demonstrated in the non-survivors as compared to those in survivors. Conclusions Pre-existing chronic liver dysfunction, chronic renal failure, thrombocytopenia and hypoalbuminemia, and post-operative dependence on mechanical ventilation represent poor prognostic factors in monomicrobial necrotizing fasciitis. Patients with gram-negative monobacterial necrotizing fasciitis present with more fulminant sepsis.
Protamine-induced permeabilization of cell envelopes of gram-positive and gram-negative bacteria
DEFF Research Database (Denmark)
Johansen, Charlotte; Verheul, A.; Gram, Lone
1997-01-01
carboxyfluorescein and ATP after 2 to 5 min. Maximum antibacterial activity was reached at alkaline pH and in the absence of divalent cations. The efficient permeabilization of cell envelopes of both gram-positive and gram-negative bacteria suggests that protamine causes a general disruption of the cell envelope...
Defining a role for Hfq in Gram-positive bacteria
DEFF Research Database (Denmark)
Nielsen, Jesper Sejrup; Lei, Lisbeth Kristensen; Ebersbach, Tine
2010-01-01
Small trans-encoded RNAs (sRNAs) modulate the translation and decay of mRNAs in bacteria. In Gram-negative species, antisense regulation by trans-encoded sRNAs relies on the Sm-like protein Hfq. In contrast to this, Hfq is dispensable for sRNA-mediated riboregulation in the Gram-positive species......-dependent and -independent mechanisms, thus adding another layer of complexity to sRNA-mediated riboregulation in Gram-positive species....
Antiadhesion agents against Gram-positive pathogens.
Cascioferro, Stella; Cusimano, Maria Grazia; Schillaci, Domenico
2014-01-01
A fundamental step of Gram-positive pathogenesis is the bacterial adhesion to the host tissue involving interaction between bacterial surface molecules and host ligands. This review is focused on antivirulence compounds that target Gram-positive adhesins and on their potential development as therapeutic agents alternative or complementary to conventional antibiotics in the contrast of pathogens. In particular, compounds that target the sortase A, wall theicoic acid inhibitors, carbohydrates able to bind bacterial proteins and proteins capable of influencing the bacterial adhesion, were described. We further discuss the advantages and disadvantages of this strategy in the development of novel antimicrobials and the future perspective of this research field still at its first steps.
Gram-positive bacteria persisting in the food production environment
DEFF Research Database (Denmark)
Knøchel, Susanne; Harmsen, Morten; Knudsen, Bettina
2008-01-01
Many gram-positive bacteria are able to form aggregates or biofilms and resist external stress factors and some gram-positive pathogenic bacteria such as Listeria monocytogenes and Bacillus cereus may persist in the food production environment for extended periods. Most research has focussed...
International Nuclear Information System (INIS)
Varghese, S.; Jose, S.; Varghese, S.; Kuriakose, S.; Jose, S.
2013-01-01
This paper describes the isolation of carbon nanoparticles (CNPs) from kitchen soot, characterization of the CNPs by UV/visible spectroscopy, SEM and XRD, and their antimicrobial action. The antibacterial activity of the isolated carbon nanoparticles was tested against various pathogenic bacterial strains such as Gram-negative Proteus refrigere and Pseudomonas aeruginosa and Gram-positive Staphylococcus aureus and Streptococcus haemolyticus. The inhibition zones were measured, and it was found that the carbon nanoparticles isolated from natural sources are active against these Gram-negative and Gram-positive bacterial strains
Gram-positive rods prevailing in teeth with apical periodontitis undergoing root canal treatment.
Chávez de Paz, L E; Molander, A; Dahlén, G
2004-09-01
To identify Gram-positive rods from root canals of teeth with apical periodontitis and to examine their associations with other species. Consecutive root canal samples (RCSs) from 139 teeth undergoing root canal treatment were analyzed prospectively for cultivable microbes. Gram-positive rods in the first RCS submitted after chemo-mechanical preparation were categorised to genus level by selective media and gas-liquid chromatography (GLC), and identified to species level by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Associations between organisms were measured by odds ratios (OR). In the first samples submitted a total of 158 Gram-positive rods, 115 Gram-positive cocci, 26 Gram-negative rods and 9 Gram-negative cocci, were identified. At genus levels Gram-positive rods were classified into: Lactobacillus spp. (38%), Olsenella spp. (18%), Propionibacterium spp. (13%), Actinomyces spp. (12%), Bifidobacterium spp. (13%) and Eubacterium spp. (6%). The most frequent species were Olsenella uli, Lactobacillus paracasei and Propionibacterium propionicum. In subsequent samples taken during treatment, Gram-positive rods were also identified, although the number of strains was considerably reduced. Positive associations were observed between members of the genus lactobacilli and Gram-positive cocci (OR>2). Olsenella uli and Lactobacillus spp. predominated over other Gram-positive rods. A possible association exists between Lactobacillus spp. and Gram-positive cocci in root canals of teeth with apical periodontitis receiving treatment.
Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged
2017-01-01
Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.
Lafi, Feras Fawzi
2017-01-27
Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.
Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1.
Tallur, Preeti N; Megadi, Veena B; Ninnekar, Harichandra Z
2008-02-01
A bacterium capable of utilizing pyrethroid pesticide cypermethrin as sole source of carbon was isolated from soil and identified as a Micrococcus sp. The organism also utilized fenvalerate, deltamethrin, perimethrin, 3-phenoxybenzoate, phenol, protocatechuate and catechol as growth substrates. The organism degraded cypermethrin by hydrolysis of ester linkage to yield 3-phenoxybenzoate, leading to loss of its insecticidal activity. 3-Phenoxybenzoate was further metabolized by diphenyl ether cleavage to yield protocatechuate and phenol as evidenced by isolation and identification of metabolites and enzyme activities in the cell-free extracts. Protocatechuate and phenol were oxidized by ortho-cleavage pathway. Thus, the organism was versatile in detoxification and complete mineralization of pyrethroid cypermethrin.
Selenoproteins in Archaea and Gram-positive bacteria.
Stock, Tilmann; Rother, Michael
2009-11-01
Selenium is an essential trace element for many organisms by serving important catalytic roles in the form of the 21st co-translationally inserted amino acid selenocysteine. It is mostly found in redox-active proteins in members of all three domains of life and analysis of the ever-increasing number of genome sequences has facilitated identification of the encoded selenoproteins. Available data from biochemical, sequence, and structure analyses indicate that Gram-positive bacteria synthesize and incorporate selenocysteine via the same pathway as enterobacteria. However, recent in vivo studies indicate that selenocysteine-decoding is much less stringent in Gram-positive bacteria than in Escherichia coli. For years, knowledge about the pathway of selenocysteine synthesis in Archaea and Eukarya was only fragmentary, but genetic and biochemical studies guided by analysis of genome sequences of Sec-encoding archaea has not only led to the characterization of the pathways but has also shown that they are principally identical. This review summarizes current knowledge about the metabolic pathways of Archaea and Gram-positive bacteria where selenium is involved, about the known selenoproteins, and about the respective pathways employed in selenoprotein synthesis.
Selective bowel decontamination results in gram-positive translocation.
Jackson, R J; Smith, S D; Rowe, M I
1990-05-01
Colonization by enteric gram-negative bacteria with subsequent translocation is believed to be a major mechanism for infection in the critically ill patient. Selective bowel decontamination (SBD) has been used to control gram-negative infections by eliminating these potentially pathogenic bacteria while preserving anaerobic and other less pathogenic organisms. Infection with gram-positive organisms and anaerobes in two multivisceral transplant patients during SBD led us to investigate the effect of SBD on gut colonization and translocation. Twenty-four rats received enteral polymixin E, tobramycin, amphotericin B, and parenteral cefotaxime for 7 days (PTA + CEF); 23 received parenteral cefotaxime alone (CEF), 19 received the enteral antibiotics alone (PTA), 21 controls received no antibiotics. Cecal homogenates, mesenteric lymph node (MLN), liver, and spleen were cultured. Only 8% of the PTA + CEF group had gram-negative bacteria in cecal culture vs 52% CEF, 84% PTA, and 100% in controls. Log Enterococcal colony counts were higher in the PTA + CEF group (8.0 + 0.9) vs controls (5.4 + 0.4) P less than 0.01. Translocation of Enterococcus to the MLN was significantly increased in the PTA + CEF group (67%) vs controls (0%) P less than 0.01. SBD effectively eliminates gram-negative organisms from the gut in the rat model. Overgrowth and translocation of Enterococcus suggests that infection with gram-positive organisms may be a limitation of SBD.
Dustborne and airborne gram-positive and gram-negative bacteria in high versus low ERMI homes
The study aimed at investigating Gram-positive and Gram-negative bacteria in moldy and non-moldy homes, as defined by the home's Environmental Relative Moldiness Index (ERMI) value. The ERMI values were determined from floor dust samples in 2010 and 2011 and homes were classified...
Skovbjerg, Susann; Martner, Anna; Hynsjö, Lars; Hessle, Christina; Olsen, Ingar; Dewhirst, Floyd E; Tham, Wilhelm; Wold, Agnes E
2010-01-01
Upon bacterial stimulation, tissue macrophages produce a variety of cytokines that orchestrate the immune response that clears the infection. We have shown that Gram-positives induce higher levels of interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor (TNF) from human peripheral blood mononuclear cells (PBMCs) than do Gram-negatives, which instead induce more of IL-6, IL-8, and IL-10. Here, we study whether these patterns follows or crosses taxonomic borders. PBMCs from blood donors were incubated with UV-inactivated bacteria representing 37 species from five phyla. IL-12, TNF, IL-1beta, IL-6, IL-8, and IL-10 were measured in the supernatants after 24 h and IFN-gamma after 5 days. Irrespective of phylogenetic position, Gram-positive bacteria induced much more IL-12 (nine times more on average) and IFN-gamma (seven times), more TNF (three times), and slightly more IL-1beta (1.5 times) than did Gram-negatives, which instead induced more IL-6 (1.5 times), IL-8 (1.9 times), and IL-10 (3.3 times) than did Gram-positives. A notable exception was the Gram-positive Listeria monocytogenes, which induced very little IL-12, IFN-gamma, and TNF. The results confirm the fundamental difference in innate immune responses to Gram-positive and Gram-negative bacteria, which crosses taxonomic borders and probably reflects differences in cell wall structure.
Directory of Open Access Journals (Sweden)
Des Field
Full Text Available Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G, with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria.
Field, Des; Begley, Maire; O’Connor, Paula M.; Daly, Karen M.; Hugenholtz, Floor; Cotter, Paul D.; Hill, Colin; Ross, R. Paul
2012-01-01
Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G), with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E) with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria. PMID:23056510
Czarny, T L; Perri, A L; French, S; Brown, E D
2014-06-01
The emergence of antibiotic resistance in recent years has radically reduced the clinical efficacy of many antibacterial treatments and now poses a significant threat to public health. One of the earliest studied well-validated targets for antimicrobial discovery is the bacterial cell wall. The essential nature of this pathway, its conservation among bacterial pathogens, and its absence in human biology have made cell wall synthesis an attractive pathway for new antibiotic drug discovery. Herein, we describe a highly sensitive screening methodology for identifying chemical agents that perturb cell wall synthesis, using the model of the Gram-positive bacterium Bacillus subtilis. We report on a cell-based pilot screen of 26,000 small molecules to look for cell wall-active chemicals in real time using an autonomous luminescence gene cluster driven by the promoter of ywaC, which encodes a guanosine tetra(penta)phosphate synthetase that is expressed under cell wall stress. The promoter-reporter system was generally much more sensitive than growth inhibition testing and responded almost exclusively to cell wall-active antibiotics. Follow-up testing of the compounds from the pilot screen with secondary assays to verify the mechanism of action led to the discovery of 9 novel cell wall-active compounds. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Taxonomic characterization of the cellulose-degrading bacterium NCIB 10462
Energy Technology Data Exchange (ETDEWEB)
Dees, C.; Ringleberg, D.; Scott, T.C. [Oak Ridge National Lab., TN (United States); Phelps, T. [Univ. of Tennessee, Knoxville, TN (United States)
1994-06-01
The gram negative cellulase-producing bacterium NCIB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulosa. Since there is renewed interest in cellulose-degrading bacteria for use in bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its proper taxonomic characterization and to further define it`s true metabolic potential. Metabolic and physical characterization of NCIB 10462 revealed that this was an alkalophilic, non-fermentative, gram negative, oxidase positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium was found to have few characteristics consistent with a classification of P. fluorescens with a very low probability match with the genus Sphingomonas. Total lipid analysis did not reveal that any sphingolipid bases are produced by this bacterium. NCIB 10462 was found to grow best aerobically but also grows well in complex media under reducing conditions. NCIB 10462 grew slowly under full anaerobic conditions on complex media but growth on cellulosic media was found only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is it`s ability to degrade cellulose, we suggest it be called Pseudomonas cellulosa.
Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans
Duggan, D. E.; Anderson, A. W.; Elliker, P. R.
1963-01-01
A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780
Górecki, Kamil; Hägerhäll, Cecilia; Drakenberg, Torbjörn
2014-01-15
(23)Na nuclear magnetic resonance (NMR) has previously been used to monitor Na(+) translocation across membranes in gram-negative bacteria and in various other organelles and liposomes using a membrane-impermeable shift reagent to resolve the signals resulting from internal and external Na(+). In this work, the (23)Na NMR method was adapted for measurements of internal Na(+) concentration in the gram-positive bacterium Bacillus subtilis, with the aim of assessing the Na(+) translocation activity of the Mrp (multiple resistance and pH) antiporter complex, a member of the cation proton antiporter-3 (CPA-3) family. The sodium-sensitive growth phenotype observed in a B. subtilis strain with the gene encoding MrpA deleted could indeed be correlated to the inability of this strain to maintain a lower internal Na(+) concentration than an external one. Copyright © 2013 Elsevier Inc. All rights reserved.
Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A
2005-01-01
From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."
Habiba, Khaled (Inventor); Makarov, Vladimir (Inventor); Weiner, Brad R (Inventor); Morell, Gerardo (Inventor)
2018-01-01
The invention provides a composite of silver nanoparticles decorated with graphene quantum dots (Ag-GQDs) using pulsed laser synthesis. The nanocomposites were functionalized with polyethylene glycol (PEG). A concentration of 150 .mu.g/mL of Ag-GQDs, a non-toxic level for human cells, exhibits strong antibacterial activity against both Gram-Positive and Gram-Negative Bacteria.
Description of a bacterium associated with redmouth disease of rainbow trout (Salmo gairdneri)
Ross, A.J.; Rucker, R.R.; Ewing, W.H.
1966-01-01
A description was given of a gram-negative, peritrichously flagellated, fermentative bacterium that was isolated on numerous occasions from kidney tissues of rainbow trout (Salmo gairdneri) afflicted with redmouth disease. Although the bacteria apparently were members of the family Enterobacteriaceae, it was impossible to determine their taxonomic position within the family with certainty. Hence it was recommended that their taxonomic position remain sub judice for the present. As a temporary designation RM bacterium was used. Redmouth disease was transmitted from infected to normal fish through the medium of water.
Erickson, Harold P
2017-08-01
An important question for bacterial cell division is how the invaginating septum can overcome the turgor force generated by the high osmolarity of the cytoplasm. I suggest that it may not need to. Several studies in Gram-negative bacteria have shown that the periplasm is isoosmolar with the cytoplasm. Indirect evidence suggests that this is also true for Gram-positive bacteria. In this case the invagination of the septum takes place within the uniformly high osmotic pressure environment, and does not have to fight turgor pressure. A related question is how the V-shaped constriction of Gram-negative bacteria relates to the plate-like septum of Gram-positive bacteria. I collected evidence that Gram-negative bacteria have a latent capability of forming plate-like septa, and present a model in which septal division is the basic mechanism in both Gram-positive and Gram-negative bacteria. © 2017 WILEY Periodicals, Inc.
RNases and Helicases in Gram-Positive Bacteria.
Durand, Sylvain; Condon, Ciaran
2018-04-01
RNases are key enzymes involved in RNA maturation and degradation. Although they play a crucial role in all domains of life, bacteria, archaea, and eukaryotes have evolved with their own sets of RNases and proteins modulating their activities. In bacteria, these enzymes allow modulation of gene expression to adapt to rapidly changing environments. Today, >20 RNases have been identified in both Escherichia coli and Bacillus subtilis , the paradigms of the Gram-negative and Gram-positive bacteria, respectively. However, only a handful of these enzymes are common to these two organisms and some of them are essential to only one. Moreover, although sets of RNases can be very similar in closely related bacteria such as the Firmicutes Staphylococcus aureus and B. subtilis , the relative importance of individual enzymes in posttranscriptional regulation in these organisms varies. In this review, we detail the role of the main RNases involved in RNA maturation and degradation in Gram-positive bacteria, with an emphasis on the roles of RNase J1, RNase III, and RNase Y. We also discuss how other proteins such as helicases can modulate the RNA-degradation activities of these enzymes.
Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.
Hansen, M T
1978-01-01
The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572
Huang, Liyi; Xuan, Yi; Koide, Yuichiro; Zhiyentayev, Timur; Tanaka, Masamitsu; Hamblin, Michael R
2012-08-01
Antimicrobial photodynamic therapy (APDT) employs a non-toxic photosensitizer (PS) and visible light, which in the presence of oxygen produce reactive oxygen species (ROS), such as singlet oxygen ((1) O(2), produced via Type II mechanism) and hydroxyl radical (HO(.), produced via Type I mechanism). This study examined the relative contributions of (1) O(2) and HO(.) to APDT killing of Gram-positive and Gram-negative bacteria. Fluorescence probes, 3'-(p-hydroxyphenyl)-fluorescein (HPF) and singlet oxygen sensor green reagent (SOSG) were used to determine HO(.) and (1) O(2) produced by illumination of two PS: tris-cationic-buckminsterfullerene (BB6) and a conjugate between polyethylenimine and chlorin(e6) (PEI-ce6). Dimethylthiourea is a HO(.) scavenger, while sodium azide (NaN(3)) is a quencher of (1) O(2). Both APDT and killing by Fenton reaction (chemical generation of HO(.)) were carried out on Gram-positive bacteria (Staphylococcus aureus and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Proteus mirabilis, and Pseudomonas aeruginosa). Conjugate PEI-ce6 mainly produced (1) O(2) (quenched by NaN(3)), while BB6 produced HO(.) in addition to (1) O(2) when NaN(3) potentiated probe activation. NaN(3) also potentiated HPF activation by Fenton reagent. All bacteria were killed by Fenton reagent but Gram-positive bacteria needed a higher concentration than Gram-negatives. NaN(3) potentiated Fenton-mediated killing of all bacteria. The ratio of APDT killing between Gram-positive and Gram-negative bacteria was 2 or 4:1 for BB6 and 25:1 for conjugate PEI-ce6. There was a NaN(3) dose-dependent inhibition of APDT killing using both PEI-ce6 and BB6 against Gram-negative bacteria while NaN(3) almost failed to inhibit killing of Gram-positive bacteria. Azidyl radicals may be formed from NaN(3) and HO(.). It may be that Gram-negative bacteria are more susceptible to HO(.) while Gram-positive bacteria are more susceptible to (1) O(2). The differences in Na
Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P
1995-10-01
The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
Digital Repository Service at National Institute of Oceanography (India)
Bhumika, V.; Ravinder, K.; Korpole, S.; Srinivas, T.N.R.; AnilKumar, P.
A novel Gram-stain-negative, rod-shaped, motile bacterium, designated strain AK21T , was isolated from coastal surface sea water at Visakhapatnam, India. The strain was positive for oxidase, catalase, lipase, L-proline arylamidase...
Directory of Open Access Journals (Sweden)
S Mirdamadi
2011-11-01
Full Text Available In this study, the inhibitory effects of bacteriocins of lactobacilli which were isolated from Iranian traditional dairy products was determined against known gram positive, gram negative and yeast by well diffusion technique. Among 8 isolates with higher capability of bacteriocin production, 2 isolates were selected for further investigations. The bacteriocins were purified by iso-propanol and ammonium sulfate precipitation following by dialysis and chromatography technique. The molecular weight of bacteriocins was determined as 45 to 66/2 KDa. by SDS-page electrophoresis. According to the results, the produced bacteriocins had more inhibition effect on Micrococcus luteus PTCC1169, Staphylococcus epidermidis PTCC1435 as well as Bacillus cereus PTCC1247 and with lesser degree of extent on Listeria monocytogenes PTCC 1301. Results also revealed that, Micrococcus luteus was the most sensitive bacterium among indicator bacteria, while Candid albicans PTCC 5027 identified as the most resistance organism. This research showed that, bacteriocins produced by lactobacilli isolated from traditional dairy products have high potency to be used against microbial pathogens and could be applied as bio-preservative in food products.
Renshaw, Andrew A; Derhagopian, Robert P; Gould, Edwin W
2011-09-01
Although granulomatous lobular mastitis is associated with gram-positive bacilli such as Corynebacterium, this association is not well known. We report 3 cases of mastitis caused by gram-positive bacilli. All 3 abscesses were suppurative with distinct enlarged cystic spaces in which rare gram-positive bacilli were identified. Two cases were also granulomatous. Cultures in all 3 cases were negative. All 3 patients recovered after biopsy and tetracycline-based therapy. Infection in the breast by gram-positive bacilli is associated with a distinct histologic pattern, including cystic spaces in the setting of neutrophilic/granulomatous inflammation that can be recognized and should prompt careful search for the organism within enlarged vacuoles.
21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...
Directory of Open Access Journals (Sweden)
Ruolin Li
2016-05-01
Full Text Available OBJECTIVES: Delay in the treatment of pleural infection may contribute to its high mortality. In this retrospective study, we aimed to evaluate the diagnostic accuracy of pleural adenosine deaminase in discrimination between Gram-negative and Gram-positive bacterial infections of the pleural space prior to selecting antibiotics. METHODS: A total of 76 patients were enrolled and grouped into subgroups according to Gram staining: 1 patients with Gram-negative bacterial infections, aged 53.2±18.6 years old, of whom 44.7% had empyemas and 2 patients with Gram-positive bacterial infections, aged 53.5±21.5 years old, of whom 63.1% had empyemas. The pleural effusion was sampled by thoracocentesis and then sent for adenosine deaminase testing, biochemical testing and microbiological culture. The Mann-Whitney U test was used to examine the differences in adenosine deaminase levels between the groups. Correlations between adenosine deaminase and specified variables were also quantified using Spearman’s correlation coefficient. Moreover, receiver operator characteristic analysis was performed to evaluate the diagnostic accuracy of pleural effusion adenosine deaminase. RESULTS: Mean pleural adenosine deaminase levels differed significantly between Gram-negative and Gram-positive bacterial infections of the pleural space (191.8±32.1 U/L vs 81.0±16.9 U/L, p<0.01. The area under the receiver operator characteristic curve was 0.689 (95% confidence interval: 0.570, 0.792, p<0.01 at the cutoff value of 86 U/L. Additionally, pleural adenosine deaminase had a sensitivity of 63.2% (46.0-78.2%; a specificity of 73.7% (56.9-86.6%; positive and negative likelihood ratios of 2.18 and 0.50, respectively; and positive and negative predictive values of 70.6% and 66.7%, respectively. CONCLUSIONS: Pleural effusion adenosine deaminase is a helpful alternative biomarker for early and quick discrimination of Gram-negative from Gram-positive bacterial infections of the
Cellular reprogramming by gram-positive bacterial components: a review.
LENUS (Irish Health Repository)
Buckley, Julliette M
2012-02-03
LPS tolerance has been the focus of extensive scientific and clinical research over the last several decades in an attempt to elucidate the sequence of changes that occur at a molecular level in tolerized cells. Tolerance to components of gram-positive bacterial cell walls such as bacterial lipoprotein and lipoteichoic acid is a much lesser studied, although equally important, phenomenon. This review will focus on cellular reprogramming by gram-positive bacterial components and examines the alterations in cell surface receptor expression, changes in intracellular signaling, gene expression and cytokine production, and the phenomenon of cross-tolerance.
Directory of Open Access Journals (Sweden)
Azam A
2012-12-01
Full Text Available Ameer Azam,1,2 Arham S Ahmed,2 Mohammad Oves,3 Mohammad S Khan,3 Sami S Habib,1 Adnan Memic11Centre of Nanotechnology, King Abdulaziz University, Jeddah, Saudi Arabia; 2Centre of Excellence in Materials Science (Nanomaterials, 3Department of Agricultural Microbiology, Aligarh Muslim University, Aligarh, IndiaBackground: Nanomaterials have unique properties compared to their bulk counterparts. For this reason, nanotechnology has attracted a great deal of attention from the scientific community. Metal oxide nanomaterials like ZnO and CuO have been used industrially for several purposes, including cosmetics, paints, plastics, and textiles. A common feature that these nanoparticles exhibit is their antimicrobial behavior against pathogenic bacteria. In this report, we demonstrate the antimicrobial activity of ZnO, CuO, and Fe2O3 nanoparticles against Gram-positive and Gram-negative bacteria.Methods and results: Nanosized particles of three metal oxides (ZnO, CuO, and Fe2O3 were synthesized by a sol–gel combustion route and characterized by X-ray diffraction, Fourier-transform infrared spectroscopy, and transmission electron microscopy techniques. X-ray diffraction results confirmed the single-phase formation of all three nanomaterials. The particle sizes were observed to be 18, 22, and 28 nm for ZnO, CuO, and Fe2O3, respectively. We used these nanomaterials to evaluate their antibacterial activity against both Gram-negative (Escherichia coli and Pseudomonas aeruginosa and Gram-positive (Staphylococcus aureus and Bacillus subtilis bacteria.Conclusion: Among the three metal oxide nanomaterials, ZnO showed greatest antimicrobial activity against both Gram-positive and Gram-negative bacteria used in this study. It was observed that ZnO nanoparticles have excellent bactericidal potential, while Fe2O3 nanoparticles exhibited the least bactericidal activity. The order of antibacterial activity was demonstrated to be the following: ZnO > CuO > Fe2O3
Verloes, R.; Atassi, G.; Dumont, P.; Kanarek, L.
1981-01-01
The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to [female BALB/c (H2d) X male DBA/2 (H2d)]F1 hybrid mice, hereafter referred to as CDF1 mice. In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent. Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice. By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells. The i.p. route was notably superior to the i.v. route. When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary. Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. PMID:7470382
The in vivo association of manganese with the chromosome of Micrococcus radiodurans
International Nuclear Information System (INIS)
Leibowitz, P.J.; Schwartzberg, L.S.; Bruce, A.K.
1976-01-01
Extremely high levels of paramagnetic manganese (Mn 2+ ) which quench phosphorescent reactions have been found to inhibit the formation of thymine-containing dimers in M. radiodurans. Lowering the concentration of Mn 2+ in the culture medium resulted in a lower intracellular concentration of Mn 2+ , an increase in the UV-sensitivity of this bacterium, and a larger photochemical yield of thymine-containing dimers. High levels of paramagnetic Mn 2+ were not found in other test organisms which are more sensitive to UV-irradiation. One interpretation of this data is that in Micrococcus radiodurans Mn2 + + may bind to the chromosome and thereby reduce the photochemical yield of thymine-containing dimers. (author)
Energy Technology Data Exchange (ETDEWEB)
Tamboli, Dhawal P.; Lee, Dae Sung, E-mail: daesung@knu.ac.kr
2013-09-15
Highlights: • Bacterial extracelluar enzymes stabilized the silver nanoparticles (AgNPs). • AgNPs formation was characterized by analytical techniques such as UV–vis, TEM, and FTIR. • AgNPs showed obvious antimicrobial activity against both gram positive and gram negative microorganisms. • A mechanism of AgNPs’ antimicrobial activity was proposed. -- Abstract: The development of eco-friendly and reliable processes for the synthesis of nanoparticles has attracted considerable interest in nanotechnology. In this study, an extracellular enzyme system of a newly isolated microorganism, Exiguobacterium sp. KNU1, was used for the reduction of AgNO{sub 3} solutions to silver nanoparticles (AgNPs). The extracellularly biosynthesized AgNPs were characterized by UV–vis spectroscopy, Fourier transform infra-red spectroscopy and transmission electron microscopy. The AgNPs were approximately 30 nm (range 5–50 nm) in size, well-dispersed and spherical. The AgNPs were evaluated for their antimicrobial effects on different gram negative and gram positive bacteria using the minimum inhibitory concentration method. Reasonable antimicrobial activity against Salmonella typhimurium, Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus was observed. The morphological changes occurred in all the microorganisms tested. In particular, E. coli exhibited DNA fragmentation after being treated with the AgNPs. Finally, the mechanism for their bactericidal activity was proposed according to the results of scanning electron microscopy and single cell gel electrophoresis.
International Nuclear Information System (INIS)
Tamboli, Dhawal P.; Lee, Dae Sung
2013-01-01
Highlights: • Bacterial extracelluar enzymes stabilized the silver nanoparticles (AgNPs). • AgNPs formation was characterized by analytical techniques such as UV–vis, TEM, and FTIR. • AgNPs showed obvious antimicrobial activity against both gram positive and gram negative microorganisms. • A mechanism of AgNPs’ antimicrobial activity was proposed. -- Abstract: The development of eco-friendly and reliable processes for the synthesis of nanoparticles has attracted considerable interest in nanotechnology. In this study, an extracellular enzyme system of a newly isolated microorganism, Exiguobacterium sp. KNU1, was used for the reduction of AgNO 3 solutions to silver nanoparticles (AgNPs). The extracellularly biosynthesized AgNPs were characterized by UV–vis spectroscopy, Fourier transform infra-red spectroscopy and transmission electron microscopy. The AgNPs were approximately 30 nm (range 5–50 nm) in size, well-dispersed and spherical. The AgNPs were evaluated for their antimicrobial effects on different gram negative and gram positive bacteria using the minimum inhibitory concentration method. Reasonable antimicrobial activity against Salmonella typhimurium, Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus was observed. The morphological changes occurred in all the microorganisms tested. In particular, E. coli exhibited DNA fragmentation after being treated with the AgNPs. Finally, the mechanism for their bactericidal activity was proposed according to the results of scanning electron microscopy and single cell gel electrophoresis
Daptomycin treatment in Gram-positive vascular graft infections
Directory of Open Access Journals (Sweden)
Francisco Arnaiz de las Revillas
2018-03-01
Full Text Available Background: Daptomycin is a bactericidal antibiotic approved for the treatment of skin and soft tissue infections and right-side endocarditis. However, there is a lack of published data outlining its usefulness in vascular graft infections (VGI. The aim of this study was to describe the clinical experience of daptomycin use in the treatment of VGI caused by Gram-positive bacteria. Methods: This was a retrospective cohort study of patients diagnosed with VGI receiving daptomycin at a tertiary care hospital during the period January 2010 to December 2012. Results: Of a total 1066 consecutive patients who had undergone vascular grafts (VG, 25 were diagnosed with VGI. Fifteen of these patients (11 prosthetic VG, three autologous VG, one both types received daptomycin (median dose 6.7 mg/kg/day, range 4.1–7.1 mg/kg/day; median age 69 years, range 45–83 years; 80% male. The infected bypass was removed in 13 cases. The most common reason for selecting daptomycin was kidney failure (53%. The Gram-positive organisms isolated were coagulase-negative Staphylococcus (n = 10, Staphylococcus aureus (n = 3 (two methicillin-resistant S. aureus, Enterococcus faecium (n = 2, and Enterococcus faecalis (n = 1. The mean follow-up was 69 months (interquartile range 48–72 months. Ten patients (66.7% achieved complete healing of the VGI. A recurrence of the infection was observed in 100% of patients in whom the bypass was not removed. Among patients who did not achieve complete healing, one needed a supracondylar amputation and one died as a consequence of infection. Five patients received treatment with rifampicin in addition to daptomycin and they were all cured. Conclusions: The use of daptomycin and surgery for Gram-positive VGI was effective and well tolerated, and this may be a good alternative for the treatment of VGI in patients with peripheral arterial disease in whom renal insufficiency is common. Keywords: Daptomycin, Gram-positive, Vascular
The mechanisms of Micrococcus radiodurans radioresistance
International Nuclear Information System (INIS)
Samojlenko, I.I.
1983-01-01
Modern representations on molecular mechanisms of Micrococcus radiodurans viability under the effect of ionizing radiation have been considered. Factors conditioning a high level of micrococcus cell radiostability have been analyzed: peculiarities of structure of a cell wall, DNA, membranes; excess of genetic information; multiplicity of DNA implantation points to a membrane; high level of antioxidation and antiradical systems. It has been shown that on efficiency of accurate, properly balanced system of DNA repair combined with above Micrococcus radiodurant properties provide a high microorganism radioresistance
Clinical update on linezolid in the treatment of Gram-positive bacterial infections
Ager, Sally; Gould, Kate
2012-01-01
Gram-positive pathogens are a significant cause of morbidity and mortality in both community and health care settings. Glycopeptides have traditionally been the antibiotics of choice for multiresistant Gram-positive pathogens but there are problems with their use, including the emergence of glycopeptide-resistant strains, tissue penetration, and achieving and monitoring adequate serum levels. Newer antibiotics such as linezolid, a synthetic oxazolidinone, are available for the treatment of resistant Gram-positive bacteria. Linezolid is active against a wide range of Gram-positive bacteria and has been generally available for the treatment of Gram-positive infections since 2000. There are potential problems with linezolid use, including its bacteriostatic action and the relatively high incidence of reported adverse effects, particularly with long-term use. Long-term use may also be complicated by the development of resistance. However, linezolid has been shown to be clinically useful in the treatment of several serious infections where traditionally bacteriocidal agents have been required and many of its adverse effects are reversible on cessation. It has also been shown to be a cost-effective treatment option in several studies, with its high oral bioavailability allowing an early change from intravenous to oral formulations with consequent earlier patient discharge and lower inpatient costs. PMID:22787406
Digital Repository Service at National Institute of Oceanography (India)
Krishna, K.K.; Bhumika, V.; Thomas, M.; AnilKumar, P.; Srinivas, T.N.R.
A novel Gram-negative, spiral shaped, motile bacterium, designated strain NIO-S6T, was isolated from a sediment sample collected from Offshore Rameswaram, Tamilnadu, India. Strain NIO-S6 sup(T) was found to be positive for oxidase, DNase and lysine...
Genome analysis of the Anerobic Thermohalophilic bacterium Halothermothrix orenii
Energy Technology Data Exchange (ETDEWEB)
Mavromatis, Konstantinos; Ivanova, Natalia; Anderson, Iain; Lykidis, Athanasios; Hooper, Sean D.; Sun, Hui; Kunin, Victor; Lapidus, Alla; Hugenholtz, Philip; Patel, Bharat; Kyrpides, Nikos C.
2008-11-03
Halothermothirx orenii is a strictly anaerobic thermohalophilic bacterium isolated from sediment of a Tunisian salt lake. It belongs to the order Halanaerobiales in the phylum Firmicutes. The complete sequence revealed that the genome consists of one circular chromosome of 2578146 bps encoding 2451 predicted genes. This is the first genome sequence of an organism belonging to the Haloanaerobiales. Features of both Gram positive and Gram negative bacteria were identified with the presence of both a sporulating mechanism typical of Firmicutes and a characteristic Gram negative lipopolysaccharide being the most prominent. Protein sequence analyses and metabolic reconstruction reveal a unique combination of strategies for thermophilic and halophilic adaptation. H. orenii can serve as a model organism for the study of the evolution of the Gram negative phenotype as well as the adaptation under thermohalophilic conditions and the development of biotechnological applications under conditions that require high temperatures and high salt concentrations.
Lifescience Database Archive (English)
Full Text Available 16885502 Cellular reprogramming by gram-positive bacterial components: a review. Bu...(.csml) Show Cellular reprogramming by gram-positive bacterial components: a review. PubmedID 16885502 Title... Cellular reprogramming by gram-positive bacterial components: a review. Authors
Digital Repository Service at National Institute of Oceanography (India)
Nupur; Bhumika, V.; Srinivas, T.N.R.; AnilKumar, P.
A novel Gram-negative, rod-shaped, non-motile bacterium, designated strain N1 sup(T), was isolated from a marine water sample collected from the sea shore, Bay of Bengal, Visakhapatnam, India. The strain was positive for starch hydrolysis, nitrate...
Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.
Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S
2017-09-01
Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.
Raman Spectroscopy of Xylitol Uptake and Metabolism in Gram-Positive and Gram-Negative Bacteria▿
Palchaudhuri, Sunil; Rehse, Steven J.; Hamasha, Khozima; Syed, Talha; Kurtovic, Eldar; Kurtovic, Emir; Stenger, James
2011-01-01
Visible-wavelength Raman spectroscopy was used to investigate the uptake and metabolism of the five-carbon sugar alcohol xylitol by Gram-positive viridans group streptococcus and the two extensively used strains of Gram-negative Escherichia coli, E. coli C and E. coli K-12. E. coli C, but not E. coli K-12, contains a complete xylitol operon, and the viridans group streptococcus contains an incomplete xylitol operon used to metabolize the xylitol. Raman spectra from xylitol-exposed viridans group streptococcus exhibited significant changes that persisted even in progeny grown from the xylitol-exposed mother cells in a xylitol-free medium for 24 h. This behavior was not observed in the E. coli K-12. In both viridans group streptococcus and the E. coli C derivative HF4714, the metabolic intermediates are stably formed to create an anomaly in bacterial normal survival. The uptake of xylitol by Gram-positive and Gram-negative pathogens occurs even in the presence of other high-calorie sugars, and its stable integration within the bacterial cell wall may discontinue bacterial multiplication. This could be a contributing factor for the known efficacy of xylitol when taken as a prophylactic measure to prevent or reduce occurrences of persistent infection. Specifically, these bacteria are causative agents for several important diseases of children such as pneumonia, otitis media, meningitis, and dental caries. If properly explored, such an inexpensive and harmless sugar-alcohol, alone or used in conjunction with fluoride, would pave the way to an alternative preventive therapy for these childhood diseases when the causative pathogens have become resistant to modern medicines such as antibiotics and vaccine immunotherapy. PMID:21037297
Genome analysis of the anaerobic thermohalophilic bacterium Halothermothrix orenii.
Directory of Open Access Journals (Sweden)
Konstantinos Mavromatis
Full Text Available Halothermothirx orenii is a strictly anaerobic thermohalophilic bacterium isolated from sediment of a Tunisian salt lake. It belongs to the order Halanaerobiales in the phylum Firmicutes. The complete sequence revealed that the genome consists of one circular chromosome of 2578146 bps encoding 2451 predicted genes. This is the first genome sequence of an organism belonging to the Haloanaerobiales. Features of both Gram positive and Gram negative bacteria were identified with the presence of both a sporulating mechanism typical of Firmicutes and a characteristic Gram negative lipopolysaccharide being the most prominent. Protein sequence analyses and metabolic reconstruction reveal a unique combination of strategies for thermophilic and halophilic adaptation. H. orenii can serve as a model organism for the study of the evolution of the Gram negative phenotype as well as the adaptation under thermohalophilic conditions and the development of biotechnological applications under conditions that require high temperatures and high salt concentrations.
The in vivo association of manganese with the chromosome of Micrococcus radiodurans
Energy Technology Data Exchange (ETDEWEB)
Leibowitz, P J; Schwartzberg, L S; Bruce, A K [State Univ. of New York, Buffalo (USA). Dept. of Biology
1976-01-01
Extremely high levels of paramagnetic manganese (Mn/sup 2 +/) which quench phosphorescent reactions have been found to inhibit the formation of thymine-containing dimers in M. radiodurans. Lowering the concentration of Mn/sup 2 +/ in the culture medium resulted in a lower intracellular concentration of Mn/sup 2 +/, an increase in the uv-sensitivity of this bacterium, and a larger photochemical yield of thymine-containing dimers. High levels of paramagnetic Mn/sup 2 +/ were not found in other test organisms which are more sensitive to uv-irradiation. One interpretation of this data is that in Micrococcus radiodurans Mn2/sup +/+ may bind to the chromosome and thereby reduce the photochemical yield of thymine-containing dimers.
Directory of Open Access Journals (Sweden)
Iqbal, M.
2011-01-01
Full Text Available Microorganisms adhere to non-living material or living tissue, and form biofilms made up of extracellular polymers/slime. Biofilm-associated microorganisms behave differently from free-floating bacteria with respect to growth rates and ability to resist antimicrobial treatments and therefore pose a public health problem. The objective of this study is to detect the prevalence of biofilm producers among Gram positive and Gram negative bacteria isolated from clinical specimens, and to study their antimicrobial susceptibility pattern. The study was carried out from October 2009 to March 2010, at the Department of Microbiology, Army Medical College/ National University of Sciences and Technology (NUST, Rawalpindi, Pakistan. Clinical specimens were received from various wards of a tertiary care hospital. These were dealt by standard microbiological procedures. Gram positive and Gram negative bacteria isolated were subjected to biofilm detection by congo red agar method (CRA. Antimicrobial susceptibility testing of those isolates, which showed positive results (slime production, was done according to the Kirby-Bauer disc diffusion technique. A total of 150 isolates were tested for the production of biofilm/slime. Among them, 81 isolates showed positive results. From these 81, 51 were Gram positive and 30 were Gram negative. All the 81(54% slime producers showed reduced susceptibility to majority of antibiotics. Bacterial biofilms are an important virulence factor associated with chronic nosocomial infection. Detection of biofilm forming organisms can help in appropriate antibiotic choice.
From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis
Crawshaw, Samuel G.; Wipat, Anil
2001-01-01
Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943
A classification system for plasmids from Enterococci and other Gram-positive bacteria
DEFF Research Database (Denmark)
Jensen, Lars Bogø; Garcia-Migura, Lourdes; Valenzuela, Antonio Jesus Sanchez
2010-01-01
A classification system for plasmids isolated from enterococci and other Gram-positive bacteria was developed based on 111 published plasmid sequences from enterococci and other Gram-positive bacteria; mostly staphylococci. Based on PCR amplification of conserved areas of the replication initiating....... Furthermore, conjugation experiments were performed obtaining 30 transconjugants when selecting for antimicrobial resistance. Among them 19 gave no positive amplicons indicating presence of rep-families not tested for in this experimental setup....
Directory of Open Access Journals (Sweden)
Landry Blanc
Full Text Available Innate immune recognition is the first line of host defense against invading microorganisms. It is a based on the detection, by pattern recognition receptors (PRRs, of invariant molecular signatures that are unique to microorganisms. TLR2 is a PRR that plays a major role in the detection of Gram-positive bacteria by recognizing cell envelope lipid-linked polymers, also called macroamphiphiles, such as lipoproteins, lipoteichoic acids and mycobacterial lipoglycans. These microbe-associated molecular patterns (MAMPs display a structure based on a lipid anchor, being either an acylated cysteine, a glycosylated diacylglycerol or a mannosyl-phosphatidylinositol respectively, and having in common a diacylglyceryl moiety. A fourth class of macroamphiphile, namely lipoglycans, whose lipid anchor is made, as for lipoteichoic acids, of a glycosylated diacylglycerol unit rather than a mannosyl-phosphatidylinositol, is found in Gram-positive bacteria and produced by certain Actinobacteria, including Micrococcus luteus, Stomatococcus mucilaginosus and Corynebacterium glutamicum. We report here that these alternative lipoglycans are also recognized by TLR2 and that they stimulate TLR2-dependant cytokine production, including IL-8, TNF-α and IL-6, and cell surface co-stimulatory molecule CD40 expression by a human macrophage cell line. However, they differ by their co-receptor requirement and the magnitude of the innate immune response they elicit. M. luteus and S. mucilaginosus lipoglycans require TLR1 for recognition by TLR2 and induce stronger responses than C. glutamicum lipoglycan, sensing of which by TLR2 is dependent on TLR6. These results expand the repertoire of MAMPs recognized by TLR2 to lipoglycans based on a glycosylated diacylglycerol lipid anchor and reinforce the paradigm that macroamphiphiles based on such an anchor, including lipoteichoic acids and alternative lipoglycans, induce TLR2-dependant innate immune responses.
Farrell, David J; Robbins, Marion; Rhys-Williams, William; Love, William G
2010-06-01
The antibacterial activity of XF-73, a dicationic porphyrin drug, was investigated against a range of Gram-positive and Gram-negative bacteria with known antibiotic resistance profiles, including resistance to cell wall synthesis, protein synthesis, and DNA and RNA synthesis inhibitors as well as cell membrane-active antibiotics. Antibiotic-sensitive strains for each of the bacterial species tested were also included for comparison purposes. XF-73 was active [minimum inhibitory concentration (MIC) 0.25-4 mg/L] against all of the Gram-positive bacteria tested, irrespective of the antibiotic resistance profile of the isolates, suggesting that the mechanism of action of XF-73 is unique compared with the major antibiotic classes. Gram-negative activity was lower (MIC 1 mg/L to > 64 mg/L). Minimum bactericidal concentration data confirmed that the activity of XF-73 was bactericidal. Time-kill kinetics against healthcare-associated and community-associated meticillin-resistant Staphylococcus aureus isolates demonstrated that XF-73 was rapidly bactericidal, with > 5 log(10) kill obtained after 15 min at 2 x MIC, the earliest time point sampled. The post-antibiotic effect (PAE) for XF-73 under conditions where the PAE for vancomycin was 5.4 h. XF-73 represents a novel broad-spectrum Gram-positive antibacterial drug with potentially beneficial characteristics for the treatment and prevention of Gram-positive bacterial infections. 2010. Published by Elsevier B.V.
Extraction, purification and characterization of a protease from Micrococcus sp. VKMM 037.
Manikandan, Muthu; Kannan, Vijayaraghavan; Pasić, Lejla
2011-10-01
The haloalkaliphilic bacterium Micrococcus sp. VKMM 037, isolated from an effluent of the caustic soda industry, was found to produce a protease. Maximal proteolytic activity was observed in cell culture grown at 40 degrees C using 2% (w/v) glycerol, 2% (w/v) beef extract and 2% (w/v) peptone as nutrients in medium also containing 0.85 M NaCl with a pH of 10.0. An efficient purification procedure combining ammonium sulphate precipitation and Q-Sepharose ion-exchange chromatography was developed. The purified 41 kDa protease was stable in a temperature range between 20 degrees C and 60 degrees C. The protease remained active over a wide range of pH values (4.0-12.0) and NaCl concentrations (0-3.42 M) with an optimum at pH 10.0 and 0.85 M NaCl, respectively. Furthermore, the enzyme remained stable or was only marginally inhibited in the presence of various organic solvents, surfactants and reducing agents. The purified protease of Micrococcus sp. VKMM 037 efficiently removed blood stains within 40 minutes of treatment. Given the biochemical characteristics determined, this novel protease could be exploited as an additive in the detergent industry and also for the synthesis of biomolecules and the degradation of protein.
Wieser, Monika; Denner, Ewald B M; Kämpfer, Peter; Schumann, Peter; Tindall, Brian; Steiner, Ulrike; Vybiral, Dietmar; Lubitz, Werner; Maszenan, A M; Patel, B K C; Seviour, Robert J; Radax, Christian; Busse, Hans-Jürgen
2002-03-01
Nine yellow-pigmented, spherical bacterial strains isolated from a medieval wall painting (strain D7), from indoor air (strains 3, 6, 7, 13C2, 38, 83 and 118) and from an activated-sludge plant (strain Ballarat) were classified by a polyphasic approach. Analyses of the 16S rRNA gene sequences of three representatives (strains D7, 118 and Ballarat) indicated that they all belong to the genus Micrococcus. The three isolates shared the highest sequence similarities with Micrococcus luteus DSM 20030T (97.9-98%), Micrococcus antarcticus AS 1.2372T (97.9-98.3%) and Micrococcus lylae DSM 20315T (97.5-97.9%). DNA-DNA reassociation studies clearly demonstrated that all nine isolates belong to the species M. luteus. However, neither their chemotaxonomic features nor their physiological and biochemical properties were consistent with those of M. luteus DSM 20030T. In contrast to M. luteus DSM 20030T, all isolates investigated possessed MK-8(H2) as the major respiratory quinone, and strain Ballarat had an A4alpha peptidoglycan type. On the basis of analyses of their Fourier transform-infrared spectroscopy spectra, isolates D7, 3, 6, 7, 13C2, 38, 83 and 118 could be grouped into a single cluster separate from M. luteus DSM 20030T, strain Ballarat and M. lylae DSM 20315T. In addition, all these isolates could be distinguished from M. luteus DSM 20030T by their ability to assimilate D-maltose, D-trehalose, DL-3-hydroxybutyrate, DL-lactate, pyruvate and L-histidine and to hydrolyse casein. Strains D7, 3, 6, 7, 13C2, 38, 83 and 118 differed from both M. luteus DSM 20030T and strain Ballarat by their ability to assimilate acetate, L-phenylalanine, L-serine and phenylacetate. Furthermore, REP-PCR fingerprinting yielded one common band for these strains, whereas this band was not observed for M. luteus DSM 20030T, strain Ballarat or M. lylae DSM 20315T. On the basis of these data, the species M. luteus can be divided into three biovars that are distinguished by several chemotaxonomic
Laine, M J; Nakhei, H; Dreier, J; Lehtilä, K; Meletzus, D; Eichenlaub, R; Metzler, M C
1996-01-01
In this paper we describe transformation of Clavibacter michiganensis subsp. sepedonicus, the potato ring rot bacterium, with plasmid vectors. Three of the plasmids used, pDM100, pDM302, and pDM306, contain the origin of replication from pCM1, a native plasmid of C. michiganensis subsp. michiganensis. We constructed two new cloning vectors, pHN205 and pHN216, by using the origin of replication of pCM2, another native plasmid of C. michiganensis subsp. michiganensis. Plasmids pDM302, pHN205, a...
