WorldWideScience

Sample records for gram-positive bacterium micrococcus

  1. Amino acids in cell wall of Gram-positive bacterium Micrococcus sp. hsn08 with flocculation activity on Chlorella vulgaris biomass.

    Science.gov (United States)

    Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei

    2018-02-01

    The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Endocarditis associated with cardiac catheterization due to a Gram-positive coccus designated Micrococcus mucilaginosus incertae sedis.

    Science.gov (United States)

    Rubin, S J; Lyons, R W; Murcia, A J

    1978-01-01

    A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378

  3. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis

    NARCIS (Netherlands)

    Kunst, F; Ogasawara, N; Moszer, [No Value; Albertini, AM; Alloni, G; Azevedo, [No Value; Bertero, MG; Bessieres, P; Bolotin, A; Borchert, S; Borriss, R; Boursier, L; Brans, A; Brignell, SC; Bron, S; Brouillet, S; Bruschi, CV; Caldwell, B; Capuano, [No Value; Carter, NM; Choi, SK; Codani, JJ; Connerton, IF; Cummings, NJ; Daniel, RA; Denizot, F; Devine, KM; Dusterhoft, A; Ehrlich, SD; Emmerson, PT; Entian, KD; Errington, J; Fabret, C; Ferrari, E; Foulger, D; Fujita, M; Fujita, Y; Fuma, S; Galizzi, A; Galleron, N; Ghim, SY; Glaser, P; Goffeau, A; Golightly, EJ; Grandi, G; Guiseppi, G; Guy, BJ; Haga, K; Haiech, J; Harwood, CR; Henaut, A; Hilbert, H; Holsappel, S; Hosono, S; Hullo, MF; Itaya, M; Jones, L; Joris, B; Karamata, D; Kasahara, Y; KlaerrBlanchard, M; Klein, C; Kobayashi, Y; Koetter, P; Koningstein, G; Krogh, S; Kumano, M; Kurita, K; Lapidus, A; Lardinois, S; Lauber, J; Lazarevic, [No Value; Lee, SM; Levine, A; Liu, H; Masuda, S; Mauel, C; Medigue, C; Medina, N; Mellado, RP; Mizuno, M; Moestl, D; Nakai, S; Noback, M; Noone, D; OReilly, M; Ogawa, K; Ogiwara, A; Oudega, B; Park, SH; Parro, [No Value; Pohl, TM; Portetelle, D; Porwollik, S; Prescott, AM; Presecan, E; Pujic, P; Purnelle, B; Rapoport, G; Rey, M; Reynolds, S; Rieger, M; Rivolta, C; Rocha, E; Roche, B; Rose, M; Sadaie, Y; Sato, T; Scanlan, E; Schleich, S; Schroeter, R; Scoffone, F; Sekiguchi, J; Sekowska, A; Seror, SJ; Serror, P; Shin, BS; Soldo, B; Sorokin, A; Tacconi, E; Takagi, T; Takahashi, H; Takemaru, K; Takeuchi, M; Tamakoshi, A; Tanaka, T; Terpstra, P; Tognoni, A; Tosato, [No Value; Uchiyama, S; Vandenbol, M; Vannier, F; Vassarotti, A; Viari, A; Wambutt, R; Wedler, E; Wedler, H; Weitzenegger, T; Winters, P; Wipat, A; Yamamoto, H; Yamane, K; Yasumoto, K; Yata, K; Yoshida, K; Yoshikawa, HF; Zumstein, E; Yoshikawa, H; Danchin, A

    1997-01-01

    Bacillus subtilis is the best-characterized member of the Gram-positive bacteria. Its genome of 4,214,810 base pairs comprises 4,100 protein-coding genes. Of these protein-coding genes, 53% are represented once, while a quarter of the genome corresponds to several gene families that have been

  4. A pathway closely related to the (D)-tagatose pathway of gram-negative enterobacteria identified in the gram-positive bacterium Bacillus licheniformis.

    Science.gov (United States)

    Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard

    2013-06-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

  5. A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

    Science.gov (United States)

    Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

    2013-01-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682

  6. A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

    OpenAIRE

    Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

    2013-01-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

  7. Identification of Multiple Soluble Fe(III Reductases in Gram-Positive Thermophilic Bacterium Thermoanaerobacter indiensis BSB-33

    Directory of Open Access Journals (Sweden)

    Subrata Pal

    2014-01-01

    Full Text Available Thermoanaerobacter indiensis BSB-33 has been earlier shown to reduce Fe(III and Cr(VI anaerobically at 60°C optimally. Further, the Gram-positive thermophilic bacterium contains Cr(VI reduction activity in both the membrane and cytoplasm. The soluble fraction prepared from T. indiensis cells grown at 60°C was found to contain the majority of Fe(III reduction activity of the microorganism and produced four distinct bands in nondenaturing Fe(III reductase activity gel. Proteins from each of these bands were partially purified by chromatography and identified by mass spectrometry (MS with the help of T. indiensis proteome sequences. Two paralogous dihydrolipoamide dehydrogenases (LPDs, thioredoxin reductase (Trx, NADP(H-nitrite reductase (Ntr, and thioredoxin disulfide reductase (Tdr were determined to be responsible for Fe(III reductase activity. Amino acid sequence and three-dimensional (3D structural similarity analyses of the T. indiensis Fe(III reductases were carried out with Cr(VI reducing proteins from other bacteria. The two LPDs and Tdr showed very significant sequence and structural identity, respectively, with Cr(VI reducing dihydrolipoamide dehydrogenase from Thermus scotoductus and thioredoxin disulfide reductase from Desulfovibrio desulfuricans. It appears that in addition to their iron reducing activity T. indiensis LPDs and Tdr are possibly involved in Cr(VI reduction as well.

  8. Fermentation of glycolate by a pure culture of a strictly anaerobic gram-positive bacterium belonging to the family Lachnospiraceae.

    Science.gov (United States)

    Janssen, Peter H; Hugenholtz, Philip

    2003-05-01

    The component bacteria of a three-membered mixed culture able to ferment glycolate to acetate, propionate and CO(2) were isolated in pure culture. All three strains were strict anaerobes that, on the basis of comparative 16S rRNA gene sequence analysis, belonged to the order Clostridiales in the phylum Firmicutes (low G+C gram-positive bacteria). Two of the strains were not involved in glycolate metabolism. The third, the glycolate-fermenting strain 19gly4 (DSM 11261), was related to members of the family Lachnospiraceae. The cells of strain 19gly4 were oval- to lemon-shaped, 0.85 microm long and 0.65 microm in diameter, occurring singly, in pairs, or in chains of up to 30 cells. Strain 19gly4 fermented glycolate or fumarate to acetate, succinate, and CO(2). Hydrogen was not formed, and strain 19gly4 was able to grow on glycolate in pure culture without any syntrophic hydrogen transfer and without the use of an external electron acceptor. There was no evidence for homoacetogenic metabolism. This bacterium therefore differs in metabolism from previously reported glycolate-utilising anaerobes.

  9. Salirhabdus euzebyi gen. nov., sp. nov., a Gram-positive, halotolerant bacterium isolated from a sea salt evaporation pond.

    Science.gov (United States)

    Albuquerque, Luciana; Tiago, Igor; Rainey, Fred A; Taborda, Marco; Nobre, M Fernanda; Veríssimo, António; da Costa, Milton S

    2007-07-01

    A low-G+C, Gram-positive bacterium, designated CVS-14(T), was recovered from a sea salt evaporation pond on the island of Sal in the Cape Verde Archipelago. This organism was catalase- and oxidase-positive. Cells were motile, spore-forming aerobic rods, with an optimum growth temperature of about 35-40 degrees C and optimum pH between 7.0 and 8.5. Optimal growth occurred in media containing 4-6 % (w/v) NaCl, although the organism was able to grow in medium without added NaCl and in medium containing 16 % NaCl. The cell-wall peptidoglycan was of A1 gamma type and the major respiratory quinone was menaquinone 7 (MK-7). Major fatty acids were iso-15 : 0, anteiso-15 : 0, iso-17 : 0 and anteiso-17 : 0. The DNA G+C content was 37.0 mol%. Phylogenetic analysis of the 16S rRNA gene sequence indicated that strain CVS-14(T) formed a distinct new branch within the radiation of the moderately halophilic bacilli group, forming a separate lineage from species of the genera Salinibacillus, Paucisalibacillus, Oceanobacillus, Lentibacillus and Virgibacillus. Strain CVS-14(T) showed 16S rRNA gene pairwise similarity values of approximately 95 % with species of the genus Salinibacillus. On the basis of morphological, physiological, chemotaxonomic and phylogenetic characteristics, strain CVS-14(T) is considered to represent a novel species in a new genus, for which the name Salirhabdus euzebyi gen. nov., sp. nov. is proposed. The type strain is CVS-14(T) (=LMG 22839(T)=CIP 108577(T)).

  10. Higher order structure in the 3'-minor domain of small subunit ribosomal RNAs from a gram negative bacterium, a gram positive bacterium and a eukaryote

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1983-01-01

    of additional higher order structure in the renatured free RNA. It can be concluded that a high level of conservation of higher order structure has occurred during the evolution of the gram negative and gram positive eubacteria and the eukaryote in both the double helical regions and the "unstructured" regions...

  11. Stable transformation of the gram-positive phytopathogenic bacterium Clavibacter michiganensis subsp. sepedonicus with several cloning vectors.

    OpenAIRE

    Laine, M J; Nakhei, H; Dreier, J; Lehtilä, K; Meletzus, D; Eichenlaub, R; Metzler, M C

    1996-01-01

    In this paper we describe transformation of Clavibacter michiganensis subsp. sepedonicus, the potato ring rot bacterium, with plasmid vectors. Three of the plasmids used, pDM100, pDM302, and pDM306, contain the origin of replication from pCM1, a native plasmid of C. michiganensis subsp. michiganensis. We constructed two new cloning vectors, pHN205 and pHN216, by using the origin of replication of pCM2, another native plasmid of C. michiganensis subsp. michiganensis. Plasmids pDM302, pHN205, a...

  12. The origin of a derived superkingdom: how a gram-positive bacterium crossed the desert to become an archaeon

    Directory of Open Access Journals (Sweden)

    Bourne Philip E

    2011-02-01

    Full Text Available Abstract Background The tree of life is usually rooted between archaea and bacteria. We have previously presented three arguments that support placing the root of the tree of life in bacteria. The data have been dismissed because those who support the canonical rooting between the prokaryotic superkingdoms cannot imagine how the vast divide between the prokaryotic superkingdoms could be crossed. Results We review the evidence that archaea are derived, as well as their biggest differences with bacteria. We argue that using novel data the gap between the superkingdoms is not insurmountable. We consider whether archaea are holophyletic or paraphyletic; essential to understanding their origin. Finally, we review several hypotheses on the origins of archaea and, where possible, evaluate each hypothesis using bioinformatics tools. As a result we argue for a firmicute ancestry for archaea over proposals for an actinobacterial ancestry. Conclusion We believe a synthesis of the hypotheses of Lake, Gupta, and Cavalier-Smith is possible where a combination of antibiotic warfare and viral endosymbiosis in the bacilli led to dramatic changes in a bacterium that resulted in the birth of archaea and eukaryotes. Reviewers This article was reviewed by Patrick Forterre, Eugene Koonin, and Gáspár Jékely

  13. Stable transformation of the gram-positive phytopathogenic bacterium Clavibacter michiganensis subsp. sepedonicus with several cloning vectors.

    Science.gov (United States)

    Laine, M J; Nakhei, H; Dreier, J; Lehtilä, K; Meletzus, D; Eichenlaub, R; Metzler, M C

    1996-05-01

    In this paper we describe transformation of Clavibacter michiganensis subsp. sepedonicus, the potato ring rot bacterium, with plasmid vectors. Three of the plasmids used, pDM100, pDM302, and pDM306, contain the origin of replication from pCM1, a native plasmid of C. michiganensis subsp. michiganensis. We constructed two new cloning vectors, pHN205 and pHN216, by using the origin of replication of pCM2, another native plasmid of C. michiganensis subsp. michiganensis. Plasmids pDM302, pHN205, and pHN216 were stably maintained without antibiotic selection in various strains of C. michiganensis subsp. sepedonicus. We observed that for a single plasmid, different strains of C. michiganensis subsp. sepedonicus showed significantly different transformation efficiencies. We also found unexplained strain-to-strain differences in stability with various plasmid constructions containing different arrangements of antibiotic resistance genes and origins of replication. We examined the effect of a number of factors on transformation efficiency. The best transformation efficiencies were obtained when C. michiganensis subsp. sepedonicus cells were grown on DM agar plates, harvested during the early exponential growth phase, and used fresh (without freezing) for electroporation. The maximal transformation efficiency obtained was 4.6 x 10(4) CFU/microgram of pHN216 plasmid DNA. To demonstrate the utility of this transformation system, we cloned a beta-1,4-endoglucanase-encoding gene from C. michiganensis subsp. sepedonicus into pHN216. When this construction, pHN216:C8, was electroporated into competent cells of a cellulase-deficient mutant, it restored cellulase production to almost wild-type levels.

  14. Comparative Proteomic Analysis of Desulfotomaculum reducens MI-1: Insights into the Metabolic Versatility of a Gram-positive Sulfate and Metal-reducing Bacterium

    Directory of Open Access Journals (Sweden)

    Anne Elyse Otwell

    2016-02-01

    Full Text Available The proteomes of the metabolically versatile and poorly characterized Gram-positive bacterium Desulfotomaculum reducens MI-1 were compared across four cultivation conditions including sulfate reduction, soluble Fe(III reduction, insoluble Fe(III reduction, and pyruvate fermentation. Collectively across conditions, we observed at high confidence ~38% of genome-encoded proteins. Here, we focus on proteins that display significant differential abundance on conditions tested. To the best of our knowledge, this is the first full-proteome study focused on a Gram-positive organism grown either on sulfate or metal-reducing conditions. Several proteins with uncharacterized function encoded within heterodisulfide reductase (hdr-containing loci were upregulated on either sulfate (Dred_0633-4, Dred_0689-90, and Dred_1325-30 or Fe(III-citrate-reducing conditions (Dred_0432-3 and Dred_1778-84. Two of these hdr-containing loci display homology to recently described flavin-based electron bifurcation (FBEB pathways (Dred_1325-30 and Dred_1778-84. Additionally, we propose that a cluster of proteins, which is homologous to a described FBEB lactate dehydrogenase (LDH complex, is performing lactate oxidation in D. reducens (Dred_0367-9. Analysis of the putative sulfate reduction machinery in D. reducens revealed that most of these proteins are constitutively expressed across cultivation conditions tested. In addition, peptides from the single multiheme c-type cytochrome (MHC in the genome were exclusively observed on the insoluble Fe(III condition, suggesting that this MHC may play a role in reduction of insoluble metals.

  15. Sediminibacillus massiliensis sp. nov., a moderately halophilic, Gram-positive bacterium isolated from a stool sample of a young Senegalese man.

    Science.gov (United States)

    Senghor, Bruno; Bassène, Hubert; Khelaifia, Saber; Robert, Catherine; Fournier, Pierre-Edouard; Ruimy, Raymond; Sokhna, Cheikh; Raoult, Didier; Lagier, Jean-Christophe

    2018-07-01

    A Gram-positive, moderately halophilic bacterium, referred to as strain Marseille-P3518 T , was isolated from a stool sample with 2% NaCl concentration from a healthy 15-year-old male living in Dielmo, a village in Senegal. Cells are aerobic, rod-shaped and motile and display endospore formation. Strain Marseille-P3518 T can grow in a medium with 0-20% (w/v) sodium chloride (optimally at 5-7.5% w/v). The major fatty acids were 12-methyl-tetradecanoic acid (45.8%), 13-methyl-tetradecanoic acid (26.9%) and 12-methyl-tridecanoic acid (12.8%). The genome is 4,347,479 bp long with 42.1% G+C content. It contains 4282 protein-coding and 107 RNA genes. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that strain Marseille-P3518 T is a member of the Bacillaceae family and is closely related to Sediminibacillus albus (97.4% gene sequence similarity). Strain Marseille-P3518 T was clearly differentiated from its phylogenetic neighbors on the basis of phenotypic and genotypic features. Strain Marseille-P3518 T is, therefore, considered to be a novel representative of the genus Sediminibacillus, for which the name Sediminibacillus massiliensis sp. nov. is proposed, and the type strain is Marseille-P3518 T (CSUR P3518T, DSM69894).

  16. Molecular evolution of the nif gene cluster carrying nifI1 and nifI2 genes in the Gram-positive phototrophic bacterium Heliobacterium chlorum.

    Science.gov (United States)

    Enkh-Amgalan, Jigjiddorj; Kawasaki, Hiroko; Seki, Tatsuji

    2006-01-01

    A major nif cluster was detected in the strictly anaerobic, Gram-positive phototrophic bacterium Heliobacterium chlorum. The cluster consisted of 11 genes arranged within a 10 kb region in the order nifI1, nifI2, nifH, nifD, nifK, nifE, nifN, nifX, fdx, nifB and nifV. The phylogenetic position of Hbt. chlorum was the same in the NifH, NifD, NifK, NifE and NifN trees; Hbt. chlorum formed a cluster with Desulfitobacterium hafniense, the closest neighbour of heliobacteria based on the 16S rRNA phylogeny, and two species of the genus Geobacter belonging to the Deltaproteobacteria. Two nifI genes, known to occur in the nif clusters of methanogenic archaea between nifH and nifD, were found upstream of the nifH gene of Hbt. chlorum. The organization of the nif operon and the phylogeny of individual and concatenated gene products showed that the Hbt. chlorum nif operon carrying nifI genes upstream of the nifH gene was an intermediate between the nif operon with nifI downstream of nifH (group II and III of the nitrogenase classification) and the nif operon lacking nifI (group I). Thus, the phylogenetic position of Hbt. chlorum nitrogenase may reflect an evolutionary stage of a divergence of the two nitrogenase groups, with group I consisting of the aerobic diazotrophs and group II consisting of strictly anaerobic prokaryotes.

  17. A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.

    Science.gov (United States)

    Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright

    2005-12-30

    A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.

  18. Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans

    Science.gov (United States)

    Duggan, D. E.; Anderson, A. W.; Elliker, P. R.

    1963-01-01

    A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780

  19. A Disulfide Bond-forming Machine Is Linked to the Sortase-mediated Pilus Assembly Pathway in the Gram-positive Bacterium Actinomyces oris*

    Science.gov (United States)

    Reardon-Robinson, Melissa E.; Osipiuk, Jerzy; Chang, Chungyu; Wu, Chenggang; Jooya, Neda; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

    2015-01-01

    Export of cell surface pilins in Gram-positive bacteria likely occurs by the translocation of unfolded precursor polypeptides; however, how the unfolded pilins gain their native conformation is presently unknown. Here, we present physiological studies to demonstrate that the FimA pilin of Actinomyces oris contains two disulfide bonds. Alanine substitution of cysteine residues forming the C-terminal disulfide bridge abrogates pilus assembly, in turn eliminating biofilm formation and polymicrobial interaction. Transposon mutagenesis of A. oris yielded a mutant defective in adherence to Streptococcus oralis, and revealed the essential role of a vitamin K epoxide reductase (VKOR) gene in pilus assembly. Targeted deletion of vkor results in the same defects, which are rescued by ectopic expression of VKOR, but not a mutant containing an alanine substitution in its conserved CXXC motif. Depletion of mdbA, which encodes a membrane-bound thiol-disulfide oxidoreductase, abrogates pilus assembly and alters cell morphology. Remarkably, overexpression of MdbA or a counterpart from Corynebacterium diphtheriae, rescues the Δvkor mutant. By alkylation assays, we demonstrate that VKOR is required for MdbA reoxidation. Furthermore, crystallographic studies reveal that A. oris MdbA harbors a thioredoxin-like fold with the conserved CXXC active site. Consistently, each MdbA enzyme catalyzes proper disulfide bond formation within FimA in vitro that requires the catalytic CXXC motif. Because the majority of signal peptide-containing proteins encoded by A. oris possess multiple Cys residues, we propose that MdbA and VKOR constitute a major folding machine for the secretome of this organism. This oxidative protein folding pathway may be a common feature in Actinobacteria. PMID:26170452

  20. A Disulfide Bond-forming Machine Is Linked to the Sortase-mediated Pilus Assembly Pathway in the Gram-positive Bacterium Actinomyces oris.

    Science.gov (United States)

    Reardon-Robinson, Melissa E; Osipiuk, Jerzy; Chang, Chungyu; Wu, Chenggang; Jooya, Neda; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

    2015-08-28

    Export of cell surface pilins in Gram-positive bacteria likely occurs by the translocation of unfolded precursor polypeptides; however, how the unfolded pilins gain their native conformation is presently unknown. Here, we present physiological studies to demonstrate that the FimA pilin of Actinomyces oris contains two disulfide bonds. Alanine substitution of cysteine residues forming the C-terminal disulfide bridge abrogates pilus assembly, in turn eliminating biofilm formation and polymicrobial interaction. Transposon mutagenesis of A. oris yielded a mutant defective in adherence to Streptococcus oralis, and revealed the essential role of a vitamin K epoxide reductase (VKOR) gene in pilus assembly. Targeted deletion of vkor results in the same defects, which are rescued by ectopic expression of VKOR, but not a mutant containing an alanine substitution in its conserved CXXC motif. Depletion of mdbA, which encodes a membrane-bound thiol-disulfide oxidoreductase, abrogates pilus assembly and alters cell morphology. Remarkably, overexpression of MdbA or a counterpart from Corynebacterium diphtheriae, rescues the Δvkor mutant. By alkylation assays, we demonstrate that VKOR is required for MdbA reoxidation. Furthermore, crystallographic studies reveal that A. oris MdbA harbors a thioredoxin-like fold with the conserved CXXC active site. Consistently, each MdbA enzyme catalyzes proper disulfide bond formation within FimA in vitro that requires the catalytic CXXC motif. Because the majority of signal peptide-containing proteins encoded by A. oris possess multiple Cys residues, we propose that MdbA and VKOR constitute a major folding machine for the secretome of this organism. This oxidative protein folding pathway may be a common feature in Actinobacteria. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Methods for targetted mutagenesis in gram-positive bacteria

    Science.gov (United States)

    Yang, Yunfeng

    2014-05-27

    The present invention provides a method of targeted mutagenesis in Gram-positive bacteria. In particular, the present invention provides a method that effectively integrates a suicide integrative vector into a target gene in the chromosome of a Gram-positive bacterium, resulting in inactivation of the target gene.

  2. Discovery of novel cell wall-active compounds using P ywaC, a sensitive reporter of cell wall stress, in the model gram-positive bacterium Bacillus subtilis.

    Science.gov (United States)

    Czarny, T L; Perri, A L; French, S; Brown, E D

    2014-06-01

    The emergence of antibiotic resistance in recent years has radically reduced the clinical efficacy of many antibacterial treatments and now poses a significant threat to public health. One of the earliest studied well-validated targets for antimicrobial discovery is the bacterial cell wall. The essential nature of this pathway, its conservation among bacterial pathogens, and its absence in human biology have made cell wall synthesis an attractive pathway for new antibiotic drug discovery. Herein, we describe a highly sensitive screening methodology for identifying chemical agents that perturb cell wall synthesis, using the model of the Gram-positive bacterium Bacillus subtilis. We report on a cell-based pilot screen of 26,000 small molecules to look for cell wall-active chemicals in real time using an autonomous luminescence gene cluster driven by the promoter of ywaC, which encodes a guanosine tetra(penta)phosphate synthetase that is expressed under cell wall stress. The promoter-reporter system was generally much more sensitive than growth inhibition testing and responded almost exclusively to cell wall-active antibiotics. Follow-up testing of the compounds from the pilot screen with secondary assays to verify the mechanism of action led to the discovery of 9 novel cell wall-active compounds. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.

    Science.gov (United States)

    Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T

    2017-08-10

    We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.

  4. Microbiological Synthesis of 2H-Labeled Phenylalanine, Alanine, Valine, and Leucine/Isoleucine with Different Degrees of Deuterium Enrichment by the Gram-Positive Facultative Methylotrophic Bacterium Вrevibacterium Methylicum

    Directory of Open Access Journals (Sweden)

    Oleg V. Mosin, PhD¹

    2013-06-01

    Full Text Available The microbiological synthesis of [2H]amino acids was performed by the conversion of low molecular weight substrates ([U-2H]MeOH and 2H2O using the Gram-positive aerobic facultative methylotrophic bacterium Brevibacterium methylicum, an L-phenylalanine producer, realizing the NAD+ dependent methanol dehydrogenase (EC 1.6.99.3 variant of the ribulose-5-monophosphate (RuMP cycle of carbon assimilation. In this process, the adapted cells of the methylotroph with enhanced growth characteristics were used on a minimal salt medium M9, supplemented with 2% (v/v [U-2H]MeOH and an increasing gradient of 2Н2O concentration from 0; 24.5, 49.0; 73.5 up to 98% (v/v 2Н2O. Alanine, valine, and leucine/isoleucine were produced and accumulated exogeneously in quantities of 5–6 mol, in addition to the main product of biosynthesis. This method enables the production of [2Н]amino acids with different degrees of deuterium enrichment, depending on the 2Н2O concentration in the growth medium, from 17 at.% 2Н (on the growth medium with 24.5 % (v/v 2Н2О up to 75 at.% 2Н (on the growth medium with 98 % (v/v 2Н2О. This has been confirmed with the data from the electron impact (EI mass spectrometry analysis of the methyl ethers of N-dimethylamino(naphthalene-5-sulfochloride [2H]amino acids under these experimental conditions.

  5. Transformation of gram positive bacteria by sonoporation

    Science.gov (United States)

    Yang, Yunfeng; Li, Yongchao

    2014-03-11

    The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

  6. Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.

    Science.gov (United States)

    Hansen, M T

    1978-01-01

    The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572

  7. Endocarditis due to Micrococcus sedentarius incertae sedis.

    Science.gov (United States)

    Old, D C; McNeill, G P

    1979-01-01

    The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056

  8. Isolation and characterization of a novel nitrobenzene-degrading bacterium with high salinity tolerance: Micrococcus luteus.

    Science.gov (United States)

    Zheng, Chunli; Qu, Baocheng; Wang, Jing; Zhou, Jiti; Wang, Jing; Lu, Hong

    2009-06-15

    Strain Z3 was isolated from nitrobenzene-contaminated sludge. Strain Z3 was able to utilize nitrobenzene as a sole source of carbon, nitrogen and energy under aerobic condition. Based on the morphology, physiological biochemical characteristics, and 16S rDNA sequence, strain Z3 was identified as Micrococcus luteus. Strain Z3 completely degraded nitrobenzene with initial concentration of 100, 150, 200, and 250 mg L(-1) within 70, 96, 120 and 196 h, respectively. Kinetics of nitrobenzene degradation was described using the Andrews equation. The kinetic parameters were as follows: q(max)=1.19 h(-1), K(s)=29.11 mg L(-1), and K(i)=94.00 mg L(-1). Strain Z3 had a high salinity tolerance. It degraded 200 mg L(-1) nitrobenzene completely in 5% NaCl (w/w%). Strain Z3 therefore could be an excellent candidate for the bio-treatment of nitrobenzene industrial wastewaters with high salinity. This is the first report on the degradation of nitrobenzene by M. luteus and the degradation of nitrobenzene achieved in such a high salinity.

  9. Antiadhesion agents against Gram-positive pathogens.

    Science.gov (United States)

    Cascioferro, Stella; Cusimano, Maria Grazia; Schillaci, Domenico

    2014-01-01

    A fundamental step of Gram-positive pathogenesis is the bacterial adhesion to the host tissue involving interaction between bacterial surface molecules and host ligands. This review is focused on antivirulence compounds that target Gram-positive adhesins and on their potential development as therapeutic agents alternative or complementary to conventional antibiotics in the contrast of pathogens. In particular, compounds that target the sortase A, wall theicoic acid inhibitors, carbohydrates able to bind bacterial proteins and proteins capable of influencing the bacterial adhesion, were described. We further discuss the advantages and disadvantages of this strategy in the development of novel antimicrobials and the future perspective of this research field still at its first steps.

  10. Effect of ionophores on phosphate and arsenate transport in Micrococcus lysodeikticus

    Energy Technology Data Exchange (ETDEWEB)

    Friedberg, I

    1977-09-01

    The effects of ionophores on P/sub i/ and arsenate transport, at acid and alkaline environment, were investigated in whole cells of Micrococcus lysodeikticus, a Gram positive obligatory aerobic bacterium. The results suggest that both ..delta.. Psi and ..delta.. pH contribute to the driving force of P/sub i/ transport; ..delta.. Psi seems to be predominant at pH 7.8, whereas at pH 5.5, the transport is primarily driven by ..delta.. pH. 12 references, 1 figure.

  11. Diversity of pigmented Gram-positive bacteria associated with marine macroalgae from Antarctica.

    Science.gov (United States)

    Leiva, Sergio; Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio

    2015-12-01

    Little is known about the diversity and roles of Gram-positive and pigmented bacteria in Antarctic environments, especially those associated with marine macroorganisms. This work is the first study about the diversity and antimicrobial activity of culturable pigmented Gram-positive bacteria associated with marine Antarctic macroalgae. A total of 31 pigmented Gram-positive strains were isolated from the surface of six species of macroalgae collected in the King George Island, South Shetland Islands. On the basis of 16S rRNA gene sequence similarities ≥99%, 18 phylotypes were defined, which were clustered into 11 genera of Actinobacteria (Agrococcus, Arthrobacter, Brachybacterium, Citricoccus, Kocuria, Labedella, Microbacterium, Micrococcus, Rhodococcus, Salinibacterium and Sanguibacter) and one genus of the Firmicutes (Staphylococcus). It was found that five isolates displayed antimicrobial activity against a set of macroalgae-associated bacteria. The active isolates were phylogenetically related to Agrococcus baldri, Brachybacterium rhamnosum, Citricoccus zhacaiensis and Kocuria palustris. The results indicate that a diverse community of pigmented Gram-positive bacteria is associated with Antartic macroalgae and suggest its potential as a promising source of antimicrobial and pigmented natural compounds. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Glass bead transformation method for gram-positive bacteria

    OpenAIRE

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2009-01-01

    A simple, inexpensive and reproducible transformation method was developed for Gram-positive bacteria. It was based on agitation of bacterial protoplasts with glass beads in the presence of DNA and polyethylene glycol. By using this method, introduction of pGK12 into protoplasts of several strains of Gram-positive bacteria was achieved.

  13. Gram-positive bacteria persisting in the food production environment

    DEFF Research Database (Denmark)

    Knøchel, Susanne; Harmsen, Morten; Knudsen, Bettina

    2008-01-01

    Many gram-positive bacteria are able to form aggregates or biofilms and resist external stress factors and some gram-positive pathogenic bacteria such as Listeria monocytogenes and Bacillus cereus may persist in the food production environment for extended periods. Most research has focussed...

  14. c-di-GMP Regulates Various Phenotypes and Insecticidal Activity of Gram-Positive Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Yang Fu

    2018-02-01

    Full Text Available C-di-GMP has been well investigated to play significant roles in the physiology of many Gram-negative bacteria. However, its effect on Gram-positive bacteria is less known. In order to more understand the c-di-GMP functions in Gram-positive bacteria, we have carried out a detailed study on the c-di-GMP-metabolizing enzymes and their physiological functions in Bacillus thuringiensis, a Gram-positive entomopathogenic bacterium that has been applied as an insecticide successfully. We performed a systematic study on the ten putative c-di-GMP-synthesizing enzyme diguanylate cyclases (DGCs and c-di-GMP-degrading enzyme phosphodiesterases (PDEs in B. thuringiensis BMB171, and artificially elevated the intracellular c-di-GMP level in BMB171 by deleting one or more pde genes. We found increasing level of intracellular c-di-GMP exhibits similar activities as those in Gram-negative bacteria, including altered activities in cell motility, biofilm formation, and cell-cell aggregation. Unexpectedly, we additionally found a novel function exhibited by the increasing level of c-di-GMP to promote the insecticidal activity of this bacterium against Helicoverpa armigera. Through whole-genome transcriptome profile analyses, we found that 4.3% of the B. thuringiensis genes were differentially transcribed when c-di-GMP level was increased, and 77.3% of such gene products are involved in some regulatory pathways not reported in other bacteria to date. In summary, our study represents the first comprehensive report on the c-di-GMP-metabolizing enzymes, their effects on phenotypes, and the transcriptome mediated by c-di-GMP in an important Gram-positive bacterium.

  15. Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

    Science.gov (United States)

    Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

    2011-06-10

    The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Defining a role for Hfq in Gram-positive bacteria

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Lei, Lisbeth Kristensen; Ebersbach, Tine

    2010-01-01

    Small trans-encoded RNAs (sRNAs) modulate the translation and decay of mRNAs in bacteria. In Gram-negative species, antisense regulation by trans-encoded sRNAs relies on the Sm-like protein Hfq. In contrast to this, Hfq is dispensable for sRNA-mediated riboregulation in the Gram-positive species......-dependent and -independent mechanisms, thus adding another layer of complexity to sRNA-mediated riboregulation in Gram-positive species....

  17. Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.

    Science.gov (United States)

    Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen

    2014-01-01

    Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.

  18. Extrachromosomal genetic elements in Micrococcus.

    Science.gov (United States)

    Dib, Julián Rafael; Liebl, Wolfgang; Wagenknecht, Martin; Farías, María Eugenia; Meinhardt, Friedhelm

    2013-01-01

    Micrococci are Gram-positive G + C-rich, nonmotile, nonspore-forming actinomycetous bacteria. Micrococcus comprises ten members, with Micrococcus luteus being the type species. Representatives of the genus play important roles in the biodegradation of xenobiotics, bioremediation processes, production of biotechnologically important enzymes or bioactive compounds, as test strains in biological assays for lysozyme and antibiotics, and as infective agents in immunocompromised humans. The first description of plasmids dates back approximately 28 years, when several extrachromosomal elements ranging in size from 1.5 to 30.2 kb were found in Micrococcus luteus. Up to the present, a number of circular plasmids conferring antibiotic resistance, the ability to degrade aromatic compounds, and osmotolerance are known, as well as cryptic elements with unidentified functions. Here, we review the Micrococcus extrachromosomal traits reported thus far including phages and the only quite recently described large linear extrachromosomal genetic elements, termed linear plasmids, which range in size from 75 kb (pJD12) to 110 kb (pLMA1) and which confer putative advantageous capabilities, such as antibiotic or heavy metal resistances (inferred from sequence analyses and curing experiments). The role of the extrachromosomal elements for the frequently proven ecological and biotechnological versatility of the genus will be addressed as well as their potential for the development and use as genetic tools.

  19. Cellular reprogramming by gram-positive bacterial components: a review.

    LENUS (Irish Health Repository)

    Buckley, Julliette M

    2012-02-03

    LPS tolerance has been the focus of extensive scientific and clinical research over the last several decades in an attempt to elucidate the sequence of changes that occur at a molecular level in tolerized cells. Tolerance to components of gram-positive bacterial cell walls such as bacterial lipoprotein and lipoteichoic acid is a much lesser studied, although equally important, phenomenon. This review will focus on cellular reprogramming by gram-positive bacterial components and examines the alterations in cell surface receptor expression, changes in intracellular signaling, gene expression and cytokine production, and the phenomenon of cross-tolerance.

  20. Diesel degradation and biosurfactant production by Gram-positive ...

    African Journals Online (AJOL)

    The ability of Gram-positive bacteria to degrade diesel increased in a comparable trend as its biosurfactant production increased. The E24 index was highest at 87.6% for isolate D9. Isolates D2, D9 and D10, were identified as Paenibacillus sp. whilst isolate DJLB was found to belong to Stenotrophomonas sp. This study ...

  1. Nicotinoprotein methanol dehydrogenase enzymes in Gram-positive methylotrophic bacteria

    NARCIS (Netherlands)

    Hektor, Harm J.; Kloosterman, Harm; Dijkhuizen, Lubbert

    2000-01-01

    A novel type of alcohol dehydrogenase enzyme has been characterized from Gram-positive methylotrophic (Bacillus methanolicus, the actinomycetes Amycolatopsis methanolica and Mycobacterium gastri) and non-methylotrophic bacteria (Rhodococcus strains). Its in vivo role is in oxidation of methanol and

  2. Endocarditis : Effects of routine echocardiography during Gram-positive bacteraemia

    NARCIS (Netherlands)

    Vos, F J; Bleeker-Rovers, C P; Sturm, P D; Krabbe, P F M; van Dijk, A P J; Oyen, W J G; Kullberg, B J

    2011-01-01

    BACKGROUND: Despite firm recommendations to perform echocardiography in high-risk patients with Gram-positive bacteraemia, routine echocardiography is not embedded in daily practice in many settings. The aim of this study was to evaluate whether a regime including routine echocardiography results in

  3. Selenoproteins in Archaea and Gram-positive bacteria.

    Science.gov (United States)

    Stock, Tilmann; Rother, Michael

    2009-11-01

    Selenium is an essential trace element for many organisms by serving important catalytic roles in the form of the 21st co-translationally inserted amino acid selenocysteine. It is mostly found in redox-active proteins in members of all three domains of life and analysis of the ever-increasing number of genome sequences has facilitated identification of the encoded selenoproteins. Available data from biochemical, sequence, and structure analyses indicate that Gram-positive bacteria synthesize and incorporate selenocysteine via the same pathway as enterobacteria. However, recent in vivo studies indicate that selenocysteine-decoding is much less stringent in Gram-positive bacteria than in Escherichia coli. For years, knowledge about the pathway of selenocysteine synthesis in Archaea and Eukarya was only fragmentary, but genetic and biochemical studies guided by analysis of genome sequences of Sec-encoding archaea has not only led to the characterization of the pathways but has also shown that they are principally identical. This review summarizes current knowledge about the metabolic pathways of Archaea and Gram-positive bacteria where selenium is involved, about the known selenoproteins, and about the respective pathways employed in selenoprotein synthesis.

  4. Daptomycin treatment in Gram-positive vascular graft infections

    Directory of Open Access Journals (Sweden)

    Francisco Arnaiz de las Revillas

    2018-03-01

    Full Text Available Background: Daptomycin is a bactericidal antibiotic approved for the treatment of skin and soft tissue infections and right-side endocarditis. However, there is a lack of published data outlining its usefulness in vascular graft infections (VGI. The aim of this study was to describe the clinical experience of daptomycin use in the treatment of VGI caused by Gram-positive bacteria. Methods: This was a retrospective cohort study of patients diagnosed with VGI receiving daptomycin at a tertiary care hospital during the period January 2010 to December 2012. Results: Of a total 1066 consecutive patients who had undergone vascular grafts (VG, 25 were diagnosed with VGI. Fifteen of these patients (11 prosthetic VG, three autologous VG, one both types received daptomycin (median dose 6.7 mg/kg/day, range 4.1–7.1 mg/kg/day; median age 69 years, range 45–83 years; 80% male. The infected bypass was removed in 13 cases. The most common reason for selecting daptomycin was kidney failure (53%. The Gram-positive organisms isolated were coagulase-negative Staphylococcus (n = 10, Staphylococcus aureus (n = 3 (two methicillin-resistant S. aureus, Enterococcus faecium (n = 2, and Enterococcus faecalis (n = 1. The mean follow-up was 69 months (interquartile range 48–72 months. Ten patients (66.7% achieved complete healing of the VGI. A recurrence of the infection was observed in 100% of patients in whom the bypass was not removed. Among patients who did not achieve complete healing, one needed a supracondylar amputation and one died as a consequence of infection. Five patients received treatment with rifampicin in addition to daptomycin and they were all cured. Conclusions: The use of daptomycin and surgery for Gram-positive VGI was effective and well tolerated, and this may be a good alternative for the treatment of VGI in patients with peripheral arterial disease in whom renal insufficiency is common. Keywords: Daptomycin, Gram-positive, Vascular

  5. Antibacterial activity of oregano (Origanum vulgare Linn.) against gram positive bacteria.

    Science.gov (United States)

    Saeed, Sabahat; Tariq, Perween

    2009-10-01

    The present investigation is focused on antibacterial potential of infusion, decoction and essential oil of oregano (Origanum vulgare) against 111 Gram-positive bacterial isolates belonging to 23 different species related to 3 genera. Infusion and essential oil exhibited antibacterial activity against Staphylococcus saprophyticus, S. aureus, Micrococcus roseus, M. kristinae, M. nishinomiyaensis, M. lylae, M. luteus, M. sedentarius, M. varians, Bacillus megaterium, B. thuringiensis, B. alvei, B. circulans, B. brevis, B. coagulans, B. pumilus, B. laterosporus, B. polymyxa, B. macerans, B. subtilis, B. firmus, B. cereus and B. lichiniformis. The infusion exhibited maximum activity against B. laterosporus (17.5 mm mean zone of inhibition+/-1.5 Standard deviation) followed by B. polymyxa (17.0 mm+/-2.0 SD) and essential oil of oregano exhibited maximum activity against S. saprophyticus (16.8 mm+/-1.8 SD) followed by B. circulans (14.5 mm+/-0.5 SD). While all these tested isolates were found resistant to decoction of oregano.

  6. Characterization of Micrococcus luteus and Bacillus marisflavi Recovered from Common Dentex (Dentex dentex Larviculture System

    Directory of Open Access Journals (Sweden)

    T. AKAYLI

    2015-09-01

    Full Text Available In this manuscript, thirty yellow-pigmented Gram-positive bacteria were isolated from natural intestine microflora and from sea water around the marine cage of a rearing tank of common dentex (Dentex dentex, in the Aegean Sea on the Turkish coast and were characterized. Eighteen isolates were assigned to the species Micrococcus luteus, the other twelve to the species Bacillus marisflavi. Eight representative strains, six from B. marisflavi and two from M. luteus, were chosen for further 16S rDNA analyses. A pathogenicity assay for the isolated bacterial strains was carried out in rainbow trout and it evidenced absence of pathogenicity in the tested strains. The isolated strains were tested for in vitro antagonistic activity against Listonella anguillarum, a pathogen bacterium diffused in Mediterranean aquaculture and affecting various fish species. The isolated bacterial strains showed antagonistic activity against the pathogenic bacterium, suggesting a possible role of isolates as probiotics. In this study, for the first time, bacterial strains of the species B. marisflavi, known as an environmental species, were recovered in the gut microbiota of a healthy fish. The use of the isolates characterized in this study, mainly the yellow-pigmented bacterium, is suggested as possible probiotics to improve fish health, along with alternative methods of maintaining a healthy environment.

  7. Selective bowel decontamination results in gram-positive translocation.

    Science.gov (United States)

    Jackson, R J; Smith, S D; Rowe, M I

    1990-05-01

    Colonization by enteric gram-negative bacteria with subsequent translocation is believed to be a major mechanism for infection in the critically ill patient. Selective bowel decontamination (SBD) has been used to control gram-negative infections by eliminating these potentially pathogenic bacteria while preserving anaerobic and other less pathogenic organisms. Infection with gram-positive organisms and anaerobes in two multivisceral transplant patients during SBD led us to investigate the effect of SBD on gut colonization and translocation. Twenty-four rats received enteral polymixin E, tobramycin, amphotericin B, and parenteral cefotaxime for 7 days (PTA + CEF); 23 received parenteral cefotaxime alone (CEF), 19 received the enteral antibiotics alone (PTA), 21 controls received no antibiotics. Cecal homogenates, mesenteric lymph node (MLN), liver, and spleen were cultured. Only 8% of the PTA + CEF group had gram-negative bacteria in cecal culture vs 52% CEF, 84% PTA, and 100% in controls. Log Enterococcal colony counts were higher in the PTA + CEF group (8.0 + 0.9) vs controls (5.4 + 0.4) P less than 0.01. Translocation of Enterococcus to the MLN was significantly increased in the PTA + CEF group (67%) vs controls (0%) P less than 0.01. SBD effectively eliminates gram-negative organisms from the gut in the rat model. Overgrowth and translocation of Enterococcus suggests that infection with gram-positive organisms may be a limitation of SBD.

  8. RNases and Helicases in Gram-Positive Bacteria.

    Science.gov (United States)

    Durand, Sylvain; Condon, Ciaran

    2018-04-01

    RNases are key enzymes involved in RNA maturation and degradation. Although they play a crucial role in all domains of life, bacteria, archaea, and eukaryotes have evolved with their own sets of RNases and proteins modulating their activities. In bacteria, these enzymes allow modulation of gene expression to adapt to rapidly changing environments. Today, >20 RNases have been identified in both Escherichia coli and Bacillus subtilis , the paradigms of the Gram-negative and Gram-positive bacteria, respectively. However, only a handful of these enzymes are common to these two organisms and some of them are essential to only one. Moreover, although sets of RNases can be very similar in closely related bacteria such as the Firmicutes Staphylococcus aureus and B. subtilis , the relative importance of individual enzymes in posttranscriptional regulation in these organisms varies. In this review, we detail the role of the main RNases involved in RNA maturation and degradation in Gram-positive bacteria, with an emphasis on the roles of RNase J1, RNase III, and RNase Y. We also discuss how other proteins such as helicases can modulate the RNA-degradation activities of these enzymes.

  9. Daptomycin: a novel lipopeptide antibiotic against Gram-positive pathogens

    Directory of Open Access Journals (Sweden)

    Andres Beiras-Fernandez

    2010-08-01

    Full Text Available Andres Beiras-Fernandez1,*, Ferdinand Vogt1,*, Ralf Sodian1, Florian Weis21Department of Cardiac Surgery, University Hospital Großhadern, Ludwig-Maximilian-University, Munich, Germany; 2Department of Anesthesiology, University Hospital Großhadern, Ludwig-Maximilian-University, Munich, Germany *Andres Beiras-Fernandez and Ferdinand Vogt contributed equally to this paperAbstract: The aim of this review is to summarize the historical background of drug resistance of Gram-positive pathogens as well as to describe in detail the novel lipopeptide antibiotic daptomycin. Pharmacological and pharmacokinetic aspects are reviewed and the current clinical use of daptomycin is presented. Daptomycin seems to be a reliable drug in the treatment of complicated skin and skin structure infections, infective right-sided endocarditis, and bacteremia caused by Gram-positive agents. Its unique mechanism of action and its low resistance profile, together with its rapid bactericidal action make it a favorable alternative to vancomycin in multi-drug resistant cocci. The role of daptomycin in the treatment of prosthetic material infections, osteomyelitis, and urogenital infections needs to be evaluated in randomized clinical trials.Keywords: daptomycin, multi-drug resistance, methicillin-resistant Staphylococcus aureus (MRSA, pneumonia, urinary tract infection, left-sided endocarditis

  10. Micrococcus lactis sp. nov., isolated from dairy industry waste.

    Science.gov (United States)

    Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh

    2011-12-01

    A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).

  11. Mechanism of action of recombinant acc-royalisin from royal jelly of Asian honeybee against gram-positive bacteria.

    Directory of Open Access Journals (Sweden)

    Lirong Shen

    Full Text Available The antibacterial activity of royalisin, an antimicrobial peptide from the royal jelly produced by honeybees, has been addressed extensively. However, its mechanism of action remains unclear. In this study, a recombinant royalisin, RAcc-royalisin from the royal jelly of Asian honeybee Apis cerana cerana, was expressed by fusing with glutathione S-transferase (GST in Escherichia coli BL21, isolated and purified. The agar dilution assays with inhibition zone showed that RAcc-royalisin, similar to nisin, inhibits the growth of Gram-positive bacteria. The antibacterial activity of RAcc-royalisin was associated with its concentration, and was weakened by heat treatment ranging from 55°C to 85°C for 15 min. Both RAcc-royalisin and nisin exhibited the minimum inhibitory concentrations (MIC of 62.5 µg/ml, 125 µg/ml, and 250 µg/ml against Gram-positive bacterial strains, Bacillus subtilis and Micrococcus flavus and Staphyloccocus aureus in the microplate assay, respectively. However, RAcc-royalisin did not show antimicrobial activity against tested Gram-negative bacterial and fungal strains. The antibacterial activity of RAcc-royalisin agrees well with the decrease in bacterial cell hydrophobicity, the leakage of 260-nm absorbing materials, and the observation by transmission electron microscopy, all indicating that RAcc-royalisin induced the disruption and dysfunction of cell walls and membranes. This is the first report detailing the antibacterial mechanism of royalisin against Gram-positive bacteria, and provides insight into the application of recombinant royalisin in food and pharmaceutical industries as an antimicrobial agent.

  12. DMPD: Cellular reprogramming by gram-positive bacterial components: a review. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16885502 Cellular reprogramming by gram-positive bacterial components: a review. Bu...(.csml) Show Cellular reprogramming by gram-positive bacterial components: a review. PubmedID 16885502 Title... Cellular reprogramming by gram-positive bacterial components: a review. Authors

  13. Polymers for binding of the gram-positive oral pathogen Streptococcus mutans

    Science.gov (United States)

    Magennis, Eugene P.; Francini, Nora; Mastrotto, Francesca; Catania, Rosa; Redhead, Martin; Fernandez-Trillo, Francisco; Bradshaw, David; Churchley, David; Winzer, Klaus; Alexander, Cameron

    2017-01-01

    Streptococcus mutans is the most significant pathogenic bacterium implicated in the formation of dental caries and, both directly and indirectly, has been associated with severe conditions such as multiple sclerosis, cerebrovascular and peripheral artery disease. Polymers able to selectively bind S. mutans and/or inhibit its adhesion to oral tissue in a non-lethal manner would offer possibilities for addressing pathogenicity without selecting for populations resistant against bactericidal agents. In the present work two libraries of 2-(dimethylamino)ethyl methacrylate (pDMAEMA)-based polymers were synthesized with various proportions of either N,N,N-trimethylethanaminium cationic- or sulfobetaine zwitterionic groups. These copolymers where initially tested as potential macromolecular ligands for S. mutans NCTC 10449, whilst Escherichia coli MG1655 was used as Gram-negative control bacteria. pDMAEMA-derived materials with high proportions of zwitterionic repeating units were found to be selective for S. mutans, in both isolated and S. mutans–E. coli mixed bacterial cultures. Fully sulfobetainized pDMAEMA was subsequently found to bind/cluster preferentially Gram-positive S. mutans and S. aureus compared to Gram negative E. coli and V. harveyi. A key initial stage of S. mutans pathogenesis involves a lectin-mediated adhesion to the tooth surface, thus the range of potential macromolecular ligands was further expanded by investigating two glycopolymers bearing α-mannopyranoside and β-galactopyranoside pendant units. Results with these polymers indicated that preferential binding to either S. mutans or E. coli can be obtained by modulating the glycosylation pattern of the chosen multivalent ligands without incurring unacceptable cytotoxicity in a model gastrointestinal cell line. Overall, our results allowed to identify a structure–property relationship for the potential antimicrobial polymers investigated, and suggest that preferential binding to Gram-positive S

  14. Streptococcus mutans: a new Gram-positive paradigm?

    Science.gov (United States)

    Quivey, Robert G.; Koo, Hyun; Abranches, Jacqueline

    2013-01-01

    Despite the enormous contributions of the bacterial paradigms Escherichia coli and Bacillus subtilis to basic and applied research, it is well known that no single organism can be a perfect representative of all other species. However, given that some bacteria are difficult, or virtually impossible, to cultivate in the laboratory, that some are recalcitrant to genetic and molecular manipulation, and that others can be extremely dangerous to manipulate, the use of model organisms will continue to play an important role in the development of basic research. In particular, model organisms are very useful for providing a better understanding of the biology of closely related species. Here, we discuss how the lifestyle, the availability of suitable in vitro and in vivo systems, and a thorough understanding of the genetics, biochemistry and physiology of the dental pathogen Streptococcus mutans have greatly advanced our understanding of important areas in the field of bacteriology such as interspecies biofilms, competence development and stress responses. In this article, we provide an argument that places S. mutans, an organism that evolved in close association with the human host, as a novel Gram-positive model organism. PMID:23393147

  15. High-level fluorescence labeling of gram-positive pathogens.

    Directory of Open Access Journals (Sweden)

    Simone Aymanns

    Full Text Available Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

  16. Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.

    Science.gov (United States)

    Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo

    2009-04-01

    In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.

  17. Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

    Science.gov (United States)

    Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

    2014-01-01

    Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

  18. Probing interaction of Gram-positive and Gram-negative bacterial cells with ZnO nanorods

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Aanchal; Bhargava, Richa; Poddar, Pankaj, E-mail: p.poddar@ncl.res.in

    2013-04-01

    In the present work, the physiological effects of the ZnO nanorods on the Gram positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli and Aerobacter aerogenes) bacterial cells have been studied. The analysis of bacterial growth curves for various concentrations of ZnO nanorods indicates that Gram positive and Gram negative bacterial cells show inhibition at concentrations of ∼ 64 and ∼ 256 μg/mL respectively. The marked difference in susceptibility towards nanorods was also validated by spread plate and disk diffusion methods. In addition, the scanning electron micrographs show a clear damage to the cells via changed morphology of the cells from rod to coccoid etc. The confocal optical microscopy images of these cells also demonstrate the reduction in live cell count in the presence of ZnO nanorods. These, results clearly indicate that the antibacterial activity of ZnO nanorods is higher towards Gram positive bacterium than Gram negative bacterium which indicates that the structure of the cell wall might play a major role in the interaction with nanostructured materials and shows high sensitivity to the particle concentration. Highlights: ► Effect of ZnO nanorods on the growth cycles of four bacterial strains. ► A relation has been established between growth rate of bacteria and concentration. ► Serious damage in the morphology of bacterial cells in the presence of ZnO nanorods. ► Microscopic studies to see the time dependent effect on bacterial cells.

  19. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  20. Microbiological method for radiation sterilization (II). Identification procedure of gram positive bacteria by using BBL CRYSTAL GP identification kit

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko

    2004-01-01

    The part II in this title series describes details of the commercially available BBL CRYSTAL GP Identification Kit with the software (Becton, Dickinson and Co., Ltd.), by which identification of Gram positive bacteria as well as their number becoming easier in the radiation sterilization of medical devices. Isolation of a bacterium has to be confirmed by microscopy and its Gram positive property, by the Gram staining. The exponentially growing bacteria are to be inoculated in the Kit and cultured for 18-24 hr at 37 deg C with the lid attached by substrates for identification. Reactions to substrates are to be judged by CRYSTAL auto-reader, which is further to be searched by the computer software (code-book) for final identification. For possible misidentification, re-isolation of the bacterium, prolonged culture, concentrated inoculation and re-consideration for ranking of identification the software provides are necessary as well as other identification approaches. Representative bacteria as the bioburden are spp. of Bacilli, Corynebacteria, Staphylococci and Micrococci. (N.I.)

  1. Bio sorption of some Rare Earth Elements and Yttrium by Gram Positive and Gram Negative Bacteria

    International Nuclear Information System (INIS)

    Ibrahim, H.A.

    2012-01-01

    The separate bio sorption of the REEs La, Sm, Eu and Dy together with yttrium upon the Gram positive bacteria Bacillus subtilis (B.subtilis) and Bacillus Licheniformis (B. Licheniformis),the Gram negative bacterium Escherichia coli (E. coli ) and Saccharomyces cervisiae (Yeast) was studied. The revelant factors of ph 1-6, contact time (30-180 min), the initial rare earth concentration (50-200 mg/l) have been studied. The amount of the accumulated element was strongly affected by its concentration.In addition, bio sorptive fractionation of Y and the studied REEs from a solution containing a mixture of these elements was also studied. From the obtained data, it was found that Langmuir isotherm model for both B.licheniformis and E.coli gives a best fit for the studied elements over the working range of concentration (50-200 mg/I). Transmission electron microscopy exhibited accumulation throughout the bacterial cell with some granular deposits in both the cell periphery and cytoplasm

  2. Gram-positive rods prevailing in teeth with apical periodontitis undergoing root canal treatment.

    Science.gov (United States)

    Chávez de Paz, L E; Molander, A; Dahlén, G

    2004-09-01

    To identify Gram-positive rods from root canals of teeth with apical periodontitis and to examine their associations with other species. Consecutive root canal samples (RCSs) from 139 teeth undergoing root canal treatment were analyzed prospectively for cultivable microbes. Gram-positive rods in the first RCS submitted after chemo-mechanical preparation were categorised to genus level by selective media and gas-liquid chromatography (GLC), and identified to species level by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Associations between organisms were measured by odds ratios (OR). In the first samples submitted a total of 158 Gram-positive rods, 115 Gram-positive cocci, 26 Gram-negative rods and 9 Gram-negative cocci, were identified. At genus levels Gram-positive rods were classified into: Lactobacillus spp. (38%), Olsenella spp. (18%), Propionibacterium spp. (13%), Actinomyces spp. (12%), Bifidobacterium spp. (13%) and Eubacterium spp. (6%). The most frequent species were Olsenella uli, Lactobacillus paracasei and Propionibacterium propionicum. In subsequent samples taken during treatment, Gram-positive rods were also identified, although the number of strains was considerably reduced. Positive associations were observed between members of the genus lactobacilli and Gram-positive cocci (OR>2). Olsenella uli and Lactobacillus spp. predominated over other Gram-positive rods. A possible association exists between Lactobacillus spp. and Gram-positive cocci in root canals of teeth with apical periodontitis receiving treatment.

  3. Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Beatriz García

    2016-11-01

    Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

  4. Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

    Science.gov (United States)

    García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

    2016-01-01

    The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

  5. European surveillance study on antimicrobial susceptibility of Gram-positive anaerobic cocci

    DEFF Research Database (Denmark)

    Brazier, J; Chmelar, D; Dubreuil, L

    2008-01-01

    Gram-positive anaerobic cocci (GPAC) are a heterogeneous group of microorganisms frequently isolated from local and systemic infections. In this study, the antimicrobial susceptibilities of clinical strains isolated in 10 European countries were investigated. After identification of 299 GPAC...

  6. Cystic neutrophilic granulomatous mastitis: an underappreciated pattern strongly associated with gram-positive bacilli.

    Science.gov (United States)

    Renshaw, Andrew A; Derhagopian, Robert P; Gould, Edwin W

    2011-09-01

    Although granulomatous lobular mastitis is associated with gram-positive bacilli such as Corynebacterium, this association is not well known. We report 3 cases of mastitis caused by gram-positive bacilli. All 3 abscesses were suppurative with distinct enlarged cystic spaces in which rare gram-positive bacilli were identified. Two cases were also granulomatous. Cultures in all 3 cases were negative. All 3 patients recovered after biopsy and tetracycline-based therapy. Infection in the breast by gram-positive bacilli is associated with a distinct histologic pattern, including cystic spaces in the setting of neutrophilic/granulomatous inflammation that can be recognized and should prompt careful search for the organism within enlarged vacuoles.

  7. A classification system for plasmids from Enterococci and other Gram-positive bacteria

    DEFF Research Database (Denmark)

    Jensen, Lars Bogø; Garcia-Migura, Lourdes; Valenzuela, Antonio Jesus Sanchez

    2010-01-01

    A classification system for plasmids isolated from enterococci and other Gram-positive bacteria was developed based on 111 published plasmid sequences from enterococci and other Gram-positive bacteria; mostly staphylococci. Based on PCR amplification of conserved areas of the replication initiating....... Furthermore, conjugation experiments were performed obtaining 30 transconjugants when selecting for antimicrobial resistance. Among them 19 gave no positive amplicons indicating presence of rep-families not tested for in this experimental setup....

  8. Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract.

    Science.gov (United States)

    Kline, Kimberly A; Lewis, Amanda L

    2016-04-01

    Gram-positive bacteria are a common cause of urinary-tract infection (UTI), particularly among individuals who are elderly, pregnant, or who have other risk factors for UTI. Here we review the epidemiology, virulence mechanisms, and host response to the most frequently isolated Gram-positive uropathogens: Staphylococcus saprophyticus, Enterococcus faecalis, and Streptococcus agalactiae. We also review several emerging, rare, misclassified, and otherwise underreported Gram-positive pathogens of the urinary tract including Aerococcus, Corynebacterium, Actinobaculum, and Gardnerella. The literature strongly suggests that urologic diseases involving Gram-positive bacteria may be easily overlooked due to limited culture-based assays typically utilized for urine in hospital microbiology laboratories. Some UTIs are polymicrobial in nature, often involving one or more Gram-positive bacteria. We herein review the risk factors and recent evidence for mechanisms of bacterial synergy in experimental models of polymicrobial UTI. Recent experimental data has demonstrated that, despite being cleared quickly from the bladder, some Gram-positive bacteria can impact pathogenic outcomes of co-infecting organisms. When taken together, the available evidence argues that Gram-positive bacteria are important uropathogens in their own right, but that some can be easily overlooked because they are missed by routine diagnostic methods. Finally, a growing body of evidence demonstrates that a surprising variety of fastidious Gram-positive bacteria may either reside in or be regularly exposed to the urinary tract and further suggests that their presence is widespread among women, as well as men. Experimental studies in this area are needed; however, there is a growing appreciation that the composition of bacteria found in the bladder could be a potentially important determinant in urologic disease, including susceptibility to UTI.

  9. Protein synthesis in vitro by Micrococcus luteus.

    Science.gov (United States)

    Farwell, M A; Rabinowitz, J C

    1991-01-01

    Bacillus subtilis and related gram-positive bacteria which have low to moderate genomic G + C contents are unable to efficiently translate mRNA derived from gram-negative bacteria, whereas Escherichia coli and other gram-negative bacteria are able to translate mRNA from both types of organisms. This phenomenon has been termed translational species specificity. Ribosomes from the low-G + C-content group (low-G + C group) of gram-positive organisms (B. subtilis and relatives) lack an equivalent to Escherichia ribosomal protein S1. The requirement for S1 for translation in E. coli (G. van Dieijen, P. H. van Knippenberg, J. van Duin, B. Koekman, and P. H. Pouwels, Mol. Gen. Genet. 153:75-80, 1977) and its specific role (A.R. Subramanian, Trends Biochem. Sci. 9:491-494, 1984) have been proposed. The group of gram-positive bacteria characterized by high genomic G + C content (formerly Actinomyces species and relatives) contain S1, in contrast to the low-G + C group (K. Mikulik, J. Smardova, A. Jiranova, and P. Branny, Eur. J. Biochem. 155:557-563, 1986). It is not known whether members of the high-G + C group are translationally specific, although there is evidence that one genus, Streptomyces, can express Escherichia genes in vivo (M. J. Bibb and S. N. Cohen, Mol. Gen. Genet. 187:265-277, 1985; J. L. Schottel, M. J. Bibb, and S. N. Cohen, J. Bacteriol. 146:360-368, 1981). In order to determine whether the organisms of this group are translationally specific, we examined the in vitro translational characteristics of a member of the high-G + C group, Micrococcus luteus, whose genomic G + C content is 73%. A semipurified coupled transcription-translation system of M. luteus translates Escherichia mRNA as well as Bacillus and Micrococcus mRNA. Therefore, M. luteus is translationally nonspecific and resembles E. coli rather than B. subtilis in its translational characteristics. Images PMID:2045372

  10. Cardiolipin, a major phospholipid of gram-positive bacteria that is not readily extractable

    NARCIS (Netherlands)

    Filgueiras, M.H.; Kamp, J.A.F. op den

    1980-01-01

    Extraction of phospholipids from stationary phase grown cells of the Gram+ bacteria, Bacillus megaterium, Bacillus subtilis, Bacillus cereus and Micrococcus lysodeikticus was found to be incomplete with various commonly used extraction procedures. Phosphatidylglycerol and phosphatidyl-ethanolamine

  11. Clinical update on linezolid in the treatment of Gram-positive bacterial infections

    Science.gov (United States)

    Ager, Sally; Gould, Kate

    2012-01-01

    Gram-positive pathogens are a significant cause of morbidity and mortality in both community and health care settings. Glycopeptides have traditionally been the antibiotics of choice for multiresistant Gram-positive pathogens but there are problems with their use, including the emergence of glycopeptide-resistant strains, tissue penetration, and achieving and monitoring adequate serum levels. Newer antibiotics such as linezolid, a synthetic oxazolidinone, are available for the treatment of resistant Gram-positive bacteria. Linezolid is active against a wide range of Gram-positive bacteria and has been generally available for the treatment of Gram-positive infections since 2000. There are potential problems with linezolid use, including its bacteriostatic action and the relatively high incidence of reported adverse effects, particularly with long-term use. Long-term use may also be complicated by the development of resistance. However, linezolid has been shown to be clinically useful in the treatment of several serious infections where traditionally bacteriocidal agents have been required and many of its adverse effects are reversible on cessation. It has also been shown to be a cost-effective treatment option in several studies, with its high oral bioavailability allowing an early change from intravenous to oral formulations with consequent earlier patient discharge and lower inpatient costs. PMID:22787406

  12. Relative roles of the cellular and humoral responses in the Drosophila host defense against three gram-positive bacterial infections.

    Directory of Open Access Journals (Sweden)

    Nadine T Nehme

    2011-03-01

    Full Text Available Two NF-kappaB signaling pathways, Toll and immune deficiency (imd, are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense.In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus, we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival--independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response.Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen.

  13. Structure of FabH and factors affecting the distribution of branched fatty acids in Micrococcus luteus

    International Nuclear Information System (INIS)

    Pereira, Jose H.; Goh, Ee-Been; Keasling, Jay D.; Beller, Harry R.; Adams, Paul D.

    2012-01-01

    In an effort to better understand the control of the formation of branched fatty acids in Micrococcus luteus, the structure of β-ketoacyl-ACP synthase III, which catalyzes the initial step of fatty-acid biosynthesis, has been determined. Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition

  14. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  15. In vitro activity of daptomycin against clinical isolates of Gram-positive bacteria.