Ratzinger, Franz; Dedeyan, Michel; Rammerstorfer, Matthias; Perkmann, Thomas; Burgmann, Heinz; Makristathis, Athanasios; Dorffner, Georg; Loetsch, Felix; Blacky, Alexander; Ramharter, Michael
2015-01-01
Adequate early empiric antibiotic therapy is pivotal for the outcome of patients with bloodstream infections. In clinical practice the use of surrogate laboratory parameters is frequently proposed to predict underlying bacterial pathogens; however there is no clear evidence for this assumption. In this study, we investigated the discriminatory capacity of predictive models consisting of routinely available laboratory parameters to predict the presence of Gram-positive or Gram-negative bacteremia. Major machine learning algorithms were screened for their capacity to maximize the area under the receiver operating characteristic curve (ROC-AUC) for discriminating between Gram-positive and Gram-negative cases. Data from 23,765 patients with clinically suspected bacteremia were screened and 1,180 bacteremic patients were included in the study. A relative predominance of Gram-negative bacteremia (54.0%), which was more pronounced in females (59.1%), was observed. The final model achieved 0.675 ROC-AUC resulting in 44.57% sensitivity and 79.75% specificity. Various parameters presented a significant difference between both genders. In gender-specific models, the discriminatory potency was slightly improved. The results of this study do not support the use of surrogate laboratory parameters for predicting classes of causative pathogens. In this patient cohort, gender-specific differences in various laboratory parameters were observed, indicating differences in the host response between genders. PMID:26522966
Draft Genome Sequence of the Efficient Bioflocculant-Producing Bacterium Paenibacillus sp. Strain A9
Liu, Jin-liang; Hu, Xiao-min
2013-01-01
Paenibacillus sp. strain A9 is an important bioflocculant-producing bacterium, isolated from a soil sample, and is pale pink-pigmented, aerobic, and Gram-positive. Here, we report the draft genome sequence and the initial findings from a preliminary analysis of strain A9, which is a novel species of Paenibacillus. PMID:23618713
Tran, Phat; Arnett, Avery; Jarvis, Courtney; Mosley, Thomas; Tran, Khien; Hanes, Rob; Webster, Dan; Mitchell, Kelly; Dominguez, Leo; Hamood, Abdul; Reid, Ted W
2017-09-01
Biofilm formation is a problem for solid and sponge-type scleral buckles. This can lead to complications that require removal of the buckle, and result in vision loss due to related ocular morbidity, primarily infection, or recurrent retinal detachment. We investigate the ability of a covalent organo-selenium coating to inhibit biofilm formation on a scleral buckle. Sponge and solid Labtican brand scleral buckles were coated with organo-selenium coupled to a silyation reagent. Staphylococcus aureus biofilm formation was monitored by a standard colony-forming unit assay and the confocal laser scanning microscopy, while Pseudomonas aeruginosa biofilm formation was examined by scanning electron microscopy. Stability studies were done, by soaking in phosphate buffer saline (PBS) at room temperature for 2 months. Toxicity against human corneal epithelial cell was examined by growing the cells in the presence of organo-selenium-coated scleral buckles. The organo-selenium coating inhibited biofilm formation by gram-negative and gram-positive bacteria. The buckle coatings also were shown to be fully active after soaking in PBS for 2 months. The organo-selenium coatings had no effect on the viability of human corneal epithelial cells. Organo-selenium can be used to covalently coat a scleral buckle, which is stable and inhibits biofilm formation for gram-negative and gram-positive bacteria. The organo-selenium buckle coating was stable and nontoxic to cell culture. This technology provides a means to inhibit bacterial attachment to devices attached to the eye, without damage to ocular cells.
Kline, Kimberly A; Lewis, Amanda L
2016-04-01
Gram-positive bacteria are a common cause of urinary-tract infection (UTI), particularly among individuals who are elderly, pregnant, or who have other risk factors for UTI. Here we review the epidemiology, virulence mechanisms, and host response to the most frequently isolated Gram-positive uropathogens: Staphylococcus saprophyticus, Enterococcus faecalis, and Streptococcus agalactiae. We also review several emerging, rare, misclassified, and otherwise underreported Gram-positive pathogens of the urinary tract including Aerococcus, Corynebacterium, Actinobaculum, and Gardnerella. The literature strongly suggests that urologic diseases involving Gram-positive bacteria may be easily overlooked due to limited culture-based assays typically utilized for urine in hospital microbiology laboratories. Some UTIs are polymicrobial in nature, often involving one or more Gram-positive bacteria. We herein review the risk factors and recent evidence for mechanisms of bacterial synergy in experimental models of polymicrobial UTI. Recent experimental data has demonstrated that, despite being cleared quickly from the bladder, some Gram-positive bacteria can impact pathogenic outcomes of co-infecting organisms. When taken together, the available evidence argues that Gram-positive bacteria are important uropathogens in their own right, but that some can be easily overlooked because they are missed by routine diagnostic methods. Finally, a growing body of evidence demonstrates that a surprising variety of fastidious Gram-positive bacteria may either reside in or be regularly exposed to the urinary tract and further suggests that their presence is widespread among women, as well as men. Experimental studies in this area are needed; however, there is a growing appreciation that the composition of bacteria found in the bladder could be a potentially important determinant in urologic disease, including susceptibility to UTI.
Dolch, Michael E; Janitza, Silke; Boulesteix, Anne-Laure; Graßmann-Lichtenauer, Carola; Praun, Siegfried; Denzer, Wolfgang; Schelling, Gustav; Schubert, Sören
2016-12-01
Identification of microorganisms in positive blood cultures still relies on standard techniques such as Gram staining followed by culturing with definite microorganism identification. Alternatively, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry or the analysis of headspace volatile compound (VC) composition produced by cultures can help to differentiate between microorganisms under experimental conditions. This study assessed the efficacy of volatile compound based microorganism differentiation into Gram-negatives and -positives in unselected positive blood culture samples from patients. Headspace gas samples of positive blood culture samples were transferred to sterilized, sealed, and evacuated 20 ml glass vials and stored at -30 °C until batch analysis. Headspace gas VC content analysis was carried out via an auto sampler connected to an ion-molecule reaction mass spectrometer (IMR-MS). Measurements covered a mass range from 16 to 135 u including CO2, H2, N2, and O2. Prediction rules for microorganism identification based on VC composition were derived using a training data set and evaluated using a validation data set within a random split validation procedure. One-hundred-fifty-two aerobic samples growing 27 Gram-negatives, 106 Gram-positives, and 19 fungi and 130 anaerobic samples growing 37 Gram-negatives, 91 Gram-positives, and two fungi were analysed. In anaerobic samples, ten discriminators were identified by the random forest method allowing for bacteria differentiation into Gram-negative and -positive (error rate: 16.7 % in validation data set). For aerobic samples the error rate was not better than random. In anaerobic blood culture samples of patients IMR-MS based headspace VC composition analysis facilitates bacteria differentiation into Gram-negative and -positive.
Richmond, Robert Chaffee (Inventor); Schramm, Jr., Harry F. (Inventor); Defalco, Francis G. (Inventor); Farris, III, Alex F. (Inventor)
2012-01-01
Systems and methods for the use of compounds from the Hofmeister series coupled with specific pH and temperature to provide rapid physico-chemical-managed killing of penicillin-resistant static and growing Gram-positive and Gram-negative vegetative bacteria. The systems and methods represent the more general physico-chemical enhancement of susceptibility for a wide range of pathological macromolecular targets to clinical management by establishing the reactivity of those targets to topically applied drugs or anti-toxins.
Positive role of peptidoglycan breaks in lactococcal biofilm formation
Mercier, C; Durrieu, C; Briandet, R; Domakova, E; Tremblay, J; Buist, G; Kulakauskas, S
2002-01-01
Bacterial attachment to solid matrices depends on adhesive molecules present on the cell surface. Here we establish a positive correlation between peptidoglycan (PG) breaks, rather than particular molecules, and biofilm-forming capacity in the Gram-positive bacterium Lactococcus lactis. The L.
Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei
2011-06-10
The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.
Biswas, Bipul; Rogers, Kimberly; McLaughlin, Fredrick; Yadav, Anand
2013-01-01
Aim. To determine the antimicrobial potential of guava (Psidium guajava) leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis) and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus) which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water). The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties. PMID:24223039
Directory of Open Access Journals (Sweden)
Bipul Biswas
2013-01-01
Full Text Available Aim. To determine the antimicrobial potential of guava (Psidium guajava leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water. The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties.
Nicotinoprotein methanol dehydrogenase enzymes in Gram-positive methylotrophic bacteria
Hektor, Harm J.; Kloosterman, Harm; Dijkhuizen, Lubbert
2000-01-01
A novel type of alcohol dehydrogenase enzyme has been characterized from Gram-positive methylotrophic (Bacillus methanolicus, the actinomycetes Amycolatopsis methanolica and Mycobacterium gastri) and non-methylotrophic bacteria (Rhodococcus strains). Its in vivo role is in oxidation of methanol and
Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S
2017-06-01
An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.
In vitro activity of daptomycin against clinical isolates of Gram-positive bacteria.
Piper, Kerryl E; Steckelberg, James M; Patel, Robin
2005-08-01
We determined the activity of daptomycin, a recently FDA-approved antimicrobial agent, against clinical isolates of Gram-positive bacteria, including viridans group streptococci (16 Streptococcus mitis species group, 12 S. mutans species group, 9 S. anginosus species group, 8 S. sanguinis species group, 5 S. salivarius species group) from patients with infective endocarditis, 32 methicillin-resistant Staphylococcus aureus, 32 high-level penicillin-resistant Streptococcus pneumoniae, 38 vancomycin-resistant enterococci (including 1 linezolid-resistant isolate), and the following unusual Gram-positive bacteria: 3 Listeria monocytogenes, 4 Erysipelothrix rhusiopathiae, 9 Corynebacterium species, 10 Abiotrophia/Granulicatella species, 2 Rothia (Stomatococcus) mucilaginosus, and 4 Gemella morbillorum. Daptomycin minimum inhibitory concentration (MIC)(90) values for the viridans group streptococci, methicillin-resistant S. aureus, penicillin-resistant S. pneumoniae, and Enterococcus species were 0.5, 0.5, endocarditis as well as against several types of unusual Gram-positive bacteria that can cause endocarditis.
Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.
2016-01-01
SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798
Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten
2016-12-01
Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Diesel degradation and biosurfactant production by Gram-positive ...
African Journals Online (AJOL)
The ability of Gram-positive bacteria to degrade diesel increased in a comparable trend as its biosurfactant production increased. The E24 index was highest at 87.6% for isolate D9. Isolates D2, D9 and D10, were identified as Paenibacillus sp. whilst isolate DJLB was found to belong to Stenotrophomonas sp. This study ...
Wang, Xiao; Zhang, Jun; Li, Guo-Zheng
2015-01-01
It has become a very important and full of challenge task to predict bacterial protein subcellular locations using computational methods. Although there exist a lot of prediction methods for bacterial proteins, the majority of these methods can only deal with single-location proteins. But unfortunately many multi-location proteins are located in the bacterial cells. Moreover, multi-location proteins have special biological functions capable of helping the development of new drugs. So it is necessary to develop new computational methods for accurately predicting subcellular locations of multi-location bacterial proteins. In this article, two efficient multi-label predictors, Gpos-ECC-mPLoc and Gneg-ECC-mPLoc, are developed to predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. The two multi-label predictors construct the GO vectors by using the GO terms of homologous proteins of query proteins and then adopt a powerful multi-label ensemble classifier to make the final multi-label prediction. The two multi-label predictors have the following advantages: (1) they improve the prediction performance of multi-label proteins by taking the correlations among different labels into account; (2) they ensemble multiple CC classifiers and further generate better prediction results by ensemble learning; and (3) they construct the GO vectors by using the frequency of occurrences of GO terms in the typical homologous set instead of using 0/1 values. Experimental results show that Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently improve prediction accuracy of subcellular localization of multi-location gram-positive and gram-negative bacterial proteins respectively. The online web servers for Gpos-ECC-mPLoc and Gneg-ECC-mPLoc predictors are freely accessible
Endocarditis : Effects of routine echocardiography during Gram-positive bacteraemia
Vos, F J; Bleeker-Rovers, C P; Sturm, P D; Krabbe, P F M; van Dijk, A P J; Oyen, W J G; Kullberg, B J
2011-01-01
BACKGROUND: Despite firm recommendations to perform echocardiography in high-risk patients with Gram-positive bacteraemia, routine echocardiography is not embedded in daily practice in many settings. The aim of this study was to evaluate whether a regime including routine echocardiography results in
Linezolid: a promising option in the treatment of Gram-positives.
Zahedi Bialvaei, Abed; Rahbar, Mohammad; Yousefi, Mehdi; Asgharzadeh, Mohammad; Samadi Kafil, Hossein
2017-02-01
Linezolid, an oxazolidinone antimicrobial agent that acts by inhibiting protein synthesis in a unique fashion, is used in the treatment of community-acquired pneumonia, skin and soft-tissue infections and other infections caused by Gram-positive bacteria including VRE and methicillin-resistant staphylococci. Currently, linezolid resistance among these pathogens remains low, commonly linezolid susceptibility testing for this important agent and should be taken into account when considering its therapeutic use. Considering the importance of linezolid in the treatment of infections caused by Gram-positive bacteria, this review was undertaken to optimize the clinical use of this antibiotic. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Oleg V. Mosin, PhD¹
2013-06-01
Full Text Available The microbiological synthesis of [2H]amino acids was performed by the conversion of low molecular weight substrates ([U-2H]MeOH and 2H2O using the Gram-positive aerobic facultative methylotrophic bacterium Brevibacterium methylicum, an L-phenylalanine producer, realizing the NAD+ dependent methanol dehydrogenase (EC 1.6.99.3 variant of the ribulose-5-monophosphate (RuMP cycle of carbon assimilation. In this process, the adapted cells of the methylotroph with enhanced growth characteristics were used on a minimal salt medium M9, supplemented with 2% (v/v [U-2H]MeOH and an increasing gradient of 2Н2O concentration from 0; 24.5, 49.0; 73.5 up to 98% (v/v 2Н2O. Alanine, valine, and leucine/isoleucine were produced and accumulated exogeneously in quantities of 5–6 mol, in addition to the main product of biosynthesis. This method enables the production of [2Н]amino acids with different degrees of deuterium enrichment, depending on the 2Н2O concentration in the growth medium, from 17 at.% 2Н (on the growth medium with 24.5 % (v/v 2Н2О up to 75 at.% 2Н (on the growth medium with 98 % (v/v 2Н2О. This has been confirmed with the data from the electron impact (EI mass spectrometry analysis of the methyl ethers of N-dimethylamino(naphthalene-5-sulfochloride [2H]amino acids under these experimental conditions.
Fighting infections due to multidrug-resistant Gram-positive pathogens.
Cornaglia, G
2009-03-01
Growing bacterial resistance in Gram-positive pathogens means that what were once effective and inexpensive treatments for infections caused by these bacteria are now being seriously questioned, including penicillin and macrolides for use against pneumococcal infections and-in hospitals-oxacillin for use against staphylococcal infections. As a whole, multidrug-resistant (MDR) Gram-positive pathogens are rapidly becoming an urgent and sometimes unmanageable clinical problem. Nevertheless, and despite decades of research into the effects of antibiotics, the actual risk posed to human health by antibiotic resistance has been poorly defined; the lack of reliable data concerning the outcomes resulting from antimicrobial resistance stems, in part, from problems with study designs and the methods used in resistence determination. Surprisingly little is known, too, about the actual effectiveness of the many types of intervention aimed at controlling antibiotic resistance. New antibiotics active against MDR Gram-positive pathogens have been recently introduced into clinical practice, and the antibiotic pipeline contains additional compounds at an advanced stage of development, including new glycopeptides, new anti-methicillin-resistant Staphylococcus aureus (MRSA) beta-lactams, and new diaminopyrimidines. Many novel antimicrobial agents are likely to be niche products, endowed with narrow antibacterial spectra and/or targeted at specific clinical problems. Therefore, an important educational goal will be to change the current, long-lasting attitudes of both physicians and customers towards broad-spectrum and multipurpose compounds. Scientific societies, such as the European Society of Clinical Microbiology and Infectious Diseases (ESCMID), must play a leading role in this process.
Coico, Richard
2005-10-01
Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.
Barnini, Simona; Ghelardi, Emilia; Brucculeri, Veronica; Morici, Paola; Lupetti, Antonella
2015-06-18
Rapid identification of the causative agent(s) of bloodstream infections using the matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) methodology can lead to increased empirical antimicrobial therapy appropriateness. Herein, we aimed at establishing an easier and simpler method, further referred to as the direct method, using bacteria harvested by serum separator tubes from positive blood cultures and placed onto the polished steel target plate for rapid identification by MALDI-TOF. The results by the direct method were compared with those obtained by MALDI-TOF on bacteria isolated on solid media. Identification of Gram-negative bacilli was 100 % concordant using the direct method or MALDI-TOF on isolated bacteria (96 % with score > 2.0). These two methods were 90 % concordant on Gram-positive cocci (32 % with score > 2.0). Identification by the SepsiTyper method of Gram-positive cocci gave concordant results with MALDI-TOF on isolated bacteria in 87 % of cases (37 % with score > 2.0). The direct method herein developed allows rapid identification (within 30 min) of Gram-negative bacteria and Gram-positive cocci from positive blood cultures and can be used to rapidly report reliable and accurate results, without requiring skilled personnel or the use of expensive kits.
Electromechanical and elastic probing of bacteria in a cell culture medium
International Nuclear Information System (INIS)
Thompson, G L; Reukov, V V; Vertegel, A A; Nikiforov, M P; Jesse, S; Kalinin, S V
2012-01-01
Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of bacteria of different types in pure water. Here, the BEPFM method is performed for the first time on physiologically relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria in DPBS are demonstrated. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media. (paper)
The characteristics of micrococcus (deinococcus) radiodurans sark plasmids
International Nuclear Information System (INIS)
Sjarief, Sri Hariani; Kikuchi, Masahiro; Watanabe, Hiroshi.
1994-01-01
The characterization of micrococcus (deinococcus) radiodurans sark plasmids. This bacterium has been classified as a new genus deinococcus radiodurans which is resistant to gamma-rays. It can repair itself completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 KGy. To reveal the repair mechanism, several investigations had been done to develop a cloning vector available for the genetic analysis. For this purpose D. radiodurans Sark are to be prepared as a vector by studying the characteristics of its plasmid. Plasmids were isolated by electrophoresis using 0.6% low-melting-temperature agarose in TAE and run for 5.5 hours, followed by the identification. An antibiotic marker was also carried out in this experiment to identify its location in the genetic materials of the cell, beside making a restriction map of the plasmid. Results have shown that D. radiodurans Sark has 4 plasmids (P1, P2, P3, and P4) and the refampicin resistant genes were not found in the plasmid. (authors). 14 refs; 4 figs
Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a substantial role in non-foodborne human, animal and avian diseases as well as human foodborne disease. Previously discovered C. perfringens bacteriophage lytic enzyme amino acid sequences were utilized to iden...
Cytokine profile in severe gram-positive and gram-negative abdominal sepsis
Surbatovic, Maja; Popovic, Nada; Vojvodic, Danilo; Milosevic, Ivan; Acimovic, Gordana; Stojicic, Milan; Veljovic, Milic; Jevdjic, Jasna; Djordjevic, Dragan; Radakovic, Sonja
2015-01-01
Sepsis is a principal cause of death in critical care units worldwide and consumes considerable healthcare resources. The aim of our study was to determine whether the early cytokine profile can discriminate between Gram-positive and Gram-negative bacteraemia (GPB and GNB, respectively) and to assess the prognostic value regarding outcome in critically ill patients with severe abdominal sepsis. The outcome measure was hospital mortality. Blood samples were obtained from 165 adult patients with confirmed severe abdominal sepsis. Levels of the proinflammatory mediators TNF-α, IL-8, IL-12 and IFN-γ and the anti-inflammatory mediators IL-1ra, IL-4, IL-10 and TGF-β1 were determined and correlated with the nature of the bacteria isolated from the blood culture and outcome. The cytokine profile in our study indicated that the TNF-α levels were 2-fold, IL-8 were 3.3-fold, IFN-γ were 13-fold, IL-1ra were 1.05-fold, IL-4 were 1.4-fold and IL-10 were 1.83-fold higher in the GNB group compared with the GPB group. The TNF-α levels were 4.7-fold, IL-8 were 4.6-fold, IL-1ra were 1.5-fold and IL-10 were 3.3-fold higher in the non-survivors compared with the survivors. PMID:26079127
Urinary infection caused by Micrococcus subgroup 3
Kerr, Helen
1973-01-01
The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863
Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen
2000-01-01
An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214
Liu, Rui; Miller, Patricia A; Vakulenko, Sergei B; Stewart, Nichole K; Boggess, William C; Miller, Marvin J
2018-05-10
Many antibiotics lack activity against Gram-negative bacteria because they cannot permeate the outer membrane or suffer from efflux and, in the case of β-lactams, are degraded by β-lactamases. Herein, we describe the synthesis and studies of a dual drug conjugate (1) of a siderophore linked to a cephalosporin with an attached oxazolidinone. The cephalosporin component of 1 is rapidly hydrolyzed by purified ADC-1 β-lactamase to release the oxazolidinone. Conjugate 1 is active against clinical isolates of Acinetobacter baumannii as well as strains producing large amounts of ADC-1 β-lactamase. Overall, the results are consistent with siderophore-mediated active uptake, inherent activity of the delivered dual drug, and in the presence of β-lactamases, intracellular release of the oxazolidinone upon cleavage of the cephalosporin to allow the freed oxazolidinone to inactivate its target. The ultimate result demonstrates that Gram-positive oxazolidinone antibiotics can be made to be effective against Gram-negative bacteria by β-lactamase triggered release.
Fast Mechanically Driven Daughter Cell Separation Is Widespread in Actinobacteria
Directory of Open Access Journals (Sweden)
Xiaoxue Zhou
2016-08-01
Full Text Available Dividing cells of the coccoid Gram-positive bacterium Staphylococcus aureus undergo extremely rapid (millisecond daughter cell separation (DCS driven by mechanical crack propagation, a strategy that is very distinct from the gradual, enzymatically driven cell wall remodeling process that has been well described in several rod-shaped model bacteria. To determine if other bacteria, especially those in the same phylum (Firmicutes or with similar coccoid shapes as S. aureus, might use a similar mechanically driven strategy for DCS, we used high-resolution video microscopy to examine cytokinesis in a phylogenetically wide range of species with various cell shapes and sizes. We found that fast mechanically driven DCS is rather rare in the Firmicutes (low G+C Gram positives, observed only in Staphylococcus and its closest coccoid relatives in the Macrococcus genus, and we did not observe this division strategy among the Gram-negative Proteobacteria. In contrast, several members of the high-G+C Gram-positive phylum Actinobacteria (Micrococcus luteus, Brachybacterium faecium, Corynebacterium glutamicum, and Mycobacterium smegmatis with diverse shapes ranging from coccoid to rod all undergo fast mechanical DCS during cell division. Most intriguingly, similar fast mechanical DCS was also observed during the sporulation of the actinobacterium Streptomyces venezuelae.
The effect of cellular carotenoid levels in micrococcus luteus on resistance to gamma radiation
International Nuclear Information System (INIS)
Al-Wandawi, K. H.
2000-01-01
In the present study, a biological system was developed to link the cellular carotenoid levels to Gamma radiation resistance in bacteria for the frst time. thus, in a non-photosynrhetic bacterium, in Micrococcus Luteus an inverse relationship was found between the increase in diphenylamine (DPA) concentration (5.25 μg/ml culture) and the polar cellular carotenoid pigments (C-45 and C-50 carotenoids and their glucosides). It was also found that irradiation of cells with different carotenoid concentrations with doses of γ-radiation in the range of (0.2500 gray) under oxic, air and hypoxic conditions showed that carotenoid pigments offer no significant protection as they usually do in case of visible light. (author).15 refs., 5 figs., 3 tabs
Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.
Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang
2010-08-01
Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is
DEFF Research Database (Denmark)
Nilsson, Lennart E; Frimodt-Møller, Niels; Vaara, Martti
2011-01-01
This study involves a multicentre surveillance of tigecycline and tetracycline activity against Gram-negative and Gram-positive bacteria from primary care centres (PCCs), general hospital wards (GHWs) and intensive care units (ICUs) in Denmark (n = 9), Finland (n = 10), Norway (n = 7) and Sweden (n...
Isolation of an unidentified pink-pigmented bacterium in a clinical specimen.
Odugbemi, T; Nwofor, C; Joiner, K T
1988-01-01
An unidentified pink-pigmented bacterium isolated from a clinical specimen is reported. The organism was oxidase, urease, and catalase positive; it grew on Thayer-Martin and MacConkey media. The isolate is possibly similar to an unnamed taxon (G.L. Gilardi and Y.C. Faur, J. Clin. Microbiol. 20:626-629, 1984); however, it had unique characteristics of nonmotility with no flagellum detectable and was a gram-negative coccoid with a few rods in pairs and negative for starch hydrolysis.
Isolation of an unidentified pink-pigmented bacterium in a clinical specimen.
Odugbemi, T; Nwofor, C; Joiner, K T
1988-05-01
An unidentified pink-pigmented bacterium isolated from a clinical specimen is reported. The organism was oxidase, urease, and catalase positive; it grew on Thayer-Martin and MacConkey media. The isolate is possibly similar to an unnamed taxon (G.L. Gilardi and Y.C. Faur, J. Clin. Microbiol. 20:626-629, 1984); however, it had unique characteristics of nonmotility with no flagellum detectable and was a gram-negative coccoid with a few rods in pairs and negative for starch hydrolysis.
Surface interactions and fouling properties of Micrococcus luteus with microfiltration membranes.
Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian
2011-11-01
This study was conducted to investigate microbial adhesion of Micrococcus luteus to polypropylene (PP) and polyvinylidene fluoride (PVDF) membranes in relation to the variation of the interfacial energies in the membrane-bacteria systems, for revealing effects of short-range surface interactions on filtration behavior. Both the membranes and M. luteus showed typical strong electron donors and hydrophilic properties. The AB component was dominant in the interfacial energies of the two membrane-bacteria systems. M. luteus presented larger negative U(mlb)(XDLVO) to the PP membrane than to the PVDF membrane. The adhesion experiments also proved that M. luteus had higher adhesion percentage to the PP membrane. This study demonstrated that the adhesion potentials of M. luteus to the PP and PVDF membranes might be explained in terms of bacterium, membrane, and intervening medium surface properties, which are mainly determined by the interfacial energies in the systems according to the XDLVO theory.
McCoy, K B; Derecho, I; Wong, T; Tran, H M; Huynh, T D; La Duc, M T; Venkateswaran, K; Mogul, R
2012-09-01
The microbiology of the spacecraft assembly process is of paramount importance to planetary exploration, as the biological contamination that can result from remote-enabled spacecraft carries the potential to impact both life-detection experiments and extraterrestrial evolution. Accordingly, insights into the mechanisms and range of extremotolerance of Acinetobacter radioresistens 50v1, a Gram-negative bacterium isolated from the surface of the preflight Mars Odyssey orbiter, were gained by using a combination of microbiological, enzymatic, and proteomic methods. In summary, A. radioresistens 50v1 displayed a remarkable range of survival against hydrogen peroxide and the sequential exposures of desiccation, vapor and plasma phase hydrogen peroxide, and ultraviolet irradiation. The survival is among the highest reported for non-spore-forming and Gram-negative bacteria and is based upon contributions from the enzyme-based degradation of H(2)O(2) (catalase and alkyl hydroperoxide reductase), energy management (ATP synthase and alcohol dehydrogenase), and modulation of the membrane composition. Together, the biochemical and survival features of A. radioresistens 50v1 support a potential persistence on Mars (given an unintended or planned surface landing of the Mars Odyssey orbiter), which in turn may compromise the scientific integrity of future life-detection missions.
Dubuffet, Aurore; Zanchi, Caroline; Boutet, Gwendoline; Moreau, Jérôme; Teixeira, Maria; Moret, Yannick
2015-01-01
In many vertebrates and invertebrates, offspring whose mothers have been exposed to pathogens can exhibit increased levels of immune activity and/or increased survival to infection. Such phenomena, called “Trans-generational immune priming” (TGIP) are expected to provide immune protection to the offspring. As the offspring and their mother may share the same environment, and consequently similar microbial threats, we expect the immune molecules present in the progeny to be specific to the microbes that immune challenged the mother. We provide evidence in the mealworm beetle Tenebrio molitor that the antimicrobial activity found in the eggs is only active against Gram-positive bacteria, even when females were exposed to Gram-negative bacteria or fungi. Fungi were weak inducers of TGIP while we obtained similar levels of anti-Gram-positive activity using different bacteria for the maternal challenge. Furthermore, we have identified an antibacterial peptide from the defensin family, the tenecin 1, which spectrum of activity is exclusively directed toward Gram-positive bacteria as potential contributor to this antimicrobial activity. We conclude that maternal transfer of antimicrobial activity in the eggs of T. molitor might have evolved from persistent Gram-positive bacterial pathogens between insect generations. PMID:26430786
Directory of Open Access Journals (Sweden)
Aurore Dubuffet
2015-10-01
Full Text Available In many vertebrates and invertebrates, offspring whose mothers have been exposed to pathogens can exhibit increased levels of immune activity and/or increased survival to infection. Such phenomena, called "Trans-generational immune priming" (TGIP are expected to provide immune protection to the offspring. As the offspring and their mother may share the same environment, and consequently similar microbial threats, we expect the immune molecules present in the progeny to be specific to the microbes that immune challenged the mother. We provide evidence in the mealworm beetle Tenebrio molitor that the antimicrobial activity found in the eggs is only active against Gram-positive bacteria, even when females were exposed to Gram-negative bacteria or fungi. Fungi were weak inducers of TGIP while we obtained similar levels of anti-Gram-positive activity using different bacteria for the maternal challenge. Furthermore, we have identified an antibacterial peptide from the defensin family, the tenecin 1, which spectrum of activity is exclusively directed toward Gram-positive bacteria as potential contributor to this antimicrobial activity. We conclude that maternal transfer of antimicrobial activity in the eggs of T. molitor might have evolved from persistent Gram-positive bacterial pathogens between insect generations.
[Preparation and characterization of monoclonal antibodies against Micrococcus luteus Rpf domain].
Fan, Ai-lin; Shi, Chang-hong; Su, Ming-quan; Ma, Jing; Bai, Yin-lan; Cheng, Xiao-dong; Xu, Zhi-kai; Hao, Xiao-ke
2008-05-01
To express Micrococcus luteus Rpf domain in prokaryotic cells and prepare monoclonal antibodies against Rpf domain. The gene encoding Micrococcus luteus Rpf domain was amplified from genome of Micrococcus luteus by polymerase chain reaction(PCR), and inserted into cloning vector pUC-19. After sequenced, Micrococcus luteus Rpf domain gene was subcloned into the expression vector pPro-EXHT and transfected into E.coli DH5alpha. After induced by IPTG, the bacteria controlled by T7 promoter expressed the fused Micrococcus luteus Rpf domain protein with a hexahistidine tail at its N-terminal and the target protein was purified under denaturing conditions. Using this protein as antigen to immunize the BALB/c mice and prepare monoclonal antibodies against Micrococcus luteus Rpf domain. Then specifities and relative affinities of mAbs were identified by ELISA. The fusion protein was purified by metal chelate affinity chromatography under denaturing condition. Three cloned mAbs were prepared from the mice immunized by Rpf domain. All of them could recognize Rpf domain. specifically. The prepared mAbs against Rpf domain have strong specificity with high titers, which provides useful tools for further study of the function of Rpf domain in TB prevention.
Saini, Harsh; Raicar, Gaurav; Dehzangi, Abdollah; Lal, Sunil; Sharma, Alok
2015-12-07
Protein subcellular localization is an important topic in proteomics since it is related to a protein׳s overall function, helps in the understanding of metabolic pathways, and in drug design and discovery. In this paper, a basic approximation technique from natural language processing called the linear interpolation smoothing model is applied for predicting protein subcellular localizations. The proposed approach extracts features from syntactical information in protein sequences to build probabilistic profiles using dependency models, which are used in linear interpolation to determine how likely is a sequence to belong to a particular subcellular location. This technique builds a statistical model based on maximum likelihood. It is able to deal effectively with high dimensionality that hinders other traditional classifiers such as Support Vector Machines or k-Nearest Neighbours without sacrificing performance. This approach has been evaluated by predicting subcellular localizations of Gram positive and Gram negative bacterial proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Daptomycin: a novel lipopeptide antibiotic against Gram-positive pathogens
Directory of Open Access Journals (Sweden)
Andres Beiras-Fernandez
2010-08-01
Full Text Available Andres Beiras-Fernandez1,*, Ferdinand Vogt1,*, Ralf Sodian1, Florian Weis21Department of Cardiac Surgery, University Hospital Großhadern, Ludwig-Maximilian-University, Munich, Germany; 2Department of Anesthesiology, University Hospital Großhadern, Ludwig-Maximilian-University, Munich, Germany *Andres Beiras-Fernandez and Ferdinand Vogt contributed equally to this paperAbstract: The aim of this review is to summarize the historical background of drug resistance of Gram-positive pathogens as well as to describe in detail the novel lipopeptide antibiotic daptomycin. Pharmacological and pharmacokinetic aspects are reviewed and the current clinical use of daptomycin is presented. Daptomycin seems to be a reliable drug in the treatment of complicated skin and skin structure infections, infective right-sided endocarditis, and bacteremia caused by Gram-positive agents. Its unique mechanism of action and its low resistance profile, together with its rapid bactericidal action make it a favorable alternative to vancomycin in multi-drug resistant cocci. The role of daptomycin in the treatment of prosthetic material infections, osteomyelitis, and urogenital infections needs to be evaluated in randomized clinical trials.Keywords: daptomycin, multi-drug resistance, methicillin-resistant Staphylococcus aureus (MRSA, pneumonia, urinary tract infection, left-sided endocarditis
Tribolium castaneum defensins are primarily active against Gram-positive bacteria
Czech Academy of Sciences Publication Activity Database
Tonk, M.; Knorr, E.; Cabezas-Cruz, A.; Valdés, James J.; Kollewe, C.; Vilcinskas, A.
2015-01-01
Roč. 132, NOV 2015 (2015), s. 208-215 ISSN 0022-2011 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Antimicrobial peptides * Defensin * Innate immunity * Insects * Tribolium castaneum * Gram-positive bacteria Subject RIV: EI - Biotechnology ; Bionics Impact factor: 2.198, year: 2015
European surveillance study on antimicrobial susceptibility of Gram-positive anaerobic cocci
DEFF Research Database (Denmark)
Brazier, J; Chmelar, D; Dubreuil, L
2008-01-01
Gram-positive anaerobic cocci (GPAC) are a heterogeneous group of microorganisms frequently isolated from local and systemic infections. In this study, the antimicrobial susceptibilities of clinical strains isolated in 10 European countries were investigated. After identification of 299 GPAC...
Bunke, C M; Brier, M E; Golper, T A
1997-08-01
The use of the "peritonitis rate" in the management of patients undergoing peritoneal dialysis is assuming importance in comparing the prowess of facilities, care givers and new innovations. For this to be a meaningful outcome measure, the type of infection (causative pathogen) must have less clinical significance than the number of infections during a time interval. The natural history of Staphylococcus aureus, pseudomonas, and fungal peritonitis would not support that the outcome of an episode of peritonitis is independent of the causative pathogen. Could this concern be extended to other more frequently occurring pathogens? To address this, the Network 9 Peritonitis Study identified 530 episodes of single organism peritonitis caused by a gram positive organism and 136 episodes caused by a single non-pseudomonal gram negative (NPGN) pathogen. Coincidental soft tissue infections (exit site or tunnel) occurred equally in both groups. Outcomes of peritonitis were analyzed by organism classification and by presence or absence of a soft tissue infection. NPGN peritonitis was associated with significantly more frequent catheter loss, hospitalization, and technique failure and was less likely to resolve regardless of the presence or absence of a soft tissue infection. Hospitalization and death tended to occur more frequently with enterococcal peritonitis than with other gram positive peritonitis. The outcomes in the NPGN peritonitis group were significantly worse (resolution, catheter loss, hospitalization, technique failure) compared to coagulase negative staphylococcal or S. aureus peritonitis, regardless of the presence or absence of a coincidental soft tissue infection. Furthermore, for the first time, the poor outcomes of gram negative peritonitis are shown to be independent of pseudomonas or polymicrobial involvement or soft tissue infections. The gram negative organism appears to be the important factor. In addition, the outcome of peritonitis caused by S. aureus
First report of linear megaplasmids in the genus Micrococcus.
Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm
2010-01-01
High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.
Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe
2006-01-01
Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.
Methods for Confirming the Gram Reaction of Gram-variable Bacillus Species Isolated from Tobacco
Directory of Open Access Journals (Sweden)
Morin A
2014-12-01
Full Text Available Bacillus is a predominant genus of bacteria isolated from tobacco. The Gram stain is the most commonly used and most important of all diagnostic staining techniques in microbiology. In order to help confirm the Gram positivity of Bacillus isolates from tobacco, three methods using the chemical differences of the cell wall and membrane of Gram-positive and Gram-negative bacteria were investigated: the KOH (potassium hydroxide, the LANA (L-alanine-4-nitroanilide, and the vancomycin susceptibility tests. When colonies of Gram-negative bacteria are treated with 3% KOH solution, a slimy suspension is produced, probably due to destruction of the cell wall and liberation of deoxyribonucleic acid (DNA. Gram-positive cell walls resist KOH treatment. The LANA test reveals the presence of a cell wall aminopeptidase that hydrolyzes the L-alanine-4-nitroanilide in Gram-negative bacteria. This enzyme is absent in Gram-positive bacteria. Vancomycin is a glycopeptide antibiotic inhibiting the cell wall peptido-glycan synthesis of Gram-positive microorganisms. Absence of lysis with KOH, absence of hydrolysis of LANA, and susceptibility to vancomycin were used with the Gram reaction to confirm the Gram positivity of various Bacillus species isolated from tobacco. B. laevolacticus excepted, all Bacillus species tested showed negative reactions to KOH and LANA tests, and all species were susceptible to vancomycin (5 and 30 µg.
Arif, Mohammad; Busot, Grethel Y.; Mann, Rachel; Rodoni, Brendan; Liu, Sanzhen; Stack, James P.
2016-01-01
Rathayibacter toxicus is a gram-positive bacterium that infects the floral parts of several Poaceae species in Australia. Bacterial ooze is often produced on the surface of infected plants and bacterial galls are produced in place of seed. R. toxicus is a regulated plant pathogen in the U.S. yet reliable detection and diagnostic tools are lacking. To better understand this geographically-isolated plant pathogen, genetic variation as a function of geographic location, host species, and date of...
Yang, Minjie; Zhang, Jing; Chen, Yuancheng; Liang, Xiaoyu; Guo, Yan; Yu, Jicheng; Zhu, Demei; Zhang, Yingyuan
2017-01-01
To optimize linezolid treatment regimens for Gram-positive bacterial infections based on pharmacokinetic/pharmacodynamic analysis. The minimum inhibitory concentration (MIC) distribution of 572 Gram-positive strains from patients with clinically confirmed infections was analyzed. Using the Monte Carlo simulation method, the cumulative fraction of response and probability of target attainment were determined for linezolid regimens of 600 mg q.12h and q.8h Results: Linezolid dosage of 600 mg q.12h yielded >90% cumulative fraction of response and probability of target attainment for staphylococcal infections with an MIC of ≤1 mg/l, enterococcal infections with higher MIC values required 600 mg q.8h. Linezolid 600 mg q.12h is still the clinically recommended empirical dosage for Gram-positive bacterial infections. However, as bacterial MICs increase, 600 mg q.8h may be required to achieve better efficacy.
Halophilic Amylase from a Moderately Halophilic Micrococcus
Onishi, Hiroshi
1972-01-01
A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445
Electrochemical reduction of oxygen catalyzed by a wide range of bacteria including Gram-positive
Energy Technology Data Exchange (ETDEWEB)
Cournet, Amandine [Universite de Toulouse, UPS, LU49, Adhesion Bacterienne et Formation de Biofilms, 35 chemin des Maraichers, 31 062 Toulouse cedex 09 (France); Laboratoire de Genie Chimique CNRS, Universite de Toulouse, 4 allee Emile Monso, BP 84234, 31432 Toulouse cedex 04 (France); Delia, Marie-Line; Bergel, Alain [Laboratoire de Genie Chimique CNRS, Universite de Toulouse, 4 allee Emile Monso, BP 84234, 31432 Toulouse cedex 04 (France); Roques, Christine; Berge, Mathieu [Universite de Toulouse, UPS, LU49, Adhesion Bacterienne et Formation de Biofilms, 35 chemin des Maraichers, 31 062 Toulouse cedex 09 (France)
2010-04-15
Most bacteria known to be electrochemically active have been harvested in the anodic compartments of microbial fuel cells (MFCs) and are able to use electrodes as electron acceptors. The reverse phenomenon, i.e. using solid electrodes as electron donors, is not so widely studied. To our knowledge, most of the electrochemically active bacteria are Gram-negative. The present study implements a transitory electrochemical technique (cyclic voltammetry) to study the microbial catalysis of the electrochemical reduction of oxygen. It is demonstrated that a wide range of aerobic and facultative anaerobic bacteria are able to catalyze oxygen reduction. Among these electroactive bacteria, several were Gram-positive. The transfer of electrons was direct since no activity was obtained with the filtrate. These findings, showing a widespread property among bacteria including Gram-positive ones, open new and interesting routes in the field of electroactive bacteria research. (author)
Jones, Ronald N; Stilwell, Matthew G
2013-06-01
Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.
Zheng, Chunli; Qu, Baocheng; Wang, Jing; Zhou, Jiti; Wang, Jing; Lu, Hong
2009-06-15
Strain Z3 was isolated from nitrobenzene-contaminated sludge. Strain Z3 was able to utilize nitrobenzene as a sole source of carbon, nitrogen and energy under aerobic condition. Based on the morphology, physiological biochemical characteristics, and 16S rDNA sequence, strain Z3 was identified as Micrococcus luteus. Strain Z3 completely degraded nitrobenzene with initial concentration of 100, 150, 200, and 250 mg L(-1) within 70, 96, 120 and 196 h, respectively. Kinetics of nitrobenzene degradation was described using the Andrews equation. The kinetic parameters were as follows: q(max)=1.19 h(-1), K(s)=29.11 mg L(-1), and K(i)=94.00 mg L(-1). Strain Z3 had a high salinity tolerance. It degraded 200 mg L(-1) nitrobenzene completely in 5% NaCl (w/w%). Strain Z3 therefore could be an excellent candidate for the bio-treatment of nitrobenzene industrial wastewaters with high salinity. This is the first report on the degradation of nitrobenzene by M. luteus and the degradation of nitrobenzene achieved in such a high salinity.
Recovery of vancomycin-resistant gram-positive cocci from children.
Green, M; Wadowsky, R M; Barbadora, K
1990-01-01
A cross-sectional survey of vancomycin-resistant gram-positive cocci (VRGPC) in the feces of children was initiated after several bacteremic infections with these organisms occurred at our hospital. A selective medium consisting of colistin-nalidixic acid agar, 5% sheep blood, vancomycin (5 mg/liter), and amphotericin B (8 mg/liter) was developed to isolate VRGPC. A single stool specimen submitted to the clinical microbiology laboratory from each of 48 patients was inoculated onto the medium....
Metabolic versatility of Gram-positive microbial isolates from contaminated river sediments
International Nuclear Information System (INIS)
Narancic, Tanja; Djokic, Lidija; Kenny, Shane T.; O’Connor, Kevin E.; Radulovic, Vanja; Nikodinovic-Runic, Jasmina; Vasiljevic, Branka
2012-01-01
Highlights: ► Thirty-four isolated Gram-positive bacteria could degrade wide range of aromatic pollutants. ► Nine isolates could grow in the presence of extremely high levels of heavy metals. ► Twelve isolates accumulated polyphosphate, 3 polyhydroxybutyrate, 4 exopolysaccharides. ► The incidence of multiple antibiotic resistance markers among isolates was low. - Abstract: Gram-positive bacteria from river sediments affected by the proximity of a petrochemical industrial site were isolated and characterized with respect to their ability to degrade a wide range of aromatic compounds. In this study we identified metabolically diverse Gram-positive bacteria capable of growth on wide range aromatic compounds in the presence of heavy metals and with the ability to accumulate biopolymers. Thirty-four isolates that were able to use 9 or more common aromatic pollutants, such as benzene, biphenyl, naphthalene etc. as a sole source of carbon and energy included members of Bacillus, Arthrobacter, Rhodococcus, Gordonia, Streptomyces, and Staphylococcus genus. Rhodococcus sp. TN105, Gordonia sp. TN103 and Arthrobacter sp. TN221 were identified as novel strains. Nine isolates were able to grow in the presence of one or more metals (mercury, cadmium, nickel) at high concentration (100 mM). Seven isolates could degrade 15 different aromatic compounds and could grow in the presence of one or more heavy metals. Two of these isolates were resistant to multiple antibiotics including erythromycin and nalidixic acid. One third of isolates could accumulate at least one biopolymer. Twelve isolates (mainly Bacillus sp. and Arthrobacter sp.) accumulated polyphosphate, 3 Bacillus sp. accumulated polyhydroxybutyrate, while 4 isolates could accumulate exopolysaccharides.
Peptidoglycan architecture of Gram-positive bacteria by solid-state NMR.
Kim, Sung Joon; Chang, James; Singh, Manmilan
2015-01-01
Peptidoglycan is an essential component of cell wall in Gram-positive bacteria with unknown architecture. In this review, we summarize solid-state NMR approaches to address some of the unknowns in the Gram-positive bacteria peptidoglycan architecture: 1) peptidoglycan backbone conformation, 2) PG-lattice structure, 3) variations in the peptidoglycan architecture and composition, 4) the effects of peptidoglycan bridge-length on the peptidoglycan architecture in Fem mutants, 5) the orientation of glycan strands with respect to the membrane, and 6) the relationship between the peptidoglycan structure and the glycopeptide antibiotic mode of action. Solid-state NMR analyses of Staphylococcus aureus cell wall show that peptidoglycan chains are surprisingly ordered and densely packed. The peptidoglycan disaccharide backbone adopts 4-fold screw helical symmetry with the disaccharide unit periodicity of 40Å. Peptidoglycan lattice in the S. aureus cell wall is formed by cross-linked PG stems that have parallel orientations. The structural characterization of Fem-mutants of S. aureus with varying lengths of bridge structures suggests that the PG-bridge length is an important determining factor for the PG architecture. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Mladenovska, Zuzana; Mathrani, Indra M.; Ahring, Birgitte Kiær
1995-01-01
An anaerobic, extremely thermophilic, cellulolytic, non-spore-forming bacterium, strain 6A, was isolated from an alkaline hot spring in Hverageroi, Iceland. The bacterium was non-motile, rod-shaped (1.5-3.5 x 0.7 mu m) and occurred singly, in pairs or in chains and stained gram-negative. The growth...
Osawa, Ayako; Ishii, Yoko; Sasamura, Nao; Morita, Marie; Kasai, Hiroaki; Maoka, Takashi; Shindo, Kazutoshi
2010-01-01
While screening for antioxidative carotenoids from marine bacteria, we isolated and identified sarcinaxanthin and its glucosylated compounds (sarcinaxanthin monoglucoside and sarcinaxanthin diglucoside) from a moderately halophilic bacterium-Micrococcus yunnanensis strain AOY-1. In the singlet oxygen ((¹O₂) quenching model, the IC(50) values of the antioxidative activities of these carotenoids were as follows: sarcinaxanthin , 57 µM; sarcinaxanthin monoglucoside, 54 µM; and sarcinaxanthin diglucoside, 74 µM. In addition, the complete proton nuclear magnetic resonance (¹H NMR) assignments of sarcinaxanthin monoglucoside pentaacetate and sarcinaxanthin diglucoside octaacetate, and fast atom bombardment mass spectrometry/mass spectrometry (FAB-MS/MS) analyses of sarcinaxanthin and sarcinaxanthin monoglucoside are reported for the first time.
Directory of Open Access Journals (Sweden)
Nadine T Nehme
2011-03-01
Full Text Available Two NF-kappaB signaling pathways, Toll and immune deficiency (imd, are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense.In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus, we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival--independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response.Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen.
Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.
von Eiff, C; Herrmann, M; Peters, G
1995-01-01
The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited.
Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.
von Eiff, C; Herrmann, M; Peters, G
1995-01-01
The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321
Kunkalekar, R K; Prabhu, M S; Naik, M M; Salker, A V
2014-01-01
Palladium, ruthenium and silver-doped MnO2 and silver doped Mn2O3 nanoparticles were synthesized by simple co-precipitation technique. SEM-TEM analysis revealed the nano-size of these synthesized samples. XPS data illustrates that Mn is present in 4+ and 3+ oxidation states in MnO2 and Mn2O3 respectively. Thermal analysis gave significant evidence for the phase changes with increasing temperature. Antibacterial activity of these synthesized nanoparticles on three Gram positive bacterial cultures (Staphylococcus aureus ATCC 6538, Streptococcus epidermis ATCC 12228, Bacillus subtilis ATCC 6633) and three Gram negative cultures (Escherichia coli ATCC 8739, Salmonella abony NCTC 6017 and Klebsiella pneumoniae ATCC 1003) was investigated using a disc diffusion method and live/dead assay. Only Ag-doped MnO2 and Ag-doped Mn2O3 nanoparticles showed antibacterial property against all six-test bacteria but Ag-doped MnO2 was found to be more effective than Ag-doped Mn2O3. Copyright © 2013 Elsevier B.V. All rights reserved.
Lu, Hoang D.; Yang, Shirley S.; Wilson, Brian K.; McManus, Simon A.; Chen, Christopher V. H.-H.; Prud'homme, Robert K.
2017-04-01
Antimicrobial resistance is a healthcare problem of increasing significance, and there is increasing interest in developing new tools to address bacterial infections. Bacteria-targeting nanoparticles hold promise to improve drug efficacy, compliance, and safety. In addition, nanoparticles can also be used for novel applications, such as bacterial imaging or bioseperations. We here present the use of a scalable block-copolymer-directed self-assembly process, Flash NanoPrecipitation, to form zinc(II)-bis(dipicolylamine) modified nanoparticles that bind to both Gram-positive and Gram-negative bacteria with specificity. Particles have tunable surface ligand densities that change particle avidity and binding efficacy. A variety of materials can be encapsulated into the core of the particles, such as optical dyes or iron oxide colloids, to produce imageable and magnetically active bacterial targeting constructs. As a proof-of-concept, these particles are used to bind and separate bacteria from solution in a magnetic column. Magnetic manipulation and separation would translate to a platform for pathogen identification or removal. These magnetic and targeted nanoparticles enable new methods to address bacterial infections.
Design, synthesis and antimicrobial evaluation of novel carbendazim dithioate analogs
DEFF Research Database (Denmark)
Zahran, Magdy A H; Osman, Amany M A; Wahed, Rania A.
2015-01-01
-spectroscopy. All the synthesized carbendazim analogs were screened for their in vitro antimicrobial activity against different Gram-positive (Staphylococcus aureus and Micrococcus luteus), Gram-negative (Escherichia coli and Klebsiella pneumonia) bacteria, fungi (Fusarium solani and Fusarium oxysporu) and in vivo...
Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.
Geary, C; Stevens, M
1986-01-01
A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667
Resistance of Gram-positive bacteria to nisin is not determined by Lipid II levels
Kramer, NE; Smid, EJ; Kok, J; de Kruijff, B; Kuipers, OP; Breukink, E; Kramer, Naomi E.; Smid, Eddy J.
2004-01-01
Lipid II is essential for nisin-mediated pore formation at nano-molar concentrations. We tested whether nisin resistance could result from different Lipid II levels, by comparing the maximal Lipid II pool in Micrococcus flavus (sensitive) and Listeria monocytogenes (relatively insensitive) and their
Factors Affecting Transformation of Micrococcus lysodeikticus
Kloos, Wesley E.
1969-01-01
Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710
Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud
2016-12-01
The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID 50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. © The Author(s) 2016.
Identification of aerobic Gram-positive bacilli by use of Vitek MS.
Navas, Maria; Pincus, David H; Wilkey, Kathy; Sercia, Linda; LaSalvia, Margaret; Wilson, Deborah; Procop, Gary W; Richter, Sandra S
2014-04-01
The accuracy of Vitek MS mass spectrometric identifications was assessed for 206 clinically significant isolates of aerobic Gram-positive bacilli representing 20 genera and 38 species. The Vitek MS identifications were correct for 85% of the isolates (56.3% to the species level, 28.6% limited to the genus level), with misidentifications occurring for 7.3% of the isolates.
Goldstein, Ellie J C; Citron, Diane M; Merriam, C Vreni; Warren, Yumi; Tyrrell, Kerin; Fernandez, Helen T
2003-06-01
Dalbavancin is a novel semisynthetic glycopeptide with enhanced activity against gram-positive species. Its comparative in vitro activities and those of nine comparator agents, including daptomycin, vancomycin, linezolid, and quinupristin-dalfopristin, against 290 recent gram-positive clinical isolates strains, as determined by the NCCLS agar dilution method, were studied. The MICs of dalbavancin at which 90% of various isolates tested were inhibited were as follows: Actinomyces spp., 0.5 microg/ml; Clostridium clostridioforme, 8 microg/ml; C. difficile, 0.25 microg/ml; C. innocuum, 0.25 microg/ml; C. perfringens, 0.125 microg/ml; C. ramosum, 1 microg/ml; Eubacterium spp., 1 microg/ml; Lactobacillus spp., >32 microg/ml, Propionibacterium spp., 0.5 microg/ml; and Peptostreptococcus spp., 0.25 microg/ml. Dalbavancin was 1 to 3 dilutions more active than vancomycin against most strains. Dalbavancin exhibited excellent activity against gram-positive strains tested and warrants clinical evaluation.
Directory of Open Access Journals (Sweden)
Erick Pazos-Ortiz
2017-01-01
Full Text Available The adhesion ability and adaptability of bacteria, coupled with constant use of the same bactericides, have made the increase in the diversity of treatments against infections necessary. Nanotechnology has played an important role in the search for new ways to prevent and treat infections, including the use of metallic nanoparticles with antibacterial properties. In this study, we worked on the design of a composite of silver nanoparticles (AgNPS embedded in poly-epsilon-caprolactone nanofibers and evaluated its antimicrobial properties against various Gram-positive and Gram-negative microorganisms associated with drug-resistant infections. Polycaprolactone-silver composites (PCL-AgNPs were prepared in two steps. The first step consisted in the reduction in situ of Ag+ ions using N,N-dimethylformamide (DMF in tetrahydrofuran (THF solution, and the second step involved the simple addition of polycaprolactone before electrospinning process. Antibacterial activity of PCL-AgNPs nanofibers against E. coli, S. mutans, K. pneumoniae, S. aureus, P. aeruginosa, and B. subtilis was evaluated. Results showed sensibility of E. coli, K. pneumoniae, S. aureus, and P. aeruginosa, but not for B. subtilis and S. mutans. This antimicrobial activity of PCL-AgNPs showed significant positive correlations associated with the dose-dependent effect. The antibacterial property of the PCL/Ag nanofibers might have high potential medical applications in drug-resistant infections.
[Micrococcus sp.--the pathogen of leaf necrosis of horse-chestnuts (Aesculus L.) in Kiev].
Iakovleva, L M; Makhinia, L V; Shcherbina, T N; Ogorodnik, L E
2013-01-01
A group of phytopathogenic bacteria was isolated from patterns of drying horse-chestnuts (Aesculus L.), which grow in Kyiv. The properties of slowly growing, highly aggressive microorganisms have been described in the paper. They grow up on the 8-10th day after sowing. The investigated microorganisms form very small (0.5-1 mm in diameter) colonies on the potato agar. Bacteria are protuberant, shining, smooth with flat edges, they are pale yellow, yellow, or pink. The bacteria are Gram-positive, spherical, are disposed in smears singly, in pairs, as accumulations, or netting. They are aerobes, do not form spores, are not mobile. They are inert in respect of different sources of carbon. They reduce nitrates, do not dilute gelatin, do not hydrolyze starch, do not release hydrogen sulphide and indole. The bacteria are catalase-positive, oxidase-negative. They do not cause potato and carrot rot. They lose quickly their viability under the laboratory conditions. The saturated acids C 14:0; C 15:0; C16:0; C18:0 have been revealed in the composition of cellular fatty acids. Microorganisms are identified as Micrococcus sp. Under artificial inoculation this highly aggressive pathogen causes drying of the horse-chestnut buds and necrosis, which occupies 1/3-1/2 of the leaf plate. A wide zone of chlorosis, surrounding necrosis, may occupy the whole leaf surface. The infected leaves use to twist up from the top (apex) or along a midrib and to dry.
Energy Technology Data Exchange (ETDEWEB)
Uma Suganya, K.S. [Centre for Ocean Research, Sathyabama University, Chennai 600 119 (India); Govindaraju, K., E-mail: govindtu@gmail.com [Centre for Ocean Research, Sathyabama University, Chennai 600 119 (India); Ganesh Kumar, V.; Stalin Dhas, T.; Karthick, V. [Centre for Ocean Research, Sathyabama University, Chennai 600 119 (India); Singaravelu, G. [Nanoscience Division, Department of Zoology, Thiruvalluvar University, Vellore 632115 (India); Elanchezhiyan, M. [Department of Microbiology, Dr ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Chennai 600113 (India)
2015-02-01
Biofunctionalized gold nanoparticles (AuNPs) play an important role in design and development of nanomedicine. Synthesis of AuNPs from biogenic materials is environmentally benign and possesses high bacterial inhibition and bactericidal properties. In the present study, blue green alga Spirulina platensis protein mediated synthesis of AuNPs and its antibacterial activity against Gram positive bacteria is discussed. AuNPs were characterized using Ultraviolet–visible (UV–vis) spectroscopy, Fluorescence spectroscopy, Fourier Transform-Infrared (FTIR) spectroscopy, Raman spectroscopy, High Resolution-Transmission Electron Microscopy (HR-TEM) and Energy Dispersive X-ray analysis (EDAX). Stable, well defined AuNPs of smaller and uniform shape with an average size of ∼ 5 nm were obtained. The antibacterial efficacy of protein functionalized AuNPs were tested against Gram positive organisms Bacillus subtilis and Staphylococcus aureus. - Highlights: • Size controlled synthesis of gold nanoparticles from blue green alga Spirulina platensis • Stability of gold nanoparticles at different temperatures • Potent antibacterial efficacy against Gram positive organisms.
Wang, Qi; Larese-Casanova, Philip; Webster, Thomas J
2015-01-01
There are wide spread bacterial contamination issues on various paper products, such as paper towels hanging in sink splash zones or those used to clean surfaces, filter papers used in water and air purifying systems, and wrappings used in the food industry; such contamination may lead to the potential spread of bacteria and consequent severe health concerns. In this study, selenium nanoparticles were coated on normal paper towel surfaces through a quick precipitation method, introducing antibacterial properties to the paper towels in a healthy way. Their effectiveness at preventing biofilm formation was tested in bacterial assays involving Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus epidermidis. The results showed significant and continuous bacteria inhibition with about a 90% reduction from 24 to 72 hours for gram-positive bacteria including S. aureus and S. epidermidis. The selenium coated paper towels also showed significant inhibition of gram-negative bacteria like P. aeruginosa and E. coli growth at about 57% and 84%, respectively, after 72 hours of treatment. Therefore, this study established a promising selenium-based antibacterial strategy to prevent bacterial growth on paper products, which may lead to the avoidance of bacteria spreading and consequent severe health concerns.
Garrison, Mark W; Mutters, Reinier; Dowzicky, Michael J
2009-11-01
The Tigecycline Evaluation and Surveillance Trial began in 2004 to monitor the in vitro activity of tigecycline and comparator agents against a global collection of Gram-negative and Gram-positive pathogens. Against Gram negatives (n = 63 699), tigecycline MIC(90)'s ranged from 0.25 to 2 mg/L for Escherichia coli, Haemophilus influenzae, Acinetobacter baumannii, Klebsiella oxytoca, Enterobacter cloacae, Klebsiella pneumoniae, and Serratia marcescens (but was > or =32 for Pseudomonas aeruginosa). Against Gram-positive organisms (n = 32 218), tigecycline MIC(90)'s were between 0.06 and 0.25 mg/L for Streptococcus pneumoniae, Enterococcus faecium, Streptococcus agalactiae, Staphylococcus aureus, and Enterococcus faecalis. The in vitro activity of tigecycline was maintained against resistant phenotypes, including multidrug-resistant A. baumannii (9.2% of isolates), extended-spectrum beta-lactamase-producing E. coli (7.0%) and K. pneumoniae (14.0%), beta-lactamase-producing H. influenzae (22.2%), methicillin-resistant S. aureus (44.5%), vancomycin-resistant E. faecium (45.9%) and E. faecalis (2.8%), and penicillin-resistant S. pneumoniae (13.8%). Tigecycline represents a welcome addition to the armamentarium against difficult to treat organisms.
Gram staining for the treatment of peritonsillar abscess.
Takenaka, Yukinori; Takeda, Kazuya; Yoshii, Tadashi; Hashimoto, Michiko; Inohara, Hidenori
2012-01-01
Objective. To examine whether Gram staining can influence the choice of antibiotic for the treatment of peritonsillar abscess. Methods. Between 2005 and 2009, a total of 57 cases of peritonsillar abscess were analyzed with regard to cultured bacteria and Gram staining. Results. Only aerobes were cultured in 16% of cases, and only anaerobes were cultured in 51% of cases. Mixed growth of aerobes and anaerobes was observed in 21% of cases. The cultured bacteria were mainly aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. Phagocytosis of bacteria on Gram staining was observed in 9 cases. The bacteria cultured from these cases were aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. The sensitivity of Gram staining for the Gram-positive cocci and Gram-negative rods was 90% and 64%, respectively. The specificity of Gram staining for the Gram-positive cocci and Gram-negative rods was 62% and 76%, respectively. Most of the Gram-positive cocci were sensitive to penicillin, but some of anaerobic Gram-negative rods were resistant to penicillin. Conclusion. When Gram staining shows only Gram-positive cocci, penicillin is the treatment of choice. In other cases, antibiotics effective for the penicillin-resistant organisms should be used.
DEFF Research Database (Denmark)
Ingmer, Hanne; Vogensen, Finn K.; Hammer, Karin
1999-01-01
In the genome of the gram-positive bacterium Lactococcus lactis MG1363, we have identified three genes (clpC, clpE, and clpB) which encode Clp proteins containing two conserved ATP binding domains. The proteins encoded by two of the genes belong to the previously described ClpB and ClpC families....... The clpE gene, however, encodes a member of a new Clp protein family that is characterized by a short N-terminal domain including a putative zinc binding domain (-CX2CX22CX2C-). Expression of the 83-kDa ClpE protein as well as of the two proteins encoded by clpB was strongly induced by heat shock and...... was shown to participate in the degradation of randomly folded proteins in L. lactis, could be necessary for degrading proteins generated by certain types of stress....
Transformation and Stability of Cloned Polysaccharidase Genes in Gram-Positive Bacteria
EKİNCİ, Mehmet Sait
2014-01-01
Polysaccharidase genes from rumen bacteria were transferred to and expressed in ruminal and non-ruminal Gram-positive bacteria. The transformation efficiency and genetic stability of polysaccharidase genes in bacteria from different habitats were investigated. PCR amplification of cloned polysaccharidase genes from Escherichia coli, Lactococcus lactis, Enterococcus faecalis, Streptococcus sanguis and S. bovis strain 26 showed that rearrangement of plasmid and the gene fragment did not occur. ...
Directory of Open Access Journals (Sweden)
V. V. Aginova
2017-01-01
Full Text Available Nosocomial infections caused by gram-positive organisms, including Staphylococcus aureus and enterococci (Enterococcus faecium and Enterococcus faecalis are steadily increasing in almost all clinics around the world. Cancer patients have a higher risk of hospital-acquired infections than non-cancer patients. Cancer patients are immunosuppressed due to increased use of broad-spectrum antibiotics and chemotherapy drugs, radiation therapy, surgery and use of steroids. This paper presents an analysis of resistance of gram-positive bacterial pathogens to antimicrobial agents to determine treatment strategy for cancer patients.
Cell lysis and superoxide dismutase activities of highly radioresistant bacteria
Energy Technology Data Exchange (ETDEWEB)
Yoshinaka, T; Yano, K; Yamaguchi, H [Tokyo Univ. (Japan). Faculty of Agriculture
1976-01-01
The highly radioresistant bacterium, Arthrobacter radiotolerans, has been isolated from the radioactive hot spring of Misasa, and it does not sporulate, it is Gram-positive, and its color is pink to red. This bacterium shows the highest resistance to gamma-ray among Gram-positive resistants, but the lytic enzyme capable of lysing the cells of strong radioresistants and the surface structure of the cells are little known except those about Micrococcus radiodurans. The cells of the M. radiodurans can be lysed by Achramobacter lyticus enzyme, and electron microscopic observation and chemical analysis revealed the mutilayered surface structure of the cells consisting of an inner membrane, a mucopeptide wall layer and a very outer layer. The superoxide dismutase (SOD) activity of aerobic and anaerobic bacteria was studied, and the relatively high SOD activity of the M. radiodurans was found. The SOD function acts against the threat posed by the reactive superoxide radical being generated biologically, photochemically and radiochemically in the presence of molecular oxygen. In this paper, it is reported that the lytic enzyme No.2 obtained from Cytophaga sp., containing N-acetyl-muramyl-L-alanine amidase, peptidase and endopeptidase, and showing broad lytic spectra, was able to lyse the cells of A. radiotolerans and four radioresistant micrococci, and the radioresistant bacteria showedrelatively high SOD activity except M. sp. 248. It is well known that superoxide anions are generated by aerobic irradiation, and are toxic to microbial cells.
Cell lysis and superoxide dismutase activities of highly radioresistant bacteria
International Nuclear Information System (INIS)
Yoshinaka, Taeko; Yano, Keiji; Yamaguchi, Hikoyuki
1976-01-01
The highly radioresistant bacterium, Arthrobacter radiotolerans, has been isolated from the radioactive hot spring of Misasa, and it does not sporulate, it is Gram-positive, and its color is pink to red. This bacterium shows the highest resistance to gamma-ray among Gram-positive resistants, but the lytic enzyme capable of lysing the cells of strong radioresistants and the surface structure of the cells are little known except those about Micrococcus radiodurans. The cells of the M. radiodurans can be lysed by Achramobacter lyticus enzyme, and electron microscopic observation and chemical analysis revealed the mutilayered surface structure of the cells consisting of an inner membrane, a mucopeptide wall layer and a very outer layer. The superoxide dismutase (SOD) activity of aerobic and anaerobic bacteria was studied, and the relatively high SOD activity of the M. radiodurans was found. The SOD function acts against the threat posed by the reactive superoxide radical being generated biologically, photochemically and radiochemically in the presence of molecular oxygen. In this paper, it is reported that the lytic enzyme No.2 obtained from Cytophaga sp., containing N-acetyl-muramyl-L-alanine amidase, peptidase and endopeptidase, and showing broad lytic spectra, was able to lyse the cells of A. radiotolerans and four radioresistant micrococci, and the radioresistant bacteria showed relatively high SOD activity except M. sp. 248. It is well known that superoxide anions are generated by aerobic irradiation, and are toxic to microbial cells. (Kako, I.)
Differential staining of bacteria: gram stain.
Moyes, Rita B; Reynolds, Jackie; Breakwell, Donald P
2009-11-01
In 1884, Hans Christian Gram, a Danish doctor, developed a differential staining technique that is still the cornerstone of bacterial identification and taxonomic division. This multistep, sequential staining protocol separates bacteria into four groups based on cell morphology and cell wall structure: Gram-positive cocci, Gram-negative cocci, Gram-positive rods, and Gram-negative rods. The Gram stain is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures. (c) 2009 by John Wiley & Sons, Inc.
Fischer, Carol L; Drake, David R; Dawson, Deborah V; Blanchette, Derek R; Brogden, Kim A; Wertz, Philip W
2012-03-01
There is growing evidence that the role of lipids in innate immunity is more important than previously realized. How lipids interact with bacteria to achieve a level of protection, however, is still poorly understood. To begin to address the mechanisms of antibacterial activity, we determined MICs and minimum bactericidal concentrations (MBCs) of lipids common to the skin and oral cavity--the sphingoid bases D-sphingosine, phytosphingosine, and dihydrosphingosine and the fatty acids sapienic acid and lauric acid--against four Gram-negative bacteria and seven Gram-positive bacteria. Exact Kruskal-Wallis tests of these values showed differences among lipid treatments (P 500 μg/ml). Sapienic acid (MBC range, 31.3 to 375.0 μg/ml) was active against Streptococcus sanguinis, Streptococcus mitis, and Fusobacterium nucleatum but not active against Escherichia coli, Staphylococcus aureus, S. marcescens, P. aeruginosa, Corynebacterium bovis, Corynebacterium striatum, and Corynebacterium jeikeium (MBC > 500 μg/ml). Lauric acid (MBC range, 6.8 to 375.0 μg/ml) was active against all bacteria except E. coli, S. marcescens, and P. aeruginosa (MBC > 500 μg/ml). Complete killing was achieved as early as 0.5 h for some lipids but took as long as 24 h for others. Hence, sphingoid bases and fatty acids have different antibacterial activities and may have potential for prophylactic or therapeutic intervention in infection.
Radiation resistance of a hemolytic micrococcus isolated from chicken meat
International Nuclear Information System (INIS)
Tan, S.T.
1982-01-01
The effects of environmental factors on a highly radiation-resistant hemolytic micrococcus isolated from chicken meat were studied. NaCl tolerance and gamma radiation resistance of the cells were growth phase-related. The cells were resistant to injury from drying or freezing/thawing. Under certain conditions, cells in the frozen state required approximately 5 Mrad to inactivate 90% of the population; 0.2 Mrad injured an equivalent proportion. Survival curve of the cells heated at 60 0 C showed a unique pattern which was in three distinct phases. Heat-stressed cells were much more sensitive to radiation inactivation than unheated cells. When suspended in fresh m-Plate Count Broth (PCB), the injured cells repaired without multiplication during incubation at 32 0 C. The repair process in this bacterium, however, was slower compared to thermally injured organisms studied by other workers. An improved replica-plating technique, was devised for isolation of radiation-sensitive mutants of pigmented bacteria. A simple method to demonstrate radiation-inducible radiation resistance in microbial cells was developed. The new method required neither washing/centrifugation nor procedures for cell enumeration. Mutagenesis treatment of radiation-resistant micrococcal bacterium with N-methyl-N'-nitro-N-nitrosoguanidine (NTG) followed by FPR and screening steps resulted in isolation of two radiation-sensitive mutants. The more sensitive mutant strain, designated as 702, was seven times as sensitive to gamma or UC radiation as the wild type. No apparent difference was observed between 702 and the wild type in (1) cell morphology, colonial morphology, and pigment production or (2) tolerance to NaCl, drying/storage, freezing/thawing, and heating. Sodium dodecyl sulfate treatment (for curing) of wild type did not result in isolation of a radiation-sensitive mutant
A synbio approach for selection of highly expressed gene variants in Gram-positive bacteria.
Ferro, Roberto; Rennig, Maja; Hernández-Rollán, Cristina; Daley, Daniel O; Nørholm, Morten H H
2018-03-08
The market for recombinant proteins is on the rise, and Gram-positive strains are widely exploited for this purpose. Bacillus subtilis is a profitable host for protein production thanks to its ability to secrete large amounts of proteins, and Lactococcus lactis is an attractive production organism with a long history in food fermentation. We have developed a synbio approach for increasing gene expression in two Gram-positive bacteria. First of all, the gene of interest was coupled to an antibiotic resistance gene to create a growth-based selection system. We then randomised the translation initiation region (TIR) preceding the gene of interest and selected clones that produced high protein titres, as judged by their ability to survive on high concentrations of antibiotic. Using this approach, we were able to significantly increase production of two industrially relevant proteins; sialidase in B. subtilis and tyrosine ammonia lyase in L. lactis. Gram-positive bacteria are widely used to produce industrial enzymes. High titres are necessary to make the production economically feasible. The synbio approach presented here is a simple and inexpensive way to increase protein titres, which can be carried out in any laboratory within a few days. It could also be implemented as a tool for applications beyond TIR libraries, such as screening of synthetic, homologous or domain-shuffled genes.
Peptidoglycan Recycling in Gram-Positive Bacteria Is Crucial for Survival in Stationary Phase
Borisova, Marina; Gaupp, Rosmarie; Duckworth, Amanda; Schneider, Alexander; Dalügge, Désirée; Mühleck, Maraike; Deubel, Denise; Unsleber, Sandra; Yu, Wenqi; Muth, Günther; Bischoff, Markus; Götz, Friedrich
2016-01-01
ABSTRACT Peptidoglycan recycling is a metabolic process by which Gram-negative bacteria reutilize up to half of their cell wall within one generation during vegetative growth. Whether peptidoglycan recycling also occurs in Gram-positive bacteria has so far remained unclear. We show here that three Gram-positive model organisms, Staphylococcus aureus, Bacillus subtilis, and Streptomyces coelicolor, all recycle the sugar N-acetylmuramic acid (MurNAc) of their peptidoglycan during growth in rich medium. They possess MurNAc-6-phosphate (MurNAc-6P) etherase (MurQ in E. coli) enzymes, which are responsible for the intracellular conversion of MurNAc-6P to N-acetylglucosamine-6-phosphate and d-lactate. By applying mass spectrometry, we observed accumulation of MurNAc-6P in MurNAc-6P etherase deletion mutants but not in either the isogenic parental strains or complemented strains, suggesting that MurQ orthologs are required for the recycling of cell wall-derived MurNAc in these bacteria. Quantification of MurNAc-6P in ΔmurQ cells of S. aureus and B. subtilis revealed small amounts during exponential growth phase (0.19 nmol and 0.03 nmol, respectively, per ml of cells at an optical density at 600 nm [OD600] of 1) but large amounts during transition (0.56 nmol and 0.52 nmol) and stationary (0.53 nmol and 1.36 nmol) phases. The addition of MurNAc to ΔmurQ cultures greatly increased the levels of intracellular MurNAc-6P in all growth phases. The ΔmurQ mutants of S. aureus and B. subtilis showed no growth deficiency in rich medium compared to the growth of the respective parental strains, but intriguingly, they had a severe survival disadvantage in late stationary phase. Thus, although peptidoglycan recycling is apparently not essential for the growth of Gram-positive bacteria, it provides a benefit for long-term survival. PMID:27729505
Ionizing radiation damage in Micrococcus radiodurans cell wall: release of polysaccharide
International Nuclear Information System (INIS)
Mitchel, R.E.J.
1976-01-01
Sublethal 60 Co γ-irradiation of the bacterium Micrococcus radiodurans in aqueous suspension results in a loss of up to 6 percent of its cellular dry weight and 30 percent of its wet weight. In the process some specific cell wall polysaccharides, including a polymer of glucose and N-acylated glucosamine, are released into the surrounding medium. These polysaccharides appear to originate from a hydrophobic site in the middle, lipid-rich, cell wall layer. The damage to this layer which results in the release of these and other polymers may be due to a disruption of this hydrophobic site. The polysaccharide containing glucose and N-acylated glucosamine exists as a high molecular weight polymer in unirradiated cells, but irradiation causes some degradation prior to release. In a free state this polysaccharide is considerably less sensitive to radiolytic degradation than in a bound state. Free radicals generated from surrounding water by ionizing radiation initiate the release, hydroxyl radicals being the most important species. Oxygen protects the cell wall against loss of the polysaccharides, apparently by a mechanism which does not depend on the ability of O 2 to scavenge hydrogen atoms and aqueous electrons
Wencewicz, Timothy A; Yang, Baiyuan; Rudloff, James R; Oliver, Allen G; Miller, Marvin J
2011-10-13
The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ∼100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring-opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC(90) = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds.
Flavins mediate extracellular electron transfer in Gram-positive Bacillus megaterium strain LLD-1
DEFF Research Database (Denmark)
You, Le-Xing; Liu, Li-Dan; Xiao, Yong
2018-01-01
The extracellular electron transfer (EET) mechanism of an isolated Gram-positive Bacillus megaterium strain (LLD-1), identified by 16S rRNA gene sequencing and physiological analysis, was investigated in the present study. The electrochemical activity of strain LLD-1 was confirmed by electrochemi...
International Nuclear Information System (INIS)
Abbaszadegan, A.; Ghahramani, Y.; Nabavizadeh, M.; Gholami, A.; Hemmateenejad, I.; Dorostkar, S.; Sharghi, H.
2014-01-01
The bactericidal efficiency of various positively and negatively charged silver nanoparticles has been extensively evaluated in literature, but there is no report on efficacy of neutrally charged silver nanoparticles. The goal of this study is to evaluate the role of electrical charge at the surface of silver nanoparticles on antibacterial activity against a panel of microorganisms. Three different silver nanoparticles were synthesized by different methods, providing three different electrical surface charges (positive, neutral, and negative). The antibacterial activity of these nanoparticles was tested against gram-positive (i.e., Staphylococcus aureus, Streptococcus mutans, and Streptococcus pyogenes) and gram-negative (i.e., Escherichia coli and Proteus vulgaris) bacteria. Well diffusion and micro-dilution tests were used to evaluate the bactericidal activity of the nanoparticles. According to the obtained results, the positively-charged silver nanoparticles showed the highest bactericidal activity against all microorganisms tested. The negatively charged silver nanoparticles had the least and the neutral nanoparticles had intermediate antibacterial activity. The most resistant bacteria were Proteus vulgaris. We found that the surface charge of the silver nanoparticles was a significant factor affecting bactericidal activity on these surfaces. Although the positively charged nanoparticles showed the highest level of effectiveness against the organisms tested, the neutrally charged particles were also potent against most bacterial species.
Nagano, F; Kaneko, T; Yoshinaga, Y; Ukai, T; Kuramoto, A; Nakatsu, S; Oshino, K; Ichimura, I; Hara, Y
2013-08-01
Periodontitis is generally accepted to relate to gram-negative bacteria, and the host defense system influences its onset and progression. However, little is known about the relation between gram-positive bacteria and periodontitis. In this study, we topically applied gram-positive and gram-negative bacterial suspensions to the gingival sulcus in rats after immunization, and then histopathologically examined their influence on periodontal destruction. Rats previously immunized with heat-treated and sonicated Staphylococcus aureus or Aggregatibacter actinomycetemcomitans were used as immunized groups. The non-immunized group received only sterile phosphate-buffered saline. In each animal, S. aureus or A. actinomycetemcomitans suspension was applied topically to the palatal gingival sulcus of first molars every 24 h for 10 d. Blood samples were collected and the serum level of anti-S. aureus or anti-A. actinomycetemcomitans immunoglobulin G (IgG) antibodies was determined by enzyme-linked immunosorbent assay. The first molar regions were resected and observed histopathologically. Osteoclasts were stained with tartrate-resistant acid phosphatase (TRAP). The formation of immune complexes was confirmed by immunohistological staining of C1qB. Serum levels of anti-S. aureus and anti-A. actinomycetemcomitans IgG antibodies in the immunized groups were significantly higher than those in the non-immunized groups were. The loss of attachment, increase in apical migration of the junctional epithelium, and decreases in alveolar bone level and number of TRAP-positive multinuclear cells in each immunized group were significantly greater than in each non-immunized group. The presence of C1qB was observed in the junctional epithelium and adjacent connective tissue in the immunized groups. Heat-treated and sonicated S. aureus and A. actinomycetemcomitans induced attachment loss in rats immunized with their suspensions. Our results suggest that not only gram-negative but also gram-positive
Aliidiomarina haloalkalitolerans sp. nov., a marine bacterium isolated from coastal surface seawater
Digital Repository Service at National Institute of Oceanography (India)
Srinivas, T.N.R.; Nupur; AnilKumar, P.
A novel Gram-negative, rod shaped, motile, non-sporing strictly aerobic bacterium, designated strain AK5 sup(T), was isolated from a sea water sample collected near Visakhapatnam coast, Bay of Bengal, India. Colonies on marine agar were circular, 3...
Competitive biosorption of thorium and uranium by Micrococcus luteus
International Nuclear Information System (INIS)
Nakajima, A.; Tsuruta, T.
2004-01-01
Eighteen species of bacteria were screened for abilities to adsorb thorium and uranium. High adsorption capacity was observed for thorium by Arthrobacter nicotianae and Micrococcus luteus, and for uranium by Arthrobacter nicotianae. The adsorption of both thorium and uranium by Micrococcus luteus cells was rapid, was affected by the solution pH, and obeyed the Langmuir adsorption isotherm for binary systems in a competitive manner taking the ionic charge of the metal ion into account. The thorium selectivity in the competitive adsorption is assumed to be caused by the faster adsorption and the slower desorption rates of thorium than those of uranium. (author)
A synbio approach for selection of highly expressed gene variants in Gram-positive bacteria
DEFF Research Database (Denmark)
Ferro, Roberto; Rennig, Maja; Hernández Rollán, Cristina
2018-01-01
with a long history in food fermentation. We have developed a synbio approach for increasing gene expression in two Gram-positive bacteria. First of all, the gene of interest was coupled to an antibiotic resistance gene to create a growth-based selection system. We then randomised the translation initiation...... region (TIR) preceding the gene of interest and selected clones that produced high protein titres, as judged by their ability to survive on high concentrations of antibiotic. Using this approach, we were able to significantly increase production of two industrially relevant proteins; sialidase in B....... subtilis and tyrosine ammonia lyase in L. lactis. Gram-positive bacteria are widely used to produce industrial enzymes. High titres are necessary to make the production economically feasible. The synbio approach presented here is a simple and inexpensive way to increase protein titres, which can be carried...
Laine, M J; Nakhei, H; Dreier, J; Lehtilä, K; Meletzus, D; Eichenlaub, R; Metzler, M C
1996-05-01
In this paper we describe transformation of Clavibacter michiganensis subsp. sepedonicus, the potato ring rot bacterium, with plasmid vectors. Three of the plasmids used, pDM100, pDM302, and pDM306, contain the origin of replication from pCM1, a native plasmid of C. michiganensis subsp. michiganensis. We constructed two new cloning vectors, pHN205 and pHN216, by using the origin of replication of pCM2, another native plasmid of C. michiganensis subsp. michiganensis. Plasmids pDM302, pHN205, and pHN216 were stably maintained without antibiotic selection in various strains of C. michiganensis subsp. sepedonicus. We observed that for a single plasmid, different strains of C. michiganensis subsp. sepedonicus showed significantly different transformation efficiencies. We also found unexplained strain-to-strain differences in stability with various plasmid constructions containing different arrangements of antibiotic resistance genes and origins of replication. We examined the effect of a number of factors on transformation efficiency. The best transformation efficiencies were obtained when C. michiganensis subsp. sepedonicus cells were grown on DM agar plates, harvested during the early exponential growth phase, and used fresh (without freezing) for electroporation. The maximal transformation efficiency obtained was 4.6 x 10(4) CFU/microgram of pHN216 plasmid DNA. To demonstrate the utility of this transformation system, we cloned a beta-1,4-endoglucanase-encoding gene from C. michiganensis subsp. sepedonicus into pHN216. When this construction, pHN216:C8, was electroporated into competent cells of a cellulase-deficient mutant, it restored cellulase production to almost wild-type levels.
Zymomonas mobilis: a bacterium for ethanol production
Energy Technology Data Exchange (ETDEWEB)
Baratti, J.C.; Bu' Lock, J.D.
1986-01-01
Zymomonas mobilis is a facultative anaerobic gram negative bacterium first isolated in tropical countries from alcoholic beverages like the African palm wine, the Mexican pulque and also as a contaminant of cider (cider sickness) or beer in the European countries. It is one of the few facultative anaerobic bacteria degrading glucose by the Entner-Doudoroff pathway usually found in strictly aerobic microorganisms. Some work was devoted to this bacterium in the 50s and 60s and was reviewed by Swings and De Ley in their classical paper published in 1977. During the 70s there was very little work on the bacterium until 1979 and the first report by the Australian group of P.L. Rogers on the great potentialities of Z. mobilis for ethanol production. At that time the petroleum crisis had led the developed countries to search for alternative fuel from renewable resources. The Australian group clearly demonstrated the advantages of the bacterium compared to the yeasts traditionally used for the alcoholic fermentation. As a result, there was a considerable burst in the Zymomonas literature which started from nearly zero in the late 70s to attain 70 papers published in the field in 1984. In this article, papers published from 1982 to 1986 are reviewed.
Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun
2009-10-01
In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).
Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W
2006-08-01
We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.
Goda, Shuichiro; Koga, Tomoyuki; Yamashita, Kenichiro; Kuriura, Ryo; Ueda, Toshifumi
2018-04-08
In Archaea and Bacteria, surface layer (S-layer) proteins form the cell envelope and are involved in cell protection. In the present study, a putative S-layer protein was purified from the crude extract of Pyrococcus horikoshii using affinity chromatography. The S-layer gene was cloned and expressed in Escherichia coli. Isothermal titration calorimetry analyses showed that the S-layer protein bound N-acetylglucosamine and induced agglutination of the gram-positive bacterium Micrococcus lysodeikticus. The protein comprised a 21-mer structure, with a molecular mass of 1,340 kDa, as determined using small-angle X-ray scattering. This protein showed high thermal stability, with a midpoint of thermal denaturation of 79 °C in dynamic light scattering experiments. This is the first description of the carbohydrate-binding archaeal S-layer protein and its characteristics.
Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.
Joshi, V D; Sreekantiah, K R; Manjrekar, S P
1996-01-01
A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.
Initiation of chromosomal replication in predatory bacterium Bdellovibrio bacteriovorus
Directory of Open Access Journals (Sweden)
Lukasz Makowski
2016-11-01
Full Text Available Bdellovibrio bacteriovorus is a small Gram-negative predatory bacterium that attacks other Gram-negative bacteria, including many animal, human, and plant pathogens. This bacterium exhibits a peculiar biphasic life cycle during which two different types of cells are produced: non-replicating highly motile cells (the free-living phase and replicating cells (the intracellular-growth phase. The process of chromosomal replication in B. bacteriovorus must therefore be temporally and spatially regulated to ensure that it is coordinated with cell differentiation and cell cycle progression. Recently, B. bacteriovorus has received considerable research interest due to its intriguing life cycle and great potential as a prospective antimicrobial agent. Although we know that chromosomal replication in bacteria is mainly regulated at the initiation step, no data exists about this process in B. bacteriovorus. We report the first characterization of key elements of initiation of chromosomal replication – DnaA protein and oriC region from the predatory bacterium, B. bacteriovorus. In vitro studies using different approaches demonstrate that the B. bacteriovorus oriC (BdoriC is specifically bound and unwound by the DnaA protein. Sequence comparison of the DnaA-binding sites enabled us to propose a consensus sequence for the B. bacteriovorus DnaA box (5’-NN(A/TTCCACA-3’. Surprisingly, in vitro analysis revealed that BdoriC is also bound and unwound by the host DnaA proteins (relatively distantly related from B. bacteriovorus. We compared the architecture of the DnaA–oriC complexes (orisomes in homologous (oriC and DnaA from B. bacteriovorus and heterologous (BdoriC and DnaA from prey, E. coli or P. aeruginosa systems. This work provides important new entry points toward improving our understanding of the initiation of chromosomal replication in this predatory bacterium.
Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.
Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z
2015-01-01
Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.
Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1
Directory of Open Access Journals (Sweden)
Preeti N. Tallur
2015-09-01
Full Text Available Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF, polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.
The rapid isolation of mutants of some Gram-positive bacteria
International Nuclear Information System (INIS)
Dijkhuizen, L.; Keijer, L.
1981-01-01
In this communication the authors describe a method for isolating at high frequency independent mutants of a number of Gram-positive bacteria. The method was originally developed for use with an Arthrobacter sp. and appears to work best with this and other coryneform bacteria. All the bacteria used were from the culture collections maintained at the University of Warwick or the Centre for Applied Microbiological Research. For mutagenesis using UV light, cells were grown in complex media and used while still in the logarithmic phase of growth. Details of the irradiation procedure are given in the text. (Auth.)
The Mechanisms of Virulence Regulation by Small Noncoding RNAs in Low GC Gram-Positive Pathogens
Directory of Open Access Journals (Sweden)
Stephanie Pitman
2015-12-01
Full Text Available The discovery of small noncoding regulatory RNAs (sRNAs in bacteria has grown tremendously recently, giving new insights into gene regulation. The implementation of computational analysis and RNA sequencing has provided new tools to discover and analyze potential sRNAs. Small regulatory RNAs that act by base-pairing to target mRNAs have been found to be ubiquitous and are the most abundant class of post-transcriptional regulators in bacteria. The majority of sRNA studies has been limited to E. coli and other gram-negative bacteria. However, examples of sRNAs in gram-positive bacteria are still plentiful although the detailed gene regulation mechanisms behind them are not as well understood. Strict virulence control is critical for a pathogen’s survival and many sRNAs have been found to be involved in that process. This review outlines the targets and currently known mechanisms of trans-acting sRNAs involved in virulence regulation in various gram-positive pathogens. In addition, their shared characteristics such as CU interaction motifs, the role of Hfq, and involvement in two-component regulators, riboswitches, quorum sensing, or toxin/antitoxin systems are described.
International Nuclear Information System (INIS)
Peszke, Jerzy; Nowak, Anna; Szade, Jacek; Szurko, Agnieszka; Zygadło, Dorota; Michałowska, Marlena; Krzyściak, Paweł; Zygoń, Patrycja; Ratuszna, Alicja; Ostafin, Marek M.
2016-01-01
Engineered nanomaterials, especially metallic nanoparticles, are the most popular system applied in daily life products. The study of their biological and toxicity properties seems to be indispensable. In this paper, we present results of biological activity of Ag/Cu nanoparticles. These nanoparticles show more promising killing/inhibiting properties on Gram-negative bacteria than for Gram-positive ones. The Gram-negative bacteria show strong effect already at the concentration of 1 ppm after 15 min of incubation. Moreover, in vitro tests of toxicity made on normal human dermal fibroblast cultures showed that after 72 h of incubation with Ag/Cu nanoparticles, they are less toxic then Cu 2 O/CuO nanoparticles.
Energy Technology Data Exchange (ETDEWEB)
Peszke, Jerzy; Nowak, Anna, E-mail: ana.maria.nowak@gmail.com; Szade, Jacek; Szurko, Agnieszka; Zygadło, Dorota; Michałowska, Marlena [University of Silesia, A. Chelkowski Institute of Physics (Poland); Krzyściak, Paweł [Jagiellonian University Medical College, Department of Mycology Chair of Microbiology (Poland); Zygoń, Patrycja [Czestochowa University of Technology, Institute of Materials Engineering (Poland); Ratuszna, Alicja [University of Silesia, A. Chelkowski Institute of Physics (Poland); Ostafin, Marek M. [Department of Microbiology University of Agriculture (Poland)
2016-12-15
Engineered nanomaterials, especially metallic nanoparticles, are the most popular system applied in daily life products. The study of their biological and toxicity properties seems to be indispensable. In this paper, we present results of biological activity of Ag/Cu nanoparticles. These nanoparticles show more promising killing/inhibiting properties on Gram-negative bacteria than for Gram-positive ones. The Gram-negative bacteria show strong effect already at the concentration of 1 ppm after 15 min of incubation. Moreover, in vitro tests of toxicity made on normal human dermal fibroblast cultures showed that after 72 h of incubation with Ag/Cu nanoparticles, they are less toxic then Cu{sub 2}O/CuO nanoparticles.
Bacteriological water quality changes and substratespecificity of ...
African Journals Online (AJOL)
Identification test revealed the presence of Pseudomonas, Proteus, Micrococcus, Escherichia, Chromobacterium, Serratia, Klebsiella, Bacillus, Staphylococcus, Lactobacillus, Pediococcus, Norcadia, Vibro, Salmonella, Aeromonas, Cytophaga, Corynebacterium, Campylobacter and unidentified gram-positive cocci. About 50 ...
Wu, Huifeng; Ji, Chenglong; Wei, Lei; Zhao, Jianmin; Lu, Hongjian
2013-12-06
differential effects induced by the representative Gram-positive (M. luteus) and Gram-negative (V. anguillarum) bacteria in M. galloprovincialis. © 2013.
Neuner, Elizabeth A; Pallotta, Andrea M; Lam, Simon W; Stowe, David; Gordon, Steven M; Procop, Gary W; Richter, Sandra S
2016-11-01
OBJECTIVE To describe the impact of rapid diagnostic microarray technology and antimicrobial stewardship for patients with Gram-positive blood cultures. DESIGN Retrospective pre-intervention/post-intervention study. SETTING A 1,200-bed academic medical center. PATIENTS Inpatients with blood cultures positive for Staphylococcus aureus, Enterococcus faecalis, E. faecium, Streptococcus pneumoniae, S. pyogenes, S. agalactiae, S. anginosus, Streptococcus spp., and Listeria monocytogenes during the 6 months before and after implementation of Verigene Gram-positive blood culture microarray (BC-GP) with an antimicrobial stewardship intervention. METHODS Before the intervention, no rapid diagnostic technology was used or antimicrobial stewardship intervention was undertaken, except for the use of peptide nucleic acid fluorescent in situ hybridization and MRSA agar to identify staphylococcal isolates. After the intervention, all Gram-positive blood cultures underwent BC-GP microarray and the antimicrobial stewardship intervention consisting of real-time notification and pharmacist review. RESULTS In total, 513 patients with bacteremia were included in this study: 280 patients with S. aureus, 150 patients with enterococci, 82 patients with stretococci, and 1 patient with L. monocytogenes. The number of antimicrobial switches was similar in the pre-BC-GP (52%; 155 of 300) and post-BC-GP (50%; 107 of 213) periods. The time to antimicrobial switch was significantly shorter in the post-BC-GP group than in the pre-BC-GP group: 48±41 hours versus 75±46 hours, respectively (P<.001). The most common antimicrobial switch was de-escalation and time to de-escalation, was significantly shorter in the post-BC-GP group than in the pre-BC-GP group: 53±41 hours versus 82±48 hours, respectively (P<.001). There was no difference in mortality or hospital length of stay as a result of the intervention. CONCLUSIONS The combination of a rapid microarray diagnostic test with an antimicrobial
Oliveira, Manuela; Monteiro, José L; Rana, Sílvia; Vilela, Cristina L
2010-06-01
The Timorese River Buffalo (Bubalus bubalis) plays a major role in the East Timor economy, as it is an important source of animal protein in human nutrition. They are widely spread throughout the country and are in direct contact with the populations. In spite of this proximity, information on their microbiota is scarce. This work aimed at characterizing the skin microbiota of the East Timorese River Buffalo and its antimicrobial resistance profile. Skin swab samples were taken from 46 animals in surveys conducted in three farms located in "Suco de Nairete", Lospalos district, during July and August 2006. Bacteria were isolated and identified according to conventional microbiological procedures. A total of 456 isolates were obtained, including Gram-positive (n = 243) and Gram-negative (n = 213) bacteria. Due to their importance as potential pathogens and as vehicles for antimicrobial resistance transmission, Gram-positive cocci (n = 27) and bacilli (n = 77) isolates were further characterized, and their antimicrobial resistance profile determined by the disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines. This study shows the high bacterial diversity of B. bubalis skin microbiota, representing an important first step towards understanding its importance and epidemiologic role in animal health. It also points out the potential role of these animals as vectors of antimicrobial resistant bacteria dissemination and the importance of antimicrobial resistance monitoring in developing countries.
Tsukatani, Tadayuki; Suenaga, Hikaru; Higuchi, Tomoko; Shiga, Masanobu; Noguchi, Katsuya; Matsumoto, Kiyoshi
2011-01-01
Bacteria are fundamentally divided into two groups: Gram-positive and Gram-negative. Although the Gram stain and other techniques can be used to differentiate these groups, some issues exist with traditional approaches. In this study, we developed a method for differentiating Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of the tetrazolium salt {2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt} (WST-8) via 2-methyl-1,4-napthoquinone with a selection medium. We optimized the composition of the selection medium to allow the growth of Gram-negative bacteria while inhibiting the growth of Gram-positive bacteria. When the colorimetric viability assay was carried out in a selection medium containing 0.5µg/ml crystal violet, 5.0 µg/ml daptomycin, and 5.0µg/ml vancomycin, the reduction in WST-8 by Gram-positive bacteria was inhibited. On the other hand, Gram-negative bacteria produced WST-8-formazan in the selection medium. The proposed method was also applied to determine the Gram staining characteristics of bacteria isolated from various foodstuffs. There was good agreement between the results obtained using the present method and those obtained using a conventional staining method. These results suggest that the WST-8 colorimetric assay with selection medium is a useful technique for accurately differentiating Gram-positive and -negative bacteria.
Ben Bacha, Abir; Abid, Islem
2013-03-01
The best known physiologic function of secreted phospholipase A2 (sPLA2) group IIA (sPLA2-IIA) is defense against bacterial infection through hydrolytic degradation of bacterial membrane phospholipids. In fact, sPLA2-IIA effectively kills Gram-positive bacteria and to a lesser extent Gram-negative bacteria and is considered a major component of the eye's innate immune defense system. The antibacterial properties of sPLA2 have been demonstrated in rabbit and human tears. In this report, we have analyzed the bactericidal activity of dromedary tears and the subsequently purified sPLA2 on several Gram-positive bacteria. Our results showed that the sPLA2 displays a potent bactericidal activity against all the tested bacteria particularly against the Staphylococcus strains when tested in the ionic environment of tears. There is a synergic action of the sPLA2 with lysozyme when added to the bacteria culture prior to sPLA2. Interestingly, lysozyme purified from dromedary tears showed a significant bactericidal activity against Listeria monocytogene and Staphylococcus epidermidis, whereas the one purified from human tears displayed no activity against these two strains. We have also demonstrated that Ca(2+) is crucial for the activity of dromedary tear sPLA2 and to a less extent Mg(2+) ions. Given the presence of sPLA2 in tears and intestinal secretions, this enzyme may play a substantial role in innate mucosal and systemic bactericidal defenses against Gram-positive bacteria.
Directory of Open Access Journals (Sweden)
Bourne Philip E
2011-02-01
Full Text Available Abstract Background The tree of life is usually rooted between archaea and bacteria. We have previously presented three arguments that support placing the root of the tree of life in bacteria. The data have been dismissed because those who support the canonical rooting between the prokaryotic superkingdoms cannot imagine how the vast divide between the prokaryotic superkingdoms could be crossed. Results We review the evidence that archaea are derived, as well as their biggest differences with bacteria. We argue that using novel data the gap between the superkingdoms is not insurmountable. We consider whether archaea are holophyletic or paraphyletic; essential to understanding their origin. Finally, we review several hypotheses on the origins of archaea and, where possible, evaluate each hypothesis using bioinformatics tools. As a result we argue for a firmicute ancestry for archaea over proposals for an actinobacterial ancestry. Conclusion We believe a synthesis of the hypotheses of Lake, Gupta, and Cavalier-Smith is possible where a combination of antibiotic warfare and viral endosymbiosis in the bacilli led to dramatic changes in a bacterium that resulted in the birth of archaea and eukaryotes. Reviewers This article was reviewed by Patrick Forterre, Eugene Koonin, and Gáspár Jékely
Directory of Open Access Journals (Sweden)
Bingyue Xin
2016-07-01
Full Text Available Due to the rapidly increasing prevalence of multidrug-resistant bacterial strains, the need for new antimicrobial drugs to treat infections has become urgent. Bacteriocins, which are antimicrobial peptides of bacterial origin, are considered potential alternatives to conventional antibiotics and have attracted widespread attention in recent years. Among these bacteriocins, lantibiotics, especially two-component lantibiotics, exhibit potent antimicrobial activity against some clinically relevant Gram-positive pathogens and have potential applications in the pharmaceutical industry. In this study, we characterized a novel two-component lantibiotic termed thusin that consists of Thsα, Thsβ and Thsβ' (mutation of Thsβ, A14G and that was isolated from a B. thuringiensis strain BGSC 4BT1. Thsα and Thsβ (or Thsβ' exhibit optimal antimicrobial activity at a 1:1 ratio and act sequentially to affect target cells, and they are all highly thermostable (100°C for 30 min and pH tolerant (pH 2.0 to 9.0. Thusin shows remarkable efficacy against all tested Gram-positive bacteria and greater activities than two known lantibiotics thuricin 4A-4 and ticin A4, and one antibiotic vancomycin against various bacterial pathogens (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus (MRSA, Staphylococcus sciuri, Enterococcus faecalis, and Streptococcus pneumoniae. Moreover, thusin is also able to inhibit the outgrowth of Bacillus cereus spores. The potent antimicrobial activity of thusin against some Gram-positive pathogens indicates that it has potential for the development of new drugs.
Infections of branchial epithelium by intracellular gram-negative bacteria, termed epitheliocystis, have limited culture of Arctic char (Salvelinus alpinus). To characterize a bacterium associated with epitheliocystis in cultured char, gills were sampled for histopathologic examination, conventional...
Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater
A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...
Comparative evaluation of the antimicrobial activity of Citrullus ...
African Journals Online (AJOL)
... Salmonella typhimurium, Vibrio parahaemolyticus and Vibrio alginolyticus) and gram-positive (Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Listeria monocytogenes and Micrococcus luteus) bacteria and various Candida spp. (Candida glabrata, Candida albicans, Candida parapsilosis and ...