    Science.gov (United States)

    Piper, Kerryl E; Steckelberg, James M; Patel, Robin

    2005-08-01

    We determined the activity of daptomycin, a recently FDA-approved antimicrobial agent, against clinical isolates of Gram-positive bacteria, including viridans group streptococci (16 Streptococcus mitis species group, 12 S. mutans species group, 9 S. anginosus species group, 8 S. sanguinis species group, 5 S. salivarius species group) from patients with infective endocarditis, 32 methicillin-resistant Staphylococcus aureus, 32 high-level penicillin-resistant Streptococcus pneumoniae, 38 vancomycin-resistant enterococci (including 1 linezolid-resistant isolate), and the following unusual Gram-positive bacteria: 3 Listeria monocytogenes, 4 Erysipelothrix rhusiopathiae, 9 Corynebacterium species, 10 Abiotrophia/Granulicatella species, 2 Rothia (Stomatococcus) mucilaginosus, and 4 Gemella morbillorum. Daptomycin minimum inhibitory concentration (MIC)(90) values for the viridans group streptococci, methicillin-resistant S. aureus, penicillin-resistant S. pneumoniae, and Enterococcus species were 0.5, 0.5, endocarditis as well as against several types of unusual Gram-positive bacteria that can cause endocarditis.

  16. Flavins mediate extracellular electron transfer in Gram-positive Bacillus megaterium strain LLD-1

    DEFF Research Database (Denmark)

    You, Le-Xing; Liu, Li-Dan; Xiao, Yong

    2018-01-01

    The extracellular electron transfer (EET) mechanism of an isolated Gram-positive Bacillus megaterium strain (LLD-1), identified by 16S rRNA gene sequencing and physiological analysis, was investigated in the present study. The electrochemical activity of strain LLD-1 was confirmed by electrochemi...

  17. Tribolium castaneum defensins are primarily active against Gram-positive bacteria

    Czech Academy of Sciences Publication Activity Database

    Tonk, M.; Knorr, E.; Cabezas-Cruz, A.; Valdés, James J.; Kollewe, C.; Vilcinskas, A.

    2015-01-01

    Roč. 132, NOV 2015 (2015), s. 208-215 ISSN 0022-2011 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Antimicrobial peptides * Defensin * Innate immunity * Insects * Tribolium castaneum * Gram-positive bacteria Subject RIV: EI - Biotechnology ; Bionics Impact factor: 2.198, year: 2015

  18. Identification of aerobic Gram-positive bacilli by use of Vitek MS.

    Science.gov (United States)

    Navas, Maria; Pincus, David H; Wilkey, Kathy; Sercia, Linda; LaSalvia, Margaret; Wilson, Deborah; Procop, Gary W; Richter, Sandra S

    2014-04-01

    The accuracy of Vitek MS mass spectrometric identifications was assessed for 206 clinically significant isolates of aerobic Gram-positive bacilli representing 20 genera and 38 species. The Vitek MS identifications were correct for 85% of the isolates (56.3% to the species level, 28.6% limited to the genus level), with misidentifications occurring for 7.3% of the isolates.

  19. Procalcitonin levels in gram-positive, gram-negative, and fungal bloodstream infections.

    Science.gov (United States)

    Leli, Christian; Ferranti, Marta; Moretti, Amedeo; Al Dhahab, Zainab Salim; Cenci, Elio; Mencacci, Antonella

    2015-01-01

    Procalcitonin (PCT) can discriminate bacterial from viral systemic infections and true bacteremia from contaminated blood cultures. The aim of this study was to evaluate PCT diagnostic accuracy in discriminating Gram-positive, Gram-negative, and fungal bloodstream infections. A total of 1,949 samples from patients with suspected bloodstream infections were included in the study. Median PCT value in Gram-negative (13.8 ng/mL, interquartile range (IQR) 3.4-44.1) bacteremias was significantly higher than in Gram-positive (2.1 ng/mL, IQR 0.6-7.6) or fungal (0.5 ng/mL, IQR 0.4-1) infections (P Gram-negatives from Gram-positives at the best cut-off value of 10.8 ng/mL and an AUC of 0.944 (95% CI 0.919-0.969, P Gram-negatives from fungi at the best cut-off of 1.6 ng/mL. Additional results showed a significant difference in median PCT values between Enterobacteriaceae and nonfermentative Gram-negative bacteria (17.1 ng/mL, IQR 5.9-48.5 versus 3.5 ng/mL, IQR 0.8-21.5; P Gram-negative from Gram-positive and fungal bloodstream infections. Nevertheless, its utility to predict different microorganisms needs to be assessed in further studies.

  20. Protamine-induced permeabilization of cell envelopes of gram-positive and gram-negative bacteria

    DEFF Research Database (Denmark)

    Johansen, Charlotte; Verheul, A.; Gram, Lone

    1997-01-01

    carboxyfluorescein and ATP after 2 to 5 min. Maximum antibacterial activity was reached at alkaline pH and in the absence of divalent cations. The efficient permeabilization of cell envelopes of both gram-positive and gram-negative bacteria suggests that protamine causes a general disruption of the cell envelope...

  1. Gram-negative, but not Gram-positive, bacteria elicit strong PGE2 production in human monocytes.

    Science.gov (United States)

    Hessle, Christina C; Andersson, Bengt; Wold, Agnes E

    2003-12-01

    Gram-positive and Gram-negative bacteria induce different cytokine patterns in human mononuclear cells. We have seen that Gram-positives preferentially induce IL-12 and TNF-alpha, whereas Gram-negatives induce more IL-10, IL-6, and IL-8. In this study, we compared the capacity of these two groups of bacteria to induce PGE2. Monocytes stimulated with Gram-negative bacterial species induced much more PGE2 than did Gram-positive bacteria (5600 +/- 330 vs. 1700 +/- 670 pg/mL, p Gram-positive and Gram-negative bacteria. We suggest that Gram-positive and Gram-negative bacteria may stimulate different innate effector functions; Gram-positive bacteria promoting cell-mediated effector functions whereas Gram-negative bacteria inducing mediators inhibiting the same.

  2. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

    Science.gov (United States)

    Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

    2016-01-01

    SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

  3. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression.

    Science.gov (United States)

    Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten

    2016-12-01

    Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. Resistance of Gram-positive bacteria to nisin is not determined by Lipid II levels

    NARCIS (Netherlands)

    Kramer, NE; Smid, EJ; Kok, J; de Kruijff, B; Kuipers, OP; Breukink, E; Kramer, Naomi E.; Smid, Eddy J.

    2004-01-01

    Lipid II is essential for nisin-mediated pore formation at nano-molar concentrations. We tested whether nisin resistance could result from different Lipid II levels, by comparing the maximal Lipid II pool in Micrococcus flavus (sensitive) and Listeria monocytogenes (relatively insensitive) and their

  5. Linezolid: a promising option in the treatment of Gram-positives.

    Science.gov (United States)

    Zahedi Bialvaei, Abed; Rahbar, Mohammad; Yousefi, Mehdi; Asgharzadeh, Mohammad; Samadi Kafil, Hossein

    2017-02-01

    Linezolid, an oxazolidinone antimicrobial agent that acts by inhibiting protein synthesis in a unique fashion, is used in the treatment of community-acquired pneumonia, skin and soft-tissue infections and other infections caused by Gram-positive bacteria including VRE and methicillin-resistant staphylococci. Currently, linezolid resistance among these pathogens remains low, commonly linezolid susceptibility testing for this important agent and should be taken into account when considering its therapeutic use. Considering the importance of linezolid in the treatment of infections caused by Gram-positive bacteria, this review was undertaken to optimize the clinical use of this antibiotic. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Electrochemical reduction of oxygen catalyzed by a wide range of bacteria including Gram-positive

    Energy Technology Data Exchange (ETDEWEB)

    Cournet, Amandine [Universite de Toulouse, UPS, LU49, Adhesion Bacterienne et Formation de Biofilms, 35 chemin des Maraichers, 31 062 Toulouse cedex 09 (France); Laboratoire de Genie Chimique CNRS, Universite de Toulouse, 4 allee Emile Monso, BP 84234, 31432 Toulouse cedex 04 (France); Delia, Marie-Line; Bergel, Alain [Laboratoire de Genie Chimique CNRS, Universite de Toulouse, 4 allee Emile Monso, BP 84234, 31432 Toulouse cedex 04 (France); Roques, Christine; Berge, Mathieu [Universite de Toulouse, UPS, LU49, Adhesion Bacterienne et Formation de Biofilms, 35 chemin des Maraichers, 31 062 Toulouse cedex 09 (France)

    2010-04-15

    Most bacteria known to be electrochemically active have been harvested in the anodic compartments of microbial fuel cells (MFCs) and are able to use electrodes as electron acceptors. The reverse phenomenon, i.e. using solid electrodes as electron donors, is not so widely studied. To our knowledge, most of the electrochemically active bacteria are Gram-negative. The present study implements a transitory electrochemical technique (cyclic voltammetry) to study the microbial catalysis of the electrochemical reduction of oxygen. It is demonstrated that a wide range of aerobic and facultative anaerobic bacteria are able to catalyze oxygen reduction. Among these electroactive bacteria, several were Gram-positive. The transfer of electrons was direct since no activity was obtained with the filtrate. These findings, showing a widespread property among bacteria including Gram-positive ones, open new and interesting routes in the field of electroactive bacteria research. (author)

  7. A synbio approach for selection of highly expressed gene variants in Gram-positive bacteria

    DEFF Research Database (Denmark)

    Ferro, Roberto; Rennig, Maja; Hernández Rollán, Cristina

    2018-01-01

    with a long history in food fermentation. We have developed a synbio approach for increasing gene expression in two Gram-positive bacteria. First of all, the gene of interest was coupled to an antibiotic resistance gene to create a growth-based selection system. We then randomised the translation initiation...... region (TIR) preceding the gene of interest and selected clones that produced high protein titres, as judged by their ability to survive on high concentrations of antibiotic. Using this approach, we were able to significantly increase production of two industrially relevant proteins; sialidase in B....... subtilis and tyrosine ammonia lyase in L. lactis. Gram-positive bacteria are widely used to produce industrial enzymes. High titres are necessary to make the production economically feasible. The synbio approach presented here is a simple and inexpensive way to increase protein titres, which can be carried...

  8. Mid-infrared spectroscopic assessment of nanotoxicity in gram-negative vs. gram-positive bacteria.

    Science.gov (United States)

    Heys, Kelly A; Riding, Matthew J; Strong, Rebecca J; Shore, Richard F; Pereira, M Glória; Jones, Kevin C; Semple, Kirk T; Martin, Francis L

    2014-03-07

    Nanoparticles appear to induce toxic effects through a variety of mechanisms including generation of reactive oxygen species (ROS), physical contact with the cell membrane and indirect catalysis due to remnants from manufacture. The development and subsequent increasing usage of nanomaterials has highlighted a growing need to characterize and assess the toxicity of nanoparticles, particularly those that may have detrimental health effects such as carbon-based nanomaterials (CBNs). Due to interactions of nanoparticles with some reagents, many traditional toxicity tests are unsuitable for use with CBNs. Infrared (IR) spectroscopy is a non-destructive, high throughput technique, which is unhindered by such problems. We explored the application of IR spectroscopy to investigate the effects of CBNs on Gram-negative (Pseudomonas fluorescens) and Gram-positive (Mycobacterium vanbaalenii PYR-1) bacteria. Two types of IR spectroscopy were compared: attenuated total reflection Fourier-transform infrared (ATR-FTIR) and synchrotron radiation-based FTIR (SR-FTIR) spectroscopy. This showed that Gram-positive and Gram-negative bacteria exhibit differing alterations when exposed to CBNs. Gram-positive bacteria appear more resistant to these agents and this may be due to the protection afforded by their more sturdy cell wall. Markers of exposure also vary according to Gram status; Amide II was consistently altered in Gram-negative bacteria and carbohydrate altered in Gram-positive bacteria. ATR-FTIR and SR-FTIR spectroscopy could both be applied to extract biochemical alterations induced by each CBN that were consistent across the two bacterial species; these may represent potential biomarkers of nanoparticle-induced alterations. Vibrational spectroscopy approaches may provide a novel means of fingerprinting the effects of CBNs in target cells.

  9. Transformation and Stability of Cloned Polysaccharidase Genes in Gram-Positive Bacteria

    OpenAIRE

    EKİNCİ, Mehmet Sait

    2014-01-01

    Polysaccharidase genes from rumen bacteria were transferred to and expressed in ruminal and non-ruminal Gram-positive bacteria. The transformation efficiency and genetic stability of polysaccharidase genes in bacteria from different habitats were investigated. PCR amplification of cloned polysaccharidase genes from Escherichia coli, Lactococcus lactis, Enterococcus faecalis, Streptococcus sanguis and S. bovis strain 26 showed that rearrangement of plasmid and the gene fragment did not occur. ...

  10. Widespread abundance of functional bacterial amyloid in Mycolata and other Gram-positive bacteria

    DEFF Research Database (Denmark)

    Jordal, Peter Bruun; Dueholm, Morten Simonsen; Larsen, Poul

    2009-01-01

    extracellular fibrils were also produced. In three cases, FuBA was only revealed after extensive removal of extracellular material by saponification, indicating an integrated attachment within the cellular envelope. Spores from species within the genera Streptomyces, Bacillus and Nocardia were all coated...... analysis. We conclude that amyloid is widespread among Gram-positive bacteria and may in many species constitute a hitherto overlooked integral part of the spores and the cellular envelope....

  11. Procalcitonin Levels in Gram-Positive, Gram-Negative, and Fungal Bloodstream Infections

    Directory of Open Access Journals (Sweden)

    Christian Leli

    2015-01-01

    Full Text Available Procalcitonin (PCT can discriminate bacterial from viral systemic infections and true bacteremia from contaminated blood cultures. The aim of this study was to evaluate PCT diagnostic accuracy in discriminating Gram-positive, Gram-negative, and fungal bloodstream infections. A total of 1,949 samples from patients with suspected bloodstream infections were included in the study. Median PCT value in Gram-negative (13.8 ng/mL, interquartile range (IQR 3.4–44.1 bacteremias was significantly higher than in Gram-positive (2.1 ng/mL, IQR 0.6–7.6 or fungal (0.5 ng/mL, IQR 0.4–1 infections (P<0.0001. Receiver operating characteristic analysis showed an area under the curve (AUC for PCT of 0.765 (95% CI 0.725–0.805, P<0.0001 in discriminating Gram-negatives from Gram-positives at the best cut-off value of 10.8 ng/mL and an AUC of 0.944 (95% CI 0.919–0.969, P<0.0001 in discriminating Gram-negatives from fungi at the best cut-off of 1.6 ng/mL. Additional results showed a significant difference in median PCT values between Enterobacteriaceae and nonfermentative Gram-negative bacteria (17.1 ng/mL, IQR 5.9–48.5 versus 3.5 ng/mL, IQR 0.8–21.5; P<0.0001. This study suggests that PCT may be of value to distinguish Gram-negative from Gram-positive and fungal bloodstream infections. Nevertheless, its utility to predict different microorganisms needs to be assessed in further studies.

  12. Recovery of vancomycin-resistant gram-positive cocci from children.

    OpenAIRE

    Green, M; Wadowsky, R M; Barbadora, K

    1990-01-01

    A cross-sectional survey of vancomycin-resistant gram-positive cocci (VRGPC) in the feces of children was initiated after several bacteremic infections with these organisms occurred at our hospital. A selective medium consisting of colistin-nalidixic acid agar, 5% sheep blood, vancomycin (5 mg/liter), and amphotericin B (8 mg/liter) was developed to isolate VRGPC. A single stool specimen submitted to the clinical microbiology laboratory from each of 48 patients was inoculated onto the medium....

  13. Gram-positive bacterial lipoglycans based on a glycosylated diacylglycerol lipid anchor are microbe-associated molecular patterns recognized by TLR2.

    Directory of Open Access Journals (Sweden)

    Landry Blanc

    Full Text Available Innate immune recognition is the first line of host defense against invading microorganisms. It is a based on the detection, by pattern recognition receptors (PRRs, of invariant molecular signatures that are unique to microorganisms. TLR2 is a PRR that plays a major role in the detection of Gram-positive bacteria by recognizing cell envelope lipid-linked polymers, also called macroamphiphiles, such as lipoproteins, lipoteichoic acids and mycobacterial lipoglycans. These microbe-associated molecular patterns (MAMPs display a structure based on a lipid anchor, being either an acylated cysteine, a glycosylated diacylglycerol or a mannosyl-phosphatidylinositol respectively, and having in common a diacylglyceryl moiety. A fourth class of macroamphiphile, namely lipoglycans, whose lipid anchor is made, as for lipoteichoic acids, of a glycosylated diacylglycerol unit rather than a mannosyl-phosphatidylinositol, is found in Gram-positive bacteria and produced by certain Actinobacteria, including Micrococcus luteus, Stomatococcus mucilaginosus and Corynebacterium glutamicum. We report here that these alternative lipoglycans are also recognized by TLR2 and that they stimulate TLR2-dependant cytokine production, including IL-8, TNF-α and IL-6, and cell surface co-stimulatory molecule CD40 expression by a human macrophage cell line. However, they differ by their co-receptor requirement and the magnitude of the innate immune response they elicit. M. luteus and S. mucilaginosus lipoglycans require TLR1 for recognition by TLR2 and induce stronger responses than C. glutamicum lipoglycan, sensing of which by TLR2 is dependent on TLR6. These results expand the repertoire of MAMPs recognized by TLR2 to lipoglycans based on a glycosylated diacylglycerol lipid anchor and reinforce the paradigm that macroamphiphiles based on such an anchor, including lipoteichoic acids and alternative lipoglycans, induce TLR2-dependant innate immune responses.

  14. Blue green alga mediated synthesis of gold nanoparticles and its antibacterial efficacy against Gram positive organisms

    Energy Technology Data Exchange (ETDEWEB)

    Uma Suganya, K.S. [Centre for Ocean Research, Sathyabama University, Chennai 600 119 (India); Govindaraju, K., E-mail: govindtu@gmail.com [Centre for Ocean Research, Sathyabama University, Chennai 600 119 (India); Ganesh Kumar, V.; Stalin Dhas, T.; Karthick, V. [Centre for Ocean Research, Sathyabama University, Chennai 600 119 (India); Singaravelu, G. [Nanoscience Division, Department of Zoology, Thiruvalluvar University, Vellore 632115 (India); Elanchezhiyan, M. [Department of Microbiology, Dr ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Chennai 600113 (India)

    2015-02-01

    Biofunctionalized gold nanoparticles (AuNPs) play an important role in design and development of nanomedicine. Synthesis of AuNPs from biogenic materials is environmentally benign and possesses high bacterial inhibition and bactericidal properties. In the present study, blue green alga Spirulina platensis protein mediated synthesis of AuNPs and its antibacterial activity against Gram positive bacteria is discussed. AuNPs were characterized using Ultraviolet–visible (UV–vis) spectroscopy, Fluorescence spectroscopy, Fourier Transform-Infrared (FTIR) spectroscopy, Raman spectroscopy, High Resolution-Transmission Electron Microscopy (HR-TEM) and Energy Dispersive X-ray analysis (EDAX). Stable, well defined AuNPs of smaller and uniform shape with an average size of ∼ 5 nm were obtained. The antibacterial efficacy of protein functionalized AuNPs were tested against Gram positive organisms Bacillus subtilis and Staphylococcus aureus. - Highlights: • Size controlled synthesis of gold nanoparticles from blue green alga Spirulina platensis • Stability of gold nanoparticles at different temperatures • Potent antibacterial efficacy against Gram positive organisms.

  15. A synbio approach for selection of highly expressed gene variants in Gram-positive bacteria.

    Science.gov (United States)

    Ferro, Roberto; Rennig, Maja; Hernández-Rollán, Cristina; Daley, Daniel O; Nørholm, Morten H H

    2018-03-08

    The market for recombinant proteins is on the rise, and Gram-positive strains are widely exploited for this purpose. Bacillus subtilis is a profitable host for protein production thanks to its ability to secrete large amounts of proteins, and Lactococcus lactis is an attractive production organism with a long history in food fermentation. We have developed a synbio approach for increasing gene expression in two Gram-positive bacteria. First of all, the gene of interest was coupled to an antibiotic resistance gene to create a growth-based selection system. We then randomised the translation initiation region (TIR) preceding the gene of interest and selected clones that produced high protein titres, as judged by their ability to survive on high concentrations of antibiotic. Using this approach, we were able to significantly increase production of two industrially relevant proteins; sialidase in B. subtilis and tyrosine ammonia lyase in L. lactis. Gram-positive bacteria are widely used to produce industrial enzymes. High titres are necessary to make the production economically feasible. The synbio approach presented here is a simple and inexpensive way to increase protein titres, which can be carried out in any laboratory within a few days. It could also be implemented as a tool for applications beyond TIR libraries, such as screening of synthetic, homologous or domain-shuffled genes.

  16. Gram positive and Gram negative bacteria differ in their sensitivity to cold plasma

    Science.gov (United States)

    Mai-Prochnow, Anne; Clauson, Maryse; Hong, Jungmi; Murphy, Anthony B.

    2016-12-01

    Cold atmospheric-pressure plasma (CAP) is a relatively new method being investigated for antimicrobial activity. However, the exact mode of action is still being explored. Here we report that CAP efficacy is directly correlated to bacterial cell wall thickness in several species. Biofilms of Gram positive Bacillus subtilis, possessing a 55.4 nm cell wall, showed the highest resistance to CAP, with less than one log10 reduction after 10 min treatment. In contrast, biofilms of Gram negative Pseudomonas aeruginosa, possessing only a 2.4 nm cell wall, were almost completely eradicated using the same treatment conditions. Planktonic cultures of Gram negative Pseudomonas libanensis also had a higher log10 reduction than Gram positive Staphylococcus epidermidis. Mixed species biofilms of P. aeruginosa and S. epidermidis showed a similar trend of Gram positive bacteria being more resistant to CAP treatment. However, when grown in co-culture, Gram negative P. aeruginosa was more resistant to CAP overall than as a mono-species biofilm. Emission spectra indicated OH and O, capable of structural cell wall bond breakage, were present in the plasma. This study indicates that cell wall thickness correlates with CAP inactivation times of bacteria, but cell membranes and biofilm matrix are also likely to play a role.

  17. Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.

    Science.gov (United States)

    Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun

    2009-05-01

    A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).

  18. Metabolic versatility of Gram-positive microbial isolates from contaminated river sediments

    International Nuclear Information System (INIS)

    Narancic, Tanja; Djokic, Lidija; Kenny, Shane T.; O’Connor, Kevin E.; Radulovic, Vanja; Nikodinovic-Runic, Jasmina; Vasiljevic, Branka

    2012-01-01

    Highlights: ► Thirty-four isolated Gram-positive bacteria could degrade wide range of aromatic pollutants. ► Nine isolates could grow in the presence of extremely high levels of heavy metals. ► Twelve isolates accumulated polyphosphate, 3 polyhydroxybutyrate, 4 exopolysaccharides. ► The incidence of multiple antibiotic resistance markers among isolates was low. - Abstract: Gram-positive bacteria from river sediments affected by the proximity of a petrochemical industrial site were isolated and characterized with respect to their ability to degrade a wide range of aromatic compounds. In this study we identified metabolically diverse Gram-positive bacteria capable of growth on wide range aromatic compounds in the presence of heavy metals and with the ability to accumulate biopolymers. Thirty-four isolates that were able to use 9 or more common aromatic pollutants, such as benzene, biphenyl, naphthalene etc. as a sole source of carbon and energy included members of Bacillus, Arthrobacter, Rhodococcus, Gordonia, Streptomyces, and Staphylococcus genus. Rhodococcus sp. TN105, Gordonia sp. TN103 and Arthrobacter sp. TN221 were identified as novel strains. Nine isolates were able to grow in the presence of one or more metals (mercury, cadmium, nickel) at high concentration (100 mM). Seven isolates could degrade 15 different aromatic compounds and could grow in the presence of one or more heavy metals. Two of these isolates were resistant to multiple antibiotics including erythromycin and nalidixic acid. One third of isolates could accumulate at least one biopolymer. Twelve isolates (mainly Bacillus sp. and Arthrobacter sp.) accumulated polyphosphate, 3 Bacillus sp. accumulated polyhydroxybutyrate, while 4 isolates could accumulate exopolysaccharides.

  19. Fighting infections due to multidrug-resistant Gram-positive pathogens.

    Science.gov (United States)

    Cornaglia, G

    2009-03-01

    Growing bacterial resistance in Gram-positive pathogens means that what were once effective and inexpensive treatments for infections caused by these bacteria are now being seriously questioned, including penicillin and macrolides for use against pneumococcal infections and-in hospitals-oxacillin for use against staphylococcal infections. As a whole, multidrug-resistant (MDR) Gram-positive pathogens are rapidly becoming an urgent and sometimes unmanageable clinical problem. Nevertheless, and despite decades of research into the effects of antibiotics, the actual risk posed to human health by antibiotic resistance has been poorly defined; the lack of reliable data concerning the outcomes resulting from antimicrobial resistance stems, in part, from problems with study designs and the methods used in resistence determination. Surprisingly little is known, too, about the actual effectiveness of the many types of intervention aimed at controlling antibiotic resistance. New antibiotics active against MDR Gram-positive pathogens have been recently introduced into clinical practice, and the antibiotic pipeline contains additional compounds at an advanced stage of development, including new glycopeptides, new anti-methicillin-resistant Staphylococcus aureus (MRSA) beta-lactams, and new diaminopyrimidines. Many novel antimicrobial agents are likely to be niche products, endowed with narrow antibacterial spectra and/or targeted at specific clinical problems. Therefore, an important educational goal will be to change the current, long-lasting attitudes of both physicians and customers towards broad-spectrum and multipurpose compounds. Scientific societies, such as the European Society of Clinical Microbiology and Infectious Diseases (ESCMID), must play a leading role in this process.

  20. Treatment of gram-positive deep sternal wound infections in cardiac surgery -experiences with daptomycin-

    Directory of Open Access Journals (Sweden)

    Coskun Kasim O

    2011-09-01

    Full Text Available Abstract The reported incidence of deep sternal wound infection (DSWI after cardiac surgery is 0.4-5% with Staphylococcus aureus being the most common pathogen isolated from infected wound sternotomies and bacteraemic blood cultures. This infection is associated with a higher morbidity and mortality than other known aetiologies. Little is reported about the optimal antibiotic management. The aim of the study is to quantify the application of daptomycin treatment of DSWI due to gram-positive organisms post cardiac surgery. We performed an observational analysis in 23 cases of post sternotomy DSWI with gram-positive organisms February 2009 and September 2010. When the wound appeared viable and the microbiological cultures were negative, the technique of chest closure was individualised to the patient. The incidence of DSWI was 1.46%. The mean dose of daptomycin application was 4.4 ± 0.9 mg/kg/d and the average duration of the daptomycin application was 14.47 ± 7.33 days. In 89% of the patients VAC therapy was used. The duration from daptomycin application to sternal closure was 18 ± 13.9 days. The parameters of infection including, fibrinogen (p = 0.03, white blood cell count (p = 0.001 and C-reactive protein (p = 0.0001 were significantly reduced after daptomycin application. We had no mortality and wound healing was successfully achieved in all patients. Treatment of DSWI due to gram-positive organisms with a daptomycin-containing antibiotic regimen is safe, effective and promotes immediate improvement of local wound conditions. Based on these observations, daptomycin may offer a new treatment option for expediting surgical management of DSWI after cardiac surgery.

  1. The rapid isolation of mutants of some Gram-positive bacteria

    International Nuclear Information System (INIS)

    Dijkhuizen, L.; Keijer, L.

    1981-01-01

    In this communication the authors describe a method for isolating at high frequency independent mutants of a number of Gram-positive bacteria. The method was originally developed for use with an Arthrobacter sp. and appears to work best with this and other coryneform bacteria. All the bacteria used were from the culture collections maintained at the University of Warwick or the Centre for Applied Microbiological Research. For mutagenesis using UV light, cells were grown in complex media and used while still in the logarithmic phase of growth. Details of the irradiation procedure are given in the text. (Auth.)

  2. Desulfotomaculum spp. and related Gram-positive sulfate-reducing bacteria in deep subsurface environments.

    Directory of Open Access Journals (Sweden)

    Thomas eAullo

    2013-12-01

    Full Text Available Gram-positive spore-forming sulfate reducers and particularly members of the genus Desulfotomaculum are commonly found in the subsurface biosphere by culture based and molecular approaches. Due to their metabolic versatility and their ability to persist as endospores. Desulfotomaculum spp. are well adapted for colonizing environments through a slow sedimentation process. Because of their ability to grow autotrophically (H2/CO2 and produce sulfide or acetate, these microorganisms may play key roles in deep lithoautotrophic microbial communities. Available data about Desulfotomaculum spp. and related species from studies carried out from deep freshwater lakes, marine sediments, oligotrophic and organic rich deep geological settings are discussed in this review.

  3. Gram-positive bacteria of marine origin: a numerical taxonomic study on Mediterranean isolates.

    Science.gov (United States)

    Ortigosa, M; Garay, E; Pujalte, M J

    1997-12-01

    A numerical taxonomic study was performed on 65 Gram-positive wild strains of heterotrophic, aerobic, marine bacteria, and 9 reference strains. The isolates were obtained from oysters and seawater sampled monthly over one year, by direct plating on Marine Agar. The strains were characterized by 96 morphological, biochemical, physiological and nutritional tests. Clustering yielded 13 phena at 0.62 similarity level (Sl coefficient). Only one of the seven phena containing wild isolates could be identified (Bacillus marinus). A pronounced salt requirement was found in most isolates.

  4. The Role of Functional Amyloids in Multicellular Growth and Development of Gram-Positive Bacteria

    DEFF Research Database (Denmark)

    Dragoš, Anna; Kovács, Ákos T.; Claessen, Dennis

    2017-01-01

    Amyloid fibrils play pivotal roles in all domains of life. In bacteria, these fibrillar structures are often part of an extracellular matrix that surrounds the producing organism and thereby provides protection to harsh environmental conditions. Here, we discuss the role of amyloid fibrils...... in the two distant Gram-positive bacteria, Streptomyces coelicolor and Bacillus subtilis. We describe how amyloid fibrils contribute to a multitude of developmental processes in each of these systems, including multicellular growth and community development. Despite this variety of tasks, we know...... surprisingly little about how their assembly is organized to fulfill all these roles....

  5. The Na+ transport in gram-positive bacteria defect in the Mrp antiporter complex measured with 23Na nuclear magnetic resonance.

    Science.gov (United States)

    Górecki, Kamil; Hägerhäll, Cecilia; Drakenberg, Torbjörn

    2014-01-15

    (23)Na nuclear magnetic resonance (NMR) has previously been used to monitor Na(+) translocation across membranes in gram-negative bacteria and in various other organelles and liposomes using a membrane-impermeable shift reagent to resolve the signals resulting from internal and external Na(+). In this work, the (23)Na NMR method was adapted for measurements of internal Na(+) concentration in the gram-positive bacterium Bacillus subtilis, with the aim of assessing the Na(+) translocation activity of the Mrp (multiple resistance and pH) antiporter complex, a member of the cation proton antiporter-3 (CPA-3) family. The sodium-sensitive growth phenotype observed in a B. subtilis strain with the gene encoding MrpA deleted could indeed be correlated to the inability of this strain to maintain a lower internal Na(+) concentration than an external one. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Bioengineered nisin A derivatives with enhanced activity against both Gram positive and Gram negative pathogens.

    Directory of Open Access Journals (Sweden)

    Des Field

    Full Text Available Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G, with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria.

  7. Peptidoglycan architecture of Gram-positive bacteria by solid-state NMR.

    Science.gov (United States)

    Kim, Sung Joon; Chang, James; Singh, Manmilan

    2015-01-01

    Peptidoglycan is an essential component of cell wall in Gram-positive bacteria with unknown architecture. In this review, we summarize solid-state NMR approaches to address some of the unknowns in the Gram-positive bacteria peptidoglycan architecture: 1) peptidoglycan backbone conformation, 2) PG-lattice structure, 3) variations in the peptidoglycan architecture and composition, 4) the effects of peptidoglycan bridge-length on the peptidoglycan architecture in Fem mutants, 5) the orientation of glycan strands with respect to the membrane, and 6) the relationship between the peptidoglycan structure and the glycopeptide antibiotic mode of action. Solid-state NMR analyses of Staphylococcus aureus cell wall show that peptidoglycan chains are surprisingly ordered and densely packed. The peptidoglycan disaccharide backbone adopts 4-fold screw helical symmetry with the disaccharide unit periodicity of 40Å. Peptidoglycan lattice in the S. aureus cell wall is formed by cross-linked PG stems that have parallel orientations. The structural characterization of Fem-mutants of S. aureus with varying lengths of bridge structures suggests that the PG-bridge length is an important determining factor for the PG architecture. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Prognostic factors and monomicrobial necrotizing fasciitis: gram-positive versus gram-negative pathogens

    Directory of Open Access Journals (Sweden)

    Hsu Wei-Hsiu

    2011-01-01

    Full Text Available Abstract Background Monomicrobial necrotizing fasciitis is rapidly progressive and life-threatening. This study was undertaken to ascertain whether the clinical presentation and outcome for patients with this disease differ for those infected with a gram-positive as compared to gram-negative pathogen. Methods Forty-six patients with monomicrobial necrotizing fasciitis were examined retrospectively from November 2002 to January 2008. All patients received adequate broad-spectrum antibiotic therapy, aggressive resuscitation, prompt radical debridement and adjuvant hyperbaric oxygen therapy. Eleven patients were infected with a gram-positive pathogen (Group 1 and 35 patients with a gram-negative pathogen (Group 2. Results Group 2 was characterized by a higher incidence of hemorrhagic bullae and septic shock, higher APACHE II scores at 24 h post-admission, a higher rate of thrombocytopenia, and a higher prevalence of chronic liver dysfunction. Gouty arthritis was more prevalent in Group 1. For non-survivors, the incidences of chronic liver dysfunction, chronic renal failure and thrombocytopenia were higher in comparison with those for survivors. Lower level of serum albumin was also demonstrated in the non-survivors as compared to those in survivors. Conclusions Pre-existing chronic liver dysfunction, chronic renal failure, thrombocytopenia and hypoalbuminemia, and post-operative dependence on mechanical ventilation represent poor prognostic factors in monomicrobial necrotizing fasciitis. Patients with gram-negative monobacterial necrotizing fasciitis present with more fulminant sepsis.

  9. Mechanistic antimicrobial approach of extracellularly synthesized silver nanoparticles against gram positive and gram negative bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Tamboli, Dhawal P.; Lee, Dae Sung, E-mail: daesung@knu.ac.kr

    2013-09-15

    Highlights: • Bacterial extracelluar enzymes stabilized the silver nanoparticles (AgNPs). • AgNPs formation was characterized by analytical techniques such as UV–vis, TEM, and FTIR. • AgNPs showed obvious antimicrobial activity against both gram positive and gram negative microorganisms. • A mechanism of AgNPs’ antimicrobial activity was proposed. -- Abstract: The development of eco-friendly and reliable processes for the synthesis of nanoparticles has attracted considerable interest in nanotechnology. In this study, an extracellular enzyme system of a newly isolated microorganism, Exiguobacterium sp. KNU1, was used for the reduction of AgNO{sub 3} solutions to silver nanoparticles (AgNPs). The extracellularly biosynthesized AgNPs were characterized by UV–vis spectroscopy, Fourier transform infra-red spectroscopy and transmission electron microscopy. The AgNPs were approximately 30 nm (range 5–50 nm) in size, well-dispersed and spherical. The AgNPs were evaluated for their antimicrobial effects on different gram negative and gram positive bacteria using the minimum inhibitory concentration method. Reasonable antimicrobial activity against Salmonella typhimurium, Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus was observed. The morphological changes occurred in all the microorganisms tested. In particular, E. coli exhibited DNA fragmentation after being treated with the AgNPs. Finally, the mechanism for their bactericidal activity was proposed according to the results of scanning electron microscopy and single cell gel electrophoresis.

  10. The Mechanisms of Virulence Regulation by Small Noncoding RNAs in Low GC Gram-Positive Pathogens

    Directory of Open Access Journals (Sweden)

    Stephanie Pitman

    2015-12-01

    Full Text Available The discovery of small noncoding regulatory RNAs (sRNAs in bacteria has grown tremendously recently, giving new insights into gene regulation. The implementation of computational analysis and RNA sequencing has provided new tools to discover and analyze potential sRNAs. Small regulatory RNAs that act by base-pairing to target mRNAs have been found to be ubiquitous and are the most abundant class of post-transcriptional regulators in bacteria. The majority of sRNA studies has been limited to E. coli and other gram-negative bacteria. However, examples of sRNAs in gram-positive bacteria are still plentiful although the detailed gene regulation mechanisms behind them are not as well understood. Strict virulence control is critical for a pathogen’s survival and many sRNAs have been found to be involved in that process. This review outlines the targets and currently known mechanisms of trans-acting sRNAs involved in virulence regulation in various gram-positive pathogens. In addition, their shared characteristics such as CU interaction motifs, the role of Hfq, and involvement in two-component regulators, riboswitches, quorum sensing, or toxin/antitoxin systems are described.

  11. Mechanistic antimicrobial approach of extracellularly synthesized silver nanoparticles against gram positive and gram negative bacteria

    International Nuclear Information System (INIS)

    Tamboli, Dhawal P.; Lee, Dae Sung

    2013-01-01

    Highlights: • Bacterial extracelluar enzymes stabilized the silver nanoparticles (AgNPs). • AgNPs formation was characterized by analytical techniques such as UV–vis, TEM, and FTIR. • AgNPs showed obvious antimicrobial activity against both gram positive and gram negative microorganisms. • A mechanism of AgNPs’ antimicrobial activity was proposed. -- Abstract: The development of eco-friendly and reliable processes for the synthesis of nanoparticles has attracted considerable interest in nanotechnology. In this study, an extracellular enzyme system of a newly isolated microorganism, Exiguobacterium sp. KNU1, was used for the reduction of AgNO 3 solutions to silver nanoparticles (AgNPs). The extracellularly biosynthesized AgNPs were characterized by UV–vis spectroscopy, Fourier transform infra-red spectroscopy and transmission electron microscopy. The AgNPs were approximately 30 nm (range 5–50 nm) in size, well-dispersed and spherical. The AgNPs were evaluated for their antimicrobial effects on different gram negative and gram positive bacteria using the minimum inhibitory concentration method. Reasonable antimicrobial activity against Salmonella typhimurium, Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus was observed. The morphological changes occurred in all the microorganisms tested. In particular, E. coli exhibited DNA fragmentation after being treated with the AgNPs. Finally, the mechanism for their bactericidal activity was proposed according to the results of scanning electron microscopy and single cell gel electrophoresis

  12. Bioengineered Nisin A Derivatives with Enhanced Activity against Both Gram Positive and Gram Negative Pathogens

    Science.gov (United States)

    Field, Des; Begley, Maire; O’Connor, Paula M.; Daly, Karen M.; Hugenholtz, Floor; Cotter, Paul D.; Hill, Colin; Ross, R. Paul

    2012-01-01

    Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G), with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E) with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria. PMID:23056510

  13. New and improved? A review of novel antibiotics for Gram-positive bacteria.

    Science.gov (United States)

    Abbas, M; Paul, M; Huttner, A

    2017-10-01

    The number of antibiotics in the pipeline targeting Gram-positive pathogens has increased in recent years. This narrative review aims to provide a summary of existing evidence on efficacy, microbiological spectrum and safety of novel systemic antibiotics that have either recently been licensed or completed phase III trials, and possess activity predominantly against Gram-positive organisms. A review of the published literature via the MEDLINE database was performed. In addition, ongoing trials were identified through a search of the clinical trial registration platform clinicaltrials.gov, and when necessary, pharmaceutical companies responsible for the development of the drug were contacted for further information. Data on development, microbiological spectrum, pharmacokinetic/pharmacodynamic properties, clinical efficacy, safety and cost are presented for the new cephalosporins ceftaroline and ceftobiprole; the lipoglycopeptides dalbavancin, oritavancin and telavancin; the fluoroquinolones delafloxacin, nemonoxacin and zabofloxacin; the dihydrofolate-reductase inhibitor iclaprim; the pleuromutilin lefamulin; and the tetracycline omadacycline. Although promising, these new antibiotics have so far been tested in non-severe infections whose treatment is generally uncomplicated and whose aetiologies were not predominantly multidrug-resistant pathogens. None of the new antibiotics have shown superiority to standard care, and none have been investigated for patient-relevant outcomes. Safety and pharmacokinetic data continue to be lacking. How these new drugs are to be integrated into the current armamentarium remains to be established. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  14. Antimicrobial resistance in Gram-positive bacteria from Timorese River Buffalo (Bubalus bubalis) skin microbiota.

    Science.gov (United States)

    Oliveira, Manuela; Monteiro, José L; Rana, Sílvia; Vilela, Cristina L

    2010-06-01

    The Timorese River Buffalo (Bubalus bubalis) plays a major role in the East Timor economy, as it is an important source of animal protein in human nutrition. They are widely spread throughout the country and are in direct contact with the populations. In spite of this proximity, information on their microbiota is scarce. This work aimed at characterizing the skin microbiota of the East Timorese River Buffalo and its antimicrobial resistance profile. Skin swab samples were taken from 46 animals in surveys conducted in three farms located in "Suco de Nairete", Lospalos district, during July and August 2006. Bacteria were isolated and identified according to conventional microbiological procedures. A total of 456 isolates were obtained, including Gram-positive (n = 243) and Gram-negative (n = 213) bacteria. Due to their importance as potential pathogens and as vehicles for antimicrobial resistance transmission, Gram-positive cocci (n = 27) and bacilli (n = 77) isolates were further characterized, and their antimicrobial resistance profile determined by the disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines. This study shows the high bacterial diversity of B. bubalis skin microbiota, representing an important first step towards understanding its importance and epidemiologic role in animal health. It also points out the potential role of these animals as vectors of antimicrobial resistant bacteria dissemination and the importance of antimicrobial resistance monitoring in developing countries.

  15. Brazilian experience in EU-CORE: daptomycin registry and treatment of serious Gram-positive infections

    Directory of Open Access Journals (Sweden)

    Artur Timerman

    Full Text Available OBJECTIVES: To collect data about non-controlled prescribing use of daptomycin and its impact among Brazilian patients with serious Gram positive bacterial infection, as well as the efficacy and safety outcomes. MATERIALS AND METHODS: This is a multi-center, retrospective, non-interventional registry (August 01, 2009 to June 30, 2011 to collect data on 120 patients (44 patients in the first year and 76 patients in the second year who had received at least one dose of commercial daptomycin in Brazil for the treatment of serious Gram-positive bacterial infection. RESULTS: Right-sided endocarditis (15.8%, complicated skin and soft tissue infections (cSSTIwound (15.0% and bacteremia-catheter-related (14.2% were the most frequent primary infections; lung (21.7% was the most common site for infection. Daptomycin was used empirically in 76 (63.3% patients, and methicillin-resistant Staphylococcus aureus (MRSA was the most common suspected pathogen (86.1%. 82.5% of the cultures were obtained prior to or shortly after initiation of daptomycin therapy. Staphylococcus spp. - coagulase negative, MRSA, and methicillin-susceptible S. aureus were the most frequently identified pathogens (23.8%, 23.8% and 12.5%, respectively. The most common daptomycin dose administered for bacteremia and cSSTI was 6 mg/kg (30.6% and 4 mg/kg (51.7%, respectively. The median duration of inpatient daptomycin therapy was 14 days. Most patients (57.1% did not receive daptomycin while in intensive care unit. Carbapenem (22.5% was the most commonly used antibiotic concomitantly. The patients showed clinical improvement after two days (median following the start of daptomycin therapy. The clinical success rate was 80.8% and the overall rate of treatment failure was 10.8%. The main reasons for daptomycin discontinuation were successful end of therapy (75.8%, switched therapy (11.7%, and treatment failure (4.2%. Daptomycin demonstrated a favorable safety and tolerability profile

  16. An optimized staining technique for the detection of Gram positive and Gram negative bacteria within tissue.

    Science.gov (United States)

    Becerra, Sandra C; Roy, Daniel C; Sanchez, Carlos J; Christy, Robert J; Burmeister, David M

    2016-04-12

    Bacterial infections are a common clinical problem in both acute and chronic wounds. With growing concerns over antibiotic resistance, treatment of bacterial infections should only occur after positive diagnosis. Currently, diagnosis is delayed due to lengthy culturing methods which may also fail to identify the presence of bacteria. While newer costly bacterial identification methods are being explored, a simple and inexpensive diagnostic tool would aid in immediate and accurate treatments for bacterial infections. Histologically, hematoxylin and eosin (H&E) and Gram stains have been employed, but are far from optimal when analyzing tissue samples due to non-specific staining. The goal of the current study was to develop a modification of the Gram stain that enhances the contrast between bacteria and host tissue. A modified Gram stain was developed and tested as an alternative to Gram stain that improves the contrast between Gram positive bacteria, Gram negative bacteria and host tissue. Initially, clinically relevant strains of Pseudomonas aeruginosa and Staphylococcus aureus were visualized in vitro and in biopsies of infected, porcine burns using routine Gram stain, and immunohistochemistry techniques involving bacterial strain-specific fluorescent antibodies as validation tools. H&E and Gram stain of serial biopsy sections were then compared to a modification of the Gram stain incorporating a counterstain that highlights collagen found in tissue. The modified Gram stain clearly identified both Gram positive and Gram negative bacteria, and when compared to H&E or Gram stain alone provided excellent contrast between bacteria and non-viable burn eschar. Moreover, when applied to surgical biopsies from patients that underwent burn debridement this technique was able to clearly detect bacterial morphology within host tissue. We describe a modification of the Gram stain that provides improved contrast of Gram positive and Gram negative microorganisms within host

  17. Peptidoglycan Recycling in Gram-Positive Bacteria Is Crucial for Survival in Stationary Phase

    Science.gov (United States)

    Borisova, Marina; Gaupp, Rosmarie; Duckworth, Amanda; Schneider, Alexander; Dalügge, Désirée; Mühleck, Maraike; Deubel, Denise; Unsleber, Sandra; Yu, Wenqi; Muth, Günther; Bischoff, Markus; Götz, Friedrich

    2016-01-01

    ABSTRACT Peptidoglycan recycling is a metabolic process by which Gram-negative bacteria reutilize up to half of their cell wall within one generation during vegetative growth. Whether peptidoglycan recycling also occurs in Gram-positive bacteria has so far remained unclear. We show here that three Gram-positive model organisms, Staphylococcus aureus, Bacillus subtilis, and Streptomyces coelicolor, all recycle the sugar N-acetylmuramic acid (MurNAc) of their peptidoglycan during growth in rich medium. They possess MurNAc-6-phosphate (MurNAc-6P) etherase (MurQ in E. coli) enzymes, which are responsible for the intracellular conversion of MurNAc-6P to N-acetylglucosamine-6-phosphate and d-lactate. By applying mass spectrometry, we observed accumulation of MurNAc-6P in MurNAc-6P etherase deletion mutants but not in either the isogenic parental strains or complemented strains, suggesting that MurQ orthologs are required for the recycling of cell wall-derived MurNAc in these bacteria. Quantification of MurNAc-6P in ΔmurQ cells of S. aureus and B. subtilis revealed small amounts during exponential growth phase (0.19 nmol and 0.03 nmol, respectively, per ml of cells at an optical density at 600 nm [OD600] of 1) but large amounts during transition (0.56 nmol and 0.52 nmol) and stationary (0.53 nmol and 1.36 nmol) phases. The addition of MurNAc to ΔmurQ cultures greatly increased the levels of intracellular MurNAc-6P in all growth phases. The ΔmurQ mutants of S. aureus and B. subtilis showed no growth deficiency in rich medium compared to the growth of the respective parental strains, but intriguingly, they had a severe survival disadvantage in late stationary phase. Thus, although peptidoglycan recycling is apparently not essential for the growth of Gram-positive bacteria, it provides a benefit for long-term survival. PMID:27729505

  18. Environmental gram-positive mastitis treatment: in vitro sensitivity and bacteriologic cure.

    Science.gov (United States)

    Cattell, M B; Dinsmore, R P; Belschner, A P; Carmen, J; Goodell, G

    2001-09-01

    A clinical trial was conducted in a large dairy herd to determine the efficacy of intramammary pirlimycin hydrochloride administration during lactation for bacteriologic clearance of gram-positive environmental clinical and subclinical mastitis infections. Quarters infected with environmental streptococci that received pirlimycin therapy (13/28) were 1.8 times more likely to resolve infection than untreated quarters (5/14). The small numbers of quarters infected with coagulase-negative staphylococci resulted in inadequate power to assess treatment differences in cure rate. Although the association was not statistically significant, quarters from cows with sensitive environmental streptococci isolates from composite samples (8/13) resolved infection with treatment at approximately twice the rate of treated quarters with resistant isolates (3/10).

  19. Subcellular localization for Gram positive and Gram negative bacterial proteins using linear interpolation smoothing model.

    Science.gov (United States)

    Saini, Harsh; Raicar, Gaurav; Dehzangi, Abdollah; Lal, Sunil; Sharma, Alok

    2015-12-07

    Protein subcellular localization is an important topic in proteomics since it is related to a protein׳s overall function, helps in the understanding of metabolic pathways, and in drug design and discovery. In this paper, a basic approximation technique from natural language processing called the linear interpolation smoothing model is applied for predicting protein subcellular localizations. The proposed approach extracts features from syntactical information in protein sequences to build probabilistic profiles using dependency models, which are used in linear interpolation to determine how likely is a sequence to belong to a particular subcellular location. This technique builds a statistical model based on maximum likelihood. It is able to deal effectively with high dimensionality that hinders other traditional classifiers such as Support Vector Machines or k-Nearest Neighbours without sacrificing performance. This approach has been evaluated by predicting subcellular localizations of Gram positive and Gram negative bacterial proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Purification Techniques of Bacteriocins from Lactic Acid Bacteria and Other Gram-Positive Bacteria

    Science.gov (United States)

    Saavedra, Lucila; Sesma, Fernando

    The search for new antimicrobial peptides produced by lactic acid ­bacteria and other Gram-positive microorganisms has become an interesting field of research in the past decades. The fact that bacteriocins are active against numerous foodborne and human pathogens, are produced by generally regarded as safe (GRAS) microorganisms, and are readily degraded by proteolytic host systems makes them attractive candidates for biotechnological applications. However, before suggesting or choosing a new bacteriocin for future technology developments, it is necessary to elucidate its biochemical structure and its mode of action, which may be carried out once the bacteriocin is purified to homogeneity. This chapter focuses on describing the main strategies used for the purification of numerous bacteriocins.

  1. Antimicrobial-Resistance Genetic Markers in Potentially Pathogenic Gram Positive Cocci Isolated from Brazilian Soft Cheese.

    Science.gov (United States)

    Resende, Juliana Alves; Fontes, Cláudia Oliveira; Ferreira-Machado, Alessandra Barbosa; Nascimento, Thiago César; Silva, Vânia Lúcia; Diniz, Cláudio Galuppo

    2018-02-01

    Although most Brazilian dairy products meet high technological standards, there are quality issues regarding milk production, which may reduce the final product quality. Several microbial species may contaminate milk during manufacture and handling. If antimicrobial usage remains uncontrolled in dairy cattle, the horizontal transfer of antimicrobial resistance genes in foodstuffs may be of particular concern for both food producers and dairy industry. This study focused on the evaluation of putative Gram positive cocci in Minas cheese and of antimicrobial and biocide resistance genes among the isolated bacteria. Representative samples of 7 different industrially trademarked Minas cheeses (n = 35) were processed for selective culture and isolation of Gram positive cocci. All isolated bacteria were identified by DNA sequencing of the 16S rRNA gene. Antimicrobial resistance genes were screened by PCR. Overall, 208 strains were isolated and identified as follows: Enterococcus faecalis (47.6%), Macrococcus caseolyticus (18.3%), Enterococcus faecium (11.5%), Enterococcus caseliflavus (7.7%), Staphylococcus haemolyticus (7.2%), Staphylococcus aureus (4.3%), Staphylococcus epidermidis (2.9%), and Enterococcus hirae (0.5%). The genetic markers mecA (78.0%) and smr (71.4%) were the most prevalent, but others were also detected, such as blaZ (65.2%), msrA (60.9%), msrB (46.6%), linA (54.7%), and aacA-aphD (47.6%). The occurrence of opportunist pathogenic bacteria harboring antimicrobial resistance markers in the cheese samples are of special concern, since these bacteria are not considered harmful contaminating agents according to the Brazilian sanitary regulations. However, they are potentially pathogenic bacteria and the cheese may be considered a reservoir for antimicrobial resistance genes available for horizontal transfer through the food chain, manufacturing personnel and consumers. © 2018 Institute of Food Technologists®.

  2. Raman Spectroscopy of Xylitol Uptake and Metabolism in Gram-Positive and Gram-Negative Bacteria▿

    Science.gov (United States)

    Palchaudhuri, Sunil; Rehse, Steven J.; Hamasha, Khozima; Syed, Talha; Kurtovic, Eldar; Kurtovic, Emir; Stenger, James

    2011-01-01

    Visible-wavelength Raman spectroscopy was used to investigate the uptake and metabolism of the five-carbon sugar alcohol xylitol by Gram-positive viridans group streptococcus and the two extensively used strains of Gram-negative Escherichia coli, E. coli C and E. coli K-12. E. coli C, but not E. coli K-12, contains a complete xylitol operon, and the viridans group streptococcus contains an incomplete xylitol operon used to metabolize the xylitol. Raman spectra from xylitol-exposed viridans group streptococcus exhibited significant changes that persisted even in progeny grown from the xylitol-exposed mother cells in a xylitol-free medium for 24 h. This behavior was not observed in the E. coli K-12. In both viridans group streptococcus and the E. coli C derivative HF4714, the metabolic intermediates are stably formed to create an anomaly in bacterial normal survival. The uptake of xylitol by Gram-positive and Gram-negative pathogens occurs even in the presence of other high-calorie sugars, and its stable integration within the bacterial cell wall may discontinue bacterial multiplication. This could be a contributing factor for the known efficacy of xylitol when taken as a prophylactic measure to prevent or reduce occurrences of persistent infection. Specifically, these bacteria are causative agents for several important diseases of children such as pneumonia, otitis media, meningitis, and dental caries. If properly explored, such an inexpensive and harmless sugar-alcohol, alone or used in conjunction with fluoride, would pave the way to an alternative preventive therapy for these childhood diseases when the causative pathogens have become resistant to modern medicines such as antibiotics and vaccine immunotherapy. PMID:21037297

  3. Isolation of highly active monoclonal antibodies against multiresistant gram-positive bacteria.

    Directory of Open Access Journals (Sweden)

    Friederike S Rossmann

    Full Text Available Multiresistant nosocomial pathogens often cause life-threatening infections that are sometimes untreatable with currently available antibiotics. Staphylococci and enterococci are the predominant Gram-positive species associated with hospital-acquired infections. These infections often lead to extended hospital stay and excess mortality. In this study, a panel of fully human monoclonal antibodies was isolated from a healthy individual by selection of B-cells producing antibodies with high opsonic killing against E. faecalis 12030. Variable domains (VH and VL of these immunoglobulin genes were amplified by PCR and cloned into an eukaryotic expression vector containing the constant domains of a human IgG1 molecule and the human lambda constant domain. These constructs were transfected into CHO cells and culture supernatants were collected and tested by opsonophagocytic assay against E. faecalis and S. aureus strains (including MRSA. At concentrations of 600 pg/ml, opsonic killing was between 40% and 70% against all strains tested. Monoclonal antibodies were also evaluated in a mouse sepsis model (using S. aureus LAC and E. faecium, a mouse peritonitis model (using S. aureus Newman and LAC and a rat endocarditis model (using E. faecalis 12030 and were shown to provide protection in all models at a concentration of 4 μg/kg per animal. Here we present a method to produce fully human IgG1 monoclonal antibodies that are opsonic in vitro and protective in vivo against several multiresistant Gram-positive bacteria. The monoclonal antibodies presented in this study are significantly more effective compared to another monoclonal antibody currently in clinical trials.

  4. Structure of FabH and factors affecting the distribution of branched fatty acids in Micrococcus luteus.

    Science.gov (United States)

    Pereira, Jose H; Goh, Ee-Been; Keasling, Jay D; Beller, Harry R; Adams, Paul D

    2012-10-01

    Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition.

  5. Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.

    Science.gov (United States)

    Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang

    2007-01-01

    Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).

  6. Overcoming function annotation errors in the Gram-positive pathogen Streptococcus suis by a proteomics-driven approach

    Directory of Open Access Journals (Sweden)

    Bárcena José A

    2008-12-01

    Full Text Available Abstract Background Annotation of protein-coding genes is a key step in sequencing projects. Protein functions are mainly assigned on the basis of the amino acid sequence alone by searching of homologous proteins. However, fully automated annotation processes often lead to wrong prediction of protein functions, and therefore time-intensive manual curation is often essential. Here we describe a fast and reliable way to correct function annotation in sequencing projects, focusing on surface proteomes. We use a proteomics approach, previously proven to be very powerful for identifying new vaccine candidates against Gram-positive pathogens. It consists of shaving the surface of intact cells with two proteases, the specific cleavage-site trypsin and the unspecific proteinase K, followed by LC/MS/MS analysis of the resulting peptides. The identified proteins are contrasted by computational analysis and their sequences are inspected to correct possible errors in function prediction. Results When applied to the zoonotic pathogen Streptococcus suis, of which two strains have been recently sequenced and annotated, we identified a set of surface proteins without cytoplasmic contamination: all the proteins identified had exporting or retention signals towards the outside and/or the cell surface, and viability of protease-treated cells was not affected. The combination of both experimental evidences and computational methods allowed us to determine that two of these proteins are putative extracellular new adhesins that had been previously attributed a wrong cytoplasmic function. One of them is a putative component of the pilus of this bacterium. Conclusion We illustrate the complementary nature of laboratory-based and computational methods to examine in concert the localization of a set of proteins in the cell, and demonstrate the utility of this proteomics-based strategy to experimentally correct function annotation errors in sequencing projects. This

  7. Antibacterial properties of biosurfactants against selected Gram-positive and -negative bacteria.

    Science.gov (United States)

    Díaz De Rienzo, Mayri A; Stevenson, Paul; Marchant, Roger; Banat, Ibrahim M

    2016-01-01

    The antibacterial properties and ability to disrupt biofilms of biosurfactants (rhamnolipids, sophorolipids) and sodium dodecyl sulphate (SDS) in the presence and absence of selected organic acids were investigated. Pseudomonas aeruginosa PAO1 was inhibited by sophorolipids and SDS at concentrations >5% v/v, and the growth of Escherichia coli NCTC 10418 was also inhibited by sophorolipids and SDS at concentrations >5% and 0.1% v/v, respectively. Bacillus subtilis NCTC 10400 was inhibited by rhamnolipids, sophorolipids and SDS at concentrations >0.5% v/v of all three; the same effect was observed with Staphylococcus aureus ATCC 9144. The ability to attach to surfaces and biofilm formation of P. aeruginosa PAO1, E. coli NCTC 10418 and B. subtilis NCTC 10400 was inhibited by sophorolipids (1% v/v) in the presence of caprylic acid (0.8% v/v). In the case of S. aureus ATCC 9144, the best results were obtained using caprylic acid on its own. It was concluded that sophorolipids are promising compounds for the inhibition/disruption of biofilms formed by Gram-positive and Gram-negative microorganisms and this activity can be enhanced by the presence of booster compounds such as caprylic acid. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Two Cases of Endogenous Endophthalmitis Caused by Gram-Positive Bacteria with Good Visual Outcome

    Directory of Open Access Journals (Sweden)

    Machiko Itoh

    2010-09-01

    Full Text Available Background: Endogenous endophthalmitis is a rare disease and its visual prognosis is poor. Case Reports: We present two patients, a 60-year-old man and a 53-year-old man, who developed endogenous endophthalmitis caused byGram-positive organismsbut recovered good vision after antibiotics and vitrectomy. Results: The first patient complained of ocular pain and visual decrease in his right eye. Ophthalmoscopy showed inflammation in the anterior chamber and vitreous opacities. Antibiotic was administrated systemically, and blood culture detected Streptococcus anginosus. He underwent successful heart surgery for endocarditis and total dental extraction for severe gingivitis. Vitrectomy was performed 36 days after the onset and vision improved from 0.02 to 0.7. The second patient was referred for acute visual decrease in his left eye. Severe iritis and vitreous opacities were observed, and systemic examination showed acute pyelitis and prostatic abscesses. Blood cultures detected Staphylococcus sp., and systemic antibiotics were given. Vitrectomy was performed 12 days after the onset, and vision improved from 0.06 to 1.2. Conclusions: We conclude that the rapid treatment with systemic antibiotics for the organisms at the primary site, and the vitrectomy, even though delayed, can lead to a good recovery of vision.

  9. Complete genome sequence of Paenibacillus riograndensis SBR5(T), a Gram-positive diazotrophic rhizobacterium.

    Science.gov (United States)

    Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F

    2015-08-10

    Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Revised mechanism of d-alanine incorporation into cell wall polymers in Gram-positive bacteria

    Science.gov (United States)

    Reichmann, Nathalie T.; Cassona, Carolina Picarra

    2013-01-01

    Teichoic acids (TAs) are important for growth, biofilm formation, adhesion and virulence of Gram-positive bacterial pathogens. The chemical structures of the TAs vary between bacteria, though they typically consist of zwitterionic polymers that are anchored to either the peptidoglycan layer as in the case of wall teichoic acid (WTA) or the cell membrane and named lipoteichoic acid (LTA). The polymers are modified with d-alanines and a lack of this decoration leads to increased susceptibility to cationic antimicrobial peptides. Four proteins, DltA–D, are essential for the incorporation of d-alanines into cell wall polymers and it has been established that DltA transfers d-alanines in the cytoplasm of the cell onto the carrier protein DltC. However, two conflicting models have been proposed for the remainder of the mechanism. Using a cellular protein localization and membrane topology analysis, we show here that DltC does not traverse the membrane and that DltD is anchored to the outside of the cell. These data are in agreement with the originally proposed model for d-alanine incorporation through a process that has been proposed to proceed via a d-alanine undecaprenyl phosphate membrane intermediate. Furthermore, we found that WTA isolated from a Staphylococcus aureus strain lacking LTA contains only a small amount of d-alanine, indicating that LTA has a role, either direct or indirect, in the efficient d-alanine incorporation into WTA in living cells. PMID:23858088

  11. Cytokine profile in severe gram-positive and gram-negative abdominal sepsis

    Science.gov (United States)

    Surbatovic, Maja; Popovic, Nada; Vojvodic, Danilo; Milosevic, Ivan; Acimovic, Gordana; Stojicic, Milan; Veljovic, Milic; Jevdjic, Jasna; Djordjevic, Dragan; Radakovic, Sonja

    2015-01-01

    Sepsis is a principal cause of death in critical care units worldwide and consumes considerable healthcare resources. The aim of our study was to determine whether the early cytokine profile can discriminate between Gram-positive and Gram-negative bacteraemia (GPB and GNB, respectively) and to assess the prognostic value regarding outcome in critically ill patients with severe abdominal sepsis. The outcome measure was hospital mortality. Blood samples were obtained from 165 adult patients with confirmed severe abdominal sepsis. Levels of the proinflammatory mediators TNF-α, IL-8, IL-12 and IFN-γ and the anti-inflammatory mediators IL-1ra, IL-4, IL-10 and TGF-β1 were determined and correlated with the nature of the bacteria isolated from the blood culture and outcome. The cytokine profile in our study indicated that the TNF-α levels were 2-fold, IL-8 were 3.3-fold, IFN-γ were 13-fold, IL-1ra were 1.05-fold, IL-4 were 1.4-fold and IL-10 were 1.83-fold higher in the GNB group compared with the GPB group. The TNF-α levels were 4.7-fold, IL-8 were 4.6-fold, IL-1ra were 1.5-fold and IL-10 were 3.3-fold higher in the non-survivors compared with the survivors. PMID:26079127

  12. Computational design and characterization of a temperature-sensitive plasmid replicon for gram positive thermophiles

    Directory of Open Access Journals (Sweden)

    Olson Daniel G

    2012-05-01

    Full Text Available Abstract Background Temperature-sensitive (Ts plasmids are useful tools for genetic engineering, but there are currently none compatible with the gram positive, thermophilic, obligate anaerobe, Clostridium thermocellum. Traditional mutagenesis techniques yield Ts mutants at a low frequency, and therefore requires the development of high-throughput screening protocols, which are also not available for this organism. Recently there has been progress in the development of computer algorithms which can predict Ts mutations. Most plasmids currently used for genetic modification of C. thermocellum are based on the replicon of plasmid pNW33N, which replicates using the RepB replication protein. To address this problem, we set out to create a Ts plasmid by mutating the gene coding for the RepB replication protein using an algorithm designed by Varadarajan et al. (1996 for predicting Ts mutants based on the amino-acid sequence of the protein. Results A library of 34 mutant plasmids was designed, synthesized and screened, resulting in 6 mutants which exhibited a Ts phenotype. Of these 6, the one with the most temperature-sensitive phenotype (M166A was compared with the original plasmid. It exhibited lower stability at 48°C and was completely unable to replicate at 55°C. Conclusions The plasmid described in this work could be useful in future efforts to genetically engineer C. thermocellum, and the method used to generate this plasmid may be useful for others trying to make Ts plasmids.

  13. Recovery of vancomycin-resistant gram-positive cocci from children.

    Science.gov (United States)

    Green, M; Wadowsky, R M; Barbadora, K

    1990-03-01

    A cross-sectional survey of vancomycin-resistant gram-positive cocci (VRGPC) in the feces of children was initiated after several bacteremic infections with these organisms occurred at our hospital. A selective medium consisting of colistin-nalidixic acid agar, 5% sheep blood, vancomycin (5 mg/liter), and amphotericin B (8 mg/liter) was developed to isolate VRGPC. A single stool specimen submitted to the clinical microbiology laboratory from each of 48 patients was inoculated onto the medium. Plates were incubated at 35 degrees C with 5% carbon dioxide and examined at 24, 48, and 72 h. Susceptibilities were determined by broth microdilution. A total of 14 isolates from 11 of 48 (22%) children were recovered. The density of growth ranged from a single colony to 2+. The VRGPC were identified as Leuconostoc lactis (n = 2), Lactobacillus confusus (n = 4), Enterococcus species (n = 5), and Lactococcus lactis (n = 3). One strain of Lactobacillus confusus was recovered from both the stool and the blood of one of these patients. The MICs of vancomycin were 4 micrograms/ml for one of the isolates, 8 micrograms/ml for four of the isolates, and more than 16 micrograms/ml for the remaining eight isolates. All isolates were susceptible to both penicillin and ampicillin. Only 1 of the 11 children had received prior treatment with vancomycin. We conclude that low concentrations of VRGPC may be common in the gastrointestinal tracts of children.