Directory of Open Access Journals (Sweden)
Coskun Kasim O
2011-09-01
Full Text Available Abstract The reported incidence of deep sternal wound infection (DSWI after cardiac surgery is 0.4-5% with Staphylococcus aureus being the most common pathogen isolated from infected wound sternotomies and bacteraemic blood cultures. This infection is associated with a higher morbidity and mortality than other known aetiologies. Little is reported about the optimal antibiotic management. The aim of the study is to quantify the application of daptomycin treatment of DSWI due to gram-positive organisms post cardiac surgery. We performed an observational analysis in 23 cases of post sternotomy DSWI with gram-positive organisms February 2009 and September 2010. When the wound appeared viable and the microbiological cultures were negative, the technique of chest closure was individualised to the patient. The incidence of DSWI was 1.46%. The mean dose of daptomycin application was 4.4 ± 0.9 mg/kg/d and the average duration of the daptomycin application was 14.47 ± 7.33 days. In 89% of the patients VAC therapy was used. The duration from daptomycin application to sternal closure was 18 ± 13.9 days. The parameters of infection including, fibrinogen (p = 0.03, white blood cell count (p = 0.001 and C-reactive protein (p = 0.0001 were significantly reduced after daptomycin application. We had no mortality and wound healing was successfully achieved in all patients. Treatment of DSWI due to gram-positive organisms with a daptomycin-containing antibiotic regimen is safe, effective and promotes immediate improvement of local wound conditions. Based on these observations, daptomycin may offer a new treatment option for expediting surgical management of DSWI after cardiac surgery.
VAGHASIYA, Yogeshkumar; CHANDA, Sumitra V.
2014-01-01
The methanol and acetone extracts of 14 plants belonging to different families were evaluated for antimicrobial activity against five Gram-positive bacteria: Staphylococcus aureus, Staphylococcus epidermidis, Bacillus cereus, Bacillus subtilis, Micrococcus flavus; seven Gram-negative bacteria: Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris, Salmonella typhimurium, Citrobacter freundii; and three fungi: Candida tropicalis, Cryptococcus lut...
Characterization of Micrococcus strains isolated from indoor air.
Kooken, Jennifer M; Fox, Karen F; Fox, Alvin
2012-02-01
The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.
Hasibuan, M.; Safni, I.; Lisnawita; Lubis, K.
2018-02-01
Burkholderia glumae is a quarantine seed-borne bacterial pathogen causing panicle blight disease on rice. This pathogen has been detected in some locations in Java, and recently, farmers in North Sumatra have reported rice yield loss with symptoms similar with those on rice infeced by the rice-pathogenic bacterium B. glumae. This research was aimed to isolate several bacterial strains from several rice varieties in various locations in North Sumatra and characterize the morphology of the strains to detect and identify the unknown bacterial strains presumably B. glumae. Several rice seed varieties were collected from Medan and Deli Serdang Districts. The seed samples were extracted, isolated and purified, then grown in semi-selective media PPGA. The morphological characteristics of the bacterial strains were determined including Gram staining, bacterial colony’s and bacterial cell’s morphology. The results showed that of eleven strains isolated, two strains were Gram negative and nine strains were Gram positive. On the basis of colony morphology, all strains had circular form, flat elevation and cream colour while the colony margin varied, i.e. entire and undulate. Most strains had bacillus/rod shape (8 strains) and only 3 strains were coccus.
Streptococcus mutans: a new Gram-positive paradigm?
Quivey, Robert G.; Koo, Hyun; Abranches, Jacqueline
2013-01-01
Despite the enormous contributions of the bacterial paradigms Escherichia coli and Bacillus subtilis to basic and applied research, it is well known that no single organism can be a perfect representative of all other species. However, given that some bacteria are difficult, or virtually impossible, to cultivate in the laboratory, that some are recalcitrant to genetic and molecular manipulation, and that others can be extremely dangerous to manipulate, the use of model organisms will continue to play an important role in the development of basic research. In particular, model organisms are very useful for providing a better understanding of the biology of closely related species. Here, we discuss how the lifestyle, the availability of suitable in vitro and in vivo systems, and a thorough understanding of the genetics, biochemistry and physiology of the dental pathogen Streptococcus mutans have greatly advanced our understanding of important areas in the field of bacteriology such as interspecies biofilms, competence development and stress responses. In this article, we provide an argument that places S. mutans, an organism that evolved in close association with the human host, as a novel Gram-positive model organism. PMID:23393147
Xu, Jiancheng; Chen, Qihui; Yao, Hanxin; Zhou, Qi
This study was to investigate the quinolones resistance to gram-positive cocci isolated in the First Bethune Hospital during the past 8 years. Disk diffusion test was used to study the antimicrobial resistance. The data were analyzed by WHONET 5 software according to Clinical and Laboratory Standards Institute (CLSI). The rates of methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative Staphylococci (MRCNS) were 50.8%∼83.3% and 79.4%∼81.5%during the past 8 years, respectively. In recent 8 years, the quinolones resistance to gram-positive cocci had increased. Monitoring of the quinolones resistance to gram-positive cocci should be strengthened. The change of the antimicrobial resistance should be investigated in order to guide rational drug usage in the clinic and prevent bacterial strain of drug resistance from being transmitted.
Four Proteins Synthesized in Response to Deoxyribonucleic Acid Damage in Micrococcus Radiodurans
DEFF Research Database (Denmark)
Hansen, M. T.
1980-01-01
Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis for these prote......Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis...
Schalk, Isabelle J
2018-05-10
In the alarming context of rising bacterial antibiotic resistance, there is an urgent need to discover new antibiotics or increase and/or enlarge the activity of those currently in use. The need for new antibiotics is even more urgent in the case of Gram-negative bacteria, such as Acinetobacter, Pseudomonas, and Enterobacteria, which have become resistant to many antibiotics and have an outer membrane with very low permeability to drugs. Vectorization of antibiotics using siderophores may be a solution to bypass such a bacterial wall: the drugs use the iron transporters of the outer membrane as gates to enter bacteria in a Trojan-horse strategy. Designing siderophore-antibiotics that can cross outer membranes has become almost routine, but their transport across the inner membrane is still a limiting step, as well as a strategy that allows dissociation of the antibiotic from the siderophore once inside the bacteria. Liu et al. ( J. Med. Chem. 2018 , DOI: 10.1021/acs.jmedchem.8b00218 ) report the synthesis of a siderophore-cephalosporin compound and demonstrate that β-lactams, such as cephalosporins, can serve as β-lactamase-triggered releasable linkers to allow intracellular delivery of Gram-positive antibiotics to Gram-negative bacteria.
Directory of Open Access Journals (Sweden)
Cristina Anamaria Semeniuc
2017-04-01
Full Text Available The aim of this study was to compare the antibacterial effects of several essential oils (EOs alone and in combination against different Gram-positive and Gram-negative bacteria associated with food products. Parsley, lovage, basil, and thyme EOs, as well as their mixtures (1:1, v/v, were tested against Bacillus cereus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Salmonella typhimurium. The inhibitory effects ranged from strong (thyme EO against E. coli to no inhibition (parsley EO against P. aeruginosa. Thyme EO exhibited strong (against E. coli, moderate (against S. typhimurium and B. cereus, or mild inhibitory effects (against P. aeruginosa and S. aureus, and basil EO showed mild (against E. coli and B. cereus or no inhibitory effects (against S. typhimurium, P. aeruginosa, and S. aureus. Parsley and lovage EOs revealed no inhibitory effects against all tested strains. Combinations of lovage/thyme and basil/thyme EOs displayed antagonistic effects against all bacteria, parsley/thyme EOs against B. cereus, S. aureus, P. aeruginosa, and E. coli, and lovage/basil EOs against B. cereus and E. coli. Combinations of parsley/lovage and parsley/basil EOs exhibited indifferent effects against all bacteria. The combination of lovage/basil EO showed indifferent effect against S. aureus, P. aeruginosa, and S. typhimurium, and the combination parsley/thyme EO against S. typhimurium. Thyme EO has the highest percentage yield and antibacterial potential from all tested formulations; its combination with parsley, lovage, and basil EOs determines a reduction of its antibacterial activity. Hence, it is recommended to be used alone as the antibacterial agent.
Hwang, Kyu-Youn; Kwon, Sung Hong; Jung, Sun-Ok; Lim, Hee-Kyun; Jung, Won-Jong; Park, Chin-Sung; Kim, Joon-Ho; Suh, Kahp-Yang; Huh, Nam
2011-11-07
We have developed a miniaturized bead-beating device to automate nucleic acids extraction from Gram-positive bacteria for molecular diagnostics. The microfluidic device was fabricated by sandwiching a monolithic flexible polydimethylsiloxane (PDMS) membrane between two glass wafers (i.e., glass-PDMS-glass), which acted as an actuator for bead collision via its pneumatic vibration without additional lysis equipment. The Gram-positive bacteria, S. aureus and methicillin-resistant S. aureus, were captured on surface-modified glass beads from 1 mL of initial sample solution and in situ lyzed by bead-beating operation. Then, 10 μL or 20 μL of bacterial DNA solution was eluted and amplified successfully by real-time PCR. It was found that liquid volume fraction played a crucial role in determining the cell lysis efficiency in a confined chamber by facilitating membrane deflection and bead motion. The miniaturized bead-beating operation disrupted most of S. aureus within 3 min, which turned out to be as efficient as the conventional benchtop vortexing machine or the enzyme-based lysis technique. The effective cell concentration was significantly enhanced with the reduction of initial sample volume by 50 or 100 times. Combination of such analyte enrichment and in situ bead-beating lysis provided an excellent PCR detection sensitivity amounting to ca. 46 CFU even for the Gram-positive bacteria. The proposed bead-beating microdevice is potentially useful as a nucleic acid extraction method toward a PCR-based sample-to-answer system. This journal is © The Royal Society of Chemistry 2011
International Nuclear Information System (INIS)
Ayhan, H.; Tutluer, H.
1994-01-01
Determination of the irradiation dose for the inhibition of some pathogenic bacteria which cause food poisoning and spoilage were aimed. For this purpose, Salmonella typhi, Salmonella typhimurium,Salmonella enteridits,Klebsiella pneumonia, Pseudomonas fluorescence,Proteus vulgaris, Aeromonas hydrophila ,(gram-negative bacteria) and Bacillus cereus, Staphylococcus aureus strain 24,Staphylococcus aureus ATCC 6538 P,Staphylococcus epidermidis strain 115 and Clostridium perfringens A4TTK,(gram-positive bacteria) were used.Sensitivity of above mentioned bacteria to gamma rays (source Cs-137) was examined in saline with 0.1% peptone at different temperatures.Survivor plots (log.10 number of survivors versus dose) were determined by regression analysis of the data.Decimal reduction doses (D values in kGy) were calculated as the slope obtained from the regression analysis
Isolation of highly active monoclonal antibodies against multiresistant gram-positive bacteria.
Directory of Open Access Journals (Sweden)
Friederike S Rossmann
Full Text Available Multiresistant nosocomial pathogens often cause life-threatening infections that are sometimes untreatable with currently available antibiotics. Staphylococci and enterococci are the predominant Gram-positive species associated with hospital-acquired infections. These infections often lead to extended hospital stay and excess mortality. In this study, a panel of fully human monoclonal antibodies was isolated from a healthy individual by selection of B-cells producing antibodies with high opsonic killing against E. faecalis 12030. Variable domains (VH and VL of these immunoglobulin genes were amplified by PCR and cloned into an eukaryotic expression vector containing the constant domains of a human IgG1 molecule and the human lambda constant domain. These constructs were transfected into CHO cells and culture supernatants were collected and tested by opsonophagocytic assay against E. faecalis and S. aureus strains (including MRSA. At concentrations of 600 pg/ml, opsonic killing was between 40% and 70% against all strains tested. Monoclonal antibodies were also evaluated in a mouse sepsis model (using S. aureus LAC and E. faecium, a mouse peritonitis model (using S. aureus Newman and LAC and a rat endocarditis model (using E. faecalis 12030 and were shown to provide protection in all models at a concentration of 4 μg/kg per animal. Here we present a method to produce fully human IgG1 monoclonal antibodies that are opsonic in vitro and protective in vivo against several multiresistant Gram-positive bacteria. The monoclonal antibodies presented in this study are significantly more effective compared to another monoclonal antibody currently in clinical trials.
Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan
2005-01-01
Strain GO5, a bacteriocin-producing bacterium, was isolated from green onion kimchi and identified as Micrococcus sp. The bacteriocin, micrococcin GO5, displayed a broad spectrum of inhibitory activity against a variety of pathogenic and nonpathogenic microorganisms, as tested by the spot-on-lawn method; its activity spectrum was almost identical to that of nisin. Micrococcin GO5 was inactivated by trypsin (whereas nisin was not) and was completely stable at 100 degrees C for 30 min and in the pH range of 2.0 to 7.0. Micrococcin GO5 exhibited a typical mode of bactericidal activity against Micrococcus flavus ATCC 10240. It was purified to homogeneity through ammonium sulfate precipitation, ultrafiltration, and CM-Sepharose column chromatography. The molecular mass of micrococcin GO5 was estimated to be about 5.0 kDa by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis and in situ activity assay with the indicator organism. The amino acid sequence of micrococcin GO5 lacks lanthionine and beta-methyllanthionine and is rich in hydrophobic amino acids and glycine, providing the basis for the high heat stability of this bacteriocin. The N-terminal amino acid sequence of micrococcin GO5 is Lys-Lys-Ser-Phe-Cys-Gln-Lys, and no homology to bacteriocins reported previously was observed in the amino acid composition or N-terminal amino acid sequence. Based on the physicochemical properties, small molecular size, and inhibition of Listeria monocytogenes, micrococcin GO5 has been placed with the class II bacteriocins, but its broad spectrum of activity differs from that of other bacteriocins in this class.
Flow cytometric evaluation of physico-chemical impact on Gram-positive and Gram-negative bacteria
Fröhling, Antje; Schlüter, Oliver
2015-01-01
Since heat sensitivity of fruits and vegetables limits the application of thermal inactivation processes, new emerging inactivation technologies have to be established to fulfill the requirements of food safety without affecting the produce quality. The efficiency of inactivation treatments has to be ensured and monitored. Monitoring of inactivation effects is commonly performed using traditional cultivation methods which have the disadvantage of the time span needed to obtain results. The aim of this study was to compare the inactivation effects of peracetic acid (PAA), ozonated water (O3), and cold atmospheric pressure plasma (CAPP) on Gram-positive and Gram-negative bacteria using flow cytometric methods. E. coli cells were completely depolarized after treatment (15 s) with 0.25% PAA at 10°C, and after treatment (10 s) with 3.8 mg l−1 O3 at 12°C. The membrane potential of CAPP treated cells remained almost constant at an operating power of 20 W over a time period of 3 min, and subsequently decreased within 30 s of further treatment. Complete membrane permeabilization was observed after 10 s O3 treatment, but treatment with PAA and CAPP did not completely permeabilize the cells within 2 and 4 min, respectively. Similar results were obtained for esterase activity. O3 inactivates cellular esterase but esterase activity was detected after 4 min CAPP treatment and 2 min PAA treatment. L. innocua cells and P. carotovorum cells were also permeabilized instantaneously by O3 treatment at concentrations of 3.8 ± 1 mg l−1. However, higher membrane permeabilization of L. innocua and P. carotovorum than of E. coli was observed at CAPP treatment of 20 W. The degree of bacterial damage due to the inactivation processes is highly dependent on treatment parameters as well as on treated bacteria. Important information regarding the inactivation mechanisms can be obtained by flow cytometric measurements and this enables the definition of critical process parameters. PMID
Flow cytometric evaluation of physico-chemical impact on Gram-positive and Gram-negative bacteria
Directory of Open Access Journals (Sweden)
Antje eFröhling
2015-09-01
Full Text Available Since heat sensitivity of fruits and vegetables limits the application of thermal inactivation processes, new emerging inactivation technologies have to be established to fulfil the requirements of food safety without affecting the produce quality. The efficiency of inactivation treatments has to be ensured and monitored. Monitoring of inactivation effects is commonly performed using traditional cultivation methods which have the disadvantage of the time span needed to obtain results.The aim of this study was to compare the inactivation effects of peracetic acid (PAA, ozonated water (O3 and cold atmospheric pressure plasma (CAPP on Gram-positive and Gram-negative bacteria using flow cytometric methods. E. coli cells were completely depolarized after treatment (15 s with 0.25 % PAA at 10 °C, and after treatment (10 s with 3.8 mg l-1 O3 at 12°C. The membrane potential of CAPP treated cells remained almost constant at an operating power of 20 W over a time period of 3 min, and subsequently decreased within 30 s of further treatment. Complete membrane permeabilization was observed after 10 s O3 treatment, but treatment with PAA and CAPP did not completely permeabilize the cells within 2 min and 4 min, respectively. Similar results were obtained for esterase activity. O3 inactivates cellular esterase but esterase activity was detected after 4 min CAPP treatment and 2 min PAA treatment. L. innocua cells and P. carotovorum cells were also permeabilized instantaneously by O3 treatment at concentrations of 3.8 ± 1 mg l-1. However, higher membrane permeabilization of L. innocua and P. carotovorum than of E. coli was observed at CAPP treatment of 20 W. The degree of bacterial damage due to the inactivation processes is highly dependent on treatment parameters as well as on treated bacteria. Important information regarding the inactivation mechanisms can be obtained by flow cytometric measurements and this enables the definition of critical process
Shrestha, Nabin K; Tuohy, Marion J; Padmanabhan, Ravindran A; Hall, Gerri S; Procop, Gary W
2005-12-01
We evaluated the Roche LightCycler Staphylococcus M(GRADE) kits to differentiate between Staphylococcus aureus and coagulase-negative staphylococci in blood cultures growing clusters of gram-positive cocci. Testing 100 bottles (36 containing S. aureus), the assay was 100% sensitive and 98.44% specific for S. aureus and 100% sensitive and specific for coagulase-negative staphylococci.
Widespread abundance of functional bacterial amyloid in Mycolata and other Gram-positive bacteria
DEFF Research Database (Denmark)
Jordal, Peter Bruun; Dueholm, Morten Simonsen; Larsen, Poul
2009-01-01
extracellular fibrils were also produced. In three cases, FuBA was only revealed after extensive removal of extracellular material by saponification, indicating an integrated attachment within the cellular envelope. Spores from species within the genera Streptomyces, Bacillus and Nocardia were all coated...... analysis. We conclude that amyloid is widespread among Gram-positive bacteria and may in many species constitute a hitherto overlooked integral part of the spores and the cellular envelope....
Directory of Open Access Journals (Sweden)
E.H. Seck
2016-03-01
Full Text Available We propose the main phenotypic characteristics and the complete genome sequence and annotation of Planococcus massiliensis strain ES2T (= CSUR P1103 = DSM 28915, the type strain of P. massiliensis sp. nov., isolated from a faeces sample collected from a healthy Senegalese man. It is an aerobic, Gram-positive, moderately halophilic, motile and rod-shaped bacterium. The 3 357 017 bp long genome exhibits a G+C content of 46.0% and contains 3357 protein-coding genes and 48 RNA genes.
Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz
2006-01-01
Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.
Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects
Nath, K. R.; Wagner, B. J.
1973-01-01
Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337
DEFF Research Database (Denmark)
Jensen, Rikke Lind; Pedersen, K.S.; Loeschcke, V
2007-01-01
resistance respectively, were subjected to infection by L. monocytogenes, S. aureus and E. coli. Mortality rates were comparable with that of the Oregon R strain. Conclusions: Use of the injection method shows the limitation of D. melanogaster as a model host for gram-positive bacteria as opportunistic......Aims: To examine sensitivities of various Drosophila melanogaster strains towards human pathogenic and nonpathogenic gram-positive bacteria. Methods and Results: The D. melanogaster Oregon R strain was infected by injecting the thorax with a needle containing Escherichia coli (negative control...... with the negative control. Infection with L. innocua, B. subtilis or C. maltaromaticum also resulted in a high fly mortality, whereas Lact. plantarum and P. acidilactici resulted in a slightly increased mortality. Four additional D. melanogaster lines, three of which had been selected for heat, cold and desiccation...
Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.
Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z
2011-02-01
A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.
A Proteomic Signature of Dormancy in the Actinobacterium Micrococcus luteus.
Mali, Sujina; Mitchell, Morgan; Havis, Spencer; Bodunrin, Abiodun; Rangel, Jonathan; Olson, Gabriella; Widger, William R; Bark, Steven J
2017-07-15
. Dormancy is comprised of different states, including persistent and viable but nonculturable (VBNC) states that contribute to the spread of bacterial infections. Therefore, it is imperative to identify how bacteria utilize these different dormancy states to survive antibiotic treatment. The objective of our research is to eliminate dormancy as a route to antibiotic tolerance by understanding the proteins that control dormancy in Micrococcus luteus NCTC 2665. This bacterium has unique advantages for studying dormancy, including a small genome and a well-defined and reproducible VBNC state. Our experiments implicate four previously identified and 14 novel proteins upregulated in VBNC that may regulate this critical survival mechanism. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Nielsen, Jesper Sejrup; Lei Kristensen, Lisbeth; Hanghøj Chrisitansen, Mie
between sRNA and target mRNA rely on the RNA chaperone Hfq. Hfq is a ubiquitous protein found in almost all genres of bacterial life. However, so far its role as an RNA chaperone has only been described in Gram-negative species such as Escherichia coli and Salmonella (Vogel, J. 2009). We previously...... identified several Hfq-binding sRNAs in the Gram-positive human pathogen L. monocytogenes (Christiansen et al 2006). Through bioinformatics, we have identified a number of candidate targets for one of these sRNAs (LhrA). Here, we present the characterization of one of these targets. Our results suggest...
Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease
International Nuclear Information System (INIS)
Hentosh, P.; Henner, W.D.; Reynolds, R.J.
1985-01-01
DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation
Reardon-Robinson, Melissa E.; Osipiuk, Jerzy; Chang, Chungyu; Wu, Chenggang; Jooya, Neda; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung
2015-01-01
Export of cell surface pilins in Gram-positive bacteria likely occurs by the translocation of unfolded precursor polypeptides; however, how the unfolded pilins gain their native conformation is presently unknown. Here, we present physiological studies to demonstrate that the FimA pilin of Actinomyces oris contains two disulfide bonds. Alanine substitution of cysteine residues forming the C-terminal disulfide bridge abrogates pilus assembly, in turn eliminating biofilm formation and polymicrobial interaction. Transposon mutagenesis of A. oris yielded a mutant defective in adherence to Streptococcus oralis, and revealed the essential role of a vitamin K epoxide reductase (VKOR) gene in pilus assembly. Targeted deletion of vkor results in the same defects, which are rescued by ectopic expression of VKOR, but not a mutant containing an alanine substitution in its conserved CXXC motif. Depletion of mdbA, which encodes a membrane-bound thiol-disulfide oxidoreductase, abrogates pilus assembly and alters cell morphology. Remarkably, overexpression of MdbA or a counterpart from Corynebacterium diphtheriae, rescues the Δvkor mutant. By alkylation assays, we demonstrate that VKOR is required for MdbA reoxidation. Furthermore, crystallographic studies reveal that A. oris MdbA harbors a thioredoxin-like fold with the conserved CXXC active site. Consistently, each MdbA enzyme catalyzes proper disulfide bond formation within FimA in vitro that requires the catalytic CXXC motif. Because the majority of signal peptide-containing proteins encoded by A. oris possess multiple Cys residues, we propose that MdbA and VKOR constitute a major folding machine for the secretome of this organism. This oxidative protein folding pathway may be a common feature in Actinobacteria. PMID:26170452
Reardon-Robinson, Melissa E; Osipiuk, Jerzy; Chang, Chungyu; Wu, Chenggang; Jooya, Neda; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung
2015-08-28
Export of cell surface pilins in Gram-positive bacteria likely occurs by the translocation of unfolded precursor polypeptides; however, how the unfolded pilins gain their native conformation is presently unknown. Here, we present physiological studies to demonstrate that the FimA pilin of Actinomyces oris contains two disulfide bonds. Alanine substitution of cysteine residues forming the C-terminal disulfide bridge abrogates pilus assembly, in turn eliminating biofilm formation and polymicrobial interaction. Transposon mutagenesis of A. oris yielded a mutant defective in adherence to Streptococcus oralis, and revealed the essential role of a vitamin K epoxide reductase (VKOR) gene in pilus assembly. Targeted deletion of vkor results in the same defects, which are rescued by ectopic expression of VKOR, but not a mutant containing an alanine substitution in its conserved CXXC motif. Depletion of mdbA, which encodes a membrane-bound thiol-disulfide oxidoreductase, abrogates pilus assembly and alters cell morphology. Remarkably, overexpression of MdbA or a counterpart from Corynebacterium diphtheriae, rescues the Δvkor mutant. By alkylation assays, we demonstrate that VKOR is required for MdbA reoxidation. Furthermore, crystallographic studies reveal that A. oris MdbA harbors a thioredoxin-like fold with the conserved CXXC active site. Consistently, each MdbA enzyme catalyzes proper disulfide bond formation within FimA in vitro that requires the catalytic CXXC motif. Because the majority of signal peptide-containing proteins encoded by A. oris possess multiple Cys residues, we propose that MdbA and VKOR constitute a major folding machine for the secretome of this organism. This oxidative protein folding pathway may be a common feature in Actinobacteria. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Evelin Flores Hernández
2017-11-01
Full Text Available Several studies have reported variations in bacterial staining by Gram, which are associated with the content of nucleic acids in the bacterial cell cycle. In order to give continuity to the microscopical studies pertaining to the bacterial cell cycle, the morphological and staining characteristics were evaluated by Gram and 4', 6-diamidino-2'-phenylindole, dihydrochloride (DAPI in the cell cycle of Acinetobacter baumannii. From the synchronic cultures of 4 strains of A. baumannii, the cell cycle was studied incubating them in aerobiosis at 30ºC, taking aliquots every 5 min for 2 h. In turn, the respective extensions were made and stained with Gram and DAPI for their posterior microscopical study. In the statistical analysis Fischer's test was used to associate morphological and the staining characteristics by Gram and DAPI. In 74% of cycle times, the cocoid form predominated and 67% in the negative Gram staining. When determining the mean and standard deviation of bacterial morphological values, it was observed that between 15 and 55 min the bacterium initiates a new cell cycle, decreasing its diameter and length. There was a statistically significant association (p < 0.05 between the lax and compact appearance of the material with the light and intense fluorescent, respectively; likewise, between the strong Gram positive character and the intense fluorescence. It is concluded that in the Gram positive reaction, the DNA is possibly involved and that the purple material of compact and lax aspect observed by Gram staining in the bacterial cytoplasm correspond to the nucleoid and the morphological changes obey to the cellular growth process. These findings contribute to explain the mechanism of Gram staining, as well as its variability and the pleomorphism observed in this bacterial genus.
New and improved? A review of novel antibiotics for Gram-positive bacteria.
Abbas, M; Paul, M; Huttner, A
2017-10-01
The number of antibiotics in the pipeline targeting Gram-positive pathogens has increased in recent years. This narrative review aims to provide a summary of existing evidence on efficacy, microbiological spectrum and safety of novel systemic antibiotics that have either recently been licensed or completed phase III trials, and possess activity predominantly against Gram-positive organisms. A review of the published literature via the MEDLINE database was performed. In addition, ongoing trials were identified through a search of the clinical trial registration platform clinicaltrials.gov, and when necessary, pharmaceutical companies responsible for the development of the drug were contacted for further information. Data on development, microbiological spectrum, pharmacokinetic/pharmacodynamic properties, clinical efficacy, safety and cost are presented for the new cephalosporins ceftaroline and ceftobiprole; the lipoglycopeptides dalbavancin, oritavancin and telavancin; the fluoroquinolones delafloxacin, nemonoxacin and zabofloxacin; the dihydrofolate-reductase inhibitor iclaprim; the pleuromutilin lefamulin; and the tetracycline omadacycline. Although promising, these new antibiotics have so far been tested in non-severe infections whose treatment is generally uncomplicated and whose aetiologies were not predominantly multidrug-resistant pathogens. None of the new antibiotics have shown superiority to standard care, and none have been investigated for patient-relevant outcomes. Safety and pharmacokinetic data continue to be lacking. How these new drugs are to be integrated into the current armamentarium remains to be established. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Antibacterial properties of biosurfactants against selected Gram-positive and -negative bacteria.
Díaz De Rienzo, Mayri A; Stevenson, Paul; Marchant, Roger; Banat, Ibrahim M
2016-01-01
The antibacterial properties and ability to disrupt biofilms of biosurfactants (rhamnolipids, sophorolipids) and sodium dodecyl sulphate (SDS) in the presence and absence of selected organic acids were investigated. Pseudomonas aeruginosa PAO1 was inhibited by sophorolipids and SDS at concentrations >5% v/v, and the growth of Escherichia coli NCTC 10418 was also inhibited by sophorolipids and SDS at concentrations >5% and 0.1% v/v, respectively. Bacillus subtilis NCTC 10400 was inhibited by rhamnolipids, sophorolipids and SDS at concentrations >0.5% v/v of all three; the same effect was observed with Staphylococcus aureus ATCC 9144. The ability to attach to surfaces and biofilm formation of P. aeruginosa PAO1, E. coli NCTC 10418 and B. subtilis NCTC 10400 was inhibited by sophorolipids (1% v/v) in the presence of caprylic acid (0.8% v/v). In the case of S. aureus ATCC 9144, the best results were obtained using caprylic acid on its own. It was concluded that sophorolipids are promising compounds for the inhibition/disruption of biofilms formed by Gram-positive and Gram-negative microorganisms and this activity can be enhanced by the presence of booster compounds such as caprylic acid. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Martinez, Virginia; Herencias, Cristina; Jurkevitch, Edouard
2016-01-01
This work examines the potential of the predatory bacterium Bdellovibrio bacteriovorus HD100, an obligate predator of other Gram-negative bacteria, as an external cell-lytic agent for recovering valuable intracellular bio-products produced by prey cultures. The bio-product targets to be recovered......% of that accumulated by the prey bacteria, even at high biomass concentrations. This innovative downstream process highlights how B. bacteriovorus can be used as a novel, biological lytic agent for the inexpensive, industrial scale recovery of intracellular products from different Gram-negative prey cultures....
Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong
2017-01-24
Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains
International Nuclear Information System (INIS)
Akhtar, N.; Alzahrani, A.; Obeid, O.El-Treify; Dassal, D.
2009-01-01
Over the last few decades the ever-increasing level of bacterial resistance to antimicrobials has been a cause of worldwide concern. Fluoroquinolones, particularly ciprofloxacin has been used indiscriminately for both gram-positive and gram-negative bacterial infections. The increased use of ciprofloxacin has led to a progressive loss of bacterial susceptibility to this antibiotic. Therefore it is necessary to have update knowledge of resistance pattern of bacteria to this antibiotic so that alternate appropriate antibiotics can be used for ciprofloxacin-resistant bacterial infections. Objective: To evaluate the trends of ciprofloxacin resistance pattern in commonly isolated gram positive bacteria over time in a Saudi Arabian teaching hospital. Methods: A retrospective analysis was carried out for ciprofloxacin susceptibility patterns of 5534 isolates of gram-positive bacteria isolated from clinical specimens submitted to microbiology laboratories at King Fahd Hospital of the University (KFHU), Al-Khobar, Saudi Arabia during the period from January 2002 to August 2005. Results: Increase in ciprofloxacin resistance rates with some fluctuations, among these isolates, were observed. For Staphylococcus aureus, it varied from 4.62, 1.83, 7.01 and 3.98%, methicillin resistant Staphylococcus aureus (MRSA) 97.92, 97.75, 87.01 and 88.26%, Streptococcus pyogenes 5.35, 4.47, 14.44 and 3.53% during the years 2002, 2003, 2004 and 2005 respectively. Cirprofloxacin resistance during the years 2002, 2004 and 2005 for other isolates was as follows: Streptococcus pneumoniae, 30.23, 23.02 and 26.47%; enterococcus group D, 43.05, 20.68 and 57.03% and non-enterococcus group D, 62.96, 76.92 and 87.50% respectively. Conclusion: Ciprofloxacin resistance in gram positive bacterial clinical isolates particularly Staphylococcus aureus, methicillin resistant Staphylococcus aureus (MRSA) enterococcus group D, and non-enterococcus group D, has greatly increased and ciprofloxacin no more remains
Gram-negative diabetic foot osteomyelitis: risk factors and clinical presentation.
Aragón-Sánchez, Javier; Lipsky, Benjamin A; Lázaro-Martínez, Jose L
2013-03-01
Osteomyelitis frequently complicates infections in the feet of patients with diabetes. Gram-positive cocci, especially Staphylococcus aureus, are the most commonly isolated pathogens, but gram-negative bacteria also cause some cases of diabetic foot osteomyelitis (DFO). These gram-negatives require different antibiotic regimens than those commonly directed at gram-positives. There are, however, few data on factors related to their presence and how they influence the clinical picture. We conducted a retrospective study to determine the variables associated with the isolation of gram-negative bacteria from bone samples in cases of DFO and the clinical presentation of these infections. Among 341 cases of DFO, 150 had a gram-negative isolate (alone or combined with a gram-positive isolate) comprising 44.0% of all patients and 50.8% of those with a positive bone culture. Compared with gram-positive infections, wounds with gram-negative organisms more often had a fetid odor, necrotic tissue, signs of soft tissue infection accompanying osteomyelitis, and clinically severe infection. By multivariate analysis, the predictive variables related to an increased likelihood of isolating gram-negatives from bone samples were glycated hemoglobin gram-negatives had a statistically significantly higher prevalence of leukocytosis and higher white blood cell counts than those without gram-negatives. In conclusion, gram-negative organisms were isolated in nearly half of our cases of DFO and were associated with more severe infections, higher white blood cell counts, lower glycated hemoglobin levels, and wounds of traumatic etiology.
Finnerty, W. R.; Kallio, R. E.
1964-01-01
Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700
Directory of Open Access Journals (Sweden)
Artur Timerman
Full Text Available OBJECTIVES: To collect data about non-controlled prescribing use of daptomycin and its impact among Brazilian patients with serious Gram positive bacterial infection, as well as the efficacy and safety outcomes. MATERIALS AND METHODS: This is a multi-center, retrospective, non-interventional registry (August 01, 2009 to June 30, 2011 to collect data on 120 patients (44 patients in the first year and 76 patients in the second year who had received at least one dose of commercial daptomycin in Brazil for the treatment of serious Gram-positive bacterial infection. RESULTS: Right-sided endocarditis (15.8%, complicated skin and soft tissue infections (cSSTIwound (15.0% and bacteremia-catheter-related (14.2% were the most frequent primary infections; lung (21.7% was the most common site for infection. Daptomycin was used empirically in 76 (63.3% patients, and methicillin-resistant Staphylococcus aureus (MRSA was the most common suspected pathogen (86.1%. 82.5% of the cultures were obtained prior to or shortly after initiation of daptomycin therapy. Staphylococcus spp. - coagulase negative, MRSA, and methicillin-susceptible S. aureus were the most frequently identified pathogens (23.8%, 23.8% and 12.5%, respectively. The most common daptomycin dose administered for bacteremia and cSSTI was 6 mg/kg (30.6% and 4 mg/kg (51.7%, respectively. The median duration of inpatient daptomycin therapy was 14 days. Most patients (57.1% did not receive daptomycin while in intensive care unit. Carbapenem (22.5% was the most commonly used antibiotic concomitantly. The patients showed clinical improvement after two days (median following the start of daptomycin therapy. The clinical success rate was 80.8% and the overall rate of treatment failure was 10.8%. The main reasons for daptomycin discontinuation were successful end of therapy (75.8%, switched therapy (11.7%, and treatment failure (4.2%. Daptomycin demonstrated a favorable safety and tolerability profile
Veillonella, Firmicutes: Microbes disguised as Gram negatives
DEFF Research Database (Denmark)
Vesth, Tammi Camilla; Ozen, Asli; Andersen, Sandra Christine
2013-01-01
Negativicutes, including the genus Veillonella, stain Gram negative. Veillonella are among the most abundant organisms of the oral and intestinal microflora of animals and humans, in spite of being strict anaerobes. In this work, the genomes of 24 Negativicutes, including eight Veillonella spp., are compared......, with the exception of a shared LPS biosynthesis pathway. The clade within the class Negativicutes to which the genus Veillonella belongs exhibits unique properties, most of which are in common with Gram-positives and some with Gram negatives. They are only distantly related to Clostridia, but are even less closely...... related to Gram-negative species. Though the Negativicutes stain Gram-negative and possess two membranes, the genome and proteome analysis presented here confirm their place within the (mainly) Gram positive phylum of the Firmicutes. Further studies are required to unveil the evolutionary history...
Johnson, D M; Jones, R N
1996-01-01
DMG-DMDOT (CL-331,002 OR CL-331,928) and DMG-MINO (CL-329,998 or CL-344,677) are two new semisynthetic tetracyclines called glycylcyclines, with a broad spectrum of activity and includes Enterobacteriaceae, Gram-positive cocci, JK diphtheroids, and Bacillus cereus. Potent activity was demonstrated against all Streptococcus spp. strains [minimum inhibitory concentrations] (MIC90S) 0.06-0.25 micrograms/ml) and staphylococci (oxacillin susceptible ans resistant; MIC90S 0.12-2 micrograms/ml). Both glycylcyclines (MIC90, 0.06 micrograms/ml) were more potent than minocycline (MIC90 8 micrograms/ml) against Enterococcus faecium, many of which were vancomycin resistant (116 strains). Organisms with minocycline MICs at > or = 8 micrograms/ml (Staphylococcus aureus, enterococci, beta-hemolytic streptococci, and pneumococci) had glycylcycline MIC results ranging from 0.06 to 0.5 micrograms/ml (e.g., apparent use against existing tetracycline-resistance phenotypes). Drugs in this class appear promising for therapy of infections caused by Gram-positive species now testing resistant to contemporary antimicrobial agents, and further development of compounds in this class is encouraged.
Kiliç, Nur Koçberber; Dönmez, Gönül
2008-06-15
Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.
Repair of double-strand breaks in Micrococcus radiodurans
International Nuclear Information System (INIS)
Burrell, A.D.; Dean, C.J.
1975-01-01
Micrococcus radiodurans has been shown to sustain double-strand breaks in its DNA after exposure to x-radiation. Following sublethal doses of x-rays (200 krad in oxygen or less), the cells were able to repair these breaks, and an intermediate fast-sedimenting DNA component seemed to be involved in the repair process
Kang, Jun-Won; Kim, Sang-Soon; Kang, Dong-Hyun
2018-07-01
The object of this study was to elucidate the bactericidal mechanism of a 222 nm Krypton Chlorine (KrCl) excilamp compared with that of a 254 nm Low Pressure mercury (LP Hg) lamp. The KrCl excilamp had higher bactericidal capacity against Gram-positive pathogenic bacteria (Staphylococcus aureus and L. monocytogenes) and Gram-negative pathogenic bacteria (S. Typhimurium and E. coli O157:H7) than did the LP Hg lamp when cell suspensions in PBS were irradiated with each type of UV lamp. It was found out that the KrCl excilamp induced cell membrane damage as a form of depolarization. From the study of respiratory chain dehydrogenase activity and the lipid peroxidation assay, it was revealed that cell membrane damage was attributed to inactivation of enzymes related to generation of membrane potential and occurrence of lipid peroxidation. Direct absorption of UV radiation which led to photoreaction through formation of an excited state was one of the causes inducing cell damage. Additionally, generation of ROS and thus occurrence of secondary damage can be another cause. The LP Hg lamp only induced damage to DNA but not to other components such as lipids or proteins. This difference was derived from differences of UV radiation absorption by cellular materials. Copyright © 2018 Elsevier Ltd. All rights reserved.
Environmental gram-positive mastitis treatment: in vitro sensitivity and bacteriologic cure.
Cattell, M B; Dinsmore, R P; Belschner, A P; Carmen, J; Goodell, G
2001-09-01
A clinical trial was conducted in a large dairy herd to determine the efficacy of intramammary pirlimycin hydrochloride administration during lactation for bacteriologic clearance of gram-positive environmental clinical and subclinical mastitis infections. Quarters infected with environmental streptococci that received pirlimycin therapy (13/28) were 1.8 times more likely to resolve infection than untreated quarters (5/14). The small numbers of quarters infected with coagulase-negative staphylococci resulted in inadequate power to assess treatment differences in cure rate. Although the association was not statistically significant, quarters from cows with sensitive environmental streptococci isolates from composite samples (8/13) resolved infection with treatment at approximately twice the rate of treated quarters with resistant isolates (3/10).
ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1
Perry, Jerome J.; Evans, James B.
1961-01-01
Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577
Simultaneous fluorescent gram staining and activity assessment of activated sludge bacteria.
Forster, Scott; Snape, Jason R; Lappin-Scott, Hilary M; Porter, Jonathan
2002-10-01
Wastewater treatment is one of the most important commercial biotechnological processes, and yet the component bacterial populations and their associated metabolic activities are poorly understood. The novel fluorescent dye hexidium iodide allows assessment of Gram status by differential absorption through bacterial cell walls. Differentiation between gram-positive and gram-negative wastewater bacteria was achieved after flow cytometric analysis. This study shows that the relative proportions of gram-positive and gram-negative bacterial cells identified by traditional microscopy and hexidium iodide staining were not significantly different. Dual staining of cells for Gram status and activity proved effective in analyzing mixtures of cultured bacteria and wastewater populations. Levels of highly active organisms at two wastewater treatment plants, both gram positive and gram negative, ranged from 1.5% in activated sludge flocs to 16% in the activated sludge fluid. Gram-positive organisms comprised Gram status and activity within activated sludge samples over a 4-day period showed significant differences over time. This method provides a rapid, quantitative measure of Gram status linked with in situ activity within wastewater systems.
Techniques for controlling variability in gram staining of obligate anaerobes.
Johnson, M J; Thatcher, E; Cox, M E
1995-01-01
Identification of anaerobes recovered from clinical samples is complicated by the fact that certain gram-positive anaerobes routinely stain gram negative; Peptostreptococcus asaccharolyticus, Eubacterium plautii, Clostridium ramosum, Clostridium symbiosum, and Clostridium clostridiiforme are among the nonconformists with regard to conventional Gram-staining procedures. Accurate Gram staining of American Type Culture Collection strains of these anaerobic bacteria is possible by implementing fixing and staining techniques within a gloveless anaerobic chamber. Under anaerobic conditions, gram-positive staining occurred in all test organisms with "quick" fixing techniques with both absolute methanol and formalin. The results support the hypothesis that, when anaerobic bacteria are exposed to oxygen, a breakdown of the physical integrity of the cell wall occurs, introducing Gram stain variability in gram-positive anaerobes. PMID:7538512
Miao, Li-Li; Fan, Hong-Xia; Qu, Jie; Liu, Ying; Liu, Zhi-Pei
2017-03-01
Psychrophilic enzymes display efficient activity at moderate or low temperatures (4-25 °C) and are therefore of great interest in biotechnological industries. We previously examined the crystal structure of BglU, a psychrophilic β-glucosidase from the bacterium Micrococcus antarcticus, at 2.2 Å resolution. In structural comparison and sequence alignment with mesophilic (BglB) and thermophilic (GlyTn) counterpart enzymes, BglU showed much lower contents of Pro residue and of charged amino acids (particularly positively charged) on the accessible surface area. In the present study, we investigated the roles of specific amino acid residues in the cold adaptedness of BglU. Mutagenesis assays showed that the mutations G261R and Q448P increased optimal temperature (from 25 to 40-45 °C) at the expense of low-temperature activity, but had no notable effects on maximal activity or heat lability. Mutations A368P, T383P, and A389E significantly increased optimal temperature (from 25 to 35-40 °C) and maximal activity (~1.5-fold relative to BglU). Thermostability of A368P and A389E increased slightly at 30 °C. Mutations K163P, N228P, and H301A greatly reduced enzymatic activity-almost completely in the case of H301A. Low contents of Pro, Arg, and Glu are important factors contributing to BglU's psychrophilic properties. Our findings will be useful in structure-based engineering of psychrophilic enzymes and in production of mutants suitable for a variety of industrial processes (e.g., food production, sewage treatment) at cold or moderate temperatures.
Idogawa, Nao; Amamoto, Ryuta; Murata, Kousaku; Kawai, Shigeyuki
2014-01-01
Gluconacetobacter diazotrophicus is a gram-negative and endophytic nitrogen-fixing bacterium that has several beneficial effects in host plants; thus, utilization of this bacterium as a biofertilizer in agriculture may be possible. G. diazotrophicus synthesizes levan, a D-fructofuranosyl polymer with β-(2→6) linkages, as an exopolysaccharide and the synthesized levan improves the stress tolerance of the bacterium. In this study, we found that phosphate enhances levan production by G. diazotrophicus Pal5, a wild type strain that showed a stronger mucous phenotype on solid medium containing 28 mM phosphate than on solid medium containing 7 mM phosphate. A G. diazotrophicus Pal5 levansucrase disruptant showed only a weak mucous phenotype regardless of the phosphate concentration, indicating that the mucous phenotype observed on 28 mM phosphate medium was caused by levan. To our knowledge, this is the first report of the effect of a high concentration of phosphate on exopolysaccharide production. PMID:24717418
Wojewoda, Christina M; Sercia, Linda; Navas, Maria; Tuohy, Marion; Wilson, Deborah; Hall, Geraldine S; Procop, Gary W; Richter, Sandra S
2013-07-01
Rapid identification of pathogens from blood cultures can decrease lengths of stay and improve patient outcomes. We evaluated the accuracy of the Verigene Gram-positive blood culture (BC-GP) nucleic acid test for investigational use only (Nanosphere, Inc., Northbrook, IL) for the identification of Gram-positive bacteria from blood cultures. The detection of resistance genes (mecA in Staphylococcus aureus and Staphylococcus epidermidis and vanA or vanB in Enterococcus faecium and Enterococcus faecalis) by the BC-GP assay also was assessed. A total of 186 positive blood cultures (in BacT/Alert FA bottles) with Gram-positive cocci observed with Gram staining were analyzed using the BC-GP assay. The BC-GP results were compared with the identification and susceptibility profiles obtained with routine methods in the clinical laboratory. Discordant results were arbitrated with additional biochemical, cefoxitin disk, and repeat BC-GP testing. The initial BC-GP organism identification was concordant with routine method results for 94.6% of the blood cultures. Only 40% of the Streptococcus pneumoniae identifications were correct. The detection of the mecA gene for 69 blood cultures with only S. aureus or S. epidermidis was concordant with susceptibility testing results. For 3 of 6 cultures with multiple Staphylococcus spp., mecA detection was reported but was correlated with oxacillin resistance in a species other than S. aureus or S. epidermidis. The detection of vanA agreed with susceptibility testing results for 45 of 46 cultures with E. faecalis or E. faecium. Comparison of the mean times to results for each organism group showed that BC-GP results were available 31 to 42 h earlier than phenotypic identifications and 41 to 50 h earlier than susceptibility results.
Kläring, K.; Hanske, L.; Bui, T.P.N.; Charrier, C.; Blaut, M.; Haller, D.; Plugge, C.M.; Clavel, T.
2013-01-01
Whilst creating a bacterial collection of strains from the mouse intestine, we isolated a Gram-negative, spore-forming, non-motile and strictly anaerobic rod-shaped bacterium from the caecal content of a TNFdeltaARE mouse. The isolate, referred to as strain SRB-521-5-IT, was originally cultured on a
Gram-positive bacteria of marine origin: a numerical taxonomic study on Mediterranean isolates.
Ortigosa, M; Garay, E; Pujalte, M J
1997-12-01
A numerical taxonomic study was performed on 65 Gram-positive wild strains of heterotrophic, aerobic, marine bacteria, and 9 reference strains. The isolates were obtained from oysters and seawater sampled monthly over one year, by direct plating on Marine Agar. The strains were characterized by 96 morphological, biochemical, physiological and nutritional tests. Clustering yielded 13 phena at 0.62 similarity level (Sl coefficient). Only one of the seven phena containing wild isolates could be identified (Bacillus marinus). A pronounced salt requirement was found in most isolates.
Deleers, M; Dodémont, M; Van Overmeire, B; Hennequin, Y; Vermeylen, D; Roisin, S; Denis, O
2016-04-01
Catheter-related bloodstream infections (CRBSIs) remain a leading cause of healthcare-associated infections in preterm infants. Rapid and accurate methods for the diagnosis of CRBSIs are needed in order to implement timely and appropriate treatment. A retrospective study was conducted during a 7-year period (2005-2012) in the neonatal intensive care unit of the University Hospital Erasme to assess the value of Gram stain on catheter-drawn blood samples (CDBS) to predict CRBSIs. Both peripheral samples and CDBS were obtained from neonates with clinically suspected CRBSI. Gram stain, automated culture and quantitative cultures on blood agar plates were performed for each sample. The paired quantitative blood culture was used as the standard to define CRBSI. Out of 397 episodes of suspected CRBSIs, 35 were confirmed by a positive ratio of quantitative culture (>5) or a colony count of CDBS culture >100 colony-forming units (CFU)/mL. All but two of the 30 patients who had a CDBS with a positive Gram stain were confirmed as having a CRBSI. Seven patients who had a CDBS with a negative Gram stain were diagnosed as CRBSI. The sensitivity, specificity, positive predictive value and negative predictive value of Gram stain on CDBS were 80, 99.4, 93.3 and 98.1 %, respectively. Gram staining on CDBS is a viable method for rapidly (<1 h) detecting CRBSI without catheter withdrawal.
Joshi, M. N.; Sharma, A. C.; Pandya, R. V.; Patel, R. P.; Saiyed, Z. M.; Saxena, A. K.
2012-01-01
Pontibacter sp. nov. BAB1700 is a halotolerant, Gram-negative, rod-shaped, pink-pigmented, menaquinone-7-producing bacterium isolated from sediments of a drilling well. The draft genome sequence of the strain, consisting of one chromosome of 4.5 Mb, revealed vital gene clusters involved in vitamin biosynthesis and resistance against various metals and antibiotics. PMID:23105068
Use of MALDI-TOF Mass Spectrometry for the Fast Identification of Gram-Positive Fish Pathogens
Assis, Gabriella B. N.; Pereira, Felipe L.; Zegarra, Alexandra U.; Tavares, Guilherme C.; Leal, Carlos A.; Figueiredo, Henrique C. P.
2017-01-01
Gram-positive cocci, such as Streptococcus agalactiae, Lactococcus garvieae, Streptococcus iniae, and Streptococcus dysgalactiae subsp. dysgalactiae, are found throughout the world, particularly in outbreaks in farmed fish, and are thus associated with high economic losses, especially in the cultivation of Nile Tilapia. The aim of this study was to evaluate the efficacy of matrix-assisted laser desorption ionization (MALDI)-time of flight (TOF) mass spectrometry (MS) as an alternative for the diagnosis of these pathogens. One hundred and thirty-one isolates from Brazilian outbreaks assisted by the national authority were identified using a MALDI Biotyper from Bruker Daltonics. The results showed an agreement with respect to identification (Kappa = 1) between this technique and 16S ribosomal RNA gene sequencing for S. agalactiae and L. garvieae. However, for S. iniae and S. dysgalactiae subsp. dysgalactiae, perfect agreement was only achieved after the creation of a custom main spectra profile, as well as further comparisons with 16S ribosomal RNA and multilocus sequence analysis. MALDI-TOF MS was shown to be an efficient technology for the identification of these Gram-positive pathogens, yielding a quick and precise diagnosis. PMID:28848512
Crude oil degradation by Bacillus and Micrococcus species isolated ...