  14. Bacterial glycobiology: rhamnose-containing cell wall polysaccharides in Gram-positive bacteria.

    Science.gov (United States)

    Mistou, Michel-Yves; Sutcliffe, Iain C; van Sorge, Nina M

    2016-07-01

    The composition of the Gram-positive cell wall is typically described as containing peptidoglycan, proteins and essential secondary cell wall structures called teichoic acids, which comprise approximately half of the cell wall mass. The cell walls of many species within the genera Streptococcus, Enterococcus and Lactococcus contain large amounts of the sugar rhamnose, which is incorporated in cell wall-anchored polysaccharides (CWP) that possibly function as homologues of well-studied wall teichoic acids (WTA). The presence and chemical structure of many rhamnose-containing cell wall polysaccharides (RhaCWP) has sometimes been known for decades. In contrast to WTA, insight into the biosynthesis and functional role of RhaCWP has been lacking. Recent studies in human streptococcal and enterococcal pathogens have highlighted critical roles for these complex polysaccharides in bacterial cell wall architecture and pathogenesis. In this review, we provide an overview of the RhaCWP with regards to their biosynthesis, genetics and biological function in species most relevant to human health. We also briefly discuss how increased knowledge in this field can provide interesting leads for new therapeutic compounds and improve biotechnological applications. © FEMS 2016.

  15. Optimization of linezolid treatment regimens for Gram-positive bacterial infections based on pharmacokinetic/pharmacodynamic analysis.

    Science.gov (United States)

    Yang, Minjie; Zhang, Jing; Chen, Yuancheng; Liang, Xiaoyu; Guo, Yan; Yu, Jicheng; Zhu, Demei; Zhang, Yingyuan

    2017-01-01

    To optimize linezolid treatment regimens for Gram-positive bacterial infections based on pharmacokinetic/pharmacodynamic analysis. The minimum inhibitory concentration (MIC) distribution of 572 Gram-positive strains from patients with clinically confirmed infections was analyzed. Using the Monte Carlo simulation method, the cumulative fraction of response and probability of target attainment were determined for linezolid regimens of 600 mg q.12h and q.8h Results: Linezolid dosage of 600 mg q.12h yielded >90% cumulative fraction of response and probability of target attainment for staphylococcal infections with an MIC of ≤1 mg/l, enterococcal infections with higher MIC values required 600 mg q.8h. Linezolid 600 mg q.12h is still the clinically recommended empirical dosage for Gram-positive bacterial infections. However, as bacterial MICs increase, 600 mg q.8h may be required to achieve better efficacy.

  16. Evaluation of Inhibitory and Lethal Effects of Aqueous, Ethanolic and Hydroalcoholic Extracts of Aerial Parts of Salvia chorassanica against Some Gram-negative and Gram-positive Bacteria in Vitro

    Directory of Open Access Journals (Sweden)

    Azam Mehraban

    2016-05-01

    Full Text Available Abstract Background and Objectives: Development of bacterial resistance to antibiotics has led to an increased tendency to development of new more effective and non-toxic antimicrobial compounds. In this study, the inhibitory and lethal effects of aqueous, ethanolic, and hydroalcoholic extracts of aerial parts of Salvia chorassanica were evaluated against Listeria monocytogenes, Bacillus cereus, Salmonella typhi, and Escherichia coli O:157. Methods: In this study, Kirby–Bauer disk diffusion method was used to evaluate antimicrobial activity. In this method, bacteria were cultivated as grass culture in Mueller Hinton Agar (MHA media. To determine the minimum inhibitory concentration and minimum bactericidal concentration, micro-dilution method with ELISA and addition of phenyl tetrazolium chloride reagent, were used. Data were analyzed using one-way ANOVA and Duncan’s test at the significance level of p<0.05. Results: The highest diameter of inhibition in agar diffusion method was related to hydroalcoholic extract of aerial parts of Salvia chorassanica against Gram-positive bacteria Bacillus cereus. The amount of calculated MIC of hydro-alcoholic extract for Gram-positive bacteria was 30mg/ml. This amount was the lowest among other measured MIC. Conclusion: Based on the results of this study, Gram-negative bacteria showed more resistance to different extracts of aerial parts of Salvia chorassanica as compared to Gram-positive bacteria, so that Salmonella typhi was found to be the most resistant bacterium among the tested bacteria.

  17. Rational approaches to the therapy of nosocomial infections caused by gram-positive microorganisms in cancer p

    Directory of Open Access Journals (Sweden)

    V. V. Aginova

    2017-01-01

    Full Text Available Nosocomial infections caused by gram-positive organisms, including Staphylococcus aureus and enterococci (Enterococcus faecium and Enterococcus faecalis are steadily increasing in almost all clinics around the world. Cancer patients have a higher risk of hospital-acquired infections than non-cancer patients. Cancer patients are immunosuppressed due to increased use of broad-spectrum antibiotics and chemotherapy drugs, radiation therapy, surgery and use of steroids. This paper presents an analysis of resistance of gram-positive bacterial pathogens to antimicrobial agents to determine treatment strategy for cancer patients.

  18. Antimicrobial Activity of Carbon Nanoparticles Isolated from Natural Sources against Pathogenic Gram-Negative and Gram-Positive Bacteria

    International Nuclear Information System (INIS)

    Varghese, S.; Jose, S.; Varghese, S.; Kuriakose, S.; Jose, S.

    2013-01-01

    This paper describes the isolation of carbon nanoparticles (CNPs) from kitchen soot, characterization of the CNPs by UV/visible spectroscopy, SEM and XRD, and their antimicrobial action. The antibacterial activity of the isolated carbon nanoparticles was tested against various pathogenic bacterial strains such as Gram-negative Proteus refrigere and Pseudomonas aeruginosa and Gram-positive Staphylococcus aureus and Streptococcus haemolyticus. The inhibition zones were measured, and it was found that the carbon nanoparticles isolated from natural sources are active against these Gram-negative and Gram-positive bacterial strains

  19. Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1.

    Science.gov (United States)

    Tallur, Preeti N; Megadi, Veena B; Ninnekar, Harichandra Z

    2008-02-01

    A bacterium capable of utilizing pyrethroid pesticide cypermethrin as sole source of carbon was isolated from soil and identified as a Micrococcus sp. The organism also utilized fenvalerate, deltamethrin, perimethrin, 3-phenoxybenzoate, phenol, protocatechuate and catechol as growth substrates. The organism degraded cypermethrin by hydrolysis of ester linkage to yield 3-phenoxybenzoate, leading to loss of its insecticidal activity. 3-Phenoxybenzoate was further metabolized by diphenyl ether cleavage to yield protocatechuate and phenol as evidenced by isolation and identification of metabolites and enzyme activities in the cell-free extracts. Protocatechuate and phenol were oxidized by ortho-cleavage pathway. Thus, the organism was versatile in detoxification and complete mineralization of pyrethroid cypermethrin.

  20. Halophilic Nuclease from a Moderately Halophilic Micrococcus varians

    Science.gov (United States)

    Kamekura, Masahiro; Onishi, Hiroshi

    1974-01-01

    The moderately halophilic bacterium Micrococcus varians, isolated from soy sauce mash, produced extracellular nuclease when cultivated aerobically in media containing 1 to 4 M NaCl or KCl. The enzyme, purified to an electrophoretically homogeneous state, had both ribonuclease and deoxyribonuclease activities. The nuclease had maximal activity in the presence of 2.9 M NaCl or 2.1 M KCl at 40 C. The enzymatic activity was lost by dialysis against low-salt buffer, whereas when the inactivated enzyme was dialyzed against 3.4 M NaCl buffer as much as 77% of the initial activity could be restored. Images PMID:4852218

  1. Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ

    Directory of Open Access Journals (Sweden)

    Dennapa Saeloh

    2017-02-01

    Full Text Available Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach (in silico, in vitro, and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S- and (R-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states. Calculations of free binding energy showed a higher affinity of FtsZ to (S-rhodomyrtone (−35.92 ± 0.36 kcal mol−1 than the GDP substrate (−23.47 ± 0.25 kcal mol−1 while less affinity was observed in the case of (R-rhodomyrtone (−18.11 ± 0.11 kcal mol−1. In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance.

  2. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Science.gov (United States)

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  3. Trans-generational Immune Priming Protects the Eggs Only against Gram-Positive Bacteria in the Mealworm Beetle

    Science.gov (United States)

    Dubuffet, Aurore; Zanchi, Caroline; Boutet, Gwendoline; Moreau, Jérôme; Teixeira, Maria; Moret, Yannick

    2015-01-01

    In many vertebrates and invertebrates, offspring whose mothers have been exposed to pathogens can exhibit increased levels of immune activity and/or increased survival to infection. Such phenomena, called “Trans-generational immune priming” (TGIP) are expected to provide immune protection to the offspring. As the offspring and their mother may share the same environment, and consequently similar microbial threats, we expect the immune molecules present in the progeny to be specific to the microbes that immune challenged the mother. We provide evidence in the mealworm beetle Tenebrio molitor that the antimicrobial activity found in the eggs is only active against Gram-positive bacteria, even when females were exposed to Gram-negative bacteria or fungi. Fungi were weak inducers of TGIP while we obtained similar levels of anti-Gram-positive activity using different bacteria for the maternal challenge. Furthermore, we have identified an antibacterial peptide from the defensin family, the tenecin 1, which spectrum of activity is exclusively directed toward Gram-positive bacteria as potential contributor to this antimicrobial activity. We conclude that maternal transfer of antimicrobial activity in the eggs of T. molitor might have evolved from persistent Gram-positive bacterial pathogens between insect generations. PMID:26430786

  4. Antibacterial Activity of Silver-Graphene Quantum Dots Nanocomposites Against Gram-Positive and Gram-Negative Bacteria

    Science.gov (United States)

    Habiba, Khaled (Inventor); Makarov, Vladimir (Inventor); Weiner, Brad R (Inventor); Morell, Gerardo (Inventor)

    2018-01-01

    The invention provides a composite of silver nanoparticles decorated with graphene quantum dots (Ag-GQDs) using pulsed laser synthesis. The nanocomposites were functionalized with polyethylene glycol (PEG). A concentration of 150 .mu.g/mL of Ag-GQDs, a non-toxic level for human cells, exhibits strong antibacterial activity against both Gram-Positive and Gram-Negative Bacteria.

  5. Trans-generational Immune Priming Protects the Eggs Only against Gram-Positive Bacteria in the Mealworm Beetle.

    Directory of Open Access Journals (Sweden)

    Aurore Dubuffet

    2015-10-01

    Full Text Available In many vertebrates and invertebrates, offspring whose mothers have been exposed to pathogens can exhibit increased levels of immune activity and/or increased survival to infection. Such phenomena, called "Trans-generational immune priming" (TGIP are expected to provide immune protection to the offspring. As the offspring and their mother may share the same environment, and consequently similar microbial threats, we expect the immune molecules present in the progeny to be specific to the microbes that immune challenged the mother. We provide evidence in the mealworm beetle Tenebrio molitor that the antimicrobial activity found in the eggs is only active against Gram-positive bacteria, even when females were exposed to Gram-negative bacteria or fungi. Fungi were weak inducers of TGIP while we obtained similar levels of anti-Gram-positive activity using different bacteria for the maternal challenge. Furthermore, we have identified an antibacterial peptide from the defensin family, the tenecin 1, which spectrum of activity is exclusively directed toward Gram-positive bacteria as potential contributor to this antimicrobial activity. We conclude that maternal transfer of antimicrobial activity in the eggs of T. molitor might have evolved from persistent Gram-positive bacterial pathogens between insect generations.

  6. Dustborne and airborne gram-positive and gram-negative bacteria in high versus low ERMI homes

    Science.gov (United States)

    The study aimed at investigating Gram-positive and Gram-negative bacteria in moldy and non-moldy homes, as defined by the home's Environmental Relative Moldiness Index (ERMI) value. The ERMI values were determined from floor dust samples in 2010 and 2011 and homes were classified...

  7. The Causes of Post-Operative Meningitis: The Comparison Of Gram-Negative and Gram-Positive Pathogens.

    Science.gov (United States)

    Kurtaran, Behice; Kuscu, Ferit; Ulu, Aslihan; Inal, Ayse Seza; Komur, Suheyla; Kibar, Filiz; Cetinalp, Nuri Eralp; Ozsoy, Kerem Mazhar; Arslan, Yusuf Kemal; Aksu, Hasan Salih; Tasova, Yesim

    2017-06-20

    In this study, we aim to determine the microbiological etiology in critically ill neurosurgical patients with nosocomial meningitis (NM) and show the impact of Gram-negative rods and differences of patient's characteristics, clinical and prognostic measures between Gram-negative and Gram-positive meningitis. In this prospective, one center study we reviewed all adult patients hospitalized during a 12-year period and identified pathogens isolated from post-neurosurgical cases of NM. Demographic, clinical, and treatment characteristics were noted from the medical records. Of the 134 bacterial NM patients, 78 were male and 56 were female, with a mean age of 46±15.9 and median age of 50 (18-80) years. 141 strains isolated; 82 (58.2%) were Gram negative, 59 (41.8%) were Gram positive. Most common isolated microorganism was Acinetobacter baumannii (%34.8). In comparison of mortality data shows that the patients who have meningitis with Gram-negative pathogens have higher mortality than with Gram positives (p=0.034). The duration between surgery and meningitis was shorter in Gram negative meningitis cases compared to others (p=0.045) but the duration between the diagnosis and death was shorter in Gram-positive meningitis cases compared to Gram negatives (p= 0.017). CSF protein and lactate level were higher and glucose level was lower in cases of NM with Gram negatives (p value were respectively, 0.022, 0.039 and 0.049). As conclusions; in NM, Gram-negative pathogens were seen more frequently; A.baumanni was the predominant pathogen; and NM caused by Gram negatives had worse clinical and laboratory characteristic and prognostic outcome than Gram positives.

  8. Limitations in the use of Drosophila melanogaster as a model host for gram-positive bacterial infection

    DEFF Research Database (Denmark)

    Jensen, Rikke Lind; Pedersen, K.S.; Loeschcke, V

    2007-01-01

    resistance respectively, were subjected to infection by L. monocytogenes, S. aureus and E. coli. Mortality rates were comparable with that of the Oregon R strain. Conclusions: Use of the injection method shows the limitation of D. melanogaster as a model host for gram-positive bacteria as opportunistic......Aims: To examine sensitivities of various Drosophila melanogaster strains towards human pathogenic and nonpathogenic gram-positive bacteria. Methods and Results: The D. melanogaster Oregon R strain was infected by injecting the thorax with a needle containing Escherichia coli (negative control...... with the negative control. Infection with L. innocua, B. subtilis or C. maltaromaticum also resulted in a high fly mortality, whereas Lact. plantarum and P. acidilactici resulted in a slightly increased mortality. Four additional D. melanogaster lines, three of which had been selected for heat, cold and desiccation...

  9. In vitro ciprofloxacin resistance patterns of gram positive bacteria isolated from clinical specimens in a teaching hospital in Saudi Arabia

    International Nuclear Information System (INIS)

    Akhtar, N.; Alzahrani, A.; Obeid, O.El-Treify; Dassal, D.

    2009-01-01

    Over the last few decades the ever-increasing level of bacterial resistance to antimicrobials has been a cause of worldwide concern. Fluoroquinolones, particularly ciprofloxacin has been used indiscriminately for both gram-positive and gram-negative bacterial infections. The increased use of ciprofloxacin has led to a progressive loss of bacterial susceptibility to this antibiotic. Therefore it is necessary to have update knowledge of resistance pattern of bacteria to this antibiotic so that alternate appropriate antibiotics can be used for ciprofloxacin-resistant bacterial infections. Objective: To evaluate the trends of ciprofloxacin resistance pattern in commonly isolated gram positive bacteria over time in a Saudi Arabian teaching hospital. Methods: A retrospective analysis was carried out for ciprofloxacin susceptibility patterns of 5534 isolates of gram-positive bacteria isolated from clinical specimens submitted to microbiology laboratories at King Fahd Hospital of the University (KFHU), Al-Khobar, Saudi Arabia during the period from January 2002 to August 2005. Results: Increase in ciprofloxacin resistance rates with some fluctuations, among these isolates, were observed. For Staphylococcus aureus, it varied from 4.62, 1.83, 7.01 and 3.98%, methicillin resistant Staphylococcus aureus (MRSA) 97.92, 97.75, 87.01 and 88.26%, Streptococcus pyogenes 5.35, 4.47, 14.44 and 3.53% during the years 2002, 2003, 2004 and 2005 respectively. Cirprofloxacin resistance during the years 2002, 2004 and 2005 for other isolates was as follows: Streptococcus pneumoniae, 30.23, 23.02 and 26.47%; enterococcus group D, 43.05, 20.68 and 57.03% and non-enterococcus group D, 62.96, 76.92 and 87.50% respectively. Conclusion: Ciprofloxacin resistance in gram positive bacterial clinical isolates particularly Staphylococcus aureus, methicillin resistant Staphylococcus aureus (MRSA) enterococcus group D, and non-enterococcus group D, has greatly increased and ciprofloxacin no more remains

  10. In vitro activities of dalbavancin and nine comparator agents against anaerobic gram-positive species and corynebacteria.

    Science.gov (United States)

    Goldstein, Ellie J C; Citron, Diane M; Merriam, C Vreni; Warren, Yumi; Tyrrell, Kerin; Fernandez, Helen T

    2003-06-01

    Dalbavancin is a novel semisynthetic glycopeptide with enhanced activity against gram-positive species. Its comparative in vitro activities and those of nine comparator agents, including daptomycin, vancomycin, linezolid, and quinupristin-dalfopristin, against 290 recent gram-positive clinical isolates strains, as determined by the NCCLS agar dilution method, were studied. The MICs of dalbavancin at which 90% of various isolates tested were inhibited were as follows: Actinomyces spp., 0.5 microg/ml; Clostridium clostridioforme, 8 microg/ml; C. difficile, 0.25 microg/ml; C. innocuum, 0.25 microg/ml; C. perfringens, 0.125 microg/ml; C. ramosum, 1 microg/ml; Eubacterium spp., 1 microg/ml; Lactobacillus spp., >32 microg/ml, Propionibacterium spp., 0.5 microg/ml; and Peptostreptococcus spp., 0.25 microg/ml. Dalbavancin was 1 to 3 dilutions more active than vancomycin against most strains. Dalbavancin exhibited excellent activity against gram-positive strains tested and warrants clinical evaluation.

  11. The Toll pathway underlies host sexual dimorphism in resistance to both Gram-negative and Gram-positive bacteria in mated Drosophila.

    Science.gov (United States)

    Duneau, David F; Kondolf, Hannah C; Im, Joo Hyun; Ortiz, Gerardo A; Chow, Christopher; Fox, Michael A; Eugénio, Ana T; Revah, J; Buchon, Nicolas; Lazzaro, Brian P

    2017-12-21

    Host sexual dimorphism is being increasingly recognized to generate strong differences in the outcome of infectious disease, but the mechanisms underlying immunological differences between males and females remain poorly characterized. Here, we used Drosophila melanogaster to assess and dissect sexual dimorphism in the innate response to systemic bacterial infection. We demonstrated sexual dimorphism in susceptibility to infection by a broad spectrum of Gram-positive and Gram-negative bacteria. We found that both virgin and mated females are more susceptible than mated males to most, but not all, infections. We investigated in more detail the lower resistance of females to infection with Providencia rettgeri, a Gram-negative bacterium that naturally infects D. melanogaster. We found that females have a higher number of phagocytes than males and that ablation of hemocytes does not eliminate the dimorphism in resistance to P. rettgeri, so the observed dimorphism does not stem from differences in the cellular response. The Imd pathway is critical for the production of antimicrobial peptides in response to Gram-negative bacteria, but mutants for Imd signaling continued to exhibit dimorphism even though both sexes showed strongly reduced resistance. Instead, we found that the Toll pathway is responsible for the dimorphism in resistance. The Toll pathway is dimorphic in genome-wide constitutive gene expression and in induced response to infection. Toll signaling is dimorphic in both constitutive signaling and in induced activation in response to P. rettgeri infection. The dimorphism in pathway activation can be specifically attributed to Persephone-mediated immune stimulation, by which the Toll pathway is triggered in response to pathogen-derived virulence factors. We additionally found that, in absence of Toll signaling, males become more susceptible than females to the Gram-positive Enterococcus faecalis. This reversal in susceptibility between male and female Toll

  12. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

    Science.gov (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

    2016-01-01

    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

  13. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria.

    Science.gov (United States)

    Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong

    2017-01-24

    Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains

  14. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi

    2017-01-27

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  15. Draft Genome Sequence of Plant Growth–Promoting Micrococcus luteus Strain K39 Isolated from Cyperus conglomeratus in Saudi Arabia

    KAUST Repository

    Lafi, Feras Fawzi; Ramirez Prado, Juan Sebastian; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Micrococcus luteus strain K39 is an endophyte bacterium isolated from roots of the desert plant Cyperus conglomeratus collected from the Red Sea shore, Thuwal, Saudi Arabia. The draft genome sequence of strain K39 revealed a number of enzymes involved in salinity and oxidative stress tolerance or having herbicide-resistance activity.

  16. Cyclic Di-GMP Binding by an Assembly ATPase (PilB2) and Control of Type IV Pilin Polymerization in the Gram-Positive Pathogen Clostridium perfringens.

    Science.gov (United States)

    Hendrick, William A; Orr, Mona W; Murray, Samantha R; Lee, Vincent T; Melville, Stephen B

    2017-05-15

    The Gram-positive pathogen Clostridium perfringens possesses type IV pili (TFP), which are extracellular fibers that are polymerized from a pool of pilin monomers in the cytoplasmic membrane. Two proteins that are essential for pilus functions are an assembly ATPase (PilB) and an inner membrane core protein (PilC). Two homologues each of PilB and PilC are present in C. perfringens , called PilB1/PilB2 and PilC1/PilC2, respectively, along with four pilin proteins, PilA1 to PilA4. The gene encoding PilA2, which is considered the major pilin based on previous studies, is immediately downstream of the pilB2 and pilC2 genes. Purified PilB2 had ATPase activity, bound zinc, formed hexamers even in the absence of ATP, and bound the second messenger molecule cyclic di-GMP (c-di-GMP). Circular dichroism spectroscopy of purified PilC2 indicated that it retained its predicted degree of alpha-helical secondary structure. Even though no direct interactions between PilB2 and PilC2 could be detected in vivo or in vitro even in the presence of c-di-GMP, high levels of expression of a diguanylate cyclase from C. perfringens (CPE1788) stimulated polymerization of PilA2 in a PilB2- and PilC2-dependent manner. These results suggest that PilB2 activity is controlled by c-di-GMP levels in vivo but that PilB2-PilC2 interactions are either transitory or of low affinity, in contrast to results reported previously from in vivo studies of the PilB1/PilC1 pair in which PilC1 was needed for polar localization of PilB1. This is the first biochemical characterization of a c-di-GMP-dependent assembly ATPase from a Gram-positive bacterium. IMPORTANCE Type IV pili (TFP) are protein fibers involved in important bacterial functions, including motility, adherence to surfaces and host cells, and natural transformation. All clostridia whose genomes have been sequenced show evidence of the presence of TFP. The genetically tractable species Clostridium perfringens was used to study proteins involved in

  17. Urinary infection caused by Micrococcus subgroup 3

    Science.gov (United States)

    Kerr, Helen

    1973-01-01

    The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863

  18. Micrococcus-associated central venous catheter infection in patients with pulmonary arterial hypertension.

    Science.gov (United States)

    Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J

    2004-07-01

    To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require

  19. Antibiotic Sensitivity of Micrococcus radiodurans

    Science.gov (United States)

    Hawiger, J.; Jeljaszewicz, J.

    1967-01-01

    A wild-type strain of Micrococcus radiodurans and its nonpigmented mutant W1 were tested for sensitivity to 10 antibiotics selected from the standpoint of their mechanism of action. Representatives of groups of antibiotics inhibiting deoxyribonucleic acid (DNA) synthesis, DNA-dependent ribonucleic acid synthesis, protein synthesis, and cell wall synthesis were selected. M. radiodurans and its mutant exhibited full susceptibility to all antibiotics tested (mitomycin C, actinomycin D, chloramphenicol, dihydrostreptomycin, erythromycin, neomycin, kanamycin, benzylpenicillin, bacitracin, and vancomycin), the degree of susceptibility being of the same order as that of a standard strain of Staphylococcus aureus 209 P, with the exception of dihydrostreptomycin. PMID:4166078

  20. Miniaturized bead-beating device to automate full DNA sample preparation processes for gram-positive bacteria.

    Science.gov (United States)

    Hwang, Kyu-Youn; Kwon, Sung Hong; Jung, Sun-Ok; Lim, Hee-Kyun; Jung, Won-Jong; Park, Chin-Sung; Kim, Joon-Ho; Suh, Kahp-Yang; Huh, Nam

    2011-11-07

    We have developed a miniaturized bead-beating device to automate nucleic acids extraction from Gram-positive bacteria for molecular diagnostics. The microfluidic device was fabricated by sandwiching a monolithic flexible polydimethylsiloxane (PDMS) membrane between two glass wafers (i.e., glass-PDMS-glass), which acted as an actuator for bead collision via its pneumatic vibration without additional lysis equipment. The Gram-positive bacteria, S. aureus and methicillin-resistant S. aureus, were captured on surface-modified glass beads from 1 mL of initial sample solution and in situ lyzed by bead-beating operation. Then, 10 μL or 20 μL of bacterial DNA solution was eluted and amplified successfully by real-time PCR. It was found that liquid volume fraction played a crucial role in determining the cell lysis efficiency in a confined chamber by facilitating membrane deflection and bead motion. The miniaturized bead-beating operation disrupted most of S. aureus within 3 min, which turned out to be as efficient as the conventional benchtop vortexing machine or the enzyme-based lysis technique. The effective cell concentration was significantly enhanced with the reduction of initial sample volume by 50 or 100 times. Combination of such analyte enrichment and in situ bead-beating lysis provided an excellent PCR detection sensitivity amounting to ca. 46 CFU even for the Gram-positive bacteria. The proposed bead-beating microdevice is potentially useful as a nucleic acid extraction method toward a PCR-based sample-to-answer system. This journal is © The Royal Society of Chemistry 2011

  1. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Yunpeng Yang

    2017-01-01

    Full Text Available Catabolite control protein A (CcpA is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR and carbon catabolite activation (CCA, two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt consensus site that is called a catabolite response element (cre within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named crevar, has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA. It was found that the length of the intervening spacer of crevar can affect CcpA binding affinity, and moreover, the core palindromic sequence of crevar is the key structure for regulation. Such a variable architecture of crevar shows potential importance for CcpA’s diverse and fine regulation. A total of 103 potential crevar sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs, and 30 sites were confirmed to be bound by CcpA. These 30 crevar sites are associated with 27 genes involved in many important pathways. Also of significance, the crevar sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria.

  2. Secretory phospholipase A2 in dromedary tears: a host defense against staphylococci and other gram-positive bacteria.

    Science.gov (United States)

    Ben Bacha, Abir; Abid, Islem

    2013-03-01

    The best known physiologic function of secreted phospholipase A2 (sPLA2) group IIA (sPLA2-IIA) is defense against bacterial infection through hydrolytic degradation of bacterial membrane phospholipids. In fact, sPLA2-IIA effectively kills Gram-positive bacteria and to a lesser extent Gram-negative bacteria and is considered a major component of the eye's innate immune defense system. The antibacterial properties of sPLA2 have been demonstrated in rabbit and human tears. In this report, we have analyzed the bactericidal activity of dromedary tears and the subsequently purified sPLA2 on several Gram-positive bacteria. Our results showed that the sPLA2 displays a potent bactericidal activity against all the tested bacteria particularly against the Staphylococcus strains when tested in the ionic environment of tears. There is a synergic action of the sPLA2 with lysozyme when added to the bacteria culture prior to sPLA2. Interestingly, lysozyme purified from dromedary tears showed a significant bactericidal activity against Listeria monocytogene and Staphylococcus epidermidis, whereas the one purified from human tears displayed no activity against these two strains. We have also demonstrated that Ca(2+) is crucial for the activity of dromedary tear sPLA2 and to a less extent Mg(2+) ions. Given the presence of sPLA2 in tears and intestinal secretions, this enzyme may play a substantial role in innate mucosal and systemic bactericidal defenses against Gram-positive bacteria.

  3. Thusin, a novel two-component lantibiotic with potent antimicrobial activity against several Gram-positive pathogens

    Directory of Open Access Journals (Sweden)

    Bingyue Xin

    2016-07-01

    Full Text Available Due to the rapidly increasing prevalence of multidrug-resistant bacterial strains, the need for new antimicrobial drugs to treat infections has become urgent. Bacteriocins, which are antimicrobial peptides of bacterial origin, are considered potential alternatives to conventional antibiotics and have attracted widespread attention in recent years. Among these bacteriocins, lantibiotics, especially two-component lantibiotics, exhibit potent antimicrobial activity against some clinically relevant Gram-positive pathogens and have potential applications in the pharmaceutical industry. In this study, we characterized a novel two-component lantibiotic termed thusin that consists of Thsα, Thsβ and Thsβ' (mutation of Thsβ, A14G and that was isolated from a B. thuringiensis strain BGSC 4BT1. Thsα and Thsβ (or Thsβ' exhibit optimal antimicrobial activity at a 1:1 ratio and act sequentially to affect target cells, and they are all highly thermostable (100°C for 30 min and pH tolerant (pH 2.0 to 9.0. Thusin shows remarkable efficacy against all tested Gram-positive bacteria and greater activities than two known lantibiotics thuricin 4A-4 and ticin A4, and one antibiotic vancomycin against various bacterial pathogens (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus (MRSA, Staphylococcus sciuri, Enterococcus faecalis, and Streptococcus pneumoniae. Moreover, thusin is also able to inhibit the outgrowth of Bacillus cereus spores. The potent antimicrobial activity of thusin against some Gram-positive pathogens indicates that it has potential for the development of new drugs.

  4. Evaluation of the Verigene Gram-positive blood culture nucleic acid test for rapid detection of bacteria and resistance determinants.

    Science.gov (United States)

    Wojewoda, Christina M; Sercia, Linda; Navas, Maria; Tuohy, Marion; Wilson, Deborah; Hall, Geraldine S; Procop, Gary W; Richter, Sandra S

    2013-07-01

    Rapid identification of pathogens from blood cultures can decrease lengths of stay and improve patient outcomes. We evaluated the accuracy of the Verigene Gram-positive blood culture (BC-GP) nucleic acid test for investigational use only (Nanosphere, Inc., Northbrook, IL) for the identification of Gram-positive bacteria from blood cultures. The detection of resistance genes (mecA in Staphylococcus aureus and Staphylococcus epidermidis and vanA or vanB in Enterococcus faecium and Enterococcus faecalis) by the BC-GP assay also was assessed. A total of 186 positive blood cultures (in BacT/Alert FA bottles) with Gram-positive cocci observed with Gram staining were analyzed using the BC-GP assay. The BC-GP results were compared with the identification and susceptibility profiles obtained with routine methods in the clinical laboratory. Discordant results were arbitrated with additional biochemical, cefoxitin disk, and repeat BC-GP testing. The initial BC-GP organism identification was concordant with routine method results for 94.6% of the blood cultures. Only 40% of the Streptococcus pneumoniae identifications were correct. The detection of the mecA gene for 69 blood cultures with only S. aureus or S. epidermidis was concordant with susceptibility testing results. For 3 of 6 cultures with multiple Staphylococcus spp., mecA detection was reported but was correlated with oxacillin resistance in a species other than S. aureus or S. epidermidis. The detection of vanA agreed with susceptibility testing results for 45 of 46 cultures with E. faecalis or E. faecium. Comparison of the mean times to results for each organism group showed that BC-GP results were available 31 to 42 h earlier than phenotypic identifications and 41 to 50 h earlier than susceptibility results.

  5. Characterization and Discrimination of Gram-Positive Bacteria Using Raman Spectroscopy with the Aid of Principal Component Analysis

    Directory of Open Access Journals (Sweden)

    Alia Colniță

    2017-09-01

    Full Text Available Raman scattering and its particular effect, surface-enhanced Raman scattering (SERS, are whole-organism fingerprinting spectroscopic techniques that gain more and more popularity in bacterial detection. In this work, two relevant Gram-positive bacteria species, Lactobacillus casei (L. casei and Listeria monocytogenes (L. monocytogenes were characterized based on their Raman and SERS spectral fingerprints. The SERS spectra were used to identify the biochemical structures of the bacterial cell wall. Two synthesis methods of the SERS-active nanomaterials were used and the recorded spectra were analyzed. L. casei and L. monocytogenes were successfully discriminated by applying Principal Component Analysis (PCA to their specific spectral data.

  6. Experience With Rapid Microarray-Based Diagnostic Technology and Antimicrobial Stewardship for Patients With Gram-Positive Bacteremia.

    Science.gov (United States)

    Neuner, Elizabeth A; Pallotta, Andrea M; Lam, Simon W; Stowe, David; Gordon, Steven M; Procop, Gary W; Richter, Sandra S

    2016-11-01

    OBJECTIVE To describe the impact of rapid diagnostic microarray technology and antimicrobial stewardship for patients with Gram-positive blood cultures. DESIGN Retrospective pre-intervention/post-intervention study. SETTING A 1,200-bed academic medical center. PATIENTS Inpatients with blood cultures positive for Staphylococcus aureus, Enterococcus faecalis, E. faecium, Streptococcus pneumoniae, S. pyogenes, S. agalactiae, S. anginosus, Streptococcus spp., and Listeria monocytogenes during the 6 months before and after implementation of Verigene Gram-positive blood culture microarray (BC-GP) with an antimicrobial stewardship intervention. METHODS Before the intervention, no rapid diagnostic technology was used or antimicrobial stewardship intervention was undertaken, except for the use of peptide nucleic acid fluorescent in situ hybridization and MRSA agar to identify staphylococcal isolates. After the intervention, all Gram-positive blood cultures underwent BC-GP microarray and the antimicrobial stewardship intervention consisting of real-time notification and pharmacist review. RESULTS In total, 513 patients with bacteremia were included in this study: 280 patients with S. aureus, 150 patients with enterococci, 82 patients with stretococci, and 1 patient with L. monocytogenes. The number of antimicrobial switches was similar in the pre-BC-GP (52%; 155 of 300) and post-BC-GP (50%; 107 of 213) periods. The time to antimicrobial switch was significantly shorter in the post-BC-GP group than in the pre-BC-GP group: 48±41 hours versus 75±46 hours, respectively (P<.001). The most common antimicrobial switch was de-escalation and time to de-escalation, was significantly shorter in the post-BC-GP group than in the pre-BC-GP group: 53±41 hours versus 82±48 hours, respectively (P<.001). There was no difference in mortality or hospital length of stay as a result of the intervention. CONCLUSIONS The combination of a rapid microarray diagnostic test with an antimicrobial

  7. Extracellular Electron Transfer Mediated by Flavins in Gram-positive Bacillus sp. WS-XY1 and Yeast Pichia stipitis

    International Nuclear Information System (INIS)

    Wu, Song; Xiao, Yong; Wang, Lu; Zheng, Yue; Chang, Kenlin; Zheng, Zhiyong; Yang, Zhaohui; Varcoe, John R.; Zhao, Feng

    2014-01-01

    Extracellular electron transfer (EET) of microorganisms represents a communicative bridge between the interior and exterior of the cells. Most prior EET studies have focused on Gram-negative bacteria. However, fungi and Gram-positive bacteria, that contain dense cellular walls, have rarely been reported. Herein, two model dense cell wall microorganisms (Bacillus sp. WS-XY1 and the yeast Pichia stipitis) were identified to be electrochemically active. Further analysis indicated that the two microorganisms were able to secrete flavins to mediate their EET. The discovery, that dense cell wall containing microorganisms can undertake mediated EET, adds to the body of knowledge towards building a comprehensive understanding of biogeochemical and bioelectrical processes

  8. Characterization of an Hfq dependent antisense sRNA in the Gram-positive human pathogen Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Lei Kristensen, Lisbeth; Hanghøj Chrisitansen, Mie

    between sRNA and target mRNA rely on the RNA chaperone Hfq. Hfq is a ubiquitous protein found in almost all genres of bacterial life. However, so far its role as an RNA chaperone has only been described in Gram-negative species such as Escherichia coli and Salmonella (Vogel, J. 2009). We previously...... identified several Hfq-binding sRNAs in the Gram-positive human pathogen L. monocytogenes (Christiansen et al 2006). Through bioinformatics, we have identified a number of candidate targets for one of these sRNAs (LhrA). Here, we present the characterization of one of these targets. Our results suggest...

  9. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

  10. Disruption and analysis of the clpB, clpC, and clpE genes in Lactococcus lactis: ClpE, a new Clp family in gram-positive bacteria

    DEFF Research Database (Denmark)

    Ingmer, Hanne; Vogensen, Finn K.; Hammer, Karin

    1999-01-01

    In the genome of the gram-positive bacterium Lactococcus lactis MG1363, we have identified three genes (clpC, clpE, and clpB) which encode Clp proteins containing two conserved ATP binding domains. The proteins encoded by two of the genes belong to the previously described ClpB and ClpC families....... The clpE gene, however, encodes a member of a new Clp protein family that is characterized by a short N-terminal domain including a putative zinc binding domain (-CX2CX22CX2C-). Expression of the 83-kDa ClpE protein as well as of the two proteins encoded by clpB was strongly induced by heat shock and...... was shown to participate in the degradation of randomly folded proteins in L. lactis, could be necessary for degrading proteins generated by certain types of stress....

  11. Antimicrobial Activities of Leaf Extracts of Guava (Psidium guajava L.) on Two Gram-Negative and Gram-Positive Bacteria

    Science.gov (United States)

    Biswas, Bipul; Rogers, Kimberly; McLaughlin, Fredrick; Yadav, Anand

    2013-01-01

    Aim. To determine the antimicrobial potential of guava (Psidium guajava) leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis) and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus) which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water). The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties. PMID:24223039

  12. Antimicrobial Activities of Leaf Extracts of Guava (Psidium guajava L. on Two Gram-Negative and Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Bipul Biswas

    2013-01-01

    Full Text Available Aim. To determine the antimicrobial potential of guava (Psidium guajava leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water. The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties.

  13. An extreme-halophile archaebacterium possesses the interlock type of prephenate dehydratase characteristic of the Gram-positive eubacteria

    Science.gov (United States)

    Jensen, R. A.; d'Amato, T. A.; Hochstein, L. I.

    1988-01-01

    The focal point of phenylalanine biosynthesis is a dehydratase reaction which in different organisms may be prephenate dehydratase, arogenate dehydratase, or cyclohexadienyl dehydratase. Gram-positive, Gram-negative, and cyanobacterial divisions of the eubacterial kingdom exhibit different dehydratase patterns. A new extreme-halophile isolate, which grows on defined medium and is tentatively designated as Halobacterium vallismortis CH-1, possesses the interlock type of prephenate dehydratase present in Gram-positive bacteria. In addition to the conventional sensitivity to feedback inhibition by L-phenylalanine, the phenomenon of metabolic interlock was exemplified by the sensitivity of prephenate dehydratase to allosteric effects produced by extra-pathway (remote) effectors. Thus, L-tryptophan inhibited activity while L-tyrosine, L-methionine, L-leucine and L-isoleucine activated the enzyme. L-Isoleucine and L-phenylalanine were effective at micromolar levels; other effectors operated at mM levels. A regulatory mutant selected for resistance to growth inhibition caused by beta-2-thienylalanine possessed an altered prephenate dehydratase in which a phenomenon of disproportionately low activity at low enzyme concentration was abolished. Inhibition by L-tryptophan was also lost, and activation by allosteric activators was diminished. Not only was sensitivity to feedback inhibition by L-phenylalanine lost, but the mutant enzyme was now activated by this amino acid (a mutation type previously observed in Bacillus subtilis). It remains to be seen whether this type of prephenate dehydratase will prove to be characteristic of all archaebacteria or of some archaebacterial subgroup cluster.

  14. A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria

    Science.gov (United States)

    Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.

    2013-01-01

    The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138

  15. Crystallization and preliminary X-ray analysis of three dUTPases from Gram-positive bacteria

    International Nuclear Information System (INIS)

    Li, Gui-Lan; Wang, Juan; Li, Lan-Fen; Su, Xiao-Dong

    2009-01-01

    All organisms examined to date possess a dUTPase that performs the important function of efficiently hydrolyzing dUTP to dUMP in order to prevent the incorporation of dUTP into DNA. Three putative dUTPases from Gram-positive bacteria have been studied in this work. All organisms examined to date possess a dUTPase that performs the important function of efficiently hydrolyzing dUTP to dUMP in order to prevent the incorporation of dUTP into DNA. Three putative dUTPases from Gram-positive bacteria have been studied in this work. Two dUTPase-encoding genes, yncF and yosS, have been identified in Bacillus subtilis. The gene dut, encoding dUTPase from the dental pathogen Streptococcus mutans, was amplified from S. mutans genomic DNA. The three genes were cloned into expression vectors and overexpressed at high levels in Escherichia coli. Each protein was purified in two steps using chromatographic methods. Crystals of the YosS and YncF proteins and of S. mutans dUTPase were obtained using the vapour-diffusion method. X-ray diffraction data sets were collected from crystals of selenomethionine-labelled YosS and S. mutans dUTPase to resolutions of 2.3 and 1.7 Å, respectively. The crystal of native YncF diffracted to 2.7 Å resolution

  16. Use of MALDI-TOF Mass Spectrometry for the Fast Identification of Gram-Positive Fish Pathogens

    Science.gov (United States)

    Assis, Gabriella B. N.; Pereira, Felipe L.; Zegarra, Alexandra U.; Tavares, Guilherme C.; Leal, Carlos A.; Figueiredo, Henrique C. P.

    2017-01-01

    Gram-positive cocci, such as Streptococcus agalactiae, Lactococcus garvieae, Streptococcus iniae, and Streptococcus dysgalactiae subsp. dysgalactiae, are found throughout the world, particularly in outbreaks in farmed fish, and are thus associated with high economic losses, especially in the cultivation of Nile Tilapia. The aim of this study was to evaluate the efficacy of matrix-assisted laser desorption ionization (MALDI)-time of flight (TOF) mass spectrometry (MS) as an alternative for the diagnosis of these pathogens. One hundred and thirty-one isolates from Brazilian outbreaks assisted by the national authority were identified using a MALDI Biotyper from Bruker Daltonics. The results showed an agreement with respect to identification (Kappa = 1) between this technique and 16S ribosomal RNA gene sequencing for S. agalactiae and L. garvieae. However, for S. iniae and S. dysgalactiae subsp. dysgalactiae, perfect agreement was only achieved after the creation of a custom main spectra profile, as well as further comparisons with 16S ribosomal RNA and multilocus sequence analysis. MALDI-TOF MS was shown to be an efficient technology for the identification of these Gram-positive pathogens, yielding a quick and precise diagnosis. PMID:28848512

  17. Neither Single nor a Combination of Routine Laboratory Parameters can Discriminate between Gram-positive and Gram-negative Bacteremia

    Science.gov (United States)

    Ratzinger, Franz; Dedeyan, Michel; Rammerstorfer, Matthias; Perkmann, Thomas; Burgmann, Heinz; Makristathis, Athanasios; Dorffner, Georg; Loetsch, Felix; Blacky, Alexander; Ramharter, Michael

    2015-01-01

    Adequate early empiric antibiotic therapy is pivotal for the outcome of patients with bloodstream infections. In clinical practice the use of surrogate laboratory parameters is frequently proposed to predict underlying bacterial pathogens; however there is no clear evidence for this assumption. In this study, we investigated the discriminatory capacity of predictive models consisting of routinely available laboratory parameters to predict the presence of Gram-positive or Gram-negative bacteremia. Major machine learning algorithms were screened for their capacity to maximize the area under the receiver operating characteristic curve (ROC-AUC) for discriminating between Gram-positive and Gram-negative cases. Data from 23,765 patients with clinically suspected bacteremia were screened and 1,180 bacteremic patients were included in the study. A relative predominance of Gram-negative bacteremia (54.0%), which was more pronounced in females (59.1%), was observed. The final model achieved 0.675 ROC-AUC resulting in 44.57% sensitivity and 79.75% specificity. Various parameters presented a significant difference between both genders. In gender-specific models, the discriminatory potency was slightly improved. The results of this study do not support the use of surrogate laboratory parameters for predicting classes of causative pathogens. In this patient cohort, gender-specific differences in various laboratory parameters were observed, indicating differences in the host response between genders. PMID:26522966

  18. Two investigational glycylcyclines, DMG-DMDOT and DMG-MINO. Antimicrobial activity studies against gram-positive species.

    Science.gov (United States)

    Johnson, D M; Jones, R N

    1996-01-01

    DMG-DMDOT (CL-331,002 OR CL-331,928) and DMG-MINO (CL-329,998 or CL-344,677) are two new semisynthetic tetracyclines called glycylcyclines, with a broad spectrum of activity and includes Enterobacteriaceae, Gram-positive cocci, JK diphtheroids, and Bacillus cereus. Potent activity was demonstrated against all Streptococcus spp. strains [minimum inhibitory concentrations] (MIC90S) 0.06-0.25 micrograms/ml) and staphylococci (oxacillin susceptible ans resistant; MIC90S 0.12-2 micrograms/ml). Both glycylcyclines (MIC90, 0.06 micrograms/ml) were more potent than minocycline (MIC90 8 micrograms/ml) against Enterococcus faecium, many of which were vancomycin resistant (116 strains). Organisms with minocycline MICs at > or = 8 micrograms/ml (Staphylococcus aureus, enterococci, beta-hemolytic streptococci, and pneumococci) had glycylcycline MIC results ranging from 0.06 to 0.5 micrograms/ml (e.g., apparent use against existing tetracycline-resistance phenotypes). Drugs in this class appear promising for therapy of infections caused by Gram-positive species now testing resistant to contemporary antimicrobial agents, and further development of compounds in this class is encouraged.

  19. The mechanisms of Micrococcus radiodurans radioresistance

    International Nuclear Information System (INIS)

    Samojlenko, I.I.

    1983-01-01

    Modern representations on molecular mechanisms of Micrococcus radiodurans viability under the effect of ionizing radiation have been considered. Factors conditioning a high level of micrococcus cell radiostability have been analyzed: peculiarities of structure of a cell wall, DNA, membranes; excess of genetic information; multiplicity of DNA implantation points to a membrane; high level of antioxidation and antiradical systems. It has been shown that on efficiency of accurate, properly balanced system of DNA repair combined with above Micrococcus radiodurant properties provide a high microorganism radioresistance

  20. Comparative activity of ceftobiprole against Gram-positive and Gram-negative isolates from Europe and the Middle East: the CLASS study.

    Science.gov (United States)

    Rossolini, Gian M; Dryden, Matthew S; Kozlov, Roman S; Quintana, Alvaro; Flamm, Robert K; Läuffer, Jörg M; Lee, Emma; Morrissey, Ian; CLASS Study Group

    2011-01-01

    to assess the in vitro activity of ceftobiprole and comparators against a recent collection of Gram-positive and Gram-negative pathogens, in order to detect potential changes in susceptibility patterns, and to evaluate the Etest assay for ceftobiprole susceptibility testing. contemporary Gram-positive and Gram-negative isolates (excluding extended-spectrum β-lactamase-producing isolates) from across Europe and the Middle East were collected, and their susceptibility to ceftobiprole, vancomycin, teicoplanin, linezolid, ceftazidime and cefepime was assessed using the Etest method. Quality testing [using Etest and broth microdilution (BMD)] was conducted at a central reference laboratory. some 5041 Gram-positive and 4026 Gram-negative isolates were included. Against Gram-positive isolates overall, ceftobiprole had the lowest MIC50 (0.5 mg/L), compared with 1 mg/L for its comparators (vancomycin, teicoplanin and linezolid). Against methicillin-resistant Staphylococcus aureus, all four agents had a similar MIC90 (2 mg/L), but ceftobiprole had a 4-fold better MIC90 (0.5 mg/L) against methicillin-susceptible strains. Only 38 Gram-positive isolates were confirmed as ceftobiprole resistant. Among Gram-negative strains, 86.9%, 91.7% and 95.2% were susceptible to ceftobiprole, ceftazidime and cefepime, respectively. Pseudomonas aeruginosa was less susceptible to all three antimicrobials than any other Gram-negative pathogen. There was generally good agreement between local Etest results and those obtained at the reference laboratory (for ceftobiprole: 86.8% with Gram-negatives; and 94.7% with Gram-positives), as well as between results obtained by BMD and Etest methods (for ceftobiprole: 98.2% with Gram-negatives; and 98.4% with Gram-positives). ceftobiprole exhibits in vitro activity against a wide range of Gram-positive and Gram-negative pathogens, including multidrug-resistant strains. No changes in its known susceptibility profile were identified.

  1. Antimicrobial activity of metal oxide nanoparticles against Gram-positive and Gram-negative bacteria: a comparative study

    Directory of Open Access Journals (Sweden)

    Azam A

    2012-12-01

    Full Text Available Ameer Azam,1,2 Arham S Ahmed,2 Mohammad Oves,3 Mohammad S Khan,3 Sami S Habib,1 Adnan Memic11Centre of Nanotechnology, King Abdulaziz University, Jeddah, Saudi Arabia; 2Centre of Excellence in Materials Science (Nanomaterials, 3Department of Agricultural Microbiology, Aligarh Muslim University, Aligarh, IndiaBackground: Nanomaterials have unique properties compared to their bulk counterparts. For this reason, nanotechnology has attracted a great deal of attention from the scientific community. Metal oxide nanomaterials like ZnO and CuO have been used industrially for several purposes, including cosmetics, paints, plastics, and textiles. A common feature that these nanoparticles exhibit is their antimicrobial behavior against pathogenic bacteria. In this report, we demonstrate the antimicrobial activity of ZnO, CuO, and Fe2O3 nanoparticles against Gram-positive and Gram-negative bacteria.Methods and results: Nanosized particles of three metal oxides (ZnO, CuO, and Fe2O3 were synthesized by a sol–gel combustion route and characterized by X-ray diffraction, Fourier-transform infrared spectroscopy, and transmission electron microscopy techniques. X-ray diffraction results confirmed the single-phase formation of all three nanomaterials. The particle sizes were observed to be 18, 22, and 28 nm for ZnO, CuO, and Fe2O3, respectively. We used these nanomaterials to evaluate their antibacterial activity against both Gram-negative (Escherichia coli and Pseudomonas aeruginosa and Gram-positive (Staphylococcus aureus and Bacillus subtilis bacteria.Conclusion: Among the three metal oxide nanomaterials, ZnO showed greatest antimicrobial activity against both Gram-positive and Gram-negative bacteria used in this study. It was observed that ZnO nanoparticles have excellent bactericidal potential, while Fe2O3 nanoparticles exhibited the least bactericidal activity. The order of antibacterial activity was demonstrated to be the following: ZnO > CuO > Fe2O3

  2. Gram-positive bacteria as an antigen topically applied into gingival sulcus of immunized rat accelerates periodontal destruction.

    Science.gov (United States)

    Nagano, F; Kaneko, T; Yoshinaga, Y; Ukai, T; Kuramoto, A; Nakatsu, S; Oshino, K; Ichimura, I; Hara, Y

    2013-08-01

    Periodontitis is generally accepted to relate to gram-negative bacteria, and the host defense system influences its onset and progression. However, little is known about the relation between gram-positive bacteria and periodontitis. In this study, we topically applied gram-positive and gram-negative bacterial suspensions to the gingival sulcus in rats after immunization, and then histopathologically examined their influence on periodontal destruction. Rats previously immunized with heat-treated and sonicated Staphylococcus aureus or Aggregatibacter actinomycetemcomitans were used as immunized groups. The non-immunized group received only sterile phosphate-buffered saline. In each animal, S. aureus or A. actinomycetemcomitans suspension was applied topically to the palatal gingival sulcus of first molars every 24 h for 10 d. Blood samples were collected and the serum level of anti-S. aureus or anti-A. actinomycetemcomitans immunoglobulin G (IgG) antibodies was determined by enzyme-linked immunosorbent assay. The first molar regions were resected and observed histopathologically. Osteoclasts were stained with tartrate-resistant acid phosphatase (TRAP). The formation of immune complexes was confirmed by immunohistological staining of C1qB. Serum levels of anti-S. aureus and anti-A. actinomycetemcomitans IgG antibodies in the immunized groups were significantly higher than those in the non-immunized groups were. The loss of attachment, increase in apical migration of the junctional epithelium, and decreases in alveolar bone level and number of TRAP-positive multinuclear cells in each immunized group were significantly greater than in each non-immunized group. The presence of C1qB was observed in the junctional epithelium and adjacent connective tissue in the immunized groups. Heat-treated and sonicated S. aureus and A. actinomycetemcomitans induced attachment loss in rats immunized with their suspensions. Our results suggest that not only gram-negative but also gram-positive

  3. Factors Affecting Transformation of Micrococcus lysodeikticus

    Science.gov (United States)

    Kloos, Wesley E.

    1969-01-01

    Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710

  4. Plants used in Guatemala for the treatment of respiratory diseases. 1. Screening of 68 plants against gram-positive bacteria.

    Science.gov (United States)

    Caceres, A; Alvarez, A V; Ovando, A E; Samayoa, B E

    1991-02-01

    Respiratory ailments are important causes of morbidity and mortality in developing countries. Ethnobotanical surveys and literature reviews conducted in Guatemala during 1986-88 showed that 234 plants from 75 families, most of them of American origin, have been used for the treatment of respiratory ailments. Three Gram-positive bacteria causing respiratory infections (Staphylococcus aureus, Streptococcus pneumoniae and Streptococcus pyogenes) were used to screen 68 of the most commonly used plants for activity. Twenty-eight of these (41.2%) inhibited the growth of one or more of the bacteria tested. Staphylococcus aureus was inhibited by 18 of the plant extracts, while 7 extracts were effective against Streptococcus pyogenes. Plants of American origin which exhibited antibacterial activity were: Gnaphalium viscosum, Lippia alba, Lippia dulcis, Physalis philadelphica, Satureja brownei, Solanum nigrescens and Tagetes lucida. These preliminary in vitro results provide scientific basis for the use of these plants against bacterial respiratory infections.

  5. Amplifiable DNA from Gram-negative and Gram-positive bacteria by a low strength pulsed electric field method

    Science.gov (United States)

    Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen

    2000-01-01

    An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214

  6. [Yearly changes in antibacterial activities of cefozopran against various clinical isolates between 1996 and 2000--I. Gram-positive bacteria].

    Science.gov (United States)

    Suzuki, Yumiko; Nishinari, Chisato; Endo, Harumi; Tamura, Chieko; Jinbo, Keiko; Hiramatsu, Nobuyoshi; Akiyama, Kazumitsu; Koyama, Tsuneo

    2002-04-01

    The in vitro antibacterial activities of cefozopran (CZOP), an agent of cephems, against various clinical isolates obtained between 1996 and 2000 were yearly evaluated and compared with those of other cephems, oxacephems, carbapenems, and penicillins. Fifteen species, 1,062 strains, of Gram-positive bacteria were isolated from the clinical materials annually collected from January to December, and consisted of methicillin-susceptible Staphylococcus aureus (MSSA; n = 127), methicillin-resistant Staphylococcus aureus (MRSA; n = 123), Staphylococcus epidermidis (n = 104), Staphylococcus haemolyticus (n = 58), Streptococcus pyogenes (n = 100), Streptococcus agalactiae (n = 50), Streptococcus pneumoniae (n = 125), Enterococcus faecalis (n = 150), Enterococcus faecium (n = 50), Enterococcus avium (n = 50), and Peptostreptococcus spp. (P. anaerobius, P. asaccharolyticus, P. magnus, P. micros, P. prevotii; n = 125). CZOP possessed stable antibacterial activities against all strains tested throughout 5 years. The MIC90 of CZOP against MRSA and S. haemolyticus tended to decrease while against S. pneumoniae and Peptostreptococcus spp., tended to increase year by year. However, the MIC90 just changed a little and were consistent with the results from the studies performed until the new drug application approval. Increases in the MIC90 against S. pneumoniae were also observed with cefpirome (CPR), cefepime (CFPM), flomoxef (FMOX), sulbactam/cefoperazone (SBT/CPZ), and imipenem (IPM). Increases in the MIC90 against Peptostreptococcus spp. were also observed with ceftazidime (CAZ), CPR, CFPM, FMOX, SBT/CPZ, and IPM. The decreases in the sensitivities were not always considered to depend upon generation of resistant bacteria because the annual MIC range of each antibacterial agent was almost generally wide every year and the annual sensitivity of each strain to the agents extremely varied. In conclusion, the annual antibacterial activities of CZOP against the Gram-positive

  7. In vitro characterization of the antivirulence target of Gram-positive pathogens, peptidoglycan O-acetyltransferase A (OatA.

    Directory of Open Access Journals (Sweden)

    David Sychantha

    2017-10-01

    Full Text Available The O-acetylation of the essential cell wall polymer peptidoglycan occurs in most Gram-positive bacterial pathogens, including species of Staphylococcus, Streptococcus and Enterococcus. This modification to peptidoglycan protects these pathogens from the lytic action of the lysozymes of innate immunity systems and, as such, is recognized as a virulence factor. The key enzyme involved, peptidoglycan O-acetyltransferase A (OatA represents a particular challenge to biochemical study since it is a membrane associated protein whose substrate is the insoluble peptidoglycan cell wall polymer. OatA is predicted to be bimodular, being comprised of an N-terminal integral membrane domain linked to a C-terminal extracytoplasmic domain. We present herein the first biochemical and kinetic characterization of the C-terminal catalytic domain of OatA from two important human pathogens, Staphylococcus aureus and Streptococcus pneumoniae. Using both pseudosubstrates and novel biosynthetically-prepared peptidoglycan polymers, we characterized distinct substrate specificities for the two enzymes. In addition, the high resolution crystal structure of the C-terminal domain reveals an SGNH/GDSL-like hydrolase fold with a catalytic triad of amino acids but with a non-canonical oxyanion hole structure. Site-specific replacements confirmed the identity of the catalytic and oxyanion hole residues. A model is presented for the O-acetylation of peptidoglycan whereby the translocation of acetyl groups from a cytoplasmic source across the cytoplasmic membrane is catalyzed by the N-terminal domain of OatA for their transfer to peptidoglycan by its C-terminal domain. This study on the structure-function relationship of OatA provides a molecular and mechanistic understanding of this bacterial resistance mechanism opening the prospect for novel chemotherapeutic exploration to enhance innate immunity protection against Gram-positive pathogens.

  8. Organo-Selenium Coatings Inhibit Gram-Negative and Gram-Positive Bacterial Attachment to Ophthalmic Scleral Buckle Material.

    Science.gov (United States)

    Tran, Phat; Arnett, Avery; Jarvis, Courtney; Mosley, Thomas; Tran, Khien; Hanes, Rob; Webster, Dan; Mitchell, Kelly; Dominguez, Leo; Hamood, Abdul; Reid, Ted W

    2017-09-01

    Biofilm formation is a problem for solid and sponge-type scleral buckles. This can lead to complications that require removal of the buckle, and result in vision loss due to related ocular morbidity, primarily infection, or recurrent retinal detachment. We investigate the ability of a covalent organo-selenium coating to inhibit biofilm formation on a scleral buckle. Sponge and solid Labtican brand scleral buckles were coated with organo-selenium coupled to a silyation reagent. Staphylococcus aureus biofilm formation was monitored by a standard colony-forming unit assay and the confocal laser scanning microscopy, while Pseudomonas aeruginosa biofilm formation was examined by scanning electron microscopy. Stability studies were done, by soaking in phosphate buffer saline (PBS) at room temperature for 2 months. Toxicity against human corneal epithelial cell was examined by growing the cells in the presence of organo-selenium-coated scleral buckles. The organo-selenium coating inhibited biofilm formation by gram-negative and gram-positive bacteria. The buckle coatings also were shown to be fully active after soaking in PBS for 2 months. The organo-selenium coatings had no effect on the viability of human corneal epithelial cells. Organo-selenium can be used to covalently coat a scleral buckle, which is stable and inhibits biofilm formation for gram-negative and gram-positive bacteria. The organo-selenium buckle coating was stable and nontoxic to cell culture. This technology provides a means to inhibit bacterial attachment to devices attached to the eye, without damage to ocular cells.

  9. Outcomes of single organism peritonitis in peritoneal dialysis: gram negatives versus gram positives in the Network 9 Peritonitis Study.

    Science.gov (United States)

    Bunke, C M; Brier, M E; Golper, T A

    1997-08-01

    The use of the "peritonitis rate" in the management of patients undergoing peritoneal dialysis is assuming importance in comparing the prowess of facilities, care givers and new innovations. For this to be a meaningful outcome measure, the type of infection (causative pathogen) must have less clinical significance than the number of infections during a time interval. The natural history of Staphylococcus aureus, pseudomonas, and fungal peritonitis would not support that the outcome of an episode of peritonitis is independent of the causative pathogen. Could this concern be extended to other more frequently occurring pathogens? To address this, the Network 9 Peritonitis Study identified 530 episodes of single organism peritonitis caused by a gram positive organism and 136 episodes caused by a single non-pseudomonal gram negative (NPGN) pathogen. Coincidental soft tissue infections (exit site or tunnel) occurred equally in both groups. Outcomes of peritonitis were analyzed by organism classification and by presence or absence of a soft tissue infection. NPGN peritonitis was associated with significantly more frequent catheter loss, hospitalization, and technique failure and was less likely to resolve regardless of the presence or absence of a soft tissue infection. Hospitalization and death tended to occur more frequently with enterococcal peritonitis than with other gram positive peritonitis. The outcomes in the NPGN peritonitis group were significantly worse (resolution, catheter loss, hospitalization, technique failure) compared to coagulase negative staphylococcal or S. aureus peritonitis, regardless of the presence or absence of a coincidental soft tissue infection. Furthermore, for the first time, the poor outcomes of gram negative peritonitis are shown to be independent of pseudomonas or polymicrobial involvement or soft tissue infections. The gram negative organism appears to be the important factor. In addition, the outcome of peritonitis caused by S. aureus

  10. Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.

    Science.gov (United States)

    Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman

    2010-11-01

    A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.

  11. [Cloning and expression of Micrococcus luteus IAM 14879 Rpf and its role in the recovery of the VBNC state in Rhodococcus sp. DS471].

    Science.gov (United States)

    Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira

    2012-01-01

    The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.

  12. Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

    Science.gov (United States)

    Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

    2014-01-01

    Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

  13. Distinction of Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of water-soluble tetrazolium salts with a selection medium.

    Science.gov (United States)

    Tsukatani, Tadayuki; Suenaga, Hikaru; Higuchi, Tomoko; Shiga, Masanobu; Noguchi, Katsuya; Matsumoto, Kiyoshi

    2011-01-01

    Bacteria are fundamentally divided into two groups: Gram-positive and Gram-negative. Although the Gram stain and other techniques can be used to differentiate these groups, some issues exist with traditional approaches. In this study, we developed a method for differentiating Gram-positive and -negative bacteria using a colorimetric microbial viability assay based on the reduction of the tetrazolium salt {2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt} (WST-8) via 2-methyl-1,4-napthoquinone with a selection medium. We optimized the composition of the selection medium to allow the growth of Gram-negative bacteria while inhibiting the growth of Gram-positive bacteria. When the colorimetric viability assay was carried out in a selection medium containing 0.5µg/ml crystal violet, 5.0 µg/ml daptomycin, and 5.0µg/ml vancomycin, the reduction in WST-8 by Gram-positive bacteria was inhibited. On the other hand, Gram-negative bacteria produced WST-8-formazan in the selection medium. The proposed method was also applied to determine the Gram staining characteristics of bacteria isolated from various foodstuffs. There was good agreement between the results obtained using the present method and those obtained using a conventional staining method. These results suggest that the WST-8 colorimetric assay with selection medium is a useful technique for accurately differentiating Gram-positive and -negative bacteria.

  14. Gram-positive and gram-negative bacteria induce different patterns of cytokine production in human mononuclear cells irrespective of taxonomic relatedness.

    Science.gov (United States)

    Skovbjerg, Susann; Martner, Anna; Hynsjö, Lars; Hessle, Christina; Olsen, Ingar; Dewhirst, Floyd E; Tham, Wilhelm; Wold, Agnes E

    2010-01-01

    Upon bacterial stimulation, tissue macrophages produce a variety of cytokines that orchestrate the immune response that clears the infection. We have shown that Gram-positives induce higher levels of interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor (TNF) from human peripheral blood mononuclear cells (PBMCs) than do Gram-negatives, which instead induce more of IL-6, IL-8, and IL-10. Here, we study whether these patterns follows or crosses taxonomic borders. PBMCs from blood donors were incubated with UV-inactivated bacteria representing 37 species from five phyla. IL-12, TNF, IL-1beta, IL-6, IL-8, and IL-10 were measured in the supernatants after 24 h and IFN-gamma after 5 days. Irrespective of phylogenetic position, Gram-positive bacteria induced much more IL-12 (nine times more on average) and IFN-gamma (seven times), more TNF (three times), and slightly more IL-1beta (1.5 times) than did Gram-negatives, which instead induced more IL-6 (1.5 times), IL-8 (1.9 times), and IL-10 (3.3 times) than did Gram-positives. A notable exception was the Gram-positive Listeria monocytogenes, which induced very little IL-12, IFN-gamma, and TNF. The results confirm the fundamental difference in innate immune responses to Gram-positive and Gram-negative bacteria, which crosses taxonomic borders and probably reflects differences in cell wall structure.

  15. Endophthalmitis caused by gram-positive bacteria resistant to vancomycin: Clinical settings, causative organisms, antimicrobial susceptibilities, and treatment outcomes

    Directory of Open Access Journals (Sweden)

    Hegde Sharat Shivaramaiah

    2018-06-01

    Full Text Available Purpose: To report the clinical settings, causative organisms, antimicrobial susceptibilities, and treatment outcomes of patients with endophthalmitis caused by gram-positive bacteria resistant to vancomycin. Methods: Retrospective case series of all patients with culture-proven endophthalmitis caused by gram-positive bacteria resistant to vancomycin between January 2010 and December 2016 in LV Prasad Eye Institute, Visakhapatnam, India. Results: The current study included 14 patients. The clinical settings were post-cataract surgery in 8/14 (57.1% and open globe injury in 6/14 (42.8%. Primary intervention for all patients included tap and intravitreal antibiotic injection. During subsequent follow-up, pars plana vitrectomy was performed in 6 patients and one patient underwent penetrating keratoplasty. Mean number of intravitreal antibiotic injections performed were 3.4 per patient. The most common organisms isolated were coagulase-negative Staphylococci in 6/14 (42.8%, Staphylococcus aureus in 5/14 (35.7%, Streptococcus sp in 2/14 (14.2% and Bacillus sp in 1/14 (7.14%. In addition to vancomycin, resistance to multiple drugs (three or more groups of antibiotics was found in all 14 cases. Antimicrobial susceptibility results showed susceptibility to amikacin in 7/14 (50.0%, gatifloxacin in 6/14 (42.8%, moxifloxacin in 3/13 (23.0%, cefazoline in 5/14 (35.7%, cefuroxime in 3/14 (21.4%, ciprofloxacin in 2/14 (14.2% and linezolid in 5/5 (100%. The mean duration of follow-up was 30.7 weeks (6 weeks–90 weeks. At last follow-up, visual acuity (VA of 20/200 or better was recorded in 7/14 (50% and VA < 5/200 occurred in 7/14 (50%. Conclusion and importance: Antimicrobial susceptibility testing may help in selection of suitable antimicrobial agents for repeat intravitreal injection. Inspite of retreatment with intravitreal antibiotics, these patients generally had poor VA outcomes. Keywords: Coagulase-negative Staphylococci, Endophthalmitis

  16. Can early MRI distinguish between Kingella kingae and Gram-positive cocci in osteoarticular infections in young children?

    Energy Technology Data Exchange (ETDEWEB)

    Kanavaki, Aikaterini; Hanquinet, Sylviane; Merlini, Laura [Geneva University Hospital HUG, Unit of Pediatric Radiology, Geneva (Switzerland); Ceroni, Dimitri [Geneva University Hospital, Unit of Pediatric Orthopedics, Geneva (Switzerland); Tchernin, David [Geneva University Hospital, Department of Radiology, Geneva (Switzerland)

    2012-01-15

    K. kingae is a common causative organism in acute osteoarticular infections (OAIs) in children under 4 years of age. Differentiation between K. kingae and Gram-positive cocci (GPC) is of great interest therapeutically. Our aim was to identify early distinguishing MRI features of OAIs. Thirty-one children younger than 4 years of age with OAI underwent MRI at presentation. Of these, 21 were caused by K. kingae and ten by GPC. Bone and soft tissue reaction, epiphyseal cartilage involvement, bone and subperiosteal abscess formation were compared between the two groups. Interobserver agreement was measured. Bone reaction was less frequent (P=0.0066) and soft tissue reaction less severe (P=0.0087) in the K. kingae group. Epiphysis cartilage abscesses were present only in the K. kingae group (P=0.0118). No difference was found for bone abscess (P=0.1411), subperiosteal abscess (P=1) or joint effusion (P=0.4414). Interobserver agreement was good for all criteria. MRI is useful in differentiating K. kingae from GPC in OAI. Cartilaginous involvement and modest soft tissue and bone reaction suggest K. kingae. (orig.)

  17. Dose-Dependent Antimicrobial Activity of Silver Nanoparticles on Polycaprolactone Fibers against Gram-Positive and Gram-Negative Bacteria

    Directory of Open Access Journals (Sweden)

    Erick Pazos-Ortiz

    2017-01-01

    Full Text Available The adhesion ability and adaptability of bacteria, coupled with constant use of the same bactericides, have made the increase in the diversity of treatments against infections necessary. Nanotechnology has played an important role in the search for new ways to prevent and treat infections, including the use of metallic nanoparticles with antibacterial properties. In this study, we worked on the design of a composite of silver nanoparticles (AgNPS embedded in poly-epsilon-caprolactone nanofibers and evaluated its antimicrobial properties against various Gram-positive and Gram-negative microorganisms associated with drug-resistant infections. Polycaprolactone-silver composites (PCL-AgNPs were prepared in two steps. The first step consisted in the reduction in situ of Ag+ ions using N,N-dimethylformamide (DMF in tetrahydrofuran (THF solution, and the second step involved the simple addition of polycaprolactone before electrospinning process. Antibacterial activity of PCL-AgNPs nanofibers against E. coli, S. mutans, K. pneumoniae, S. aureus, P. aeruginosa, and B. subtilis was evaluated. Results showed sensibility of E. coli, K. pneumoniae, S. aureus, and P. aeruginosa, but not for B. subtilis and S. mutans. This antimicrobial activity of PCL-AgNPs showed significant positive correlations associated with the dose-dependent effect. The antibacterial property of the PCL/Ag nanofibers might have high potential medical applications in drug-resistant infections.

  18. Silver-doped manganese dioxide and trioxide nanoparticles inhibit both gram positive and gram negative pathogenic bacteria.

    Science.gov (United States)

    Kunkalekar, R K; Prabhu, M S; Naik, M M; Salker, A V

    2014-01-01

    Palladium, ruthenium and silver-doped MnO2 and silver doped Mn2O3 nanoparticles were synthesized by simple co-precipitation technique. SEM-TEM analysis revealed the nano-size of these synthesized samples. XPS data illustrates that Mn is present in 4+ and 3+ oxidation states in MnO2 and Mn2O3 respectively. Thermal analysis gave significant evidence for the phase changes with increasing temperature. Antibacterial activity of these synthesized nanoparticles on three Gram positive bacterial cultures (Staphylococcus aureus ATCC 6538, Streptococcus epidermis ATCC 12228, Bacillus subtilis ATCC 6633) and three Gram negative cultures (Escherichia coli ATCC 8739, Salmonella abony NCTC 6017 and Klebsiella pneumoniae ATCC 1003) was investigated using a disc diffusion method and live/dead assay. Only Ag-doped MnO2 and Ag-doped Mn2O3 nanoparticles showed antibacterial property against all six-test bacteria but Ag-doped MnO2 was found to be more effective than Ag-doped Mn2O3. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Modulation of Quorum Sensing in a Gram-Positive Pathogen by Linear Molecularly Imprinted Polymers with Anti-infective Properties.

    Science.gov (United States)

    Motib, Anfal; Guerreiro, Antonio; Al-Bayati, Firas; Piletska, Elena; Manzoor, Irfan; Shafeeq, Sulman; Kadam, Anagha; Kuipers, Oscar; Hiller, Luisa; Cowen, Todd; Piletsky, Sergey; Andrew, Peter W; Yesilkaya, Hasan

    2017-12-22

    We describe the development, characterization, and biological testing of a new type of linear molecularly imprinted polymer (LMIP) designed to act as an anti-infective by blocking the quorum sensing (QS) mechanism and so abrogating the virulence of the pathogen Streptococcus pneumoniae. The LMIP is prepared (polymerized) in presence of a template molecule, but unlike in traditional molecular imprinting approaches, no cross-linker is used. This results in soluble low-molecular-weight oligomers that can act as a therapeutic agent in vitro and in vivo. The LMIP was characterized by mass spectrometry to determine its monomer composition. Fragments identified were then aligned along the peptide template by computer modeling to predict the possible monomer sequence of the LMIP. These findings provide a proof of principle that LMIPs can be used to block QS, thus setting the stage for the development of LMIPs a novel drug-discovery platform and class of materials to target Gram-positive pathogens. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Antibacterial Activity of Extracellular Protease Isolated From an Algicolous Fungus Xylaria psidii KT30 Against Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Taufik Indarmawan

    2016-04-01

    Full Text Available Infectious diseases became more serious problem for public health in recent years. Although existing antibacterial drugs have been relatively effective, they do not rule out the emergence of resistance to the drug. Therefore, the intensive exploration of new bioactive compounds from natural, especially peptide compounds began in recent decades in order-handling infection. This study aimed to isolate, purify and test the potential application of Xylaria psidii KT30 extracellular protease as antibacterial agent against Gram-positive bacteria. X. psidii KT30, a marine fungus isolated from red seaweed Kappaphycus alvarezii showed antibacterial activity against Bacillus subtilis and Staphylococcus aureus. Antibacterial compounds of this fungus were predicted as a group of proteases. Extracellular protease exhibited an optimum activity when potato dextrose broth was used as cultivation medium. Furthermore, the highest activity of these proteases was found on fungal extract after day 15 of cultivation with value of 2.33 ± 0.19 U/mL. The partial purification of proteases using G-75 column chromatography resulted in 2 groups of fractions and showed protease activity based on zymogram assay. The extracellular proteases obtained from those fractions have 3 patterns of molecular mass based on sodium dodecyl sulfate–polyacrylamide gel electrophoresis which are 56.62, 89.12, 162.18 kDa.

  1. A Synthetic Dual Drug Sideromycin Induces Gram-Negative Bacteria To Commit Suicide with a Gram-Positive Antibiotic.

    Science.gov (United States)

    Liu, Rui; Miller, Patricia A; Vakulenko, Sergei B; Stewart, Nichole K; Boggess, William C; Miller, Marvin J

    2018-05-10

    Many antibiotics lack activity against Gram-negative bacteria because they cannot permeate the outer membrane or suffer from efflux and, in the case of β-lactams, are degraded by β-lactamases. Herein, we describe the synthesis and studies of a dual drug conjugate (1) of a siderophore linked to a cephalosporin with an attached oxazolidinone. The cephalosporin component of 1 is rapidly hydrolyzed by purified ADC-1 β-lactamase to release the oxazolidinone. Conjugate 1 is active against clinical isolates of Acinetobacter baumannii as well as strains producing large amounts of ADC-1 β-lactamase. Overall, the results are consistent with siderophore-mediated active uptake, inherent activity of the delivered dual drug, and in the presence of β-lactamases, intracellular release of the oxazolidinone upon cleavage of the cephalosporin to allow the freed oxazolidinone to inactivate its target. The ultimate result demonstrates that Gram-positive oxazolidinone antibiotics can be made to be effective against Gram-negative bacteria by β-lactamase triggered release.

  2. Distribution of multi-resistant Gram-negative versus Gram-positive bacteria in the hospital inanimate environment.

    Science.gov (United States)

    Lemmen, S W; Häfner, H; Zolldann, D; Stanzel, S; Lütticken, R

    2004-03-01

    We prospectively studied the difference in detection rates of multi-resistant Gram-positive and multi-resistant Gram-negative bacteria in the inanimate environment of patients harbouring these organisms. Up to 20 different locations around 190 patients were surveyed. Fifty-four patients were infected or colonized with methicillin-resistant Staphylococcus aureus (MRSA) or vancomycin-resistant enterococci (VRE) and 136 with multi-resistant Gram-negative bacteria. The environmental detection rate for MRSA or VRE was 24.7% (174/705 samples) compared with 4.9% (89/1827 samples) for multi-resistant Gram-negative bacteria (PGram-positive bacteria were isolated more frequently than Gram-negatives from the hands of patients (PGram-positive and Gram-negative isolates. Our results suggest that the inanimate environment serves as a secondary source for MRSA and VRE, but less so for Gram-negative bacteria. Thus, strict contact isolation in a single room with complete barrier precautions is recommended for MRSA or VRE; however, for multi-resistant Gram-negative bacteria, contact isolation with barrier precautions for close contact but without a single room seems sufficient. This benefits not only the patients, but also the hospital by removing some of the strain placed on already over-stretched resources.

  3. A Sortase A-Immobilized Mesoporous Hollow Carbon Sphere-Based Biosensor for Detection of Gram-Positive Bacteria

    Science.gov (United States)

    Wang, Hongsu; Luo, Ruiping; Chen, Yang; Si, Qi; Niu, Xiaodi

    2018-05-01

    A sensor based on mesoporous carbon materials immobilized with sortase A (SrtA) for determination of Staphylococcus aureus (S. aureus) is reported. To prepare the biosensor, we first synthesized carboxyl-functionalized mesoporous hollow carbon spheres, then applied them as carriers for immobilization of SrtA. Based on the catalytic mechanism of SrtA, a highly sensitive, inexpensive, and rapid method was developed for S. aureus detection. The sensor showed a linear response in the bacterial concentration range of 0.125 × 102 colony-forming units (CFU) mL-1 to 2.5 × 102 CFU mL-1, with detection limit as low as 9.0 CFU mL-1. The method was successfully used for quantitative detection of S. aureus in whole milk samples, giving results similar to experimental results obtained from the plate counting method. This biosensor could also be used to detect other Gram-positive bacteria that secrete SrtA.

  4. Nanoparticle targeting of Gram-positive and Gram-negative bacteria for magnetic-based separations of bacterial pathogens

    Science.gov (United States)

    Lu, Hoang D.; Yang, Shirley S.; Wilson, Brian K.; McManus, Simon A.; Chen, Christopher V. H.-H.; Prud'homme, Robert K.

    2017-04-01

    Antimicrobial resistance is a healthcare problem of increasing significance, and there is increasing interest in developing new tools to address bacterial infections. Bacteria-targeting nanoparticles hold promise to improve drug efficacy, compliance, and safety. In addition, nanoparticles can also be used for novel applications, such as bacterial imaging or bioseperations. We here present the use of a scalable block-copolymer-directed self-assembly process, Flash NanoPrecipitation, to form zinc(II)-bis(dipicolylamine) modified nanoparticles that bind to both Gram-positive and Gram-negative bacteria with specificity. Particles have tunable surface ligand densities that change particle avidity and binding efficacy. A variety of materials can be encapsulated into the core of the particles, such as optical dyes or iron oxide colloids, to produce imageable and magnetically active bacterial targeting constructs. As a proof-of-concept, these particles are used to bind and separate bacteria from solution in a magnetic column. Magnetic manipulation and separation would translate to a platform for pathogen identification or removal. These magnetic and targeted nanoparticles enable new methods to address bacterial infections.

  5. Antimicrobial resistance in gram-positive pathogens isolated in the UK between October 1996 and January 1997.

    Science.gov (United States)

    Andrews, J; Ashby, J; Jevons, G; Lines, N; Wise, R

    1999-05-01

    Antimicrobial resistance in gram-positive pathogens from 30 centres in the UK (ten Teaching, ten Associate Teaching and ten District General Hospitals) was studied over a 4 month period between October 1996 and January 1997. High-level resistance (HLR) and low-level resistance (LLR) to penicillin amongst pneumococci was 3.3% and 3.4%, respectively. However, considerable variation in resistance rates was observed depending on geographical location (LLR range 0-15.4% and HLR range 0-30.8%). Considerable variation in resistance rates was also observed for Staphylococcus aureus to methicillin, with rates ranging from 0% to 56.7% depending on locality. Using conventional MIC methodology, none of the isolates of S. aureus was considered as having reduced sensitivity to vancomycin. However, eight isolates grew on Brain Heart Infusion Agar containing vancomycin (4 mg/L) after prolonged incubation and are therefore worthy of further investigation by electron microscopy. With Enterococcus faecalis, resistance rates were similar between the three types of hospital and only four isolates were considered resistant to glycopeptide antibiotics (one vanA and three vanB phenotype).

  6. Inhibition of various gram-positive and gram-negative bacteria growth on selenium nanoparticle coated paper towels.

    Science.gov (United States)

    Wang, Qi; Larese-Casanova, Philip; Webster, Thomas J

    2015-01-01

    There are wide spread bacterial contamination issues on various paper products, such as paper towels hanging in sink splash zones or those used to clean surfaces, filter papers used in water and air purifying systems, and wrappings used in the food industry; such contamination may lead to the potential spread of bacteria and consequent severe health concerns. In this study, selenium nanoparticles were coated on normal paper towel surfaces through a quick precipitation method, introducing antibacterial properties to the paper towels in a healthy way. Their effectiveness at preventing biofilm formation was tested in bacterial assays involving Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus epidermidis. The results showed significant and continuous bacteria inhibition with about a 90% reduction from 24 to 72 hours for gram-positive bacteria including S. aureus and S. epidermidis. The selenium coated paper towels also showed significant inhibition of gram-negative bacteria like P. aeruginosa and E. coli growth at about 57% and 84%, respectively, after 72 hours of treatment. Therefore, this study established a promising selenium-based antibacterial strategy to prevent bacterial growth on paper products, which may lead to the avoidance of bacteria spreading and consequent severe health concerns.

  7. Antibacterial activity of sphingoid bases and fatty acids against Gram-positive and Gram-negative bacteria.

    Science.gov (United States)

    Fischer, Carol L; Drake, David R; Dawson, Deborah V; Blanchette, Derek R; Brogden, Kim A; Wertz, Philip W

    2012-03-01

    There is growing evidence that the role of lipids in innate immunity is more important than previously realized. How lipids interact with bacteria to achieve a level of protection, however, is still poorly understood. To begin to address the mechanisms of antibacterial activity, we determined MICs and minimum bactericidal concentrations (MBCs) of lipids common to the skin and oral cavity--the sphingoid bases D-sphingosine, phytosphingosine, and dihydrosphingosine and the fatty acids sapienic acid and lauric acid--against four Gram-negative bacteria and seven Gram-positive bacteria. Exact Kruskal-Wallis tests of these values showed differences among lipid treatments (P 500 μg/ml). Sapienic acid (MBC range, 31.3 to 375.0 μg/ml) was active against Streptococcus sanguinis, Streptococcus mitis, and Fusobacterium nucleatum but not active against Escherichia coli, Staphylococcus aureus, S. marcescens, P. aeruginosa, Corynebacterium bovis, Corynebacterium striatum, and Corynebacterium jeikeium (MBC > 500 μg/ml). Lauric acid (MBC range, 6.8 to 375.0 μg/ml) was active against all bacteria except E. coli, S. marcescens, and P. aeruginosa (MBC > 500 μg/ml). Complete killing was achieved as early as 0.5 h for some lipids but took as long as 24 h for others. Hence, sphingoid bases and fatty acids have different antibacterial activities and may have potential for prophylactic or therapeutic intervention in infection.

  8. Evaluation of the automated system Vitek2 for identification and antimicrobial susceptibility testing of Brazilian Gram-positive cocci strains

    Directory of Open Access Journals (Sweden)

    Pedro Alves d'Azevedo

    Full Text Available Automated instruments offer many advantages for clinical laboratories. Nevertheless, they can have problems identifying and determining susceptibilities of some pathogens. Vitek® 2 (bioMérieux is an automated system that was recently introduced to Brazil. We evaluated the performance of this equipment for Brazilian isolates that had been characterized using reference identification and antimicrobial susceptibility testing methods. Ninety-nine strains of Gram-positive cocci from a local reference center collection were analyzed, consisting of 50 coagulasenegative Staphylococcus (CoNS and 49 Enterococcus and related species. Vitek® 2 correctly identified 79.8% (79/99 of the isolates. Oxacillin resistance was detected in 76% (19/25 of resistant S. epidermidis strains and in 88% (22/25 of other resistant CoNS species strains. Vancomycin resistance was detected in 100% (20/20 of resistant Enterococcus and related species strains. Vitek® 2 performed very well for the identification of S. epidermidis and non-epidermidis staphylococci, and for the detection of vancomycin resistance in Enterococcus and related species. However, the system needs improvement in order to provide reliable results for the characterization of some CoNS species, identification of Enterococcus and related species and for detecting oxacillin resistance in CoNS.

  9. How bacterial cell division might cheat turgor pressure - a unified mechanism of septal division in Gram-positive and Gram-negative bacteria.

    Science.gov (United States)

    Erickson, Harold P

    2017-08-01

    An important question for bacterial cell division is how the invaginating septum can overcome the turgor force generated by the high osmolarity of the cytoplasm. I suggest that it may not need to. Several studies in Gram-negative bacteria have shown that the periplasm is isoosmolar with the cytoplasm. Indirect evidence suggests that this is also true for Gram-positive bacteria. In this case the invagination of the septum takes place within the uniformly high osmotic pressure environment, and does not have to fight turgor pressure. A related question is how the V-shaped constriction of Gram-negative bacteria relates to the plate-like septum of Gram-positive bacteria. I collected evidence that Gram-negative bacteria have a latent capability of forming plate-like septa, and present a model in which septal division is the basic mechanism in both Gram-positive and Gram-negative bacteria. © 2017 WILEY Periodicals, Inc.

  10. Changes of the Quinolones Resistance to Gram-positive Cocci Isolated during the Past 8 Years in the First Bethune Hospital

    Science.gov (United States)

    Xu, Jiancheng; Chen, Qihui; Yao, Hanxin; Zhou, Qi

    This study was to investigate the quinolones resistance to gram-positive cocci isolated in the First Bethune Hospital during the past 8 years. Disk diffusion test was used to study the antimicrobial resistance. The data were analyzed by WHONET 5 software according to Clinical and Laboratory Standards Institute (CLSI). The rates of methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative Staphylococci (MRCNS) were 50.8%∼83.3% and 79.4%∼81.5%during the past 8 years, respectively. In recent 8 years, the quinolones resistance to gram-positive cocci had increased. Monitoring of the quinolones resistance to gram-positive cocci should be strengthened. The change of the antimicrobial resistance should be investigated in order to guide rational drug usage in the clinic and prevent bacterial strain of drug resistance from being transmitted.

  11. Chemical constituents of Helichrysum italicum (Roth G. Don essential oil and their antimicrobial activity against Gram-positive and Gram-negative bacteria, filamentous fungi and Candida albicans

    Directory of Open Access Journals (Sweden)

    Bouzid Djihane

    2017-07-01

    Full Text Available The aerial parts of Helichrysum italicum (Roth G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%. The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%, α-Curcumene (11.41%, Geranyl acetate (10.05%, Limonene (6.07%, Nerol (5.04%, Neryl acetate (4.91% and α-Pinene (3.78%. The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum, Aspergillus niger, Alternaria alternata, Ascochyta rabiei. H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml−1. A minimum fungistatic and fungicide concentration of 6.325 μg ml−1 and 12.65 μg ml−1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml−1 to 50.6 μg ml−1 and a fungicide minimum

  12. Chemical constituents of Helichrysum italicum (Roth) G. Don essential oil and their antimicrobial activity against Gram-positive and Gram-negative bacteria, filamentous fungi and Candida albicans.

    Science.gov (United States)

    Djihane, Bouzid; Wafa, Nouioua; Elkhamssa, Soltani; Pedro, De Haro Juan; Maria, Angeles Esteban; Mohamed Mihoub, Zerroug

    2017-07-01

    The aerial parts of Helichrysum italicum (Roth) G. Don were subjected to hydrodistillation to obtain essential oils which had been analyzed by gas chromatography and gas chromatography coupled with mass spectrometry and tested for antimicrobial activity against 12 bacteria, two yeasts and four fungi by agar diffusion method. The essential oil yielded 0.44% (v/w) and 67 compounds accounting for 99.24% of the oil were identified with a high content of oxygenated sesquiterpenes (61.42%). The most oxygenated sesquiterpene compounds were α-Cedrene (13.61%), α-Curcumene (11.41%), Geranyl acetate (10.05%), Limonene (6.07%), Nerol (5.04%), Neryl acetate (4.91%) and α-Pinene (3.78%). The antimicrobial activity of the essential oil was assayed by using the disk diffusion method on Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 6538, Micrococcus luteus ATCC 4698, Klebsiella pneumonia ATCC 4352, Enterococcus cereus ATCC 2035, Bacillus cereus ATCC 10876, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis ATCC 9372, Pseudomonas aeruginosa ATCC 27853, Enterococcus faecalis ATCC 49452, Proteus mirabilis ATCC 35659, Listeria monocytogenes ATCC 15313 and yeasts Candida albicans ATCC 10231, Saccharomyces cerevisiae ATCC 9763 and fungi, Fusarium solani var. coeruleum , Aspergillus niger , Alternaria alternata , Ascochyta rabiei . H. italicum inhibited the growth of all the tested microorganisms except three bacteria, E. coli ATCC 25922, K. pneumonia ATCC 4352 and L. monocytogenes ATCC 15313. The most sensitive bacterium was E. cereus ATCC 2035 with minimum inhibitory and bactericidal concentrations of 0.79 μg ml -1 . A minimum fungistatic and fungicide concentration of 6.325 μg ml -1 and 12.65 μg ml -1 respectively was obtained with C. albicans ATCC 10231 and S. cerevisiae ATCC 9763. However the four fungi were more resistant with fungistatic minimum concentration ranging from 6.325 μg ml -1 to 50.6 μg ml -1 and a fungicide minimum concentration of 50

  13. Draft Genome Sequence of the Efficient Bioflocculant-Producing Bacterium Paenibacillus sp. Strain A9

    Science.gov (United States)

    Liu, Jin-liang; Hu, Xiao-min

    2013-01-01

    Paenibacillus sp. strain A9 is an important bioflocculant-producing bacterium, isolated from a soil sample, and is pale pink-pigmented, aerobic, and Gram-positive. Here, we report the draft genome sequence and the initial findings from a preliminary analysis of strain A9, which is a novel species of Paenibacillus. PMID:23618713

  14. Halophilic Amylase from a Moderately Halophilic Micrococcus

    Science.gov (United States)

    Onishi, Hiroshi

    1972-01-01

    A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445

  15. [Post-marketing surveillance of antibacterial activities of cefozopran against various clinical isolates--I. Gram-positive bacteria].

    Science.gov (United States)

    Igari, Jun; Oguri, Toyoko; Hiramatsu, Nobuyoshi; Akiyama, Kazumitsu; Koyama, Tsuneo

    2003-10-01

    As a post-marketing surveillance, the in vitro antibacterial activities of cefozopran (CZOP), an agent of cephems, against various clinical isolates were yearly evaluated and compared with those of other cephems, oxacephems, penicillins, and carbapenems. Changes in the bacterial susceptibility for CZOP were also evaluated with the resistance ratio calculated with breakpoint MIC. Sixteen species (2,363 strains) of Gram-positive bacteria were isolated from the clinical materials annually collected from 1996 to 2001, and consisted of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant Staphylococcus aureus (MRSA), methicillin-susceptible Staphylococcus epidermidis (MSSE), methicillin-resistant Staphylococcus epidermidis (MRSE), Staphylococcus haemolyticus, Staphylococcus saprophyticus, Enterococcus faecalis, Enterococcus faecium, Enterococcus avium, Streptococcus pyogenes, Streptococcus agalactiae, penicillin-susceptible Streptococcus pneumoniae (PSSP), penicillin-intermediate resistant S. pneumoniae (PISP), penicillin-resistant S. pneumoniae (PRSP), Streptococcus milleri group and Peptostreptococcus spp. The antibacterial activity of CZOP either against MSSA or MSSE was preferable (MIC90: 2 or 0.5 micrograms/mL) and comparable to those of other cephems. CZOP was also effective on MRSE (MIC90: 16 micrograms/mL) but not on MRSA. CZOP and other cephems had low antibacterial activity against S. haemolyticus (MIC90: 64 micrograms/mL). The antibacterial activity of CZOP against S. saprophyticus was comparable to or higher than those of other cephems, but the MIC90 of CZOP in 2001 was higher than those in 1996-2000 (32 vs 1-2 micrograms/mL). The antibacterial activity of CZOP against E. faecalis was comparable to that of cefpirome (CPR; MIC90: 16 micrograms/mL) and higher than those of other cephems. No antibacterial activity of CZOP against E. faecium and E. avium was observed, like other drugs. The antibacterial activity of CZOP against S. pyogenes

  16. Genome sequence of Desulfitobacterium hafniense DCB-2, a Gram-positive anaerobe capable of dehalogenation and metal reduction

    Directory of Open Access Journals (Sweden)

    Kim Sang-Hoon

    2012-02-01

    Full Text Available Abstract Background The genome of the Gram-positive, metal-reducing, dehalorespiring Desulfitobacterium hafniense DCB-2 was sequenced in order to gain insights into its metabolic capacities, adaptive physiology, and regulatory machineries, and to compare with that of Desulfitobacterium hafniense Y51, the phylogenetically closest strain among the species with a sequenced genome. Results The genome of Desulfitobacterium hafniense DCB-2 is composed of a 5,279,134-bp circular chromosome with 5,042 predicted genes. Genome content and parallel physiological studies support the cell's ability to fix N2 and CO2, form spores and biofilms, reduce metals, and use a variety of electron acceptors in respiration, including halogenated organic compounds. The genome contained seven reductive dehalogenase genes and four nitrogenase gene homologs but lacked the Nar respiratory nitrate reductase system. The D. hafniense DCB-2 genome contained genes for 43 RNA polymerase sigma factors including 27 sigma-24 subunits, 59 two-component signal transduction systems, and about 730 transporter proteins. In addition, it contained genes for 53 molybdopterin-binding oxidoreductases, 19 flavoprotein paralogs of the fumarate reductase, and many other FAD/FMN-binding oxidoreductases, proving the cell's versatility in both adaptive and reductive capacities. Together with the ability to form spores, the presence of the CO2-fixing Wood-Ljungdahl pathway and the genes associated with oxygen tolerance add flexibility to the cell's options for survival under stress. Conclusions D. hafniense DCB-2's genome contains genes consistent with its abilities for dehalogenation, metal reduction, N2 and CO2 fixation, anaerobic respiration, oxygen tolerance, spore formation, and biofilm formation which make this organism a potential candidate for bioremediation at contaminated sites.

  17. Flow cytometric evaluation of physico-chemical impact on Gram-positive and Gram-negative bacteria

    Science.gov (United States)

    Fröhling, Antje; Schlüter, Oliver

    2015-01-01

    Since heat sensitivity of fruits and vegetables limits the application of thermal inactivation processes, new emerging inactivation technologies have to be established to fulfill the requirements of food safety without affecting the produce quality. The efficiency of inactivation treatments has to be ensured and monitored. Monitoring of inactivation effects is commonly performed using traditional cultivation methods which have the disadvantage of the time span needed to obtain results. The aim of this study was to compare the inactivation effects of peracetic acid (PAA), ozonated water (O3), and cold atmospheric pressure plasma (CAPP) on Gram-positive and Gram-negative bacteria using flow cytometric methods. E. coli cells were completely depolarized after treatment (15 s) with 0.25% PAA at 10°C, and after treatment (10 s) with 3.8 mg l−1 O3 at 12°C. The membrane potential of CAPP treated cells remained almost constant at an operating power of 20 W over a time period of 3 min, and subsequently decreased within 30 s of further treatment. Complete membrane permeabilization was observed after 10 s O3 treatment, but treatment with PAA and CAPP did not completely permeabilize the cells within 2 and 4 min, respectively. Similar results were obtained for esterase activity. O3 inactivates cellular esterase but esterase activity was detected after 4 min CAPP treatment and 2 min PAA treatment. L. innocua cells and P. carotovorum cells were also permeabilized instantaneously by O3 treatment at concentrations of 3.8 ± 1 mg l−1. However, higher membrane permeabilization of L. innocua and P. carotovorum than of E. coli was observed at CAPP treatment of 20 W. The degree of bacterial damage due to the inactivation processes is highly dependent on treatment parameters as well as on treated bacteria. Important information regarding the inactivation mechanisms can be obtained by flow cytometric measurements and this enables the definition of critical process parameters. PMID

  18. Flow cytometric evaluation of physico-chemical impact on Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Antje eFröhling

    2015-09-01

    Full Text Available Since heat sensitivity of fruits and vegetables limits the application of thermal inactivation processes, new emerging inactivation technologies have to be established to fulfil the requirements of food safety without affecting the produce quality. The efficiency of inactivation treatments has to be ensured and monitored. Monitoring of inactivation effects is commonly performed using traditional cultivation methods which have the disadvantage of the time span needed to obtain results.The aim of this study was to compare the inactivation effects of peracetic acid (PAA, ozonated water (O3 and cold atmospheric pressure plasma (CAPP on Gram-positive and Gram-negative bacteria using flow cytometric methods. E. coli cells were completely depolarized after treatment (15 s with 0.25 % PAA at 10 °C, and after treatment (10 s with 3.8 mg l-1 O3 at 12°C. The membrane potential of CAPP treated cells remained almost constant at an operating power of 20 W over a time period of 3 min, and subsequently decreased within 30 s of further treatment. Complete membrane permeabilization was observed after 10 s O3 treatment, but treatment with PAA and CAPP did not completely permeabilize the cells within 2 min and 4 min, respectively. Similar results were obtained for esterase activity. O3 inactivates cellular esterase but esterase activity was detected after 4 min CAPP treatment and 2 min PAA treatment. L. innocua cells and P. carotovorum cells were also permeabilized instantaneously by O3 treatment at concentrations of 3.8 ± 1 mg l-1. However, higher membrane permeabilization of L. innocua and P. carotovorum than of E. coli was observed at CAPP treatment of 20 W. The degree of bacterial damage due to the inactivation processes is highly dependent on treatment parameters as well as on treated bacteria. Important information regarding the inactivation mechanisms can be obtained by flow cytometric measurements and this enables the definition of critical process

  19. Antibacterial activity and interactions of plant essential oil combinations against Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Cristina Anamaria Semeniuc

    2017-04-01

    Full Text Available The aim of this study was to compare the antibacterial effects of several essential oils (EOs alone and in combination against different Gram-positive and Gram-negative bacteria associated with food products. Parsley, lovage, basil, and thyme EOs, as well as their mixtures (1:1, v/v, were tested against Bacillus cereus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Salmonella typhimurium. The inhibitory effects ranged from strong (thyme EO against E. coli to no inhibition (parsley EO against P. aeruginosa. Thyme EO exhibited strong (against E. coli, moderate (against S. typhimurium and B. cereus, or mild inhibitory effects (against P. aeruginosa and S. aureus, and basil EO showed mild (against E. coli and B. cereus or no inhibitory effects (against S. typhimurium, P. aeruginosa, and S. aureus. Parsley and lovage EOs revealed no inhibitory effects against all tested strains. Combinations of lovage/thyme and basil/thyme EOs displayed antagonistic effects against all bacteria, parsley/thyme EOs against B. cereus, S. aureus, P. aeruginosa, and E. coli, and lovage/basil EOs against B. cereus and E. coli. Combinations of parsley/lovage and parsley/basil EOs exhibited indifferent effects against all bacteria. The combination of lovage/basil EO showed indifferent effect against S. aureus, P. aeruginosa, and S. typhimurium, and the combination parsley/thyme EO against S. typhimurium. Thyme EO has the highest percentage yield and antibacterial potential from all tested formulations; its combination with parsley, lovage, and basil EOs determines a reduction of its antibacterial activity. Hence, it is recommended to be used alone as the antibacterial agent.

  20. Enhanced Cadmium (Cd Phytoextraction from Contaminated Soil using Cd-Resistant Bacterium

    Directory of Open Access Journals (Sweden)

    Kunchaya Setkit

    2014-01-01

    Full Text Available A cadmium (Cd-resistant bacterium, Micrococcus sp. MU1, is able to produce indole-3-acetic acid and promotes root elongation and plant growth. The potential of this bacterium on enhancement of Cd uptake and bioaccumulation of Cd in Helianthus annuus L. planted in Cd-contaminated soil was evaluated in greenhouse condition. The results showed that Micrococcus sp. MU1promoted the growth of H. annuus L. by increasing the root length, stem height, dry biomass, root to shoot ratio and also significantly increased Cd accumulation in the root and above-ground tissues of H. annuus L. compared to uninoculated control. Re-inoculation with Micrococcus sp. MU1in contaminated soil helped in promoting plant growth and Cd phytoextraction throughout the cultivation period. In addition, phytoextraction coefficient and translocation factor (TF of H. annuus L. inoculated with Micrococcus sp. MU1were higher than that of uninoculated control and TF continuously increased with time. Our results suggested that Micrococcus sp. MU1 has an ability to enhance plant growth and Cd uptake in H. annuus L. Synergistic interaction between Micrococcus sp. MU1 and H. annuus L. could be further applied for Cd phytoextraction in polluted areas.

  1. Comparative in vitro activities of trovafloxacin (CP-99,219) against 445 gram-positive isolates from patients with endocarditis and those with other bloodstream infections

    NARCIS (Netherlands)

    H.P. Endtz (Hubert); J.W. Mouton (Johan); J.G. den Hollander (Jan); N.P.W.C.J. van den Braak (Nicole); H.A. Verbrugh (Henri)

    1997-01-01

    textabstractThe in vitro activity of trovafloxacin (CP-99,219), a new fluoroquinolone, was compared with the in vitro activities of other commonly used quinolones and other antimicrobial agents against 445 gram-positive microorganisms isolated between 1986 and 1995 from

  2. The optimization and validation of the Biotyper MALDI-TOF MS database for the identification of Gram-positive anaerobic cocci

    NARCIS (Netherlands)

    Veloo, A. C. M.; de Vries, E D; Jean-Pierre, H.; Justesen, U. S.; Morris, T.; Urban, E.; Wybo, I.; van Winkelhoff, A. J.

    OBJECTIVES: Gram-positive anaerobic cocci (GPAC) account for 24-31% of the anaerobic bacteria isolated from human clinical specimens. At present GPAC are underrepresented in the Biotyper MALDI-TOF MS database. Profiles of new species have yet to be added. We present the optimization of the MALDI-TOF

  3. Identification of the sigmaB regulon of Bacillus cereus and conservation of sigmaB-regulated genes in low-GC-content gram-positive bacteria

    NARCIS (Netherlands)

    Schaik, van W.; Voort, van der M.; Molenaar, D.; Moezelaar, R.; Vos, de W.M.; Abee, T.

    2007-01-01

    The alternative sigma factor B has an important role in the acquisition of stress resistance in many gram-positive bacteria, including the food-borne pathogen Bacillus cereus. Here, we describe the identification of the set of B-regulated genes in B. cereus by DNA microarray analysis of the

  4. Evaluation of the LightCycler Staphylococcus M GRADE kits on positive blood cultures that contained gram-positive cocci in clusters.

    Science.gov (United States)

    Shrestha, Nabin K; Tuohy, Marion J; Padmanabhan, Ravindran A; Hall, Gerri S; Procop, Gary W

    2005-12-01

    We evaluated the Roche LightCycler Staphylococcus M(GRADE) kits to differentiate between Staphylococcus aureus and coagulase-negative staphylococci in blood cultures growing clusters of gram-positive cocci. Testing 100 bottles (36 containing S. aureus), the assay was 100% sensitive and 98.44% specific for S. aureus and 100% sensitive and specific for coagulase-negative staphylococci.

  5. Chemical analysis of isolated cell walls of Gram-positive bacteria and the determination of the cell wall to cell mass ratio.

    NARCIS (Netherlands)

    Wal, van der A.; Norde, W.; Bendinger, B.; Zehnder, A.J.B.; Lyklema, J.

    1997-01-01

    Cell walls of five Gram-positive bacterial strains, including four coryneforms and a Bacillus brevis strain were isolated and subsequently chemically analysed. The wall contribution to the total cell mass is calculated from a comparison of D-Lactate concentrations in hydrolysates of whole cells and

  6. Evolution of Recognition of Ligands from Gram-Positive Bacteria: Similarities and Differences in the TLR2-Mediated Response between Mammalian Vertebrates and Teleost Fish

    NARCIS (Netherlands)

    Ribeiro, Carla M. S.; Hermsen, Trudi; Taverne-Thiele, Anja J.; Savelkoul, Huub F. J.; Wiegertjes, Geert F.

    2010-01-01

    We investigated the role of the TLR2 receptor in the recognition of ligands from Gram-positive bacteria in fish. Comparative sequence analysis showed a highly conserved Toll/IL-1 receptor domain. Although the leucine-rich repeat domain was less conserved, the position of the critical peptidoglycan

  7. Use of the Lactococcal nisA Promoter To Regulate Gene Expression in Gram-Positive Bacteria : Comparison of Induction Level and Promoter Strength

    NARCIS (Netherlands)

    Eichenbaum, Zehava; Federle, Michael J.; Marra, Diana; Vos, Willem M. de; Kuipers, Oscar P.; Kleerebezem, Michiel; Scott, June R.

    1998-01-01

    We characterized the regulated activity of the lactococcal nisA promoter in strains of the gram-positive species Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumoniae, Enterococcus faecalis, and Bacillus subtilis. nisA promoter activity was dependent on the proteins NisR and

  8. Comparative activity of tigecycline and tetracycline on Gram-negative and Gram-positive bacteria revealed by a multicentre study in four North European countries

    DEFF Research Database (Denmark)

    Nilsson, Lennart E; Frimodt-Møller, Niels; Vaara, Martti

    2011-01-01

    This study involves a multicentre surveillance of tigecycline and tetracycline activity against Gram-negative and Gram-positive bacteria from primary care centres (PCCs), general hospital wards (GHWs) and intensive care units (ICUs) in Denmark (n = 9), Finland (n = 10), Norway (n = 7) and Sweden (n...

  9. In vitro activity of XF-73, a novel antibacterial agent, against antibiotic-sensitive and -resistant Gram-positive and Gram-negative bacterial species.

    Science.gov (United States)

    Farrell, David J; Robbins, Marion; Rhys-Williams, William; Love, William G

    2010-06-01

    The antibacterial activity of XF-73, a dicationic porphyrin drug, was investigated against a range of Gram-positive and Gram-negative bacteria with known antibiotic resistance profiles, including resistance to cell wall synthesis, protein synthesis, and DNA and RNA synthesis inhibitors as well as cell membrane-active antibiotics. Antibiotic-sensitive strains for each of the bacterial species tested were also included for comparison purposes. XF-73 was active [minimum inhibitory concentration (MIC) 0.25-4 mg/L] against all of the Gram-positive bacteria tested, irrespective of the antibiotic resistance profile of the isolates, suggesting that the mechanism of action of XF-73 is unique compared with the major antibiotic classes. Gram-negative activity was lower (MIC 1 mg/L to > 64 mg/L). Minimum bactericidal concentration data confirmed that the activity of XF-73 was bactericidal. Time-kill kinetics against healthcare-associated and community-associated meticillin-resistant Staphylococcus aureus isolates demonstrated that XF-73 was rapidly bactericidal, with > 5 log(10) kill obtained after 15 min at 2 x MIC, the earliest time point sampled. The post-antibiotic effect (PAE) for XF-73 under conditions where the PAE for vancomycin was 5.4 h. XF-73 represents a novel broad-spectrum Gram-positive antibacterial drug with potentially beneficial characteristics for the treatment and prevention of Gram-positive bacterial infections. 2010. Published by Elsevier B.V.

  10. Type I and Type II mechanisms of antimicrobial photodynamic therapy: an in vitro study on gram-negative and gram-positive bacteria.

    Science.gov (United States)

    Huang, Liyi; Xuan, Yi; Koide, Yuichiro; Zhiyentayev, Timur; Tanaka, Masamitsu; Hamblin, Michael R

    2012-08-01

    Antimicrobial photodynamic therapy (APDT) employs a non-toxic photosensitizer (PS) and visible light, which in the presence of oxygen produce reactive oxygen species (ROS), such as singlet oxygen ((1) O(2), produced via Type II mechanism) and hydroxyl radical (HO(.), produced via Type I mechanism). This study examined the relative contributions of (1) O(2) and HO(.) to APDT killing of Gram-positive and Gram-negative bacteria. Fluorescence probes, 3'-(p-hydroxyphenyl)-fluorescein (HPF) and singlet oxygen sensor green reagent (SOSG) were used to determine HO(.) and (1) O(2) produced by illumination of two PS: tris-cationic-buckminsterfullerene (BB6) and a conjugate between polyethylenimine and chlorin(e6) (PEI-ce6). Dimethylthiourea is a HO(.) scavenger, while sodium azide (NaN(3)) is a quencher of (1) O(2). Both APDT and killing by Fenton reaction (chemical generation of HO(.)) were carried out on Gram-positive bacteria (Staphylococcus aureus and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Proteus mirabilis, and Pseudomonas aeruginosa). Conjugate PEI-ce6 mainly produced (1) O(2) (quenched by NaN(3)), while BB6 produced HO(.) in addition to (1) O(2) when NaN(3) potentiated probe activation. NaN(3) also potentiated HPF activation by Fenton reagent. All bacteria were killed by Fenton reagent but Gram-positive bacteria needed a higher concentration than Gram-negatives. NaN(3) potentiated Fenton-mediated killing of all bacteria. The ratio of APDT killing between Gram-positive and Gram-negative bacteria was 2 or 4:1 for BB6 and 25:1 for conjugate PEI-ce6. There was a NaN(3) dose-dependent inhibition of APDT killing using both PEI-ce6 and BB6 against Gram-negative bacteria while NaN(3) almost failed to inhibit killing of Gram-positive bacteria. Azidyl radicals may be formed from NaN(3) and HO(.). It may be that Gram-negative bacteria are more susceptible to HO(.) while Gram-positive bacteria are more susceptible to (1) O(2). The differences in Na

  11. Radiation resistance of a hemolytic micrococcus isolated from chicken meat

    International Nuclear Information System (INIS)

    Tan, S.T.

    1982-01-01

    The effects of environmental factors on a highly radiation-resistant hemolytic micrococcus isolated from chicken meat were studied. NaCl tolerance and gamma radiation resistance of the cells were growth phase-related. The cells were resistant to injury from drying or freezing/thawing. Under certain conditions, cells in the frozen state required approximately 5 Mrad to inactivate 90% of the population; 0.2 Mrad injured an equivalent proportion. Survival curve of the cells heated at 60 0 C showed a unique pattern which was in three distinct phases. Heat-stressed cells were much more sensitive to radiation inactivation than unheated cells. When suspended in fresh m-Plate Count Broth (PCB), the injured cells repaired without multiplication during incubation at 32 0 C. The repair process in this bacterium, however, was slower compared to thermally injured organisms studied by other workers. An improved replica-plating technique, was devised for isolation of radiation-sensitive mutants of pigmented bacteria. A simple method to demonstrate radiation-inducible radiation resistance in microbial cells was developed. The new method required neither washing/centrifugation nor procedures for cell enumeration. Mutagenesis treatment of radiation-resistant micrococcal bacterium with N-methyl-N'-nitro-N-nitrosoguanidine (NTG) followed by FPR and screening steps resulted in isolation of two radiation-sensitive mutants. The more sensitive mutant strain, designated as 702, was seven times as sensitive to gamma or UC radiation as the wild type. No apparent difference was observed between 702 and the wild type in (1) cell morphology, colonial morphology, and pigment production or (2) tolerance to NaCl, drying/storage, freezing/thawing, and heating. Sodium dodecyl sulfate treatment (for curing) of wild type did not result in isolation of a radiation-sensitive mutant

  12. The characteristics of micrococcus (deinococcus) radiodurans sark plasmids

    International Nuclear Information System (INIS)

    Sjarief, Sri Hariani; Kikuchi, Masahiro; Watanabe, Hiroshi.

    1994-01-01

    The characterization of micrococcus (deinococcus) radiodurans sark plasmids. This bacterium has been classified as a new genus deinococcus radiodurans which is resistant to gamma-rays. It can repair itself completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 KGy. To reveal the repair mechanism, several investigations had been done to develop a cloning vector available for the genetic analysis. For this purpose D. radiodurans Sark are to be prepared as a vector by studying the characteristics of its plasmid. Plasmids were isolated by electrophoresis using 0.6% low-melting-temperature agarose in TAE and run for 5.5 hours, followed by the identification. An antibiotic marker was also carried out in this experiment to identify its location in the genetic materials of the cell, beside making a restriction map of the plasmid. Results have shown that D. radiodurans Sark has 4 plasmids (P1, P2, P3, and P4) and the refampicin resistant genes were not found in the plasmid. (authors). 14 refs; 4 figs

  13. Emended descriptions of the genus Micrococcus, Micrococcus luteus (Cohn 1872) and Micrococcus lylae (Kloos et al. 1974).

    Science.gov (United States)

    Wieser, Monika; Denner, Ewald B M; Kämpfer, Peter; Schumann, Peter; Tindall, Brian; Steiner, Ulrike; Vybiral, Dietmar; Lubitz, Werner; Maszenan, A M; Patel, B K C; Seviour, Robert J; Radax, Christian; Busse, Hans-Jürgen

    2002-03-01

    Nine yellow-pigmented, spherical bacterial strains isolated from a medieval wall painting (strain D7), from indoor air (strains 3, 6, 7, 13C2, 38, 83 and 118) and from an activated-sludge plant (strain Ballarat) were classified by a polyphasic approach. Analyses of the 16S rRNA gene sequences of three representatives (strains D7, 118 and Ballarat) indicated that they all belong to the genus Micrococcus. The three isolates shared the highest sequence similarities with Micrococcus luteus DSM 20030T (97.9-98%), Micrococcus antarcticus AS 1.2372T (97.9-98.3%) and Micrococcus lylae DSM 20315T (97.5-97.9%). DNA-DNA reassociation studies clearly demonstrated that all nine isolates belong to the species M. luteus. However, neither their chemotaxonomic features nor their physiological and biochemical properties were consistent with those of M. luteus DSM 20030T. In contrast to M. luteus DSM 20030T, all isolates investigated possessed MK-8(H2) as the major respiratory quinone, and strain Ballarat had an A4alpha peptidoglycan type. On the basis of analyses of their Fourier transform-infrared spectroscopy spectra, isolates D7, 3, 6, 7, 13C2, 38, 83 and 118 could be grouped into a single cluster separate from M. luteus DSM 20030T, strain Ballarat and M. lylae DSM 20315T. In addition, all these isolates could be distinguished from M. luteus DSM 20030T by their ability to assimilate D-maltose, D-trehalose, DL-3-hydroxybutyrate, DL-lactate, pyruvate and L-histidine and to hydrolyse casein. Strains D7, 3, 6, 7, 13C2, 38, 83 and 118 differed from both M. luteus DSM 20030T and strain Ballarat by their ability to assimilate acetate, L-phenylalanine, L-serine and phenylacetate. Furthermore, REP-PCR fingerprinting yielded one common band for these strains, whereas this band was not observed for M. luteus DSM 20030T, strain Ballarat or M. lylae DSM 20315T. On the basis of these data, the species M. luteus can be divided into three biovars that are distinguished by several chemotaxonomic

  14. Detection and Antibiotic Susceptibility Pattern of Biofilm Producing Gram Positive and Gram Negative Bacteria Isolated From a Tertiary Care Hospital of Pakistan

    Directory of Open Access Journals (Sweden)

    Iqbal, M.

    2011-01-01

    Full Text Available Microorganisms adhere to non-living material or living tissue, and form biofilms made up of extracellular polymers/slime. Biofilm-associated microorganisms behave differently from free-floating bacteria with respect to growth rates and ability to resist antimicrobial treatments and therefore pose a public health problem. The objective of this study is to detect the prevalence of biofilm producers among Gram positive and Gram negative bacteria isolated from clinical specimens, and to study their antimicrobial susceptibility pattern. The study was carried out from October 2009 to March 2010, at the Department of Microbiology, Army Medical College/ National University of Sciences and Technology (NUST, Rawalpindi, Pakistan. Clinical specimens were received from various wards of a tertiary care hospital. These were dealt by standard microbiological procedures. Gram positive and Gram negative bacteria isolated were subjected to biofilm detection by congo red agar method (CRA. Antimicrobial susceptibility testing of those isolates, which showed positive results (slime production, was done according to the Kirby-Bauer disc diffusion technique. A total of 150 isolates were tested for the production of biofilm/slime. Among them, 81 isolates showed positive results. From these 81, 51 were Gram positive and 30 were Gram negative. All the 81(54% slime producers showed reduced susceptibility to majority of antibiotics. Bacterial biofilms are an important virulence factor associated with chronic nosocomial infection. Detection of biofilm forming organisms can help in appropriate antibiotic choice.

  15. Rapid and reliable identification of Gram-negative bacteria and Gram-positive cocci by deposition of bacteria harvested from blood cultures onto the MALDI-TOF plate.

    Science.gov (United States)

    Barnini, Simona; Ghelardi, Emilia; Brucculeri, Veronica; Morici, Paola; Lupetti, Antonella

    2015-06-18

    Rapid identification of the causative agent(s) of bloodstream infections using the matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) methodology can lead to increased empirical antimicrobial therapy appropriateness. Herein, we aimed at establishing an easier and simpler method, further referred to as the direct method, using bacteria harvested by serum separator tubes from positive blood cultures and placed onto the polished steel target plate for rapid identification by MALDI-TOF. The results by the direct method were compared with those obtained by MALDI-TOF on bacteria isolated on solid media. Identification of Gram-negative bacilli was 100 % concordant using the direct method or MALDI-TOF on isolated bacteria (96 % with score > 2.0). These two methods were 90 % concordant on Gram-positive cocci (32 % with score > 2.0). Identification by the SepsiTyper method of Gram-positive cocci gave concordant results with MALDI-TOF on isolated bacteria in 87 % of cases (37 % with score > 2.0). The direct method herein developed allows rapid identification (within 30 min) of Gram-negative bacteria and Gram-positive cocci from positive blood cultures and can be used to rapidly report reliable and accurate results, without requiring skilled personnel or the use of expensive kits.

  16. A Proteomic Signature of Dormancy in the Actinobacterium Micrococcus luteus.

    Science.gov (United States)

    Mali, Sujina; Mitchell, Morgan; Havis, Spencer; Bodunrin, Abiodun; Rangel, Jonathan; Olson, Gabriella; Widger, William R; Bark, Steven J

    2017-07-15

    . Dormancy is comprised of different states, including persistent and viable but nonculturable (VBNC) states that contribute to the spread of bacterial infections. Therefore, it is imperative to identify how bacteria utilize these different dormancy states to survive antibiotic treatment. The objective of our research is to eliminate dormancy as a route to antibiotic tolerance by understanding the proteins that control dormancy in Micrococcus luteus NCTC 2665. This bacterium has unique advantages for studying dormancy, including a small genome and a well-defined and reproducible VBNC state. Our experiments implicate four previously identified and 14 novel proteins upregulated in VBNC that may regulate this critical survival mechanism. Copyright © 2017 American Society for Microbiology.

  17. The Effect of Bicarbonate on the Microbial Dissolution of Autunite Mineral in the Presence of Gram-Positive Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Sepulveda-Medina, Paola; Katsenovich, Yelena; Wellman, Dawn M.; Lagos, Leonel

    2015-06-01

    Bacteria are key players in the processes that govern fate and transport of contaminants. The uranium release from Na and Ca-autunite by Arthrobacter oxydans strain G968 was evaluated in the presence of bicarbonate ions. This bacterium was previously isolated from Hanford Site soil and in earlier prescreening tests demonstrated low tolerance to U(VI) toxicity compared to other A.oxydans isolates. Experiments were conducted using glass serum bottles as mixed bioreactors and sterile 6-well cell culture plates with inserts separating bacteria cells from mineral solids. Reactors containing phosphorus-limiting media were amended with bicarbonate ranging between 0-10 mM and metaautunite solids to provide a U(VI) concentration of 4.4 mmol/L. Results showed that in the presence of bicarbonate, A.oxydans G968 was able to enhance the release of U(VI) from Na and Ca autunite at the same capacity as other A.oxydans isolates with relatively high tolerance to U(VI). The effect of bacterial strains on autunite dissolution decreases as the concentration of bicarbonate increases. The results illustrate that direct interaction between the bacteria and the mineral is not necessary to result in U (VI) biorelease from autunite. The formation of secondary calcium-phosphate mineral phases on the surface of the mineral during the dissolution can ultimately reduce the natural autunite mineral contact area, which bacterial cells can access. This thereby reduces the concentration of uranium released into the solution. This study provides a better understanding of the interactions between meta-autunite and microbes in conditions mimicking arid and semiarid subsurface environments of western U.S.

  18. [Micrococcus sp.--the pathogen of leaf necrosis of horse-chestnuts (Aesculus L.) in Kiev].

    Science.gov (United States)

    Iakovleva, L M; Makhinia, L V; Shcherbina, T N; Ogorodnik, L E

    2013-01-01

    A group of phytopathogenic bacteria was isolated from patterns of drying horse-chestnuts (Aesculus L.), which grow in Kyiv. The properties of slowly growing, highly aggressive microorganisms have been described in the paper. They grow up on the 8-10th day after sowing. The investigated microorganisms form very small (0.5-1 mm in diameter) colonies on the potato agar. Bacteria are protuberant, shining, smooth with flat edges, they are pale yellow, yellow, or pink. The bacteria are Gram-positive, spherical, are disposed in smears singly, in pairs, as accumulations, or netting. They are aerobes, do not form spores, are not mobile. They are inert in respect of different sources of carbon. They reduce nitrates, do not dilute gelatin, do not hydrolyze starch, do not release hydrogen sulphide and indole. The bacteria are catalase-positive, oxidase-negative. They do not cause potato and carrot rot. They lose quickly their viability under the laboratory conditions. The saturated acids C 14:0; C 15:0; C16:0; C18:0 have been revealed in the composition of cellular fatty acids. Microorganisms are identified as Micrococcus sp. Under artificial inoculation this highly aggressive pathogen causes drying of the horse-chestnut buds and necrosis, which occupies 1/3-1/2 of the leaf plate. A wide zone of chlorosis, surrounding necrosis, may occupy the whole leaf surface. The infected leaves use to twist up from the top (apex) or along a midrib and to dry.

  19. Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257).

    Science.gov (United States)

    Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

    2016-12-01

    The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID 50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. © The Author(s) 2016.

  20. Pleural effusion adenosine deaminase: a candidate biomarker to discriminate between Gram-negative and Gram-positive bacterial infections of the pleural space

    Directory of Open Access Journals (Sweden)

    Ruolin Li

    2016-05-01

    Full Text Available OBJECTIVES: Delay in the treatment of pleural infection may contribute to its high mortality. In this retrospective study, we aimed to evaluate the diagnostic accuracy of pleural adenosine deaminase in discrimination between Gram-negative and Gram-positive bacterial infections of the pleural space prior to selecting antibiotics. METHODS: A total of 76 patients were enrolled and grouped into subgroups according to Gram staining: 1 patients with Gram-negative bacterial infections, aged 53.2±18.6 years old, of whom 44.7% had empyemas and 2 patients with Gram-positive bacterial infections, aged 53.5±21.5 years old, of whom 63.1% had empyemas. The pleural effusion was sampled by thoracocentesis and then sent for adenosine deaminase testing, biochemical testing and microbiological culture. The Mann-Whitney U test was used to examine the differences in adenosine deaminase levels between the groups. Correlations between adenosine deaminase and specified variables were also quantified using Spearman’s correlation coefficient. Moreover, receiver operator characteristic analysis was performed to evaluate the diagnostic accuracy of pleural effusion adenosine deaminase. RESULTS: Mean pleural adenosine deaminase levels differed significantly between Gram-negative and Gram-positive bacterial infections of the pleural space (191.8±32.1 U/L vs 81.0±16.9 U/L, p<0.01. The area under the receiver operator characteristic curve was 0.689 (95% confidence interval: 0.570, 0.792, p<0.01 at the cutoff value of 86 U/L. Additionally, pleural adenosine deaminase had a sensitivity of 63.2% (46.0-78.2%; a specificity of 73.7% (56.9-86.6%; positive and negative likelihood ratios of 2.18 and 0.50, respectively; and positive and negative predictive values of 70.6% and 66.7%, respectively. CONCLUSIONS: Pleural effusion adenosine deaminase is a helpful alternative biomarker for early and quick discrimination of Gram-negative from Gram-positive bacterial infections of the

  1. Physico-Chemical-Managed Killing of Penicillin-Resistant Static and Growing Gram-Positive and Gram-Negative Vegetative Bacteria

    Science.gov (United States)

    Richmond, Robert Chaffee (Inventor); Schramm, Jr., Harry F. (Inventor); Defalco, Francis G. (Inventor); Farris, III, Alex F. (Inventor)

    2012-01-01

    Systems and methods for the use of compounds from the Hofmeister series coupled with specific pH and temperature to provide rapid physico-chemical-managed killing of penicillin-resistant static and growing Gram-positive and Gram-negative vegetative bacteria. The systems and methods represent the more general physico-chemical enhancement of susceptibility for a wide range of pathological macromolecular targets to clinical management by establishing the reactivity of those targets to topically applied drugs or anti-toxins.

  2. Antimicrobial susceptibility trends among gram-positive and -negative clinical isolates collected between 2005 and 2012 in Mexico: results from the Tigecycline Evaluation and Surveillance Trial.

    Science.gov (United States)

    Morfin-Otero, Rayo; Noriega, Eduardo Rodriguez; Dowzicky, Michael J

    2015-12-15

    The Tigecycline Evaluation and Surveillance Trial (T.E.S.T) is a global antimicrobial surveillance study of both gram-positive and gram-negative organisms. This report presents data on antimicrobial susceptibility among organisms collected in Mexico between 2005 and 2012 as part of T.E.S.T., and compares rates between 2005-2007 and 2008-2012. Each center in Mexico submitted at least 200 isolates per collection year; including 65 gram-positive isolates and 135 gram-negative isolates. Minimum inhibitory concentrations (MICs) were determined using Clinical Laboratory Standards Institute (CLSI) broth microdilution methodology and antimicrobial susceptibility was established using the 2013 CLSI-approved breakpoints. For tigecycline US Food and Drug Administration (FDA) breakpoints were applied. Isolates of E. coli and K. pneumoniae with a MIC for ceftriaxone of >1 mg/L were screened for ESBL production using the phenotypic confirmatory disk test according to CLSI guidelines. The rates of some key resistant phenotypes changed during this study: vancomycin resistance among Enterococcus faecium decreased from 28.6 % in 2005-2007 to 19.1 % in 2008-2012, while β-lactamase production among Haemophilus influenzae decreased from 37.6 to 18.9 %. Conversely, methicillin-resistant Staphylococcus aureus increased from 38.1 to 47.9 %, meropenem-resistant Acinetobacter spp. increased from 17.7 to 33.0 % and multidrug-resistant Acinetobacter spp. increased from 25.6 to 49.7 %. The prevalence of other resistant pathogens was stable over the study period, including extended-spectrum β-lactamase-positive Escherichia coli (39.0 %) and Klebsiella pneumoniae (25.0 %). The activity of tigecycline was maintained across the study years with MIC90s of ≤2 mg/L against Enterococcus spp., S. aureus, Streptococcus agalactiae, Streptococcus pneumoniae, Enterobacter spp., E. coli, K. pneumoniae, Klebsiella oxytoca, Serratia marcescens, H. influenzae, and Acinetobacter spp. All gram-positive

  3. Monograph: In vitro efficacy of 30 ethnomedicinal plants used by Indian aborigines against 6 multidrug resistant Gram-positive pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Mahesh Chandra Sahu

    2015-02-01

    Full Text Available Objective: To monitor in vitro antibacterial activities of leaf extracts of 30 common and noncommon plants used by aborigines in Kalahandi district, Odisha, against 6 clinically isolated multidrug resistant (MDR Gram-positive bacteria of 3 genera, Staphylococcus, Streptococcus, and Enterococcus. Methods: The antibiotic sensitivity patterns of 6 bacterial strains were studied with the diskdiffusion method with 1 7 antibiotics belonging to 8 classes. Monitored plants have ethnomedicinal use and several are used as traditional medicines. Antibacterial properties were studied with the agar-well diffusion method. Minimum inhibitory concentration and minimum bactericidal concentration values of ethanolic and aqueous extracts of plants were determined by the microbroth-dilution method. Results: Ethanolic plant-extracts had the better antibacterial potencies in comparison to their corresponding aqueous extracts. Plants with most conspicuous antibacterial properties in controlling MDR strains of Gram-positive bacteria were aqueous and ethanolic extracts of plants, Ixora coccinea, Nyctanthes arbor-tristis, Polycythaemia rubra, Pongamia pinnata and Syzygium cumini, Carthamus tinctorius, Cucurbita maxima, Murraya koenigii, Leucas aspera, Plumbago indica and Psidium guajava. Ethanolic extracts of most plants had phytochemicals, alkaloids, glycosides, terpenoids, reducing sugars, saponins, tannins, flavonoids and steroids. Conclusions: These plants could be used further for the isolation of pure compounds to be used as complementary non-microbial antimicrobial medicines.

  4. Therapeutic Potential of a Scorpion Venom-Derived Antimicrobial Peptide and Its Homologs Against Antibiotic-Resistant Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Gaomin Liu

    2018-05-01

    Full Text Available The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N-terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro, chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18 showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.