African Journals Online (AJOL)
Microorganisms capable of degrading crude oil were isolated from soil compost in Kano, northwestern Nigeria. The work was carried out with the aim of determining crude-oil biodegradation potentials of Bacillus and Micrococcus species isolated from the soil compost as well as the assessment of the applicability of ...
Prediction of lipoprotein signal peptides in Gram-negative bacteria.
Juncker, Agnieszka S; Willenbrock, Hanni; Von Heijne, Gunnar; Brunak, Søren; Nielsen, Henrik; Krogh, Anders
2003-08-01
A method to predict lipoprotein signal peptides in Gram-negative Eubacteria, LipoP, has been developed. The hidden Markov model (HMM) was able to distinguish between lipoproteins (SPaseII-cleaved proteins), SPaseI-cleaved proteins, cytoplasmic proteins, and transmembrane proteins. This predictor was able to predict 96.8% of the lipoproteins correctly with only 0.3% false positives in a set of SPaseI-cleaved, cytoplasmic, and transmembrane proteins. The results obtained were significantly better than those of previously developed methods. Even though Gram-positive lipoprotein signal peptides differ from Gram-negatives, the HMM was able to identify 92.9% of the lipoproteins included in a Gram-positive test set. A genome search was carried out for 12 Gram-negative genomes and one Gram-positive genome. The results for Escherichia coli K12 were compared with new experimental data, and the predictions by the HMM agree well with the experimentally verified lipoproteins. A neural network-based predictor was developed for comparison, and it gave very similar results. LipoP is available as a Web server at www.cbs.dtu.dk/services/LipoP/.
Antibiotic Sensitivity of Micrococcus radiodurans
Hawiger, J.; Jeljaszewicz, J.
1967-01-01
A wild-type strain of Micrococcus radiodurans and its nonpigmented mutant W1 were tested for sensitivity to 10 antibiotics selected from the standpoint of their mechanism of action. Representatives of groups of antibiotics inhibiting deoxyribonucleic acid (DNA) synthesis, DNA-dependent ribonucleic acid synthesis, protein synthesis, and cell wall synthesis were selected. M. radiodurans and its mutant exhibited full susceptibility to all antibiotics tested (mitomycin C, actinomycin D, chloramphenicol, dihydrostreptomycin, erythromycin, neomycin, kanamycin, benzylpenicillin, bacitracin, and vancomycin), the degree of susceptibility being of the same order as that of a standard strain of Staphylococcus aureus 209 P, with the exception of dihydrostreptomycin. PMID:4166078
De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R
1977-01-01
Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263
High-level fluorescence labeling of gram-positive pathogens.
Directory of Open Access Journals (Sweden)
Simone Aymanns
Full Text Available Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.
Ahmed, Eman Fadl; Hassan, Hossam Mokhtar; Rateb, Mostafa Ezzat; Abdel-Wahab, Noha; Sameer, Somayah; Aly Taie, Hanan Anwar; Abdel-Hameed, Mohammed Sayed; Hammouda, Ola
2016-01-01
Two marine endophytic bacteria were isolated from the Red Sea algae; a red alga; Acanthophora dendroides and the brown alga Sargassum sabrepandum. The isolates were identified based on their 16SrRNA sequences as Bacterium SRCnm and Bacillus sp. JS. The objective of this study was to investigate the potential anti-microbial and antioxidant activities of the extracts of the isolated bacteria grown in different nutrient conditions. Compared to amoxicillin (25μg/disk) and erythromycin (15μg/disk), the extracts of Bacterium SRCn min media II, III, IV and V were potent inhibitors of the gram-positive bacterium Sarcina maxima even at low concentrations. Also, the multidrug resistant Staphylococcus aureus(MRSA) was more sensitive to the metabolites produced in medium (II) of the same endophyte than erythromycin (15μg/disk). A moderate activity of the Bacillus sp. JS extracts of media I and II was obtained against the same pathogen. The total compounds (500ug/ml) of both isolated endophytes showed moderate antioxidant activities (48.9% and 46.1%, respectively). LC/MS analysis of the bacterial extracts was carried out to investigate the likely natural products produced. Cyclo(D-cis-Hyp-L-Leu), dihydrosphingosine and 2-Amino-1,3-hexadecanediol were identified in the fermentation medium of Bacterium SRCnm, whereas cyclo (D-Pro-L-Tyr) and cyclo (L-Leu-L-Pro) were the suggested compounds of Bacillus sp. JS.
Crystallization and preliminary X-ray analysis of three dUTPases from Gram-positive bacteria
International Nuclear Information System (INIS)
Li, Gui-Lan; Wang, Juan; Li, Lan-Fen; Su, Xiao-Dong
2009-01-01
All organisms examined to date possess a dUTPase that performs the important function of efficiently hydrolyzing dUTP to dUMP in order to prevent the incorporation of dUTP into DNA. Three putative dUTPases from Gram-positive bacteria have been studied in this work. All organisms examined to date possess a dUTPase that performs the important function of efficiently hydrolyzing dUTP to dUMP in order to prevent the incorporation of dUTP into DNA. Three putative dUTPases from Gram-positive bacteria have been studied in this work. Two dUTPase-encoding genes, yncF and yosS, have been identified in Bacillus subtilis. The gene dut, encoding dUTPase from the dental pathogen Streptococcus mutans, was amplified from S. mutans genomic DNA. The three genes were cloned into expression vectors and overexpressed at high levels in Escherichia coli. Each protein was purified in two steps using chromatographic methods. Crystals of the YosS and YncF proteins and of S. mutans dUTPase were obtained using the vapour-diffusion method. X-ray diffraction data sets were collected from crystals of selenomethionine-labelled YosS and S. mutans dUTPase to resolutions of 2.3 and 1.7 Å, respectively. The crystal of native YncF diffracted to 2.7 Å resolution
Gram staining apparatus for space station applications
Molina, T. C.; Brown, H. D.; Irbe, R. M.; Pierson, D. L.
1990-01-01
A self-contained, portable Gram staining apparatus (GSA) has been developed for use in the microgravity environment on board the Space Station Freedom. Accuracy and reproducibility of this apparatus compared with the conventional Gram staining method were evaluated by using gram-negative and gram-positive controls and different species of bacteria grown in pure cultures. A subsequent study was designed to assess the performance of the GSA with actual specimens. A set of 60 human and environmental specimens was evaluated with the GSA and the conventional Gram staining procedure. Data obtained from these studies indicated that the GSA will provide the Gram staining capability needed for the microgravity environment of space.
Fast Mechanically Driven Daughter Cell Separation Is Widespread in Actinobacteria.
Zhou, Xiaoxue; Halladin, David K; Theriot, Julie A
2016-08-30
Dividing cells of the coccoid Gram-positive bacterium Staphylococcus aureus undergo extremely rapid (millisecond) daughter cell separation (DCS) driven by mechanical crack propagation, a strategy that is very distinct from the gradual, enzymatically driven cell wall remodeling process that has been well described in several rod-shaped model bacteria. To determine if other bacteria, especially those in the same phylum (Firmicutes) or with similar coccoid shapes as S. aureus, might use a similar mechanically driven strategy for DCS, we used high-resolution video microscopy to examine cytokinesis in a phylogenetically wide range of species with various cell shapes and sizes. We found that fast mechanically driven DCS is rather rare in the Firmicutes (low G+C Gram positives), observed only in Staphylococcus and its closest coccoid relatives in the Macrococcus genus, and we did not observe this division strategy among the Gram-negative Proteobacteria In contrast, several members of the high-G+C Gram-positive phylum Actinobacteria (Micrococcus luteus, Brachybacterium faecium, Corynebacterium glutamicum, and Mycobacterium smegmatis) with diverse shapes ranging from coccoid to rod all undergo fast mechanical DCS during cell division. Most intriguingly, similar fast mechanical DCS was also observed during the sporulation of the actinobacterium Streptomyces venezuelae Much of our knowledge on bacterial cytokinesis comes from studying rod-shaped model organisms such as Escherichia coli and Bacillus subtilis Less is known about variations in this process among different bacterial species. While cell division in many bacteria has been characterized to some extent genetically or biochemically, few species have been examined using video microscopy to uncover the kinetics of cytokinesis and daughter cell separation (DCS). In this work, we found that fast (millisecond) DCS is exhibited by species in two independent clades of Gram-positive bacteria and is particularly prevalent
Corsaro, Daniele; Work, Thierry M.
2012-01-01
The blue-striped snapper Lutjanus kasmira (Perciformes, Lutjanidae) are cosmopolitan in the Indo-Pacific but were introduced into Oahu, Hawaii, USA, in the 1950s and have since colonized most of the archipelago. Studies of microparasites in blue-striped snappers from Hawaii revealed chlamydia-like organisms (CLO) infecting the spleen and kidney, characterized by intracellular basophilic granular inclusions containing Gram-negative and Gimenez-positive bacteria similar in appearance to epitheliocysts when seen under light microscopy. We provide molecular evidence that CLO are a new member of Chlamydiae, i.e. Candidatus Renichlamydia lutjani, that represents the first reported case of chlamydial infection in organs other than the gill in fishes.
Hanafy, Radwa A; Couger, M B; Baker, Kristina; Murphy, Chelsea; O'Kane, Shannon D; Budd, Connie; French, Donald P; Hoff, Wouter D; Youssef, Noha
2016-09-01
Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.
In this paper, effects of disinfection by nano-TiO2 were studied on the two typical foodborne microorganisms, Gram-negative bacterium Salmonella typhimurium and Gram-positive bacterium-Listeria monocytogenes, in meat products. The performance of nano-TiO2 against the foodborne pathogens was evaluate...
Directory of Open Access Journals (Sweden)
Yunpeng Yang
2017-01-01
Full Text Available Catabolite control protein A (CcpA is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR and carbon catabolite activation (CCA, two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt consensus site that is called a catabolite response element (cre within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named crevar, has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA. It was found that the length of the intervening spacer of crevar can affect CcpA binding affinity, and moreover, the core palindromic sequence of crevar is the key structure for regulation. Such a variable architecture of crevar shows potential importance for CcpA’s diverse and fine regulation. A total of 103 potential crevar sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs, and 30 sites were confirmed to be bound by CcpA. These 30 crevar sites are associated with 27 genes involved in many important pathways. Also of significance, the crevar sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria.
Morfin-Otero, Rayo; Noriega, Eduardo Rodriguez; Dowzicky, Michael J
2015-12-15
The Tigecycline Evaluation and Surveillance Trial (T.E.S.T) is a global antimicrobial surveillance study of both gram-positive and gram-negative organisms. This report presents data on antimicrobial susceptibility among organisms collected in Mexico between 2005 and 2012 as part of T.E.S.T., and compares rates between 2005-2007 and 2008-2012. Each center in Mexico submitted at least 200 isolates per collection year; including 65 gram-positive isolates and 135 gram-negative isolates. Minimum inhibitory concentrations (MICs) were determined using Clinical Laboratory Standards Institute (CLSI) broth microdilution methodology and antimicrobial susceptibility was established using the 2013 CLSI-approved breakpoints. For tigecycline US Food and Drug Administration (FDA) breakpoints were applied. Isolates of E. coli and K. pneumoniae with a MIC for ceftriaxone of >1 mg/L were screened for ESBL production using the phenotypic confirmatory disk test according to CLSI guidelines. The rates of some key resistant phenotypes changed during this study: vancomycin resistance among Enterococcus faecium decreased from 28.6 % in 2005-2007 to 19.1 % in 2008-2012, while β-lactamase production among Haemophilus influenzae decreased from 37.6 to 18.9 %. Conversely, methicillin-resistant Staphylococcus aureus increased from 38.1 to 47.9 %, meropenem-resistant Acinetobacter spp. increased from 17.7 to 33.0 % and multidrug-resistant Acinetobacter spp. increased from 25.6 to 49.7 %. The prevalence of other resistant pathogens was stable over the study period, including extended-spectrum β-lactamase-positive Escherichia coli (39.0 %) and Klebsiella pneumoniae (25.0 %). The activity of tigecycline was maintained across the study years with MIC90s of ≤2 mg/L against Enterococcus spp., S. aureus, Streptococcus agalactiae, Streptococcus pneumoniae, Enterobacter spp., E. coli, K. pneumoniae, Klebsiella oxytoca, Serratia marcescens, H. influenzae, and Acinetobacter spp. All gram-positive
Arunkumar, Pichaimani; Thanalakshmi, Muthukrishnan; Kumar, Priyadarsini; Premkumar, Kumpati
2013-03-01
In the present study we have utilized the bioreductive potential of Micrococcus luteus for the synthesis of gold nanoparticles. Biochemical and physiological analysis indicate that the biosynthesized GNPs were achieved by dual mode, involving extracellular α-amylase and cell wall teichuronic acid (TUA) of M. luteus. The biosynthetic potential of both α-amylase and TUA, after isolation from bacterium, was examined. Under optimum conditions, these biomolecules reduces Au(3+) into Au(0) and the resulting GNPs were found to be stable for 1 month. The synthesized GNPs were characterized by UV-VIS spectrometry, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) and dynamic light scattering (DLS). Results demonstrated that the synthesized GNPs were found to be monodispersive and spherical in shape with an average size of ∼6 nm and ∼50 nm for α-amylase and teichuronic acid, respectively. These findings suggest that M. luteus can be exploited as a potential biosource for the eco-friendly synthesis of gold nanoparticles. Copyright © 2012 Elsevier B.V. All rights reserved.
Balk, M.; Weijma, J.; Stams, A.J.M.
2002-01-01
A novel, anaerobic, non-spore-forming, mobile, Gram-negative, thermophilic bacterium, strain TMO(T), was isolated from a thermophilic sulfate-reducing bioreactor operated at 65 degrees C with methanol as the sole substrate. The G C content of the DNA of strain TMO(T) was 39.2 molÐThe optimum pH,
Huang, Jing; Qiao, Zi Xu; Tang, Jing Wei; Wang, Gejiao
2015-01-01
Pontibacillus yanchengensis Y32(T) is an aerobic, motile, Gram-positive, endospore-forming, and moderately halophilic bacterium isolated from a salt field. In this study, we describe the features of P. yanchengensis strain Y32(T) together with a comparison with other four Pontibacillus genomes. The 4,281,464 bp high-quality-draft genome of strain Y32(T) is arranged into 153 contigs containing 3,965 protein-coding genes and 77 RNA encoding genes. The genome of strain Y32(T) possesses many genes related to its halophilic character, flagellar assembly and chemotaxis to support its survival in a salt-rich environment.
Veillonella, Firmicutes: Microbes disguised as Gram negatives.
Vesth, Tammi; Ozen, Aslı; Andersen, Sandra C; Kaas, Rolf Sommer; Lukjancenko, Oksana; Bohlin, Jon; Nookaew, Intawat; Wassenaar, Trudy M; Ussery, David W
2013-12-20
The Firmicutes represent a major component of the intestinal microflora. The intestinal Firmicutes are a large, diverse group of organisms, many of which are poorly characterized due to their anaerobic growth requirements. Although most Firmicutes are Gram positive, members of the class Negativicutes, including the genus Veillonella, stain Gram negative. Veillonella are among the most abundant organisms of the oral and intestinal microflora of animals and humans, in spite of being strict anaerobes. In this work, the genomes of 24 Negativicutes, including eight Veillonella spp., are compared to 20 other Firmicutes genomes; a further 101 prokaryotic genomes were included, covering 26 phyla. Thus a total of 145 prokaryotic genomes were analyzed by various methods to investigate the apparent conflict of the Veillonella Gram stain and their taxonomic position within the Firmicutes. Comparison of the genome sequences confirms that the Negativicutes are distantly related to Clostridium spp., based on 16S rRNA, complete genomic DNA sequences, and a consensus tree based on conserved proteins. The genus Veillonella is relatively homogeneous: inter-genus pair-wise comparison identifies at least 1,350 shared proteins, although less than half of these are found in any given Clostridium genome. Only 27 proteins are found conserved in all analyzed prokaryote genomes. Veillonella has distinct metabolic properties, and significant similarities to genomes of Proteobacteria are not detected, with the exception of a shared LPS biosynthesis pathway. The clade within the class Negativicutes to which the genus Veillonella belongs exhibits unique properties, most of which are in common with Gram-positives and some with Gram negatives. They are only distantly related to Clostridia, but are even less closely related to Gram-negative species. Though the Negativicutes stain Gram-negative and possess two membranes, the genome and proteome analysis presented here confirm their place within the
DEFF Research Database (Denmark)
Compaore, C. S.; Nielsen, Dennis S.; Ouoba, L. I. I.
2013-01-01
inhibited in the agar spot assay while only Gram-positive pathogens were inhibited in the agar well diffusion assay. Cell free supernatants (CFS) of pure cultures of 3 B. subtilis subsp. subtilis (G2, H4 and F1) strains inhibited growth of Listeria monocytogenes, Micrococcus luteus, Staphylococcus aureus...
Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.
2013-01-01
The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138
DEFF Research Database (Denmark)
Tanaka, Reiji; Kawaichi, Satoshi; Nishimura, Hiroshi
2006-01-01
A novel thermophilic bacterium, strain KW1T, was isolated from a coastal hydrothermal field on the Satsuma Peninsula, Kagoshima Prefecture, Japan. The variably Gram-stained cells were motile rods with flagella, did not form spores and proliferated at 52-78°C (optimum, 70°C), pH 5-8 (optimum, pH 7...
Jensen, R. A.; d'Amato, T. A.; Hochstein, L. I.
1988-01-01
The focal point of phenylalanine biosynthesis is a dehydratase reaction which in different organisms may be prephenate dehydratase, arogenate dehydratase, or cyclohexadienyl dehydratase. Gram-positive, Gram-negative, and cyanobacterial divisions of the eubacterial kingdom exhibit different dehydratase patterns. A new extreme-halophile isolate, which grows on defined medium and is tentatively designated as Halobacterium vallismortis CH-1, possesses the interlock type of prephenate dehydratase present in Gram-positive bacteria. In addition to the conventional sensitivity to feedback inhibition by L-phenylalanine, the phenomenon of metabolic interlock was exemplified by the sensitivity of prephenate dehydratase to allosteric effects produced by extra-pathway (remote) effectors. Thus, L-tryptophan inhibited activity while L-tyrosine, L-methionine, L-leucine and L-isoleucine activated the enzyme. L-Isoleucine and L-phenylalanine were effective at micromolar levels; other effectors operated at mM levels. A regulatory mutant selected for resistance to growth inhibition caused by beta-2-thienylalanine possessed an altered prephenate dehydratase in which a phenomenon of disproportionately low activity at low enzyme concentration was abolished. Inhibition by L-tryptophan was also lost, and activation by allosteric activators was diminished. Not only was sensitivity to feedback inhibition by L-phenylalanine lost, but the mutant enzyme was now activated by this amino acid (a mutation type previously observed in Bacillus subtilis). It remains to be seen whether this type of prephenate dehydratase will prove to be characteristic of all archaebacteria or of some archaebacterial subgroup cluster.
Directory of Open Access Journals (Sweden)
Radwa A. Hanafy
2016-09-01
Full Text Available Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.
International Nuclear Information System (INIS)
Wu, Song; Xiao, Yong; Wang, Lu; Zheng, Yue; Chang, Kenlin; Zheng, Zhiyong; Yang, Zhaohui; Varcoe, John R.; Zhao, Feng
2014-01-01
Extracellular electron transfer (EET) of microorganisms represents a communicative bridge between the interior and exterior of the cells. Most prior EET studies have focused on Gram-negative bacteria. However, fungi and Gram-positive bacteria, that contain dense cellular walls, have rarely been reported. Herein, two model dense cell wall microorganisms (Bacillus sp. WS-XY1 and the yeast Pichia stipitis) were identified to be electrochemically active. Further analysis indicated that the two microorganisms were able to secrete flavins to mediate their EET. The discovery, that dense cell wall containing microorganisms can undertake mediated EET, adds to the body of knowledge towards building a comprehensive understanding of biogeochemical and bioelectrical processes
Directory of Open Access Journals (Sweden)
Yi-Huang Hsueh
2017-11-01
Full Text Available Abstract Background Zero-valent iron nanoparticles (ZVI NPs have been used extensively for the remediation of contaminated soil and groundwater. Owing to their large active surface area, they serve as strong and effective reductants. However, the ecotoxicity and bioavailability of ZVI NPs in diverse ecological media have not been evaluated in detail and most studies have focused on non-nano ZVI or Fe0. In addition, the antimicrobial properties of ZVI NPs have rarely been investigated, and the underlying mechanism of their toxicity remains unknown. Results In the present study, we demonstrate that ZVI NPs exhibited significant toxicity at 1000 ppm against two distinct gram-positive bacterial strains (Bacillus subtilis 3610 and Bacillus thuringiensis 407 but not against two gram-negative strains (Escherichia coli K12 and ATCC11634. Specifically, ZVI NPs caused at least a 4-log and 1-log reductions in cell numbers, respectively, in the two Bacillus strains, whereas no change was detected in the two E. coli strains. X-ray photoelectron spectroscopy, X-ray absorption near-edge, and extended X-ray absorption fine structure spectra confirmed that Bacillus cells exposed to ZVI NPs contained mostly Fe2O3 with some detectable FeS. This finding indicated that Fe0 nanoparticles penetrated the bacterial cells, where they were subsequently oxidized to Fe2O3 and FeS. RedoxSensor analysis and propidium iodide (PI staining showed decreased reductase activity and increased PI in both Bacillus strains treated with a high (1000 ppm concentration of ZVI NPs. Conclusion Taken together, these data show that the toxicity of ZVI NPs was derived from their oxidative properties, which may increase the levels of reactive oxygen species and lead to cell death.
A fatal endocarditis case due to an emerging bacterium: Moraxella nonliquefaciens
Directory of Open Access Journals (Sweden)
C. Duployez
2017-01-01
Full Text Available Moraxella nonliquefaciens is a Gram-negative coccobacillus considered as a commensal organism from the upper respiratory tract, with low pathogenic potential. The phenotypical conventional identification is difficult and the matrix-assisted laser desorption/ionization time-of-flight technology has increased the resolution of identification of this bacterium. We report a fatal case of endocarditis due to M. nonliquefaciens whose identification was confirmed by 16S rRNA, and we review the literature on this pathogen in endocarditis.
Berben, T.; Sorokin, D.Y.; Ivanova, N.; Pati, A.; Kyrpides, N.; Goodwin, L.A; Woyke, T.; Muyzer, G.
2015-01-01
Thioalkalivibrio thiocyanodenitrificans strain ARhD 1 T is a motile, Gram-negative bacterium isolated from soda lakes that belongs to the Gammaproteobacteria. It derives energy for growth and carbon fixation from the oxidation of sulfur compounds, most notably thiocyanate, and so is a
Hendrick, William A; Orr, Mona W; Murray, Samantha R; Lee, Vincent T; Melville, Stephen B
2017-05-15
The Gram-positive pathogen Clostridium perfringens possesses type IV pili (TFP), which are extracellular fibers that are polymerized from a pool of pilin monomers in the cytoplasmic membrane. Two proteins that are essential for pilus functions are an assembly ATPase (PilB) and an inner membrane core protein (PilC). Two homologues each of PilB and PilC are present in C. perfringens , called PilB1/PilB2 and PilC1/PilC2, respectively, along with four pilin proteins, PilA1 to PilA4. The gene encoding PilA2, which is considered the major pilin based on previous studies, is immediately downstream of the pilB2 and pilC2 genes. Purified PilB2 had ATPase activity, bound zinc, formed hexamers even in the absence of ATP, and bound the second messenger molecule cyclic di-GMP (c-di-GMP). Circular dichroism spectroscopy of purified PilC2 indicated that it retained its predicted degree of alpha-helical secondary structure. Even though no direct interactions between PilB2 and PilC2 could be detected in vivo or in vitro even in the presence of c-di-GMP, high levels of expression of a diguanylate cyclase from C. perfringens (CPE1788) stimulated polymerization of PilA2 in a PilB2- and PilC2-dependent manner. These results suggest that PilB2 activity is controlled by c-di-GMP levels in vivo but that PilB2-PilC2 interactions are either transitory or of low affinity, in contrast to results reported previously from in vivo studies of the PilB1/PilC1 pair in which PilC1 was needed for polar localization of PilB1. This is the first biochemical characterization of a c-di-GMP-dependent assembly ATPase from a Gram-positive bacterium. IMPORTANCE Type IV pili (TFP) are protein fibers involved in important bacterial functions, including motility, adherence to surfaces and host cells, and natural transformation. All clostridia whose genomes have been sequenced show evidence of the presence of TFP. The genetically tractable species Clostridium perfringens was used to study proteins involved in
Induction of mutation in Micrococcus pyogenes by chemical inactivation of sulfhydryl groups
Energy Technology Data Exchange (ETDEWEB)
Clark, J B; Wyss, O; Stone, W S
1950-08-26
The purpose of this work was to determine whether this naphthaquinone could induce antibiotic-resistant mutants in Micrococcus pyogenes var. aureus, and to determine if such mutagenicity was due to -SH inactivation.
Alternate gram staining technique using a fluorescent lectin.
Sizemore, R K; Caldwell, J J; Kendrick, A S
1990-01-01
Fluorescence-labeled wheat germ agglutinin binds specifically to N-acetylglucosamine in the outer peptidoglycan layer of gram-positive bacteria. The peptidoglycan layer of gram-negative bacteria is covered by a membrane and is not labeled by the lectin. By exploiting this phenomenon, an alternative Gram staining technique has been developed. Images PMID:1697149
Inactivation of Lactobacillus plantarum in apple cider using radio frequency electric fields
Radio frequency electric fields (RFEF) processing is effective at inactivating Gram negative bacteria in fruit juices at moderately low temperatures, but has yet to be shown to be effective at reducing Gram positive bacteria. Lactobacillus plantarum ATCC 49445, a Gram positive bacterium, was inocula...
Directory of Open Access Journals (Sweden)
Andrew McDowell
2017-12-01
Full Text Available The Gram-positive, anaerobic bacterium Propionibacterium acnes forms part of the normal microbiota on human skin and mucosal surfaces. While normally associated with skin health, P. acnes is also an opportunistic pathogen linked with a range of human infections and clinical conditions. Over the last decade, our knowledge of the intraspecies phylogenetics and taxonomy of this bacterium has increased tremendously due to the introduction of DNA typing schemes based on single and multiple gene loci, as well as whole genomes. Furthermore, this work has led to the identification of specific lineages associated with skin health and human disease. In this review we will look back at the introduction of DNA sequence typing of P. acnes based on recA and tly loci, and then describe how these methods provided a basic understanding of the population genetic structure of the bacterium, and even helped characterize the grapevine-associated lineage of P. acnes, known as P. acnes type Zappe, which appears to have undergone a host switch from humans-to-plants. Particular limitations of recA and tly sequence typing will also be presented, as well as a detailed discussion of more recent, higher resolution, DNA-based methods to type P. acnes and investigate its evolutionary history in greater detail.
Directory of Open Access Journals (Sweden)
Bouzid Djihane
2017-07-01
Full Text Available The aerial parts of Helichrysum italicum (Roth G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%. The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%, α-Curcumene (11.41%, Geranyl acetate (10.05%, Limonene (6.07%, Nerol (5.04%, Neryl acetate (4.91% and α-Pinene (3.78%. The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum, Aspergillus niger, Alternaria alternata, Ascochyta rabiei. H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml−1. A minimum fungistatic and fungicide concentration of 6.325 μg ml−1 and 12.65 μg ml−1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml−1 to 50.6 μg ml−1 and a fungicide minimum
Djihane, Bouzid; Wafa, Nouioua; Elkhamssa, Soltani; Pedro, De Haro Juan; Maria, Angeles Esteban; Mohamed Mihoub, Zerroug
2017-07-01
The aerial parts of Helichrysum italicum (Roth) G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w) and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%). The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%), α-Curcumene (11.41%), Geranyl acetate (10.05%), Limonene (6.07%), Nerol (5.04%), Neryl acetate (4.91%) and α-Pinene (3.78%). The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum , Aspergillus niger , Alternaria alternata , Ascochyta rabiei . H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml -1 . A minimum fungistatic and fungicide concentration of 6.325 μg ml -1 and 12.65 μg ml -1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml -1 to 50.6 μg ml -1 and a fungicide minimum concentration of 50
Directory of Open Access Journals (Sweden)
Demetrio L Valle
Full Text Available Piper betle L. has traditionally been used in alternative medicine in different countries for various therapeutic purposes, including as an anti-infective agent. However, studies reported in the literature are mainly on its activities on drug susceptible bacterial strains. This study determined the antimicrobial activities of its ethanol, methanol, and supercritical CO2 extracts on clinical isolates of multiple drug resistant bacteria which have been identified by the Infectious Disease Society of America as among the currently more challenging strains in clinical management. Assay methods included the standard disc diffusion method and the broth microdilution method for the determination of the minimum inhibitory concentration (MIC and the minimum bactericidal concentrations (MBC of the extracts for the test microorganisms. This study revealed the bactericidal activities of all the P. betle leaf crude extracts on methicillin-resistant Staphylococcus aureus (MRSA, vancomycin-resistant Enterococcus (VRE, extended spectrum β-lactamase-producing Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, and metallo-β-lactamase-producing Pseudomonas aeruginosa and Acinetobacter baumannii, with minimum bactericidal concentrations that ranged from 19μg/ml to 1250 μg/ml. The extracts proved to be more potent against the Gram positive MRSA and VRE than for the Gram negative test bacteria. VRE isolates were more susceptible to all the extracts than the MRSA isolates. Generally, the ethanol extracts proved to be more potent than the methanol extracts and supercritical CO2 extracts as shown by their lower MICs for both the Gram positive and Gram negative MDRs. MTT cytotoxicity assay showed that the highest concentration (100 μg/ml of P. betle ethanol extract tested was not toxic to normal human dermal fibroblasts (HDFn. Data from the study firmly established P. betle as an alternative source of anti-infectives against multiple drug resistant
Valle, Demetrio L; Cabrera, Esperanza C; Puzon, Juliana Janet M; Rivera, Windell L
2016-01-01
Piper betle L. has traditionally been used in alternative medicine in different countries for various therapeutic purposes, including as an anti-infective agent. However, studies reported in the literature are mainly on its activities on drug susceptible bacterial strains. This study determined the antimicrobial activities of its ethanol, methanol, and supercritical CO2 extracts on clinical isolates of multiple drug resistant bacteria which have been identified by the Infectious Disease Society of America as among the currently more challenging strains in clinical management. Assay methods included the standard disc diffusion method and the broth microdilution method for the determination of the minimum inhibitory concentration (MIC) and the minimum bactericidal concentrations (MBC) of the extracts for the test microorganisms. This study revealed the bactericidal activities of all the P. betle leaf crude extracts on methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus (VRE), extended spectrum β-lactamase-producing Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, and metallo-β-lactamase-producing Pseudomonas aeruginosa and Acinetobacter baumannii, with minimum bactericidal concentrations that ranged from 19μg/ml to 1250 μg/ml. The extracts proved to be more potent against the Gram positive MRSA and VRE than for the Gram negative test bacteria. VRE isolates were more susceptible to all the extracts than the MRSA isolates. Generally, the ethanol extracts proved to be more potent than the methanol extracts and supercritical CO2 extracts as shown by their lower MICs for both the Gram positive and Gram negative MDRs. MTT cytotoxicity assay showed that the highest concentration (100 μg/ml) of P. betle ethanol extract tested was not toxic to normal human dermal fibroblasts (HDFn). Data from the study firmly established P. betle as an alternative source of anti-infectives against multiple drug resistant bacteria.
Directory of Open Access Journals (Sweden)
Thomas eAullo
2013-12-01
Full Text Available Gram-positive spore-forming sulfate reducers and particularly members of the genus Desulfotomaculum are commonly found in the subsurface biosphere by culture based and molecular approaches. Due to their metabolic versatility and their ability to persist as endospores. Desulfotomaculum spp. are well adapted for colonizing environments through a slow sedimentation process. Because of their ability to grow autotrophically (H2/CO2 and produce sulfide or acetate, these microorganisms may play key roles in deep lithoautotrophic microbial communities. Available data about Desulfotomaculum spp. and related species from studies carried out from deep freshwater lakes, marine sediments, oligotrophic and organic rich deep geological settings are discussed in this review.
Gram staining with an automatic machine.
Felek, S; Arslan, A
1999-01-01
This study was undertaken to develop a new Gram-staining machine controlled by a micro-controller and to investigate the quality of slides that were stained in the machine. The machine was designed and produced by the authors. It uses standard 220 V AC. Staining, washing, and drying periods are controlled by a timer built in the micro-controller. A software was made that contains a certain algorithm and time intervals for the staining mode. One-hundred and forty smears were prepared from Escherichia coli, Staphylococcus aureus, Neisseria sp., blood culture, trypticase soy broth, direct pus and sputum smears for comparison studies. Half of the slides in each group were stained with the machine, the other half by hand and then examined by four different microbiologists. Machine-stained slides had a higher clarity and less debris than the hand-stained slides (p stained slides, some Gram-positive organisms showed poor Gram-positive staining features (p Gram staining with the automatic machine increases the staining quality and helps to decrease the work load in a busy diagnostic laboratory.
Characterization of the surfaceome of the metal-reducing bacterium Desulfotomaculum reducens
Directory of Open Access Journals (Sweden)
Elena eDalla Vecchia
2014-08-01
Full Text Available Desulfotomaculum reducens strain MI-1 is a Gram-positive, sulfate-reducing bacterium also capable of reducing Fe(III. Metal reduction in Gram-positive bacteria is poorly understood. Here, we investigated Fe(III reduction with lactate, a non-fermentable substrate, as the electron donor. Lactate consumption is concomitant to Fe(III reduction, but does not support significant growth, suggesting that little energy can be conserved from this process and that it may occur fortuitously. D. reducens can reduce both soluble (Fe(III-citrate and insoluble (hydrous ferric oxide, HFO Fe(III. Because physically inaccessible HFO was not reduced, we concluded that reduction requires direct contact under these experimental conditions. This implies the presence of a surface exposed reductase capable of transferring electrons from the cell to the extracellular electron acceptor. With the goal of characterizing the role of surface proteins in D. reducens and of identifying candidate Fe(III reductases, we carried out an investigation of the surface proteome (surfaceome of D. reducens. Cell surface exposed proteins were extracted by trypsin cell shaving or by lysozyme treatment, and analyzed by liquid chromatography-tandem mass spectrometry. This investigation revealed that the surfaceome fulfills many functions, including solute transport, protein export, maturation and hydrolysis, peptidoglycan synthesis and modification, and chemotaxis. Furthermore, a few redox-active proteins were identified. Among these, three are putatively involved in Fe(III reduction, i.e., a membrane-bound hydrogenase 4Fe-4S cluster subunit (Dred_0462, a heterodisulfide reductase subunit A (Dred_0143 and a protein annotated as alkyl hydroperoxide reductase but likely functioning as a thiol-disulfide oxidoreductase (Dred_1533.
Mitsui, Ryoji; Hirota, Mizuho; Tsuno, Takuo; Tanaka, Mitsuo
2010-02-01
Vanillin dehydrogenases (VDHs) were purified and characterized from two bacterial strains that have different pH dependencies for growth. The alkaliphile Micrococcus sp. TA1, isolated from an alkaline spa, can grow on several aromatic compounds such as ferulic acid, vanillin, vanillic acid, and protocatechuic acid under alkaline conditions. The neutrophile Burkholderia cepacia TM1, which was isolated previously, also grew on the above-mentioned compounds because they functioned as the sole carbon source under neutral conditions. Purified VDHs showed activities toward some aromatic aldehydes. These enzymes have the same subunit molecular mass of about 57 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, but differed in some of their observed properties. Native molecular masses also differed between the purified enzymes. These were 250 kDa for the enzyme from alkaliphilic strain TA1 and 110 kDa for that from neutrophilic strain TM1, as determined by gel filtration. The enzyme from strain TA1 required NADP(+) as a coenzyme for its activity, but that from strain TM1 required NAD(+). These results are important because this is the first report of an alkaliphilic bacterium consuming lignin monomers.
A flow-cytometric gram-staining technique for milk-associated bacteria.
Holm, Claus; Jespersen, Lene
2003-05-01
A Gram-staining technique combining staining with two fluorescent stains, Oregon Green-conjugated wheat germ agglutinin (WGA) and hexidium iodide (HI) followed by flow-cytometric detection is described. WGA stains gram-positive bacteria while HI binds to the DNA of all bacteria after permeabilization by EDTA and incubation at 50 degrees C for 15 min. For WGA to bind to gram-positive bacteria, a 3 M potassium chloride solution was found to give the highest fluorescence intensity. A total of 12 strains representing some of the predominant bacterial species in bulk tank milk and mixtures of these were stained and analyzed by flow cytometry. Overall, the staining method showed a clear differentiation between gram-positive and gram-negative bacterial populations. For stationary-stage cultures of seven gram-positive bacteria and five gram-negative bacteria, an average of 99% of the cells were correctly interpreted. The method was only slightly influenced by the growth phase of the bacteria or conditions such as freezing at -18 degrees C for 24 h. For any of these conditions, an average of at least 95% of the cells were correctly interpreted. When stationary-stage cultures were stored at 5 degrees C for 14 days, an average of 86% of the cells were correctly interpreted. The Gram-staining technique was applied to the flow cytometry analysis of bulk tank milk inoculated with Staphylococcus aureus and Escherichia coli. These results demonstrate that the technique is suitable for analyzing milk samples without precultivation.
International Nuclear Information System (INIS)
Bhuyan, Diganta; Saikia, Mrinal; Saikia, Lakshi; Gogoi, Animesh; Saikia, Ratul
2015-01-01
The facile synthesis of an SBA-15-pr- + NH 3 .Au 0 nano-hybrid material by spontaneous autoreduction of aqueous chloroaurate anions on propylamine functionalized SBA-15 was successfully demonstrated. The as-synthesized SBA-15-pr- + NH 3 .Au 0 nano-hybrid material was well characterized using low and wide angle x-ray diffraction (XRD), N 2 adsorption–desorption isotherms, Fourier transform infrared (FTIR), transmission electron microscopy (TEM), scanning electron microscopy-energy dispersive x-ray spectroscopy (SEM-EDX), x-ray photoelectron spectroscopy (XPS), UV-Visible spectroscopy and atomic absorption spectroscopy (AAS). The activity of the nano-hybrid material as a potent bactericidal agent was successfully tested against Gram positive/negative bacteria viz. Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. The colony killing percentage of Gram positive bacteria was found to be higher than Gram negative bacteria due to the stronger electrostatic interaction between the positively-charged amine functionality of SBA-15 and the negatively charged functionality of the bacterial cell wall. (paper)
Riboflavin Production during Growth of Micrococcus luteus on Pyridine †
Sims, Gerald K.; O'Loughlin, Edward J.
1992-01-01
Micrococcus luteus produced 29 μM riboflavin during growth on 6.5 mM pyridine but not during growth on other substrates. On the basis of the results of radiolabelling studies, riboflavin was not directly synthesized from pyridine. Pyridine may interfere with riboflavin biosynthesis or elicit a general stress response in M. luteus.
Li, Jiulong; Li, Qinghao; Ma, Xiaoqiong; Tian, Bing; Li, Tao; Yu, Jiangliu; Dai, Shang; Weng, Yulan; Hua, Yuejin
Deinococcus radiodurans is an extreme bacterium known for its high resistance to stresses including radiation and oxidants. The ability of D. radiodurans to reduce Au(III) and biosynthesize gold nanoparticles (AuNPs) was investigated in aqueous solution by ultraviolet and visible (UV/Vis) absorption spectroscopy, electron microscopy, X-ray diffraction (XRD), dynamic light scattering (DLS), Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS). D. radiodurans efficiently synthesized AuNPs from 1 mM Au(III) solution in 8 h. The AuNPs were of spherical, triangular and irregular shapes with an average size of 43.75 nm and a polydispersity index of 0.23 as measured by DLS. AuNPs were distributed in the cell envelope, across the cytosol and in the extracellular space. XRD analysis confirmed the crystallite nature of the AuNPs from the cell supernatant. Data from the FTIR and XPS showed that upon binding to proteins or compounds through interactions with carboxyl, amine, phospho and hydroxyl groups, Au(III) may be reduced to Au(I), and further reduced to Au(0) with the capping groups to stabilize the AuNPs. Biosynthesis of AuNPs was optimized with respect to the initial concentration of gold salt, bacterial growth period, solution pH and temperature. The purified AuNPs exhibited significant antibacterial activity against both Gram-negative ( Escherichia coli ) and Gram-positive ( Staphylococcus aureus ) bacteria by damaging their cytoplasmic membrane. Therefore, the extreme bacterium D. radiodurans can be used as a novel bacterial candidate for efficient biosynthesis of AuNPs, which exhibited potential in biomedical application as an antibacterial agent.
Directory of Open Access Journals (Sweden)
Pirvu Lucia
2017-04-01
Full Text Available This work aimed to study the potential effects of four Arctii folium extracts, 5 mg gallic [GAE] acid equivalents per 1 mL sample, on six antibiotics (Ampicillin/AM, Tetracycline/TE, Ciprofloxacin/CIP, Sulfamethoxazole-Trimethoprim/SXT, Chloramphenicol/C and Gentamicin/CN tested on four Gram-positive (Staphylococcus aureus ATCC 6538, Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, and Staphylococcus epidermidis ATCC 12228 and five Gram-negative (Proteus mirabilis ATCC 29245, Escherichia coli ATCC 35218, E. coli ATCC 11229, E. coli ATCC 8739, and Bacillus cereus ATCC 11778 bacteria. Arctii folium extracts were the whole ethanol extract/W and subsequent ethyl acetate/EA, aqueous/AQ, and chloroform/CHL fractions. Chemical qualitative analysis (HPTLC method emphasized five main polyphenol compounds in Arctii folium polar extracts: chlorogenic acid (Rf≈0.52/0.55 and its isomer, 1,5-di-O-caffeoylquinic acid (Rf≈0.90/0.92, plus cynarin (Rf≈0.77, hyperoside (Rf≈0.68/0.64 and isoquercitrin (Rf≈0.69/0.71. Microbiological screening indicated Arctii folium polar extracts (AQ and W efficacy on S. epidermidis ATCC 12228; the MIC values were in the range of common antibiotics, being 32 and 128 μg GAE per mL sample respectively. The unpredictable effects (stimulatory or inhibitory of Arctii folium extracts in combination with typical antibiotics as well as a potential use of the whole ethanol extract/W for restoring the antimicrobial potency of susceptible antibiotics have also been evidenced.
Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis
Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.
2014-01-01
Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386
Is the gram stain useful in the microbiologic diagnosis of VAP? A meta-analysis.
O'Horo, John C; Thompson, Deb; Safdar, Nasia
2012-08-01
In a meta-analysis examining respiratory specimen Gram stain for diagnosis of ventilator-associated pneumonia, absence of bacteria on Gram stain had a high negative predictive value, but a positive Gram stain correlated poorly with organisms recovered in culture. Rapid and accurate diagnosis of ventilator-associated pneumonia (VAP) is a major challenge and no generally accepted gold standard exists for VAP diagnosis. We conducted a meta-analysis to examine the role of respiratory specimen Gram stain to diagnose VAP, and the correlation with final culture results. In 21 studies, pooled sensitivity of Gram stain for VAP was 0.79 (95% confidence interval [CI], .77-0.81; P Gram stain for a VAP prevalence of 20%-30% was 91%, suggesting that VAP is unlikely with a negative Gram stain but the positive predictive value of Gram stain was only 40%. Pooled kappa was 0.42 for gram-positive organisms and 0.34 for gram-negative organisms, suggesting fair concordance between organisms on Gram stain and recovery by culture. Therefore, a positive Gram stain should not be used to narrow anti-infective therapy until culture results become available.
The Role of Functional Amyloids in Multicellular Growth and Development of Gram-Positive Bacteria
DEFF Research Database (Denmark)
Dragoš, Anna; Kovács, Ákos T.; Claessen, Dennis
2017-01-01
Amyloid fibrils play pivotal roles in all domains of life. In bacteria, these fibrillar structures are often part of an extracellular matrix that surrounds the producing organism and thereby provides protection to harsh environmental conditions. Here, we discuss the role of amyloid fibrils...... in the two distant Gram-positive bacteria, Streptomyces coelicolor and Bacillus subtilis. We describe how amyloid fibrils contribute to a multitude of developmental processes in each of these systems, including multicellular growth and community development. Despite this variety of tasks, we know...... surprisingly little about how their assembly is organized to fulfill all these roles....
Sanchez Andrea, I.; Luis Sanz, J.; Stams, A.J.M.
2014-01-01
A novel anaerobic propionigenic bacterium, strain ADRIT, was isolated from sediment of an acid rock drainage environment (Tinto River, Spain). Cells were small (0.4-0.6 x 1-1.7 µm), non-motile and non-spore forming rods. Cells possessed a Gram-negative cell wall structure and were vancomycin
DEFF Research Database (Denmark)
Finster, Kai; Liesack, Werner; Thamdrup, Bo
1998-01-01
A mesophilic, anaerobic, gram-negative bacterium, strain SB164P1, was enriched and isolated from oxidized marine surface sediment with elemental sulfur as the sole energy substrate in the presence of ferrihydrite. Elemental sulfur was disproportionated to hydrogen sulfide and sulfate. Growth was ...
Directory of Open Access Journals (Sweden)
Ziyanda Mmango-Kaseke
2016-11-01
Full Text Available This paper reports on the optimization of culture conditions for cellulase and xylanase production by bacterial isolate from lignocellulosic biomass. The bacterial isolate was screened for cellulase and xylanase production on carboxyl methyl cellulose (CMC and birch wood xylan as substrates, respectively. One bacterial isolate showing the highest halo zone diameter (isolate PLY1 was selected for detailed studies. The analysis of the 16S ribosomal ribonucleic acid (rRNA gene nucleotide sequence of PLY1 revealed it to have 98% similarity to Micrococcus luteus strain Fse9 and the sequence was deposited in the GenBank as Micrococcus luteus strain SAMRC-UFH3 with accession number KU171371. Cellulase production was achieved in the presence of CMC (1% w/v under an incubation temperature of 25 °C (198 U/mL, pH 5 (173 U/mL, agitation speed 50 rpm (173 U/mL and incubation period of 96 h (102 U/mL. Xylanase was produced maximally when birch wood xylan (1% w/v was used as the substrate at 25 °C (1007 U/mL, pH 10 (2487 U/mL, 200 rpm (1814 U/mL, and under an incubation period of 84 h (1296 U/mL. Our findings showed that Micrococcus sp. SAMRC-UFH3 appears to be a potentially important candidate for lignocellulosic waste degradation and other relevant industrial applications.
Sokolova, Tatyana G; Kostrikina, Nadezhda A; Chernyh, Nikolai A; Kolganova, Tatjana V; Tourova, Tatjana P; Bonch-Osmolovskaya, Elizaveta A
2005-09-01
A novel anaerobic, thermophilic, alkalitolerant bacterium, strain 2204(T), was isolated from a hot spring of the Baikal Lake region. The cells of strain 2204(T) were straight rods of variable length, Gram-positive with an S-layer, motile with one to two lateral flagella, and often formed aggregates of 3-15 cells. The isolate was shown to be an obligate anaerobe oxidizing CO and producing equimolar quantities of H(2) and CO(2) according to the equation CO+H(2)O-->CO(2)+H(2). No organic substrates were used as energy sources. For lithotrophic growth on CO, 0.2 g acetate or yeast extract l(-1) was required but did not support growth in the absence of CO. Growth was observed in the temperature range 37-68 degrees C, the optimum being 55 degrees C. The pH range for growth was 6.7-9.5, the optimum pH being 8.0. The generation time under optimal conditions was 1.3 h. The DNA G+C content was 45 mol%. Penicillin, erythromycin, streptomycin, rifampicin, vancomycin and tetracycline completely inhibited both growth and CO utilization by strain 2204(T). Thus, isolate 2204(T) was found to be the first known moderately thermophilic and alkalitolerant H(2)-producing anaerobic carboxydotroph. The novel bacterium fell within the cluster of the family Peptococcaceae within the low-G+C-content Gram-positive bacteria, where it formed a separate branch. On the basis of morphological, physiological and phylogenetic features, strain 2204(T) should be assigned to a novel genus and species, for which the name Thermincola carboxydiphila gen. nov., sp. nov. is proposed. The type strain is strain 2204(T) (=DSM 17129(T)=VKM B-2283(T)=JCM 13258(T)).
Purification Techniques of Bacteriocins from Lactic Acid Bacteria and Other Gram-Positive Bacteria
Saavedra, Lucila; Sesma, Fernando
The search for new antimicrobial peptides produced by lactic acid bacteria and other Gram-positive microorganisms has become an interesting field of research in the past decades. The fact that bacteriocins are active against numerous foodborne and human pathogens, are produced by generally regarded as safe (GRAS) microorganisms, and are readily degraded by proteolytic host systems makes them attractive candidates for biotechnological applications. However, before suggesting or choosing a new bacteriocin for future technology developments, it is necessary to elucidate its biochemical structure and its mode of action, which may be carried out once the bacteriocin is purified to homogeneity. This chapter focuses on describing the main strategies used for the purification of numerous bacteriocins.
Stafeev, A A; Chesnokova, M G; Chesnokov, V A
2015-01-01
Microbiological analysis of biomaterial surface in dental prosthesis showed the most common colonizing gram-positive species to be S. aureus, Micrococcus spp., S. haemolyticus, E. faecalis, mainly massive colonization with S. aureus was seen. The highest concentration of C. albicans colonization was found in removable dentures and may have a destructive effect on prosthetic material.