  5. Facile synthesis of gold nanoparticles on propylamine functionalized SBA-15 and effect of surface functionality of its enhanced bactericidal activity against gram positive bacteria

    International Nuclear Information System (INIS)

    Bhuyan, Diganta; Saikia, Mrinal; Saikia, Lakshi; Gogoi, Animesh; Saikia, Ratul

    2015-01-01

    The facile synthesis of an SBA-15-pr- + NH 3 .Au 0 nano-hybrid material by spontaneous autoreduction of aqueous chloroaurate anions on propylamine functionalized SBA-15 was successfully demonstrated. The as-synthesized SBA-15-pr- + NH 3 .Au 0 nano-hybrid material was well characterized using low and wide angle x-ray diffraction (XRD), N 2 adsorption–desorption isotherms, Fourier transform infrared (FTIR), transmission electron microscopy (TEM), scanning electron microscopy-energy dispersive x-ray spectroscopy (SEM-EDX), x-ray photoelectron spectroscopy (XPS), UV-Visible spectroscopy and atomic absorption spectroscopy (AAS). The activity of the nano-hybrid material as a potent bactericidal agent was successfully tested against Gram positive/negative bacteria viz. Bacillus subtilis, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. The colony killing percentage of Gram positive bacteria was found to be higher than Gram negative bacteria due to the stronger electrostatic interaction between the positively-charged amine functionality of SBA-15 and the negatively charged functionality of the bacterial cell wall. (paper)

  6. The optimization and validation of the Biotyper MALDI-TOF MS database for the identification of Gram-positive anaerobic cocci

    DEFF Research Database (Denmark)

    Veloo, A C M; de Vries, E D; Jean-Pierre, H

    2016-01-01

    Gram-positive anaerobic cocci (GPAC) account for 24%-31% of the anaerobic bacteria isolated from human clinical specimens. At present, GPAC are under-represented in the Biotyper MALDI-TOF MS database. Profiles of new species have yet to be added. We present the optimization of the matrix-assisted......Gram-positive anaerobic cocci (GPAC) account for 24%-31% of the anaerobic bacteria isolated from human clinical specimens. At present, GPAC are under-represented in the Biotyper MALDI-TOF MS database. Profiles of new species have yet to be added. We present the optimization of the matrix......-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS) database for the identification of GPAC. Main spectral profiles (MSPs) were created for 108 clinical GPAC isolates. Identity was confirmed using 16S rRNA gene sequencing. Species identification was considered to be reliable...... if the sequence similarity with its closest relative was ≥98.7%. The optimized database was validated using 140 clinical isolates. The 16S rRNA sequencing identity was compared with the MALDI-TOF MS result. MSPs were added from 17 species that were not yet represented in the MALDI-TOF MS database or were under...

  7. Emergence of a New Population of Rathayibacter toxicus: An Ecologically Complex, Geographically Isolated Bacterium

    OpenAIRE

    Arif, Mohammad; Busot, Grethel Y.; Mann, Rachel; Rodoni, Brendan; Liu, Sanzhen; Stack, James P.

    2016-01-01

    Rathayibacter toxicus is a gram-positive bacterium that infects the floral parts of several Poaceae species in Australia. Bacterial ooze is often produced on the surface of infected plants and bacterial galls are produced in place of seed. R. toxicus is a regulated plant pathogen in the U.S. yet reliable detection and diagnostic tools are lacking. To better understand this geographically-isolated plant pathogen, genetic variation as a function of geographic location, host species, and date of...

  8. Extraction, purification and characterization of a protease from Micrococcus sp. VKMM 037.

    Science.gov (United States)

    Manikandan, Muthu; Kannan, Vijayaraghavan; Pasić, Lejla

    2011-10-01

    The haloalkaliphilic bacterium Micrococcus sp. VKMM 037, isolated from an effluent of the caustic soda industry, was found to produce a protease. Maximal proteolytic activity was observed in cell culture grown at 40 degrees C using 2% (w/v) glycerol, 2% (w/v) beef extract and 2% (w/v) peptone as nutrients in medium also containing 0.85 M NaCl with a pH of 10.0. An efficient purification procedure combining ammonium sulphate precipitation and Q-Sepharose ion-exchange chromatography was developed. The purified 41 kDa protease was stable in a temperature range between 20 degrees C and 60 degrees C. The protease remained active over a wide range of pH values (4.0-12.0) and NaCl concentrations (0-3.42 M) with an optimum at pH 10.0 and 0.85 M NaCl, respectively. Furthermore, the enzyme remained stable or was only marginally inhibited in the presence of various organic solvents, surfactants and reducing agents. The purified protease of Micrococcus sp. VKMM 037 efficiently removed blood stains within 40 minutes of treatment. Given the biochemical characteristics determined, this novel protease could be exploited as an additive in the detergent industry and also for the synthesis of biomolecules and the degradation of protein.

  9. Expression of a Clostridium perfringens genome-encoded putative N-acetylmuramoyl-L-alanine amidase as a potential antimicrobial to control the bacterium

    Science.gov (United States)

    Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a substantial role in non-foodborne human, animal and avian diseases as well as human foodborne disease. Previously discovered C. perfringens bacteriophage lytic enzyme amino acid sequences were utilized to iden...

  10. The effect of cellular carotenoid levels in micrococcus luteus on resistance to gamma radiation

    International Nuclear Information System (INIS)

    Al-Wandawi, K. H.

    2000-01-01

    In the present study, a biological system was developed to link the cellular carotenoid levels to Gamma radiation resistance in bacteria for the frst time. thus, in a non-photosynrhetic bacterium, in Micrococcus Luteus an inverse relationship was found between the increase in diphenylamine (DPA) concentration (5.25 μg/ml culture) and the polar cellular carotenoid pigments (C-45 and C-50 carotenoids and their glucosides). It was also found that irradiation of cells with different carotenoid concentrations with doses of γ-radiation in the range of (0.2500 gray) under oxic, air and hypoxic conditions showed that carotenoid pigments offer no significant protection as they usually do in case of visible light. (author).15 refs., 5 figs., 3 tabs

  11. Surface interactions and fouling properties of Micrococcus luteus with microfiltration membranes.

    Science.gov (United States)

    Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

    2011-11-01

    This study was conducted to investigate microbial adhesion of Micrococcus luteus to polypropylene (PP) and polyvinylidene fluoride (PVDF) membranes in relation to the variation of the interfacial energies in the membrane-bacteria systems, for revealing effects of short-range surface interactions on filtration behavior. Both the membranes and M. luteus showed typical strong electron donors and hydrophilic properties. The AB component was dominant in the interfacial energies of the two membrane-bacteria systems. M. luteus presented larger negative U(mlb)(XDLVO) to the PP membrane than to the PVDF membrane. The adhesion experiments also proved that M. luteus had higher adhesion percentage to the PP membrane. This study demonstrated that the adhesion potentials of M. luteus to the PP and PVDF membranes might be explained in terms of bacterium, membrane, and intervening medium surface properties, which are mainly determined by the interfacial energies in the systems according to the XDLVO theory.

  12. The in vivo association of manganese with the chromosome of Micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Leibowitz, P J; Schwartzberg, L S; Bruce, A K [State Univ. of New York, Buffalo (USA). Dept. of Biology

    1976-01-01

    Extremely high levels of paramagnetic manganese (Mn/sup 2 +/) which quench phosphorescent reactions have been found to inhibit the formation of thymine-containing dimers in M. radiodurans. Lowering the concentration of Mn/sup 2 +/ in the culture medium resulted in a lower intracellular concentration of Mn/sup 2 +/, an increase in the uv-sensitivity of this bacterium, and a larger photochemical yield of thymine-containing dimers. High levels of paramagnetic Mn/sup 2 +/ were not found in other test organisms which are more sensitive to uv-irradiation. One interpretation of this data is that in Micrococcus radiodurans Mn2/sup +/+ may bind to the chromosome and thereby reduce the photochemical yield of thymine-containing dimers.

  13. The in vivo association of manganese with the chromosome of Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Leibowitz, P.J.; Schwartzberg, L.S.; Bruce, A.K.

    1976-01-01

    Extremely high levels of paramagnetic manganese (Mn 2+ ) which quench phosphorescent reactions have been found to inhibit the formation of thymine-containing dimers in M. radiodurans. Lowering the concentration of Mn 2+ in the culture medium resulted in a lower intracellular concentration of Mn 2+ , an increase in the UV-sensitivity of this bacterium, and a larger photochemical yield of thymine-containing dimers. High levels of paramagnetic Mn 2+ were not found in other test organisms which are more sensitive to UV-irradiation. One interpretation of this data is that in Micrococcus radiodurans Mn2 + + may bind to the chromosome and thereby reduce the photochemical yield of thymine-containing dimers. (author)

  14. The deoxyribonucleic acid of Micrococcus radiodurans

    Science.gov (United States)

    Schein, Arnold H.

    1966-01-01

    The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439

  15. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  16. Antimicrobial susceptibility of quinupristin/dalfopristin tested against gram-positive cocci from Latin America: results from the Global SMART (GSMART surveillance study

    Directory of Open Access Journals (Sweden)

    Sader Helio S.

    2001-01-01

    Full Text Available Gram-positive cocci are important causes of both nosocomial and community-acquired infections, and antimicrobial resistance among these pathogens has become an important problem worldwide. Since resistance among these organisms can vary substantially by geographic location, we conducted a multicenter surveillance study with isolates from five Latin American countries (15 medical centers. Quinupristin/dalfopristin (formerly RP-59500 is a novel streptogramin combination with focused activity against Gram-positive cocci, many exhibiting emerging resistance. The in vitro activity of quinupristin/dalfopristin and 12 other antimicrobial agents were evaluated against 1,948 strains including Staphylococcus aureus (747 strains, coagulase-negative staphylococci (CoNS; 446 strains, enterococci (429 strains, and various Streptococcus spp. (326 strains. Oxacillin resistance was observed in 41% of S. aureus (MIC, or = 13 mm and 40% of CoNS (MIC, or = 18 mm. Vancomycin, teicoplanin, and quinupristin/dalfopristin (MIC90, 0.25 - 1 mug/ml remained effective against all strains, but cross-resistance was high among other tested drugs. The quinupristin/dalfopristin MIC50 for Streptococcus pneumoniae and other streptococci was only 0.5 mug/ml (13% to 28% were penicillin-resistant; 12% to 22% were macrolide-resistant. Enterococci demonstrated variable inhibition by quinupristin/dalfopristin depending upon identification and the susceptibility testing method used. The demonstrated quinupristin/dalfopristin activity against Enterococcus faecium was confirmed, but potential species identification errors with various commercial systems continue to confuse susceptibility statistics, even though some strains of E. faecium confirmed by PCR-based or other molecular identification techniques did have quinupristin/dalfopristin MICs of > or = 4 mug/mL. Most important, glycopeptide-resistant enterococci are rapidly emerging in Latin America, and quinupristin/dalfopristin appears

  17. Multi-location gram-positive and gram-negative bacterial protein subcellular localization using gene ontology and multi-label classifier ensemble.

    Science.gov (United States)

    Wang, Xiao; Zhang, Jun; Li, Guo-Zheng

    2015-01-01

    It has become a very important and full of challenge task to predict bacterial protein subcellular locations using computational methods. Although there exist a lot of prediction methods for bacterial proteins, the majority of these methods can only deal with single-location proteins. But unfortunately many multi-location proteins are located in the bacterial cells. Moreover, multi-location proteins have special biological functions capable of helping the development of new drugs. So it is necessary to develop new computational methods for accurately predicting subcellular locations of multi-location bacterial proteins. In this article, two efficient multi-label predictors, Gpos-ECC-mPLoc and Gneg-ECC-mPLoc, are developed to predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. The two multi-label predictors construct the GO vectors by using the GO terms of homologous proteins of query proteins and then adopt a powerful multi-label ensemble classifier to make the final multi-label prediction. The two multi-label predictors have the following advantages: (1) they improve the prediction performance of multi-label proteins by taking the correlations among different labels into account; (2) they ensemble multiple CC classifiers and further generate better prediction results by ensemble learning; and (3) they construct the GO vectors by using the frequency of occurrences of GO terms in the typical homologous set instead of using 0/1 values. Experimental results show that Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently improve prediction accuracy of subcellular localization of multi-location gram-positive and gram-negative bacterial proteins respectively. The online web servers for Gpos-ECC-mPLoc and Gneg-ECC-mPLoc predictors are freely accessible

  18. Successful immunotherapy with micrococcus, BCG or related polysaccharides on L1210 leukaemia after BCNU chemotherapy.

    Science.gov (United States)

    Verloes, R.; Atassi, G.; Dumont, P.; Kanarek, L.

    1981-01-01

    The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to [female BALB/c (H2d) X male DBA/2 (H2d)]F1 hybrid mice, hereafter referred to as CDF1 mice. In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent. Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice. By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells. The i.p. route was notably superior to the i.v. route. When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary. Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. PMID:7470382

  19. Determination of the irradiation dose for the inhibition (D-10 radiation doses) of some gram negative and gram positive bacteria in peptone saline water

    International Nuclear Information System (INIS)

    Ayhan, H.; Tutluer, H.

    1994-01-01

    Determination of the irradiation dose for the inhibition of some pathogenic bacteria which cause food poisoning and spoilage were aimed. For this purpose, Salmonella typhi, Salmonella typhimurium,Salmonella enteridits,Klebsiella pneumonia, Pseudomonas fluorescence,Proteus vulgaris, Aeromonas hydrophila ,(gram-negative bacteria) and Bacillus cereus, Staphylococcus aureus strain 24,Staphylococcus aureus ATCC 6538 P,Staphylococcus epidermidis strain 115 and Clostridium perfringens A4TTK,(gram-positive bacteria) were used.Sensitivity of above mentioned bacteria to gamma rays (source Cs-137) was examined in saline with 0.1% peptone at different temperatures.Survivor plots (log.10 number of survivors versus dose) were determined by regression analysis of the data.Decimal reduction doses (D values in kGy) were calculated as the slope obtained from the regression analysis

  20. Sequence-Based Characterization of Tn5801-Like Genomic Islands in Tetracycline-Resistant Staphylococcus pseudintermedius and Other Gram-positive Bacteria from Humans and Animals

    DEFF Research Database (Denmark)

    de Vries, Lisbeth Elvira; Hasman, Henrik; Jurado Rabadán, Sonia

    2016-01-01

    Antibiotic resistance in pathogens is often associated with mobile genetic elements, such as genomic islands (GI) including integrative and conjugative elements (ICEs). These can transfer resistance genes within and between bacteria from humans and/or animals. The aim of this study was to investi......Antibiotic resistance in pathogens is often associated with mobile genetic elements, such as genomic islands (GI) including integrative and conjugative elements (ICEs). These can transfer resistance genes within and between bacteria from humans and/or animals. The aim of this study......-like GIs appear to be relatively common in tetracycline-resistant S. pseudintermedius in Denmark. Almost identical Tn5801-like GIs were identified in different Gram-positive species of pet and human origin, suggesting that horizontal transfer of these elements has occurred between S. pseudintermedius...

  1. The potent antimicrobial properties of cell penetrating peptide-conjugated silver nanoparticles with excellent selectivity for gram-positive bacteria over erythrocytes.

    Science.gov (United States)

    Liu, Lihong; Yang, Jun; Xie, Jianping; Luo, Zhentao; Jiang, Jiang; Yang, Yi Yan; Liu, Shaomin

    2013-05-07

    Silver nanoparticles are of great interest for use as antimicrobial agents. Studies aimed at producing potent nano-silver biocides have focused on manipulation of particle size, shape, composition and surface charge. Here, we report the cell penetrating peptide catalyzed formation of antimicrobial silver nanoparticles in N,N-dimethylformamide. The novel nano-composite demonstrated a distinctly enhanced biocidal effect toward bacteria (gram-positive Bacillus subtilis, gram-negative Escherichia coli) and pathogenic yeast (Candida albicans), as compared to triangular and extremely small silver nanoparticles. In addition, a satisfactory biocompatibility was verified by a haemolysis test. Our results provide a paradigm in developing strategies that can maximize the silver nanoparticle application potentials while minimizing the toxic effects.

  2. Lactococcus lactis TrxD represents a subgroup of thioredoxins prevalent in Gram-positive bacteria containing WCXDC active site motifs

    DEFF Research Database (Denmark)

    Björnberg, Olof; Efler, Petr; Epie, Denis Ebong

    2014-01-01

    Three protein disulfide reductases of the thioredoxin superfamily from the industrially important Gram-positive Lactococcus lactis (LlTrxA, LlTrxD and LlNrdH) are compared to the "classical" thioredoxin from Escherichia coil (EcTrx1). LlTrxA resembles EcTrx1 with a WCGPC active site motif and other...... capacity to reduce insulin disulfides and their exposed active site thiol is alkylated at a similar rate at pH 7.0. LlTrxD on the other hand, is alkylated by iodoacetamide at almost 100 fold higher rate and shows no activity towards insulin disulfides. LlTrxA, LlTrxD and L1NrdH are all efficiently reduced...

  3. Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination.

    Science.gov (United States)

    Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M; Arpi, Magnus; Christensen, Jens Jørgen

    2010-01-01

    Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains belonged to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods. Most VS strains belonging to the groups of salivarius, anginosus, and mutans obtained agreeing species identifications with the two methods, while this only was the case for 13 of the 21 bovis strains. Pyogenic strains (n=10), Enterococcus faecalis strains (n=54) and a miscellaneous group of catalase-negative, Gram-positive cocci (n=15) seemed well identified by both methods, except that disagreements in identifications in the miscellaneous group of strains occurred for 6 of 15 strains.

  4. Multicenter Evaluation of the Vitek MS Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry System for Identification of Gram-Positive Aerobic Bacteria

    Science.gov (United States)

    Burnham, Carey-Ann D.; Bythrow, Maureen; Garner, Omai B.; Ginocchio, Christine C.; Jennemann, Rebecca; Lewinski, Michael A.; Manji, Ryhana; Mochon, A. Brian; Procop, Gary W.; Richter, Sandra S.; Sercia, Linda; Westblade, Lars F.; Ferraro, Mary Jane; Branda, John A.

    2013-01-01

    Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF) is gaining momentum as a tool for bacterial identification in the clinical microbiology laboratory. Compared with conventional methods, this technology can more readily and conveniently identify a wide range of organisms. Here, we report the findings from a multicenter study to evaluate the Vitek MS v2.0 system (bioMérieux, Inc.) for the identification of aerobic Gram-positive bacteria. A total of 1,146 unique isolates, representing 13 genera and 42 species, were analyzed, and results were compared to those obtained by nucleic acid sequence-based identification as the reference method. For 1,063 of 1,146 isolates (92.8%), the Vitek MS provided a single identification that was accurate to the species level. For an additional 31 isolates (2.7%), multiple possible identifications were provided, all correct at the genus level. Mixed-genus or single-choice incorrect identifications were provided for 18 isolates (1.6%). Although no identification was obtained for 33 isolates (2.9%), there was no specific bacterial species for which the Vitek MS consistently failed to provide identification. In a subset of 463 isolates representing commonly encountered important pathogens, 95% were accurately identified to the species level and there were no misidentifications. Also, in all but one instance, the Vitek MS correctly differentiated Streptococcus pneumoniae from other viridans group streptococci. The findings demonstrate that the Vitek MS system is highly accurate for the identification of Gram-positive aerobic bacteria in the clinical laboratory setting. PMID:23658261

  5. Multicenter evaluation of the Vitek MS matrix-assisted laser desorption ionization-time of flight mass spectrometry system for identification of Gram-positive aerobic bacteria.

    Science.gov (United States)

    Rychert, Jenna; Burnham, Carey-Ann D; Bythrow, Maureen; Garner, Omai B; Ginocchio, Christine C; Jennemann, Rebecca; Lewinski, Michael A; Manji, Ryhana; Mochon, A Brian; Procop, Gary W; Richter, Sandra S; Sercia, Linda; Westblade, Lars F; Ferraro, Mary Jane; Branda, John A

    2013-07-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF) is gaining momentum as a tool for bacterial identification in the clinical microbiology laboratory. Compared with conventional methods, this technology can more readily and conveniently identify a wide range of organisms. Here, we report the findings from a multicenter study to evaluate the Vitek MS v2.0 system (bioMérieux, Inc.) for the identification of aerobic Gram-positive bacteria. A total of 1,146 unique isolates, representing 13 genera and 42 species, were analyzed, and results were compared to those obtained by nucleic acid sequence-based identification as the reference method. For 1,063 of 1,146 isolates (92.8%), the Vitek MS provided a single identification that was accurate to the species level. For an additional 31 isolates (2.7%), multiple possible identifications were provided, all correct at the genus level. Mixed-genus or single-choice incorrect identifications were provided for 18 isolates (1.6%). Although no identification was obtained for 33 isolates (2.9%), there was no specific bacterial species for which the Vitek MS consistently failed to provide identification. In a subset of 463 isolates representing commonly encountered important pathogens, 95% were accurately identified to the species level and there were no misidentifications. Also, in all but one instance, the Vitek MS correctly differentiated Streptococcus pneumoniae from other viridans group streptococci. The findings demonstrate that the Vitek MS system is highly accurate for the identification of Gram-positive aerobic bacteria in the clinical laboratory setting.

  6. Transcriptional attenuation controls macrolide inducible efflux and resistance in Streptococcus pneumoniae and in other Gram-positive bacteria containing mef/mel(msr(D)) elements.

    Science.gov (United States)

    Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S

    2015-01-01

    Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.

  7. From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis

    Science.gov (United States)

    Crawshaw, Samuel G.; Wipat, Anil

    2001-01-01

    Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943

  8. Taxonomic dissection of the genus Micrococcus: Kocuria gen. nov., Nesterenkonia gen. nov., Kytococcus gen. nov., Dermacoccus gen. nov., and Micrococcus Cohn 1872 gen. emend.

    Science.gov (United States)

    Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P

    1995-10-01

    The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].

  9. Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.

    OpenAIRE

    von Eiff, C; Herrmann, M; Peters, G

    1995-01-01

    The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited.

  10. Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.

    Science.gov (United States)

    von Eiff, C; Herrmann, M; Peters, G

    1995-01-01

    The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321

  11. Optimization of Nutrients and Culture Conditions for Alkaline Protease Production Using Two Endophytic Micrococci: Micrococcus aloeverae and Micrococcus yunnanensis.

    Science.gov (United States)

    Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S

    2017-06-01

    An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.

  12. Proteomic and metabolomic responses in hepatopancreas of Mytilus galloprovincialis challenged by Micrococcus luteus and Vibrio anguillarum.

    Science.gov (United States)

    Wu, Huifeng; Ji, Chenglong; Wei, Lei; Zhao, Jianmin; Lu, Hongjian

    2013-12-06

    differential effects induced by the representative Gram-positive (M. luteus) and Gram-negative (V. anguillarum) bacteria in M. galloprovincialis. © 2013.

  13. Structural changes and cellular localization of resuscitation-promoting factor in environmental isolates of Micrococcus luteus.

    Science.gov (United States)

    Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S

    2010-02-01

    Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.

  14. Antimicrobial activity of Micrococcus luteus Cartenoid pigment

    Directory of Open Access Journals (Sweden)

    Huda Z. Majeed

    2017-11-01

    Full Text Available Cartenoids are group of pigments, with enormous types different structurally and functionally, have colors range from red to yellow found in a wide variety of plants, fungi, algae and bacteria. The animals took from food because they cannot make it, on contrary, the plants and microbes produce them due to subjection to environment. The aim of the study is to isolate and characterize the cartenoid pigment from Micrococcus luteus. The pigment extraction was done by acetone, and then was characterized with UltraViolet-Visible spectroscopy (UV–Vis and Fourier Transform Infrared (FTIR spectroscopy. Then, it was tested for antibacterial activity against five different bacterial isolates and antifungal activity tests against six different fungal isolates by well diffusion method. The results found that, the extracted pigment having antibacterial activity and antifungal activity and having the ability to absorb UVA rays within the range of 300-500 nm. There was no significant difference in antimicrobial effect of pigment, even when the extraction and isolation were done by two culture mediums (Nutrient Broth and Luria Bertani Broth. There were considerable inhibition percentages of adhesion after subjection to Cartenoid pigment ranged between (5.71, 23.84 % for Klebsiella spp. and Pseudomonas aeruginosa respectively and all the 11 isolate changed from Biofilm producer to non-producer. The isolated compound can be used against different bacterial and fungal infections. So they had a great future in medicine, cosmetics and as a sun protecting agent.

  15. In vitro activities of the new semisynthetic glycopeptide telavancin (TD-6424), vancomycin, daptomycin, linezolid, and four comparator agents against anaerobic gram-positive species and Corynebacterium spp.

    Science.gov (United States)

    Goldstein, Ellie J C; Citron, Diane M; Merriam, C Vreni; Warren, Yumi A; Tyrrell, Kerin L; Fernandez, Helen T

    2004-06-01

    Telavancin is a new semisynthetic glycopeptide anti-infective with multiple mechanisms of action, including inhibition of bacterial membrane phospholipid synthesis and inhibition of bacterial cell wall synthesis. We determined the in vitro activities of telavancin, vancomycin, daptomycin, linezolid, quinupristin-dalfopristin, imipenem, piperacillin-tazobactam, and ampicillin against 268 clinical isolates of anaerobic gram-positive organisms and 31 Corynebacterium strains using agar dilution methods according to National Committee for Clinical Laboratory Standards procedures. Plates with daptomycin were supplemented with Ca(2+) to 50 mg/liter. The MICs at which 90% of isolates tested were inhibited (MIC(90)s) for telavancin and vancomycin were as follows: Actinomyces spp. (n = 45), 0.25 and 1 microg/ml, respectively; Clostridium difficile (n = 14), 0.25 and 1 microg/ml, respectively; Clostridium ramosum (n = 16), 1 and 4 microg/ml, respectively; Clostridium innocuum (n = 15), 4 and 16 microg/ml, respectively; Clostridium clostridioforme (n = 15), 8 and 1 microg/ml, respectively; Eubacterium group (n = 33), 0.25 and 2 microg/ml, respectively; Lactobacillus spp. (n = 26), 0.5 and 4 microg/ml, respectively; Propionibacterium spp. (n = 34), 0.125 and 0.5 microg/ml, respectively; Peptostreptococcus spp. (n = 52), 0.125 and 0.5 microg/ml, respectively; and Corynebacterium spp. (n = 31), 0.03 and 0.5 microg/ml, respectively. The activity of TD-6424 was similar to that of quinupristin-dalfopristin for most strains except C. clostridioforme and Lactobacillus casei, where quinupristin-dalfopristin was three- to fivefold more active. Daptomycin had decreased activity (MIC > 4 microg/ml) against 14 strains of Actinomyces spp. and all C. ramosum, Eubacterium lentum, and Lactobacillus plantarum strains. Linezolid showed decreased activity (MIC > 4 microg/ml) against C. ramosum, two strains of C. difficile, and 15 strains of Lactobacillus spp. Imipenem and piperacillin

  16. Comprehensive update of dalbavancin activity when tested against uncommonly isolated streptococci, Corynebacterium spp., Listeria monocytogenes, and Micrococcus spp. (1357 strains).

    Science.gov (United States)

    Jones, Ronald N; Stilwell, Matthew G

    2013-06-01

    Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Inactivation dynamics of 222 nm krypton-chlorine excilamp irradiation on Gram-positive and Gram-negative foodborne pathogenic bacteria.

    Science.gov (United States)

    Kang, Jun-Won; Kim, Sang-Soon; Kang, Dong-Hyun

    2018-07-01

    The object of this study was to elucidate the bactericidal mechanism of a 222 nm Krypton Chlorine (KrCl) excilamp compared with that of a 254 nm Low Pressure mercury (LP Hg) lamp. The KrCl excilamp had higher bactericidal capacity against Gram-positive pathogenic bacteria (Staphylococcus aureus and L. monocytogenes) and Gram-negative pathogenic bacteria (S. Typhimurium and E. coli O157:H7) than did the LP Hg lamp when cell suspensions in PBS were irradiated with each type of UV lamp. It was found out that the KrCl excilamp induced cell membrane damage as a form of depolarization. From the study of respiratory chain dehydrogenase activity and the lipid peroxidation assay, it was revealed that cell membrane damage was attributed to inactivation of enzymes related to generation of membrane potential and occurrence of lipid peroxidation. Direct absorption of UV radiation which led to photoreaction through formation of an excited state was one of the causes inducing cell damage. Additionally, generation of ROS and thus occurrence of secondary damage can be another cause. The LP Hg lamp only induced damage to DNA but not to other components such as lipids or proteins. This difference was derived from differences of UV radiation absorption by cellular materials. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Use of tuf as a target for sequence-based identification of Gram-positive cocci of the genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus

    Directory of Open Access Journals (Sweden)

    Li Xuerui

    2012-11-01

    Full Text Available Abstract Background Accurate identification of isolates belonging to genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus at the species level is necessary to provide a better understanding of their pathogenic potential, to aid in making clinical decisions, and to conduct epidemiologic investigations,especially when large blind samples must be analyzed. It is useful to simultaneously identify species in different genera using a single primer pair. Methods We developed a primer pair based on the tuf gene (encoding elongation factor sequence to identify 56 Gram-positive cocci isolates. Results The target sequences were amplified from all 56 samples. The sequencing results and the phylogenetic tree derived from the partial tuf gene sequences identified the isolates as three enterococcal species, two lactococcal species, two staphylococcal species, and six streptococcal species, as well as eight isolates that were novel species of the genus Streptococcus. Partial gene sequence analysis of the sodA, dnaK, and 16S RNA genes confirmed the results obtained by tuf gene sequencing. Conclusion Based on the uniform amplification of the tuf gene from all samples and the ability to identify all isolates at both the genus and species levels, we conclude that the primer pair developed in this research provides a powerful tool for identifying these organisms in clinical laboratories where large blind samples are used.

  19. A thiol-disulfide oxidoreductase of the Gram-positive pathogen Corynebacterium diphtheriae is essential for viability, pilus assembly, toxin production and virulence.

    Science.gov (United States)

    Reardon-Robinson, Melissa E; Osipiuk, Jerzy; Jooya, Neda; Chang, Chungyu; Joachimiak, Andrzej; Das, Asis; Ton-That, Hung

    2015-12-01

    The Gram-positive pathogen Corynebacterium diphtheriae exports through the Sec apparatus many extracellular proteins that include the key virulence factors diphtheria toxin and the adhesive pili. How these proteins attain their native conformations after translocation as unfolded precursors remains elusive. The fact that the majority of these exported proteins contain multiple cysteine residues and that several membrane-bound oxidoreductases are encoded in the corynebacterial genome suggests the existence of an oxidative protein-folding pathway in this organism. Here we show that the shaft pilin SpaA harbors a disulfide bond in vivo and alanine substitution of these cysteines abrogates SpaA polymerization and leads to the secretion of degraded SpaA peptides. We then identified a thiol-disulfide oxidoreductase (MdbA), whose structure exhibits a conserved thioredoxin-like domain with a CPHC active site. Remarkably, deletion of mdbA results in a severe temperature-sensitive cell division phenotype. This mutant also fails to assemble pilus structures and is greatly defective in toxin production. Consistent with these defects, the ΔmdbA mutant is attenuated in a guinea pig model of diphtheritic toxemia. Given its diverse cellular functions in cell division, pilus assembly and toxin production, we propose that MdbA is a component of the general oxidative folding machine in C. diphtheriae. © 2015 John Wiley & Sons Ltd.

  20. A Trojan-Horse Strategy Including a Bacterial Suicide Action for the Efficient Use of a Specific Gram-Positive Antibiotic on Gram-Negative Bacteria.

    Science.gov (United States)

    Schalk, Isabelle J

    2018-05-10

    In the alarming context of rising bacterial antibiotic resistance, there is an urgent need to discover new antibiotics or increase and/or enlarge the activity of those currently in use. The need for new antibiotics is even more urgent in the case of Gram-negative bacteria, such as Acinetobacter, Pseudomonas, and Enterobacteria, which have become resistant to many antibiotics and have an outer membrane with very low permeability to drugs. Vectorization of antibiotics using siderophores may be a solution to bypass such a bacterial wall: the drugs use the iron transporters of the outer membrane as gates to enter bacteria in a Trojan-horse strategy. Designing siderophore-antibiotics that can cross outer membranes has become almost routine, but their transport across the inner membrane is still a limiting step, as well as a strategy that allows dissociation of the antibiotic from the siderophore once inside the bacteria. Liu et al. ( J. Med. Chem. 2018 , DOI: 10.1021/acs.jmedchem.8b00218 ) report the synthesis of a siderophore-cephalosporin compound and demonstrate that β-lactams, such as cephalosporins, can serve as β-lactamase-triggered releasable linkers to allow intracellular delivery of Gram-positive antibiotics to Gram-negative bacteria.

  1. The Effect of Charge at the Surface of Silver Nanoparticles on Antimicrobial Activity against Gram-Positive and Gram-Negative Bacteria: A Preliminary Study

    International Nuclear Information System (INIS)

    Abbaszadegan, A.; Ghahramani, Y.; Nabavizadeh, M.; Gholami, A.; Hemmateenejad, I.; Dorostkar, S.; Sharghi, H.

    2014-01-01

    The bactericidal efficiency of various positively and negatively charged silver nanoparticles has been extensively evaluated in literature, but there is no report on efficacy of neutrally charged silver nanoparticles. The goal of this study is to evaluate the role of electrical charge at the surface of silver nanoparticles on antibacterial activity against a panel of microorganisms. Three different silver nanoparticles were synthesized by different methods, providing three different electrical surface charges (positive, neutral, and negative). The antibacterial activity of these nanoparticles was tested against gram-positive (i.e., Staphylococcus aureus, Streptococcus mutans, and Streptococcus pyogenes) and gram-negative (i.e., Escherichia coli and Proteus vulgaris) bacteria. Well diffusion and micro-dilution tests were used to evaluate the bactericidal activity of the nanoparticles. According to the obtained results, the positively-charged silver nanoparticles showed the highest bactericidal activity against all microorganisms tested. The negatively charged silver nanoparticles had the least and the neutral nanoparticles had intermediate antibacterial activity. The most resistant bacteria were Proteus vulgaris. We found that the surface charge of the silver nanoparticles was a significant factor affecting bactericidal activity on these surfaces. Although the positively charged nanoparticles showed the highest level of effectiveness against the organisms tested, the neutrally charged particles were also potent against most bacterial species.

  2. Synergistic effect of Carum copticum and Mentha piperita essential oils with ciprofloxacin, vancomycin, and gentamicin on Gram-negative and Gram-positive bacteria

    Science.gov (United States)

    Talei, Gholam-Reza; Mohammadi, Mohsen; Bahmani, Mahmoud; Kopaei, Mahmoud Rafieian

    2017-01-01

    Background: Infectious diseases have always been an important health issue in human communities. In the recent years, much research has been conducted on antimicrobial effects of nature-based compounds because of increased prevalence of antibiotic resistance. The present study was conducted to investigate synergistic effect of Carum copticum and Mentha piperita essential oils with ciprofloxacin, vancomycin, and gentamicin on Gram-negative and Gram-positive bacteria. Materials and Methods: In this experimental study, the synergistic effects of C. copticum and M. piperita essential oils with antibiotics on Staphylococcus aureus (ATCC 25923), Enterococcus faecalis (ATCC 29212), Escherichia coli (ATCC 8739), Pseudomonas aeruginosa (ATCC 9027), Staphylococcus epidermidis (ATCC 14990), and Listeria monocytogenes (ATCC 7644) were studied according to broth microdilution and the MIC and fractional inhibitory concentration (FIC) of these two essential oils determined. Results: C. copticum essential oil at 30 μg/ml could inhibit S. aureus, and in combination with vancomycin, decreased MIC from 0.5 to 0.12 μg/ml. Moreover, the FIC was derived 0.24 μg/ml which represents a potent synergistic effect with vancomycin against S. aureus growth. C. copticum essential oil alone or combined with other antibiotics is effective in treating bacterial infections. Conclusions: In addition, C. copticum essential oil can strengthen the activities of certain antibiotics, which makes it possible to use this essential oil, especially in drug resistance or to lower dosage or toxicity of the drugs. PMID:28929050

  3. Rapid Assessment of Resistance to Antibiotic Inhibitors of Protein Synthesis in the Gram-Positive Pathogens, Enterococcus faecalis and Streptococcus pneumoniae, Based on Evaluation of the Lytic Response.

    Science.gov (United States)

    Otero, Fátima; Tamayo, María; Santiso, Rebeca; Gosálvez, Jaime; Bou, Germán; Fernández, José Luis

    2017-04-01

    A novel assay for rapid determination of resistance to antibiotic inhibitors of protein synthesis was developed for the gram-positive pathogens, Enterococcus faecalis and Streptococcus pneumoniae. To this purpose, a lytic response was obtained by a brief incubation with lysozyme or a mixture of lysozyme, Triton X-100, and EDTA for E. faecalis (n = 82) and S. pneumoniae (n = 51), respectively. Lysis was quantified by visualizing the released nucleoids. Antibiotic-susceptible bacteria treated with Clinical and Laboratory Standards Institute (CLSI) breakpoint doses of erythromycin, azithromycin, or doxycycline that inhibited protein synthesis demonstrated a large reduction of lysed cells with respect to the control, that is, without antibiotics. However, cell lysis prevention was much lower in nonsusceptible strains, with unsuccessful inhibition of protein synthesis. ROC analysis showed that a reduction value of ≥35.6% and ≥40.4% discriminates susceptible and nonsusceptible strains for erythromycin and for doxycycline, respectively, in E. faecalis, whereas ≥20.0% is adequate for both macrolides and doxycycline in S. pneumoniae. Resistant stains were identified in 90-120 min with sensitivity and specificity between 91.7% and 100%. This is a proof of concept that evaluation of the lytic response may be a rapid and efficient test for determination of resistance to antibiotic inhibitors of protein synthesis.

  4. Type-IVC Secretion System: A Novel Subclass of Type IV Secretion System (T4SS) Common Existing in Gram-Positive Genus Streptococcus

    Science.gov (United States)

    Chen, Chen; Gao, George F.

    2012-01-01

    A growing number of pathogens are being found to possess specialized secretion systems which they use in various ways to subvert host defenses. Type IV secretion system (T4SS) is one of versatile secretion systems essential for the virulence and even survival of some bacteria species, and they enable the secretion of protein and DNA substrates across the cell envelope. T4SS was once believed to be present only in Gram-negative bacteria. In this study, we present evidence of a new subclass of T4SS, Type-IVC secretion system and indicate its common existence in the Gram-positive bacterial genus Streptococcus. We further identified that VirB1, VirB4, VirB6 and VirD4 are the minimal key components of this system. Using genome comparisons and evolutionary relationship analysis, we proposed that Type-IVC secretion system is movable via transposon factors and mediates the conjugative transfer of DNA, enhances bacterial pathogenicity, and could cause large-scale outbreaks of infections in humans. PMID:23056296

  5. Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.

    Science.gov (United States)

    Geary, C; Stevens, M

    1986-01-01

    A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667

  6. Competitive biosorption of thorium and uranium by Micrococcus luteus

    International Nuclear Information System (INIS)

    Nakajima, A.; Tsuruta, T.

    2004-01-01

    Eighteen species of bacteria were screened for abilities to adsorb thorium and uranium. High adsorption capacity was observed for thorium by Arthrobacter nicotianae and Micrococcus luteus, and for uranium by Arthrobacter nicotianae. The adsorption of both thorium and uranium by Micrococcus luteus cells was rapid, was affected by the solution pH, and obeyed the Langmuir adsorption isotherm for binary systems in a competitive manner taking the ionic charge of the metal ion into account. The thorium selectivity in the competitive adsorption is assumed to be caused by the faster adsorption and the slower desorption rates of thorium than those of uranium. (author)

  7. Design, Synthesis and Evaluation of Branched RRWQWR-Based Peptides as Antibacterial Agents Against Clinically Relevant Gram-Positive and Gram-Negative Pathogens

    Directory of Open Access Journals (Sweden)

    Sandra C. Vega

    2018-03-01

    Full Text Available Multidrug resistance of pathogenic bacteria has become a public health crisis that requires the urgent design of new antibacterial drugs such as antimicrobial peptides (AMPs. Seeking to obtain new, lactoferricin B (LfcinB-based synthetic peptides as viable early-stage candidates for future development as AMPs against clinically relevant bacteria, we designed, synthesized and screened three new cationic peptides derived from bovine LfcinB. These peptides contain at least one RRWQWR motif and differ by the copy number (monomeric, dimeric or tetrameric and structure (linear or branched of this motif. They comprise a linear palindromic peptide (RWQWRWQWR, a dimeric peptide (RRWQWR2KAhx and a tetrameric peptide (RRWQWR4K2Ahx2C2. They were screened for antibacterial activity against Enterococcus faecalis (ATCC 29212 and ATCC 51575 strains, Pseudomonas aeruginosa (ATCC 10145 and ATCC 27853 strains and clinical isolates of two Gram-positive bacteria (Enterococcus faecium and Staphylococcus aureus and two Gram-negative bacteria (Klebsiella pneumoniae and Pseudomonas aeruginosa. All three peptides exhibited greater activity than did the reference peptide, LfcinB (17–31, which contains a single linear RRWQWR motif. Against the ATCC reference strains, the three new peptides exhibited minimum inhibitory concentration (MIC50 values of 3.1–198.0 μM and minimum bactericidal concentration (MBC values of 25–200 μM, and against the clinical isolates, MIC50 values of 1.6–75.0 μM and MBC values of 12.5–100 μM. However, the tetrameric peptide was also found to be strongly hemolytic (49.1% at 100 μM. Scanning Electron Microscopy (SEM demonstrated that in the dimeric and tetrameric peptides, the RRWQWR motif is exposed to the pathogen surface. Our results may inform the design of new, RRWQWR-based AMPs.

  8. Antibiotic Susceptibility Pattern of Gram-positive Cocci Cultured from Patients in Three University Hospitals in Tehran, Iran during 2001-2005

    Directory of Open Access Journals (Sweden)

    Aligholi Marzieh

    2009-10-01

    Full Text Available Bacterial resistance to antibiotics is a serious problem and is increasing in prevalence world-wide at an alarming rate. The antimicrobial susceptibility patterns of 1897 gram-positive bacterial Isolates were evaluated. The minimum inhibitory concentration (MIC of isolates which comprised Staphylococcus aureus (927 isolates, coagulase-negative staphylococci (CNS; 425 isolates, Enterococcus faecalis (320 isolates, Enterococcus faecium (157 isolates, and pneumococci (50 isolates collected from 3 teaching hospitals in Tehran were determined by agar dilution method according to Clinical and Laboratory Standards Institute (CLSI guidelines. The presence of mecA gene was investigated in methicillin-resistant staphylococci by PCR method and vanA and vanB genes were targeted in enterococcal isolates by Multiplex PCR method. The resistance rate to methicillin among S. aureus and CNS isolates were 33% and 49%, respectively. All S. aureus isolates were susceptible to vancomycin .The lowest rate of resistance in all S. aureus isolates was found for rifampicin (<4%. The vancomycin resistance rate in enterococci isolates was 11% which was more frequent among E. faecium (19% than E. faecalis (4%, all resistant isolates carrying vanA. High-level resistance to gentamicin and streptomycin, were detected in 47% and 87% of enterococcal isolates respectively. The rate of penicillin resistance in pneumococci was 3% and about 27% of isolates had reduced susceptibility to penicillin. The prevalence of erythromycin resistant among pneumococci was 58%. All pneumococcal isolates were susceptible to ceftriaxone, rifampicin and vancomycin. Our data highlight the importance of access to updated bacterial susceptibility data regarding commonly prescribed agents for clinicians in Iran.

  9. Electron Transport Chain Is Biochemically Linked to Pilus Assembly Required for Polymicrobial Interactions and Biofilm Formation in the Gram-Positive Actinobacterium Actinomyces oris

    Directory of Open Access Journals (Sweden)

    Belkys C. Sanchez

    2017-06-01

    Full Text Available The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans-acting factors contributing to these processes. We report here a large-scale Tn5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis. We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis, and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn5 insertions in fimA, cafA, or srtC2, as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE, a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding.

  10. A new approach to treatment of resistant gram-positive infections: potential impact of targeted IV to oral switch on length of stay

    Directory of Open Access Journals (Sweden)

    Trust Sarah

    2006-06-01

    Full Text Available Abstract Background Patients prescribed intravenous (IV glycopeptides usually remain in hospital until completion of this treatment. Some of these patients could be discharged earlier if a switch to an oral antibiotic was made. This study was designed to identify the percentage of inpatients currently prescribed IV glycopeptides who could be discharged earlier if a switch to an oral agent was used, and to estimate the number of bed days that could be saved. We also aimed to identify the patient group(s most likely to benefit, and to estimate the number of days of IV therapy that could be prevented in patients who remained in hospital. Methods Patients were included if they were prescribed an IV glycopeptide for 5 days or more. Predetermined IV to oral antibiotic switch criteria and discharge criteria were applied. A multiple logistic regression model was used to identify the characteristics of the patients most likely to be suitable for earlier discharge. Results Of 211 patients, 62 (29% could have had a reduced length of stay if they were treated with a suitable oral antibiotic. This would have saved a total of 649 inpatient days (median 5 per patient; range 1–54. A further 31 patients (15% could have switched to oral therapy as an inpatient thus avoiding IV line use. The patients most likely to be suitable for early discharge were those with skin and soft tissue infection, under the cardiology, cardiothoracic surgery, orthopaedics, general medical, plastic surgery and vascular specialities, with no high risk comorbidity and less than five other regularly prescribed drugs. Conclusion The need for glycopeptide therapy has a significant impact on length of stay. Effective targeting of oral antimicrobials could reduce the need for IV access, allow outpatient treatment and thus reduce the length of stay in patients with infections caused by antibiotic resistant gram-positive bacteria.

  11. 3,5-Dioxopyrazolidines, Novel Inhibitors of UDP-N- Acetylenolpyruvylglucosamine Reductase (MurB) with Activity against Gram-Positive Bacteria

    Science.gov (United States)

    Yang, Youjun; Severin, Anatoly; Chopra, Rajiv; Krishnamurthy, Girija; Singh, Guy; Hu, William; Keeney, David; Svenson, Kristine; Petersen, Peter J.; Labthavikul, Pornpen; Shlaes, David M.; Rasmussen, Beth A.; Failli, Amedeo A.; Shumsky, Jay S.; Kutterer, Kristina M. K.; Gilbert, Adam; Mansour, Tarek S.

    2006-01-01

    A series of 3,5-dioxopyrazolidines was identified as novel inhibitors of UDP-N-acetylenolpyruvylglucosamine reductase (MurB). Compounds 1 to 3, which are 1,2-bis(4-chlorophenyl)-3,5-dioxopyrazolidine-4-carboxamides, inhibited Escherichia coli MurB, Staphyloccocus aureus MurB, and E. coli MurA with 50% inhibitory concentrations (IC50s) in the range of 4.1 to 6.8 μM, 4.3 to 10.3 μM, and 6.8 to 29.4 μM, respectively. Compound 4, a C-4-unsubstituted 1,2-bis(3,4-dichlorophenyl)-3,5-dioxopyrazolidine, showed moderate inhibitory activity against E. coli MurB, S. aureus MurB, and E. coli MurC (IC50s, 24.5 to 35 μM). A fluorescence-binding assay indicated tight binding of compound 3 with E. coli MurB, giving a dissociation constant of 260 nM. Structural characterization of E. coli MurB was undertaken, and the crystal structure of a complex with compound 4 was obtained at 2.4 Å resolution. The crystal structure indicated the binding of a compound at the active site of MurB and specific interactions with active-site residues and the bound flavin adenine dinucleotide cofactor. Peptidoglycan biosynthesis studies using a strain of Staphylococcus epidermidis revealed reduced peptidoglycan biosynthesis upon incubation with 3,5-dioxopyrazolidines, with IC50s of 0.39 to 11.1 μM. Antibacterial activity was observed for compounds 1 to 3 (MICs, 0.25 to 16 μg/ml) and 4 (MICs, 4 to 8 μg/ml) against gram-positive bacteria including methicillin-resistant S. aureus, vancomycin-resistant Enterococcus faecalis, and penicillin-resistant Streptococcus pneumoniae. PMID:16436710

  12. Gram-Positive Bacteria with Probiotic Potential for the Apis mellifera L. Honey Bee: The Experience in the Northwest of Argentina.

    Science.gov (United States)

    Audisio, Marcela Carina

    2017-03-01

    Apis mellifera L. is one of the most important natural pollinators of significant crops and flowers around the world. It can be affected by different types of illnesses: american foulbrood, nosemosis, varroasis, viruses, among others. Such infections mainly cause a reduction in honey production and in extreme situations, the death of the colony. Argentina is the world's second largest honey exporter and the third largest honey producer, after China and Turkey. Given both the prominence of the honey bee in nature and the economic importance of apiculture in Argentina and the world, it is crucial to develop efficient and sustainable strategies to control honey bee diseases and to improve bee colony health. Gram-positive bacteria, such as lactic acid bacteria, mainly Lactobacillus, and Bacillus spp. are promising options. In the Northwest of Argentina, several Lactobacillus and Bacillus strains from the honey bee gut and honey were isolated by our research group and characterized by using in vitro tests. Two strains were selected because of their potential probiotic properties: Lactobacillus johnsonii CRL1647 and Bacillus subtilis subsp. subtilis Mori2. Under independent trials with both experimental and commercial hives, it was determined that each strain was able to elicit probiotic effects on bee colonies reared in the northwestern region of Argentina. One result was the increase in egg-laying by the queen which therefore produced an increase in bee number and, consequently, a higher honey yield. Moreover, the beneficial bacteria reduced the incidence of two important bee diseases: nosemosis and varroosis. These results are promising and extend the horizon of probiotic bacteria to the insect world, serving beekeepers worldwide as a natural tool that they can administer as is, or combine with other disease-controlling methods.

  13. Burdock (Arctium lappa Leaf Extracts Increase the In Vitro Antimicrobial Efficacy of Common Antibiotics on Gram-positive and Gram-negative Bacteria

    Directory of Open Access Journals (Sweden)

    Pirvu Lucia

    2017-04-01

    Full Text Available This work aimed to study the potential effects of four Arctii folium extracts, 5 mg gallic [GAE] acid equivalents per 1 mL sample, on six antibiotics (Ampicillin/AM, Tetracycline/TE, Ciprofloxacin/CIP, Sulfamethoxazole-Trimethoprim/SXT, Chloramphenicol/C and Gentamicin/CN tested on four Gram-positive (Staphylococcus aureus ATCC 6538, Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, and Staphylococcus epidermidis ATCC 12228 and five Gram-negative (Proteus mirabilis ATCC 29245, Escherichia coli ATCC 35218, E. coli ATCC 11229, E. coli ATCC 8739, and Bacillus cereus ATCC 11778 bacteria. Arctii folium extracts were the whole ethanol extract/W and subsequent ethyl acetate/EA, aqueous/AQ, and chloroform/CHL fractions. Chemical qualitative analysis (HPTLC method emphasized five main polyphenol compounds in Arctii folium polar extracts: chlorogenic acid (Rf≈0.52/0.55 and its isomer, 1,5-di-O-caffeoylquinic acid (Rf≈0.90/0.92, plus cynarin (Rf≈0.77, hyperoside (Rf≈0.68/0.64 and isoquercitrin (Rf≈0.69/0.71. Microbiological screening indicated Arctii folium polar extracts (AQ and W efficacy on S. epidermidis ATCC 12228; the MIC values were in the range of common antibiotics, being 32 and 128 μg GAE per mL sample respectively. The unpredictable effects (stimulatory or inhibitory of Arctii folium extracts in combination with typical antibiotics as well as a potential use of the whole ethanol extract/W for restoring the antimicrobial potency of susceptible antibiotics have also been evidenced.

  14. Antimicrobial effects of zero-valent iron nanoparticles on gram-positive Bacillus strains and gram-negative Escherichia coli strains

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-11-01

    Full Text Available Abstract Background Zero-valent iron nanoparticles (ZVI NPs have been used extensively for the remediation of contaminated soil and groundwater. Owing to their large active surface area, they serve as strong and effective reductants. However, the ecotoxicity and bioavailability of ZVI NPs in diverse ecological media have not been evaluated in detail and most studies have focused on non-nano ZVI or Fe0. In addition, the antimicrobial properties of ZVI NPs have rarely been investigated, and the underlying mechanism of their toxicity remains unknown. Results In the present study, we demonstrate that ZVI NPs exhibited significant toxicity at 1000 ppm against two distinct gram-positive bacterial strains (Bacillus subtilis 3610 and Bacillus thuringiensis 407 but not against two gram-negative strains (Escherichia coli K12 and ATCC11634. Specifically, ZVI NPs caused at least a 4-log and 1-log reductions in cell numbers, respectively, in the two Bacillus strains, whereas no change was detected in the two E. coli strains. X-ray photoelectron spectroscopy, X-ray absorption near-edge, and extended X-ray absorption fine structure spectra confirmed that Bacillus cells exposed to ZVI NPs contained mostly Fe2O3 with some detectable FeS. This finding indicated that Fe0 nanoparticles penetrated the bacterial cells, where they were subsequently oxidized to Fe2O3 and FeS. RedoxSensor analysis and propidium iodide (PI staining showed decreased reductase activity and increased PI in both Bacillus strains treated with a high (1000 ppm concentration of ZVI NPs. Conclusion Taken together, these data show that the toxicity of ZVI NPs was derived from their oxidative properties, which may increase the levels of reactive oxygen species and lead to cell death.

  15. Heavy Metal uptake Potentials of Pseudomonas aeruginosa and ...

    African Journals Online (AJOL)

    Uptake of heavy metals, silver and cadmium by Pseudomonas aeruginosa (a Gram negative bacterium) and Micrococcus luteus (a Gram positive bacterium) was investigated in Cadmium and Silver stock solution using ion selective electrodes. Silver and cadmium uptake by the two organisms was described by Langmuir ...

  16. Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry Analysis of Gram-Positive, Catalase-Negative Cocci Not Belonging to the Streptococcus or Enterococcus Genus and Benefits of Database Extension

    DEFF Research Database (Denmark)

    Christensen, Jens Jørgen; Dargis, Rimtas; Hammer, Monja

    2012-01-01

    Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry with a Bruker Daltonics microflex LT system was applied to 90 well-characterized catalase-negative, Gram-positive cocci not belonging to the streptococci or enterococci. Biotyper version 2.0.43.1 software...

  17. Crude oil degradation by Bacillus and Micrococcus species isolated ...

    African Journals Online (AJOL)

    Microorganisms capable of degrading crude oil were isolated from soil compost in Kano, northwestern Nigeria. The work was carried out with the aim of determining crude-oil biodegradation potentials of Bacillus and Micrococcus species isolated from the soil compost as well as the assessment of the applicability of ...

  18. First report of linear megaplasmids in the genus Micrococcus.

    Science.gov (United States)

    Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm

    2010-01-01

    High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.

  19. Repair of double-strand breaks in Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Burrell, A.D.; Dean, C.J.

    1975-01-01

    Micrococcus radiodurans has been shown to sustain double-strand breaks in its DNA after exposure to x-radiation. Following sublethal doses of x-rays (200 krad in oxygen or less), the cells were able to repair these breaks, and an intermediate fast-sedimenting DNA component seemed to be involved in the repair process

  20. Riboflavin Production during Growth of Micrococcus luteus on Pyridine †

    OpenAIRE

    Sims, Gerald K.; O'Loughlin, Edward J.

    1992-01-01

    Micrococcus luteus produced 29 μM riboflavin during growth on 6.5 mM pyridine but not during growth on other substrates. On the basis of the results of radiolabelling studies, riboflavin was not directly synthesized from pyridine. Pyridine may interfere with riboflavin biosynthesis or elicit a general stress response in M. luteus.

  1. Clinical significance of coryneform Gram-positive rods from blood identified by MALDI-TOF mass spectrometry and their susceptibility profiles - a retrospective chart review.

    Science.gov (United States)

    Mushtaq, Ammara; Chen, Derrick J; Strand, Gregory J; Dylla, Brenda L; Cole, Nicolynn C; Mandrekar, Jayawant; Patel, Robin

    2016-07-01

    With the advent of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), most Gram-positive rods (GPRs) are readily identified; however, their clinical relevance in blood cultures remains unclear. Herein, we assessed the clinical significance of GPRs isolated from blood and identified in the era of MALDI-TOF MS. A retrospective chart review of patients presenting to the Mayo Clinic, Rochester, MN, from January 1, 2013, to October 13, 2015, was performed. Any episode of a positive blood culture for a GPR was included. We assessed the number of bottles positive for a given isolate, time to positivity of blood cultures, patient age, medical history, interpretation of culture results by the healthcare team and whether infectious diseases consultation was obtained. We also evaluated the susceptibility profiles of a larger collection of GPRs tested in the clinical microbiology laboratory of the Mayo Clinic, Rochester, MN from January 1, 2013, to October 31, 2015. There were a total of 246 GPRs isolated from the blood of 181 patients during the study period. 56% (n = 101) were deemed contaminants by the healthcare team and were not treated; 33% (n = 59) were clinically determined to represent true bacteremia and were treated; and 8% (n = 14) were considered of uncertain significance, with patients prescribed treatment regardless. Patient characteristics associated with an isolate being treated on univariate analysis included younger age (P = 0.02), identification to the species level (P = 0.02), higher number of positive blood culture sets (P < 0.0001), lower time to positivity (P < 0.0001), immunosuppression (P = 0.03), and recommendation made by an infectious disease consultant (P = 0.0005). On multivariable analysis, infectious diseases consultation (P = 0.03), higher number of positive blood culture sets (P = 0.0005) and lower time to positivity (P = 0.03) were associated with an isolate being treated. 100, 83, 48 and 34% of GPRs

  2. Enzymes produced by halotolerant spore-forming gram-positive bacterial strains isolated from a resting habitat (Restinga de Jurubatiba) in Rio de Janeiro, Brazil: focus on proteases.

    Science.gov (United States)

    D Santos, Anderson Fragoso; Pacheco, Clarissa Almeida; Valle, Roberta D Santos; Seldin, Lucy; D Santos, André Luis Souza

    2014-12-01

    The screening for hydrolases-producing, halotolerant, and spore-forming gram-positive bacteria from the root, rhizosphere, and non-rhizosphere soil of Blutaparon portulacoides, a plant found in the Restinga de Jurubatiba located at the northern region of Rio de Janeiro State, Brazil, resulted in the isolation of 22 strains. These strains were identified as Halobacillus blutaparonensis (n = 2), Oceanobacillus picturae (n = 5), and Oceanobacillus iheyensis (n = 15), and all showed the ability to produce different extracellular enzymes. A total of 20 isolates (90.9 %) showed activity for protease, 5 (22.7 %) for phytase, 3 (13.6 %) for cellulase, and 2 (9.1 %) for amylase. Some bacterial strains were capable of producing three (13.6 %) or two (9.1 %) distinct hydrolytic enzymes. However, no bacterial strain with ability to produce esterase and DNase was observed. The isolate designated M9, belonging to the species H. blutaparonensis, was the best producer of protease and also yielded amylase and phytase. This strain was chosen for further studies regarding its protease activity. The M9 strain produced similar amounts of protease when grown either without or with different NaCl concentrations (from 0.5 to 10 %). A simple inspection of the cell-free culture supernatant by gelatin-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed the presence of three major alkaline proteases of 40, 50, and 70 kDa, which were fully inhibited by phenylmethylsulfonyl fluoride (PMSF) and tosyl-L-phenylalanine chloromethyl ketone (TPCK) (two classical serine protease inhibitors). The secreted proteases were detected in a wide range of temperature (from 4 to 45 °C) and their hydrolytic activities were stimulated by NaCl (up to 10 %). The serine proteases produced by the M9 strain cleaved gelatin, casein, albumin, and hemoglobin, however, in different extensions. Collectively, these results suggest the potential use of the M9 strain in biotechnological

  3. Investigating of the antimicrobial effect of total extract of Tribulus terrestris against some gram positive and negative bacteria and candida spp.

    Directory of Open Access Journals (Sweden)

    Mojdeh Hakemi Vala

    2014-08-01

    Full Text Available Introduction: In the recent years, due to the wide spread of resistant bacteria on one side and several different reports about the side effects of chemical drugs on the other side, vast researches on the medicinal plants have been started. In this study, antimicrobial effect of total extract of Tribulus terrestris L. and its fraction containing Benzoxazine derivative (Terresoxazine was studied for the first time in Iran.Materials and methods: Total aqueous extract of aerial parts of the plant was prepared and in order to separate the components of aqueous extract, liquid/liquid extraction with Petroleum ether was used. Formation of three layers was the result of this extraction. Layers included water fraction, Petroleum ether fraction and a third layer which was formed at the interface of water and petroleum ether. LC/MS system proved the existence of Benzixazine derivative in the water fraction and the thirds fraction. Antimicrobial effects of total extract, water fraction and the third fraction (which were the layers formed after the extraction process were examined against 10 Gram positive and negative and candida spp by cup plate method and Disk diffusion method. Also, the MIC and MBC were determined by micro dilution method.Results: Of 8 evaluated bacteria and 2 Candida spp, the total extract showed antibacterial effect only against E.coli, P.aeruginosa and B.subtilis. Size of the zone of inhibitation increased with increasing the concentration of the extract. Fraction containing Benzoxazine derivative had no effect against tested microbes. MIC and MBC determination showed that B.subtilis had the least sensitivity to the total extract, comparing to other microorganisms. Besides, comparing the zone of inhibitation of Penicillin 200 mg/ml and the zone of inhibitation of the total aqueous extract shows that the solution of total extract in water with 1000 mg/ml concentration and the solution of total extract in DMSO10% with 750 mg/ml density

  4. Genome analysis of the anaerobic thermohalophilic bacterium Halothermothrix orenii.

    Directory of Open Access Journals (Sweden)

    Konstantinos Mavromatis

    Full Text Available Halothermothirx orenii is a strictly anaerobic thermohalophilic bacterium isolated from sediment of a Tunisian salt lake. It belongs to the order Halanaerobiales in the phylum Firmicutes. The complete sequence revealed that the genome consists of one circular chromosome of 2578146 bps encoding 2451 predicted genes. This is the first genome sequence of an organism belonging to the Haloanaerobiales. Features of both Gram positive and Gram negative bacteria were identified with the presence of both a sporulating mechanism typical of Firmicutes and a characteristic Gram negative lipopolysaccharide being the most prominent. Protein sequence analyses and metabolic reconstruction reveal a unique combination of strategies for thermophilic and halophilic adaptation. H. orenii can serve as a model organism for the study of the evolution of the Gram negative phenotype as well as the adaptation under thermohalophilic conditions and the development of biotechnological applications under conditions that require high temperatures and high salt concentrations.

  5. Genome analysis of the Anerobic Thermohalophilic bacterium Halothermothrix orenii

    Energy Technology Data Exchange (ETDEWEB)

    Mavromatis, Konstantinos; Ivanova, Natalia; Anderson, Iain; Lykidis, Athanasios; Hooper, Sean D.; Sun, Hui; Kunin, Victor; Lapidus, Alla; Hugenholtz, Philip; Patel, Bharat; Kyrpides, Nikos C.

    2008-11-03

    Halothermothirx orenii is a strictly anaerobic thermohalophilic bacterium isolated from sediment of a Tunisian salt lake. It belongs to the order Halanaerobiales in the phylum Firmicutes. The complete sequence revealed that the genome consists of one circular chromosome of 2578146 bps encoding 2451 predicted genes. This is the first genome sequence of an organism belonging to the Haloanaerobiales. Features of both Gram positive and Gram negative bacteria were identified with the presence of both a sporulating mechanism typical of Firmicutes and a characteristic Gram negative lipopolysaccharide being the most prominent. Protein sequence analyses and metabolic reconstruction reveal a unique combination of strategies for thermophilic and halophilic adaptation. H. orenii can serve as a model organism for the study of the evolution of the Gram negative phenotype as well as the adaptation under thermohalophilic conditions and the development of biotechnological applications under conditions that require high temperatures and high salt concentrations.

  6. Ionizing radiation damage in Micrococcus radiodurans cell wall: release of polysaccharide

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.

    1976-01-01

    Sublethal 60 Co γ-irradiation of the bacterium Micrococcus radiodurans in aqueous suspension results in a loss of up to 6 percent of its cellular dry weight and 30 percent of its wet weight. In the process some specific cell wall polysaccharides, including a polymer of glucose and N-acylated glucosamine, are released into the surrounding medium. These polysaccharides appear to originate from a hydrophobic site in the middle, lipid-rich, cell wall layer. The damage to this layer which results in the release of these and other polymers may be due to a disruption of this hydrophobic site. The polysaccharide containing glucose and N-acylated glucosamine exists as a high molecular weight polymer in unirradiated cells, but irradiation causes some degradation prior to release. In a free state this polysaccharide is considerably less sensitive to radiolytic degradation than in a bound state. Free radicals generated from surrounding water by ionizing radiation initiate the release, hydroxyl radicals being the most important species. Oxygen protects the cell wall against loss of the polysaccharides, apparently by a mechanism which does not depend on the ability of O 2 to scavenge hydrogen atoms and aqueous electrons

  7. Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.

    Science.gov (United States)

    Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z

    2011-02-01

    A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.

  8. Characterization of Micrococcus strains isolated from indoor air.

    Science.gov (United States)

    Kooken, Jennifer M; Fox, Karen F; Fox, Alvin

    2012-02-01

    The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Metabolism of dimethylphthalate by Micrococcus sp. strain 12B.

    Science.gov (United States)

    Eaton, R W; Ribbons, D W

    1982-01-01

    During growth of Micrococcus sp. strain 12B with dimethylphthalate, 4-carboxy-2-hydroxymuconate lactone (CHML, X) and 3,4-dihydroxyphthalate-2-methyl ester (XI) were isolated from culture filtrates. CHML is the lactone of intermediate 4-carboxy-2-hydroxymuconate (IX). Accumulation of XI which is not a substrate for 3,4-dihydroxyphthalate-2-decarboxylase in strain 12B afforded an easy access to the preparation of 3,4-dihydroxyphthalate. PMID:7085569

  10. ["Candidatus contubernalis alkalaceticum," an obligately syntrophic alkaliphilic bacterium capable of anaerobic acetate oxidation in a coculture with Desulfonatronum cooperativum].

    Science.gov (United States)

    Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A

    2005-01-01

    From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."

  11. Isolation and Identification of Echinenone from Micrococcus roseus

    Science.gov (United States)

    Schwartzel, E. H.; Cooney, J. J.

    1970-01-01

    An orange carotenoid from Micrococcus roseus was purified by solvent partitioning followed by column and thin-layer chromatography. Absorption spectra, chromatographic mobility, and partition coefficient suggested that the pigment was echinenone (4-keto-β-carotene). Reduction yielded a pigment with the spectral and polar properties of isocryptoxanthin (4-hydroxy-β-carotene), the expected product. The orange pigment and its reduction product co-chromatographed with the respective authentic pigments, confirming the original pigment as echinenone. To our knowledge echinenone has not been identified previously as a bacterial pigment. PMID:5473895

  12. Production, purification, and characterization of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5 isolated from kimchi.

    Science.gov (United States)

    Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

    2005-01-01

    Strain GO5, a bacteriocin-producing bacterium, was isolated from green onion kimchi and identified as Micrococcus sp. The bacteriocin, micrococcin GO5, displayed a broad spectrum of inhibitory activity against a variety of pathogenic and nonpathogenic microorganisms, as tested by the spot-on-lawn method; its activity spectrum was almost identical to that of nisin. Micrococcin GO5 was inactivated by trypsin (whereas nisin was not) and was completely stable at 100 degrees C for 30 min and in the pH range of 2.0 to 7.0. Micrococcin GO5 exhibited a typical mode of bactericidal activity against Micrococcus flavus ATCC 10240. It was purified to homogeneity through ammonium sulfate precipitation, ultrafiltration, and CM-Sepharose column chromatography. The molecular mass of micrococcin GO5 was estimated to be about 5.0 kDa by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis and in situ activity assay with the indicator organism. The amino acid sequence of micrococcin GO5 lacks lanthionine and beta-methyllanthionine and is rich in hydrophobic amino acids and glycine, providing the basis for the high heat stability of this bacteriocin. The N-terminal amino acid sequence of micrococcin GO5 is Lys-Lys-Ser-Phe-Cys-Gln-Lys, and no homology to bacteriocins reported previously was observed in the amino acid composition or N-terminal amino acid sequence. Based on the physicochemical properties, small molecular size, and inhibition of Listeria monocytogenes, micrococcin GO5 has been placed with the class II bacteriocins, but its broad spectrum of activity differs from that of other bacteriocins in this class.

  13. Oxidation and Assimilation of Carbohydrates by Micrococcus sodonensis1

    Science.gov (United States)

    Perry, Jerome J.; Evans, James B.

    1966-01-01

    Perry, Jerome J. (North Carolina State University, Raleigh), and James B. Evans. Oxidation and assimilation of carbohydrates by Micrococcus sodonensis. J. Bacteriol. 91:33–38. 1966.—Micrococcus sodonensis is a biotin-requiring strict aerobe that cannot utilize carbohydrates as sole sources of carbon and energy. However, addition of mannose, glucose, sucrose, or maltose to a medium on which the organism can grow resulted in an increase in total growth. M. sodonensis oxidized these sugars without induction, thus indicating the presence of constitutive enzymes for their transport, activation, and metabolism. Under appropriate nonproliferating cell conditions, glucose was readily incorporated into essential constituents of the cell. When glucose-1-C14 and glucose-6-C14 were oxidized by nonproliferating cells, the label was found in both the protein and nucleic acid fractions of the cell. The respiratory quotients of cells oxidizing glucose in saline and in phosphate buffer indicated assimilation of sugar carbon in buffer and virtually no assimilation in saline. The ability of M. sodonensis to completely oxidize glucose and to grow on intermediates of glucose oxidation but not on glucose suggests that glucose may suppress or repress some reaction(s) necessary for growth, and that growth substrates either derepress or circumvent this block. PMID:5903100

  14. In vitro activity of tigecycline and comparator agents against a global collection of Gram-negative and Gram-positive organisms: tigecycline Evaluation and Surveillance Trial 2004 to 2007.

    Science.gov (United States)

    Garrison, Mark W; Mutters, Reinier; Dowzicky, Michael J

    2009-11-01

    The Tigecycline Evaluation and Surveillance Trial began in 2004 to monitor the in vitro activity of tigecycline and comparator agents against a global collection of Gram-negative and Gram-positive pathogens. Against Gram negatives (n = 63 699), tigecycline MIC(90)'s ranged from 0.25 to 2 mg/L for Escherichia coli, Haemophilus influenzae, Acinetobacter baumannii, Klebsiella oxytoca, Enterobacter cloacae, Klebsiella pneumoniae, and Serratia marcescens (but was > or =32 for Pseudomonas aeruginosa). Against Gram-positive organisms (n = 32 218), tigecycline MIC(90)'s were between 0.06 and 0.25 mg/L for Streptococcus pneumoniae, Enterococcus faecium, Streptococcus agalactiae, Staphylococcus aureus, and Enterococcus faecalis. The in vitro activity of tigecycline was maintained against resistant phenotypes, including multidrug-resistant A. baumannii (9.2% of isolates), extended-spectrum beta-lactamase-producing E. coli (7.0%) and K. pneumoniae (14.0%), beta-lactamase-producing H. influenzae (22.2%), methicillin-resistant S. aureus (44.5%), vancomycin-resistant E. faecium (45.9%) and E. faecalis (2.8%), and penicillin-resistant S. pneumoniae (13.8%). Tigecycline represents a welcome addition to the armamentarium against difficult to treat organisms.

  15. Noncontiguous finished genome sequence and description of Planococcus massiliensis sp. nov., a moderately halophilic bacterium isolated from the human gut

    Directory of Open Access Journals (Sweden)

    E.H. Seck

    2016-03-01

    Full Text Available We propose the main phenotypic characteristics and the complete genome sequence and annotation of Planococcus massiliensis strain ES2T (= CSUR P1103 = DSM 28915, the type strain of P. massiliensis sp. nov., isolated from a faeces sample collected from a healthy Senegalese man. It is an aerobic, Gram-positive, moderately halophilic, motile and rod-shaped bacterium. The 3 357 017 bp long genome exhibits a G+C content of 46.0% and contains 3357 protein-coding genes and 48 RNA genes.

  16. High quality draft genome sequence of the moderately halophilic bacterium Pontibacillus yanchengensis Y32(T) and comparison among Pontibacillus genomes.

    Science.gov (United States)

    Huang, Jing; Qiao, Zi Xu; Tang, Jing Wei; Wang, Gejiao

    2015-01-01

    Pontibacillus yanchengensis Y32(T) is an aerobic, motile, Gram-positive, endospore-forming, and moderately halophilic bacterium isolated from a salt field. In this study, we describe the features of P. yanchengensis strain Y32(T) together with a comparison with other four Pontibacillus genomes. The 4,281,464 bp high-quality-draft genome of strain Y32(T) is arranged into 153 contigs containing 3,965 protein-coding genes and 77 RNA encoding genes. The genome of strain Y32(T) possesses many genes related to its halophilic character, flagellar assembly and chemotaxis to support its survival in a salt-rich environment.

  17. Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.

    Science.gov (United States)

    Joshi, V D; Sreekantiah, K R; Manjrekar, S P

    1996-01-01

    A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.

  18. Characterization and antioxidative activities of rare C(50) carotenoids-sarcinaxanthin, sarcinaxanthin monoglucoside, and sarcinaxanthin diglucoside-obtained from Micrococcus yunnanensis.

    Science.gov (United States)

    Osawa, Ayako; Ishii, Yoko; Sasamura, Nao; Morita, Marie; Kasai, Hiroaki; Maoka, Takashi; Shindo, Kazutoshi

    2010-01-01

    While screening for antioxidative carotenoids from marine bacteria, we isolated and identified sarcinaxanthin and its glucosylated compounds (sarcinaxanthin monoglucoside and sarcinaxanthin diglucoside) from a moderately halophilic bacterium-Micrococcus yunnanensis strain AOY-1. In the singlet oxygen ((¹O₂) quenching model, the IC(50) values of the antioxidative activities of these carotenoids were as follows: sarcinaxanthin , 57 µM; sarcinaxanthin monoglucoside, 54 µM; and sarcinaxanthin diglucoside, 74 µM. In addition, the complete proton nuclear magnetic resonance (¹H NMR) assignments of sarcinaxanthin monoglucoside pentaacetate and sarcinaxanthin diglucoside octaacetate, and fast atom bombardment mass spectrometry/mass spectrometry (FAB-MS/MS) analyses of sarcinaxanthin and sarcinaxanthin monoglucoside are reported for the first time.

  19. Bacterium oxidizing carbon monoxide

    Energy Technology Data Exchange (ETDEWEB)

    Kistner, A

    1953-01-01

    Present-day knowledge of the microbiological oxidation of carbon monoxide is based on doubtful observations and imperfect experimental procedures. By making use of shake cultures in contact with gas mixtures containing high concentrations of CO and by employing liquid enrichment media with a low content of organic matter and solid media of the same composition with not more than 1.2% agar, it proved possible to isolate a co-oxidizing bacterium of the genus hydrogenomonas from sewage sludge. For the first time irrefutable proof has been given of the oxidation of carbon monoxide by a pure culture of a bacterium, both in growing cultures and in resting cell suspensions. 12 references.

  20. Separation of DNA-dependent polymerate activities in Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Kitayama, S.; Matsuyama, A.

    1977-01-01

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by γ-radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans

  1. Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

    International Nuclear Information System (INIS)

    Hentosh, P.; Henner, W.D.; Reynolds, R.J.

    1985-01-01

    DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

  2. Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)

    1977-03-02

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

  3. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole

    2003-01-01

    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  4. Effect of silver/copper and copper oxide nanoparticle powder on growth of Gram-negative and Gram-positive bacteria and their toxicity against the normal human dermal fibroblasts

    International Nuclear Information System (INIS)

    Peszke, Jerzy; Nowak, Anna; Szade, Jacek; Szurko, Agnieszka; Zygadło, Dorota; Michałowska, Marlena; Krzyściak, Paweł; Zygoń, Patrycja; Ratuszna, Alicja; Ostafin, Marek M.

    2016-01-01

    Engineered nanomaterials, especially metallic nanoparticles, are the most popular system applied in daily life products. The study of their biological and toxicity properties seems to be indispensable. In this paper, we present results of biological activity of Ag/Cu nanoparticles. These nanoparticles show more promising killing/inhibiting properties on Gram-negative bacteria than for Gram-positive ones. The Gram-negative bacteria show strong effect already at the concentration of 1 ppm after 15 min of incubation. Moreover, in vitro tests of toxicity made on normal human dermal fibroblast cultures showed that after 72 h of incubation with Ag/Cu nanoparticles, they are less toxic then Cu 2 O/CuO nanoparticles.

  5. Effect of silver/copper and copper oxide nanoparticle powder on growth of Gram-negative and Gram-positive bacteria and their toxicity against the normal human dermal fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Peszke, Jerzy; Nowak, Anna, E-mail: ana.maria.nowak@gmail.com; Szade, Jacek; Szurko, Agnieszka; Zygadło, Dorota; Michałowska, Marlena [University of Silesia, A. Chelkowski Institute of Physics (Poland); Krzyściak, Paweł [Jagiellonian University Medical College, Department of Mycology Chair of Microbiology (Poland); Zygoń, Patrycja [Czestochowa University of Technology, Institute of Materials Engineering (Poland); Ratuszna, Alicja [University of Silesia, A. Chelkowski Institute of Physics (Poland); Ostafin, Marek M. [Department of Microbiology University of Agriculture (Poland)

    2016-12-15

    Engineered nanomaterials, especially metallic nanoparticles, are the most popular system applied in daily life products. The study of their biological and toxicity properties seems to be indispensable. In this paper, we present results of biological activity of Ag/Cu nanoparticles. These nanoparticles show more promising killing/inhibiting properties on Gram-negative bacteria than for Gram-positive ones. The Gram-negative bacteria show strong effect already at the concentration of 1 ppm after 15 min of incubation. Moreover, in vitro tests of toxicity made on normal human dermal fibroblast cultures showed that after 72 h of incubation with Ag/Cu nanoparticles, they are less toxic then Cu{sub 2}O/CuO nanoparticles.

  6. HSP70 gene expression in Mytilus galloprovincialis hemocytes is triggered by moderate heat shock and Vibrio anguillarum, but not by V. splendidus or Micrococcus lysodeikticus.

    Science.gov (United States)

    Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe

    2006-01-01

    Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.

  7. Antimicrobial Activities of Methanol, Ethanol and Supercritical CO2 Extracts of Philippine Piper betle L. on Clinical Isolates of Gram Positive and Gram Negative Bacteria with Transferable Multiple Drug Resistance.

    Directory of Open Access Journals (Sweden)

    Demetrio L Valle

    Full Text Available Piper betle L. has traditionally been used in alternative medicine in different countries for various therapeutic purposes, including as an anti-infective agent. However, studies reported in the literature are mainly on its activities on drug susceptible bacterial strains. This study determined the antimicrobial activities of its ethanol, methanol, and supercritical CO2 extracts on clinical isolates of multiple drug resistant bacteria which have been identified by the Infectious Disease Society of America as among the currently more challenging strains in clinical management. Assay methods included the standard disc diffusion method and the broth microdilution method for the determination of the minimum inhibitory concentration (MIC and the minimum bactericidal concentrations (MBC of the extracts for the test microorganisms. This study revealed the bactericidal activities of all the P. betle leaf crude extracts on methicillin-resistant Staphylococcus aureus (MRSA, vancomycin-resistant Enterococcus (VRE, extended spectrum β-lactamase-producing Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, and metallo-β-lactamase-producing Pseudomonas aeruginosa and Acinetobacter baumannii, with minimum bactericidal concentrations that ranged from 19μg/ml to 1250 μg/ml. The extracts proved to be more potent against the Gram positive MRSA and VRE than for the Gram negative test bacteria. VRE isolates were more susceptible to all the extracts than the MRSA isolates. Generally, the ethanol extracts proved to be more potent than the methanol extracts and supercritical CO2 extracts as shown by their lower MICs for both the Gram positive and Gram negative MDRs. MTT cytotoxicity assay showed that the highest concentration (100 μg/ml of P. betle ethanol extract tested was not toxic to normal human dermal fibroblasts (HDFn. Data from the study firmly established P. betle as an alternative source of anti-infectives against multiple drug resistant

  8. Antimicrobial Activities of Methanol, Ethanol and Supercritical CO2 Extracts of Philippine Piper betle L. on Clinical Isolates of Gram Positive and Gram Negative Bacteria with Transferable Multiple Drug Resistance.

    Science.gov (United States)

    Valle, Demetrio L; Cabrera, Esperanza C; Puzon, Juliana Janet M; Rivera, Windell L

    2016-01-01

    Piper betle L. has traditionally been used in alternative medicine in different countries for various therapeutic purposes, including as an anti-infective agent. However, studies reported in the literature are mainly on its activities on drug susceptible bacterial strains. This study determined the antimicrobial activities of its ethanol, methanol, and supercritical CO2 extracts on clinical isolates of multiple drug resistant bacteria which have been identified by the Infectious Disease Society of America as among the currently more challenging strains in clinical management. Assay methods included the standard disc diffusion method and the broth microdilution method for the determination of the minimum inhibitory concentration (MIC) and the minimum bactericidal concentrations (MBC) of the extracts for the test microorganisms. This study revealed the bactericidal activities of all the P. betle leaf crude extracts on methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus (VRE), extended spectrum β-lactamase-producing Enterobacteriaceae, carbapenem-resistant Enterobacteriaceae, and metallo-β-lactamase-producing Pseudomonas aeruginosa and Acinetobacter baumannii, with minimum bactericidal concentrations that ranged from 19μg/ml to 1250 μg/ml. The extracts proved to be more potent against the Gram positive MRSA and VRE than for the Gram negative test bacteria. VRE isolates were more susceptible to all the extracts than the MRSA isolates. Generally, the ethanol extracts proved to be more potent than the methanol extracts and supercritical CO2 extracts as shown by their lower MICs for both the Gram positive and Gram negative MDRs. MTT cytotoxicity assay showed that the highest concentration (100 μg/ml) of P. betle ethanol extract tested was not toxic to normal human dermal fibroblasts (HDFn). Data from the study firmly established P. betle as an alternative source of anti-infectives against multiple drug resistant bacteria.

  9. Activities of Tedizolid and Linezolid Determined by the Reference Broth Microdilution Method against 3,032 Gram-Positive Bacterial Isolates Collected in Asia-Pacific, Eastern Europe, and Latin American Countries in 2014.

    Science.gov (United States)

    Pfaller, Michael A; Flamm, Robert K; Jones, Ronald N; Farrell, David J; Mendes, Rodrigo E

    2016-09-01

    Tedizolid and linezolid in vitro activities against 3,032 Gram-positive pathogens collected in Asia-Pacific, Eastern European, and Latin American medical centers during 2014 were assessed. The isolates were tested for susceptibility by the current reference broth microdilution methods. Due to concern over the effect of MIC endpoint criteria on the results of testing the oxazolidinones tedizolid and linezolid, MIC endpoint values were read by two methods: (i) reading the MIC at the first well where the trailing began without regard for pinpoint trailing, according to CLSI M07-A10 and M100-S26 document instructions for reading linezolid (i.e., 80% inhibition of growth; these reads were designated tedizolid 80 and linezolid 80), and (ii) at 100% inhibition of growth (designated tedizolid 100 and linezolid 100). All Staphylococcus aureus, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus anginosus group, and Enterococcus faecalis isolates were inhibited at tedizolid 80 and 100 MIC values of 0.25 and 0.5, 0.25 and 0.25, 0.25 and 0.5, 0.12 and 0.25, and 0.5 and 1 μg/ml, respectively. Generally, MIC50 and MIC90 results for tedizolid 80 and linezolid 80 were one doubling dilution lower than those read at 100% inhibition. Tedizolid was 4- to 8-fold more potent than linezolid against all the isolates tested regardless of the MIC endpoint criterion used. Despite the differences in potency, >99.9% of isolates tested in this survey were susceptible to both linezolid and tedizolid using CLSI and EUCAST interpretive criteria. In conclusion, tedizolid demonstrated greater in vitro potency than linezolid against Gram-positive pathogens isolated from patients in medical centers across the Asia-Pacific region, Eastern Europe, and Latin America. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Five-Year Summary of In Vitro Activity and Resistance Mechanisms of Linezolid against Clinically Important Gram-Positive Cocci in the United States from the LEADER Surveillance Program (2011 to 2015).

    Science.gov (United States)

    Pfaller, Michael A; Mendes, Rodrigo E; Streit, Jennifer M; Hogan, Patricia A; Flamm, Robert K

    2017-07-01

    This report describes linezolid susceptibility testing results for 6,741 Gram-positive pathogens from 60 U.S. sites collected during 2015 for the LEADER Program. In addition, the report summarizes linezolid in vitro activity, resistance mechanisms, and molecular typing obtained for 2011 to 2015. During 2015, linezolid showed potent activity in testing against Staphylococcus aureus , inhibiting >99.9% of 3,031 isolates at ≤2 µg/ml. Similarly, linezolid showed coverage against 99.2% of coagulase-negative staphylococci, 99.7% of enterococci, and 100.0% of Streptococcus pneumoniae , virdans group, and beta-hemolytic streptococcus isolates tested. The overall linezolid resistance rate remained a modest linezolid resistance mechanisms. Increased annual trends for the presence of cfr among Staphylococcus aureus isolates were not observed, but 64.3% (9/14) of the isolates with decreased susceptibility (MIC, ≥4 µg/ml) to linezolid carried this transferrable gene (2011 to 2015). The cfr gene was detected in 21.9% (7/32) of linezolid-resistant staphylococci other than S. aureus from 2011 to 2015. The optrA gene was noted in half (2/4) of the population of linezolid-nonsusceptible Enterococcus faecalis isolates from 2011 to 2015, while linezolid-nonsusceptible Enterococcus faecium isolates showed alterations predominantly (16/16) in the 23S rRNA gene (G2576T). This report confirms a long record of linezolid activity against Gram-positive isolates in the United States since regulatory approval in 2000 and reports the oxazolidinones evolving resistance mechanisms. Copyright © 2017 American Society for Microbiology.

  11. In Vitro Repair of UV-Irradiated Micrococcus luteus Bacteriophage N1 Transfecting DNA 1

    Science.gov (United States)

    Mahler, Inga; George, Jeanne; Grossman, Lawrence

    1974-01-01

    Calcium-treated UV-sensitive, host cell reactivation− strains of Micrococcus luteus are infected with UV-irradiated N1 DNA. In strains lacking UV endonuclease, in vitro treatment of the irradiated DNA results in transfection enhancement. PMID:4823319

  12. Induction of mutation in Micrococcus pyogenes by chemical inactivation of sulfhydryl groups

    Energy Technology Data Exchange (ETDEWEB)

    Clark, J B; Wyss, O; Stone, W S

    1950-08-26

    The purpose of this work was to determine whether this naphthaquinone could induce antibiotic-resistant mutants in Micrococcus pyogenes var. aureus, and to determine if such mutagenicity was due to -SH inactivation.

  13. Description of Micrococcus aloeverae sp. nov., an endophytic actinobacterium isolated from Aloe vera.

    Science.gov (United States)

    Prakash, Om; Nimonkar, Yogesh; Munot, Hitendra; Sharma, Avinash; Vemuluri, Venkata Ramana; Chavadar, Mahesh S; Shouche, Yogesh S

    2014-10-01

    A yellow Gram-stain-positive, non-motile, non-endospore -forming, spherical endophytic actinobacterium, designated strain AE-6(T), was isolated from the inner fleshy leaf tissues of Aloe barbadensis (Aloe vera) collected from Pune, Maharashtra, India. Strain AE-6(T) grew at high salt concentrations [10% (w/v) NaCl], temperatures of 15-41 °C and a pH range of 5-12. It showed highest (99.7%) 16S rRNA gene sequence similarity with Micrococcus yunnanensis YIM 65004(T) followed by Micrococcus luteus NCTC 2665(T) (99.6%) and Micrococcus endophyticus YIM 56238(T) (99.0%). Ribosomal protein profiling by MALDI-TOF/MS also showed it was most closely related to M. yunnanensis YIM 65004(T) and M. luteus NCTC 2665(T). Like other members of the genus Micrococcus, strain AE-6(T) had a high content of branched chain fatty acids (iso-C15:0 and anteiso-C15:0). MK-8(H2) and MK-8 were the predominant isoprenoid quinones. Cell wall analysis showed an 'A2 L-Lys-peptide subunit' type of peptidoglycan and ribose to be the major cell wall sugar. The DNA G+C content was 70 mol%. Results of DNA-DNA hybridization of AE-6(T) with its closest relatives from the genus Micrococcus produced a value of less than 70%. Based on the results of this study, strain AE-6(T) could be clearly differentiated from other members of the genus Micrococcus. We propose that it represents a novel species of the genus Micrococcus and suggest the name Micrococcus aloeverae sp. nov., with strain AE-6(T) ( = MCC 2184(T) = DSM 27472(T)) as the type strain of the species. © 2014 IUMS.

  14. [Preparation and characterization of monoclonal antibodies against Micrococcus luteus Rpf domain].

    Science.gov (United States)

    Fan, Ai-lin; Shi, Chang-hong; Su, Ming-quan; Ma, Jing; Bai, Yin-lan; Cheng, Xiao-dong; Xu, Zhi-kai; Hao, Xiao-ke

    2008-05-01

    To express Micrococcus luteus Rpf domain in prokaryotic cells and prepare monoclonal antibodies against Rpf domain. The gene encoding Micrococcus luteus Rpf domain was amplified from genome of Micrococcus luteus by polymerase chain reaction(PCR), and inserted into cloning vector pUC-19. After sequenced, Micrococcus luteus Rpf domain gene was subcloned into the expression vector pPro-EXHT and transfected into E.coli DH5alpha. After induced by IPTG, the bacteria controlled by T7 promoter expressed the fused Micrococcus luteus Rpf domain protein with a hexahistidine tail at its N-terminal and the target protein was purified under denaturing conditions. Using this protein as antigen to immunize the BALB/c mice and prepare monoclonal antibodies against Micrococcus luteus Rpf domain. Then specifities and relative affinities of mAbs were identified by ELISA. The fusion protein was purified by metal chelate affinity chromatography under denaturing condition. Three cloned mAbs were prepared from the mice immunized by Rpf domain. All of them could recognize Rpf domain. specifically. The prepared mAbs against Rpf domain have strong specificity with high titers, which provides useful tools for further study of the function of Rpf domain in TB prevention.

  15. Purification and characterization of vanillin dehydrogenases from alkaliphile Micrococcus sp. TA1 and neutrophile Burkholderia cepacia TM1.

    Science.gov (United States)

    Mitsui, Ryoji; Hirota, Mizuho; Tsuno, Takuo; Tanaka, Mitsuo

    2010-02-01

    Vanillin dehydrogenases (VDHs) were purified and characterized from two bacterial strains that have different pH dependencies for growth. The alkaliphile Micrococcus sp. TA1, isolated from an alkaline spa, can grow on several aromatic compounds such as ferulic acid, vanillin, vanillic acid, and protocatechuic acid under alkaline conditions. The neutrophile Burkholderia cepacia TM1, which was isolated previously, also grew on the above-mentioned compounds because they functioned as the sole carbon source under neutral conditions. Purified VDHs showed activities toward some aromatic aldehydes. These enzymes have the same subunit molecular mass of about 57 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, but differed in some of their observed properties. Native molecular masses also differed between the purified enzymes. These were 250 kDa for the enzyme from alkaliphilic strain TA1 and 110 kDa for that from neutrophilic strain TM1, as determined by gel filtration. The enzyme from strain TA1 required NADP(+) as a coenzyme for its activity, but that from strain TM1 required NAD(+). These results are important because this is the first report of an alkaliphilic bacterium consuming lignin monomers.

  16. Micrococcus luteus mediated dual mode synthesis of gold nanoparticles: involvement of extracellular α-amylase and cell wall teichuronic acid.

    Science.gov (United States)

    Arunkumar, Pichaimani; Thanalakshmi, Muthukrishnan; Kumar, Priyadarsini; Premkumar, Kumpati

    2013-03-01

    In the present study we have utilized the bioreductive potential of Micrococcus luteus for the synthesis of gold nanoparticles. Biochemical and physiological analysis indicate that the biosynthesized GNPs were achieved by dual mode, involving extracellular α-amylase and cell wall teichuronic acid (TUA) of M. luteus. The biosynthetic potential of both α-amylase and TUA, after isolation from bacterium, was examined. Under optimum conditions, these biomolecules reduces Au(3+) into Au(0) and the resulting GNPs were found to be stable for 1 month. The synthesized GNPs were characterized by UV-VIS spectrometry, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) and dynamic light scattering (DLS). Results demonstrated that the synthesized GNPs were found to be monodispersive and spherical in shape with an average size of ∼6 nm and ∼50 nm for α-amylase and teichuronic acid, respectively. These findings suggest that M. luteus can be exploited as a potential biosource for the eco-friendly synthesis of gold nanoparticles. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. A Repeating Sulfated Galactan Motif Resuscitates Dormant Micrococcus luteus Bacteria.

    Science.gov (United States)

    Böttcher, Thomas; Szamosvári, Dávid; Clardy, Jon

    2018-07-01

    Only a small fraction of bacteria can autonomously initiate growth on agar plates. Nongrowing bacteria typically enter a metabolically inactive dormant state and require specific chemical trigger factors or signals to exit this state and to resume growth. Micrococcus luteus has become a model organism for this important yet poorly understood phenomenon. Only a few resuscitation signals have been described to date, and all of them are produced endogenously by bacterial species. We report the discovery of a novel type of resuscitation signal that allows M. luteus to grow on agar but not agarose plates. Fractionation of the agar polysaccharide complex and sulfation of agarose allowed us to identify the signal as highly sulfated saccharides found in agar or carrageenans. Purification of hydrolyzed κ-carrageenan ultimately led to the identification of the signal as a small fragment of a large linear polysaccharide, i.e., an oligosaccharide of five or more sugars with a repeating disaccharide motif containing d-galactose-4-sulfate (G4S) 1,4-linked to 3,6-anhydro-α-d-galactose (DA), G4S-(DA-G4S) n ≥2 IMPORTANCE Most environmental bacteria cannot initiate growth on agar plates, but they can flourish on the same plates once growth is initiated. While there are a number of names for and manifestations of this phenomenon, the underlying cause appears to be the requirement for a molecular signal indicating safe growing conditions. Micrococcus luteus has become a model organism for studying this growth initiation process, often called resuscitation, because of its apparent connection with the persistent or dormant form of Mycobacterium tuberculosis , an important human pathogen. In this report, we identify a highly sulfated saccharide from agar or carrageenans that robustly resuscitates dormant M. luteus on agarose plates. We identified and characterized the signal as a small repeating disaccharide motif. Our results indicate that signals inherent in or absent from the

  18. Comparison of TiO2 and ZnO nanoparticles for photocatalytic degradation of methylene blue and the correlated inactivation of gram-positive and gram-negative bacteria

    International Nuclear Information System (INIS)

    Barnes, Robert J.; Molina, Rodrigo; Xu Jianbin; Dobson, Peter J.; Thompson, Ian P.

    2013-01-01

    Titanium dioxide (TiO 2 ) and zinc oxide (ZnO) nanoparticles are important photocatalysts and as such have been extensively studied for the removal of organic compounds from contaminated air and water and for microbial disinfection. Despite much research on the effect of TiO 2 and ZnO nanoparticles on different bacterial species, uncertainties remain about which bacteria are more sensitive to these compounds. Very few studies have directly compared the toxicity of ZnO to TiO 2 under both light and dark conditions. In addition, authors investigating the photocatalytic inactivation of TiO 2 and ZnO nanoparticles on bacteria have failed to investigate the reactive oxygen species (ROS) generation of the nanoparticles, making it difficult to correlate killing action with the generation of ROS. In this study, three types of metal nanoparticle (ZnO 2 ) have been characterised and ROS production assessed through the degradation of methylene blue (MB). The photocatalytic killing potential of three nanoparticle concentrations (0.01, 0.1 and 1 g/L) was then assessed on four representative bacteria: two gram-positive (S. aureus and B. subtilis) and two gram-negative (E. coli and P. aeruginosa). Results showed that out of the three nanoparticles tested, the TiO 2 nanoparticles generated more ROS than the ZnO nanoparticles, corresponding to a greater photocatalytic inactivation of three of the four species of bacteria examined. The MB decomposition results correlated well with the bacterial inactivation results with higher TiO 2 nanoparticle concentrations leading to greater ROS production and increased loss of cell viability. Although producing less ROS than the TiO 2 nanoparticles under ultraviolet light, the ZnO nanoparticles were toxic to two of the bacterial species even under dark conditions. In this study, no correlation between cell wall type and bacterial inactivation was observed for any of the nanoparticles tested although both gram-positive bacteria were sensitive to

  19. Effects of oxygen during γ-irradiation of Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Myers, D.K.; Johnson, L.D.

    1977-01-01

    A study has been made of the effects of oxygen on the yield of double strand breaks in the DNA of Micrococcus radiodurans, and of the relation of these effects to cell death. The o.e.r. values for cell survival were considerably smaller than those for the yield of double strand breaks, although they showed similar trends after irradiation in different media. The o.e.r. values for the inhibition of post-irradiation enzymatic repair were similar to those for cell survival. The o.e.r. for radiation-induced breaks in DNA therefore seems to depend on radiochemical reactions that are occurring during irradiation rather than on a preferential enzymatic repair of those strand breaks that are produced by anoxic irradiation. Cell survival depends less on the number of double strand breaks produced than on the ability of the cell to repair the double strand breaks. The maximum yield of double strand breaks after oxic γ-irradiation was approximately 1.7 breaks/krad/10 10 Daltons, corresponding to 1 break per 610 eV. (U.K.)

  20. The utilization of aconate and itaconate by Micrococcus sp

    Science.gov (United States)

    Cooper, R. A.; Itiaba, K.; Kornberg, H. L.

    1965-01-01

    1. An organism, identified as Micrococcus sp., was isolated by elective culture on aconate; it also grew on itaconate. 2. Washed suspensions of the aconate-grown organism readily oxidized intermediates of the tricarboxylic acid cycle, aconate and succinic semialdehyde, but not itaconate. Itaconate-grown cells oxidized tricarboxylic acid-cycle intermediates, succinic semialdehyde and itaconate, but not aconate. Succinate-grown cells oxidized neither itaconate nor aconate. 3. Extracts of aconate-grown cells catalysed the formation of succinic semialdehyde and carbon dioxide, in equimolar amounts, from aconate. In the presence of NAD or NADP, succinic semialdehyde was oxidized to succinate with concomitant reduction of the coenzyme. 4. Extracts of itaconate-grown cells catalysed the formation of pyruvate and acetyl-CoA from itaconyl-CoA. 5. Key enzymes involved in the formation of succinate from aconate, and of pyruvate and acetyl-CoA from itaconate, were distinct and inducible: their formation preceded growth on the appropriate substrate. PMID:14342240

  1. Bioremediation of contaminated surface water by immobilized Micrococcus roseus.

    Science.gov (United States)

    Li, H; Li, P; Hua, T; Zhang, Y; Xiong, X; Gong, Z

    2005-08-01

    The problems caused by contaminated surface water have gradually become more serious in recent years. Although various remediation technologies were investigated, unfortunately, no efficient method was developed. In this paper, a new bioremediation technology was studied using Micrococcus roseus, which was immobilized in porous spherical beads by an improved polyvinyl alcohol (PVA) - sodium alginate (SA) embedding method. The experimental results indicated that COD removal rate could reach 64.7 % within 72 hours when immobilized M. roseus beads were used, which was ten times as high as that of free cells. The optimum inoculation rate of immobilized M. roseus beads was 10 % (mass percent of the beads in water sample, g g(-1)). Suitable aeration was proved necessary to enhance the bioremediation process. The immobilized cells had an excellent tolerance to pH and temperature changes, and were also more resistant to heavy metal stress compared with free cells. The immobilized M. roseus beads had an excellent regeneration capacity and could be reused after 180-day continuous usage. The Scanning Electronic Microscope (SEM) analysis showed that the bead microstructure was suitable for M. roseus growth, however, some defect structures should still be improved.

  2. Effects of oxygen during. gamma. irradiation of Micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Myers, D K; Johnson, L D [Atomic Energy of Canada Ltd., Chalk River, Ontario. Chalk River Nuclear Labs.

    1977-09-01

    A study has been made of the effects of oxygen on the yield of double strand breaks in the DNA of Micrococcus radiodurans, and of the relation of these effects to cell death. The OER values for cell survival were considerably smaller than those for the yield of double strand breaks, although they showed similar trends after irradiation in different media. The OER values for the inhibition of post-irradiation enzymatic repair were similar to those for cell survival. The OER for radiation-induced breaks in DNA therefore seems to depend on radiochemical reactions that are occurring during irradiation rather than on a preferential enzymatic repair of those strand breaks that are produced by anoxic irradiation. Cell survival depends less on the number of double strand breaks produced than on the ability of the cell to repair the double strand breaks. The maximum yield of double strand breaks after oxic ..gamma.. irradiation was approximately 1.7 breaks/krad/10/sup 10/Daltons, corresponding to 1 break per 610 eV.

  3. Keratinolytic abilities of Micrococcus luteus from poultry waste.

    Science.gov (United States)

    Laba, Wojciech; Choinska, Anna; Rodziewicz, Anna; Piegza, Michal

    2015-01-01

    Keratinolytic microorganisms have become the subject of scientific interest due to their ability to biosynthesize specific keratinases and their prospective application in keratinic waste management. Among several bacterial classes, actinobacteria remain one of the most important sources of keratin-degrading strains, however members of the Micrococcaceae family are rarely scrutinized in regard to their applicatory keratinolytic potential. The tested Micrococcus sp. B1pz isolate from poultry feather waste was identified as M. luteus. The strain, grown in the medium with 1-2% chicken feathers and a yeast extract supplement, produced keratinases of 32 KU and lower level of proteases, 6 PU. It was capable to effectively decompose feathers or "soft" keratin of stratum corneum, in contrast to other "hard" hair-type keratins. The produced keratinolytic enzymes were mainly a combination of alkaline serine or thiol proteases, active at the optimum pH 9.4, 55 °C. Four main protease fractions of 62, 185, 139 and 229 kDa were identified in the crude culture fluid. The research on the auxiliary role of reducing factors revealed that reducing sulfur compounds could be applied in keratinolysis enhancement during enzymatic digestion of keratin, rather than in culture conditions. The presented M. luteus isolate exhibits a significant keratinolytic potential, which determines its feasible applicatory capacity towards biodegradation of poultry by-products or formulation of keratin-based feed components.

  4. Competitive binding of polyethyleneimine-coated gold nanoparticles to enzymes and bacteria: a key mechanism for low-level colorimetric detection of gram-positive and gram-negative bacteria

    International Nuclear Information System (INIS)

    Thiramanas, Raweewan; Laocharoensuk, Rawiwan

    2016-01-01

    The article describes a simple and rapid method for colorimetric detection of bacteria. It is based on competitive binding of positively charged polyethyleneimine-coated gold nanoparticles (PEI-AuNPs) to negatively charged enzymes and bacteria. The PEI-AuNPs are electrostatically attracted by both the bacterial surface and the enzyme β-galactosidase (β-Gal). Binding to the latter results in the inhibition of enzyme activity. However, in the presence of a large number of bacteria, the PEI-AuNPs preferentially bind to bacteria. Hence, the enzyme will not be inhibited and its activity can be colorimetrically determined via hydrolysis of the chromogenic substrate chlorophenol red β-D-galactopyranoside (CPRG). The detection limit of this assay is as low as 10 cfu·mL −1 , and the linear range extends from 10 6 to 10 8 cfu·mL −1 . The assay is applicable to both Gram-negative (such as enterotoxigenic Escherichia coli; ETEC) and Gram-positive (Staphylococcus aureus; S. aureus) bacteria. Results are obtained within 10 min using an optical reader, and within 2–3 h by bare-eye detection. The method was applied to the identification of ETEC contamination at a level of 10 cfu·mL −1 in spiked drinking water. Given its low detection limit and rapidity (sample preconcentration is not required), this method holds great promise for on-site detection of total bacterial contamination. (author)

  5. In vivo metabolism of 2,2'-diaminopimelic acid from gram-positive and gram-negative bacterial cells by ruminal microorganisms and ruminants and its use as a marker of bacterial biomass

    International Nuclear Information System (INIS)

    Masson, H.A.; Denholm, A.M.; Ling, J.R.

    1991-01-01

    Cells of Bacillus megaterium GW1 and Escherichia coli W7-M5 were specifically radiolabeled with 2,2'-diamino [G- 3 H] pimelic acid ([ 3 H]DAP) as models of gram-positive and gram-negative bacteria, respectively. Two experiments were conducted to study the in vivo metabolism of 2,2'-diaminopimelic acid (DAP) in sheep. In experiment 1, cells of [ 3 H]DAP-labeled B. megaterium GW1 were infused into the rumen of one sheep and the radiolabel was traced within microbial samples, digesta, and the whole animal. Bacterially bound [ 3 H]DAP was extensively metabolized, primarily (up to 70% after 8 h) via decarboxylation to [ 3 H]lysine by both ruminal protozoa and ruminal bacteria. Recovery of infused radiolabel in urine and feces was low (42% after 96 h) and perhaps indicative of further metabolism by the host animal. In experiment 2, [ 3 H]DAP-labeled B. megaterium GW1 was infused into the rumens of three sheep and [ 3 H]DAP-labeled E. coli W7-W5 was infused into the rumen of another sheep. The radioactivity contents of these mutant bacteria were insufficient to use as tracers, but the metabolism of DAP was monitored in the total, free, and peptidyl forms. Free DAP, as a proportion of total DPA in duodenal digesta, varied from 0 to 9.5%, whereas peptidyl DAP accounted for 8.3 to 99.2%

  6. Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots.

    Science.gov (United States)

    Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun

    2009-10-01

    In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).

  7. Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects

    Science.gov (United States)

    Nath, K. R.; Wagner, B. J.

    1973-01-01

    Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337

  8. A Comparative biochemical study on two marine endophytes, Bacterium SRCnm and Bacillus sp. JS, Isolated from red sea algae.

    Science.gov (United States)

    Ahmed, Eman Fadl; Hassan, Hossam Mokhtar; Rateb, Mostafa Ezzat; Abdel-Wahab, Noha; Sameer, Somayah; Aly Taie, Hanan Anwar; Abdel-Hameed, Mohammed Sayed; Hammouda, Ola

    2016-01-01

    Two marine endophytic bacteria were isolated from the Red Sea algae; a red alga; Acanthophora dendroides and the brown alga Sargassum sabrepandum. The isolates were identified based on their 16SrRNA sequences as Bacterium SRCnm and Bacillus sp. JS. The objective of this study was to investigate the potential anti-microbial and antioxidant activities of the extracts of the isolated bacteria grown in different nutrient conditions. Compared to amoxicillin (25μg/disk) and erythromycin (15μg/disk), the extracts of Bacterium SRCn min media II, III, IV and V were potent inhibitors of the gram-positive bacterium Sarcina maxima even at low concentrations. Also, the multidrug resistant Staphylococcus aureus(MRSA) was more sensitive to the metabolites produced in medium (II) of the same endophyte than erythromycin (15μg/disk). A moderate activity of the Bacillus sp. JS extracts of media I and II was obtained against the same pathogen. The total compounds (500ug/ml) of both isolated endophytes showed moderate antioxidant activities (48.9% and 46.1%, respectively). LC/MS analysis of the bacterial extracts was carried out to investigate the likely natural products produced. Cyclo(D-cis-Hyp-L-Leu), dihydrosphingosine and 2-Amino-1,3-hexadecanediol were identified in the fermentation medium of Bacterium SRCnm, whereas cyclo (D-Pro-L-Tyr) and cyclo (L-Leu-L-Pro) were the suggested compounds of Bacillus sp. JS.

  9. Micrococcus sedentarius bacteraemia presenting with haemophagocytic syndrome in previously healthy boy.

    Science.gov (United States)

    Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz

    2006-01-01

    Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.

  10. Four Proteins Synthesized in Response to Deoxyribonucleic Acid Damage in Micrococcus Radiodurans

    DEFF Research Database (Denmark)

    Hansen, M. T.

    1980-01-01

    Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis for these prote......Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points. Within the sublethal-dose range, the differential rate of synthesis...

  11. Restriction of the anti-bovine serum albumin response in rabbits immunized with Micrococcus lysodeikticus.

    Science.gov (United States)

    De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R

    1977-01-01

    Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263

  12. Surveillance of multidrug resistance of two Gram-positive pathogenic bacteria in a teaching hospital and in vitro efficacy of 30 ethnomedicinal plants used by an aborigine of India

    Directory of Open Access Journals (Sweden)

    Debasmita Dubey

    2012-08-01

    Full Text Available Objective: To record hospital- and community-acquired accounts of multidrug resistance (MDR of two Gram-positive pathogens, Staphylococcus aureus (S. aureus and Enterococcus faecalis (E. faecalis, by surveillance, and to evaluate antibacterial potencies of 30 plants with information on ethnomedicinal uses for infectious ailments by the aborigine Kandha tribe of Kalahandi district, Odisha (India, against both pathogens. Methods: Over a period of 6 months bacteria/ strains of S. aureus and E. faecalis were isolated from clinical samples in a teaching hospital and their antibiograms were ascertained using 17 antibiotics of 9 different groups. S. aureus strains were further tested for confirmation if they were methicillin and vancomycin resistant, similarly, E. faecalis strains for vancomycin resistance. Concentrated aqueous and ethanolic extracts of leaves/ barks of 30 plants were used for monitoring their antimicrobial potencies, by the agar-well diffusion method, along with qualitative phytochemical analyses. Results: From the surveillance, both pathogens were found MDR and it was evident that the distribution of MDR strains was more in hospital-acquired than community-acquired samples. Both aqueous and ethanolic extracts of plants, Diospyrous melanoxylon, Woodfordia fruticosa (W. fruticosa, Oroxylum indicum (O. indicum, Dalbergia paniculata and Lantana camara had the most significant in vitro controlling capacity against MDR strains of both bacteria. Further, extracts of Holarrhena antidysenterica, Aspidopterys tomentosa and Argyreia speciosa had moderate antibacterial activities. Ethanolic extracts of L. camara, O. indicum and W. fruticosa contained all the phytochemicals, alkaloids, glycosides, terpenoids, reducing sugars, saponins, tannins, flavonoids and steroids, which could be attributed to the recorded significant antibacterial activity. Conclusions: S. aureus strains have been found as the most widely prevailing pathogens in nosocomial

  13. Enhanced antiadhesive properties of chitosan/hyaluronic acid polyelectrolyte multilayers driven by thermal annealing: Low adherence for mammalian cells and selective decrease in adhesion for Gram-positive bacteria.

    Science.gov (United States)

    Muzzio, Nicolás E; Pasquale, Miguel A; Diamanti, Eleftheria; Gregurec, Danijela; Moro, Marta Martinez; Azzaroni, Omar; Moya, Sergio E

    2017-11-01

    The development of antifouling coatings with restricted cell and bacteria adherence is fundamental for many biomedical applications. A strategy for the fabrication of antifouling coatings based on the layer-by-layer assembly and thermal annealing is presented. Polyelectrolyte multilayers (PEMs) assembled from chitosan and hyaluronic acid were thermally annealed in an oven at 37°C for 72h. The effect of annealing on the PEM properties and topography was studied by atomic force microscopy, ζ-potential, circular dichroism and contact angle measurements. Cell adherence on PEMs before and after annealing was evaluated by measuring the cell spreading area and aspect ratio for the A549 epithelial, BHK kidney fibroblast, C2C12 myoblast and MC-3T3-E1 osteoblast cell lines. Chitosan/hyaluronic acid PEMs show a low cell adherence that decreases with the thermal annealing, as observed from the reduction in the average cell spreading area and more rounded cell morphology. The adhesion of S. aureus (Gram-positive) and E. coli (Gram-negative) bacteria strains was quantified by optical microscopy, counting the number of colony-forming units and measuring the light scattering of bacteria suspension after detachment from the PEM surface. A 20% decrease in bacteria adhesion was selectively observed in the S. aureus strain after annealing. The changes in mammalian cell and bacteria adhesion correlate with the changes in topography of the chitosan/hyaluronic PEMs from a rough fibrillar 3D structure to a smoother and planar surface after thermal annealing. Copyright © 2017. Published by Elsevier B.V.

  14. Rolling-circle plasmids from Bacillus subtilis : complete nucleotide sequences and analyses of genes of pTA1015, pTA1040, pTA1050 and pTA1060, and comparisons with related plasmids from Gram-positive bacteria

    NARCIS (Netherlands)

    Meijer, W.J.; Schuurs-Wisman, Bea; Terpstra, P; Thorsted, P.; Thomas, C.M.; Holsappel, S; Venema, G; Bron, S

    Most small plasmids of Gram-positive bacteria use the rolling-circle mechanism of replication and several of these have been studied in considerable detail at the DNA level and for the function of their genes. Although most of the common laboratory Bacillus subtilis 168 strains do not contain

  15. Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus.

    Science.gov (United States)

    Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying; Li, De-Feng; Liu, Zhi-Pei

    2016-01-22

    Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Specific amino acids responsible for the cold adaptedness of Micrococcus antarcticus β-glucosidase BglU.

    Science.gov (United States)

    Miao, Li-Li; Fan, Hong-Xia; Qu, Jie; Liu, Ying; Liu, Zhi-Pei

    2017-03-01

    Psychrophilic enzymes display efficient activity at moderate or low temperatures (4-25 °C) and are therefore of great interest in biotechnological industries. We previously examined the crystal structure of BglU, a psychrophilic β-glucosidase from the bacterium Micrococcus antarcticus, at 2.2 Å resolution. In structural comparison and sequence alignment with mesophilic (BglB) and thermophilic (GlyTn) counterpart enzymes, BglU showed much lower contents of Pro residue and of charged amino acids (particularly positively charged) on the accessible surface area. In the present study, we investigated the roles of specific amino acid residues in the cold adaptedness of BglU. Mutagenesis assays showed that the mutations G261R and Q448P increased optimal temperature (from 25 to 40-45 °C) at the expense of low-temperature activity, but had no notable effects on maximal activity or heat lability. Mutations A368P, T383P, and A389E significantly increased optimal temperature (from 25 to 35-40 °C) and maximal activity (~1.5-fold relative to BglU). Thermostability of A368P and A389E increased slightly at 30 °C. Mutations K163P, N228P, and H301A greatly reduced enzymatic activity-almost completely in the case of H301A. Low contents of Pro, Arg, and Glu are important factors contributing to BglU's psychrophilic properties. Our findings will be useful in structure-based engineering of psychrophilic enzymes and in production of mutants suitable for a variety of industrial processes (e.g., food production, sewage treatment) at cold or moderate temperatures.

  17. Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.

    Science.gov (United States)

    Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z

    2015-01-01

    Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

  18. Surface hydrolysis of polyacrylonitrile with nitrile hydrolysing enzymes from Micrococcus luteus BST20

    Czech Academy of Sciences Publication Activity Database

    Fischer-Colbrie, G.; Matamá, T.; Heumann, S.; Martínková, Ludmila; Cavaco Paulo, A.; Gubitz, G.

    2007-01-01

    Roč. 129, č. 1 (2007), s. 62-68 ISSN 0168-1656 R&D Projects: GA MŠk OC D25.001 Institutional research plan: CEZ:AV0Z50200510 Keywords : micrococcus luteus * nitrilase * polyacrylonitrile Subject RIV: EE - Microbiology, Virology Impact factor: 2.565, year: 2007

  19. Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1

    Directory of Open Access Journals (Sweden)

    Preeti N. Tallur

    2015-09-01

    Full Text Available Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF, polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

  20. Single Intravenous Dose of Oritavancin for Treatment of Acute Skin and Skin Structure Infections Caused by Gram-Positive Bacteria: Summary of Safety Analysis from the Phase 3 SOLO Studies.

    Science.gov (United States)

    Corey, G Ralph; Loutit, Jeffery; Moeck, Greg; Wikler, Matthew; Dudley, Michael N; O'Riordan, William

    2018-04-01

    Oritavancin is a lipoglycopeptide with bactericidal activity against Gram-positive organisms. Its rapid concentration-dependent bactericidal activity and long elimination half-life allow single-dose treatment of acute bacterial skin and skin structure infections (ABSSSI). SOLO I and SOLO II were randomized, double-blind studies evaluating the efficacy and safety of a single 1,200-mg intravenous (i.v.) dose of oritavancin versus twice-daily i.v. vancomycin for 7 to 10 days in ABSSSI patients. Safety data from both studies were pooled for safety analysis. The database comprised pooled safety data for 976 oritavancin-treated patients and 983 vancomycin-treated patients. The incidences of adverse events, serious adverse events, and discontinuations due to adverse events were similar for oritavancin (55.3, 5.8, and 3.7%, respectively) and vancomycin (56.9, 5.9, and 4.2%, respectively). The median time to onset (3.8 days versus 3.1 days, respectively) and the duration (3.0 days for both groups) of adverse events were also similar between the two groups. The most frequently reported events were nausea, headache, and vomiting. Greater than 90% of all events were mild or moderate in severity. There were slightly more infections and infestations, abscesses or cellulitis, and hepatic and cardiac adverse events in the oritavancin group; however, more than 80% of these events were mild or moderate. Subgroup analyses did not identify clinically meaningful differences in the incidence of adverse events attributed to oritavancin. A single 1,200-mg dose of oritavancin was well tolerated and had a safety profile similar to that of twice-daily vancomycin. The long elimination half-life of oritavancin compared to that of vancomycin did not result in a clinically meaningful delay to the onset or prolongation of adverse events. (This study has been registered at ClinicalTrials.gov under registration no. NCT01252719 and NCT01252732.). Copyright © 2018 American Society for Microbiology.

  1. Matrix-assisted Laser Desorption Ionization-Time-of-Flight Mass Spectrometry (MALDI-TOF MS) as a Reliable Tool to Identify Species of Catalase-negative Gram-positive Cocci not Belonging to the Streptococcus Genus.

    Science.gov (United States)

    Almuzara, Marisa; Barberis, Claudia; Velázquez, Viviana Rojas; Ramirez, Maria Soledad; Famiglietti, Angela; Vay, Carlos

    2016-01-01

    To evaluate the performance of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) by using 190 Catalase-negative Gram-Positive Cocci (GPC) clinical isolates. All isolates were identified by conventional phenotypic tests following the proposed scheme by Ruoff and Christensen and MALDI-TOF MS (Bruker Daltonics, BD, Bremen, Germany). Two different extraction methods (direct transfer formic acid method on spot and ethanol formic acid extraction method) and different cut-offs for genus/specie level identification were used. The score cut-offs recommended by the manufacturer (≥ 2.000 for species-level, 1.700 to 1.999 for genus level and genus level, ≥ 1.700 for species-level and score genus or species. MALDI-TOF MS identification was considered correct when the result obtained from MS database agreed with the phenotypic identification result. When both methods gave discordant results, the 16S rDNA or sodA genes sequencing was considered as the gold standard identification method. The results obtained by MS concordant with genes sequencing, although discordant with conventional phenotyping, were considered correct. MS results discordant with 16S or sod A identification were considered incorrect. Using the score cut-offs recommended by the manufacturer, 97.37% and 81.05% were correctly identified to genus and species level, respectively. On the other hand, using lower cut-off scores for identification, 97.89% and 94.21% isolates were correctly identified to genus and species level respectively by MALDI-TOF MS and no significant differences between the results obtained with two extraction methods were obtained. The results obtained suggest that MALDI-TOF MS has the potential of being an accurate tool for Catalase-negative GPC identification even for those species with difficult diagnosis as Helcococcus , Abiotrophia , Granulicatella , among others. Nevertheless, expansion of the library, especially including more strains with

  2. Micrococcus cohnii sp. nov., isolated from the air in a medical practice.

    Science.gov (United States)

    Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike

    2013-01-01

    Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).

  3. Noncontiguous finished genome sequence and description of Virgibacillus massiliensis sp. nov., a moderately halophilic bacterium isolated from human gut

    Directory of Open Access Journals (Sweden)

    S. Khelaifia

    2015-11-01

    Full Text Available Strain Vm-5T was isolated from the stool specimen of a 10-year-old Amazonian boy. This bacterium is a Gram-positive, strictly aerobic rod, motile by a polar flagellum. Here we describe its phenotypic characteristics and complete genome sequence. The 4 353 177 bp long genome exhibits a G + C content of 36.87% and contains 4394 protein-coding and 125 predicted RNA genes. Phylogenetically and genetically, strain Vm-c is a member of the genus Virgibacillus but is distinct enough to be classified as a new species. We propose the creation of V. massiliensis sp. nov., whose type strain is strain Vm-5T (CSUR P971 = DSM 28587.

  4. Characterization of the surfaceome of the metal-reducing bacterium Desulfotomaculum reducens

    Directory of Open Access Journals (Sweden)

    Elena eDalla Vecchia

    2014-08-01

    Full Text Available Desulfotomaculum reducens strain MI-1 is a Gram-positive, sulfate-reducing bacterium also capable of reducing Fe(III. Metal reduction in Gram-positive bacteria is poorly understood. Here, we investigated Fe(III reduction with lactate, a non-fermentable substrate, as the electron donor. Lactate consumption is concomitant to Fe(III reduction, but does not support significant growth, suggesting that little energy can be conserved from this process and that it may occur fortuitously. D. reducens can reduce both soluble (Fe(III-citrate and insoluble (hydrous ferric oxide, HFO Fe(III. Because physically inaccessible HFO was not reduced, we concluded that reduction requires direct contact under these experimental conditions. This implies the presence of a surface exposed reductase capable of transferring electrons from the cell to the extracellular electron acceptor. With the goal of characterizing the role of surface proteins in D. reducens and of identifying candidate Fe(III reductases, we carried out an investigation of the surface proteome (surfaceome of D. reducens. Cell surface exposed proteins were extracted by trypsin cell shaving or by lysozyme treatment, and analyzed by liquid chromatography-tandem mass spectrometry. This investigation revealed that the surfaceome fulfills many functions, including solute transport, protein export, maturation and hydrolysis, peptidoglycan synthesis and modification, and chemotaxis. Furthermore, a few redox-active proteins were identified. Among these, three are putatively involved in Fe(III reduction, i.e., a membrane-bound hydrogenase 4Fe-4S cluster subunit (Dred_0462, a heterodisulfide reductase subunit A (Dred_0143 and a protein annotated as alkyl hydroperoxide reductase but likely functioning as a thiol-disulfide oxidoreductase (Dred_1533.

  5. Perfil de susceptibilidade a antimicrobianos em amostras de cocos Gram-positivos, catalase negativos, isoladas de mastite subclínica bubalina Profile of antimicrobial susceptibility in strains of Gram positive cocos, negative catalase, isolated from buffalo subclinical mastitis

    Directory of Open Access Journals (Sweden)

    Maria C.E. Vianni

    2003-06-01

    Full Text Available Estudou-se o perfil de susceptibilidade a antimicrobianos em cocos Gram-positivos catalase negativos (21 amostras de Lactococcus garvieae e 6 de Enterococcus gallinarum, isoladas do leite de fêmeas com mastite subclínica e pertencentes a uma população composta por seis rebanhos bubalinos localizados no Estado do Rio de Janeiro. O teste utilizado foi o da difusão de discos em agar Müller Hinton, segundo recomendações do National Committee for Clinical Laboratory Standards - NCCLS, tendo sido testados discos com ampicilina (10mg, cefalotina (30mg, cefotaxima (30mg, cefoxitina (30mg, cloranfenicol (30mg, eritromicina (15mg, gentamicina (10mg, nitrofurantoína (300mg, norfloxacina (10mg, penicilina (10 UI, tetraciclina (30mg e vancomicina (30mg. Os resultados evidenciaram que em se tratando de Lactococcus garvieae, o antimicrobiano mais eficiente foi o nitrofurantoína com 85,71% de sensibilidade, seguido da cefotaxima (61,90%, vancomicina (52,38%, norfloxacina (47,62% e cefalotina (47,62%. A maior resistência foi desenvolvida frente a penicilina e ampicilina, com 95,24% de resistênciapara os dois antimicrobianos testados. O perfil de susceptibilidade desenvolvido pelas amostras de Enterococcus gallinarum, mostrou baixa sensibilidade frente aos antimicrobianos testados, onde os maiores índices foram observados frente eritromicina e gentamicina, com 33,34% de sensibilidade para ambos; quanto à resistência desenvolvida, foi possível observar 100% de resistência com relação a vancomicina e tetraciclina, seguindo-se cloranfenicol, penicilina, ampicilina, cefoxitina, cefalotina, cefotaxima, norfloxacina e nitrofurantoína, todas evidenciando uma resistência de 83,33% das amostras testadas.The susceptibility of antimicrobials was studied in Gram positive and catalase negative cocci (21 samples of Lactococcus garvieae and 6 Enterococcus gallinarum, isolated from the milk of cows with subclinical mastitis, belonging to six buffalo herds in

  6. [GEIPC-SEIMC (Study Group for Infections in the Critically Ill Patient of the Spanish Society for Infectious Diseases and Clinical Microbiology) and GTEI-SEMICYUC ( Working Group on Infectious Diseases of the Spanish Society of Intensive Medicine, Critical Care, and Coronary Units) recommendations for antibiotic treatment of gram-positive cocci infections in the critical patient].

    Science.gov (United States)

    Astigarraga, P M Olaechea; Montero, J Garnacho; Cerrato, S Grau; Colomo, O Rodríguez; Martínez, M Palomar; Crespo, R Zaragoza; García-Paredes, P Muñoz; Cerdá, E Cerdá; Lerma, F Alvarez

    2007-01-01

    In recent years, an increment of infections caused by gram-positive cocci has been documented in nosocomial and hospital-acquired-infections. In diverse countries, a rapid development of resistance to common antibiotics against gram-positive cocci has been observed. This situation is exceptional in Spain but our country might be affected in the near future. New antimicrobials active against these multi-drug resistant pathogens are nowadays available. It is essential to improve our current knowledge about pharmacokinetic properties of traditional and new antimicrobials to maximize its effectiveness and to minimize toxicity. These issues are even more important in critically ill patients because inadequate empirical therapy is associated with therapeutic failure and a poor outcome. Experts representing two scientific societies (Grupo de estudio de Infecciones en el Paciente Crítico de la SEIMC and Grupo de trabajo de Enfermedades Infecciosas de la SEMICYUC) have elaborated a consensus document based on the current scientific evidence to summarize recommendations for the treatment of serious infections caused by gram-positive cocci in critically ill patients.

  7. Repair of ultraviolet light-induced damage in Micrococcus radiophilus, and extremely resistant microorganism

    International Nuclear Information System (INIS)

    Lavin, M.F.; Jenkins, A.; Kidson, C.

    1976-01-01

    Repair of ultraviolet radiation damage was examined in an extremely radioresistant organism, Micrococcus radiophilus. Measurement of the number of thymine-containing dimers formed as a function of ultraviolet dose suggests that the ability of this organism to withstand high doses of ultraviolet radiation (20,000 ergs/mm 2 ) is not related to protective screening by pigments. M. radiophilus carries out a rapid excision of thymine dimers at doses of ultraviolet light up to 10,000 ergs/mm 2 . Synthesis of deoxyribonucleic acid is reduced after irradiation, but after removal of photodamage the rate approaches that in unirradiated cells. A comparison is drawn with Micrococcus luteus and M. radiodurans. We conclude that the extremely high resistance to ultraviolet irradiation in M. radiophilus is at least partly due to the presence of an efficient excision repair system

  8. ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1

    Science.gov (United States)

    Perry, Jerome J.; Evans, James B.

    1961-01-01

    Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577

  9. Excision repair of 5,6-dihydroxydihydrothymine from the DNA of Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Targovnik, H.S.; Hariharan, P.V.

    1980-01-01

    One of the major ionizing radiation products, 5,6-dihydroxydihydrothymine (thymine glycol), was measured in the DNA of Micrococcus radiodurans following exposure of cells to 6.8-MeV electrons or 254-nm ultraviolet light. Removal of 5,6-dihydroxydihydrothymine was measured in both an ionizing radiation-sensitive strain (262) and a highly radioresistant strain (the wild type W + ) of Micrococcus radiodurans. Within 30 min of incubation (33 0 C) following exposure to ultraviolet light (2400 J/m 2 ) approximately 60% of the thymine glycols were excised, whereas in the case of ionizing radiation (250 krad) only 35% were removed from the cellular DNA of the wild-type strain. In contrast less than 50% of the thymine glycols were excised from the sensitive strain. The amount of DNA degradation induced by radiation was less than 10% in both strains. The results suggest a possible correlation between reduced excision repair of base damage and increased radiation sensitivity

  10. Response of membrane-bound ATPase of Micrococcus luteus to heat and ultraviolet light

    International Nuclear Information System (INIS)

    Volotovskij, J.; Risi, S.; Dose, K.

    1976-01-01

    It is shown that the properties of ATPase (EC 3.6.1.3) of Micrococcus luteus depend only to some extent on the state of the membrane to which it is attached. Its interaction with the membrane appears to be largely controlled by polar forces. It is shown, however, that the UV-sensitivity of the membrane-bound ATPase is also significantly influenced by the state of membrane lipids. (orig.) [de

  11. Effects of combined exposure of Micrococcus luteus to nisin and pulsed electric fields

    NARCIS (Netherlands)

    Dutreux, N.; Notermans, S.; Góngora-Nieto, M.M.; Barbosa-Cánovas, G.V.; Swanson, B.G.

    2000-01-01

    Death and injury following exposure of Micrococcus luteus to nisin and pulsed electric field (PEF) treatment were investigated in phosphate buffer (pH 6.8, σ = 4.8 ms/cm at 20°C). Four types of experiment were carried out, a single treatment with nisin (100 IU/ml at 20°C for 2 h), a single PEF

  12. Response of membrane-bound ATPase of Micrococcus luteus to heat and ultraviolet light

    Energy Technology Data Exchange (ETDEWEB)

    Volotovskii, J; Risi, S; Dose, K [Mainz Univ. (F.R. Germany). Inst. fuer Biochemie

    1976-03-01

    It is shown that the properties of ATPase (EC 3.6.1.3) of Micrococcus luteus depend only to some extent on the state of the membrane to which it is attached. Its interaction with the membrane appears to be largely controlled by polar forces. It is shown, however, that the UV-sensitivity of the membrane-bound ATPase is also significantly influenced by the state of membrane lipids.

  13. Evaluation of autochthonous micrococcus strains as starter cultures for the production of Kedong sufu.

    Science.gov (United States)

    Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X

    2016-03-01

    The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.

  14. Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.

    Science.gov (United States)

    Kiliç, Nur Koçberber; Dönmez, Gönül

    2008-06-15

    Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

  15. Optimization of Cellulase and Xylanase Production by Micrococcus Species under Submerged Fermentation

    Directory of Open Access Journals (Sweden)

    Ziyanda Mmango-Kaseke

    2016-11-01

    Full Text Available This paper reports on the optimization of culture conditions for cellulase and xylanase production by bacterial isolate from lignocellulosic biomass. The bacterial isolate was screened for cellulase and xylanase production on carboxyl methyl cellulose (CMC and birch wood xylan as substrates, respectively. One bacterial isolate showing the highest halo zone diameter (isolate PLY1 was selected for detailed studies. The analysis of the 16S ribosomal ribonucleic acid (rRNA gene nucleotide sequence of PLY1 revealed it to have 98% similarity to Micrococcus luteus strain Fse9 and the sequence was deposited in the GenBank as Micrococcus luteus strain SAMRC-UFH3 with accession number KU171371. Cellulase production was achieved in the presence of CMC (1% w/v under an incubation temperature of 25 °C (198 U/mL, pH 5 (173 U/mL, agitation speed 50 rpm (173 U/mL and incubation period of 96 h (102 U/mL. Xylanase was produced maximally when birch wood xylan (1% w/v was used as the substrate at 25 °C (1007 U/mL, pH 10 (2487 U/mL, 200 rpm (1814 U/mL, and under an incubation period of 84 h (1296 U/mL. Our findings showed that Micrococcus sp. SAMRC-UFH3 appears to be a potentially important candidate for lignocellulosic waste degradation and other relevant industrial applications.

  16. Lactococcus lactis - a diploid bacterium

    DEFF Research Database (Denmark)

    Michelsen, Ole; Hansen, Flemming G.; Jensen, Peter Ruhdal

    the next division. Thus, the regions of the chromosome that are the last to be replicated are haploid even in fast-growing bacteria. In contrast to this general rule for bacteria, we found that Lactococcus lactis, a bacterium which has been exploited for thousands of years for the production of fermented...... milk products, is born with two complete non-replicating chromosomes. L. lactis therefore remain diploid throughout its entire life cycle....

  17. Evaluation of enhanced thermostability and operational stability of carbonic anhydrase from Micrococcus species.

    Science.gov (United States)

    Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana

    2013-06-01

    Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.