Ionothermal synthesis of hierarchical BiOBr microspheres for water treatment
Energy Technology Data Exchange (ETDEWEB)
Zhang, Dieqing [The Education Ministry Key Lab of Resource Chemistry and Shanghai Key Laboratory of Rare Earth Functional Materials, Shanghai Normal University, 100 Guilin Road, Shanghai 200231 (China); Department of Chemistry and Institute of Environment, Energy and Sustainability, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong (China); Wen, Meicheng; Jiang, Bo; Li, Guisheng [The Education Ministry Key Lab of Resource Chemistry and Shanghai Key Laboratory of Rare Earth Functional Materials, Shanghai Normal University, 100 Guilin Road, Shanghai 200231 (China); Yu, Jimmy C., E-mail: jimyu@cuhk.edu.hk [Department of Chemistry and Institute of Environment, Energy and Sustainability, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong (China)
2012-04-15
Graphical abstract: Hierarchical BiOBr microspheres were prepared from a bromine-containing ionic liquid. The material was found effective for removing heavy metals, degrading organic pollutants and killing bacteria. Highlight: Black-Right-Pointing-Pointer Ionothermal synthesis of BiOBr microspheres with hierarchical structure. Black-Right-Pointing-Pointer Efficient mass transfer and excellent light-harvesting ability. Black-Right-Pointing-Pointer Suitable for removing heavy metals and treatment of organic dyes. Black-Right-Pointing-Pointer Remarkable photocatalytic bactericidal property. - Abstract: Bismuth oxybromide (BiOBr) micropsheres with hierarchical morphologies have been fabricated via an ionothermal synthesis route. Ionic liquid acts as a unique soft material capable of promoting nucleation and in situ growth of 3D hierarchical BiOBr mesocrystals without the help of surfactants. The as-prepared BiOBr nanomaterials can effectively remove heavy metal ions and organic dyes from wastewater. They can also kill Micrococcus lylae, a Gram positive bacterium, in water under fluorescent light irradiation. Their high adaptability in water treatment may be ascribed to their hierarchical structure, allowing them high surface to volume ratio, facile species transportation and excellent light-harvesting ability.
Ionothermal synthesis of hierarchical BiOBr microspheres for water treatment
International Nuclear Information System (INIS)
Zhang, Dieqing; Wen, Meicheng; Jiang, Bo; Li, Guisheng; Yu, Jimmy C.
2012-01-01
Graphical abstract: Hierarchical BiOBr microspheres were prepared from a bromine-containing ionic liquid. The material was found effective for removing heavy metals, degrading organic pollutants and killing bacteria. Highlight: ► Ionothermal synthesis of BiOBr microspheres with hierarchical structure. ► Efficient mass transfer and excellent light-harvesting ability. ► Suitable for removing heavy metals and treatment of organic dyes. ► Remarkable photocatalytic bactericidal property. - Abstract: Bismuth oxybromide (BiOBr) micropsheres with hierarchical morphologies have been fabricated via an ionothermal synthesis route. Ionic liquid acts as a unique soft material capable of promoting nucleation and in situ growth of 3D hierarchical BiOBr mesocrystals without the help of surfactants. The as-prepared BiOBr nanomaterials can effectively remove heavy metal ions and organic dyes from wastewater. They can also kill Micrococcus lylae, a Gram positive bacterium, in water under fluorescent light irradiation. Their high adaptability in water treatment may be ascribed to their hierarchical structure, allowing them high surface to volume ratio, facile species transportation and excellent light-harvesting ability.
International Nuclear Information System (INIS)
Barnes, Robert J.; Molina, Rodrigo; Xu Jianbin; Dobson, Peter J.; Thompson, Ian P.
2013-01-01
Titanium dioxide (TiO 2 ) and zinc oxide (ZnO) nanoparticles are important photocatalysts and as such have been extensively studied for the removal of organic compounds from contaminated air and water and for microbial disinfection. Despite much research on the effect of TiO 2 and ZnO nanoparticles on different bacterial species, uncertainties remain about which bacteria are more sensitive to these compounds. Very few studies have directly compared the toxicity of ZnO to TiO 2 under both light and dark conditions. In addition, authors investigating the photocatalytic inactivation of TiO 2 and ZnO nanoparticles on bacteria have failed to investigate the reactive oxygen species (ROS) generation of the nanoparticles, making it difficult to correlate killing action with the generation of ROS. In this study, three types of metal nanoparticle (ZnO 2 ) have been characterised and ROS production assessed through the degradation of methylene blue (MB). The photocatalytic killing potential of three nanoparticle concentrations (0.01, 0.1 and 1 g/L) was then assessed on four representative bacteria: two gram-positive (S. aureus and B. subtilis) and two gram-negative (E. coli and P. aeruginosa). Results showed that out of the three nanoparticles tested, the TiO 2 nanoparticles generated more ROS than the ZnO nanoparticles, corresponding to a greater photocatalytic inactivation of three of the four species of bacteria examined. The MB decomposition results correlated well with the bacterial inactivation results with higher TiO 2 nanoparticle concentrations leading to greater ROS production and increased loss of cell viability. Although producing less ROS than the TiO 2 nanoparticles under ultraviolet light, the ZnO nanoparticles were toxic to two of the bacterial species even under dark conditions. In this study, no correlation between cell wall type and bacterial inactivation was observed for any of the nanoparticles tested although both gram-positive bacteria were sensitive to
Directory of Open Access Journals (Sweden)
S. Khelaifia
2015-11-01
Full Text Available Strain Vm-5T was isolated from the stool specimen of a 10-year-old Amazonian boy. This bacterium is a Gram-positive, strictly aerobic rod, motile by a polar flagellum. Here we describe its phenotypic characteristics and complete genome sequence. The 4 353 177 bp long genome exhibits a G + C content of 36.87% and contains 4394 protein-coding and 125 predicted RNA genes. Phylogenetically and genetically, strain Vm-c is a member of the genus Virgibacillus but is distinct enough to be classified as a new species. We propose the creation of V. massiliensis sp. nov., whose type strain is strain Vm-5T (CSUR P971 = DSM 28587.
[Usefulness of sputum Gram staining in community-acquired pneumonia].
Sato, Tadashi; Aoshima, Masahiro; Ohmagari, Norio; Tada, Hiroshi; Chohnabayashi, Naohiko
2002-07-01
To evaluate the usefulness of sputum gram staining in community-acquired pneumonia (CAP), we reviewed 144 cases requiring hospitalization in the last 4 years. The sensitivity was 75.5%, specificity 68.2%, positive predictive value 74.1%, negative predictive value 69.8%, positive likelihood ratio 2.37, negative likelihood ratio 0.36 and accuracy 72.2% in 97 cases. Both sputum gram staining and culture were performed. Concerning bacterial pneumonia (65 cases), we compared the Gram staining group (n = 33), which received initial antibiotic treatment, based on sputum gram staining with the Empiric group (n = 32) that received antibiotics empirically. The success rates of the initial antibiotic treatment were 87.9% vs. 78.1% (P = 0.473); mean hospitalization periods were 9.67 vs. 11.75 days (P = 0.053); and periods of intravenous therapy were 6.73 vs. 7.91 days (P = 0.044), respectively. As for initial treatment, penicillins were used in the Gram staining group more frequently (P gram staining is useful for the shortening of the treatment period and the appropriate selection of initial antibiotics in bacterial pneumonia. We believe, therefore, that sputum gram staining is indispensable as a diagnostic tool CAP.
Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S
2010-02-01
Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.
A new technique for Gram staining paraffin-embedded tissue.
Engbaek, K; Johansen, K S; Jensen, M E
1979-01-01
Five techniques for Gram staining bacteria in paraffin sections were compared on serial sections of pulmonary tissues from eight bacteriological necropsies. Brown and Hopp's method was the most satisfactory for distinguishing Gram-positive and Gram-negative bacteria. However, this method cannot be recommended as the preparations were frequently overstained, and the Gram-negative bacteria were stained indistinctly. A modification of Brown and Hopps' method was developed which stains larger numbers of Gram-negative bacteria and differentiates well between different cell types and connective tissue, and there is no risk of overstaining. PMID:86548
Veloo, A. C. M.; de Vries, E D; Jean-Pierre, H.; Justesen, U. S.; Morris, T.; Urban, E.; Wybo, I.; van Winkelhoff, A. J.
OBJECTIVES: Gram-positive anaerobic cocci (GPAC) account for 24-31% of the anaerobic bacteria isolated from human clinical specimens. At present GPAC are underrepresented in the Biotyper MALDI-TOF MS database. Profiles of new species have yet to be added. We present the optimization of the MALDI-TOF
Pang, Changlong; Li, Ang; Cui, Di; Yang, Jixian; Ma, Fang; Guo, Haijuan
2016-02-20
Klebsiella pneumoniae J1 is a Gram-negative strain, which belongs to a protein-based microbial flocculant-producing bacterium. However, little genetic information is known about this species. Here we carried out a whole-genome sequence analysis of this strain and report the complete genome sequence of this organism and its genetic basis for carbohydrate metabolism, capsule biosynthesis and transport system. Copyright © 2016 Elsevier B.V. All rights reserved.
The deoxyribonucleic acid of Micrococcus radiodurans
Schein, Arnold H.
1966-01-01
The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439
International Nuclear Information System (INIS)
Lavin, M.F.; Jenkins, A.; Kidson, C.
1976-01-01
Repair of ultraviolet radiation damage was examined in an extremely radioresistant organism, Micrococcus radiophilus. Measurement of the number of thymine-containing dimers formed as a function of ultraviolet dose suggests that the ability of this organism to withstand high doses of ultraviolet radiation (20,000 ergs/mm 2 ) is not related to protective screening by pigments. M. radiophilus carries out a rapid excision of thymine dimers at doses of ultraviolet light up to 10,000 ergs/mm 2 . Synthesis of deoxyribonucleic acid is reduced after irradiation, but after removal of photodamage the rate approaches that in unirradiated cells. A comparison is drawn with Micrococcus luteus and M. radiodurans. We conclude that the extremely high resistance to ultraviolet irradiation in M. radiophilus is at least partly due to the presence of an efficient excision repair system
Oxidation and Assimilation of Carbohydrates by Micrococcus sodonensis1
Perry, Jerome J.; Evans, James B.
1966-01-01
Perry, Jerome J. (North Carolina State University, Raleigh), and James B. Evans. Oxidation and assimilation of carbohydrates by Micrococcus sodonensis. J. Bacteriol. 91:33–38. 1966.—Micrococcus sodonensis is a biotin-requiring strict aerobe that cannot utilize carbohydrates as sole sources of carbon and energy. However, addition of mannose, glucose, sucrose, or maltose to a medium on which the organism can grow resulted in an increase in total growth. M. sodonensis oxidized these sugars without induction, thus indicating the presence of constitutive enzymes for their transport, activation, and metabolism. Under appropriate nonproliferating cell conditions, glucose was readily incorporated into essential constituents of the cell. When glucose-1-C14 and glucose-6-C14 were oxidized by nonproliferating cells, the label was found in both the protein and nucleic acid fractions of the cell. The respiratory quotients of cells oxidizing glucose in saline and in phosphate buffer indicated assimilation of sugar carbon in buffer and virtually no assimilation in saline. The ability of M. sodonensis to completely oxidize glucose and to grow on intermediates of glucose oxidation but not on glucose suggests that glucose may suppress or repress some reaction(s) necessary for growth, and that growth substrates either derepress or circumvent this block. PMID:5903100
Talei, Gholam-Reza; Mohammadi, Mohsen; Bahmani, Mahmoud; Kopaei, Mahmoud Rafieian
2017-01-01
Background: Infectious diseases have always been an important health issue in human communities. In the recent years, much research has been conducted on antimicrobial effects of nature-based compounds because of increased prevalence of antibiotic resistance. The present study was conducted to investigate synergistic effect of Carum copticum and Mentha piperita essential oils with ciprofloxacin, vancomycin, and gentamicin on Gram-negative and Gram-positive bacteria. Materials and Methods: In this experimental study, the synergistic effects of C. copticum and M. piperita essential oils with antibiotics on Staphylococcus aureus (ATCC 25923), Enterococcus faecalis (ATCC 29212), Escherichia coli (ATCC 8739), Pseudomonas aeruginosa (ATCC 9027), Staphylococcus epidermidis (ATCC 14990), and Listeria monocytogenes (ATCC 7644) were studied according to broth microdilution and the MIC and fractional inhibitory concentration (FIC) of these two essential oils determined. Results: C. copticum essential oil at 30 μg/ml could inhibit S. aureus, and in combination with vancomycin, decreased MIC from 0.5 to 0.12 μg/ml. Moreover, the FIC was derived 0.24 μg/ml which represents a potent synergistic effect with vancomycin against S. aureus growth. C. copticum essential oil alone or combined with other antibiotics is effective in treating bacterial infections. Conclusions: In addition, C. copticum essential oil can strengthen the activities of certain antibiotics, which makes it possible to use this essential oil, especially in drug resistance or to lower dosage or toxicity of the drugs. PMID:28929050
Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin
2013-01-01
We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.
Directory of Open Access Journals (Sweden)
Aashish Srivastava
Full Text Available Protein translation is essential for all bacteria pathogens. It has also been a major focus of structural and functional studies and an important target of antibiotics. Here we report our attempts to biochemically reconstitute mycobacterial protein translation in vitro from purified components. This mycobacterial translation system consists of individually purified recombinant translation factors from Mycobacterium tuberculosis (M. tuberculosis, purified tRNAs and ribosomes from Mycobacterium smegmatis (M. smegmatis, and an aminoacyl-tRNA synthetase (AARS mixture from the cell-extract of M. smegmatis. We demonstrate that such mycobacterial translation system was efficient in in vitro protein synthesis, and enabled functional comparisons of translational components between the gram-positive Mycobacterium and the gram-negative E. coli. Although mycobacterial translation factors and ribosomes were highly compatible with their E. coli counterparts, M. smegmatis tRNAs were not properly charged by the E. coli AARSs to allow efficient translation of a reporter. In contrast, both E. coli and M. smegmatis tRNAs exhibited similar activity with the semi-purified M. smegmatis AARSs mixture for in vitro translation. We further demonstrated the use of both mycobacterial and E. coli translation systems as comparative in vitro assays for small-molecule antibiotics that target protein translation. While mycobacterial and E. coli translation were both inhibited at the same IC50 by the antibiotic spectinomycin, mycobacterial translation was preferentially inhibited by the antibiotic tetracycline, suggesting that there may be structural differences at the antibiotic binding sites between the ribosomes of Mycobacterium and E. coli. Our results illustrate an alternative approach for antibiotic discovery and functional studies of protein translation in mycobacteria and possibly other bacterial pathogens.
International Nuclear Information System (INIS)
Thiramanas, Raweewan; Laocharoensuk, Rawiwan
2016-01-01
The article describes a simple and rapid method for colorimetric detection of bacteria. It is based on competitive binding of positively charged polyethyleneimine-coated gold nanoparticles (PEI-AuNPs) to negatively charged enzymes and bacteria. The PEI-AuNPs are electrostatically attracted by both the bacterial surface and the enzyme β-galactosidase (β-Gal). Binding to the latter results in the inhibition of enzyme activity. However, in the presence of a large number of bacteria, the PEI-AuNPs preferentially bind to bacteria. Hence, the enzyme will not be inhibited and its activity can be colorimetrically determined via hydrolysis of the chromogenic substrate chlorophenol red β-D-galactopyranoside (CPRG). The detection limit of this assay is as low as 10 cfu·mL −1 , and the linear range extends from 10 6 to 10 8 cfu·mL −1 . The assay is applicable to both Gram-negative (such as enterotoxigenic Escherichia coli; ETEC) and Gram-positive (Staphylococcus aureus; S. aureus) bacteria. Results are obtained within 10 min using an optical reader, and within 2–3 h by bare-eye detection. The method was applied to the identification of ETEC contamination at a level of 10 cfu·mL −1 in spiked drinking water. Given its low detection limit and rapidity (sample preconcentration is not required), this method holds great promise for on-site detection of total bacterial contamination. (author)
Metabolism of dimethylphthalate by Micrococcus sp. strain 12B.
Eaton, R W; Ribbons, D W
1982-01-01
During growth of Micrococcus sp. strain 12B with dimethylphthalate, 4-carboxy-2-hydroxymuconate lactone (CHML, X) and 3,4-dihydroxyphthalate-2-methyl ester (XI) were isolated from culture filtrates. CHML is the lactone of intermediate 4-carboxy-2-hydroxymuconate (IX). Accumulation of XI which is not a substrate for 3,4-dihydroxyphthalate-2-decarboxylase in strain 12B afforded an easy access to the preparation of 3,4-dihydroxyphthalate. PMID:7085569
EFFECT OF SILICATE ON GRAM STAINING AND VIABILITY OF PNEUMOCOCCI AND OTHER BACTERIA
MacLeod, Colin M.; Roe, Amy S.
1956-01-01
Application of silicate solutions to living or heat-killed pneumococci and to certain "viridans" streptococci causes their conversion from a Gram-positive to a Gram-negative state. The original staining properties can be restored by suspending the silicate-treated bacteria in alkaline solutions of various salts but not by simple washing in water. Living pneumococci and the strains of streptococci whose staining properties are similarly affected are killed when suspended in silicate solutions. In other Gram-positive species silicate causes conversion to Gram negativity but restoration to positivity occurs upon washing in water. In a third group of Gram-positive organisms silicate has no effect on the Gram reaction. The viability of organisms in these two groups is unaffected by silicate under the conditions employed. No effect on staining or viability of Gram-negative bacteria has been observed. The effects of silicate on staining and viability are inhibited by nutrient broth or whole serum but not by purified serum albumin. Lecithin, choline, and other substituted ammonium compounds also inhibit the effects of silicate on pneumococci. PMID:13306854
Isolation and characterization of a radiation resistant thermophilic bacterium from radon hot spring
International Nuclear Information System (INIS)
Liang Xinle; Yang Long; Zhang Hong; Zhang Lei
2011-01-01
A radiation resistant and thermophilic bacterium strain R4-33 was isolated from radon hot spring water samples, pretreated with 60 Co γ-rays and UV irradiation. Tests on morphological, physiological and biochemical characters, fatty acid compositions, (G + C) mol% contents, and 16S rDNA sequencing were conducted. The results showed that strain R4-33 was of rod-shape, Gram-negative, atrichous, and endospore-forming. The optimum growth temperature and pH were 60 ℃ and 7.5, respectively. The strain utilized glucose, maltose and trehalose as carbon sources, and hydrolyzed casein and starch. Its catalase positive. The strain was sensitive to penicillin, neomycin, erythromycin, vancomycin, streptomycin, gentamycin, amikacin and ampicillin. The major cellular fatty acids were C 14:1 (48.8%) and C 15:1 (15.2%). The (G + C) mol% content of DNA was 58.2%. Phylogenetic tree based on 16S rDNA sequence showed R4-33 shared highly similarity to those of species in genus Anoxybacillus, especially to that of Anoxybacillus gonensis (99.5%). Based on the above, the strain R4-33 was proposed to the evolution branch of Anoxybacillus and designated as Anoxybacillu sp. R4-33. The UV and γ-radiation tests showed that the strain R4-33 had an ability of resistance to UV of 396 J/m 2 and 60 Co γ-rays irradiation of 14.0 kGy, indicating that the strain was a radiation resistant and thermophilic bacterium. (authors)
Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana
2013-06-01
Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.
Cabrera, A.; Aguilera, M.; Fuentes Enriquez de Salamanca, S.; Incerti, C.; Russell, N.J.; Ramos-Cormenzana, A.; Monteoliva-Sanchez, M.
2007-01-01
moderately halophilic bacterium, strain CG2.1T, isolated from a solar saltern at Cabo de Gata, a wildlife reserve located in the province of Almería, southern Spain, was subjected to a polyphasic taxonomic study. This organism was an aerobic, motile, Gram-negative rod that produced orange-pigmented
Isolation and Identification of Echinenone from Micrococcus roseus
Schwartzel, E. H.; Cooney, J. J.
1970-01-01
An orange carotenoid from Micrococcus roseus was purified by solvent partitioning followed by column and thin-layer chromatography. Absorption spectra, chromatographic mobility, and partition coefficient suggested that the pigment was echinenone (4-keto-β-carotene). Reduction yielded a pigment with the spectral and polar properties of isocryptoxanthin (4-hydroxy-β-carotene), the expected product. The orange pigment and its reduction product co-chromatographed with the respective authentic pigments, confirming the original pigment as echinenone. To our knowledge echinenone has not been identified previously as a bacterial pigment. PMID:5473895
International Nuclear Information System (INIS)
Daly, Michael J.
2006-01-01
Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus and Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella and Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR
Energy Technology Data Exchange (ETDEWEB)
Daly, Michael J.
2006-05-01
Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.
Excision repair of 5,6-dihydroxydihydrothymine from the DNA of Micrococcus radiodurans
International Nuclear Information System (INIS)
Targovnik, H.S.; Hariharan, P.V.
1980-01-01
One of the major ionizing radiation products, 5,6-dihydroxydihydrothymine (thymine glycol), was measured in the DNA of Micrococcus radiodurans following exposure of cells to 6.8-MeV electrons or 254-nm ultraviolet light. Removal of 5,6-dihydroxydihydrothymine was measured in both an ionizing radiation-sensitive strain (262) and a highly radioresistant strain (the wild type W + ) of Micrococcus radiodurans. Within 30 min of incubation (33 0 C) following exposure to ultraviolet light (2400 J/m 2 ) approximately 60% of the thymine glycols were excised, whereas in the case of ionizing radiation (250 krad) only 35% were removed from the cellular DNA of the wild-type strain. In contrast less than 50% of the thymine glycols were excised from the sensitive strain. The amount of DNA degradation induced by radiation was less than 10% in both strains. The results suggest a possible correlation between reduced excision repair of base damage and increased radiation sensitivity
Directory of Open Access Journals (Sweden)
Bárcena José A
2008-12-01
Full Text Available Abstract Background Annotation of protein-coding genes is a key step in sequencing projects. Protein functions are mainly assigned on the basis of the amino acid sequence alone by searching of homologous proteins. However, fully automated annotation processes often lead to wrong prediction of protein functions, and therefore time-intensive manual curation is often essential. Here we describe a fast and reliable way to correct function annotation in sequencing projects, focusing on surface proteomes. We use a proteomics approach, previously proven to be very powerful for identifying new vaccine candidates against Gram-positive pathogens. It consists of shaving the surface of intact cells with two proteases, the specific cleavage-site trypsin and the unspecific proteinase K, followed by LC/MS/MS analysis of the resulting peptides. The identified proteins are contrasted by computational analysis and their sequences are inspected to correct possible errors in function prediction. Results When applied to the zoonotic pathogen Streptococcus suis, of which two strains have been recently sequenced and annotated, we identified a set of surface proteins without cytoplasmic contamination: all the proteins identified had exporting or retention signals towards the outside and/or the cell surface, and viability of protease-treated cells was not affected. The combination of both experimental evidences and computational methods allowed us to determine that two of these proteins are putative extracellular new adhesins that had been previously attributed a wrong cytoplasmic function. One of them is a putative component of the pilus of this bacterium. Conclusion We illustrate the complementary nature of laboratory-based and computational methods to examine in concert the localization of a set of proteins in the cell, and demonstrate the utility of this proteomics-based strategy to experimentally correct function annotation errors in sequencing projects. This
Decreased mortality associated with prompt Gram staining of blood cultures.
Barenfanger, Joan; Graham, Donald R; Kolluri, Lavanya; Sangwan, Gaurav; Lawhorn, Jerry; Drake, Cheryl A; Verhulst, Steven J; Peterson, Ryan; Moja, Lauren B; Ertmoed, Matthew M; Moja, Ashley B; Shevlin, Douglas W; Vautrain, Robert; Callahan, Charles D
2008-12-01
Gram stains of positive blood cultures are the most important factor influencing appropriate therapy. The sooner appropriate therapy is initiated, the better. Therefore, it is reasonable to expect that the sooner Gram stains are performed, the better. To determine the value of timely Gram stains and whether improvement in Gram stain turnaround time (TAT) is feasible, we compared data for matched pairs of patients with cultures processed promptly ( or =1 hour TAT) and then monitored TAT by control charting.In 99 matched pairs, average difference in time to detection of positive blood cultures within a pair of patients was less than 0.1 hour. For the less than 1 hour TAT group, the average TAT and crude mortality were 0.1 hour and 10.1%, respectively; for the 1 hour or longer TAT group, they were 3.3 hours and 19.2%, respectively (P Gram stains.
Should gram stains have a role in diagnosing hip arthroplasty infections?
Johnson, Aaron J; Zywiel, Michael G; Stroh, D Alex; Marker, David R; Mont, Michael A
2010-09-01
The utility of Gram stains in diagnosing periprosthetic infections following total hip arthroplasty has recently been questioned. Several studies report low sensitivity of the test, and its poor ability to either confirm or rule out infection in patients undergoing revision total hip arthroplasty. Despite this, many institutions including that of the senior author continue to perform Gram stains during revision total hip arthroplasty. We assessed the sensitivity, specificity, accuracy, and positive and negative predictive values of Gram stains from surgical-site samplings taken from procedures on patients with both infected and aseptic revision total hip arthroplasties. A review was performed on patients who underwent revision total hip arthroplasty between 2000 and 2007. Eighty-two Gram stains were performed on patients who had infected total hip arthroplasties and underwent revision procedures. Additionally, of the 410 revision total hip arthroplasties performed on patients who were confirmed infection-free, 120 Gram stains were performed. Patients were diagnosed as infected using multiple criteria at the time of surgery. Sensitivity, specificity, positive and negative predictive values, and accuracy were calculated from these Gram stain results. The Gram stain demonstrated a sensitivity and specificity of 9.8% and 100%, respectively. In this series, the Gram stain had a negative predictive value of 62%, a positive predictive value of 100%, and an accuracy of 63%. Gram stains obtained from surgical-site samples had poor sensitivity and poor negative predictive value. Based on these findings, as well as those of other authors, we believe that Gram stains should no longer be considered for diagnosing infections in revision total hip arthroplasty. Level III, diagnostic study. See Guidelines for Authors for a complete description of levels of evidence.
Liu, Lihong; Yang, Jun; Xie, Jianping; Luo, Zhentao; Jiang, Jiang; Yang, Yi Yan; Liu, Shaomin
2013-05-07
Silver nanoparticles are of great interest for use as antimicrobial agents. Studies aimed at producing potent nano-silver biocides have focused on manipulation of particle size, shape, composition and surface charge. Here, we report the cell penetrating peptide catalyzed formation of antimicrobial silver nanoparticles in N,N-dimethylformamide. The novel nano-composite demonstrated a distinctly enhanced biocidal effect toward bacteria (gram-positive Bacillus subtilis, gram-negative Escherichia coli) and pathogenic yeast (Candida albicans), as compared to triangular and extremely small silver nanoparticles. In addition, a satisfactory biocompatibility was verified by a haemolysis test. Our results provide a paradigm in developing strategies that can maximize the silver nanoparticle application potentials while minimizing the toxic effects.
Cox, Georgina; Koteva, Kalinka; Wright, Gerard D.
2014-01-01
Objectives An orthogonal approach taken towards novel antibacterial drug discovery involves the identification of small molecules that potentiate or enhance the activity of existing antibacterial agents. This study aimed to identify natural-product rifampicin adjuvants in the intrinsically resistant organism Escherichia coli. Methods E. coli BW25113 was screened against 1120 actinomycete fermentation extracts in the presence of subinhibitory (2 mg/L) concentrations of rifampicin. The active molecule exhibiting the greatest rifampicin potentiation was isolated using activity-guided methods and identified using mass and NMR spectroscopy. Susceptibility testing and biochemical assays were used to determine the mechanism of antibiotic potentiation. Results The anthracycline Antibiotic 301A1 was isolated from the fermentation broth of a strain of Streptomyces (WAC450); the molecule was shown to be highly synergistic with rifampicin (fractional inhibitory concentration index = 0.156) and moderately synergistic with linezolid (FIC index = 0.25) in both E. coli and Acinetobacter baumannii. Activity was associated with inhibition of efflux and the synergistic phenotype was lost when tested against E. coli harbouring mutations within the rpoB gene. Structure–activity relationship studies revealed that other anthracyclines do not synergize with rifampicin and removal of the sugar moiety of Antibiotic 301A1 abolishes activity. Conclusions Screening only a subsection of our natural product library identified a small-molecule antibiotic adjuvant capable of sensitizing Gram-negative bacteria to antibiotics to which they are ordinarily intrinsically resistant. This result demonstrates the great potential of this approach in expanding antibiotic effectiveness in the face of the growing challenge of resistance in Gram-negatives. PMID:24627312
Seitz, Patrick; Blokesch, Melanie
2013-05-01
Bacterial genomics is flourishing, as whole-genome sequencing has become affordable, readily available and rapid. As a result, it has become clear how frequently horizontal gene transfer (HGT) occurs in bacteria. The potential implications are highly significant because HGT contributes to several processes, including the spread of antibiotic-resistance cassettes, the distribution of toxin-encoding phages and the transfer of pathogenicity islands. Three modes of HGT are recognized in bacteria: conjugation, transduction and natural transformation. In contrast to the first two mechanisms, natural competence for transformation does not rely on mobile genetic elements but is driven solely by a developmental programme in the acceptor bacterium. Once the bacterium becomes competent, it is able to take up DNA from the environment and to incorporate the newly acquired DNA into its own chromosome. The initiation and duration of competence differ significantly among bacteria. In this review, we outline the latest data on representative naturally transformable Gram-negative bacteria and how their competence windows differ. We also summarize how environmental cues contribute to the initiation of competence in a subset of naturally transformable Gram-negative bacteria and how the complexity of the niche might dictate the fine-tuning of the competence window. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Recovery of vancomycin-resistant gram-positive cocci from children.
Green, M; Wadowsky, R M; Barbadora, K
1990-03-01
A cross-sectional survey of vancomycin-resistant gram-positive cocci (VRGPC) in the feces of children was initiated after several bacteremic infections with these organisms occurred at our hospital. A selective medium consisting of colistin-nalidixic acid agar, 5% sheep blood, vancomycin (5 mg/liter), and amphotericin B (8 mg/liter) was developed to isolate VRGPC. A single stool specimen submitted to the clinical microbiology laboratory from each of 48 patients was inoculated onto the medium. Plates were incubated at 35 degrees C with 5% carbon dioxide and examined at 24, 48, and 72 h. Susceptibilities were determined by broth microdilution. A total of 14 isolates from 11 of 48 (22%) children were recovered. The density of growth ranged from a single colony to 2+. The VRGPC were identified as Leuconostoc lactis (n = 2), Lactobacillus confusus (n = 4), Enterococcus species (n = 5), and Lactococcus lactis (n = 3). One strain of Lactobacillus confusus was recovered from both the stool and the blood of one of these patients. The MICs of vancomycin were 4 micrograms/ml for one of the isolates, 8 micrograms/ml for four of the isolates, and more than 16 micrograms/ml for the remaining eight isolates. All isolates were susceptible to both penicillin and ampicillin. Only 1 of the 11 children had received prior treatment with vancomycin. We conclude that low concentrations of VRGPC may be common in the gastrointestinal tracts of children.
Unique antimicrobial spectrum of ophiobolin K produced by Aspergillus ustus.
Sohsomboon, Natthapat; Kanzaki, Hiroshi; Nitoda, Teruhiko
2018-03-01
A co-cultivation study of two fungal strains showed that Aspergillus ustus could inhibit Aspergillus repens growth. The bioactive compound responsible for the observed activity was purified and identified as a sesterterpene, ophiobolin K. Ophiobolin K exhibited marked inhibition against both fungi and bacteria, especially A. repens, A. glaucus and gram-positive bacteria including Bacillus subtilis, Staphylococcus aureus, and Micrococcus luteus.
Directory of Open Access Journals (Sweden)
Nadine Lemaître
2017-07-01
Full Text Available The infectious diseases caused by multidrug-resistant bacteria pose serious threats to humankind. It has been suggested that an antibiotic targeting LpxC of the lipid A biosynthetic pathway in Gram-negative bacteria is a promising strategy for curing Gram-negative bacterial infections. However, experimental proof of this concept is lacking. Here, we describe our discovery and characterization of a biphenylacetylene-based inhibitor of LpxC, an essential enzyme in the biosynthesis of the lipid A component of the outer membrane of Gram-negative bacteria. The compound LPC-069 has no known adverse effects in mice and is effective in vitro against a broad panel of Gram-negative clinical isolates, including several multiresistant and extremely drug-resistant strains involved in nosocomial infections. Furthermore, LPC-069 is curative in a murine model of one of the most severe human diseases, bubonic plague, which is caused by the Gram-negative bacterium Yersinia pestis. Our results demonstrate the safety and efficacy of LpxC inhibitors as a new class of antibiotic against fatal infections caused by extremely virulent pathogens. The present findings also highlight the potential of LpxC inhibitors for clinical development as therapeutics for infections caused by multidrug-resistant bacteria.
Wal, van der A.; Norde, W.; Bendinger, B.; Zehnder, A.J.B.; Lyklema, J.
1997-01-01
Cell walls of five Gram-positive bacterial strains, including four coryneforms and a Bacillus brevis strain were isolated and subsequently chemically analysed. The wall contribution to the total cell mass is calculated from a comparison of D-Lactate concentrations in hydrolysates of whole cells and
Directory of Open Access Journals (Sweden)
Santhanam Amutha
2010-08-01
Full Text Available The antimicrobial activities of the methanolic extracts of Euphorbia hirta L leaves, flowers, stems and roots were evaluated against some medically important bacteria and yeast using the agar disc diffusion method. Four Gram positive (Staphylococcus aureus, Micrococcus sp., Bacillus subtilis and Bacillus thuringensis, four Gram negative (Escherichia coli, Klebsiella pneumonia, Salmonella typhi and P. mirabilis and one yeast (Candida albicans species were screened. Inhibition zones ranged between 16–29 mm. Leaves extract inhibited the growth of all tested microorganisms with large zones of inhibition, followed by that of flowers, which also inhibited all the bacteria except C. albicans. The most susceptible microbes to all extracts were S. aureus and Micrococcus sp. Root extract displayed larger inhibition zones against Gram positive bacteria than Gram negative bacteria and had larger inhibition zones compared to stem extract. The lowest MIC values were obtained with E. coli and C. albicans (3.12 mg/mL, followed by S. aureus (12.50 mg/mL and P. mirabilis (50.00 mg/mL. All the other bacteria had MIC values of 100.00 mg/mL. Scanning Electron Microscopic (SEM studies revealed that the cells exposed to leaf extract displayed a rough surface with multiple blends and invaginations which increased with increasing time of treatment, and cells exposed to leaf extract for 36 h showed the most damage, with abundant surface cracks which may be related to final cell collapse and lossThe antimicrobial activities of the methanolic extracts of Euphorbia hirta L leaves, flowers, stems and roots were evaluated against some medically important bacteria and yeast using the agar disc diffusion method. Four Gram positive (Staphylococcus aureus, Micrococcus sp., Bacillus subtilis and Bacillus thuringensis, four Gram negative (Escherichia coli, Klebsiella pneumonia, Salmonella typhi and P. mirabilis and one yeast (Candida albicans species were screened. Inhibition
Directory of Open Access Journals (Sweden)
Sandra C. Vega
2018-03-01
Full Text Available Multidrug resistance of pathogenic bacteria has become a public health crisis that requires the urgent design of new antibacterial drugs such as antimicrobial peptides (AMPs. Seeking to obtain new, lactoferricin B (LfcinB-based synthetic peptides as viable early-stage candidates for future development as AMPs against clinically relevant bacteria, we designed, synthesized and screened three new cationic peptides derived from bovine LfcinB. These peptides contain at least one RRWQWR motif and differ by the copy number (monomeric, dimeric or tetrameric and structure (linear or branched of this motif. They comprise a linear palindromic peptide (RWQWRWQWR, a dimeric peptide (RRWQWR2KAhx and a tetrameric peptide (RRWQWR4K2Ahx2C2. They were screened for antibacterial activity against Enterococcus faecalis (ATCC 29212 and ATCC 51575 strains, Pseudomonas aeruginosa (ATCC 10145 and ATCC 27853 strains and clinical isolates of two Gram-positive bacteria (Enterococcus faecium and Staphylococcus aureus and two Gram-negative bacteria (Klebsiella pneumoniae and Pseudomonas aeruginosa. All three peptides exhibited greater activity than did the reference peptide, LfcinB (17–31, which contains a single linear RRWQWR motif. Against the ATCC reference strains, the three new peptides exhibited minimum inhibitory concentration (MIC50 values of 3.1–198.0 μM and minimum bactericidal concentration (MBC values of 25–200 μM, and against the clinical isolates, MIC50 values of 1.6–75.0 μM and MBC values of 12.5–100 μM. However, the tetrameric peptide was also found to be strongly hemolytic (49.1% at 100 μM. Scanning Electron Microscopy (SEM demonstrated that in the dimeric and tetrameric peptides, the RRWQWR motif is exposed to the pathogen surface. Our results may inform the design of new, RRWQWR-based AMPs.
In Vitro Repair of UV-Irradiated Micrococcus luteus Bacteriophage N1 Transfecting DNA 1
Mahler, Inga; George, Jeanne; Grossman, Lawrence
1974-01-01
Calcium-treated UV-sensitive, host cell reactivation− strains of Micrococcus luteus are infected with UV-irradiated N1 DNA. In strains lacking UV endonuclease, in vitro treatment of the irradiated DNA results in transfection enhancement. PMID:4823319
Ribeiro, Carla M. S.; Hermsen, Trudi; Taverne-Thiele, Anja J.; Savelkoul, Huub F. J.; Wiegertjes, Geert F.
2010-01-01
We investigated the role of the TLR2 receptor in the recognition of ligands from Gram-positive bacteria in fish. Comparative sequence analysis showed a highly conserved Toll/IL-1 receptor domain. Although the leucine-rich repeat domain was less conserved, the position of the critical peptidoglycan
Eichenbaum, Zehava; Federle, Michael J.; Marra, Diana; Vos, Willem M. de; Kuipers, Oscar P.; Kleerebezem, Michiel; Scott, June R.
1998-01-01
We characterized the regulated activity of the lactococcal nisA promoter in strains of the gram-positive species Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumoniae, Enterococcus faecalis, and Bacillus subtilis. nisA promoter activity was dependent on the proteins NisR and
DEFF Research Database (Denmark)
Veloo, A C M; de Vries, E D; Jean-Pierre, H
2016-01-01
Gram-positive anaerobic cocci (GPAC) account for 24%-31% of the anaerobic bacteria isolated from human clinical specimens. At present, GPAC are under-represented in the Biotyper MALDI-TOF MS database. Profiles of new species have yet to be added. We present the optimization of the matrix-assisted......Gram-positive anaerobic cocci (GPAC) account for 24%-31% of the anaerobic bacteria isolated from human clinical specimens. At present, GPAC are under-represented in the Biotyper MALDI-TOF MS database. Profiles of new species have yet to be added. We present the optimization of the matrix......-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS) database for the identification of GPAC. Main spectral profiles (MSPs) were created for 108 clinical GPAC isolates. Identity was confirmed using 16S rRNA gene sequencing. Species identification was considered to be reliable...... if the sequence similarity with its closest relative was ≥98.7%. The optimized database was validated using 140 clinical isolates. The 16S rRNA sequencing identity was compared with the MALDI-TOF MS result. MSPs were added from 17 species that were not yet represented in the MALDI-TOF MS database or were under...
Czech Academy of Sciences Publication Activity Database
Fischer-Colbrie, G.; Matamá, T.; Heumann, S.; Martínková, Ludmila; Cavaco Paulo, A.; Gubitz, G.
2007-01-01
Roč. 129, č. 1 (2007), s. 62-68 ISSN 0168-1656 R&D Projects: GA MŠk OC D25.001 Institutional research plan: CEZ:AV0Z50200510 Keywords : micrococcus luteus * nitrilase * polyacrylonitrile Subject RIV: EE - Microbiology, Virology Impact factor: 2.565, year: 2007
International Nuclear Information System (INIS)
Fredrickson, Jim K.; Daly, Michael J.
2006-01-01
Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus and Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella and Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf)
Energy Technology Data Exchange (ETDEWEB)
Fredrickson, Jim K.; Daly, Michael J.
2006-06-01
Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).
Bacterial glycobiology: rhamnose-containing cell wall polysaccharides in Gram-positive bacteria.
Mistou, Michel-Yves; Sutcliffe, Iain C; van Sorge, Nina M
2016-07-01
The composition of the Gram-positive cell wall is typically described as containing peptidoglycan, proteins and essential secondary cell wall structures called teichoic acids, which comprise approximately half of the cell wall mass. The cell walls of many species within the genera Streptococcus, Enterococcus and Lactococcus contain large amounts of the sugar rhamnose, which is incorporated in cell wall-anchored polysaccharides (CWP) that possibly function as homologues of well-studied wall teichoic acids (WTA). The presence and chemical structure of many rhamnose-containing cell wall polysaccharides (RhaCWP) has sometimes been known for decades. In contrast to WTA, insight into the biosynthesis and functional role of RhaCWP has been lacking. Recent studies in human streptococcal and enterococcal pathogens have highlighted critical roles for these complex polysaccharides in bacterial cell wall architecture and pathogenesis. In this review, we provide an overview of the RhaCWP with regards to their biosynthesis, genetics and biological function in species most relevant to human health. We also briefly discuss how increased knowledge in this field can provide interesting leads for new therapeutic compounds and improve biotechnological applications. © FEMS 2016.
Resende, Juliana Alves; Fontes, Cláudia Oliveira; Ferreira-Machado, Alessandra Barbosa; Nascimento, Thiago César; Silva, Vânia Lúcia; Diniz, Cláudio Galuppo
2018-02-01
Although most Brazilian dairy products meet high technological standards, there are quality issues regarding milk production, which may reduce the final product quality. Several microbial species may contaminate milk during manufacture and handling. If antimicrobial usage remains uncontrolled in dairy cattle, the horizontal transfer of antimicrobial resistance genes in foodstuffs may be of particular concern for both food producers and dairy industry. This study focused on the evaluation of putative Gram positive cocci in Minas cheese and of antimicrobial and biocide resistance genes among the isolated bacteria. Representative samples of 7 different industrially trademarked Minas cheeses (n = 35) were processed for selective culture and isolation of Gram positive cocci. All isolated bacteria were identified by DNA sequencing of the 16S rRNA gene. Antimicrobial resistance genes were screened by PCR. Overall, 208 strains were isolated and identified as follows: Enterococcus faecalis (47.6%), Macrococcus caseolyticus (18.3%), Enterococcus faecium (11.5%), Enterococcus caseliflavus (7.7%), Staphylococcus haemolyticus (7.2%), Staphylococcus aureus (4.3%), Staphylococcus epidermidis (2.9%), and Enterococcus hirae (0.5%). The genetic markers mecA (78.0%) and smr (71.4%) were the most prevalent, but others were also detected, such as blaZ (65.2%), msrA (60.9%), msrB (46.6%), linA (54.7%), and aacA-aphD (47.6%). The occurrence of opportunist pathogenic bacteria harboring antimicrobial resistance markers in the cheese samples are of special concern, since these bacteria are not considered harmful contaminating agents according to the Brazilian sanitary regulations. However, they are potentially pathogenic bacteria and the cheese may be considered a reservoir for antimicrobial resistance genes available for horizontal transfer through the food chain, manufacturing personnel and consumers. © 2018 Institute of Food Technologists®.
Cox, Georgina; Koteva, Kalinka; Wright, Gerard D
2014-07-01
An orthogonal approach taken towards novel antibacterial drug discovery involves the identification of small molecules that potentiate or enhance the activity of existing antibacterial agents. This study aimed to identify natural-product rifampicin adjuvants in the intrinsically resistant organism Escherichia coli. E. coli BW25113 was screened against 1120 actinomycete fermentation extracts in the presence of subinhibitory (2 mg/L) concentrations of rifampicin. The active molecule exhibiting the greatest rifampicin potentiation was isolated using activity-guided methods and identified using mass and NMR spectroscopy. Susceptibility testing and biochemical assays were used to determine the mechanism of antibiotic potentiation. The anthracycline Antibiotic 301A(1) was isolated from the fermentation broth of a strain of Streptomyces (WAC450); the molecule was shown to be highly synergistic with rifampicin (fractional inhibitory concentration index = 0.156) and moderately synergistic with linezolid (FIC index = 0.25) in both E. coli and Acinetobacter baumannii. Activity was associated with inhibition of efflux and the synergistic phenotype was lost when tested against E. coli harbouring mutations within the rpoB gene. Structure-activity relationship studies revealed that other anthracyclines do not synergize with rifampicin and removal of the sugar moiety of Antibiotic 301A(1) abolishes activity. Screening only a subsection of our natural product library identified a small-molecule antibiotic adjuvant capable of sensitizing Gram-negative bacteria to antibiotics to which they are ordinarily intrinsically resistant. This result demonstrates the great potential of this approach in expanding antibiotic effectiveness in the face of the growing challenge of resistance in Gram-negatives. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Cantey, Joseph B; Gaviria-Agudelo, Claudia; McElvania TeKippe, Erin; Doern, Christopher D
2015-04-01
Urinary tract infection (UTI) is one of the most common infections in children. Urine culture remains the gold standard for diagnosis, but the utility of urine Gram stain relative to urinalysis (UA) is unclear. We reviewed 312 pediatric patients with suspected UTI who had urine culture, UA, and urine Gram stain performed from a single urine specimen. UA was considered positive if ≥10 leukocytes per oil immersion field were seen or if either nitrates or leukocyte esterase testing was positive. Urine Gram stain was considered positive if any organisms were seen. Sensitivity, specificity, and positive and negative predictive values were calculated using urine culture as the gold standard. Thirty-seven (12%) patients had a culture-proven UTI. Compared to urine Gram stain, UA had equal sensitivity (97.3% versus 97.5%) and higher specificity (85% versus 74%). Empirical therapy was prescribed before the Gram stain result was known in 40 (49%) patients and after in 42 (51%) patients. The antibiotics chosen did not differ between the two groups (P=0.81), nor did they differ for patients with Gram-negative rods on urine Gram stain compared to those with Gram-positive cocci (P=0.67). From these data, we conclude that UA has excellent negative predictive value that is not enhanced by urine Gram stain and that antibiotic selection did not vary based on the urine Gram stain result. In conclusion, the clinical utility of urine Gram stain does not warrant the time or cost it requires. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Fuglsang-Damgaard, David; Nielsen, Camilla Houlberg; Mandrup, Elisabeth; Fuursted, Kurt
2011-10-01
Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) is promising as an alternative to more costly and cumbersome methods for direct identifications in blood cultures. We wanted to evaluate a simplified pre-treatment method for using MALDI-TOF-MS directly on positive blood cultures using BacT/Alert blood culture system, and to test an algorithm combining the result of the initial microscopy with the result suggested by MALDI-TOF-MS. Using the recommended cut-off score of 1.7 the best results were obtained among Gram-negative rods with correct identifications in 91% of Enterobacteriaceae, 83% in aerobic/non-fermentative Gram-negative rods, whereas results were more modest among Gram-positive cocci with correct identifications in 52% of Staphylococci, 54% in Enterococci and only 20% in Streptococci. Combining the results of Gram stain with the top reports by MALDI-TOF-MS, increased the sensitivity from 91% to 93% in the score range from 1.5 to 1.7 and from 48% to 85% in the score range from 1.3 to 1.5. Thus, using this strategy and accepting a cut-off at 1.3 instead of the suggested 1.7, overall sensitivity could be increased from 88.1% to 96.3%. MALDI-TOF-MS is an efficient method for direct routine identification of bacterial isolates in blood culture, especially when combined with the result of the Gram stain. © 2011 The Authors. APMIS © 2011 APMIS.
Gelria glutamica gen. nov., sp. a thermophilic oligately syntrophic glutamate-degrading anaerobe
Plugge, C.M.; Balk, M.; Zoetendal, E.G.; Stams, A.J.M.
2002-01-01
A novel anaerobic, Gram-positive, thermophilic, spore-forming, obligately syntrophic, glutamate-degrading bacterium, strain TGO(T), was isolated from a propionate-oxidizing methanogenic enrichment culture. The axenic culture was obtained by growing the bacterium on pyruvate. Cells were rod-shaped
Directory of Open Access Journals (Sweden)
C. Baskaran
2012-10-01
Full Text Available Objective: To investigate the antimicrobial activity and phytochemical screening Ethanol, methanol, Ethyl acetate, acetone, chloroform, Petroleum ether, hexane, hot water, and extracts of Carica papaya. Methods: The aim of the present study was to evaluate the qualitative analysis of phytochemicals and antimicrobial activity of various solvent extracts of Carica papaya. The antimicrobial activities of different solvent extracts of Carica papaya were tested against the Gram-positive and Gram-negative bacterial strains and fungus by observing the zone of inhibition. The Gram-positive bacteria used in the test were Staphylococcus aureus, Bacillus cereus and Micrococcus luteus, and the Gram-negative bacteria were Escherichia coli, and Klebsiella pneumoniae, fungus like Aspergillus niger, Aspergillus flavus, Candida albicans, Candida tropicalis, Cryptococcus neoformans, and Candida kefyr. Results: It was observed that ethanol, methanol, ethyl acetate, aceton, chloroform, petroleum ether, hexane and aquas extracts showed activity against bacteria and fungus. The chloroform extract of Carica papaya showed more activity against Micrococcus luteus, zone of diameter 15.17暲0.29mm and acetone extract of Carica papaya showed more activity against Candida albicans, zone of diameter 11.23暲0.25mm compared to other solvent extracts. Conclusions: In this study chloroform extract in bacteria and acetone extract in fungus showed a varying degree of inhibition to the growth of tested organism, than Ethanol, methanol, Ethyl acetate, Petroleum ether, hexane and hot water extracts. The results confirmed the presence of antibacterial and antifungal activity of Carica papaya extract against various human pathogenic bacteria. Presences of phytochemical and antimicrobial activity are confirmed.
Sokolova, T G; González, J M; Kostrikina, N A; Chernyh, N A; Tourova, T P; Kato, C; Bonch-Osmolovskaya, E A; Robb, F T
2001-01-01
A new anaerobic, thermophilic, CO-utilizing marine bacterium, strain JMT, was isolated from a submarine hot vent in Okinawa Trough. Cells of strain JMT were non-motile thin straight rods, sometimes branching, with a cell wall of the Gram-positive type, surrounded with an S-layer. Chains of three to five cells were often observed. The isolate grew chemolithotrophically on CO, producing equimolar quantities of H2 and CO2 (according to the equation CO+H2O-->CO2+H2) and organotrophically on peptone, yeast extract, starch, cellobiose, glucose, galactose, fructose and pyruvate, producing H2, acetate and CO2. Growth was observed from 50 to 80 degrees C with an optimum at 70 degrees C. The optimum pH was 6.8-7.1. The optimum concentration of sea salts in the medium was 20.5-25.5 g l(-1). The generation time under optimal conditions was 7.1 h. The DNA G+C content was 33 mol %. Growth of isolate JMT was not inhibited by penicillin, but ampicillin, streptomycin, kanamycin and neomycin completely inhibited growth. The results of 16S rDNA sequence analysis revealed that strain JMT belongs to the Thermoanaerobacter phylogenetic group within the Bacillus-Clostridium subphylum of Gram-positive bacteria but represents a separate branch of this group. On the basis of morphological and physiological features and phylogenetic data, this isolate should be assigned to a new genus, for which the name Carboxydobrachium is proposed. The type species is Carboxydobrachium pacificum; the type strain is JMT (= DSM 12653T).
Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X
2016-03-01
The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Gaomin Liu
2018-05-01
Full Text Available The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N-terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro, chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18 showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.
Gram staining in the diagnosis of acute septic arthritis.
Faraj, A A; Omonbude, O D; Godwin, P
2002-10-01
This study aimed at determining the sensitivity and specificity of Gram staining of synovial fluid as a diagnostic tool in acute septic arthritis. A retrospective study was made of 22 patients who had arthroscopic lavage following a provisional diagnosis of acute septic arthritis of the knee joint. Gram stains and cultures of the knee aspirates were compared with the clinical and laboratory parameters, to evaluate their usefulness in diagnosing acute arthritis. All patients who had septic arthritis had pain, swelling and limitation of movement. CRP was elevated in 90% of patients. The incidence of elevated white blood cell count was higher in the group of patients with a positive Gram stain study (60%) as compared to patients with a negative Gram stain study (33%). Gram staining sensitivity was 45%. Its specificity was however 100%. Gram staining is an unreliable tool in early decision making in patients requiring urgent surgical drainage and washout.
Wu, Wen-Jie; Liu, Qian-Qian; Chen, Guan-Jun; Du, Zong-Jun
2015-07-01
A Gram-stain-negative, facultatively anaerobic, non-motile and pink-pigmented bacterium, designated strain HF08(T), was isolated from marine sediment of the coast of Weihai, China. Cells were rod-shaped, and oxidase- and catalase-positive. The isolate grew optimally at 33 °C, at pH 7.5-8.0 and with 2-3% (w/v) NaCl. The dominant cellular fatty acids were iso-C15 : 0, anteiso-C15 : 0 and iso-C14 : 0. Menaquinone 7 (MK-7) was the major respiratory quinone and the DNA G+C content was 44.8 mol%. Phylogenetic analysis based on 16S rRNA gene sequences revealed that the isolate was a member of the class Bacteroidia, and shared 88-90% sequence similarity with the closest genera Sunxiuqinia, Prolixibacter, Draconibacterium, Mariniphaga and Meniscus. Based on the phylogenetic and phenotypic evidence presented, a novel species in a new genus of the family Prolixibacteraceae is proposed, with the name Roseimarinus sediminis gen. nov., sp. nov. The type strain of Roseimarinus sediminis is HF08(T) ( = KCTC 42261(T) = CICC 10901(T)).
Automated Interpretation of Blood Culture Gram Stains by Use of a Deep Convolutional Neural Network.
Smith, Kenneth P; Kang, Anthony D; Kirby, James E
2018-03-01
Microscopic interpretation of stained smears is one of the most operator-dependent and time-intensive activities in the clinical microbiology laboratory. Here, we investigated application of an automated image acquisition and convolutional neural network (CNN)-based approach for automated Gram stain classification. Using an automated microscopy platform, uncoverslipped slides were scanned with a 40× dry objective, generating images of sufficient resolution for interpretation. We collected 25,488 images from positive blood culture Gram stains prepared during routine clinical workup. These images were used to generate 100,213 crops containing Gram-positive cocci in clusters, Gram-positive cocci in chains/pairs, Gram-negative rods, or background (no cells). These categories were targeted for proof-of-concept development as they are associated with the majority of bloodstream infections. Our CNN model achieved a classification accuracy of 94.9% on a test set of image crops. Receiver operating characteristic (ROC) curve analysis indicated a robust ability to differentiate between categories with an area under the curve of >0.98 for each. After training and validation, we applied the classification algorithm to new images collected from 189 whole slides without human intervention. Sensitivity and specificity were 98.4% and 75.0% for Gram-positive cocci in chains and pairs, 93.2% and 97.2% for Gram-positive cocci in clusters, and 96.3% and 98.1% for Gram-negative rods. Taken together, our data support a proof of concept for a fully automated classification methodology for blood-culture Gram stains. Importantly, the algorithm was highly adept at identifying image crops with organisms and could be used to present prescreened, classified crops to technologists to accelerate smear review. This concept could potentially be extended to all Gram stain interpretive activities in the clinical laboratory. Copyright © 2018 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Servé W. M. Kengen
2013-01-01
Full Text Available Caldicellulosiruptor saccharolyticus is one of the most thermophilic cellulolytic organisms known to date. This Gram-positive anaerobic bacterium ferments a broad spectrum of mono-, di- and polysaccharides to mainly acetate, CO2 and hydrogen. With hydrogen yields approaching the theoretical limit for dark fermentation of 4 mol hydrogen per mol hexose, this organism has proven itself to be an excellent candidate for biological hydrogen production. This review provides an overview of the research on C. saccharolyticus with respect to the hydrolytic capability, sugar metabolism, hydrogen formation, mechanisms involved in hydrogen inhibition, and the regulation of the redox and carbon metabolism. Analysis of currently available fermentation data reveal decreased hydrogen yields under non-ideal cultivation conditions, which are mainly associated with the accumulation of hydrogen in the liquid phase. Thermodynamic considerations concerning the reactions involved in hydrogen formation are discussed with respect to the dissolved hydrogen concentration. Novel cultivation data demonstrate the sensitivity of C. saccharolyticus to increased hydrogen levels regarding substrate load and nitrogen limitation. In addition, special attention is given to the rhamnose metabolism, which represents an unusual type of redox balancing. Finally, several approaches are suggested to improve biohydrogen production by C. saccharolyticus.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Antibacterial properties of the skin mucus of the freshwater fishes, Rita rita and Channa punctatus.
Kumari, U; Nigam, A K; Mitial, S; Mitial, A K
2011-07-01
The skin mucus of Rita rita and Channa punctatus was investigated to explore the possibilities of its antibacterial properties. Skin mucus was extracted in acidic solvents (0.1% trifluoroacetic acid and 3% acetic acid) and in triple distilled water (aqueous medium). The antibacterial activity of the mucus extracts was analyzed, using disc diffusion method, against five strains of bacteria--the Gram-positive Staphylococcus aureus and Micrococcus luteus; and the Gram negative Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi. In both Rita rita and Channa punctatus, the skin mucus extracted in acidic solvents as well as in aqueous medium show antibacterial activity against Staphylococcus aureus and Micrococcus luteus. Nevertheless, the activity is higher in acidic solvents than that in aqueous medium. The acidic mucus extracts of Rita rita, show antibacterial activity against Salmonella typhi as well. The results suggest that fish skin mucus have bactericidal properties and thus play important role in the protection of fish against the invasion of pathogens. Fish skin mucus could thus be regarded as a potential source of novel antibacterial components.
DEFF Research Database (Denmark)
Ouoba, Labia Irène I.; Mbozo, Alain B. Vouidibio; Thorsen, Line
2015-01-01
. xylanilyticus DSM 23493T and L. odysseyi DSM 18869T was 41%, 16% and 15%, respectively. The internal transcribed spacer-PCR profile of the isolate was different from those of closely related bacteria. The cellwall peptidoglycan type was A4α, L-Lys-D-Asp and the major fatty acids were iso-C15:0, anteiso-C15......Investigation of the microbial diversity of Ntoba Mbodi, an African food made from the alkaline fermentation of cassava leaves, revealed the presence of a Gram-positive, catalase-positive, aerobic, motile and rod-shaped endospore-forming bacterium (NM73) with unusual phenotypic and genotypic......:0, anteiso-C17:0 and iso-C17:0 and iso-C17:1ω10c. The polar lipids included phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylglycerol, phosphoaminolipid, aminolipid, two phospholipids and two unknown lipids. The predominant menaquinones were MK-7 and MK-6.Ribose was the only whole-cell sugar...
Effects of combined exposure of Micrococcus luteus to nisin and pulsed electric fields
Dutreux, N.; Notermans, S.; Góngora-Nieto, M.M.; Barbosa-Cánovas, G.V.; Swanson, B.G.
2000-01-01
Death and injury following exposure of Micrococcus luteus to nisin and pulsed electric field (PEF) treatment were investigated in phosphate buffer (pH 6.8, σ = 4.8 ms/cm at 20°C). Four types of experiment were carried out, a single treatment with nisin (100 IU/ml at 20°C for 2 h), a single PEF
Highly efficient decolorization of Malachite Green by a novel Micrococcus sp. strain BD15.
Du, Lin-Na; Zhao, Ming; Li, Gang; Zhao, Xiao-Ping; Zhao, Yu-Hua
2011-08-01
Malachite Green (MG) is used for a variety of applications but is also known to be carcinogenic and mutagenic. In this study, a novel Micrococcus sp. (strain BD15) was observed to efficiently decolorize MG. The purposes of this study were to explore the optimal conditions for decolorization and to evaluate the potential use of this strain for MG decolorization. Optical microscope and UV-visible analyses were carried out to determine whether the decolorization was due to biosorption or biodegradation. A Plackett-Burman design was employed to investigate the effect of various parameters on decolorization, and response surface methodology was then used to explore the optimal decolorization conditions. Kinetics analysis and antimicrobial activity tests were also performed. The results indicated that the decolorization by the strain was mainly due to biodegradation. Concentrations of MG, urea, and yeast extract and inoculum size had significantly positive effects on MG decolorization, while concentrations of CuCl(2) and MgCl(2), and temperature had significantly negative effects. The interaction between different parameters could significantly affect decolorization, and the optimal conditions for decolorization were 1.0 g/L urea, 0.9 g/L yeast extract, 100 mg/L MG, 0.1 g/L inoculums (dry weight), and incubation at 25.2°C. Under the optimal conditions, 96.9% of MG was removed by the strain within 1 h, which represents highly efficient microbial decolorization. Moreover, the kinetic data for decolorization fit a second-order model well, and the strain showed a good MG detoxification capability. Based on the results of this study, we propose Micrococcus sp. strain BD15 as an excellent candidate strain for MG removal from wastewater.
Balk, Melike
2010-08-03
A mesophilic bacterium, strain An4, was isolated from an underground gas storage reservoir with methanol as substrate and perchlorate as electron acceptor. Cells were Gram-negative, spore-forming, straight to curved rods, 0.5-0.8 microm in diameter, and 2-8 microm in length, growing as single cells or in pairs. The cells grew optimally at 37 degrees C, and the pH optimum was around 7. Strain An4 converted various alcohols, organic acids, fructose, acetoin, and H(2)/CO(2) to acetate, usually as the only product. Succinate was decarboxylated to propionate. The isolate was able to respire with (per)chlorate, nitrate, and CO(2). The G+C content of the DNA was 42.6 mol%. Based on the 16S rRNA gene sequence analysis, strain An4 was most closely related to Sporomusa ovata (98% similarity). The bacterium reduced perchlorate and chlorate completely to chloride. Key enzymes, perchlorate reductase and chlorite dismutase, were detected in cell-free extracts.
Balk, Melike; Mehboob, Farrakh; van Gelder, Antonie H; Rijpstra, W Irene C; Damsté , Jaap S Sinninghe; Stams, Alfons J M
2010-01-01
A mesophilic bacterium, strain An4, was isolated from an underground gas storage reservoir with methanol as substrate and perchlorate as electron acceptor. Cells were Gram-negative, spore-forming, straight to curved rods, 0.5-0.8 microm in diameter, and 2-8 microm in length, growing as single cells or in pairs. The cells grew optimally at 37 degrees C, and the pH optimum was around 7. Strain An4 converted various alcohols, organic acids, fructose, acetoin, and H(2)/CO(2) to acetate, usually as the only product. Succinate was decarboxylated to propionate. The isolate was able to respire with (per)chlorate, nitrate, and CO(2). The G+C content of the DNA was 42.6 mol%. Based on the 16S rRNA gene sequence analysis, strain An4 was most closely related to Sporomusa ovata (98% similarity). The bacterium reduced perchlorate and chlorate completely to chloride. Key enzymes, perchlorate reductase and chlorite dismutase, were detected in cell-free extracts.
Use of magnetic beads for Gram staining of bacteria in aqueous suspension.
Yazdankhah, S P; Sørum, H; Larsen, H J; Gogstad, G
2001-12-01
A Gram staining technique was developed using monodisperse magnetic beads in concentrating bacteria in suspension for downstream application. The technique does not require heat fixation of organisms, electrical power, or a microscope. Gram-negative and Gram-positive bacteria were identified macroscopically based on the colour of the suspension. The bacteria concentrated on magnetic beads may also be identified microscopically.
Gram-typing of mastitis bacteria in milk samples using flow cytometry
DEFF Research Database (Denmark)
Langerhuus, Sine Nygaard; Ingvartsen, Klaus Lønne; Bennedsgaard, Torben Werner
2013-01-01
Fast identification of pathogenic bacteria in milk samples from cows with clinical mastitis is central to proper treatment. In Denmark, time to bacterial diagnosis is typically 24 to 48 h when using traditional culturing methods. The PCR technique provides a faster and highly sensitive identifica......Fast identification of pathogenic bacteria in milk samples from cows with clinical mastitis is central to proper treatment. In Denmark, time to bacterial diagnosis is typically 24 to 48 h when using traditional culturing methods. The PCR technique provides a faster and highly sensitive...... cytometry-based method, which can detect and distinguish gram-negative and gram-positive bacteria in mastitis milk samples. The differentiation was based on bacterial fluorescence intensities upon labeling with biotin-conjugated wheat germ agglutinin and acridine orange. Initially 19 in-house bacterial...... characteristic curves for the 19 bacterial cultures. The method was then tested on 53 selected mastitis cases obtained from the department biobank (milk samples from 6 gram-negative and 47 gram-positive mastitis cases). Gram-negative bacteria in milk samples were detected with a sensitivity of 1...
Lanini, Simone; Costa, Alessandro Nanni; Puro, Vincenzo; Procaccio, Francesco; Grossi, Paolo Antonio; Vespasiano, Francesca; Ricci, Andrea; Vesconi, Sergio; Ison, Michael G; Carmeli, Yehuda; Ippolito, Giuseppe
2015-01-01
Bacterial infections remain a challenge to solid organ transplantation. Due to the alarming spread of carbapenem-resistant gram negative bacteria, these organisms have been frequently recognized as cause of severe infections in solid organ transplant recipients. Between 15 May and 30 September 2012 we enrolled 887 solid organ transplant recipients in Italy with the aim to describe the epidemiology of gram negative bacteria spreading, to explore potential risk factors and to assess the effect of early isolation of gram negative bacteria on recipients' mortality during the first 90 days after transplantation. During the study period 185 clinical isolates of gram negative bacteria were reported, for an incidence of 2.39 per 1000 recipient-days. Positive cultures for gram negative bacteria occurred early after transplantation (median time 26 days; incidence rate 4.33, 1.67 and 1.14 per 1,000 recipient-days in the first, second and third month after SOT, respectively). Forty-nine of these clinical isolates were due to carbapenem-resistant gram negative bacteria (26.5%; incidence 0.63 per 1000 recipient-days). Carbapenems resistance was particularly frequent among Klebsiella spp. isolates (49.1%). Recipients with longer hospital stay and those who received either heart or lung graft were at the highest risk of testing positive for any gram negative bacteria. Moreover recipients with longer hospital stay, lung recipients and those admitted to hospital for more than 48h before transplantation had the highest probability to have culture(s) positive for carbapenem-resistant gram negative bacteria. Forty-four organ recipients died (0.57 per 1000 recipient-days) during the study period. Recipients with at least one positive culture for carbapenem-resistant gram negative bacteria had a 10.23-fold higher mortality rate than those who did not. The isolation of gram-negative bacteria is most frequent among recipient with hospital stays >48 hours prior to transplant and in those
Directory of Open Access Journals (Sweden)
Simone Lanini
Full Text Available Bacterial infections remain a challenge to solid organ transplantation. Due to the alarming spread of carbapenem-resistant gram negative bacteria, these organisms have been frequently recognized as cause of severe infections in solid organ transplant recipients.Between 15 May and 30 September 2012 we enrolled 887 solid organ transplant recipients in Italy with the aim to describe the epidemiology of gram negative bacteria spreading, to explore potential risk factors and to assess the effect of early isolation of gram negative bacteria on recipients' mortality during the first 90 days after transplantation. During the study period 185 clinical isolates of gram negative bacteria were reported, for an incidence of 2.39 per 1000 recipient-days. Positive cultures for gram negative bacteria occurred early after transplantation (median time 26 days; incidence rate 4.33, 1.67 and 1.14 per 1,000 recipient-days in the first, second and third month after SOT, respectively. Forty-nine of these clinical isolates were due to carbapenem-resistant gram negative bacteria (26.5%; incidence 0.63 per 1000 recipient-days. Carbapenems resistance was particularly frequent among Klebsiella spp. isolates (49.1%. Recipients with longer hospital stay and those who received either heart or lung graft were at the highest risk of testing positive for any gram negative bacteria. Moreover recipients with longer hospital stay, lung recipients and those admitted to hospital for more than 48h before transplantation had the highest probability to have culture(s positive for carbapenem-resistant gram negative bacteria. Forty-four organ recipients died (0.57 per 1000 recipient-days during the study period. Recipients with at least one positive culture for carbapenem-resistant gram negative bacteria had a 10.23-fold higher mortality rate than those who did not.The isolation of gram-negative bacteria is most frequent among recipient with hospital stays >48 hours prior to transplant
H.P. Endtz (Hubert); J.W. Mouton (Johan); J.G. den Hollander (Jan); N.P.W.C.J. van den Braak (Nicole); H.A. Verbrugh (Henri)
1997-01-01
textabstractThe in vitro activity of trovafloxacin (CP-99,219), a new fluoroquinolone, was compared with the in vitro activities of other commonly used quinolones and other antimicrobial agents against 445 gram-positive microorganisms isolated between 1986 and 1995 from
Liu, Wei; Zhu, Wei-yun; Yao, Wen; Mao, Sheng-yong
2007-06-01
The distal mammalian gut harbors prodigiously abundant microbes, which provide unique metabolic traits to host. A lactate-utilizing, butyrate-producing bacterium, strain LB01, was isolated from adult swine feces by utilizing modified Hungate technique with rumen liquid-independent YCFA medium supplemented with lactate as the single carbon source. It was an obligate anaerobic, Gram positive bacterium, and could utilize glucose, fructose, maltose and lactate with a large amount of gas products. 16S rRNA sequence analysis revealed that it had the high similarity with members of the genus Megasphaera. The metabolic characteristics of strain LB01 was investigated by using in vitro fermentation system. Lactate at the concentration of 65 mmol/L in YCFA medium was rapidly consumed within 9 hours and was mainly converted to propionate and butyrate after 24h. As the level of acetate declined, the concentration of butyrate rose only in the presence of glucose, suggesting that butyrate could possibly be synthesized by the acetyl CoA: butyryl CoA transferase. When co-cultured with lactic acid bacteria strain K9, strain LB01 evidently reduced the concentration of lactate produced by strain K9 and decelerated the rapid pH drop, finally producing 12.11 mmol/L butyrate and 4.06 mmol/L propionate. The metabolic characteristics that strain LB01 efficiently converts toxic lactate and excessive acetate to butyrate can prevent lactate and acetate accumulation in the large intestine and maintain the slightly acidic environment of the large intestine, consequently revealing that stain LB01 could act as a potential probiotics.
Directory of Open Access Journals (Sweden)
Mahesh Chandra Sahu
2015-02-01
Full Text Available Objective: To monitor in vitro antibacterial activities of leaf extracts of 30 common and noncommon plants used by aborigines in Kalahandi district, Odisha, against 6 clinically isolated multidrug resistant (MDR Gram-positive bacteria of 3 genera, Staphylococcus, Streptococcus, and Enterococcus. Methods: The antibiotic sensitivity patterns of 6 bacterial strains were studied with the diskdiffusion method with 1 7 antibiotics belonging to 8 classes. Monitored plants have ethnomedicinal use and several are used as traditional medicines. Antibacterial properties were studied with the agar-well diffusion method. Minimum inhibitory concentration and minimum bactericidal concentration values of ethanolic and aqueous extracts of plants were determined by the microbroth-dilution method. Results: Ethanolic plant-extracts had the better antibacterial potencies in comparison to their corresponding aqueous extracts. Plants with most conspicuous antibacterial properties in controlling MDR strains of Gram-positive bacteria were aqueous and ethanolic extracts of plants, Ixora coccinea, Nyctanthes arbor-tristis, Polycythaemia rubra, Pongamia pinnata and Syzygium cumini, Carthamus tinctorius, Cucurbita maxima, Murraya koenigii, Leucas aspera, Plumbago indica and Psidium guajava. Ethanolic extracts of most plants had phytochemicals, alkaloids, glycosides, terpenoids, reducing sugars, saponins, tannins, flavonoids and steroids. Conclusions: These plants could be used further for the isolation of pure compounds to be used as complementary non-microbial antimicrobial medicines.
Schaik, van W.; Voort, van der M.; Molenaar, D.; Moezelaar, R.; Vos, de W.M.; Abee, T.
2007-01-01
The alternative sigma factor B has an important role in the acquisition of stress resistance in many gram-positive bacteria, including the food-borne pathogen Bacillus cereus. Here, we describe the identification of the set of B-regulated genes in B. cereus by DNA microarray analysis of the
Szczerba, Izabela; Krzemiński, Zbigniew
2002-01-01
The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.
Directory of Open Access Journals (Sweden)
Sader Helio S.
2001-01-01
Full Text Available Gram-positive cocci are important causes of both nosocomial and community-acquired infections, and antimicrobial resistance among these pathogens has become an important problem worldwide. Since resistance among these organisms can vary substantially by geographic location, we conducted a multicenter surveillance study with isolates from five Latin American countries (15 medical centers. Quinupristin/dalfopristin (formerly RP-59500 is a novel streptogramin combination with focused activity against Gram-positive cocci, many exhibiting emerging resistance. The in vitro activity of quinupristin/dalfopristin and 12 other antimicrobial agents were evaluated against 1,948 strains including Staphylococcus aureus (747 strains, coagulase-negative staphylococci (CoNS; 446 strains, enterococci (429 strains, and various Streptococcus spp. (326 strains. Oxacillin resistance was observed in 41% of S. aureus (MIC, or = 13 mm and 40% of CoNS (MIC, or = 18 mm. Vancomycin, teicoplanin, and quinupristin/dalfopristin (MIC90, 0.25 - 1 mug/ml remained effective against all strains, but cross-resistance was high among other tested drugs. The quinupristin/dalfopristin MIC50 for Streptococcus pneumoniae and other streptococci was only 0.5 mug/ml (13% to 28% were penicillin-resistant; 12% to 22% were macrolide-resistant. Enterococci demonstrated variable inhibition by quinupristin/dalfopristin depending upon identification and the susceptibility testing method used. The demonstrated quinupristin/dalfopristin activity against Enterococcus faecium was confirmed, but potential species identification errors with various commercial systems continue to confuse susceptibility statistics, even though some strains of E. faecium confirmed by PCR-based or other molecular identification techniques did have quinupristin/dalfopristin MICs of > or = 4 mug/mL. Most important, glycopeptide-resistant enterococci are rapidly emerging in Latin America, and quinupristin/dalfopristin appears
Kobayashi, Naomi; Bauer, Thomas W; Togawa, Daisuke; Lieberman, Isador H; Sakai, Hiroshige; Fujishiro, Takaaki; Tuohy, Marion J; Procop, Gary W
2005-06-01
The bacteria associated with orthopaedic infections are usually common gram-positive and gram-negative bacteria. This fundamental grouping of bacteria is a necessary first step in the selection of appropriate antibiotics. Since polymerase chain reaction (PCR) is more rapid and may be more sensitive than culture, we developed a postamplification pyrosequencing method to subcategorize bacteria based on a few nucleotide polymorphisms in the 16S rRNA gene. We validated this method using well-characterized strains of bacteria and applied it to specimens from spinal surgery cases with suspected infections. Lysates of 114 bacteria including 75 species were created following standard cultivation to obtain DNA. The DNA was amplified by a broad-range real-time PCR. The amplicons were evaluated by pyrosequencing and were classified as gram-positive, gram-negative, or acid-fast bacilli based on the first three to five nucleotides sequenced. In addition, clinical cases of suspected infection were obtained from spinal surgery. The results of the "molecular Gram stain" were compared with the results of traditional Gram stain and culture. The lysates of 107 (93.9%) of the bacteria extracts tested were appropriately categorized as gram-positive and gram-negative or as acid-fast bacilli on the basis of this assay. The sensitivity and specificity of this assay were 100% and 97.4% for gram-positive and 88.3% and 100% for gram-negative isolates. All of the five clinical samples were appropriately categorized as containing gram-positive or gram-negative bacteria with this assay. This study demonstrates that high sensitivity and specificity of a molecular gram stain may be achieved using broad-range real-time PCR and pyrosequencing.
Directory of Open Access Journals (Sweden)
Alia Colniță
2017-09-01
Full Text Available Raman scattering and its particular effect, surface-enhanced Raman scattering (SERS, are whole-organism fingerprinting spectroscopic techniques that gain more and more popularity in bacterial detection. In this work, two relevant Gram-positive bacteria species, Lactobacillus casei (L. casei and Listeria monocytogenes (L. monocytogenes were characterized based on their Raman and SERS spectral fingerprints. The SERS spectra were used to identify the biochemical structures of the bacterial cell wall. Two synthesis methods of the SERS-active nanomaterials were used and the recorded spectra were analyzed. L. casei and L. monocytogenes were successfully discriminated by applying Principal Component Analysis (PCA to their specific spectral data.
Detection, cloning and bioinformatics analysis of vip1/vip2 genes ...
African Journals Online (AJOL)
Bio-insecticides based on the spore forming bacterium, Bacillus thuringiensis (Bt) have been used for commercial scale for the past 40 years. Bt is a Gram-positive soil bacterium that forms insecticidal crystal proteins (ICPs) during sporulation; it has been characterized as an insect pathogen. Vegetative insecticidal protein ...
International Nuclear Information System (INIS)
Ozaki, T.; Ohnuki, T.; Kimura, T.; Francis, A.J.
2006-01-01
We studied the effect of ionic strength on the interactions of Europium(III) and Curium(III) with a Gram-negative bacterium Paracoccus denitrificans. Bacterial cells grown in 0.5-, 3.5-, and 5.0% NaCl were used in adsorption experiments and laser experiments that were performed at the same ionic strengths as those in the original growth media. The distribution ratio (log K d ) for Eu(III) and Cm(III) was determined at pHs 3-5. To elucidate the coordination environment of Eu(III) adsorbed on P. denitrificans, we estimated the number of water molecules in the inner sphere and strength of the ligand field by time-resolved laser-induced fluorescence spectroscopy (TRLFS) at pHs 4-6. The log K d of Eu(III) and Cm(III) increased with an increase of pH at all ionic strengths because there was less competition for ligands in cells with H + at higher pHs, wherein less H + was present in solution: cation adsorption generally occurs through an exchange with H + on the functional groups of coordination sites. No significant differences were observed in the log K d of Eu(III) and Cm(III) at each pH in 0.5-, 3.5-, and 5.0% NaCl solutions, though competition for ligands with Na + would be expected to increase at higher NaCl concentrations. The log K d of Eu(III) was almost equivalent to that of Cm(III) under all the experimental conditions. TRLFS showed that the coordination environments of Eu(III) did not differ from each other at 0.5-, 3.5-, and 5.0% NaCl at pHs 4-6. TRLFS also showed that the characteristic of the coordination environment of Eu(III) on P. denitrificans was similar to that on a halophile, Nesterenkonia halobia, while it significantly differed from that on a non-halophile, Pseudomonas putida. These findings indicate that the number of coordination sites for Eu(III) on P. denitrificans, whose cell surface may have similar structures to that of halophiles, increased with increasing ionic strength, though their structure remained unchanged. (orig.)
Santos, Edilene dos; Pereira, Mara; Silva, Camilla da; Souza-Neta, Lourdes; Geris, Regina; Martins, Dirceu; Santana, Antônio; Barbosa, Luiz; Silva, Herymá; Freitas, Giovana; Figueiredo, Mauro; Oliveira, Fernando de; Batista, Ronan
2013-01-01
The purpose of this study was to assess the in vitro antimicrobial activity of alkaloid-enriched extracts from Prosopis juliflora (Fabaceae) pods in order to evaluate them as feed additives for ruminants. As only the basic chloroformic extract (BCE), whose main constituents were juliprosopine (juliflorine), prosoflorine and juliprosine, showed Gram-positive antibacterial activity against Micrococcus luteus (MIC = 25 μg/mL), Staphylococcus aureus (MIC = 50 μg/mL) and Streptococcus mutans (MIC ...
Directory of Open Access Journals (Sweden)
Sana Zahoor
Full Text Available ABSTRACT A thermophilic bacterium (TP-2 was isolated from the Tatta Pani hot spring in Azad Kashmir and was characterized using phenotypic and genotypic characters. The strain developed cream colored, round, smooth, flat and slimy colonies while the cells were Gram positive rods that ranged in size from about 2.1-3.6 μm to 0.2-0.3 μm in width. Sequence analysis of its 16S rRNA gene showed that isolate TP-2 had 89% homology with Geobacillus debilis. It grew within pH range of 5.5 to 8.5 with optimum growth at pH 7.0. The isolate showed optimum growth at 65ºC and gave positive results for gelatin hydrolysis (GEL, ortho nitrophenyl-β-D-galactopyranosidase (ONPG, and nitrate production and produced acid from sucrose, glucose and maltose. It utilized glucose, fructose, maltose, lactose, sucrose, xylan, starch, filter paper and carboxymethylcellulose as sole carbon source. Isolate TP-2 produced significant amount of industrially important enzymes i.e. extracellular α-amylase, CMCase, FPase, Xylanase, Protease and Lipase and intracellular CMCase and FPase.
Directory of Open Access Journals (Sweden)
Sina Dobaradaran
2006-03-01
Full Text Available Aeromonas is one the gram – negative , non spor – formating rod shaping , facultatively anaerobic and opportunistic bactria that can cause systematic infections, leision and diarrhoea in human. Fairly high bactrial population in distribution system is not only of concern because of affecting consumer health but also it makes it difficult to enumerate coliform bacterium indicator. So, the relationships between aeromonas and heterotrophic bacteria growth with pH, temperature, turbidity, free residual cholornie and DO were determined in this study. ADA- V media was used in presumptive stage to count aeromonas bacteria for the first time in Iran on the basis of 1605 EPA (2001 method and used oxidase tests, trehalose fermentation and indol test in confirmative stage. R2A media was used to count HPC bacteria and other factors measured on the basis of standards. The results showed that positive cases of aeromonas bacteria and HPC increase in higher temperature and turbidity and lower pH. In contrast, positive cases of aeromonas bacteria and HPC decrease while free residual cholorine and DO increase. In addition,no positive case of aeromonas was observed in more than 0.2 mg/L concentration of free residual cholorine.
Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F
2015-08-10
Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.
Effects of agitation speed, temperature, carbon and nitrogen sources ...
African Journals Online (AJOL)
Lactococcus lactis is a Gram-positive bacterium widely used in the production of buttermilk and cheese. Recently, the bacterium becomes famous as the genetically modified organism can be used alive for the treatment of disease. In this study, different cultural conditions based on agitation speed and temperature on the ...
Potential strategies for the eradication of multidrug-resistant Gram-negative bacterial infections.
Huwaitat, Rawan; McCloskey, Alice P; Gilmore, Brendan F; Laverty, Garry
2016-07-01
Antimicrobial resistance is one of the leading threats to society. The increasing burden of multidrug-resistant Gram-negative infection is particularly concerning as such bacteria are demonstrating resistance to nearly all currently licensed therapies. Various strategies have been hypothesized to treat multidrug-resistant Gram-negative infections including: targeting the Gram-negative outer membrane; neutralization of lipopolysaccharide; inhibition of bacterial efflux pumps and prevention of protein folding. Silver and silver nanoparticles, fusogenic liposomes and nanotubes are potential strategies for extending the activity of licensed, Gram-positive selective, antibiotics to Gram-negatives. This may serve as a strategy to fill the current void in pharmaceutical development in the short term. This review outlines the most promising strategies that could be implemented to solve the threat of multidrug-resistant Gram-negative infections.
A product of heme catabolism modulates bacterial function and survival.
Directory of Open Access Journals (Sweden)
Christopher L Nobles
Full Text Available Bilirubin is the terminal metabolite in heme catabolism in mammals. After deposition into bile, bilirubin is released in large quantities into the mammalian gastrointestinal (GI tract. We hypothesized that intestinal bilirubin may modulate the function of enteric bacteria. To test this hypothesis, we investigated the effect of bilirubin on two enteric pathogens; enterohemorrhagic E. coli (EHEC, a Gram-negative that causes life-threatening intestinal infections, and E. faecalis, a Gram-positive human commensal bacterium known to be an opportunistic pathogen with broad-spectrum antibiotic resistance. We demonstrate that bilirubin can protect EHEC from exogenous and host-generated reactive oxygen species (ROS through the absorption of free radicals. In contrast, E. faecalis was highly susceptible to bilirubin, which causes significant membrane disruption and uncoupling of respiratory metabolism in this bacterium. Interestingly, similar results were observed for other Gram-positive bacteria, including B. cereus and S. aureus. A model is proposed whereby bilirubin places distinct selective pressure on enteric bacteria, with Gram-negative bacteria being protected from ROS (positive outcome and Gram-positive bacteria being susceptible to membrane disruption (negative outcome. This work suggests bilirubin has differential but biologically relevant effects on bacteria and justifies additional efforts to determine the role of this neglected waste catabolite in disease processes, including animal models.
Bacterial flora of spices and its control by gamma irradiation
International Nuclear Information System (INIS)
El-Zawahry, Y.A.; Youssef, Y.A.; Awny, N.M.; Hussein, H.A.
1985-01-01
The bacterial contamination was tested in 26 samples of spices. Chili, allspice and paprika were the most contaminated spices by bacteria. Five bacterial genera were isolated, namely bacillus, staphylococcus, streptococcus, micrococcus, and coccobacillus, all being gram-positive. Most isolates have been related to the genus bacillus. The bacterial isolates were identified as B. alvei, B. circulans, B. megaterium, B. pasteurii, B. pumilus, B. thuringiensis, B. sphaericus, B. incertaesedis, Micrococcus luteus, staphylococcus aureus, streptococcus sp. and coccobacillus sp. Irradiation of spices led to a significant decrease in the bacterial count of all samples. The dose required to inhibit completely the natural bacterial flora was 25 KGY. The most radioresistant isolates were staphylococcus aureus and micrococcus luteus which were subjected to sublethal doses of 15 and 20 KGY respectively. The dose response curves of the 2 most radioresistant isolates showed simple exponential relationship. The D 10-value of S. aureus and M. luteus were 0.9 and 1.1 KGY, respectively. The effect of storage period on the bacterial load of, as well as, the antibacterial activity of the tested spices were investigated. (author)
Bacterial flora of spices and its control by gamma irradiation
Energy Technology Data Exchange (ETDEWEB)
El-Zawahry, Y A; Youssef, Y A; Awny, N M; Hussein, H A
1985-01-01
The bacterial contamination was tested in 26 samples of spices. Chili, allspice and paprika were the most contaminated spices by bacteria. Five bacterial genera were isolated, namely bacillus, staphylococcus, streptococcus, micrococcus, and coccobacillus, all being gram-positive. Most isolates have been related to the genus bacillus. The bacterial isolates were identified as B. alvei, B. circulans, B. megaterium, B. pasteurii, B. pumilus, B. thuringiensis, B. sphaericus, B. incertaesedis, Micrococcus luteus, staphylococcus aureus, streptococcus sp. and coccobacillus sp. Irradiation of spices led to a significant decrease in the bacterial count of all samples. The dose required to inhibit completely the natural bacterial flora was 25 KGY. The most radioresistant isolates were staphylococcus aureus and micrococcus luteus which were subjected to sublethal doses of 15 and 20 KGY respectively. The dose response curves of the 2 most radioresistant isolates showed simple exponential relationship. The D 10-value of S. aureus and M. luteus were 0.9 and 1.1 KGY, respectively. The effect of storage period on the bacterial load of, as well as, the antibacterial activity of the tested spices were investigated.
Atsukawa, Yoshiko; Kawakami, Sayoko; Asahara, Miwa; Ishigaki, Shinobu; Tanaka, Takashi; Ono, Yasuo; Nishiya, Hajime; Fujisaki, Ryuichi; Koga, Ichiro; Ota, Yasuo; Miyazawa, Yukihisa
2011-08-01
Gram staining is a useful technique for detecting bacteria but is highly questionable in detecting Mycobacterium tuberculosis. Its detection generally requires special staining, such as Ziehl-Neelsen staining. We experienced three cases in which tuberculosis was first suggested by Gram staining of sputum or pus, confirmed by Ziehl-Neelsen staining, and diagnosed by polymerase chain reaction or culture. To find colorless tubercle bacilli in clinical samples with various organisms, varying the focus to slightly longer and shorter during study of the slides is indispensable. We present criteria for detecting infective pulmonary tuberculosis in Gram staining. First, in the ordinary focus, weakly stained, thin, gram-positive bacilli are found; second, with a slightly longer focus distance, the thin, cord-like, conspicuous gram-positive bacilli can be observed; and third, with a shorter focus distance, the gram-positive bacilli have changed into the brightened, colorless, or ghost ones. Four laboratory technologists each evaluated 20 Gram-stained samples after being lectured on the criteria, with no prior information about the sample. They accurately evaluated the presence of the bacilli in Gram-stained preparations in more than 90% of samples containing 3+ bacilli on Ziehl-Neelsen staining. Gram staining is available as an easy and rapid initial clue to recognize highly infective tuberculosis.
Differential activity of a lectin from Solieria filiformis against human pathogenic bacteria
Directory of Open Access Journals (Sweden)
M.L. Holanda
2005-12-01
Full Text Available A lectin isolated from the red alga Solieria filiformis was evaluated for its effect on the growth of 8 gram-negative and 3 gram-positive bacteria cultivated in liquid medium (three independent experiments/bacterium. The lectin (500 µg/mL stimulated the growth of the gram-positive species Bacillus cereus and inhibited the growth of the gram-negative species Serratia marcescens, Salmonella typhi, Klebsiella pneumoniae, Enterobacter aerogenes, Proteus sp, and Pseudomonas aeruginosa at 1000 µg/mL but the lectin (10-1000 µg/mL had no effect on the growth of the gram-positive bacteria Staphylococcus aureus and B. subtilis, or on the gram-negative bacteria Escherichia coli and Salmonella typhimurium. The purified lectin significantly reduced the cell density of gram-negative bacteria, although no changes in growth phases (log, exponential and of decline were observed. It is possible that the interaction of S. filiformis lectin with the cell surface receptors of gram-negative bacteria promotes alterations in the flow of nutrients, which would explain the bacteriostatic effect. Growth stimulation of the gram-positive bacterium B. cereus was more marked in the presence of the lectin at a concentration of 1000 µg/mL. The stimulation of the growth of B. cereus was not observed when the lectin was previously incubated with mannan (125 µg/mL, its hapten. Thus, we suggest the involvement of the binding site of the lectin in this effect. The present study reports the first data on the inhibition and stimulation of pathogenic bacterial cells by marine alga lectins.
Directory of Open Access Journals (Sweden)
David Sychantha
2017-10-01
Full Text Available The O-acetylation of the essential cell wall polymer peptidoglycan occurs in most Gram-positive bacterial pathogens, including species of Staphylococcus, Streptococcus and Enterococcus. This modification to peptidoglycan protects these pathogens from the lytic action of the lysozymes of innate immunity systems and, as such, is recognized as a virulence factor. The key enzyme involved, peptidoglycan O-acetyltransferase A (OatA represents a particular challenge to biochemical study since it is a membrane associated protein whose substrate is the insoluble peptidoglycan cell wall polymer. OatA is predicted to be bimodular, being comprised of an N-terminal integral membrane domain linked to a C-terminal extracytoplasmic domain. We present herein the first biochemical and kinetic characterization of the C-terminal catalytic domain of OatA from two important human pathogens, Staphylococcus aureus and Streptococcus pneumoniae. Using both pseudosubstrates and novel biosynthetically-prepared peptidoglycan polymers, we characterized distinct substrate specificities for the two enzymes. In addition, the high resolution crystal structure of the C-terminal domain reveals an SGNH/GDSL-like hydrolase fold with a catalytic triad of amino acids but with a non-canonical oxyanion hole structure. Site-specific replacements confirmed the identity of the catalytic and oxyanion hole residues. A model is presented for the O-acetylation of peptidoglycan whereby the translocation of acetyl groups from a cytoplasmic source across the cytoplasmic membrane is catalyzed by the N-terminal domain of OatA for their transfer to peptidoglycan by its C-terminal domain. This study on the structure-function relationship of OatA provides a molecular and mechanistic understanding of this bacterial resistance mechanism opening the prospect for novel chemotherapeutic exploration to enhance innate immunity protection against Gram-positive pathogens.
Directory of Open Access Journals (Sweden)
Rajinder S Mann
Full Text Available Candidatus Liberibacter asiaticus is a fastidious, phloem-inhabiting, gram-negative bacterium transmitted by Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae. The bacterium is the presumed causal agent of huanglongbing (HLB, one of the most destructive and economically important diseases of citrus. We investigated whether Las is transmitted between infected and uninfected D. citri adults during courtship. Our results indicate that Las was sexually transmitted from Las-infected male D. citri to uninfected females at a low rate (<4% during mating. Sexual transmission was not observed following mating of infected females and uninfected males or among adult pairs of the same sex. Las was detected in genitalia of both sexes and also in eggs of infected females. A latent period of 7 days or more was required to detect the bacterium in recipient females. Rod shaped as well as spherical structures resembling Las were observed in ovaries of Las-infected females with transmission electron microscopy, but were absent in ovaries from uninfected D. citri females. The size of the rod shaped structures varied from 0.39 to 0.67 µm in length and 0.19 to 0.39 µm in width. The spherical structures measured from 0.61 to 0.80 µm in diameter. This investigation provides convincing evidence that a plant pathogenic bacterium is sexually transmitted from male to female insects during courtship and established evidence that bacteria persist in reproductive organs. Moreover, these findings provide an alternative sexually horizontal mechanism for the spread of Las within populations of D. citri, even in the absence of infected host trees.
Review: Gp-340/DMBT1 in mucosal innate immunity
DEFF Research Database (Denmark)
Madsen, Jens; Mollenhauer, Jan; Holmskov, Uffe
2010-01-01
) is secreted into broncho-alveolar surface lining fluid whereas DMBT(SAG) is present in the saliva. The two molecules were shown to be identical and both interact with and agglutinate several Gram-negative and Gram-positive bacteria including Streptococcus mutans, a bacterium responsible for caries in the oral...
Response of membrane-bound ATPase of Micrococcus luteus to heat and ultraviolet light
International Nuclear Information System (INIS)
Volotovskij, J.; Risi, S.; Dose, K.
1976-01-01
It is shown that the properties of ATPase (EC 3.6.1.3) of Micrococcus luteus depend only to some extent on the state of the membrane to which it is attached. Its interaction with the membrane appears to be largely controlled by polar forces. It is shown, however, that the UV-sensitivity of the membrane-bound ATPase is also significantly influenced by the state of membrane lipids. (orig.) [de
Response of membrane-bound ATPase of Micrococcus luteus to heat and ultraviolet light
Energy Technology Data Exchange (ETDEWEB)
Volotovskii, J; Risi, S; Dose, K [Mainz Univ. (F.R. Germany). Inst. fuer Biochemie
1976-03-01
It is shown that the properties of ATPase (EC 3.6.1.3) of Micrococcus luteus depend only to some extent on the state of the membrane to which it is attached. Its interaction with the membrane appears to be largely controlled by polar forces. It is shown, however, that the UV-sensitivity of the membrane-bound ATPase is also significantly influenced by the state of membrane lipids.
Gottesman, Tamar; Yossepowitch, Orit; Lerner, Evgenia; Schwartz-Harari, Orna; Soroksky, Arie; Yekutieli, Daniel; Dan, Michael
2014-10-01
To evaluate the Gram stain of deep tracheal aspirate as a tool to direct empiric antibiotic therapy, and more specifically as a tool to exclude the need for empiric antibiotic coverage against Staphylococcus aureus in ventilator-associated pneumonia (VAP). A prospective, single-center, observational, cohort study. All wards at a community hospital. Adult patients requiring mechanical ventilation, identified as having VAP in a 54-month prospective surveillance database. Sampling of lower airway secretions by deep endotracheal aspiration was taken from each patient who developed VAP. Samples were sent immediately for Gram stain and qualitative bacterial cultures. Demographic and relevant clinical data were collected; Gram stain, culture, and antibiotic susceptibility results were documented; and outcome was followed prospectively. The analysis included 114 consecutive patients with 115 episodes of VAP from June 2007 to January 2012. Sensitivity of Gram stain compared with culture was 90.47% for gram-positive cocci, 69.6% for gram-negative rods, and 50% for sterile cultures. Specificity was 82.5%, 77.8%, and 79%, respectively. Negative predictive value was high for gram-positive cocci (97%) and sterile cultures (96%) but low for gram-negative rods (20%). Acinetobacter baumanii (45%) and Pseudomonas aeruginosa (38 %) were the prevailing isolates. S aureus was found in 18.3% of the patients. Most isolates were multiresistant. Absence of gram-positive bacteria on Gram stain had a high negative predictive value. These data can be used to narrow the initial empiric antibiotic regimen and to avoid unnecessary exposure of patients to vancomycin and other antistaphyloccocal agents. Copyright © 2014 Elsevier Inc. All rights reserved.
1983-01-01
The synthetic polyether polyethylene glycol (PEG) with a molecular weight of 20,000 was anaerobically degraded in enrichment cultures inoculated with mud of limnic and marine origins. Three strains (Gra PEG 1, Gra PEG 2, and Ko PEG 2) of rod-shaped, gram-negative, nonsporeforming, strictly anaerobic bacteria were isolated in mineral medium with PEG as the sole source of carbon and energy. All strains degraded dimers, oligomers, and polymers of PEG up to a molecular weight of 20,000 completely...
[Comparison of the quick Gram stain method to the B&M modified and favor methods].
Osawa, Kayo; Kataoka, Nobumasa; Maruo, Toshio
2011-01-01
The Gram stain is an established method for bacterial identification, but the time needed to carry out this stain is 2-3 min. We attempted to shorten this time and stained a total of 70 clinical specimens isolated from using the Bartholomew & Mittwer (B&M) modified or Favor methods with a 3 s duration for washing and staining steps. Results were plotted and analyzed using a Hue Saturation Intensity (HSI) model. The range based on a plot of the two methods with the HSI model was presented as a reference interval. Our results indicated that 100% (35/35) of strains were Gram positive and 97.1% (34/35) were Gram negative for the quick B&M modified method. In the quick Favor method, 80.0% (28/35) were Gram positive and 68.6% (24/35) of strains were Gram negative. We propose that the quick B&M modified method is equivalent to the standard Gram staining method and is superior to the quick Favor method.
Briers, Yves; Lavigne, Rob
2015-01-01
The emergence and spread of antibiotic-resistant bacteria drives the search for novel classes of antibiotics to replenish our armamentarium against bacterial infections. This is particularly critical for Gram-negative pathogens, which are intrinsically resistant to many existing classes of antibiotics due to the presence of a protective outer membrane. In addition, the antibiotics development pipeline is mainly oriented to Gram-positive pathogens such as methicillin-resistant Staphylococcus aureus. A promising novel class of antibacterials is endolysins. These enzymes encoded by bacterial viruses hydrolyze the peptidoglycan layer with high efficiency, resulting in abrupt osmotic lysis and cell death. Their potential as novel antibacterials to treat Gram-positive bacteria has been extensively demonstrated; however, the Gram-negative outer membrane has presented a formidable barrier for the use of endolysins against Gram-negatives until recently. This review reports on the most recent advances in the development of endolysins to kill Gram-negative species with a special focus on endolysin-engineered Artilysins(®).
Silver enhances antibiotic activity against gram-negative bacteria.
Morones-Ramirez, J Ruben; Winkler, Jonathan A; Spina, Catherine S; Collins, James J
2013-06-19
A declining pipeline of clinically useful antibiotics has made it imperative to develop more effective antimicrobial therapies, particularly against difficult-to-treat Gram-negative pathogens. Silver has been used as an antimicrobial since antiquity, yet its mechanism of action remains unclear. We show that silver disrupts multiple bacterial cellular processes, including disulfide bond formation, metabolism, and iron homeostasis. These changes lead to increased production of reactive oxygen species and increased membrane permeability of Gram-negative bacteria that can potentiate the activity of a broad range of antibiotics against Gram-negative bacteria in different metabolic states, as well as restore antibiotic susceptibility to a resistant bacterial strain. We show both in vitro and in a mouse model of urinary tract infection that the ability of silver to induce oxidative stress can be harnessed to potentiate antibiotic activity. Additionally, we demonstrate in vitro and in two different mouse models of peritonitis that silver sensitizes Gram-negative bacteria to the Gram-positive-specific antibiotic vancomycin, thereby expanding the antibacterial spectrum of this drug. Finally, we used silver and antibiotic combinations in vitro to eradicate bacterial persister cells, and show both in vitro and in a mouse biofilm infection model that silver can enhance antibacterial action against bacteria that produce biofilms. This work shows that silver can be used to enhance the action of existing antibiotics against Gram-negative bacteria, thus strengthening the antibiotic arsenal for fighting bacterial infections.
NMSBA: Aken Technologies Final Report: Toxicity Testing of Liquidoff
Energy Technology Data Exchange (ETDEWEB)
Ruffing, Anne [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jensen, Travis [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Strickland, Lucas [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2015-02-01
To determine the effect of Liquidoff on bacteria, three bacterial strains were tested: Escherichia coli DH5α, Synechococcus sp. PCC 7002, and Synechococcus elongatus PCC 7942. E. coli DH5α is a Gram-negative, aerobic bacterium that is often found in normal gut flora and is commonly used the laboratory due to its fast growth rate. Synechococcus sp. PCC 7002 and S. elongatus PCC 7942 are Gram-negative, aquatic, autophototrophic cyanobacteria. Synechococcus sp. PCC 7002 is a marine cyanobacterium isolated from ‘fish pens’ on Magueyes Island, Puerto Rico in 1962, while S. elongatus PCC 7942 is a freshwater cyanobacterium. It should be noted that no Gram-positive bacterium was tested in this study.