  18. Draft genome sequence of Micrococcus luteus strain O'Kane implicates metabolic versatility and the potential to degrade polyhydroxybutyrates.

    Science.gov (United States)

    Hanafy, Radwa A; Couger, M B; Baker, Kristina; Murphy, Chelsea; O'Kane, Shannon D; Budd, Connie; French, Donald P; Hoff, Wouter D; Youssef, Noha

    2016-09-01

    Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.

  19. Draft genome sequence of Micrococcus luteus strain O'Kane implicates metabolic versatility and the potential to degrade polyhydroxybutyrates

    Directory of Open Access Journals (Sweden)

    Radwa A. Hanafy

    2016-09-01

    Full Text Available Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.

  20. Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango.

    Science.gov (United States)

    Rakhashiya, Purvi M; Patel, Pooja P; Thaker, Vrinda S

    2015-12-01

    Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000.

  1. Genetic control over the processes of postirradiation recovery of a compact chromosome in micrococcus radiodurans

    International Nuclear Information System (INIS)

    Kudryashova, N.Yu.; Groshev, V.V.; Shestakov, S.V.

    1984-01-01

    X-irradiation of Micrococcus radiodurans cells with sublethal doses caused disturbances in the structure of a membrane-bound compact chromosome. Recovery of the compact chromosome occurred during the postirradiation incubation of the wild type cells and cells of the UVS-17 mutant deficient in DNA-polymerase. This process was blocked in cells of rec-30 mutant with the impaired system of genetic recombination: this is indicative of an important role played by rec-30 gene product in the postirradiation recovery of the compact chromosome in M. radiodurans cells

  2. Origin of cell surface proteins released from Micrococcus radiodurans by ionizing radiation

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.

    1975-01-01

    The exposure of Micrococcus radiodurans to sublethal doses of ionizing radiation causes the release of certain proteins into the surrounding medium. As estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, these proteins range from approximately 20,000 to 125,000 daltons. At least some of the proteins, including an exonuclease, have a surface location and appear to originate from the lipid-rich midwall layer. The exonuclease has two functionally distinct locations, one with its active site available to external substrate and a second with the active site masked from the exterior. Ionizing radiation releases both the masked and unmasked activity into the surrounding medium

  3. The roles of different repair mechanisms in the ultraviolet resistance of Micrococcus luteus

    International Nuclear Information System (INIS)

    Zherebtsov, S.V.; Tomilin, N.V.

    1982-01-01

    In ultraviolet-irradiated Micrococcus luteus wild type the replication of DNA was not interrupted at every pyrimidine dimer, in contrast to that in ultraviolet-sensitive G7 and some other mutants. The contribution of uninterrupted replication to the ultraviolet resistance of M. luteus proved to be equal to the contributions of excision repair and inducible postreplication repair. It was found that some postreplication gaps could be filled by constitutive pathways of postreplication repair when inducible pathways were suppressed by chloramphenicol. Prolonged treatment with chloramphenicol was shown to block not only inducible repair but also other processes essential for ultraviolet irradiation survival. (Auth.)

  4. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  5. Substrate specificity of Micrococcus luteus uv endonuclease and its overlap with DNA photolyase activity

    International Nuclear Information System (INIS)

    Patrick, M.H.

    1975-01-01

    The action of an endonuclease from Micrococcus luteus that operates on uv damage in DNA overlaps with that of DNA photolyase from yeast: homo- and heterocyclobutane dipyrimidines in DNA are substrates for both enzymes, but pyrimidine adducts or the spore photoproduct in DNA are not. As expected from this overlap, the action of the two enzymes is mutually interfering: single-strand nicks introduced by the endonuclease effectively preclude photoreactivation; conversely, formation of a photolyase-cyclobutane dipyrimidine complex can prevent nicking by the endonuclease

  6. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  7. Biohydrogen Production by the Thermophilic Bacterium Caldicellulosiruptor saccharolyticus: Current Status and Perspectives

    Directory of Open Access Journals (Sweden)

    Servé W. M. Kengen

    2013-01-01

    Full Text Available Caldicellulosiruptor saccharolyticus is one of the most thermophilic cellulolytic organisms known to date. This Gram-positive anaerobic bacterium ferments a broad spectrum of mono-, di- and polysaccharides to mainly acetate, CO2 and hydrogen. With hydrogen yields approaching the theoretical limit for dark fermentation of 4 mol hydrogen per mol hexose, this organism has proven itself to be an excellent candidate for biological hydrogen production. This review provides an overview of the research on C. saccharolyticus with respect to the hydrolytic capability, sugar metabolism, hydrogen formation, mechanisms involved in hydrogen inhibition, and the regulation of the redox and carbon metabolism. Analysis of currently available fermentation data reveal decreased hydrogen yields under non-ideal cultivation conditions, which are mainly associated with the accumulation of hydrogen in the liquid phase. Thermodynamic considerations concerning the reactions involved in hydrogen formation are discussed with respect to the dissolved hydrogen concentration. Novel cultivation data demonstrate the sensitivity of C. saccharolyticus to increased hydrogen levels regarding substrate load and nitrogen limitation. In addition, special attention is given to the rhamnose metabolism, which represents an unusual type of redox balancing. Finally, several approaches are suggested to improve biohydrogen production by C. saccharolyticus.

  8. Gracilibacillus aidingensis sp. nov., a novel moderately halophilic bacterium isolated from Aiding salt lake.

    Science.gov (United States)

    Guan, Tong-Wei; Tian, Lei; Li, En-Yuan; Tang, Shu-Kun; Zhang, Xiao-Ping

    2017-11-01

    A novel Gram-positive, aerobe, moderately halophilic bacterium was isolated from saline soil of Aiding lake in Xinjiang, north-west of China, designated strain YIM 98001 T . Cells were rod-shaped, motile and grew at 5-20% (w/v) NaCl (optimum 10%), pH 6-10 (optimum pH 7.0) and 4-45 °C (optimum 37 °C). The major cellular fatty acids were anteiso C 15:0 , anteiso C 17:0 , iso C 15:0 . The predominant respiratory quinone was MK-7. Diphosphatidylglycerol, phosphatidylglycerol, phosphoglycolipid were the major polar lipids. Meso-diaminopimelic acid was the diagnostic diamino acid of the cell-wall peptidoglycan. The G+C content was 36.46 mol%. 16S rRNA gene sequence analysis showed that the strain belongs to the family Bacillaceae, with the highest sequence similarity to the type strain Gracilibacillus thailandensis TP2-8 T (96.84%), followed by Gracilibacillus saliphilus YIM 91119 T (96.78%) and Gracilibacillus ureilyticus MF38 T (96.57%), thus confirming the affiliation of strain YIM 98001 T to the genus Gracilibacillus. The polyphasic approach indicates that strain YIM 98001 T represents a novel species of the genus Gracilibacillus, for which the name Gracilibacillus aidingensis is proposed. The type strain is YIM 98001 T (=KCTC 42683 T  = DSMZ 104330 T ).

  9. Encapsulated in silica: genome, proteome and physiology of the thermophilic bacterium Anoxybacillus flavithermus

    Energy Technology Data Exchange (ETDEWEB)

    Saw, Jimmy H [Los Alamos National Laboratory; Mountain, Bruce W [NEW ZEALAND; Feng, Lu [NANKAI UNIV; Omelchenko, Marina V [NCBI/NLM/NIH; Hou, Shaobin [UNIV OF HAWAII; Saito, Jennifer A [UNIV OF HAWAII; Stott, Matthew B [NEW ZEALAND; Li, Dan [NANKAI UNIV; Zhao, Guang [NANKAI UNIV; Wu, Junli [NANKAI UNIV; Galperin, Michael Y [NCBI/NLM/NIH; Koonin, Eugene V [NCBI/NLM/NIH; Makarova, Kira S [NCBI/NLM/NIH; Wolf, Yuri I [NCBI/NLM/NIH; Rigden, Daniel J [UNIV OF LIVERPOOL; Dunfield, Peter F [UNIV OF CALGARY; Wang, Lei [NANKAI UNIV; Alam, Maqsudul [UNIV OF HAWAII

    2008-01-01

    Gram-positive bacteria of the genus Anoxybacillus have been found in diverse thermophilic habitats, such as geothermal hot springs and manure, and in processed foods such as gelatin and milk powder. Anoxybacillus flavithermus is a facultatively anaerobic bacterium found in super-saturated silica solutions and in opaline silica sinter. The ability of A. flavithermus to grow in super-saturated silica solutions makes it an ideal subject to study the processes of sinter formation, which might be similar to the biomineralization processes that occurred at the dawn of life. We report here the complete genome sequence of A. flavithermus strain WK1, isolated from the waste water drain at the Wairakei geothermal power station in New Zealand. It consists of a single chromosome of 2,846,746 base pairs and is predicted to encode 2,863 proteins. In silico genome analysis identified several enzymes that could be involved in silica adaptation and biofilm formation, and their predicted functions were experimentally validated in vitro. Proteomic analysis confirmed the regulation of biofilm-related proteins and crucial enzymes for the synthesis of long-chain polyamines as constituents of silica nanospheres. Microbial fossils preserved in silica and silica sinters are excellent objects for studying ancient life, a new paleobiological frontier. An integrated analysis of the A. flavithermus genome and proteome provides the first glimpse of metabolic adaptation during silicification and sinter formation. Comparative genome analysis suggests an extensive gene loss in the Anoxybacillus/Geobacillus branch after its divergence from other bacilli.

  10. Morphological characterization of several strains of the rice-pathogenic bacterium Burkholderia glumae in North Sumatra

    Science.gov (United States)

    Hasibuan, M.; Safni, I.; Lisnawita; Lubis, K.

    2018-02-01

    Burkholderia glumae is a quarantine seed-borne bacterial pathogen causing panicle blight disease on rice. This pathogen has been detected in some locations in Java, and recently, farmers in North Sumatra have reported rice yield loss with symptoms similar with those on rice infeced by the rice-pathogenic bacterium B. glumae. This research was aimed to isolate several bacterial strains from several rice varieties in various locations in North Sumatra and characterize the morphology of the strains to detect and identify the unknown bacterial strains presumably B. glumae. Several rice seed varieties were collected from Medan and Deli Serdang Districts. The seed samples were extracted, isolated and purified, then grown in semi-selective media PPGA. The morphological characteristics of the bacterial strains were determined including Gram staining, bacterial colony’s and bacterial cell’s morphology. The results showed that of eleven strains isolated, two strains were Gram negative and nine strains were Gram positive. On the basis of colony morphology, all strains had circular form, flat elevation and cream colour while the colony margin varied, i.e. entire and undulate. Most strains had bacillus/rod shape (8 strains) and only 3 strains were coccus.

  11. Molecular identification of phosphate solubilizing bacterium ...

    African Journals Online (AJOL)

    A phosphate solubilizing bacterium was isolated from the rhizosphere soil of upland rice and identified by 16S rRNA gene sequencing. The gene sequence showed 99% homology with Alcaligenes faecalis. Based on the gene sequence homology, it was identified as A. faecalis. Interaction effect of this bacterium on growth ...

  12. A novel marine bacterium Isoptericola sp. JS-C42 with the ability to saccharifying the plant biomasses for the aid in cellulosic ethanol production.

    Science.gov (United States)

    Santhi, Velayudhan Satheeja; Gupta, Ashutosh; Saranya, Somasundaram; Jebakumar, Solomon Robinson David

    2014-06-01

    The ever growing demands for food products such as starch and sugar produces; there is a need to find the sources for saccharification for cellulosic bioethanol production. This study provides the first evidence of the lignocellulolytic and saccharifying ability of a marine bacterium namely Isoptericola sp. JS-C42, a Gram positive actinobacterium with the cocci cells embedded on mycelia isolated from the Arabian Sea, India. It exhibited highest filter paper unit effect, endoglucanase, exoglucanase, cellobiohydrolase, β-glucosidase, xylanase and ligninase effect. The hydrolytic potential of the enzymes displayed the efficient saccharification capability of steam pretreated biomass. It was also found to degrade the paddy, sorghum, Acacia mangium and Ficus religiosa into simple reducing sugars by its efficient lignocellulose enzyme complex with limited consumption of sugars. Production of ethanol was also achieved with the Saccharomyces cerevisiae . Overall, it offers a great potential for the cellulosic ethanol production in an economically reliable and eco-friendly point-of-care.

  13. Carboxydobrachium pacificum gen. nov., sp. nov., a new anaerobic, thermophilic, CO-utilizing marine bacterium from Okinawa Trough.

    Science.gov (United States)

    Sokolova, T G; González, J M; Kostrikina, N A; Chernyh, N A; Tourova, T P; Kato, C; Bonch-Osmolovskaya, E A; Robb, F T

    2001-01-01

    A new anaerobic, thermophilic, CO-utilizing marine bacterium, strain JMT, was isolated from a submarine hot vent in Okinawa Trough. Cells of strain JMT were non-motile thin straight rods, sometimes branching, with a cell wall of the Gram-positive type, surrounded with an S-layer. Chains of three to five cells were often observed. The isolate grew chemolithotrophically on CO, producing equimolar quantities of H2 and CO2 (according to the equation CO+H2O-->CO2+H2) and organotrophically on peptone, yeast extract, starch, cellobiose, glucose, galactose, fructose and pyruvate, producing H2, acetate and CO2. Growth was observed from 50 to 80 degrees C with an optimum at 70 degrees C. The optimum pH was 6.8-7.1. The optimum concentration of sea salts in the medium was 20.5-25.5 g l(-1). The generation time under optimal conditions was 7.1 h. The DNA G+C content was 33 mol %. Growth of isolate JMT was not inhibited by penicillin, but ampicillin, streptomycin, kanamycin and neomycin completely inhibited growth. The results of 16S rDNA sequence analysis revealed that strain JMT belongs to the Thermoanaerobacter phylogenetic group within the Bacillus-Clostridium subphylum of Gram-positive bacteria but represents a separate branch of this group. On the basis of morphological and physiological features and phylogenetic data, this isolate should be assigned to a new genus, for which the name Carboxydobrachium is proposed. The type species is Carboxydobrachium pacificum; the type strain is JMT (= DSM 12653T).

  14. Over a Decade of recA and tly Gene Sequence Typing of the Skin Bacterium Propionibacterium acnes: What Have We Learnt?

    Directory of Open Access Journals (Sweden)

    Andrew McDowell

    2017-12-01

    Full Text Available The Gram-positive, anaerobic bacterium Propionibacterium acnes forms part of the normal microbiota on human skin and mucosal surfaces. While normally associated with skin health, P. acnes is also an opportunistic pathogen linked with a range of human infections and clinical conditions. Over the last decade, our knowledge of the intraspecies phylogenetics and taxonomy of this bacterium has increased tremendously due to the introduction of DNA typing schemes based on single and multiple gene loci, as well as whole genomes. Furthermore, this work has led to the identification of specific lineages associated with skin health and human disease. In this review we will look back at the introduction of DNA sequence typing of P. acnes based on recA and tly loci, and then describe how these methods provided a basic understanding of the population genetic structure of the bacterium, and even helped characterize the grapevine-associated lineage of P. acnes, known as P. acnes type Zappe, which appears to have undergone a host switch from humans-to-plants. Particular limitations of recA and tly sequence typing will also be presented, as well as a detailed discussion of more recent, higher resolution, DNA-based methods to type P. acnes and investigate its evolutionary history in greater detail.

  15. Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1.

    Science.gov (United States)

    Mulla, Sikandar I; Talwar, Manjunatha P; Bagewadi, Zabin K; Hoskeri, Robertcyril S; Ninnekar, Harichandra Z

    2013-02-01

    Nitrotoluenes are the toxic pollutants of the environment because of their large scale use in the production of explosives. Biodegradation of such chemicals by microorganisms may provide an effective method for their detoxification. We have studied the degradation of 2-nitrotoluene by cells of Micrococcus sp. strain SMN-1 immobilized in various matrices such as polyurethane foam (PUF), sodium alginate (SA), sodium alginate-polyvinyl alcohol (SA-PVA), agar and polyacrylamide. The rate of degradation of 15 and 30 mM 2-nitrotoluene by freely suspended cells and immobilized cells in batches and fed-batch with shaken cultures were compared. The PUF-immobilized cells achieved higher degradation of 15 and 30 mM 2-nitrotoluene than freely suspended cells and the cells immobilized in SA-PVA, polyacrylamide, SA and agar. The PUF-immobilized cells could be reused more than 24 cycles without loosing their degradation capacity and showed more tolerance to pH and temperature changes than freely suspended cells. These results revealed the enhanced rate of degradation of 2-nitrotoluene by PUF-immobilized cells of Micrococcus sp. strain SMN-1. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. The growth of Micrococcus varians by utilizing sugar cane blackstrap molasses as substrate

    Directory of Open Access Journals (Sweden)

    Miranda Luís A. S.

    1999-01-01

    Full Text Available Comparative studies on the growth of Micrococcus varians were carried out in BHI culture medium (control as well as in a culture medium with 2% diluted sugar cane blackstrap molasses, enriched with 0.1% yeast extract. The experiment was conducted with three samples of the experimental and control media in a 5 liter fermentor with working volume of 3.5 liters, continuous agitation (150 rpm, 35 ± 0.1°C temperature, 0.7 L air. l-1 medium. min -1, initial pH 7.0 ± 0.2, 24 hour fermentation period, and approximate inoculum of 6.0 log10 CFU/ml. Samples were collected at 2-hour intervals. Micrococcus varians grew in the two culture media studied, which confirms the experimental medium viability for the growth of this species. The final average concentration of biomass was higher in the control medium than in the experimental medium: 0.99 g.l-1 and 0.78 g.l-1, respectively. The final number of viable cells at the end of fermentation was 20.65 log10 CFU/ml for the control medium (BHI, while in the experimental medium the number of viable cells was 19.43 log10 CFU/ml. The consumption of total sugars was higher for the biomass in the control medium (79.78%, while only 50.53% was consumed for the experimental medium.

  17. [Occurrence of bacteria in the mouth from genera of Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus].

    Science.gov (United States)

    Szczerba, Izabela; Krzemiński, Zbigniew

    2002-01-01

    The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.

  18. Thermincola carboxydiphila gen. nov., sp. nov., a novel anaerobic, carboxydotrophic, hydrogenogenic bacterium from a hot spring of the Lake Baikal area.

    Science.gov (United States)

    Sokolova, Tatyana G; Kostrikina, Nadezhda A; Chernyh, Nikolai A; Kolganova, Tatjana V; Tourova, Tatjana P; Bonch-Osmolovskaya, Elizaveta A

    2005-09-01

    A novel anaerobic, thermophilic, alkalitolerant bacterium, strain 2204(T), was isolated from a hot spring of the Baikal Lake region. The cells of strain 2204(T) were straight rods of variable length, Gram-positive with an S-layer, motile with one to two lateral flagella, and often formed aggregates of 3-15 cells. The isolate was shown to be an obligate anaerobe oxidizing CO and producing equimolar quantities of H(2) and CO(2) according to the equation CO+H(2)O-->CO(2)+H(2). No organic substrates were used as energy sources. For lithotrophic growth on CO, 0.2 g acetate or yeast extract l(-1) was required but did not support growth in the absence of CO. Growth was observed in the temperature range 37-68 degrees C, the optimum being 55 degrees C. The pH range for growth was 6.7-9.5, the optimum pH being 8.0. The generation time under optimal conditions was 1.3 h. The DNA G+C content was 45 mol%. Penicillin, erythromycin, streptomycin, rifampicin, vancomycin and tetracycline completely inhibited both growth and CO utilization by strain 2204(T). Thus, isolate 2204(T) was found to be the first known moderately thermophilic and alkalitolerant H(2)-producing anaerobic carboxydotroph. The novel bacterium fell within the cluster of the family Peptococcaceae within the low-G+C-content Gram-positive bacteria, where it formed a separate branch. On the basis of morphological, physiological and phylogenetic features, strain 2204(T) should be assigned to a novel genus and species, for which the name Thermincola carboxydiphila gen. nov., sp. nov. is proposed. The type strain is strain 2204(T) (=DSM 17129(T)=VKM B-2283(T)=JCM 13258(T)).

  19. Application of halophilic nuclease H of Micrococcus varians subsp. halophilus to commercial production of flavoring agent 5'-GMP.

    Science.gov (United States)

    Kamekura, M; Hamakawa, T; Onishi, H

    1982-01-01

    RNA was degraded at 60 degrees C for 24 h by halophilic nuclease H in supernatants from broth cultures of Micrococcus varians subsp. halophilus containing 12% NaCl. Since contaminating 5'-nucleotidase exhibited almost no activity under these conditions, the 5'-GMP formed could be recovered from the reaction mixture, and the yield was 805 mg from 5 g of RNA. PMID:6184020

  20. Rescue of Mitomycin C- or Psoralen-Inactivated Micrococcus Radiodurans by Additional Exposure to Radiation or Alkylating Agents

    DEFF Research Database (Denmark)

    Hansen, M. Trier

    1982-01-01

    The processing of damaged DNA was altered in a mitomycin C-sensitive mutant (mtcA) of Micrococcus radiodurans. Even though the mutant retained resistance to 254-nm UV radiation, it did not, in contrast to the wild-type strain, show any excessive DNA degradation or cell death when incubated...

  1. Sporosalibacterium faouarense gen. nov., sp. nov., a moderately halophilic bacterium isolated from oil-contaminated soil.

    Science.gov (United States)

    Rezgui, Raja; Ben Ali Gam, Zouhaier; Ben Hamed, Said; Fardeau, Marie-Laure; Cayol, Jean-Luc; Maaroufi, Abderrazak; Labat, Marc

    2011-01-01

    A novel strictly anaerobic, moderately halophilic and mesophilic bacterium, designated strain SOL3f37(T), was isolated from a hydrocarbon-polluted soil surrounding a deep petroleum environment located in south Tunisia. Cells of strain SOL3f37(T) stained Gram-positive and were motile, straight and spore-forming. Strain SOL3f37(T) had a typical Gram-positive-type cell-wall structure, unlike the thick, multilayered cell wall of its closest relative Clostridiisalibacter paucivorans. The major fatty acids were iso-C(15 : 0) (41 %), iso-C(14 : 0) 3-OH and/or iso-C(15 : 0) dimethyl acetal (21.6 %), iso-C(13 : 0) (4.4 %), anteiso-C(15 : 0) (3.9 %) and iso-C(15 : 1) (2.8 %). Strain SOL3f37(T) grew between 20 and 48 °C (optimum 40 °C) and at pH 6.2-8.1 (optimum pH 6.9). Strain SOL3f37(T) required at least 0.5 NaCl l(-1) and grew in the presence of NaCl concentrations up to 150 g l(-1) (optimum 40 g l(-1)). Yeast extract (2 g l(-1)) was required for degradation of pyruvate, fumarate, fructose, glucose and mannitol. Also, strain SOL3f37(T) grew heterotrophically on yeast extract, peptone and bio-Trypticase, but was unable to grow on Casamino acids. Sulfate, thiosulfate, sulfite, elemental sulfur, fumarate, nitrate and nitrite were not reduced. The DNA G+C content was 30.7 mol%. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain SOL3f37(T) was a member of the family Clostridiaceae in the order Clostridiales; strain SOL3f37(T) was related to members of various genera of the family Clostridiaceae. It exhibited highest 16S rRNA gene sequence similarity (93.4 %) with Clostridiisalibacter paucivorans 37HS60(T), 91.8 % with Thermohalobacter berrensis CTT3(T) and 91.7 % with Caloranaerobacter azorensis MV1087(T). On the basis of genotypic, phenotypic and phylogenetic data, it is suggested that strain SOL3f37(T) represents a novel species in a new genus. The name Sporosalibacterium faouarense gen. nov., sp. nov. is

  2. Role of manganese in the resistance of Micrococcus radiodurans to ionizing radiation

    International Nuclear Information System (INIS)

    Wierowski, J.V.

    1980-01-01

    Micrococcus radiodurans possesses a very high level of intracellular manganese compared to other organisms. This manganese content has previously been shown to participate in the exceptional ulraviolet radiation resistance of M. radiodurans. This study was undertaken to determine the role of manganese in the ionizing radiation resistant of M. radiodurans. The results indicate that manganese is essential for DNA degradation to occur during irradiation. Manganese has also proven essential for the second phase of post-irradiation thymine base damage removal. These factors work together to increase the rate of recovery from radiation damage, which is reflected in a larger Dq, D 37 and exponential portion of the survival curve of high Mn-grown cells

  3. Micrococcus luteus correndonucleases. II. Mechanism of action of two endonucleases specific for DNA containing pyrimidine dimers

    International Nuclear Information System (INIS)

    Riazuddin, S.; Grossman, L.

    1977-01-01

    Py--Py correndonucleases I and II from Micrococcus luteus act exclusively on thymine-thymine, cytosine-cytosine, and thymine-cytosine cyclobutyl dimers in DNA, catalyzing incision 5' to the damage and generating 3'-hydroxyl and 5'-phosphoryl termini. Both enzymes initiate excision of pyrimidine dimers in vitro by correxonucleases and DNA polymerase I. The respective incised DNAs, however, differ in their ability to act as substrate for phage T4 polynucleotide ligase or bacterial alkaline phosphatase, suggesting that each endonuclease is specific for a conformationally unique site. The possibility that their respective action generates termini which represent different degrees of single strandedness is suggested by the unequal protection by Escherichia coli binding protein from the hydrolytic action of exonuclease VII

  4. New antibacterial xanthone from the marine sponge-derived Micrococcus sp. EG45.

    Science.gov (United States)

    Eltamany, Enas E; Abdelmohsen, Usama Ramadan; Ibrahim, Amany K; Hassanean, Hashim A; Hentschel, Ute; Ahmed, Safwat A

    2014-11-01

    Microluside A [4 (19-para-hydroxy benzoyloxy-O-β-D-cellobiosyl), 5 (30-para-hydroxy benzoyloxy-O-β-D-glucopyranosyl) xanthone (1)] is a unique O-glycosylated disubstituted xanthone isolated from the broth culture of Micrococcus sp. EG45 cultivated from the Red Sea sponge Spheciospongia vagabunda. The structure of microluside A was determined by 1D- and 2D-NMR techniques as well as high resolution tandem mass spectrometry. The antimicrobial activity evaluation showed that 1 exhibited antibacterial potential against Enterococcus faecalis JH212 and Staphylococcus aureus NCTC 8325 with MIC values of 10 and 13 μM, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. [Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].

    Science.gov (United States)

    Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen

    2015-06-01

    To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).

  6. Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.

    Science.gov (United States)

    Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang

    2010-08-01

    Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is

  7. Physicochemical properties and membrane biofouling of extra-cellular polysaccharide produced by a Micrococcus luteus strain.

    Science.gov (United States)

    Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

    2014-07-01

    The physicochemical properties of the extra-cellular polysaccharide (EPS) produced by a Micrococcus luteus strain, a dominating strain isolated from membrane biofouling layer, were determined in this study. The EPS isolated from this strain was measured to have an average molecular weight of 63,540 Da and some typical polysaccharide absorption peaks in Fourier transform infrared spectrum. Monosaccharide components of the EPS contained rhamnose, fucose, arabinose, xylose, mannose, galactose and glucose in a molar ratio of 0.2074:0.0454:0.0262:0.0446:1.7942:1.2086:0.4578. Pseudo plastic properties were also observed for the EPS through the rheological measurement. The EPS was further characterized for its behavior to cause membrane flux decline. The results showed that both flux declines for polyvinylidenefluoride (PVDF) and polypropylene membranes became more severe as EPS feed concentration increased. A higher irreversible fouling for the PVDF membrane suggested that the EPS had the larger fouling potential to this microfiltration membrane.

  8. Effect of Nisin's Controlled Release on Microbial Growth as Modeled for Micrococcus luteus.

    Science.gov (United States)

    Balasubramanian, Aishwarya; Lee, Dong Sun; Chikindas, Michael L; Yam, Kit L

    2011-06-01

    The need for safe food products has motivated food scientists and industry to find novel technologies for antimicrobial delivery for improving food safety and quality. Controlled release packaging is a novel technology that uses the package to deliver antimicrobials in a controlled manner and sustain antimicrobial stress on the targeted microorganism over the required shelf life. This work studied the effect of controlled release of nisin to inhibit growth of Micrococcus luteus (a model microorganism) using a computerized syringe pump system to mimic the release of nisin from packaging films which was characterized by an initially fast rate and a slower rate as time progressed. The results show that controlled release of nisin was strikingly more effective than instantly added ("formulated") nisin. While instant addition experiments achieved microbial inhibition only at the beginning, controlled release experiments achieved complete microbial inhibition for a longer time, even when as little as 15% of the amount of nisin was used as compared to instant addition.

  9. Highly efficient decolorization of Malachite Green by a novel Micrococcus sp. strain BD15.

    Science.gov (United States)

    Du, Lin-Na; Zhao, Ming; Li, Gang; Zhao, Xiao-Ping; Zhao, Yu-Hua

    2011-08-01

    Malachite Green (MG) is used for a variety of applications but is also known to be carcinogenic and mutagenic. In this study, a novel Micrococcus sp. (strain BD15) was observed to efficiently decolorize MG. The purposes of this study were to explore the optimal conditions for decolorization and to evaluate the potential use of this strain for MG decolorization. Optical microscope and UV-visible analyses were carried out to determine whether the decolorization was due to biosorption or biodegradation. A Plackett-Burman design was employed to investigate the effect of various parameters on decolorization, and response surface methodology was then used to explore the optimal decolorization conditions. Kinetics analysis and antimicrobial activity tests were also performed. The results indicated that the decolorization by the strain was mainly due to biodegradation. Concentrations of MG, urea, and yeast extract and inoculum size had significantly positive effects on MG decolorization, while concentrations of CuCl(2) and MgCl(2), and temperature had significantly negative effects. The interaction between different parameters could significantly affect decolorization, and the optimal conditions for decolorization were 1.0 g/L urea, 0.9 g/L yeast extract, 100 mg/L MG, 0.1 g/L inoculums (dry weight), and incubation at 25.2°C. Under the optimal conditions, 96.9% of MG was removed by the strain within 1 h, which represents highly efficient microbial decolorization. Moreover, the kinetic data for decolorization fit a second-order model well, and the strain showed a good MG detoxification capability. Based on the results of this study, we propose Micrococcus sp. strain BD15 as an excellent candidate strain for MG removal from wastewater.

  10. A Phase 3, Randomized, Double-Blind, Multicenter Study To Evaluate the Safety and Efficacy of Intravenous Iclaprim versus Vancomycin for Treatment of Acute Bacterial Skin and Skin Structure Infections Suspected or Confirmed To Be Due to Gram-Positive Pathogens (REVIVE-2 Study).

    Science.gov (United States)

    Holland, Thomas L; O'Riordan, William; McManus, Alison; Shin, Elliot; Borghei, Ali; File, Thomas M; Wilcox, Mark H; Torres, Antoni; Dryden, Matthew; Lodise, Thomas; Oguri, Toyoko; Corey, G Ralph; McLeroth, Patrick; Shukla, Rajesh; Huang, David B

    2018-05-01

    Iclaprim is a novel diaminopyrimidine antibiotic that may be an effective and safe treatment for serious skin infections. The safety and effectiveness of iclaprim were assessed in a global phase 3, double-blind, randomized, active-controlled trial. Six hundred thirteen adults with acute bacterial skin and skin structure infections (ABSSSIs) suspected or confirmed to be due to Gram-positive pathogens were randomized to iclaprim (80 mg) or vancomycin (15 mg/kg of body weight), both of which were administered intravenously every 12 h for 5 to 14 days. The primary endpoint was a ≥20% reduction in lesion size compared with that at the baseline at 48 to 72 h after the start of administration of study drug in the intent-to-treat population. Among patients randomized to iclaprim, 78.3% (231 of 295) met this primary endpoint, whereas 76.7% (234 of 305) of those receiving vancomycin met this primary endpoint (difference, 1.58%; 95% confidence interval, -5.10% to 8.26%). This met the prespecified 10% noninferiority margin. Iclaprim was well tolerated, with most adverse events being categorized as mild. In conclusion, iclaprim was noninferior to vancomycin in this phase 3 clinical trial for the treatment of acute bacterial skin and skin structure infections. On the basis of these results, iclaprim may be an efficacious and safe treatment for skin infections suspected or confirmed to be due to Gram-positive pathogens. (This trial has been registered at ClinicalTrials.gov under identifier NCT02607618.). Copyright © 2018 American Society for Microbiology.

  11. Hydrogenomics of the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus

    NARCIS (Netherlands)

    Werken, van de H.J.G.; Verhaart, M.R.A.; Vanfossen, A.L.; Willquist, K.; Lewis, D.L.; Nichols, J.D.; Goorissen, H.P.; Mongodin, E.F.; Nelson, K.E.; Niel, van E.W.J.; Stams, A.J.M.; Ward, D.E.; Vos, de W.M.; Oost, van der J.; Kelly, R.M.; Kengen, S.W.M.

    2008-01-01

    Caldicellulosiruptor saccharolyticus is an extremely thermophilic, gram-positive anaerobe which ferments cellulose-, hemicellulose- and pectin-containing biomass to acetate, CO(2), and hydrogen. Its broad substrate range, high hydrogen-producing capacity, and ability to coutilize glucose and xylose

  12. A probiotic bacterium, Pediococcus pentosaceus OZF, isolated from ...

    African Journals Online (AJOL)

    Pediococcus pentosaceus OZF, originally isolated from healthy human breast milk, produces antimicrobial activities against many gram-positive bacterial species, including the food borne pathogen, Listeria monocytogenes. A bacteriocin was purified to homogeneity from the supernatant of exponentially growing cells using ...

  13. FORMALDEHYDE DISMUTASE ACTIVITIES IN GRAM-POSITIVE BACTERIA OXIDIZING METHANOL

    NARCIS (Netherlands)

    BYSTRYKH, LV; GOVORUKHINA, NI; VANOPHEM, PW; HEKTOR, HJ; DIJKHUIZEN, L; DUINE, JA; Govorukhina, Natalya; Ophem, Peter W. van; Duine, Johannis A.

    Extracts of methanol-grown cells of Amycolatopsis methanolica and Mycobacterium gastri oxidized methanol and ethanol with concomitant reduction of N,N'-dimethyl-4-nitrosoaniline (NDMA). Anion-exchange chromatography revealed the presence of a single enzyme able to catalyse this activity in methanol-

  14. Antimicrobial sensitivity pattern of gram positive CSF isolates in ...

    African Journals Online (AJOL)

    100%) to Linezolid, Vancomycin and Piperacillin-Tazobactam. However, Staphylococcus aureus were 100% sensitive to Linezolid and Vancomycin but were only 87.5% sensitive to Piperacillin-Tazobactam combination. The Streptococcus ...

  15. Toxicity of Tolyltriazole to Gram-Positive Coccus Microorganisms

    Science.gov (United States)

    2000-03-01

    Bausmith and Neufield 459). The second general category is the SAE Type II ADAF, which is a Type I ADAF with the addition of synthetic polymers...Act of 1972 ( Bausmith and Neufield 459, Gallagher 1995:109). The FAA and EPA requirements concerning ADAFs are often in conflict; as the FAA...AZUR Environmental. "Microtox Rapid Toxicity Testing System". http://www.azurenv.com/mtox.htm. October 1999. 3. Bausmith , David S. and Ronald D

  16. Antagonistic effect of brevicin on Gram positive and Gram negative ...

    African Journals Online (AJOL)

    B. Senthil Kumar

    This is stable at high temperature acidic to neutral pH ... applications, though, due to its biochemical properties; it .... All were assessed for the production of bacteriocin ..... coating to control the growth of Listeria monocytogenes on poached.

  17. Diverse Gram-positive bacteria identified from raw and pasteurized ...

    African Journals Online (AJOL)

    tion practices associated with milking and storage equipment. ... materials, various ingredients added to dairy products and dairy farm work- ers. ... 7°E, respectively and 2200 meter above sea level, respectively. The an- ... storage facilities, and shelf life of the pasteurized milk. ... transferred into a sterile screw capped bottle.

  18. Diesel degradation and biosurfactant production by Gram-positive ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Full Length Research Paper ... Diesel degradation rates and microbial cell number, increased with an increase in glucose ... that are less or non-toxic and represents one of the ... organic compounds (Larkin et al., 2005).

  19. Comparative analysis of Micrococcus luteus isolates from blood cultures of patients with pulmonary hypertension receiving epoprostenol continuous infusion.

    Science.gov (United States)

    Hirata, Yoshinori; Sata, Makoto; Makiuchi, Yuko; Morikane, Keita; Wada, Akihito; Okabe, Nobuhiko; Tomoike, Hitonobu

    2009-12-01

    During the period 2002-2008, at the National Cardiovascular Center, Osaka, 28 Micrococcus luteus isolates and one Kocuria spp. isolate were obtained from blood cultures of pulmonary hypertension (PH) patients who were receiving continuous infusion therapy with epoprostenol. Pulsed-field gel electrophoresis patterns of the isolates were unrelated, suggesting that the infections had multiple origins. The preparation of epoprostenol solution by patients themselves was thought to be a risk factor.

  20. Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species

    Science.gov (United States)

    Rey, Michael W; Ramaiya, Preethi; Nelson, Beth A; Brody-Karpin, Shari D; Zaretsky, Elizabeth J; Tang, Maria; de Leon, Alfredo Lopez; Xiang, Henry; Gusti, Veronica; Clausen, Ib Groth; Olsen, Peter B; Rasmussen, Michael D; Andersen, Jens T; Jørgensen, Per L; Larsen, Thomas S; Sorokin, Alexei; Bolotin, Alexander; Lapidus, Alla; Galleron, Nathalie; Ehrlich, S Dusko; Berka, Randy M

    2004-01-01

    Background Bacillus licheniformis is a Gram-positive, spore-forming soil bacterium that is used in the biotechnology industry to manufacture enzymes, antibiotics, biochemicals and consumer products. This species is closely related to the well studied model organism Bacillus subtilis, and produces an assortment of extracellular enzymes that may contribute to nutrient cycling in nature. Results We determined the complete nucleotide sequence of the B. licheniformis ATCC 14580 genome which comprises a circular chromosome of 4,222,336 base-pairs (bp) containing 4,208 predicted protein-coding genes with an average size of 873 bp, seven rRNA operons, and 72 tRNA genes. The B. licheniformis chromosome contains large regions that are colinear with the genomes of B. subtilis and Bacillus halodurans, and approximately 80% of the predicted B. licheniformis coding sequences have B. subtilis orthologs. Conclusions Despite the unmistakable organizational similarities between the B. licheniformis and B. subtilis genomes, there are notable differences in the numbers and locations of prophages, transposable elements and a number of extracellular enzymes and secondary metabolic pathway operons that distinguish these species. Differences include a region of more than 80 kilobases (kb) that comprises a cluster of polyketide synthase genes and a second operon of 38 kb encoding plipastatin synthase enzymes that are absent in the B. licheniformis genome. The availability of a completed genome sequence for B. licheniformis should facilitate the design and construction of improved industrial strains and allow for comparative genomics and evolutionary studies within this group of Bacillaceae. PMID:15461803

  1. Emergence of a New Population of Rathayibacter toxicus: An Ecologically Complex, Geographically Isolated Bacterium.

    Science.gov (United States)

    Arif, Mohammad; Busot, Grethel Y; Mann, Rachel; Rodoni, Brendan; Liu, Sanzhen; Stack, James P

    2016-01-01

    Rathayibacter toxicus is a gram-positive bacterium that infects the floral parts of several Poaceae species in Australia. Bacterial ooze is often produced on the surface of infected plants and bacterial galls are produced in place of seed. R. toxicus is a regulated plant pathogen in the U.S. yet reliable detection and diagnostic tools are lacking. To better understand this geographically-isolated plant pathogen, genetic variation as a function of geographic location, host species, and date of isolation was determined for isolates collected over a forty-year period. Discriminant analyses of recently collected and archived isolates using Multi-Locus Sequence Typing (MLST) and Inter-Simple Sequence Repeats (ISSR) identified three populations of R. toxicus; RT-I and RT-II from South Australia and RT-III from Western Australia. Population RT-I, detected in 2013 and 2014 from the Yorke Peninsula in South Australia, is a newly emerged population of R. toxicus not previously reported. Commonly used housekeeping genes failed to discriminate among the R. toxicus isolates. However, strategically selected and genome-dispersed MLST genes representing an array of cellular functions from chromosome replication, antibiotic resistance and biosynthetic pathways to bacterial acquired immunity were discriminative. Genetic variation among isolates within the RT-I population was less than the within-population variation for the previously reported RT-II and RT-III populations. The lower relative genetic variation within the RT-I population and its absence from sampling over the past 40 years suggest its recent emergence. RT-I was the dominant population on the Yorke Peninsula during the 2013-2014 sampling period perhaps indicating a competitive advantage over the previously detected RT-II population. The potential for introduction of this bacterial plant pathogen into new geographic areas provide a rationale for understanding the ecological and evolutionary trajectories of R. toxicus.

  2. Emergence of a New Population of Rathayibacter toxicus: An Ecologically Complex, Geographically Isolated Bacterium.

    Directory of Open Access Journals (Sweden)

    Mohammad Arif

    Full Text Available Rathayibacter toxicus is a gram-positive bacterium that infects the floral parts of several Poaceae species in Australia. Bacterial ooze is often produced on the surface of infected plants and bacterial galls are produced in place of seed. R. toxicus is a regulated plant pathogen in the U.S. yet reliable detection and diagnostic tools are lacking. To better understand this geographically-isolated plant pathogen, genetic variation as a function of geographic location, host species, and date of isolation was determined for isolates collected over a forty-year period. Discriminant analyses of recently collected and archived isolates using Multi-Locus Sequence Typing (MLST and Inter-Simple Sequence Repeats (ISSR identified three populations of R. toxicus; RT-I and RT-II from South Australia and RT-III from Western Australia. Population RT-I, detected in 2013 and 2014 from the Yorke Peninsula in South Australia, is a newly emerged population of R. toxicus not previously reported. Commonly used housekeeping genes failed to discriminate among the R. toxicus isolates. However, strategically selected and genome-dispersed MLST genes representing an array of cellular functions from chromosome replication, antibiotic resistance and biosynthetic pathways to bacterial acquired immunity were discriminative. Genetic variation among isolates within the RT-I population was less than the within-population variation for the previously reported RT-II and RT-III populations. The lower relative genetic variation within the RT-I population and its absence from sampling over the past 40 years suggest its recent emergence. RT-I was the dominant population on the Yorke Peninsula during the 2013-2014 sampling period perhaps indicating a competitive advantage over the previously detected RT-II population. The potential for introduction of this bacterial plant pathogen into new geographic areas provide a rationale for understanding the ecological and evolutionary

  3. Natranaerobaculum magadiense gen. nov., sp. nov., an anaerobic, alkalithermophilic bacterium from soda lake sediment.

    Science.gov (United States)

    Zavarzina, Daria G; Zhilina, Tatyana N; Kuznetsov, Boris B; Kolganova, Tatyana V; Osipov, Georgy A; Kotelev, Mikhail S; Zavarzin, Georgy A

    2013-12-01

    An obligately alkaliphilic, anaerobic, thermo- and halotolerant, spore-forming bacterium was isolated from sediments of soda lake Magadi (Kenya) and designated strain Z-1001(T). Cells of strain Z-1001(T) were straight, Gram-positive rods, slowly motile. Strain Z-1001(T) was found to be an obligate anaerobe. It grew within a pH range from 7.5 to 10.7 with an optimum at 9.25-9.5 (at 40 °C), a temperature range from 20 to 57 °C with an optimum at 45-50 °C, and a NaCl concentration range from 0 to 1.55 M with an optimum at 1.2-1.4 M. Peptides, such as meat and yeast extracts, peptone and tryptone, were fermented by Z-1001(T). Carbohydrates did not support growth. With yeast extract as an electron donor, strain Z-1001(T) reduced S(2)O(3)(2-), NO(-)(3), AsO(3-)(4), Fe(III) citrate and anthraquinone-2,6-disulfonate (AQDS) as electron acceptors. The isolate was able to grow oligotrophically with a very small amount of yeast extract: 0.03 g l(-1). The main fatty acids were C16 : 0, C16 : 1ω7c, C18 : 0 and C18 : 1ω9. The DNA G+C content of the isolate was 35.6 mol%. 16S rRNA gene sequence analysis showed that strain Z-1001(T) is a member of family Natranaerobiaceae, clustering with the type strain of Natranaerobius thermophilus (95.8-96.0 % sequence similarity). On the basis of physiological and phylogenetic data it is proposed that strain Z-1001(T) ( = DSM 24923(T) = VKM B-2666(T)) represents a novel genus and species, Natranaerobaculum magadiense gen. nov., sp. nov.

  4. Brockia lithotrophica gen. nov., sp. nov., an anaerobic thermophilic bacterium from a terrestrial hot spring.

    Science.gov (United States)

    Perevalova, Anna A; Kublanov, Ilya V; Baslerov, R V; Zhang, Gengxin; Bonch-Osmolovskaya, Elizaveta A

    2013-02-01

    A novel thermophilic bacterium, strain Kam1851(T), was isolated from a terrestrial hot spring of the Uzon Caldera, Kamchatka Peninsula, Russia. Cells of strain Kam1851(T) were spore-forming rods with a gram-positive type of cell wall. Growth was observed between 46 and 78 °C, and pH 5.5-8.5. The optimal growth (doubling time, 6.0 h) was at 60-65 °C and pH 6.5. The isolate was an obligate anaerobe growing in pre-reduced medium only. It grew on mineral medium with molecular hydrogen or formate as electron donors, and elemental sulfur, thiosulfate or polysulfide as electron acceptors. The main cellular fatty acids were C(16 : 0) (34.2 %), iso-C(16 : 0) (18 %), C(18 : 0) (12.8 %) and iso-C(17 : 0) (11.1 %). The G+C content of the genomic DNA of strain Kam1851(T) was 63 mol%. 16S rRNA gene sequence analysis showed that strain Kam1851(T) belonged to the order Thermoanaerobacterales, but it was not closely related to representatives of any genera with validly published names. The most closely related strains, which had no more than 89.2 % sequence similarity, were members of the genera Ammonifex and Caldanaerobacter. On the basis of its phylogenetic position and novel phenotypic features, isolate Kam1851(T) is proposed to represent a novel species in a new genus, Brockia lithotrophica gen. nov., sp. nov.; the type strain of Brockia lithotrophica is Kam1851(T) ( = DSM 22653(T) = VKM B-2685(T)).

  5. Caldicellulosiruptor obsidiansis sp. nov., an anaerobic, extremely thermophilic, cellulolytic bacterium isolated from Obsidian Pool, Yellowstone National Park.

    Science.gov (United States)

    Hamilton-Brehm, Scott D; Mosher, Jennifer J; Vishnivetskaya, Tatiana; Podar, Mircea; Carroll, Sue; Allman, Steve; Phelps, Tommy J; Keller, Martin; Elkins, James G

    2010-02-01

    A novel, obligately anaerobic, extremely thermophilic, cellulolytic bacterium, designated OB47(T), was isolated from Obsidian Pool, Yellowstone National Park, WY. The isolate was a nonmotile, non-spore-forming, Gram-positive rod approximately 2 microm long by 0.2 microm wide and grew at temperatures between 55 and 85 degrees C, with the optimum at 78 degrees C. The pH range for growth was 6.0 to 8.0, with values of near 7.0 being optimal. Growth on cellobiose produced the fastest specific growth rate at 0.75 h(-1). The organism also displayed fermentative growth on glucose, maltose, arabinose, fructose, starch, lactose, mannose, sucrose, galactose, xylose, arabinogalactan, Avicel, xylan, filter paper, processed cardboard, pectin, dilute acid-pretreated switchgrass, and Populus. OB47(T) was unable to grow on mannitol, fucose, lignin, Gelrite, acetate, glycerol, ribose, sorbitol, carboxymethylcellulose, and casein. Yeast extract stimulated growth, and thiosulfate, sulfate, nitrate, and sulfur were not reduced. Fermentation end products were mainly acetate, H2, and CO2, although lactate and ethanol were produced in 5-liter batch fermentations. The G+C content of the DNA was 35 mol%, and sequence analysis of the small subunit rRNA gene placed OB47(T) within the genus Caldicellulosiruptor. Based on its phylogenetic and phenotypic properties, the isolate is proposed to be designated Caldicellulosiruptor obsidiansis sp. nov. and OB47 is the type strain (ATCC BAA-2073).

  6. Caldicellulosiruptor obsidiansis sp. nov., an Anaerobic, Extremely Thermophilic, Cellulolytic Bacterium Isolated from Obsidian Pool, Yellowstone National Park▿

    Science.gov (United States)

    Hamilton-Brehm, Scott D.; Mosher, Jennifer J.; Vishnivetskaya, Tatiana; Podar, Mircea; Carroll, Sue; Allman, Steve; Phelps, Tommy J.; Keller, Martin; Elkins, James G.

    2010-01-01

    A novel, obligately anaerobic, extremely thermophilic, cellulolytic bacterium, designated OB47T, was isolated from Obsidian Pool, Yellowstone National Park, WY. The isolate was a nonmotile, non-spore-forming, Gram-positive rod approximately 2 μm long by 0.2 μm wide and grew at temperatures between 55 and 85°C, with the optimum at 78°C. The pH range for growth was 6.0 to 8.0, with values of near 7.0 being optimal. Growth on cellobiose produced the fastest specific growth rate at 0.75 h−1. The organism also displayed fermentative growth on glucose, maltose, arabinose, fructose, starch, lactose, mannose, sucrose, galactose, xylose, arabinogalactan, Avicel, xylan, filter paper, processed cardboard, pectin, dilute acid-pretreated switchgrass, and Populus. OB47T was unable to grow on mannitol, fucose, lignin, Gelrite, acetate, glycerol, ribose, sorbitol, carboxymethylcellulose, and casein. Yeast extract stimulated growth, and thiosulfate, sulfate, nitrate, and sulfur were not reduced. Fermentation end products were mainly acetate, H2, and CO2, although lactate and ethanol were produced in 5-liter batch fermentations. The G+C content of the DNA was 35 mol%, and sequence analysis of the small subunit rRNA gene placed OB47T within the genus Caldicellulosiruptor. Based on its phylogenetic and phenotypic properties, the isolate is proposed to be designated Caldicellulosiruptor obsidiansis sp. nov. and OB47 is the type strain (ATCC BAA-2073). PMID:20023107

  7. Virgibacillus ainsalahensis sp. nov., a Moderately Halophilic Bacterium Isolated from Sediment of a Saline Lake in South of Algeria.

    Science.gov (United States)

    Amziane, Meriam; Darenfed-Bouanane, Amel; Abderrahmani, Ahmed; Selama, Okba; Jouadi, Lydia; Cayol, Jean-Luc; Nateche, Farida; Fardeau, Marie-Laure

    2017-02-01

    A Gram-positive, moderately halophilic, endospore-forming bacterium, designated MerV T , was isolated from a sediment sample of a saline lake located in Ain Salah, south of Algeria. The cells were rod shaped and motile. Isolate MerV T grew at salinity interval of 0.5-25% NaCl (optimum, 5-10%), pH 6.0-12.0 (optimum, 8.0), and temperature between 10 and 40 °C (optimum, 30 °C).The polar lipids comprised diphosphatidylglycerol, phosphatidylglycerol, a glycolipid, a phospholipid, and two lipids, and MK-7 is the predominant menaquinone. The predominant cellular fatty acids were anteiso C 15:0 and anteiso C 17:0 . The DNA G+C content was 45.3 mol%. Phylogenetic analysis based on 16S rRNA gene sequence comparisons revealed that strain MerV T was most closely related to Virgibacillus halodenitrificans (gene sequence similarity of 97.0%). On the basis of phenotypic, chemotaxonomic properties, and phylogenetic analyses, strain MerV T (=DSM = 28944 T ) should be placed in the genus Virgibacillus as a novel species, for which the name Virgibacillus ainsalahensis is proposed.

  8. Characterization Of A Novel Hydrolytic Enzyme Producing Thermophilic Bacterium Isolated From The Hot Spring Of Azad Kashmir-Pakistan

    Directory of Open Access Journals (Sweden)

    Sana Zahoor

    Full Text Available ABSTRACT A thermophilic bacterium (TP-2 was isolated from the Tatta Pani hot spring in Azad Kashmir and was characterized using phenotypic and genotypic characters. The strain developed cream colored, round, smooth, flat and slimy colonies while the cells were Gram positive rods that ranged in size from about 2.1-3.6 μm to 0.2-0.3 μm in width. Sequence analysis of its 16S rRNA gene showed that isolate TP-2 had 89% homology with Geobacillus debilis. It grew within pH range of 5.5 to 8.5 with optimum growth at pH 7.0. The isolate showed optimum growth at 65ºC and gave positive results for gelatin hydrolysis (GEL, ortho nitrophenyl-β-D-galactopyranosidase (ONPG, and nitrate production and produced acid from sucrose, glucose and maltose. It utilized glucose, fructose, maltose, lactose, sucrose, xylan, starch, filter paper and carboxymethylcellulose as sole carbon source. Isolate TP-2 produced significant amount of industrially important enzymes i.e. extracellular α-amylase, CMCase, FPase, Xylanase, Protease and Lipase and intracellular CMCase and FPase.

  9. Growth of hydroxyapatite on the cellular membrane of the bacterium Bacillus thuringiensis for the preparation of hybrid biomaterials

    Energy Technology Data Exchange (ETDEWEB)

    Cervantes, Eric Reyes, E-mail: onomaeric@hotmail.com [Centro de Investigación en Ciencias Microbiológicas, Benemérita Universidad Autónoma de Puebla, Prolongación de la 24 Sur y Ave San Claudio, Ciudad Universitaria, Col San Manuel, C.P. 72570 Puebla, Pue (Mexico); Torres, Maykel González, E-mail: mikegcu@fata.unam.mx [Centro de Física Aplicada y Tecnología Avanzada, Universidad Nacional Autónoma de México, Campus Juriquilla, Boulevard Juriquilla 3001, Santiago de Querétaro, Querétaro C.P. 76230 (Mexico); Muñoz, Susana Vargas, E-mail: vmsu@unam.mx [Centro de Física Aplicada y Tecnología Avanzada, Universidad Nacional Autónoma de México, Campus Juriquilla, Boulevard Juriquilla 3001, Santiago de Querétaro, Querétaro C.P. 76230 (Mexico); Rosas, Efraín Rubio, E-mail: efrainrubio@yahoo.com [Centro de Investigación en Ciencias Microbiológicas, Benemérita Universidad Autónoma de Puebla, Prolongación de la 24 Sur y Ave San Claudio, Ciudad Universitaria, Col San Manuel, C.P. 72570 Puebla, Pue (Mexico); and others

    2016-01-01

    This study aimed to grow hydroxyapatite (HAp) crystals on the cellular wall of the Gram-positive bacterium Bacillus thuringiensis using a bio-mimetic method. Several strains were phenotypically and genotypically characterized using multilocus sequence typing (MLST) gene markers to differentiate the strains and confirm the identity of the isolated species to guarantee that the selected species was not harmful to human health or the environment. Three of the analyzed strains were selected because they exhibited the best nucleation and growth of HAp on the bacterial surface. This innovative method to grow HAp crystals on a cellular membrane helps to elucidate the mechanisms by which osseous tissue is formed in nature. The optimum concentration for the simulated physiological fluid (SPF) was 1.5 ×. The hybrid materials were characterized by optical microscopy, atomic force microscopy (AFM), scanning electron microscopy (SEM), X-ray powder diffraction (XRD) and Fourier transform infrared spectroscopy (FTIR). - Highlights: • HAp crystals are grown on the cellular wall of a GP bacteria Bacillus thuringiensis. • The growing was carried out by using a bio-mimetic method. • Hybrid materials were characterized with morphological and spectroscopic techniques. • The reported method allows understanding the mechanisms to produce osseous tissue. • The membrane of Bacillus thuringiensis can grow more HAp than Bacillus halodurans.

  10. [Isolation and identification of a lactate-utilizing, butyrate-producing bacterium and its primary metabolic characteristics].

    Science.gov (United States)

    Liu, Wei; Zhu, Wei-yun; Yao, Wen; Mao, Sheng-yong

    2007-06-01

    The distal mammalian gut harbors prodigiously abundant microbes, which provide unique metabolic traits to host. A lactate-utilizing, butyrate-producing bacterium, strain LB01, was isolated from adult swine feces by utilizing modified Hungate technique with rumen liquid-independent YCFA medium supplemented with lactate as the single carbon source. It was an obligate anaerobic, Gram positive bacterium, and could utilize glucose, fructose, maltose and lactate with a large amount of gas products. 16S rRNA sequence analysis revealed that it had the high similarity with members of the genus Megasphaera. The metabolic characteristics of strain LB01 was investigated by using in vitro fermentation system. Lactate at the concentration of 65 mmol/L in YCFA medium was rapidly consumed within 9 hours and was mainly converted to propionate and butyrate after 24h. As the level of acetate declined, the concentration of butyrate rose only in the presence of glucose, suggesting that butyrate could possibly be synthesized by the acetyl CoA: butyryl CoA transferase. When co-cultured with lactic acid bacteria strain K9, strain LB01 evidently reduced the concentration of lactate produced by strain K9 and decelerated the rapid pH drop, finally producing 12.11 mmol/L butyrate and 4.06 mmol/L propionate. The metabolic characteristics that strain LB01 efficiently converts toxic lactate and excessive acetate to butyrate can prevent lactate and acetate accumulation in the large intestine and maintain the slightly acidic environment of the large intestine, consequently revealing that stain LB01 could act as a potential probiotics.

  11. Biosynthesis of gold nanoparticles by the extreme bacterium Deinococcus radiodurans and an evaluation of their antibacterial properties.

    Science.gov (United States)

    Li, Jiulong; Li, Qinghao; Ma, Xiaoqiong; Tian, Bing; Li, Tao; Yu, Jiangliu; Dai, Shang; Weng, Yulan; Hua, Yuejin

    Deinococcus radiodurans is an extreme bacterium known for its high resistance to stresses including radiation and oxidants. The ability of D. radiodurans to reduce Au(III) and biosynthesize gold nanoparticles (AuNPs) was investigated in aqueous solution by ultraviolet and visible (UV/Vis) absorption spectroscopy, electron microscopy, X-ray diffraction (XRD), dynamic light scattering (DLS), Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS). D. radiodurans efficiently synthesized AuNPs from 1 mM Au(III) solution in 8 h. The AuNPs were of spherical, triangular and irregular shapes with an average size of 43.75 nm and a polydispersity index of 0.23 as measured by DLS. AuNPs were distributed in the cell envelope, across the cytosol and in the extracellular space. XRD analysis confirmed the crystallite nature of the AuNPs from the cell supernatant. Data from the FTIR and XPS showed that upon binding to proteins or compounds through interactions with carboxyl, amine, phospho and hydroxyl groups, Au(III) may be reduced to Au(I), and further reduced to Au(0) with the capping groups to stabilize the AuNPs. Biosynthesis of AuNPs was optimized with respect to the initial concentration of gold salt, bacterial growth period, solution pH and temperature. The purified AuNPs exhibited significant antibacterial activity against both Gram-negative ( Escherichia coli ) and Gram-positive ( Staphylococcus aureus ) bacteria by damaging their cytoplasmic membrane. Therefore, the extreme bacterium D. radiodurans can be used as a novel bacterial candidate for efficient biosynthesis of AuNPs, which exhibited potential in biomedical application as an antibacterial agent.

  12. Chemical composition and antimicrobial activity of the essential oil of the leaves of Feronia elephantum (Rutaceae) from north west Karnataka.

    Science.gov (United States)

    Joshi, Rajesh K; Badakar, Vijayalaxmi M; Kholkute, Sanjiva D; Khatib, Nayeem

    2011-01-01

    The essential oil of the leaves of Feronia elephantum Corr. was analyzed by gas chromatography and gas chromatography/mass spectrometry. The main constituents were beta-pinene (28.4%), Z-anethole (22.1%), methyl chavicol (12.0%) and E-anethole (8.1%), among thirty-three identified compounds, which represented 92.6% of the total oil. The antimicrobial activity was tested against five Gram-positive and eight Gram-negative bacteria, and four fungi. The oil was active against Micrococcus luteus (Gram-positive bacterium), Proteus mirabilis (Gram-negative bacterium), Penicillium chrysogenum and Aspergillus niger (fungi) with MIC values of 0.31 +/- 0.06, 0.52 +/- 0.10, 0.20 +/- 0.50 and 0.26 +/- 0.52 mg/mL, respectively.

  13. Peroxiredoxin 1 protects the pea aphid Acyrthosiphon pisum from oxidative stress induced by Micrococcus luteus infection.

    Science.gov (United States)

    Zhang, Yongdong; Lu, Zhiqiang

    2015-05-01

    Reactive oxygen species (ROSs) are generated in organisms in response to infections caused by invading microbes. However, excessive ROSs will inflict oxidative damage on the host. Peroxiredoxins (Prxs) are antioxidative enzymes that may eliminate ROSs efficiently. In this study, ApPrx1 from the pea aphid Acyrthosiphon pisum was cloned, and its function was investigated in vitro and in vivo. In the presence of DTT, recombinant ApPrx1 protein from Escherichia coli showed antioxidative activity by eliminating H2O2 effectively. The H2O2 levels were significantly higher in Micrococcus luteus-infected aphids than in uninfected aphids, and ApPrx1 expression was remarkably up-regulated when the aphids were infected with M. luteus or injected with H2O2. When ApPrx1 expression was reduced by dsRNA injection, the survival of the aphids decreased significantly after M. luteus infection. Knockdown of ApPrx1 decreased M. luteus loads inside the aphids 48h post-infection. While under infection conditions, the H2O2 levels were much higher in ApPrx1 knockdown aphids than in dsGFP-injected aphids, indicating that the decreased survival of the aphids was caused by increased oxidative stress. Taken together, our results reveal that ApPrx1 plays a protective role in oxidative stress caused by bacterial infection. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Structure and function of the latent F0-F1-ATPase complex of Micrococcus lysodeikticus

    International Nuclear Information System (INIS)

    Chung, Y.S.

    1988-01-01

    The latent F 0 F 1 -ATPase from Micrococcus luteus (lysodeikticus) has been purified to homogeneity, and nine distinct subunit bands were observed on SDS-PAGE. Five of nine bands corresponded to the F 1 subunits and the other four bands are likely to be subunits a, a', b, and c of the F 0 segment of the complex. The subunit designated as a' probably arises from proteolytic cleavage of the 25,5000 Mr subunit a. The F 0 F 1 -ATPase complex has a molecular weight of approximately 1,060,000, as determined by Fast Protein Liquid Chromatography (FPLC). It is assumed that the F 0 F 1 -ATPase peak obtained by FPLC was a dimer and that molecular weight of the F 0 F 1 -ATPase monomer was accordingly 530,000. The stoichiometry of the subunits was determined with 14 C-labeled F 0 F 1 -ATPase prepared from cells grown on medium containing 14 C-amino acids. Antibodies to the native and SDS-denatured F 1 and F 0 F 1 -ATPase as well as to individual SDS-dissociated subunits have been generated for immunochemical analysis. The arrangement of the subunits in F 1 and F 0 F 1 -ATPase have been investigated using bifunctional chemical cross-linking agents

  15. Teichuronic acid reducing terminal N-acetylglucosamine residue linked by phosphodiester to peptidoglycan of Micrococcus luteus

    International Nuclear Information System (INIS)

    Gassner, G.T.; Dickie, J.P.; Hamerski, D.A.; Magnuson, J.K.; Anderson, J.S.

    1990-01-01

    Teichuronic acid-peptidoglycan complex isolated from Micrococcus luteus cells by lysozyme digestion in osmotically stabilized medium was treated with mild acid to cleave the linkage joining teichuronic acid to peptidoglycan. This labile linkage was shown to be the phosphodiester which joins N-acetylglucosamine, the residue located at the reducing end of the teichuronic acid, through its anomeric hydroxyl group to a 6-phosphomuramic acid, a residue of the glycan strand of peptidoglycan. 31 P nuclear magnetic resonance spectroscopy of the lysozyme digest of cell walls demonstrated the presence of a phosphodiester which was converted to a phosphomonoester by the conditions which released teichuronic acid from cell walls. Reduction of acid-liberated reducing end groups by NaB 3 H 4 followed by complete acid hydrolysis yielded [ 3 H] glucosaminitol from the true reducing end residue of teichuronic acid and [ 3 H]glucitol from the sites of fragmentation of teichuronic acid. The amount of N-acetylglucosamine detected was approximately stoichiometric with the amount of phosphate in the complex. Partial fragmentation of teichuronic acid provides an explanation of the previous erroneous identification of the reducing end residue

  16. Radiosensitization of mammalian cells by misonidazole and oxygen: DNA damage exposed by Micrococcus luteus enzymes

    International Nuclear Information System (INIS)

    Skov, K.A.; Palcic, B.; Skarsgard, L.D.

    1979-01-01

    When misonidazole is present during irradiation of hypoxic mammalian cells, an enhancement of single-strand breaks (SSB) in DNA is observed. Oxygen also enhances SSB, presumably in a manner similar to that of misonidazole. The dose-modifying factor (DMF) for 15 mM misonidazole was found to be 3.4, compared to an oxygen enhancement ratio (OER) of 3.5. Another class of DNA damage, namely, sites exposed by an extract of Micrococcus luteus, was examined. Radiation-induced M. luteus extract-sensitive sites (MLS) were also found to be enhanced by the presence of misonidazole or molecular oxygen. The DMF for this damage by 15 mM misonidazole was 1.6 while the OER was 2.5. The ratio of MLS to SSB is approximately 1.25 under hypoxia, 0.9 in the presence of oxygen, and 0.6 in the presence of 15 mM misonidazole under hypoxic conditions. Incubation with misonidazole under conditions which are toxic to mammalian cells (37 0 C, hypoxia), and which result in many SSB, produces no detectable lesions sensitive to the M. luteus extract

  17. Functional Micrococcus lysodeikticus layers deposited by laser technique for the optical sensing of lysozyme.

    Science.gov (United States)

    Dinca, Valentina; Zaharie-Butucel, Diana; Stanica, Luciana; Brajnicov, Simona; Marascu, Valentina; Bonciu, Anca; Cristocea, Andra; Gaman, Laura; Gheorghiu, Mihaela; Astilean, Simion; Vasilescu, Alina

    2018-02-01

    Whole cell optical biosensors, made by immobilizing whole algal, bacterial or mammalian cells on various supports have found applications in several fields, from ecology and ecotoxicity testing to biopharmaceutical production or medical diagnostics. We hereby report the deposition of functional bacterial layers of Micrococcus lysodeikticus (ML) via Matrix-Assisted Pulsed Laser Evaporation (MAPLE) on poly(diallyldimethylamonium) (PDDA)-coated-glass slides and their application as an optical biosensor for the detection of lysozyme in serum. Lysozyme is an enzyme upregulated in inflammatory diseases and ML is an enzymatic substrate for this enzyme. The MAPLE-deposited bacterial interfaces were characterised by Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Fourier-Transformed Infrared Spectroscopy (FTIR), Raman and optical microscopy and were compared with control interfaces deposited via layer-by-layer on the same substrate. After MAPLE deposition and coating with graphene oxide (GO), ML-modified interfaces retained their functionality and sensitivity to lysozyme's lytic action. The optical biosensor detected lysozyme in undiluted serum in the clinically relevant range up to 10μgmL -1 , in a fast and simple manner. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    Science.gov (United States)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  19. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  20. Resonance scattering spectra of micrococcus lysodeikticus and its application to assay of lysozyme activity.

    Science.gov (United States)

    Jiang, Zhi-Liang; Huang, Guo-Xia

    2007-02-01

    Several methods, including turbidimetric and colorimetric methods, have been reported for the detection of lysozyme activity. However, there is no report about the resonance scattering spectral (RSS) assay, which is based on the catalytic effect of lysozyme on the hydrolysis of micrococcus lysodeikticus (ML) and its resonance scattering effect. ML has 5 resonance scattering peaks at 360 400, 420, 470, and 520 nm with the strongest one at 470 nm. The concentration of ML in the range of 2.0x10(6)-9.3x10(8) cells/ml is proportional to the RS intensity at 470 nm (I(470 nm)). A new catalytic RSS method has been proposed for 0.24-40.0 U/ml (or 0.012-2.0 mug/ml) lysozyme activity, with a detection limit (3sigma) of 0.014 U/ml (or 0.0007 microg/ml). Saliva samples were assayed by this method, and it is in agreement with the results of turbidimetric method. The slope, intercept and the correlation coefficient of the regression analysis of the 2 assays were 0.9665, -87.50, and 0.9973, respectively. The assay has high sensitivity and simplicity.

  1. Chemical structure and antioxidant activity of a new exopolysaccharide produced from Micrococcus luteus

    Directory of Open Access Journals (Sweden)

    Mohsen Mohamed Selim Asker

    2014-12-01

    Full Text Available An exopolysaccharide (EPS reaching a maximum of 13 g/L was isolated from Micrococcus luteus by ethanol precipitation. The crude EPS was purified by chromatography on DEAE-cellulose and Sephacryl S-200, affording a polysaccharide active fraction (AEP with a molecular weight of ∼137 kDa. AEP was investigated by a combination of chemical and chromatographic methods including FTIR, HPLC, periodate oxidation, methylation and GC–MS. Data obtained indicated that AEP was composed of mannose, arabinose, glucose and glucuronic acid in a molar ratio of 3.6:2.7:2.1:1.0, respectively. The main backbone consists of mannose units linked with (1→6-glycosidic bonds and arabinose units linked with (1→5-glycosidic bonds. There is a side chain consisting of mannose units linked with (1→6-glycosidic bonds at C3, when all glucose and most of glucuronic acid are found in the side chain. The in vitro antioxidant assay showed that AEP possesses DPPH radical-scavenging activity, with an EC50 value of 180 μg/mL.

  2. Sponge-derived Kocuria and Micrococcus spp. as sources of the new thiazolyl peptide antibiotic kocurin.

    Science.gov (United States)

    Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga

    2013-03-28

    Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs.

  3. Characterization of a bioflocculant produced by a consortium of Halomonas sp. Okoh and Micrococcus sp. Leo.

    Science.gov (United States)

    Okaiyeto, Kunle; Nwodo, Uchechukwu U; Mabinya, Leonard V; Okoh, Anthony I

    2013-10-16

    The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2-10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment.

  4. Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis

    Directory of Open Access Journals (Sweden)

    Ravi Ranjan

    2017-10-01

    Full Text Available Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v solvent system with Rf value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m/z 472.4 [M-H], which does not match with any known antibacterial compound.

  5. Influence of preirradiational and postirradiational heating of lyophilized Micrococcus radioproteolyticus cells on their survival

    Energy Technology Data Exchange (ETDEWEB)

    Ryznar, L; Drasil, V [Ceskoslovenska Akademie Ved, Brno. Biofysikalni Ustav

    1981-12-10

    The survival curve of Micrococcus radioproteolyticus following gamma irradiation of lyophilized cells is characterized by a broad shoulder reaching as far as the dose range 10 - 20 kGy (1 - 2 Mrad). The course of the curve indicates that under these conditions most of the changes induced by irradiation have the character of sublethal damage, which the cell can repair. The course of the survival curve does not change if the lyophilized cells are heated prior to irradiation for 2 h at 60 /sup 0/C. Certain changes do occur if the preirradiational temperature is 80 /sup 0/C. If the cells are exposed to increased temperature after irradiation even a temperature of 60 /sup 0/C brings about a marked decrease in survival. A temperature of 80 /sup 0/C after irradiation leads to extensive changes in the shape of survival curves, which are characterized by a narrowing or even disappearing of the shoulders. It can be concluded from the results obtained that an increased temperature modifies the capability of irradiated lyophilized cells to repair radiation damage.

  6. Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis.

    Science.gov (United States)

    Ranjan, Ravi; Jadeja, Vasantba

    2017-10-01

    Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v) solvent system with R f value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m / z 472.4 [M-H], which does not match with any known antibacterial compound.

  7. Influence of preirradiational and postirradiational heating of lyophilized Micrococcus radioproteolyticus cells on their survival

    International Nuclear Information System (INIS)

    Ryznar, L.; Drasil, V.

    1981-01-01

    The survival curve of Micrococcus radioproteolyticus following gamma irradiation of lyophilized cells is characterized by a broad shoulder reaching as far as the dose range 10 - 20 kGy (1 - 2 Mrad). The course of the curve indicates that under these conditions most of the changes induced by irradiation have the character of sublethal damage, which the cell can repair. The course of the survival curve does not change if the lyophilized cells are heated prior to irradiation for 2 h at 60 0 C. Certain changes do occur if the preirradiational temperature is 80 0 C. If the cells are exposed to increased temperature after irradiation even a temperature of 60 0 C brings about a marked decrease in survival. A temperature of 80 0 C after irradiation leads to extensive changes in the shape of survival curves, which are characterized by a narrowing or even disappearing of the shoulders. It can be concluded from the results obtained that an increased temperature modifies the capability of irradiated lyophilized cells to repair radiation damage. (author)

  8. Biosorption of lead and copper by heavy-metal tolerant Micrococcus luteus DE2008.

    Science.gov (United States)

    Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Diestra, Elia; Esteve, Isabel; Solé, Antoni

    2012-12-01

    Micrococcus luteus DE2008 has the ability to absorb lead and copper. The effect of these metals on biomass and viability of this microorganism were investigated and removal of the metals from culture media was determined. Lead had no effect on the biomass expressed as mg Carbon/cm(3) of M. Iuteus DE2008, but in the case of copper, the minimum metal concentration that affected the biomass was 0.1 mM Cu(II). According to these results this microorganism shows a greater tolerance for lead. The minimum metal concentration that affected viability (expressed as the percentage of live cells) was 0.5 mM for both metals. M. luteus DE2008 exhibited a specific removal capacity of 408 mg/g for copper and 1965 mg/g for lead. This microorganism has a greater ability to absorb Pb(II) than Cu(II). M. luteus DE2008 could be seen as a microorganism capable of restoring environments polluted by lead and copper. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.

    Science.gov (United States)

    Urban, C; Salton, M R

    1983-08-31

    The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.

  10. Zymomonas mobilis: a bacterium for ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Baratti, J.C.; Bu' Lock, J.D.

    1986-01-01

    Zymomonas mobilis is a facultative anaerobic gram negative bacterium first isolated in tropical countries from alcoholic beverages like the African palm wine, the Mexican pulque and also as a contaminant of cider (cider sickness) or beer in the European countries. It is one of the few facultative anaerobic bacteria degrading glucose by the Entner-Doudoroff pathway usually found in strictly aerobic microorganisms. Some work was devoted to this bacterium in the 50s and 60s and was reviewed by Swings and De Ley in their classical paper published in 1977. During the 70s there was very little work on the bacterium until 1979 and the first report by the Australian group of P.L. Rogers on the great potentialities of Z. mobilis for ethanol production. At that time the petroleum crisis had led the developed countries to search for alternative fuel from renewable resources. The Australian group clearly demonstrated the advantages of the bacterium compared to the yeasts traditionally used for the alcoholic fermentation. As a result, there was a considerable burst in the Zymomonas literature which started from nearly zero in the late 70s to attain 70 papers published in the field in 1984. In this article, papers published from 1982 to 1986 are reviewed.

  11. Atividade antimicrobiana in vitro de quinupristina/dalfopristina para cocos gram-positivos isolados de cinco centros brasileiros: resultado do estudo de vigilância L-SMART Antimicrobial in vitro activity of quinupristin/dalfopristin against gram-positive cocci isolated from 5 Brazilian centers: results from the local smart (L-SMART surveillance study

    Directory of Open Access Journals (Sweden)

    Caio Mendes

    2002-07-01

    /ml, sendo que 45% das cepas testadas foram sensíveis e 55% apresentaram sensibilidade intermediária à associação. Desta forma, pode-se afirmar que a associação Q/D representa uma nova opção para o tratamento endovenoso de infecções causadas por cocos gram-positivos, principalmente para as cepas multirresistentes, sendo também uma alternativa ao uso de glicopeptídeos.A progressive increase of resistance among Gram-positive cocci (GPC towards some antimicrobial agents has been observed for the past few years. This rise of resistance, most often seen in Staphylococcus spp., and Enterococcus spp., has mainly been noticed in hospital environments. Due to these recent patterns of resistance, newly developed antimicrobial agents need to be evaluated for the treatment of infections caused by these multi-resistant microorganisms. Quinupristin/dalfopristin (Q/D, also known as Synercid®, is an antimicrobial agent of intravenous administration, composed of two semi-synthetic derivatives of pristinomycin belonging to the group of streptogramins. The combination of streptogramins B and A at 3:7 ratio has an antimicrobial activity against gram-positive cocci. This combination has potent activity against gram-positive cocci such as Staphylococcus spp., Streptococcus spp. including Streptococcus pneumoniae, and Enterococcus faecium. However, strains of E. faecalis are usually resistant to this compound. The aim of this study was to evaluate the in vitro activity of Q/D and other eight antibiotics against 631 strains of GPC isolated from five Brazilian centers. Additionally, 20 vancomycin-resistant strains of E. faecium provided by a reference center from the United States were also included in this study. Minimal Inhibitory Concentrations (MICs were determined by E-test methodology (AB Biodisk, Solna, Sweden, using standardized and controlled procedures. The evaluated strains were as follows: Staphylococcus aureus (267, coagulase negative Staphylococcus (131, Streptococcus

  12. A Phase 3, Randomized, Double-Blind, Multicenter Study to Evaluate the Safety and Efficacy of Intravenous Iclaprim Vs Vancomycin for the Treatment of Acute Bacterial Skin and Skin Structure Infections Suspected or Confirmed to be Due to Gram-Positive Pathogens: REVIVE-1.

    Science.gov (United States)

    Huang, David B; O'Riordan, William; Overcash, J Scott; Heller, Barry; Amin, Faisal; File, Thomas M; Wilcox, Mark H; Torres, Antoni; Dryden, Matthew; Holland, Thomas L; McLeroth, Patrick; Shukla, Rajesh; Corey, G Ralph

    2018-04-03

    Our objective in this study was to demonstrate the safety and efficacy of iclaprim compared with vancomycin for the treatment of patients with acute bacterial skin and skin structure infections (ABSSSIs). REVIVE-1 was a phase 3, 600-patient, double-blinded, randomized (1:1), active-controlled trial among patients with ABSSSI that compared the safety and efficacy of iclaprim 80 mg fixed dose with vancomycin 15 mg/kg, both administered intravenously every 12 hours for 5-14 days. The primary endpoint of this study was a ≥20% reduction in lesion size (early clinical response [ECR]) compared with baseline among patients randomized to iclaprim or vancomycin at the early time point (ETP), 48 to 72 hours after the start of administration of study drug in the intent-to-treat population. ECR among patients who received iclaprim and vancomycin at the ETP was 80.9% (241 of 298) of patients receiving iclaprim compared with 81.0% (243 of 300) of those receiving vancomycin (treatment difference, -0.13%; 95% confidence interval, -6.42%-6.17%). Iclaprim was well tolerated in the study, with most adverse events categorized as mild. Iclaprim achieved noninferiority (10% margin) at ETP compared with vancomycin and was well tolerated in this phase 3 clinical trial for the treatment of ABSSSI. Based on these results, iclaprim appears to be an efficacious and safe treatment for ABSSSI suspected or confirmed to be due to gram-positive pathogens. NCT02600611.

  13. Microflora of urogenital tract in pregnancy with asymptomatic bacterium

    International Nuclear Information System (INIS)

    Abdullaeva, R.A.

    2006-01-01

    The article contains results of research interrelationship from colonization of vagina and urinary tract diseases. E.coli one of the main factors in development asymptomatic bacterium. Presented high effects of penicillin medicaments and nitrofurans in treatment of asymptomatic bacterium

  14. Engineering a wild fast-growing Mycoplasma bacterium to generate ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2018-01-12

    Jan 12, 2018 ... The CCPP bacterium causes sick animals to experience severe symptoms ... because antibiotic treatment does not eliminate the responsible bacterium. ... To develop a fast growing CCPP vaccine for cheaper production and ...

  15. Systematics of a widely distributed western North American springsnail, Pyrgulopsis micrococcus (Caenogastropoda, Hydrobiidae), with descriptions of three new congeners.

    Science.gov (United States)

    Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin

    2013-01-01

    We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.

  16. Genes involved in long-chain alkene biosynthesis in Micrococcus luteus

    Energy Technology Data Exchange (ETDEWEB)

    Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.

    2010-01-07

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which four decades ago was reported to biosynthesize iso- and anteiso branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty-acid overproducing E. coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-CoA produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or -ACP) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (?-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during

  17. Micrococcus radiodurans surface exonuclease. Dimer to monomer conversion by ionizing radiation-generated aqueous free radicals

    Energy Technology Data Exchange (ETDEWEB)

    Mitchel, R E.J.

    1980-01-01

    Micrococcus radiodurans possesses an exonuclease firmly bound to a middle cell wall membrane layer. Aqueous OH/sup -/ radicals generated chemically or by ionizing radiation cause the immediate release of this enzyme into the surrounding medium. The enzyme is located in a hydrophobic site and can also be released by aqueous n-butanol. When extracted by this solvent it is a non-covalently linked dimer and has a molecular weight of 260,000 as determined by gel filtration. When released by radiation generated OH/sup -/ radicals, the enzyme initially appears in solution as the dimer but is rapidly split by further aqueous radical attack into two 130,000 molecular weight subunits. Hydroxyl radicals are most effective but reducing radicals are also able to monomerize the enzyme. Only the released dimer enzyme is subject to free radical monomerization. Bound dimer enzyme is not split prior to release. No detectable loss of activity or change in catalytic properties accompanies the free radical cleavage of the enzyme. Both subunits of the dimer enzyme possess a tightly bound metal ion (probably Ca/sup 2 +/) required for activity. The monomer but not the dimer enzyme will bind to an anion exchanger. The monomer is susceptible to loss of its metal ion, and consequent inactivation, when exposed to the exchanger in the absence of Ca/sup 2 +/. Besides providing information on some of the immediate non-lethal effects of ionizing radiation, the behavior of this enzyme system demonstrates a potential cellular mechanism by which internally or externally generated free radicals could be utilized by the cell to control various enzymic reactions.

  18. The resistance of Micrococcus radiodurans to killing and mutation by agents which damage DNA

    International Nuclear Information System (INIS)

    Sweet, D.M.; Moseley, B.E.B.

    1976-01-01

    The resistance of Micrococcus radiodurans to the lethal and mutagenic action of ultraviolet (UV) light, ionising (γ) radiation, mitomycin C (MTC), nitrous acid (NA), hydroxylamine (HA), N-methyl-N'-nitro-N-nitrosoguanidine (NG), ethylmethanesulphonate (EMS) and β-propiolactone (βPL) has been compared with that of Escherichia coli B/r. M. radiodurans was much more resistant than E. coli B/r to the lethal effects of UV light (by a factor of 33), γ-radiation (55), NG (15) and NA (62), showed intermediate resistance to MTC (4) and HA (7), but was sensitive to EMS (1) and βPL (2). M. radiodurans was very resistant to mutagens producing damage which can be repaired by a recombination system, indicating that it possesses an extremely efficient recombination repair mechanism. Both species were equally sensitive to mutation to trimethoprim resistance by NG, but M. radiodurans was more resistant than E. coli B/r to the other mutagens tested, being non-mutable by UV light, γ-radiation, MTC and HA, and only slightly sensitive to mutation by NA, EMS, and βPL. The resistance of M. radiodurans to mutation by UV light, γ-radiation and MTC is consistent with an hypothesis that recombination repair in M. radiodurans is accurate since these mutagens may depend on an 'error-prone' recombination system for their mutagenic effect in E. coli B/r. However, because M. radiodurans is also resistant to mutagens such as HA and EMS, which are mutagenic in E. coli in the absence of an 'error-prone' system, we propose that all the mutagens tested may have a common mode of action in E. coli B/r, but that this mutagenic pathway is missing in M. radiodurans

  19. Modulation of the DNA scanning activity of the Micrococcus luteus UV endonuclease

    International Nuclear Information System (INIS)

    Hamilton, R.W.; Lloyd, R.S.

    1989-01-01

    Micrococcus luteus UV endonuclease incises DNA at the sites of ultraviolet (UV) light-induced pyrimidine dimers. The mechanism of incision has been previously shown to be a glycosylic bond cleavage at the 5'-pyrimidine of the dimer followed by an apyrimidine endonuclease activity which cleaves the phosphodiester backbone between the pyrimidines. The process by which M. luteus UV endonuclease locates pyrimidine dimers within a population of UV-irradiated plasmids was shown to occur, in vitro, by a processive or sliding mechanism on non-target DNA as opposed to a distributive or random hit mechanism. Form I plasmid DNA containing 25 dimers per molecule was incubated with M. luteus UV endonuclease in time course reactions. The three topological forms of plasmid DNA generated were analyzed by agarose gel electrophoresis. When the enzyme encounters a pyrimidine dimer, it is significantly more likely to make only the glycosylase cleavage as opposed to making both the glycosylic and phosphodiester bond cleavages. Thus, plasmids are accumulated with many alkaline-labile sites relative to single-stranded breaks. In addition, reactions were performed at both pH 8.0 and pH 6.0, in the absence of NaCl, as well as 25,100, and 250 mM NaCl. The efficiency of the DNA scanning reaction was shown to be dependent on both the ionic strength and pH of the reaction. At low ionic strengths, the reaction was shown to proceed by a processive mechanism and shifted to a distributive mechanism as the ionic strength of the reaction increased. Processivity at pH 8.0 is shown to be more sensitive to increases in ionic strength than reactions performed at pH 6.0

  20. Resistance of Micrococcus radiodurans to killing and mutation by agents which damage DNA

    Energy Technology Data Exchange (ETDEWEB)

    Sweet, D M; Moseley, B E.B. [Edinburgh Univ. (UK). School of Agriculture

    1976-02-01

    The resistance of Micrococcus radiodurans to the lethal and mutagenic action of ultraviolet (UV) light, ionising (..gamma..) radiation, mitomycin C (MTC), nitrous acid (NA), hydroxylamine (HA), N-methyl-N'-nitro-N-nitrosoguanidine (NG), ethylmethanesulphonate (EMS) and ..beta..-propiolactone (..beta..PL) has been compared with that of Escherichia coli B/r. M. radiodurans was much more resistant than E. coli B/r to the lethal effects of UV light (by a factor of 33), ..gamma..-radiation (55), NG (15) and NA (62), showed intermediate resistance to MTC (4) and HA (7), but was sensitive to EMS (1) and ..beta..PL (2). M. radiodurans was very resistant to mutagens producing damage which can be repaired by a recombination system, indicating that it possesses an extremely efficient recombination repair mechanism. Both species were equally sensitive to mutation to trimethoprim resistance by NG, but M. radiodurans was more resistant than E. coli B/r to the other mutagens tested, being non-mutable by UV light, ..gamma..-radiation, MTC and HA, and only slightly sensitive to mutation by NA, EMS, and ..beta..PL. The resistance of M. radiodurans to mutation by UV light, ..gamma.. radiation and MTC is consistent with an hypothesis that recombination repair in M. radiodurans is accurate since these mutagens may depend on an 'error-prone' recombination system for their mutagenic effect in E. coli B/r. However, because M. radiodurans is also resistant to mutagens such as HA and EMS, which are mutagenic in E. coli in the absence of an 'error-prone' system, we propose that all the mutagens tested may have a common mode of action in E. coli B/r, but that this mutagenic pathway is missing in M. radiodurans.

  1. Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.

    Science.gov (United States)

    Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun

    2016-06-01

    To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.

  2. Genome sequence of the Fleming strain of Micrococcus luteus, a simple free- living actinobacterium

    Energy Technology Data Exchange (ETDEWEB)

    Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.; Chandra, Govind; Chater, Keith F.; Dover, Lynn G.; Goh, Ee-Been; Kahan, Tamar; Kaprelyants, Arseny S.; Kyrpides, Nikos; Lapidus, Alla; Lowry, Stephen R.; Lykidis, Athanasios; Mahillon, Jacques; Markowitz, Viktor; Mavrommatis, Konstantinos; Mukamolova, Galina V.; Oren, Aharon; Rokem, J. Stefan; Smith, Margaret C. M.; Young, Danielle I.; Greenblatt, Charles L.

    2009-11-01

    Micrococcus luteus (NCTC2665, Fleming strain) has one of the smallest genomes of free living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content 73%) predicted to encode 2403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 IS elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. The genome encodes only four sigma factors and fourteen response regulators, indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to {Beta}-lactam antibiotics may result from the presence of a reduced set of penicillin binding proteins and the absence of a wblC gene, which plays an important role in antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose, and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three gene cluster essential for this metabolism has been identified in the genome.

  3. Isolation and characterization of a mannan from mesosomal membrane vesicles of Micrococcus lysodeikticus.

    Science.gov (United States)

    Owen, P; Salton, M R

    1975-10-06

    The carbohydrate content of mesosomal membranes of Micrococcus lysodeikticus has been shown to be consistently higher (about four times) than that of corresponding plasma membrane preparations. Analysis of washed membrane fractions by gas-liquid chromatography indicated that mannose was the major neutral sugar of both types of membrane (accounting for 95 and 89%, respectively, of the mesosomal and plasma membrane carbohydrate). Small amounts of inositol, glucose and ribose were also detected. We have shown by polyacrylamide gel electrophoresis in sodium dodecylsulphate and by precipitation and agar gel diffusion experiments with concanavalin A that a mannan is the major carbohydrate component of both types of membrane. This polymer can be selectively released from mesosomal membranes by a simple procedure involving low ionic strength-shock and heating to 80 degrees C for 1 min, and purified by ultrafiltration and ethanol precipitation. The mannan contains mannose as the only neutral carbohydrate, is not phosphorylated and does not contain significant amounts of amino sugars or uronic acids. Agar gel electrophoresis experiments, however, indicate an anionic polymer whose acidic properties are eliminated upon mild base hydrolysis. Analysis of native mannan by infrared spectroscopy reveals absorption bands attributable to ester carbonyl groups and to carboxylate ions, consistent with the presence of succinyl residues in the polymer (Owen, P. and Salton, M.R.J. (1975) Biochem, Biophys. Res. Commun. 63, 875--800). A sedimentation coefficient of 1.39 S was obtained by analytical ultracentrifugation in 1.0 M NaCl and a value of one reducing equivalent per 50 mannose residues by reduction with NaB3H4. The polysaccharide was only slightly degraded (2%) by jack bean alpha-mannosidase and could precipitate 15 times its own weight of concanavalin A. The acidic polymers was also detected in the cell "periplasm" and was secreted from cells grown in defined media during the

  4. Analysis of the composition of Brazilian propolis extracts by chromatography and evaluation of their in vitro activity against gram-positive bacteria Análise da composição de extratos de própolis brasileiros por cromatografia e avaliação de sua atividade in vitro sobre bactérias

    Directory of Open Access Journals (Sweden)

    Alexandra C. H. F. Sawaya

    2004-06-01

    Full Text Available Brazilian propolis from São Paulo state was submitted to extraction using several solvents, resulting in extracts with different composition. These extracts were submitted to Thin Layer Chromatography (TLC. Bioauthographic analysis of the TLC plates identified fractions with inhibitory activity, which were then analysed by High Performance Liquid Chromatography (HPLC. In vitro assays, commonly used to evaluate the activity of propolis against Gram-positive bacteria, were compared to determine which rendered the most consistent results. The bactericidal activity of these extracts were analysed by Serial Dilution in Tubes and Agar Plate Diffusion. Serial Dilution in Tubes obtained the most consistent results, with the Minimal Bactericidal Concentration of the extracts ranging between 2.5 and 20.0 mg/mL, for the species of Gram-positive bacteria tested. The results of the Agar Plate Diffusion were directly proportional to the hydro-solubility of the extracts and did not evaluate their bactericidal activity correctly. The bactericidal activity of this sample of propolis was due to the combined effect of several components that were identified by HPLC and were best extracted using 50% ethanol as a solvent.Própolis brasileira, proveniente do estado de São Paulo, foi submetida à extração usando vários solventes, resultando em extratos com diferentes composições. Estes extratos foram submetidos à Cromatografia em Camada Delgada (CCD. Análise bioautográfica das placas de CCD permitiu identificar as frações com atividade antimicrobiana, que foram então analisadas por Cromatografia Líquida de Alta Eficiência (CLAE. Ensaios in vitro freqüentemente utilizados para avaliar a atividade de própolis frente a bactérias Gram-positivas foram comparados para determinar qual renderia os resultados mais consistentes. A atividade bactericida destes extratos foi analisada por Diluição Seriada em Tubos e por testes de Difusão em Agar. O método de

  5. Permeabilization of ultraviolet-irradiated chinese hamster cells with polyethylene glycol and introduction of ultraviolet endonuclease from Micrococcus luteus

    International Nuclear Information System (INIS)

    Yarosh, D.B.; Setlow, R.B.

    1981-01-01

    Chinese hamster V-79 cells were made permeable by treatment with polyethylene glycol and then incubated with a Micrococcus luteus extract containing ultraviolet-specific endonuclease activity. This treatment introduced nicks in irradiated, but not in unirradiated, deoxyribonucleic acid. The nicks remained open for at least 3 h; there was no loss of endonuclease-sensitive sites, and no excision of dimers as measured by chromatography was detected. In addition, there was no increase in ultraviolet resistance in treated cells. This suggests that the absence of a significant amount of excision repair in rodent cells is due to the lack of both incision and excision capacity

  6. Comparison of the cleavage of pyrimidine dimers by the bacteriophage T4 and Micrococcus luteus uv-specific endonucleases

    International Nuclear Information System (INIS)

    Gordon, L.K.; Haseltine, W.A.

    1980-01-01

    A comparison was made of the activity of the uv-specific endonucleases of bacteriophage T4 (T4 endonuclease V) and of Micrococcus luteus on ultraviolet light-irradiated DNA substrates of defined sequence. The two enzyms cleave DNA at the site of pyrimidine dimers with the same frequency. The products of the cleavage reaction are the same. The pyrimidine dimer DNA-glycosylase activity of both enzymes is more active on double-stranded DNA than it is on single-stranded DNA

  7. Studies on the Mechanism of Radiation Resistance in Micrococcus Radiodurans and its Sensitization

    Energy Technology Data Exchange (ETDEWEB)

    Kitayama, S.; Matsuyama, A. [Radiobiology Laboratory, Institute of Physical and Chemical Research, Wako-shi, Saitama-ken (Japan)

    1978-06-15

    Efficient and accurate repair of radiation-induced lesions in M. radiodurans was investigated as to the cause of its extreme radioresistance. The cells were made permeable to deoxyribonucleoside triphosphate by treatment with non-ionic detergent, Triton X-100. After irradiation with 2 krad gamma rays more than 80% of the single-strand scissions were rejoined in the permeable cells within 10 min at 37 Degree-Sign C. This fast repair process requires the presence of deoxyribonucleoside triphosphates and NAD. However, rejoining of DNA strand scission was incomplete after prolonged incubation in the permeable cells. This suggests that alternate repair reaction(s) is necessary for complete recovery. The other type of radiation lesion was found by postirradiation incubation at non-permissive temperature, which markedly sensitizes this bacterium to radiation. Postincubation at this temperature also sensitizes the cells to chemicals that damage DNA. The extreme radioresistance of this bacterium was also lost by mutation and an isolated radiosensitive mutant showed almost the same radiosensitivity as E. coli K12 or B/r. These results are discussed in connection with the extreme radioresistance of M. radiodurans. (author)

  8. Studies on the mechanism of radiation resistance in Micrococcus radiodurans and its sensitization

    International Nuclear Information System (INIS)

    Kitayama, S.; Matsuyama, A.

    1978-01-01

    Efficient and accurate repair of radiation-induced lesions in M. radiodurans was investigated as to the cause of its extreme radioresistance. The cells were made permeable to deoxyribonucleoside triphosphate by treatment with non-ionic detergent, Triton X-100. After irradiation with 2 krad gamma rays more than 80% of the single-strand scissions were rejoined in the permeable cells within 10 min at 37 0 C. This fast repair process requires the presence of deoxyribonucleoside triphosphates and NAD. However, rejoining of DNA strand scission was incomplete after prolonged incubation in the permeable cells. This suggests that alternate repair reaction(s) is necessary for complete recovery. The other type of radiation lesion was found by post-irradiation incubation at non-permissive temperature, which markedly sensitizes this bacterium to radiation. Postincubation at this temperature also sensitizes the cells to chemicals that damage DNA. The extreme radioresistance of this bacterium was also lost by mutation and an isolated radiosensitive mutant showed almost the same radiosensitivity as E. coli K12 or B/r. These results are discussed in connection with the extreme radioresistance of M. radiodurans. (author)

  9. Optimization of culture conditions and medium composition for the production of micrococcin GO5 by Micrococcus sp. GO5.

    Science.gov (United States)

    Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

    2006-01-02

    To enhance the production of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5, cultivation conditions and medium composition were optimized. The optimal initial pH and temperature for bacteriocin production were 7.0-9.0 and 37 degrees C, respectively. Micrococcus sp. GO5 displayed the highest micrococcin GO5 activity when grown in modified MRS medium that contained lactose or sucrose, rather than glucose, as a carbon source. The maximum bacteriocin activity was obtained in modified MRS medium containing 0.5% tryptone and 1.0% yeast extract as nitrogen sources instead of the other nitrogen sources present in MRS medium. Bacteriocin production was greatly affected by the concentration of K(2)HPO(4); strain GO5 produced eight-fold more bacteriocin in medium containing 2.0-2.5% K(2)HPO(4) than in medium containing 0.2% K(2)HPO(4). The optimal concentration of MgSO(4).7H(2)O for bacteriocin production was 0.5%. The production of micrococcin GO5 was increased 32-fold in shake flask culture and 16-fold in a bioreactor using the optimized medium (TY medium), compared with culturing in MRS medium.

  10. Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida.

    Science.gov (United States)

    Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y I; Stothard, Paul

    2016-01-01

    We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds.

  11. [Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

    Science.gov (United States)

    Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

    2008-10-01

    To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

  12. Genes involved in long-chain alkene biosynthesis in Micrococcus luteus.

    Science.gov (United States)

    Beller, Harry R; Goh, Ee-Been; Keasling, Jay D

    2010-02-01

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which 4 decades ago was reported to biosynthesize iso- and anteiso-branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty acid-overproducing Escherichia coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-coenzyme A (CoA) produced the same C(27) monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or-ACP [acyl carrier protein]) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (beta-ketoacyl-ACP synthase III), which

  13. Inhibitory effect of beta-pinene, alpha-pinene and eugenol on the growth of potential infectious endocarditis causing Gram-positive bacteria Efeito inibitório de eugenol, beta-pineno e alfa-pineno sobre o crescimento de bactérias Gram-positivas potencialmente causadoras de endocardite infecciosa

    Directory of Open Access Journals (Sweden)

    Aristides Medeiros Leite

    2007-03-01

    Full Text Available This study was led with the purpose of evaluating the effectiveness of eugenol, beta-pinene and alpha-pinene in inhibiting the growth of potential infectious endocarditis causing gram-positive bacteria. The phytochemicals Minimum Inhibitory Concentration-MIC was determined by solid medium diffusion procedure, while the interference of the MIC values on the bacterial cell viability was performed by viable cells count. Staphylococcus aureus, S. epidermidis, Streptococcus pneumoniae and S. pyogenes strains were used as test microorganisms. The assayed phytochemicals showed effectiveness in inhibiting all assayed bacteria strains presenting MIC values between 2.5 and 40 µL/mL. Eugenol showed the lowest MIC values which were between 2.5 and 5 µL/mL for the most bacteria strains. MIC values found to the phytochemicals were able to inhibit the cell viability of S. aureus providing a total elimination of the bacteria inoculum in a maximum time of 24 hours of exposure. These data showed the interesting antibacterial property of the assayed phytochemicals and support their possible and rational use in the antimicrobial therapy.Este estudo foi conduzido com a proposta de avaliar a efetividade de eugenol, beta-pineno e alfa-pineno em inibir o crescimento de cepas de bactérias Gram-positivas potencialmente causadoras de endocardite infecciosa. A Concentração Inibitória Mínima-CIM dos fitoconstituintes foi determinada através do método de difusão em meio sólido, enquanto a interferência da CIM sobre a viabilidade celular bacteriana foi avaliada através da contagem de células viáveis. Cepas de Staphylococcus aureus, S. epidermidis, Streptococcus pneumoniae e S. pyogenes foram utilizadas como microrganismos teste nos ensaios antimicrobianos. Os fitoconstituintes ensaiados mostraram efetividade em inibir todas as cepas bacterianas utilizadas como microrganismos testes apresentando valores de CIM entre 2.5 e 40 µL/mL. Eugenol apresentou os menores

  14. Microinjection of Micrococcus luteus UV-endonuclease restores UV-induced unscheduled DNA synthesis in cells of 9 xeroderma pigmentosum complementation groups.

    NARCIS (Netherlands)

    A.J.R. de Jonge; W. Vermeulen (Wim); W. Keijzer; J.H.J. Hoeijmakers (Jan); D. Bootsma (Dirk)

    1985-01-01

    textabstractThe UV-induced unscheduled DNA synthesis (UDS) in cultured cells of excision-deficient xeroderma pigmentosum (XP) complementation groups A through I was assayed after injection of Micrococcus luteus UV-endonuclease using glass microneedles. In all complementation groups a restoration of

  15. Hexavalent uranium reduction from solid phase by thermophilic bacterium Thermoterrabacterium ferrireducens

    International Nuclear Information System (INIS)

    Khijniak, T.V.; Slobodkin, A.I.; Bonch-Osmolovskaya, E.A.; Medvedeva-Lyalikova, N.N.; Coker, V.; Lloyd, J.R.; Birkeland, N.K.

    2005-01-01

    Full text of publication follows: It has been reported that in uranium-contaminated sites, solid-phase U(VI) present in sediments is resistant to microbial reduction. Also, it was demonstrated that mesophilic iron and sulfate-reducing bacteria can reduce hexavalent uranium and sulphate-reducing bacteria were able to grow via uranium reduction. Among thermophilic microorganisms reduction of hexavalent uranium has been demonstrated only for cell suspensions of two genera: Pyrobaculum and Thermus. In the present study, Thermoterrabacterium ferrireducens was tested for reduction of U(VI), a thermophilic, gram-positive anaerobic bacterium capable for growth with the reduction of various electron acceptors including Fe(III). Kinetic of bacterial growth, uranium reduction and influence of different uranium concentrations were investigated at 65 deg. C. Due to presence of phosphate in the basal medium yellow uranium phosphate precipitate was formed after addition of uranyl acetate. After 68 h of incubation control tubes without bacteria were contained yellow precipitate whereas in presence of bacteria precipitate turned to the grey color. In the control tubes uranium phosphates and other elements formed a uniform mixture of crystals, but in presence of bacteria the round shape particles, containing uranium, were found by Environmental Scan Electron Microscopy of air-dried or frozen samples. To determine valent state speciation spectroscopic investigations were performed also. Initial yellow uranium phosphate precipitate was separated and identified as uramphite - (NH 4 )(UO 2 )(PO 4 )*3H 2 O by X-Ray Powder Diffraction. Grey precipitate, which was formed by bacterial reduction, was identified as ningyoite - CaU(PO 4 ) 2 *H 2 O. The fact that final grey precipitate contain U(IV) was also confirmed by EXAFS investigation. High concentration of uranium has toxic effect. 1 and 2.5 mM of uranium (VI) support bacterial growth and bacterial biomass was accumulated, but if 5 or 10

  16. Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia.

    Science.gov (United States)

    Abd Rahman, Raja Noor Zaliha Raja; Leow, Thean Chor; Salleh, Abu Bakar; Basri, Mahiran

    2007-08-10

    Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78 degrees C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0) as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5-99.2%). Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70 degrees C and was also stable up to 60 degrees C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T) and Geobacillus kaustophilus (DSM 7263T). Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T). Strain T1T was able to secrete extracellular thermostable lipase into culture

  17. Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia

    Directory of Open Access Journals (Sweden)

    Salleh Abu

    2007-08-01

    Full Text Available Abstract Background Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78°C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0 as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5–99.2%. Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Results Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70°C and was also stable up to 60°C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T and Geobacillus kaustophilus (DSM 7263T. Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T. Conclusion Strain T1T was able to secrete extracellular

  18. [Identification, colonization and disease prevention capacity of an antagonistic bacterium against Ralstonia Solanacearum].

    Science.gov (United States)

    Li, Zhikun; Zhu, Honghui

    2010-03-01

    To isolate a bacterial strain YPP-9, dominantly colonizing the rhizosphere of tomato using root exudate medium. In this study, we investigated the antagnism and disease-controling effect against Ralstonia solanacearum, evaluated the ability to colonize the rhizosphere of tomato, and further analyzed the phylogeny of YPP-9. To evaluate the antagnism against R. solanacearum and the biocontrol on tomato bacterial wilt by YPP-9 respectively employing plate culture method and pot experiment in green house. We analyzed the rhizosphere colonization of YPP-9 by PCR-denaturing gradient gel electrophoresis, and also identified the taxonomic position of YPP-9 using morphological and chemotaxonomic characteristics together with 16S rRNA gene phylogenetic analysis. YPP-9 suppressed the growth of R. solanacearum (strains SSF-4) in vitro with the inhibition zone of 5 mm. The disease-control efficiency against tomato bacterial wilt in pot was 63.4%. YPP-9 also colonized the rhizosphere of tomato well. The colonies were cream in colour after 24 h culture. Cells were gram-positive, rods (1.8 -4.1 microm x 0.9 - 1.1 microm) and formed endospores. Endospores were mainly ellipsoidal to cylindrical and lied in subterminal, and occasionally paracentral, positions in no swollen sporangia. No crystal protein. The pH range for YPP-9 growth was 5.5 - 8.5 with the optimum at pH 6.0, and the temperature for YPP-9 growth was 20 to 45 degrees with the optimum at 30 degrees. The results of BIOLOG GP2 showed that YPP-9 was Bacillus. Phylogenetic analysis of the 16S rRNA gene sequence revealed that YPP-9 was the most closely related to Bacillus fumarioli, with the sequence similarity of 97.7%. The sequence number was FJ231500. The DNA G + C content was 41.9%. The major menaquinone was MK-7. The dominant fatty acids in cell wall were C14 : 0 iso, C15 : 0 iso, C16 : 0 iso and C16 : 1omega 7c alcohol, with the contents of 28.27%, 19.59%, 12.93% and 10.88%, respectively. Bacterium YPP-9 strongly

  19. A novel marine bacterium Isoptericola sp. JS-C42 with the ability to saccharifying the plant biomasses for the aid in cellulosic ethanol production

    Directory of Open Access Journals (Sweden)

    Velayudhan Satheeja Santhi

    2014-06-01

    Full Text Available The ever growing demands for food products such as starch and sugar produces; there is a need to find the sources for saccharification for cellulosic bioethanol production. This study provides the first evidence of the lignocellulolytic and saccharifying ability of a marine bacterium namely Isoptericola sp. JS-C42, a Gram positive actinobacterium with the cocci cells embedded on mycelia isolated from the Arabian Sea, India. It exhibited highest filter paper unit effect, endoglucanase, exoglucanase, cellobiohydrolase, β-glucosidase, xylanase and ligninase effect. The hydrolytic potential of the enzymes displayed the efficient saccharification capability of steam pretreated biomass. It was also found to degrade the paddy, sorghum, Acacia mangium and Ficus religiosa into simple reducing sugars by its efficient lignocellulose enzyme complex with limited consumption of sugars. Production of ethanol was also achieved with the Saccharomyces cerevisiae. Overall, it offers a great potential for the cellulosic ethanol production in an economically reliable and eco-friendly point-of-care.

  20. Lysinibacillus louembei sp. nov., a spore-forming bacterium isolated from Ntoba Mbodi, alkaline fermented leaves of cassava from the Republic of the Congo

    DEFF Research Database (Denmark)

    Ouoba, Labia Irène I.; Mbozo, Alain B. Vouidibio; Thorsen, Line

    2015-01-01

    . xylanilyticus DSM 23493T and L. odysseyi DSM 18869T was 41%, 16% and 15%, respectively. The internal transcribed spacer-PCR profile of the isolate was different from those of closely related bacteria. The cellwall peptidoglycan type was A4α, L-Lys-D-Asp and the major fatty acids were iso-C15:0, anteiso-C15......Investigation of the microbial diversity of Ntoba Mbodi, an African food made from the alkaline fermentation of cassava leaves, revealed the presence of a Gram-positive, catalase-positive, aerobic, motile and rod-shaped endospore-forming bacterium (NM73) with unusual phenotypic and genotypic......:0, anteiso-C17:0 and iso-C17:0 and iso-C17:1ω10c. The polar lipids included phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylglycerol, phosphoaminolipid, aminolipid, two phospholipids and two unknown lipids. The predominant menaquinones were MK-7 and MK-6.Ribose was the only whole-cell sugar...

  1. Chloride and organic osmolytes: a hybrid strategy to cope with elevated salinities by the moderately halophilic, chloride-dependent bacterium Halobacillus halophilus.

    Science.gov (United States)

    Saum, Stephan H; Pfeiffer, Friedhelm; Palm, Peter; Rampp, Markus; Schuster, Stephan C; Müller, Volker; Oesterhelt, Dieter

    2013-05-01

    Salt acclimation in moderately halophilic bacteria is the result of action of a grand interplay orchestrated by signals perceived from the environment. To elucidate the cellular players involved in sensing and responding to changing salinities we have determined the genome sequence of Halobacillus halophilus, a Gram-positive moderate halophilic bacterium that has a strict requirement for the anion chloride. Halobacillus halophilus synthesizes a multitude of different compatible solutes and switches its osmolyte strategy with the external salinity and growth phase. Based on the emerging genome sequence, the compatible solutes glutamate, glutamine, proline and ectoine have already been experimentally studied. The biosynthetic routes for acetyl ornithine and acetyl lysine are also delineated from the genome sequence. Halobacillus halophilus is nutritionally very versatile and most compatible solutes cannot only be produced but also used as carbon and energy sources. The genome sequence unravelled isogenes for many pathways indicating a fine regulation of metabolism. Halobacillus halophilus is unique in integrating the concept of compatible solutes with the second fundamental principle to cope with salt stress, the accumulation of molar concentrations of salt (Cl(-)) in the cytoplasm. Extremely halophilic bacteria/archaea, which exclusively rely on the salt-in strategy, have a high percentage of acidic proteins compared with non-halophiles with a low percentage. Halobacillus halophilus has an intermediate position which is consistent with its ability to integrate both principles. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  2. Microbial culturomics to isolate halophilic bacteria from table salt: genome sequence and description of the moderately halophilic bacterium Bacillus salis sp. nov.

    Science.gov (United States)

    Seck, E H; Diop, A; Armstrong, N; Delerce, J; Fournier, P-E; Raoult, D; Khelaifia, S

    2018-05-01

    Bacillus salis strain ES3 T (= CSUR P1478 = DSM 100598) is the type strain of B. salis sp. nov. It is an aerobic, Gram-positive, moderately halophilic, motile and spore-forming bacterium. It was isolated from commercial table salt as part of a broad culturomics study aiming to maximize the culture conditions for the in-depth exploration of halophilic bacteria in salty food. Here we describe the phenotypic characteristics of this isolate, its complete genome sequence and annotation, together with a comparison with closely related bacteria. Phylogenetic analysis based on 16S rRNA gene sequences indicated 97.5% similarity with Bacillus aquimaris, the closest species. The 8 329 771 bp long genome (one chromosome, no plasmids) exhibits a G+C content of 39.19%. It is composed of 18 scaffolds with 29 contigs. Of the 8303 predicted genes, 8109 were protein-coding genes and 194 were RNAs. A total of 5778 genes (71.25%) were assigned a putative function.

  3. Characterization of the arabinoxylan-degrading machinery of the thermophilic bacterium Herbinix hemicellulosilytica-Six new xylanases, three arabinofuranosidases and one xylosidase.

    Science.gov (United States)

    Mechelke, M; Koeck, D E; Broeker, J; Roessler, B; Krabichler, F; Schwarz, W H; Zverlov, V V; Liebl, W

    2017-09-10

    Herbinix hemicellulosilytica is a newly isolated, gram-positive, anaerobic bacterium with extensive hemicellulose-degrading capabilities obtained from a thermophilic biogas reactor. In order to exploit its potential as a source for new industrial arabinoxylan-degrading enzymes, six new thermophilic xylanases, four from glycoside hydrolase family 10 (GH10) and two from GH11, three arabinofuranosidases (1x GH43, 2x GH51) and one β-xylosidase (GH43) were selected. The recombinantly produced enzymes were purified and characterized. All enzymes were active on different xylan-based polysaccharides and most of them showed temperature-vs-activity profiles with maxima around 55-65°C. HPAEC-PAD analysis of the hydrolysates of wheat arabinoxylan and of various purified xylooligosaccharides (XOS) and arabinoxylooligosaccharides (AXOS) was used to investigate their substrate and product specificities: among the GH10 xylanases, XynB showed a different product pattern when hydrolysing AXOS compared to XynA, XynC, and XynD. None of the GH11 xylanases was able to degrade any of the tested AXOS. All three arabinofuranosidases, ArfA, ArfB and ArfC, were classified as type AXH-m,d enzymes. None of the arabinofuranosidases was able to degrade the double-arabinosylated xylooligosaccharides XA 2+3 XX. β-Xylosidase XylA (GH43) was able to degrade unsubstituted XOS, but showed limited activity to degrade AXOS. Copyright © 2017. Published by Elsevier B.V.

  4. Microbial culturomics to isolate halophilic bacteria from table salt: genome sequence and description of the moderately halophilic bacterium Bacillus salis sp. nov.

    Directory of Open Access Journals (Sweden)

    E.H. Seck

    2018-05-01

    Full Text Available Bacillus salis strain ES3T (= CSUR P1478 = DSM 100598 is the type strain of B. salis sp. nov. It is an aerobic, Gram-positive, moderately halophilic, motile and spore-forming bacterium. It was isolated from commercial table salt as part of a broad culturomics study aiming to maximize the culture conditions for the in-depth exploration of halophilic bacteria in salty food. Here we describe the phenotypic characteristics of this isolate, its complete genome sequence and annotation, together with a comparison with closely related bacteria. Phylogenetic analysis based on 16S rRNA gene sequences indicated 97.5% similarity with Bacillus aquimaris, the closest species. The 8 329 771 bp long genome (one chromosome, no plasmids exhibits a G+C content of 39.19%. It is composed of 18 scaffolds with 29 contigs. Of the 8303 predicted genes, 8109 were protein-coding genes and 194 were RNAs. A total of 5778 genes (71.25% were assigned a putative function. Keywords: Bacillus salis, culturomics, genome, halophilic bacteria, human gut, taxonogenomics

  5. Behavior of the meat-borne bacterium Lactobacillus sakei during its transit through the gastrointestinal tracts of axenic and conventional mice.

    Science.gov (United States)

    Chiaramonte, Fabrizio; Blugeon, Sébastien; Chaillou, Stéphane; Langella, Philippe; Zagorec, Monique

    2009-07-01

    A Lactobacillus sakei strain named FLEC01 was isolated from human feces and characterized genotypically. Comparison of the genetic features of this strain with those of both the meat-borne L. sakei strain 23K and another human isolate, LTH5590, showed that they belong to different but closely related clusters. The three L. sakei strains did not persist and only transited through the gastrointestinal tracts (GITs) of conventional C3H/HeN mice. In contrast, they all colonized the GITs of axenic mice and rapidly reached a population of 10(9) CFU/g of feces, which remained stable until day 51. Five days after mice were fed, a first subpopulation, characterized by small colonies, appeared and reached 50% of the total L. sakei population in mice. Fifteen to 21 days after feeding, a second subpopulation, characterized by rough colonies, appeared. It coexisted with the two other populations until day 51, and its cell shapes were also affected, suggesting a dysfunction of the cell division or cell wall. No clear difference between the behaviors of the meat-borne strain and the two human isolates in both conventional and axenic mice was observed, suggesting that L. sakei is a food-borne bacterium rather than a commensal one and that its presence in human feces originates from diet. Previous observations of Escherichia coli strains suggest that the mouse GIT environment could induce mutations to increase their survival and colonization capacities. Here, we observed similar mutations concerning a food-grade gram-positive bacterium for the first time.

  6. Properties of an endonuclease activity in Micrococcus luteus acting on γ-irradiated DNA and on apurinic DNA

    International Nuclear Information System (INIS)

    Schaefer, G.; Haas, P.; Coquerelle, Th.; Hagen, U.

    1980-01-01

    A protein fraction from Micrococcus luteus with endonuclease activity against γ-irradiated DNA was isolated and characterized. An additional activity on apurinic sites could not be separated, either by sucrose gradient sedimentation or by gel filtration through Sephadex G 100. From gel filtration, a molecular weight of about 25 000 was calculated for both endonuclease activities. The endonuclease activity against γ-irradiated DNA was stimulated five-fold with 5 mM Mg ++ , whereas that against apurinic sites was less dependent on the Mg ++ concentration. 100 mM KCl inhibited the γ-ray endonuclease, but not the apurinic endonuclease activity. In γ-irradiated DNA the protein recognized 1.65 endonuclease sensitive sites per radiation-induced single-strand break, among which are 0.45 alkali labile lesions in the nucleotide strand. The was evaluated resulting in a Ksub(m)-value of 73 nM. (author)

  7. Effect of simulated microgravity on growth and production of exopolymeric substances of Micrococcus luteus space and earth isolates.

    Science.gov (United States)

    Mauclaire, Laurie; Egli, Marcel

    2010-08-01

    Microorganisms tend to form biofilms on surfaces, thereby causing deterioration of the underlaying material. In addition, biofilm is a potential health risk to humans. Therefore, microorganism growth is not only an issue on Earth but also in manned space habitats like the International Space Station (ISS). The aim of the study was to identify physiological processes relevant for Micrococcus luteus attachment under microgravity conditions. The results demonstrate that simulated microgravity influences physiological processes which trigger bacterial attachment and biofilm formation. The ISS strains produced larger amounts of exopolymeric substances (EPS) compared with a reference strain from Earth. In contrast, M. luteus strains were growing faster, and Earth as well as ISS isolates produced a higher yield of biomass under microgravity conditions than under normal gravity. Furthermore, microgravity caused a reduction of the colloidal EPS production of ISS isolates in comparison with normal gravity, which probably influences biofilm thickness and stability as well.

  8. Surface Plasmon Resonance based sensing of lysozyme in serum on Micrococcus lysodeikticus-modified graphene oxide surfaces.

    Science.gov (United States)

    Vasilescu, Alina; Gáspár, Szilveszter; Gheorghiu, Mihaela; David, Sorin; Dinca, Valentina; Peteu, Serban; Wang, Qian; Li, Musen; Boukherroub, Rabah; Szunerits, Sabine

    2017-03-15

    Lysozyme is an enzyme found in biological fluids, which is upregulated in leukemia, renal diseases as well as in a number of inflammatory gastrointestinal diseases. We present here the development of a novel lysozyme sensing concept based on the use of Micrococcus lysodeikticus whole cells adsorbed on graphene oxide (GO)-coated Surface Plasmon Resonance (SPR) interfaces. M. lysodeikticus is a typical enzymatic substrate for lysozyme. Unlike previously reported sensors which are based on the detection of lysozyme through bioaffinity interactions, the bioactivity of lysozyme will be used here for sensing purposes. Upon exposure to lysozyme containing serum, the integrity of the bacterial cell wall is affected and the cells detach from the GO based interfaces, causing a characteristic decrease in the SPR signal. This allows sensing the presence of clinically relevant concentrations of lysozyme in undiluted serum samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Ecofriendly degradation of sulfonated diazo dye C.I. Reactive Green 19A using Micrococcus glutamicus NCIM-2168.

    Science.gov (United States)

    Saratale, R G; Saratale, G D; Chang, J S; Govindwar, S P

    2009-09-01

    Micrococcus glutamicus NCIM-2168 exhibited complete decolorization and degradation of C.I. Reactive Green 19A (an initial concentration of 50 mg l(-1)) within 42 h at temperature 37 degrees C and pH 8, under static condition. Extent of mineralization was determined with total organic carbon (TOC) and chemical oxygen demand (COD) measurement, showing a satisfactory reduction of TOC (72%) and COD (66%) within 42 h. Enzyme studies shows involvement of oxidoreductive enzymes in decolorization/degradation process. Analytical studies of the extracted metabolites confirmed the significant degradation of Reactive Green 19A into various metabolites. The microbial toxicity and phytotoxicity assay revealed that the degradation of Reactive Green 19A produced nontoxic metabolites. In addition, the M. glutamicus strain was applied to decolorize a mixture of ten reactive dyes showing a 63% decolorization (in terms of decrease in ADMI value) within 72 h, along with 48% and 42% reduction in TOC and COD under static condition.

  10. An analysis of the repair processes in ultraviolet-irradiated Micrococcus luteus using purified ultraviolet-endonuclease

    International Nuclear Information System (INIS)

    Tomilin, N.V.; Zherebtsov, S.V.

    1982-01-01

    The measurement of the frequency of endonucleolytic incisions in ultraviolet-irradiated DNA serves as the test for the presence of pyrimidine dimers. In accordance with this approach, the lysates of three Micrococcus luteus strains containing radioactively labeled chromosomes were treated with purified M. luteus ultraviolet-endonuclease to trace segregation of dimers amongst parental and newly synthesized DNA and their removal during postreplication and excision DNA repair. A considerable proportion of the dimers in all strains tested proved to be insensitive to the action of exogenous incising enzyme. The use of chloramphenicol as an inhibitor of postirradiation protein synthesis in combination with ultraviolet-endonuclease treatment of DNA allowed to reveal at least two alternative pathways of postreplication repair: constitutively active recombinational pathway and inducible nonrecombinational one. (Auth.)

  11. Properties of an endonuclease activity in Micrococcus luteus acting on. gamma. -irradiated DNA and on apurinic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, G; Haas, P; Coquerelle, Th; Hagen, U [Kernforschungszentrum Karlsruhe G.m.b.H. (Germany, F.R.). Inst. fuer Genetik und fuer Toxikologie von Spaltstoffen

    1980-01-01

    A protein fraction from Micrococcus luteus with endonuclease activity against ..gamma..-irradiated DNA was isolated and characterized. An additional activity on apurinic sites could not be separated, either by sucrose gradient sedimentation or by gel filtration through Sephadex G 100. From gel filtration, a molecular weight of about 25 000 was calculated for both endonuclease activities. The endonuclease activity against ..gamma..-irradiated DNA was stimulated five-fold with 5 mM Mg/sup + +/, whereas that against apurinic sites was less dependent on the Mg/sup + +/ concentration. 100 mM KCl inhibited the ..gamma..-ray endonuclease, but not the apurinic endonuclease activity. In ..gamma..-irradiated DNA the protein recognized 1.65 endonuclease sensitive sites per radiation-induced single-strand break, among which are 0.45 alkali labile lesions in the nucleotide strand. The was evaluated resulting in a Ksub(m)-value of 73 nM.

  12. Micrococcus luteus correndonucleases. III. Evidence for involvement in repair in vivo of two endonucleases specific for DNA containing pyrimidine dimers

    International Nuclear Information System (INIS)

    Riazuddin, S.; Grossman, L.; Mahler, I.

    1977-01-01

    Involvement of Py--Py correndonucleases I and II in repair of ultraviolet radiation damage in vivo by Micrococcus luteus has been demonstrated by their absence in the ultraviolet-sensitive mutant DB-7 derived by treatment of the wild type parent with N-methyl-N'-nitro-N-nitrosoguanidine. The necessity for their combined action in DNA repair in M. luteus is shown by: (a) reactivation of ultraviolet-damaged phiX174 RFI DNA in incision-defective hosts after in vivo treatment with both enzymes, (b) correlation between survival after ultraviolet irradiation and the level of the two enzymes, and (c) increased levels of repair synthesis after ultraviolet irradiation of toluenized cells DB-400 with wild type correndonuclease levels when compared with the transformant DB-200 and the mutant DB-7, which lack one or both enzymes

  13. Agrobacterium tumefaciens is a diazotrophic bacterium

    International Nuclear Information System (INIS)

    Kanvinde, L.; Sastry, G.R.K.

    1990-01-01

    This is the first report that Agrobacterium tumefaciens can fix nitrogen in a free-living condition as shown by its abilities to grown on nitrogen-free medium, reduce acetylene to ethylene, and incorporate 15 N supplied as 15 N 2 . As with most other well-characterized diazotrophic bacteria, the presence of NH 4 + in the medium and aerobic conditions repress nitrogen fixation by A. tumefaciens. The system requires molybdenum. No evidence for nodulation was found with pea, peanut, or soybean plants. Further understanding of the nitrogen-fixing ability of this bacterium, which has always been considered a pathogen, should cast new light on the evolution of a pathogenic versus symbiotic relationship

  14. Agrobacterium tumefaciens is a diazotrophic bacterium

    Energy Technology Data Exchange (ETDEWEB)

    Kanvinde, L.; Sastry, G.R.K. (Univ. of Leeds (England))

    1990-07-01

    This is the first report that Agrobacterium tumefaciens can fix nitrogen in a free-living condition as shown by its abilities to grown on nitrogen-free medium, reduce acetylene to ethylene, and incorporate {sup 15}N supplied as {sup 15}N{sub 2}. As with most other well-characterized diazotrophic bacteria, the presence of NH{sub 4}{sup +} in the medium and aerobic conditions repress nitrogen fixation by A. tumefaciens. The system requires molybdenum. No evidence for nodulation was found with pea, peanut, or soybean plants. Further understanding of the nitrogen-fixing ability of this bacterium, which has always been considered a pathogen, should cast new light on the evolution of a pathogenic versus symbiotic relationship.

  15. The chemical formula of a magnetotactic bacterium.

    Science.gov (United States)

    Naresh, Mohit; Das, Sayoni; Mishra, Prashant; Mittal, Aditya

    2012-05-01

    Elucidation of the chemical logic of life is one of the grand challenges in biology, and essential to the progress of the upcoming field of synthetic biology. Treatment of microbial cells explicitly as a "chemical" species in controlled reaction (growth) environments has allowed fascinating discoveries of elemental formulae of a few species that have guided the modern views on compositions of a living cell. Application of mass and energy balances on living cells has proved to be useful in modeling of bioengineering systems, particularly in deriving optimized media compositions for growing microorganisms to maximize yields of desired bio-derived products by regulating intra-cellular metabolic networks. In this work, application of elemental mass balance during growth of Magnetospirillum gryphiswaldense in bioreactors has resulted in the discovery of the chemical formula of the magnetotactic bacterium. By developing a stoichiometric equation characterizing the formation of a magnetotactic bacterial cell, coupled with rigorous experimental measurements and robust calculations, we report the elemental formula of M. gryphiswaldense cell as CH(2.06)O(0.13)N(0.28)Fe(1.74×10(-3)). Remarkably, we find that iron metabolism during growth of this magnetotactic bacterium is much more correlated individually with carbon and nitrogen, compared to carbon and nitrogen with each other, indicating that iron serves more as a nutrient during bacterial growth rather than just a mineral. Magnetotactic bacteria have not only invoked some interest in the field of astrobiology for the last two decades, but are also prokaryotes having the unique ability of synthesizing membrane bound intracellular organelles. Our findings on these unique prokaryotes are a strong addition to the limited repertoire, of elemental compositions of living cells, aimed at exploring the chemical logic of life. Copyright © 2011 Wiley Periodicals, Inc.

  16. Biosynthesis of gold nanoparticles by the extreme bacterium Deinococcus radiodurans and an evaluation of their antibacterial properties

    Directory of Open Access Journals (Sweden)

    Li J

    2016-11-01

    Full Text Available Jiulong Li,1,* Qinghao Li,1,* Xiaoqiong Ma,2,* Bing Tian,1 Tao Li,1 Jiangliu Yu,1 Shang Dai,1 Yulan Weng,1 Yuejin Hua1 1Key Laboratory for Nuclear-Agricultural Sciences of Chinese Ministry of Agriculture and Zhejiang Province, Institute of Nuclear-Agricultural Sciences, Zhejiang University, 2Central Laboratory, The First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, China *These authors contributed equally to this work Abstract: Deinococcus radiodurans is an extreme bacterium known for its high resistance to stresses including radiation and oxidants. The ability of D. radiodurans to reduce Au(III and biosynthesize gold nanoparticles (AuNPs was investigated in aqueous solution by ultraviolet and visible (UV/Vis absorption spectroscopy, electron microscopy, X-ray diffraction (XRD, dynamic light scattering (DLS, Fourier transform infrared spectroscopy (FTIR and X-ray photoelectron spectroscopy (XPS. D. radiodurans efficiently synthesized AuNPs from 1 mM Au(III solution in 8 h. The AuNPs were of spherical, triangular and irregular shapes with an average size of 43.75 nm and a polydispersity index of 0.23 as measured by DLS. AuNPs were distributed in the cell envelope, across the cytosol and in the extracellular space. XRD analysis confirmed the crystallite nature of the AuNPs from the cell supernatant. Data from the FTIR and XPS showed that upon binding to proteins or compounds through interactions with carboxyl, amine, phospho and hydroxyl groups, Au(III may be reduced to Au(I, and further reduced to Au(0 with the capping groups to stabilize the AuNPs. Biosynthesis of AuNPs was optimized with respect to the initial concentration of gold salt, bacterial growth period, solution pH and temperature. The purified AuNPs exhibited significant antibacterial activity against both Gram-negative (Escherichia coli and Gram-positive (Staphylococcus aureus bacteria by damaging their cytoplasmic membrane. Therefore, the extreme

  17. ORIGIN OF PALMITIC ACID CARBON IN PALMITATES FORMED FROM HEXADECANE-1-C14 AND TETRADECANE-1-C14 BY MICROCOCCUS CERIFICANS

    Science.gov (United States)

    Finnerty, W. R.; Kallio, R. E.

    1964-01-01

    Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700

  18. Ethanologenic potential of the bacterium Bacillus cereus NB-19 in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-01

    Dec 1, 2009 ... Ethanologenic bacterium was cultivated in a suspension of sugarcane ... bagasse is very useful for obtaining yields of the different products including cell mass and ethanol as ... the resources for the green fuel generation.

  19. Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.

    Science.gov (United States)

    Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S

    2017-09-01

    Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.

  20. Taxonomic characterization of the cellulose-degrading bacterium NCIB 10462

    Energy Technology Data Exchange (ETDEWEB)

    Dees, C.; Ringleberg, D.; Scott, T.C. [Oak Ridge National Lab., TN (United States); Phelps, T. [Univ. of Tennessee, Knoxville, TN (United States)

    1994-06-01

    The gram negative cellulase-producing bacterium NCIB 10462 has been previously named Pseudomonas fluorescens subsp. or var. cellulosa. Since there is renewed interest in cellulose-degrading bacteria for use in bioconversion of cellulose to chemical feed stocks and fuels, we re-examined the characteristics of this microorganism to determine its proper taxonomic characterization and to further define it`s true metabolic potential. Metabolic and physical characterization of NCIB 10462 revealed that this was an alkalophilic, non-fermentative, gram negative, oxidase positive, motile, cellulose-degrading bacterium. The aerobic substrate utilization profile of this bacterium was found to have few characteristics consistent with a classification of P. fluorescens with a very low probability match with the genus Sphingomonas. Total lipid analysis did not reveal that any sphingolipid bases are produced by this bacterium. NCIB 10462 was found to grow best aerobically but also grows well in complex media under reducing conditions. NCIB 10462 grew slowly under full anaerobic conditions on complex media but growth on cellulosic media was found only under aerobic conditions. Total fatty acid analysis (MIDI) of NCIB 10462 failed to group this bacterium with a known pseudomonas species. However, fatty acid analysis of the bacteria when grown at temperatures below 37{degrees}C suggest that the organism is a pseudomonad. Since a predominant characteristic of this bacterium is it`s ability to degrade cellulose, we suggest it be called Pseudomonas cellulosa.