Directory of Open Access Journals (Sweden)
Li J
2016-11-01
Full Text Available Jiulong Li,1,* Qinghao Li,1,* Xiaoqiong Ma,2,* Bing Tian,1 Tao Li,1 Jiangliu Yu,1 Shang Dai,1 Yulan Weng,1 Yuejin Hua1 1Key Laboratory for Nuclear-Agricultural Sciences of Chinese Ministry of Agriculture and Zhejiang Province, Institute of Nuclear-Agricultural Sciences, Zhejiang University, 2Central Laboratory, The First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, China *These authors contributed equally to this work Abstract: Deinococcus radiodurans is an extreme bacterium known for its high resistance to stresses including radiation and oxidants. The ability of D. radiodurans to reduce Au(III and biosynthesize gold nanoparticles (AuNPs was investigated in aqueous solution by ultraviolet and visible (UV/Vis absorption spectroscopy, electron microscopy, X-ray diffraction (XRD, dynamic light scattering (DLS, Fourier transform infrared spectroscopy (FTIR and X-ray photoelectron spectroscopy (XPS. D. radiodurans efficiently synthesized AuNPs from 1 mM Au(III solution in 8 h. The AuNPs were of spherical, triangular and irregular shapes with an average size of 43.75 nm and a polydispersity index of 0.23 as measured by DLS. AuNPs were distributed in the cell envelope, across the cytosol and in the extracellular space. XRD analysis confirmed the crystallite nature of the AuNPs from the cell supernatant. Data from the FTIR and XPS showed that upon binding to proteins or compounds through interactions with carboxyl, amine, phospho and hydroxyl groups, Au(III may be reduced to Au(I, and further reduced to Au(0 with the capping groups to stabilize the AuNPs. Biosynthesis of AuNPs was optimized with respect to the initial concentration of gold salt, bacterial growth period, solution pH and temperature. The purified AuNPs exhibited significant antibacterial activity against both Gram-negative (Escherichia coli and Gram-positive (Staphylococcus aureus bacteria by damaging their cytoplasmic membrane. Therefore, the extreme
Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1.
Mulla, Sikandar I; Talwar, Manjunatha P; Bagewadi, Zabin K; Hoskeri, Robertcyril S; Ninnekar, Harichandra Z
2013-02-01
Nitrotoluenes are the toxic pollutants of the environment because of their large scale use in the production of explosives. Biodegradation of such chemicals by microorganisms may provide an effective method for their detoxification. We have studied the degradation of 2-nitrotoluene by cells of Micrococcus sp. strain SMN-1 immobilized in various matrices such as polyurethane foam (PUF), sodium alginate (SA), sodium alginate-polyvinyl alcohol (SA-PVA), agar and polyacrylamide. The rate of degradation of 15 and 30 mM 2-nitrotoluene by freely suspended cells and immobilized cells in batches and fed-batch with shaken cultures were compared. The PUF-immobilized cells achieved higher degradation of 15 and 30 mM 2-nitrotoluene than freely suspended cells and the cells immobilized in SA-PVA, polyacrylamide, SA and agar. The PUF-immobilized cells could be reused more than 24 cycles without loosing their degradation capacity and showed more tolerance to pH and temperature changes than freely suspended cells. These results revealed the enhanced rate of degradation of 2-nitrotoluene by PUF-immobilized cells of Micrococcus sp. strain SMN-1. Copyright © 2012 Elsevier Ltd. All rights reserved.
Marcos, Miguel; Soriano, Alex; Iñurrieta, Amaia; Martínez, José A; Romero, Alberto; Cobos, Nazaret; Hernández, Cristina; Almela, Manel; Marco, Francesc; Mensa, Josep
2011-09-01
Gram-positive microorganisms have been the predominant pathogens in central venous catheter-related bloodstream infections (CRBSIs). Recent guidelines recommend empirical therapy according to this and restrict coverage for Gram-negatives to specific circumstances. This study aimed to analyse the epidemiological changes in CRBSIs over the 1991-2008 period and to analyse predictors of Gram-negative CRBSIs. A prospectively collected cohort of patients with confirmed CRBSIs was analysed. Strains isolated and antimicrobial susceptibility, as well as clinical and demographic variables were recorded. Differences observed during the study period were analysed by means of a χ² trend test and factors associated with Gram-negative CRBSIs by means of multivariable analysis. Between 1991 and 2008, 1129 episodes of monomicrobial CRBSIs were recorded. There was an increase in the incidence of CRBSIs, from 0.10 (1991-92) to 0.31 (2007-08) episodes/1000 patient-days. A significant increase in the number of Gram-negative strains among the total isolates was also found, from 3 (4.7%) in 1991-92 to 70 (40.23%) in 2007-08, with a parallel decrease in the percentage of Gram-positives. Solid organ transplantation, prior use of penicillins and hospital stay longer than 11 days were independently associated with a significantly higher risk of Gram-negative CRBSIs, while cirrhosis, diabetes and use of quinolones were associated with a higher risk of Gram-positives. Gram-negative strains are an increasing cause of CRBSIs, reaching a prevalence of 40% in the 2007-08 period in our hospital. If this trend is confirmed in other centres, a broad-spectrum empirical therapy should be considered in managing these infections.
Lemaître, Nadine; Liang, Xiaofei; Najeeb, Javaria; Lee, Chul-Jin; Titecat, Marie; Leteurtre, Emmanuelle; Simonet, Michel; Toone, Eric J; Zhou, Pei; Sebbane, Florent
2017-07-25
The infectious diseases caused by multidrug-resistant bacteria pose serious threats to humankind. It has been suggested that an antibiotic targeting LpxC of the lipid A biosynthetic pathway in Gram-negative bacteria is a promising strategy for curing Gram-negative bacterial infections. However, experimental proof of this concept is lacking. Here, we describe our discovery and characterization of a biphenylacetylene-based inhibitor of LpxC, an essential enzyme in the biosynthesis of the lipid A component of the outer membrane of Gram-negative bacteria. The compound LPC-069 has no known adverse effects in mice and is effective in vitro against a broad panel of Gram-negative clinical isolates, including several multiresistant and extremely drug-resistant strains involved in nosocomial infections. Furthermore, LPC-069 is curative in a murine model of one of the most severe human diseases, bubonic plague, which is caused by the Gram-negative bacterium Yersinia pestis Our results demonstrate the safety and efficacy of LpxC inhibitors as a new class of antibiotic against fatal infections caused by extremely virulent pathogens. The present findings also highlight the potential of LpxC inhibitors for clinical development as therapeutics for infections caused by multidrug-resistant bacteria. IMPORTANCE The rapid spread of antimicrobial resistance among Gram-negative bacilli highlights the urgent need for new antibiotics. Here, we describe a new class of antibiotics lacking cross-resistance with conventional antibiotics. The compounds inhibit LpxC, a key enzyme in the lipid A biosynthetic pathway in Gram-negative bacteria, and are active in vitro against a broad panel of clinical isolates of Gram-negative bacilli involved in nosocomial and community infections. The present study also constitutes the first demonstration of the curative treatment of bubonic plague by a novel, broad-spectrum antibiotic targeting LpxC. Hence, the data highlight the therapeutic potential of Lpx
Energy Technology Data Exchange (ETDEWEB)
Lemaître, Nadine; Liang, Xiaofei; Najeeb, Javaria; Lee, Chul-Jin; Titecat, Marie; Leteurtre, Emmanuelle; Simonet, Michel; Toone, Eric J.; Zhou, Pei; Sebbane, Florent; Nacy, Carol A.
2017-07-25
The infectious diseases caused by multidrug-resistant bacteria pose serious threats to humankind. It has been suggested that an antibiotic targeting LpxC of the lipid A biosynthetic pathway in Gram-negative bacteria is a promising strategy for curing Gram-negative bacterial infections. However, experimental proof of this concept is lacking. Here, we describe our discovery and characterization of a biphenylacetylene-based inhibitor of LpxC, an essential enzyme in the biosynthesis of the lipid A component of the outer membrane of Gram-negative bacteria. The compound LPC-069 has no known adverse effects in mice and is effective
Ramirez, Maria S; Traglia, German M; Lin, David L; Tran, Tung; Tolmasky, Marcelo E
Plasmids harbor genes coding for specific functions including virulence factors and antibiotic resistance that permit bacteria to survive the hostile environment found in the host and resist treatment. Together with other genetic elements such as integrons and transposons, and using a variety of mechanisms, plasmids participate in the dissemination of these traits resulting in the virtual elimination of barriers among different kinds of bacteria. In this article we review the current information about physiology and role in virulence and antibiotic resistance of plasmids from the gram-negative opportunistic pathogen Klebsiella pneumoniae . This bacterium has acquired multidrug resistance and is the causative agent of serious communityand hospital-acquired infections. It is also included in the recently defined ESKAPE group of bacteria that cause most of US hospital infections.
Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel
2014-01-01
Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.
Liang, Fang; Browne, Daniel J; Gray, Megan J; Gartlan, Kate H; Smith, David D; Barnard, Ross T; Hill, Geoffrey R; Corrie, Simon R; Markey, Kate A
2018-05-11
Bloodstream infection is a significant clinical problem, particularly in vulnerable patient groups such as those undergoing chemotherapy and bone marrow transplantation. Clinical diagnostics for suspected bloodstream infection remain centered around blood culture (highly variable timing, in the order of hours to days to become positive), and empiric use of broad-spectrum antibiotics is therefore employed for patients presenting with febrile neutropenia. Gram-typing provides the first opportunity to target therapy (e.g., combinations containing vancomycin or teicoplanin for Gram-positives; piperacillin-tazobactam or a carbapenem for Gram-negatives); however, current approaches require blood culture. In this study, we describe a multiplexed microsphere-PCR assay with flow cytometry readout, which can distinguish Gram-positive from Gram-negative bacterial DNA in a 3.5 h time period. The combination of a simple assay design (amplicon-dependent release of Gram-type specific Cy3-labeled oligonucleotides) and the Luminex-based readout (for quantifying each specific Cy3-labeled sequence) opens opportunities for further multiplexing. We demonstrate the feasibility of detecting common Gram-positive and Gram-negative organisms after spiking whole bacteria into healthy human blood prior to DNA extraction. Further development of DNA extraction methods is required to reach detection limits comparable to blood culture.
Bacillus tamaricis sp. nov., an alkaliphilic bacterium isolated from a Tamarix cone soil.
Zhang, Yong-Guang; Zhou, Xing-Kui; Guo, Jian-Wei; Xiao, Min; Wang, Hong-Fei; Wang, Yun; Bobodzhanova, Khursheda; Li, Wen-Jun
2018-02-01
A Gram-stain-positive, alkaliphilic bacterium, designated EGI 80668 T , was isolated from a Tamarix cone soil in Xinjiang, north-west China. Cells were facultatively anaerobic, terminal endospore-forming and motile by means of peritrichous flagella. Colonies were yellowish and the cells showed oxidase-negative and catalase-positive reactions. Strain EGI 80668 T grew at pH 8.0-10.0 and with 0-10 % (w/v) NaCl (optimally at pH 9.0 and with 1-2 % NaCl) on marine agar 2216. The predominant menaquinone was MK-7. The major fatty acids were anteiso-C17 : 0 and anteiso-C15 : 0. The cellular polar lipids contained diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, four unknown phospholipids and one unknown aminophospholipid. The G+C content of the genomic DNA was 38.3 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain EGI 80668 T was affiliated to the genus Bacillus. The highest 16S rRNA gene sequence similarity between strain EGI 80668 T and a member of the genus Bacillus was 96.83 % with Bacillus cellulosilyticus JCM 9156 T . A polyphasic taxonomic study based on morphological, physiological, biochemical and phylogenetic data indicated that strain EGI 80668 T represents a novel species of the genus Bacillus, for which the name Bacillus tamaricis sp. nov. (type strain EGI 80668 T =KCTC 33703 T =CGMCC 1.15917 T ) is proposed.
Zhang, Jian; Oueslati, Rania; Cheng, Cheng; Zhao, Ling; Chen, Jiangang; Almeida, Raul; Wu, Jayne
2018-07-30
Gram-negative bacteria are one of the most common microorganisms in the environment. Their differential detection and recognition from Gram-positive bacteria has been attracting much attention over the years. Using Escherichia coli (E. coli) as a model, we demonstrated on-site detection of Gram-negative bacteria by an AC electrokinetics-based capacitive sensing method using commercial microelectrodes functionalized with an aptamer specific to lipopolysaccharides. Dielectrophoresis effect was utilized to enrich viable bacteria to the microelectrodes rapidly, achieving a detection limit of 10 2 cells/mL within a 30 s' response time. The sensor showed a negligible response to Staphylococcus aureus (S. aureus), a Gram-positive species. The developed sensor showed significant advantages in sensitivity, selectivity, cost, operation simplicity, and response time. Therefore, this sensing method has shown great application potential for environmental monitoring, food safety, and real-time diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
In-vitro Antimicrobial Activity of Roots of Rauwolfia serpentina L. Benth Kurz
Directory of Open Access Journals (Sweden)
Aniel K. OWK
2016-09-01
Full Text Available Microbial pathogens develop resistance to antibiotics after repeated administration during the treatment of infectious diseases. Therefore, it is necessary to find alternative antimicrobial drugs and the present trend is focused on medicinal plants. The hereby research work was carried out to investigate the antimicrobial activity of solvents as well as aqueous extracts of Rauwolfia serpentina roots. The extracts were tested against Bacillus subtilis, Enterococcus faecalis, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Proteus vulgaris, Staphylococcus aureus, Streptococcus pneumoniae, Aspergillus niger, Candida albicans and Saccharomyces cerevisiae by agar well diffusion method. It was observed that methanol extract showed the highest antimicrobial activity against multi drug resistance S. aureus at 100 mg/ml concentration, while S. aureus was the most susceptible bacterium to all extracts. However, E. faecalis, M. luteus and S. pneumoniae were also susceptible to the experimented solvents and extracts. On the other hand, K. pneumoniae was resistant against the solvent and aqueous extracts. The present study suggested that methanol extracts of R. serpentina roots would be helpful in treating diseases caused by human pathogenic bacteria and fungi. In particular, based on the results obtained in the current experiment, it can be recommended for the control of infectious Gram-positive bacteria.
Separation of DNA-dependent polymerate activities in Micrococcus radiodurans
International Nuclear Information System (INIS)
Kitayama, S.; Matsuyama, A.
1977-01-01
DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by γ-radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans
Separation of DNA-dependent polymerase activities in Micrococcus radiodurans
Energy Technology Data Exchange (ETDEWEB)
Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)
1977-03-02
DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.
Pseudomonas aestus sp. nov., a plant growth-promoting bacterium isolated from mangrove sediments.
Vasconcellos, Rafael L F; Santos, Suikinai Nobre; Zucchi, Tiago Domingues; Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Melo, Itamar Soares
2017-10-01
Strain CMAA 1215 T , a Gram-reaction-negative, aerobic, catalase positive, polarly flagellated, motile, rod-shaped (0.5-0.8 × 1.3-1.9 µm) bacterium, was isolated from mangrove sediments, Cananéia Island, Brazil. Analysis of the 16S rRNA gene sequences showed that strain CMAA 1215 T forms a distinct phyletic line within the Pseudomonas putida subclade, being closely related to P. plecoglossicida ATCC 700383 T , P. monteilii NBRC 103158 T , and P. taiwanensis BCRC 17751 T of sequence similarity of 98.86, 98.73, and 98.71%, respectively. Genomic comparisons of the strain CMAA 1215 T with its closest phylogenetic type strains using average nucleotide index (ANI) and DNA:DNA relatedness approaches revealed 84.3-85.3% and 56.0-63.0%, respectively. A multilocus sequence analysis (MLSA) performed concatenating 16S rRNA, gyrB and rpoB gene sequences from the novel species was related with Pseudomonas putida subcluster and formed a new phylogenetic lineage. The phenotypic, physiological, biochemical, and genetic characteristics support the assignment of CMAA 1215 T to the genus Pseudomonas, representing a novel species. The name Pseudomonas aestus sp.nov. is proposed, with CMAA 1215 T (=NRRL B-653100 T = CBMAI 1962 T ) as the type strain.
Synthesis of novel antimicrobial aryl himachalene derivatives from naturally occurring himachalenes
Chaudhary, Abha; Sood, Swati; Das, Pralay; Kaur, Pushpinder; Mahajan, Isha; Gulati, Arvind; Singh, Bikram
2014-01-01
Five new 2,9,9-trimethyl-6,7,8,9-tetrahydro-benzocyclohepten-5-ylidene-amine derivatives (16a-16e) were synthesized from α-dehydro-ar-himachalene (11) that was originally prepared from an isomeric mixture of α, β and γ himachalenes (10), the abundant sesquiterpenes of Cedrus deodara essential oil. In addition, different aryl himachalenes derivatives (9, 12, 14 and 15) were also formed from 11. The structures of the synthesized compounds were confirmed on the basis of their NMR, IR and mass spectral data. The prepared compounds were tested against a group of sixteen organisms including gram positive and gram negative bacterial and fungal strains. The introduction of a series of substituted imine groups into aryl himachalenes at 5th position (16a-16e) enhanced antimicrobial activity as compared to the aromatized derivatives (9, 12, 14 and 15) against gram-positive bacteria Bacillus subtilis, Micrococcus luteus and Staphylococcus aureus, and mycotoxigenic fungi Aspergillus parasiticus, A. ochraceous and A. sydowii. graphical Abstract, Figure 1(Fig. 1) PMID:26417335
Numerically Stable Evaluation of Moments of Random Gram Matrices With Applications
Elkhalil, Khalil; Kammoun, Abla; Al-Naffouri, Tareq Y.; Alouini, Mohamed-Slim
2017-01-01
This paper focuses on the computation of the positive moments of one-side correlated random Gram matrices. Closed-form expressions for the moments can be obtained easily, but numerical evaluation thereof is prone to numerical stability, especially in high-dimensional settings. This letter provides a numerically stable method that efficiently computes the positive moments in closed-form. The developed expressions are more accurate and can lead to higher accuracy levels when fed to moment based-approaches. As an application, we show how the obtained moments can be used to approximate the marginal distribution of the eigenvalues of random Gram matrices.
Numerically Stable Evaluation of Moments of Random Gram Matrices With Applications
Elkhalil, Khalil
2017-07-31
This paper focuses on the computation of the positive moments of one-side correlated random Gram matrices. Closed-form expressions for the moments can be obtained easily, but numerical evaluation thereof is prone to numerical stability, especially in high-dimensional settings. This letter provides a numerically stable method that efficiently computes the positive moments in closed-form. The developed expressions are more accurate and can lead to higher accuracy levels when fed to moment based-approaches. As an application, we show how the obtained moments can be used to approximate the marginal distribution of the eigenvalues of random Gram matrices.
Draft genome sequence of Therminicola potens strain JR
Energy Technology Data Exchange (ETDEWEB)
Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.; Agbo, P.; Hazen, T.C.; Coates, J.D.
2010-07-01
'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.
Comparative Study of Hydroalcoholic Extracts of Momordica charantia L. against Foodborne Pathogens
Rakholiya, Kalpna; Vaghela, P.; Rathod, T.; Chanda, Sumitra
2014-01-01
The antimicrobial effect of 24 different hydroalcoholic extracts (100, 75, 50 and 25% methanol and water) obtained from four parts (leaf+stem (aerial), peel, pulp and seed) of Momordica charantia L. were investigated against five Gram-positive, six Gram-negative and four fungal strains. The extraction was done by individual cold percolation method using hexane, different hydroalcoholic solvent (100, 75, 50 and 25% methanol) and water. The antimicrobial activity was done by agar well diffusion assay. The extracts, which showed >15 mm zone of inhibition, were further screened to determine minimum inhibitory concentration and minimum bactericidal concentration using a broth dilution method performed in 96-well microtitre plate. The extractive yield was highest in aqueous extracts of all the four parts closely followed by 25% methanol. Micrococcus flavus was the most susceptible Gram-positive bacteria and Pseudomonas testosteroni was the most susceptible Gram-negative bacteria. The highest antibacterial activity was shown by 100% methanol. The Gram-negative Pseudomonas spp. was more susceptible towards all the extracts than the Gram-positive bacteria or fungal strains investigated. One hundred percent and 50% methanol extracts of seed showed lowest minimum inhibitory concentration and minimum bactericidal concentration values, that is <39 and 625 μg/ml, respectively, against Pseudomonas pictorum. Therefore, these extracts would be of interest in the control of Pseudomonas spp. in food industry as well as used for therapeutic purposes. PMID:24843188
Mimoz, O; Karim, A; Mazoit, J X; Edouard, A; Leprince, S; Nordmann, P
2000-11-01
We evaluated prospectively the use of Gram staining of protected pulmonary specimens to allow the early diagnosis of ventilator-associated pneumonia (VAP), compared with the use of 60 bronchoscopic protected specimen brushes (PSB) and 126 blinded plugged telescopic catheters (PTC) obtained from 134 patients. Gram stains were from Cytospin slides; they were studied for the presence of microorganisms in 10 and 50 fields by two independent observers and classified according to their Gram stain morphology. Quantitative cultures were performed after serial dilution and plating on appropriate culture medium. A final diagnosis of VAP, based on a culture of > or = 10(3) c.f.u. ml-1, was established after 81 (44%) samplings. When 10 fields were analysed, a strong relationship was found between the presence of bacteria on Gram staining and the final diagnosis of VAP (for PSB and PTC respectively: sensitivity 74 and 81%, specificity 94 and 100%, positive predictive value 91 and 100%, negative predictive value 82 and 88%). The correlation was less when we compared the morphology of microorganisms observed on Gram staining with those of bacteria obtained from quantitative cultures (for PSB and PTC respectively: sensitivity 54 and 69%, specificity 86 and 89%, positive predictive value 72 and 78%, negative predictive value 74 and 84%). Increasing the number of fields read to 50 was associated with a slight decrease in specificity and positive predictive value of Gram staining, but with a small increase in its sensitivity and negative predictive value. The results obtained by the two observers were similar to each other for both numbers of fields analysed. Gram staining of protected pulmonary specimens performed on 10 fields predicted the presence of VAP and partially identified (using Gram stain morphology) the microorganisms growing at significant concentrations, and could help in the early choice of the treatment of VAP. Increasing the number of fields read or having the Gram
Tissot, F; Prod'hom, G; Manuel, O; Greub, G
2015-09-01
The impact of round-the-clock cerebrospinal fluid (CSF) Gram stain on overnight empirical therapy for suspected central nervous system (CNS) infections was investigated. All consecutive overnight CSF Gram stains between 2006 and 2011 were included. The impact of a positive or a negative test on empirical therapy was evaluated and compared to other clinical and biological indications based on institutional guidelines. Bacterial CNS infection was documented in 51/241 suspected cases. Overnight CSF Gram stain was positive in 24/51. Upon validation, there were two false-positive and one false-negative results. The sensitivity and specificity were 41 and 99 %, respectively. All patients but one had other indications for empirical therapy than Gram stain alone. Upon obtaining the Gram result, empirical therapy was modified in 7/24, including the addition of an appropriate agent (1), addition of unnecessary agents (3) and simplification of unnecessary combination therapy (3/11). Among 74 cases with a negative CSF Gram stain and without formal indication for empirical therapy, antibiotics were withheld in only 29. Round-the-clock CSF Gram stain had a low impact on overnight empirical therapy for suspected CNS infections and was associated with several misinterpretation errors. Clinicians showed little confidence in CSF direct examination for simplifying or withholding therapy before definite microbiological results.
Singh, Nina; Wagener, Marilyn M; Obman, Asia; Cacciarelli, Thomas V; de Vera, Michael E; Gayowski, Timothy
2004-07-01
During the 1990s, gram-positive bacteria emerged as major pathogens after liver transplantation. We sought to determine whether the pathogens associated with bacteremias in liver transplant recipients have changed. Patients included 233 liver transplant recipients transplanted between 1989 and 2003. The proportion of all infections due to bacteremias increased significantly over time (P gram-negatives increased from 25% in the period of 1989-1993 to 51.8% in 1998-03, that of gram-positive bacteria decreased from 75% in the period of 1989-93 to 48.2% in the period of 1998-2003. Methicillin-resistant Staphylococcus aureus (MRSA), Klebsiella pneumoniae, and Pseudomonas aeruginosa were the most frequent pathogens in bacteremic patients. The incidence of bacteremias due to MRSA and Pseudomonas aeruginosa has remained unchanged (P gram-negative bacteria, particularly Klebsiella pneumoniae has increased (P =.02). Klebsiella pneumoniae isolates in the current quartile were not clonally related. In conclusion, bacteremias as a proportion of all infections in liver transplant recipients have increased significantly over time, due in part to a decline in infections due to other major pathogens, e.g., fungi, primarily Candida species, and CMV. Gram-negative bacteria have emerged as predominant pathogens in bacteremic liver transplant recipients.
Duong, Hieu N.; Snasel, Vaclav
2016-01-01
We propose an efficient method for compressing Vietnamese text using n-gram dictionaries. It has a significant compression ratio in comparison with those of state-of-the-art methods on the same dataset. Given a text, first, the proposed method splits it into n-grams and then encodes them based on n-gram dictionaries. In the encoding phase, we use a sliding window with a size that ranges from bigram to five grams to obtain the best encoding stream. Each n-gram is encoded by two to four bytes accordingly based on its corresponding n-gram dictionary. We collected 2.5 GB text corpus from some Vietnamese news agencies to build n-gram dictionaries from unigram to five grams and achieve dictionaries with a size of 12 GB in total. In order to evaluate our method, we collected a testing set of 10 different text files with different sizes. The experimental results indicate that our method achieves compression ratio around 90% and outperforms state-of-the-art methods. PMID:27965708
Directory of Open Access Journals (Sweden)
Vu H. Nguyen
2016-01-01
Full Text Available We propose an efficient method for compressing Vietnamese text using n-gram dictionaries. It has a significant compression ratio in comparison with those of state-of-the-art methods on the same dataset. Given a text, first, the proposed method splits it into n-grams and then encodes them based on n-gram dictionaries. In the encoding phase, we use a sliding window with a size that ranges from bigram to five grams to obtain the best encoding stream. Each n-gram is encoded by two to four bytes accordingly based on its corresponding n-gram dictionary. We collected 2.5 GB text corpus from some Vietnamese news agencies to build n-gram dictionaries from unigram to five grams and achieve dictionaries with a size of 12 GB in total. In order to evaluate our method, we collected a testing set of 10 different text files with different sizes. The experimental results indicate that our method achieves compression ratio around 90% and outperforms state-of-the-art methods.
DEFF Research Database (Denmark)
Hansen, M. Trier
1982-01-01
The processing of damaged DNA was altered in a mitomycin C-sensitive mutant (mtcA) of Micrococcus radiodurans. Even though the mutant retained resistance to 254-nm UV radiation, it did not, in contrast to the wild-type strain, show any excessive DNA degradation or cell death when incubated...
Isolation and characterization of a new hydrogen-utilizing bacterium from the rumen.
Rieu-Lesme, F; Fonty, G; Doré, J
1995-01-01
A new H2/CO2-utilizing acetogenic bacterium was isolated from the rumen of a mature deer. This is the first report of a spore-forming Gram-negative bacterial species from the rumen. The organism was a strictly anaerobic, motile rod and was able to grow autotrophically on hydrogen and carbon dioxide. Acetate was the major product detected. Glucose, fructose and lactate were also fermented heterotrophically. The optimum pH for growth was 7.0-7.5, and the optimum temperature was 37-42 degrees C. Yeast extract was required for growth and rumen fluid was highly stimulatory. The DNA base ratio was 52.9 +/- 0.5 mol% G+C. On the basis of these characteristics and fermentation products, the isolate was considered to be different from acetogenic bacteria described previously.
The growth of Micrococcus varians by utilizing sugar cane blackstrap molasses as substrate
Directory of Open Access Journals (Sweden)
Miranda Luís A. S.
1999-01-01
Full Text Available Comparative studies on the growth of Micrococcus varians were carried out in BHI culture medium (control as well as in a culture medium with 2% diluted sugar cane blackstrap molasses, enriched with 0.1% yeast extract. The experiment was conducted with three samples of the experimental and control media in a 5 liter fermentor with working volume of 3.5 liters, continuous agitation (150 rpm, 35 ± 0.1°C temperature, 0.7 L air. l-1 medium. min -1, initial pH 7.0 ± 0.2, 24 hour fermentation period, and approximate inoculum of 6.0 log10 CFU/ml. Samples were collected at 2-hour intervals. Micrococcus varians grew in the two culture media studied, which confirms the experimental medium viability for the growth of this species. The final average concentration of biomass was higher in the control medium than in the experimental medium: 0.99 g.l-1 and 0.78 g.l-1, respectively. The final number of viable cells at the end of fermentation was 20.65 log10 CFU/ml for the control medium (BHI, while in the experimental medium the number of viable cells was 19.43 log10 CFU/ml. The consumption of total sugars was higher for the biomass in the control medium (79.78%, while only 50.53% was consumed for the experimental medium.
Seck, E H; Diop, A; Armstrong, N; Delerce, J; Fournier, P-E; Raoult, D; Khelaifia, S
2018-05-01
Bacillus salis strain ES3 T (= CSUR P1478 = DSM 100598) is the type strain of B. salis sp. nov. It is an aerobic, Gram-positive, moderately halophilic, motile and spore-forming bacterium. It was isolated from commercial table salt as part of a broad culturomics study aiming to maximize the culture conditions for the in-depth exploration of halophilic bacteria in salty food. Here we describe the phenotypic characteristics of this isolate, its complete genome sequence and annotation, together with a comparison with closely related bacteria. Phylogenetic analysis based on 16S rRNA gene sequences indicated 97.5% similarity with Bacillus aquimaris, the closest species. The 8 329 771 bp long genome (one chromosome, no plasmids) exhibits a G+C content of 39.19%. It is composed of 18 scaffolds with 29 contigs. Of the 8303 predicted genes, 8109 were protein-coding genes and 194 were RNAs. A total of 5778 genes (71.25%) were assigned a putative function.
Hydrogenomics of the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus
Werken, van de H.J.G.; Verhaart, M.R.A.; Vanfossen, A.L.; Willquist, K.; Lewis, D.L.; Nichols, J.D.; Goorissen, H.P.; Mongodin, E.F.; Nelson, K.E.; Niel, van E.W.J.; Stams, A.J.M.; Ward, D.E.; Vos, de W.M.; Oost, van der J.; Kelly, R.M.; Kengen, S.W.M.
2008-01-01
Caldicellulosiruptor saccharolyticus is an extremely thermophilic, gram-positive anaerobe which ferments cellulose-, hemicellulose- and pectin-containing biomass to acetate, CO(2), and hydrogen. Its broad substrate range, high hydrogen-producing capacity, and ability to coutilize glucose and xylose
Lakhal, Raja; Pradel, Nathalie; Postec, Anne; Ollivier, Bernard; Cayol, Jean-Luc; Godfroy, Anne; Fardeau, Marie-Laure; Galés, Grégoire
2015-09-01
A novel, anaerobic, chemo-organotrophic bacterium, designated strain Ra1766H(T), was isolated from sediments of the Guaymas basin (Gulf of California, Mexico) taken from a depth of 2002 m. Cells were thin, motile, Gram-stain-positive, flexible rods forming terminal endospores. Strain Ra1766H(T) grew at temperatures of 25-45 °C (optimum 30 °C), pH 6.7-8.1 (optimum 7.5) and in a salinity of 5-60 g l(-1) NaCl (optimum 30 g l(-1)). It was an obligate heterotrophic bacterium fermenting carbohydrates (glucose and mannose) and organic acids (pyruvate and succinate). Casamino acids and amino acids (glutamate, aspartate and glycine) were also fermented. The main end products from glucose fermentation were acetate, butyrate, ethanol, H2 and CO2. Sulfate, sulfite, thiosulfate, elemental sulfur, fumarate, nitrate, nitrite and Fe(III) were not used as terminal electron acceptors. The predominant cellular fatty acids were C14 : 0, C16 : 1ω7, C16 : 1ω7 DMA and C16 : 0. The main polar lipids consisted of phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine and phospholipids. The G+C content of the genomic DNA was 33.7 mol%. Phylogenetic analysis of the 16S rRNA gene sequence indicated that strain Ra1766H(T) was affiliated to cluster XI of the order Clostridiales, phylum Firmicutes. The closest phylogenetic relative of Ra1766H(T) was Geosporobacter subterraneus (94.2% 16S rRNA gene sequence similarity). On the basis of phylogenetic inference and phenotypic properties, strain Ra1766H(T) ( = DSM 27501(T) = JCM 19377(T)) is proposed to be the type strain of a novel species of a novel genus, named Crassaminicella profunda.
Liu, Xiaoyan; Min, Yong; Huang, Daye; Zhou, Ronghua; Fang, Wei; Liu, Cuijun; Rao, Ben; Zhang, Guangyang; Wang, Kaimei; Yang, Ziwen
2017-11-30
Bacillus vallismortis NBIF-001, a Gram-positive bacterium, was isolated from soil in Shangri-La, China. Here, we provide the complete genome sequence of this bacterium, which has a 3,929,787-bp-long genome, including 4,030 protein-coding genes and 195 RNA genes. This strain possesses a number of genes encoding virulence factors of pathogens. Copyright © 2017 Liu et al.
A probiotic bacterium, Pediococcus pentosaceus OZF, isolated from ...
African Journals Online (AJOL)
Pediococcus pentosaceus OZF, originally isolated from healthy human breast milk, produces antimicrobial activities against many gram-positive bacterial species, including the food borne pathogen, Listeria monocytogenes. A bacteriocin was purified to homogeneity from the supernatant of exponentially growing cells using ...
Chemaly, Roy F; Hall, Gerri S; Keys, Thomas F; Procop, Gary W
2003-08-01
Although rare, pyogenic liver abscesses are potentially fatal. We evaluated the predictive value of Gram stain of liver abscess aspirates and temporally associated blood cultures. Gram stains detected bacteria in 79% of the liver abscesses tested. The sensitivity and specificity of Gram stain of the liver abscesses were 90% and 100% for Gram-positive cocci (GPC) and 52% and 94% for Gram-negative bacilli (GNB). The sensitivities of the blood cultures for any GPC and GNB present in the liver abscess were 30% and 39%, respectively. Although, Gram stains and blood cultures offer incomplete detection of the microbial contents of pyogenic liver abscesses, both tests should always accompany liver abscess cultures.
Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan
2015-01-01
Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.
Will new antimicrobials overcome resistance among Gram-negatives?
Bassetti, Matteo; Ginocchio, Francesca; Mikulska, Małgorzata; Taramasso, Lucia; Giacobbe, Daniele Roberto
2011-10-01
The spread of resistance among Gram-positive and Gram-negative bacteria represents a growing challenge for the development of new antimicrobials. The pace of antibiotic drug development has slowed during the last decade and, especially for Gram-negatives, clinicians are facing a dramatic shortage in the availability of therapeutic options to face the emergency of the resistance problem throughout the world. In this alarming scenario, although there is a shortage of compounds reaching the market in the near future, antibiotic discovery remains one of the keys to successfully stem and maybe overcome the tide of resistance. Analogs of already known compounds and new agents belonging to completely new classes of antimicrobials are in early stages of development. Novel and promising anti-Gram-negative antimicrobials belong both to old (cephalosporins, carbapenems, β-lactamase inhibitors, monobactams, aminoglycosides, polymyxin analogues and tetracycline) and completely new antibacterial classes (boron-containing antibacterial protein synthesis inhibitors, bis-indoles, outer membrane synthesis inhibitors, antibiotics targeting novel sites of the 50S ribosomal subunit and antimicrobial peptides). However, all of these compounds are still far from being introduced into clinical practice. Therefore, infection control policies and optimization in the use of already existing molecules are still the most effective approaches to reduce the spread of resistance and preserve the activity of antimicrobials.
Cunningham, Gregory; Seghrouchni, Khalid; Ruffieux, Etienne; Vaudaux, Pierre; Gayet-Ageron, Angèle; Cherkaoui, Abdessalam; Godinho, Eduardo; Lew, Daniel; Hoffmeyer, Pierre; Uçkay, Ilker
2014-06-01
The sensitivity of Gram staining is known to be suboptimal for the diagnosis of native joint septic arthritis. We lack information about the accuracy of Gram compared to other microscopic staining techniques for predicting infection in different patient populations. This was a cohort study with cost evaluations at the Orthopaedic Service of Geneva University Hospitals (January 1996-October 2012). Among 500 episodes of arthritis (196 with immunosuppression, 227 with underlying arthroplasties and 69 with gout or other crystals in synovial fluid), Gram staining revealed pathogens in 146 episodes (146/500, 29 %) or in 146 of the 400 culture-positive episodes (37 %). Correlation between the Gram and acridine staining of the same sample was good (Spearman 0.85). Overall, the sensitivity, specificity, positive predictive value and negative predictive value of Gram stain for rapid diagnosis of septic arthritis was 0.37, 0.99, 0.99 and 0.28, respectively, compared to microbiological cultures. Quite similar values were recorded across the different patient subpopulations, in particular for sensitivity values that were 0.33 for patients with prosthetic joint infections, 0.40 for immunosuppressed patients, 0.36 for patients under antibiotic administration and 0.52 for patients with concomitant crystalline disease. The sensitivity of Gram or acridine orange staining for a rapid diagnosis of episodes of septic arthritis is suboptimal compared to microbiological culture, regardless of underlying conditions, immunosuppression or antibiotic therapy. The sensitivity in the presence of synovial fluid crystals is moderate. Acridine orange and Gram stains are equivalent.
Directory of Open Access Journals (Sweden)
Pasqualina Laganà
2014-09-01
Full Text Available [b]Introduction. [/b]In hospital and other health care facilities, contamination of water systems by potentially infectious microorganisms, such as bacteria, viruses and protozoa, is a source of nosocomial infections, which may originate fromcolonization of water pipes, cooling towers, spa pools, taps, showers and water supplies. [b]Objective. [/b]The study focuses on the occurrence of [i]Legionella spp.[/i], free-living amoebae and non-fermenting Gram-negative microorganisms in a University hospital water system located in the town of Messina (Sicily, Italy, which had never been examined previously. Materials and Methods. From January 2008 – March 2009, hot tap water samples were collected from 10 wards.[i] Legionella spp[/i]. recovered on selective culture medium were identified by microagglutination latex test; free-living amoebae were cultured using [i]Escherichia coli [/i]as a food source. Non-fermenting Gram negative microorganisms were identified by API 20 NE strips. [b]Results.[/b] [i]Legionella spp.[/i] were found in 33.33% of the samples. [i]L. pneumophila[/i] serogroup 1 was recovered from the Laboratory Diagnostic and Anaesthesia-Neurology Wards, with a peak of 3.5 × 10[sup]4[/sup] cfu/L in May 2008. [i]L. pneumophila[/i] serogroups 2–14 were found in the Othorhinolaryngology, Pathologic Anatomy, Paediatrics and Surgery Wards, and peaked (4 × 10[sup]4[/sup] cfu/L in April 2008. Pseudomonadaceae and Hyphomycetes were also detected. Legionella spp. were recovered from samples positive for non-pathogenic amoebae [i]Hartmannella spp[/i]. [b]Conclusion.[/b] This first study of a Messina hospital water system suggested potential health risks related to the detection of [i]Hartmannella spp[/i]., as reservoirs for[i] Legionella spp.[/i], and Pseudomonas aeruginosa, a Gram negative non-fermenting bacterium frequently causing nosocomial pneumonia. The urgent need for monitoring programmes and prevention measures to ensure hospital water
International Nuclear Information System (INIS)
Masson, H.A.; Denholm, A.M.; Ling, J.R.
1991-01-01
Cells of Bacillus megaterium GW1 and Escherichia coli W7-M5 were specifically radiolabeled with 2,2'-diamino [G- 3 H] pimelic acid ([ 3 H]DAP) as models of gram-positive and gram-negative bacteria, respectively. Two experiments were conducted to study the in vivo metabolism of 2,2'-diaminopimelic acid (DAP) in sheep. In experiment 1, cells of [ 3 H]DAP-labeled B. megaterium GW1 were infused into the rumen of one sheep and the radiolabel was traced within microbial samples, digesta, and the whole animal. Bacterially bound [ 3 H]DAP was extensively metabolized, primarily (up to 70% after 8 h) via decarboxylation to [ 3 H]lysine by both ruminal protozoa and ruminal bacteria. Recovery of infused radiolabel in urine and feces was low (42% after 96 h) and perhaps indicative of further metabolism by the host animal. In experiment 2, [ 3 H]DAP-labeled B. megaterium GW1 was infused into the rumens of three sheep and [ 3 H]DAP-labeled E. coli W7-W5 was infused into the rumen of another sheep. The radioactivity contents of these mutant bacteria were insufficient to use as tracers, but the metabolism of DAP was monitored in the total, free, and peptidyl forms. Free DAP, as a proportion of total DPA in duodenal digesta, varied from 0 to 9.5%, whereas peptidyl DAP accounted for 8.3 to 99.2%
γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system
International Nuclear Information System (INIS)
Suessmuth, R.; Widmann, A.
1979-01-01
γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de
Behera, B; Mathur, P; Gupta, B
2010-01-01
The purpose of this study was to ascertain if the simple practice of Gram stain, acridine orange stain and direct sensitivity determination of positive blood culture bottles could be used to guide early and appropriate treatment in trauma patients with clinical suspicion of sepsis. The study also aimed to evaluate the error in interpreting antimicrobial sensitivity by direct method when compared to standard method and find out if specific antibiotic-organism combination had more discrepancies. Findings from consecutive episodes of blood stream infection at an Apex Trauma centre over a 12-month period are summarized. A total of 509 consecutive positive blood cultures were subjected to Gram staining. AO staining was done in BacT/ALERT-positive Gram-stain negative blood cultures. Direct sensitivity was performed from 369 blood culture broths, showing single type of growth in Gram and acridine orange staining. Results of direct sensitivity were compared to conventional sensitivity for errors. No 'very major' discrepancy was found in this study. About 5.2 and 1.8% minor error rates were noted in gram-positive and gram-negative bacteria, respectively, while comparing the two methods. Most of the discrepancies in gram-negative bacteria were noted in beta lactam - beta lactamase inhibitor combinations. Direct sensitivity testing was not reliable for reporting of methicillin and vancomycin resistance in Staphylococci. Gram stain result together with direct sensitivity testing is required for optimizing initial antimicrobial therapy in trauma patients with clinical suspicion of sepsis. Gram staining and AO staining proved particularly helpful in the early detection of candidaemia.
Suzuki, Yumiko; Nishinari, Chisato; Endo, Harumi; Tamura, Chieko; Jinbo, Keiko; Hiramatsu, Nobuyoshi; Akiyama, Kazumitsu; Koyama, Tsuneo
2002-04-01
The in vitro antibacterial activities of cefozopran (CZOP), an agent of cephems, against various clinical isolates obtained between 1996 and 2000 were yearly evaluated and compared with those of other cephems, oxacephems, carbapenems, and penicillins. Fifteen species, 1,062 strains, of Gram-positive bacteria were isolated from the clinical materials annually collected from January to December, and consisted of methicillin-susceptible Staphylococcus aureus (MSSA; n = 127), methicillin-resistant Staphylococcus aureus (MRSA; n = 123), Staphylococcus epidermidis (n = 104), Staphylococcus haemolyticus (n = 58), Streptococcus pyogenes (n = 100), Streptococcus agalactiae (n = 50), Streptococcus pneumoniae (n = 125), Enterococcus faecalis (n = 150), Enterococcus faecium (n = 50), Enterococcus avium (n = 50), and Peptostreptococcus spp. (P. anaerobius, P. asaccharolyticus, P. magnus, P. micros, P. prevotii; n = 125). CZOP possessed stable antibacterial activities against all strains tested throughout 5 years. The MIC90 of CZOP against MRSA and S. haemolyticus tended to decrease while against S. pneumoniae and Peptostreptococcus spp., tended to increase year by year. However, the MIC90 just changed a little and were consistent with the results from the studies performed until the new drug application approval. Increases in the MIC90 against S. pneumoniae were also observed with cefpirome (CPR), cefepime (CFPM), flomoxef (FMOX), sulbactam/cefoperazone (SBT/CPZ), and imipenem (IPM). Increases in the MIC90 against Peptostreptococcus spp. were also observed with ceftazidime (CAZ), CPR, CFPM, FMOX, SBT/CPZ, and IPM. The decreases in the sensitivities were not always considered to depend upon generation of resistant bacteria because the annual MIC range of each antibacterial agent was almost generally wide every year and the annual sensitivity of each strain to the agents extremely varied. In conclusion, the annual antibacterial activities of CZOP against the Gram-positive
Wang, Hongsu; Luo, Ruiping; Chen, Yang; Si, Qi; Niu, Xiaodi
2018-05-01
A sensor based on mesoporous carbon materials immobilized with sortase A (SrtA) for determination of Staphylococcus aureus (S. aureus) is reported. To prepare the biosensor, we first synthesized carboxyl-functionalized mesoporous hollow carbon spheres, then applied them as carriers for immobilization of SrtA. Based on the catalytic mechanism of SrtA, a highly sensitive, inexpensive, and rapid method was developed for S. aureus detection. The sensor showed a linear response in the bacterial concentration range of 0.125 × 102 colony-forming units (CFU) mL-1 to 2.5 × 102 CFU mL-1, with detection limit as low as 9.0 CFU mL-1. The method was successfully used for quantitative detection of S. aureus in whole milk samples, giving results similar to experimental results obtained from the plate counting method. This biosensor could also be used to detect other Gram-positive bacteria that secrete SrtA.
Studies on Decontamination of Cosmetic Creams by Gamma Radiation
International Nuclear Information System (INIS)
Taher, D.A.
2011-01-01
In the present study, 50 cosmetic cream samples were purchased from the market in Egypt. Cream samples were found to be contaminated with bacteria and fungi in the range of 1.0 x10 5 to 1.0 x 10 8 and 1.3 x 10 3 to 2.1 x 10 6 respectively. The contaminating organisms were gram positive cocci, gram positive rods, gram negative cocci, gram negative rods, gram negative cocci, Aspergillus species and penicillium species. The effect of consumer handling and time on the microbial levels of the tested cream samples which showed, in the present investigations, no microbial contamination were used. The results reveal that the level of contamination was found to increase with time and during use. The contamination were identified as gram positive rods, gram positive cocci. Aspergillus species and Penicillium species. Samples were subjected to gamma radiation, bacterial sublethal dose levels ranged between 1.5 and 20 kGy, 5 and 7 kGy, 3 and 5 kGy, while the fungal sublethal dose levels ranged between 3 and 5 kGy, 3 and 5 kGy also 3 and 5 kGy for foundation creams, foundation moisturizing and moisturizing creams, respectively. Bacteria survived sublethal dose levels were identified as Staphylococcus haemolyticus, Micrococcus sp. Bacillus brevis, Staphylococcus hominis-novo, Bacillus spharicus, Bacillus-pantothenticus and Bacillus Alvei in foundation cream. While, Acenatobacter baumann / haem, Bacillus sphaericus and Bacillus pumilus are the bacteria that survived the sublethal dose levels in foundation-moisturizing cream. Bacillus pantothenticus, Staphylococcus haemolyticus and Micrococcus. sp. were recorded in moisturizing cream samples. The surviving fungi were identified as Aspergillus niger, Aspergillus fumigatus in foundation cream, and Aspergillus niger, Aspergillus tamari and Penicillium chrysogenum in foundation-moisturizing cream, while the fungi surviving is Aspergillus niger in moisturizing cream. For foundation cream, the sterilizing doses were calculated to be (6
Woo, Sung-Geun; Srinivasan, Sathiyaraj; Yang, Jihoon; Jung, Yong-An; Kim, Myung Kyum; Lee, Myungjin
2012-05-01
Strain MJ31(T), a gram-reaction-positive, aerobic, rod-shaped, non-motile bacterium, was isolated from a sludge sample collected at the Daejeon sewage-disposal plant, in South Korea, and characterized in order to determine its taxonomic position. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain MJ31(T) belonged to the genus Nocardioides, appearing most closely related to Nocardioides dubius KSL-104(T) (98.6 % sequence similarity), Nocardioides jensenii DSM 20641(T) (97.6 %), Nocardioides daedukensis MDN22(T) (97.2 %) and Nocardioides mesophilus MSL-22(T) (97.0 %). The chemotaxonomic properties of strain MJ31(T) were consistent with those of the genus Nocardioides: MK-8(H(4)) was the predominant menaquinone, iso-C(16 : 0), iso-C(17 : 0) and C(18 : 1)ω9c were the predominant cellular fatty acids, and the cell-wall peptidoglycan was based on LL-2,6-diaminopimelic acid. The genomic DNA G+C content of strain MJ31(T) was 71.2 mol%. Some differential phenotypic properties and low DNA-DNA relatedness values (<28 %) with the type strains of closely related species indicated that strain MJ31(T) represents a novel species, for which the name Nocardioides daejeonensis sp. nov. is proposed. The type strain is MJ31(T) ( = KCTC 19772(T) = JCM 16922(T)).
Chiaramonte, Fabrizio; Blugeon, Sébastien; Chaillou, Stéphane; Langella, Philippe; Zagorec, Monique
2009-07-01
A Lactobacillus sakei strain named FLEC01 was isolated from human feces and characterized genotypically. Comparison of the genetic features of this strain with those of both the meat-borne L. sakei strain 23K and another human isolate, LTH5590, showed that they belong to different but closely related clusters. The three L. sakei strains did not persist and only transited through the gastrointestinal tracts (GITs) of conventional C3H/HeN mice. In contrast, they all colonized the GITs of axenic mice and rapidly reached a population of 10(9) CFU/g of feces, which remained stable until day 51. Five days after mice were fed, a first subpopulation, characterized by small colonies, appeared and reached 50% of the total L. sakei population in mice. Fifteen to 21 days after feeding, a second subpopulation, characterized by rough colonies, appeared. It coexisted with the two other populations until day 51, and its cell shapes were also affected, suggesting a dysfunction of the cell division or cell wall. No clear difference between the behaviors of the meat-borne strain and the two human isolates in both conventional and axenic mice was observed, suggesting that L. sakei is a food-borne bacterium rather than a commensal one and that its presence in human feces originates from diet. Previous observations of Escherichia coli strains suggest that the mouse GIT environment could induce mutations to increase their survival and colonization capacities. Here, we observed similar mutations concerning a food-grade gram-positive bacterium for the first time.
Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ
Directory of Open Access Journals (Sweden)
Dennapa Saeloh
2017-02-01
Full Text Available Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach (in silico, in vitro, and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S- and (R-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states. Calculations of free binding energy showed a higher affinity of FtsZ to (S-rhodomyrtone (−35.92 ± 0.36 kcal mol−1 than the GDP substrate (−23.47 ± 0.25 kcal mol−1 while less affinity was observed in the case of (R-rhodomyrtone (−18.11 ± 0.11 kcal mol−1. In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance.