WorldWideScience

Sample records for glyphosate tolerant fescue

  1. 76 FR 27268 - Glyphosate; Pesticide Tolerance

    Science.gov (United States)

    2011-05-11

    ... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 180 [EPA-HQ-OPP-2010-0938; FRL-8872-6] Glyphosate... regulation increases the established tolerance for residues of glyphosate in or on corn, field, forage... tolerance for residues of the herbicide glyphosate, N-(phosphonomethyl) glycine, in or on corn, field...

  2. 78 FR 60707 - Glyphosate; Pesticide Tolerances

    Science.gov (United States)

    2013-10-02

    ... chromatography/mass spectrometry/mass spectrometry Method 15444) is available to enforce the tolerance expression...) 566-1744, and the telephone number for the OPP Docket is (703) 305- 5805. Please review the visitor...-acetyl-glyphosate (expressed as glyphosate equivalents). VI. Statutory and Executive Order Reviews This...

  3. Natural glyphosate tolerance in sweetvetch Hedysarum boreale

    Science.gov (United States)

    Sweetvetch (Hedysarum boreale Nutt.) a legume native to the western USA and Canada, is purported to have tolerance to glyphosate {N-(phosphonomethyl) glycine} herbide. Eight rates of glyphosate were tested for their effect on biomass yield (BMY) and survival of seedlings and mature plants. Treatme...

  4. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  5. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  6. Glyphosate tolerance of soybean mutant gained after boarding on satellite

    International Nuclear Information System (INIS)

    Jiang Lingxue; Ren Honglei; Zhang Hongyan; Liu Zhangxiong; Jin Longguo; Guo Yong; Qiu Lijuan; Tao Bo

    2011-01-01

    Glyphosate-tolerant germplasm and genetic variation characteristics of SP 2 and SP 3 soybean varieties boarded on Shijian No.8 satellite were analyzed after treated by herbicide glyphosate in the field. Abundant variations of traits were produced, and the resistance within and among cultivars were different in their offspring of space mutagenesis. Plant height and maturity were used as index to screen glyphosate tolerant materials. Space mutation increased of soybean 661 SP 3 of Zhongpin, and one glyphosate-resistance variant was screened from Zhongpin 661 SP 3 . It showed that glyphosate tolerance was different among offspring of different space mutagenesis soybean materials. It is feasible to systemically screen elite traits soybean by applying space mutation breeding. (authors)

  7. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

    International Nuclear Information System (INIS)

    Mamy, Laure; Gabrielle, Benoit; Barriuso, Enrique

    2010-01-01

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

  8. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

    Energy Technology Data Exchange (ETDEWEB)

    Mamy, Laure, E-mail: laure.mamy@versailles.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Gabrielle, Benoit, E-mail: benoit.gabrielle@agroparistech.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Barriuso, Enrique, E-mail: barriuso@grignon.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France)

    2010-10-15

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

  9. Non Target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis

    Directory of Open Access Journals (Sweden)

    Pablo Tomas Fernandez-Moreno

    2016-08-01

    Full Text Available Sterile wild oat (Avena sterilis L. is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage before the beginning of summer period (due to the possibility of intense drought stress. In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha-1 for exposed (E and un-exposed (UE glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of 14C- glyphosate absorption was the same in the two accessions (E and UE, while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica and Lolium rigidum.

  10. Non-target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis.

    Science.gov (United States)

    Fernández-Moreno, Pablo T; Alcantara-de la Cruz, Ricardo; Cruz-Hipólito, Hugo E; Rojano-Delgado, Antonia M; Travlos, Ilias; De Prado, Rafael

    2016-01-01

    Sterile wild oat (Avena sterilis L.) is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage) before the beginning of summer period (due to the possibility of intense drought stress). In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha(-1) for exposed (E) and un-exposed (UE) glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of (14)C- glyphosate absorption was the same in the two accessions (E and UE), while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA) and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica, and Lolium rigidum.

  11. Selection and characterization of glyphosate tolerance in birdsfoot trefoil (Lotus corniculatus)

    International Nuclear Information System (INIS)

    Boerboom, C.M.

    1989-01-01

    If birdsfoot trefoil (Lotus corniculatus L.) was tolerant to glyphosate [N-(phosphonomethyl)glycine], Canada thistle [Cirsium arvense (L.) Scop.] and other dicot weeds could be selectively controlled in certified seed production fields. Glyphosate tolerance in birdsfoot trefoil was identified in plants from the cultivar Leo, plants regenerated from tolerant callus, and selfed progeny of plants regenerated from callus. Plants from the three sources were evaluated in field studies for tolerance to glyphosate at rates up to 1.6 kg ae/ha. Plants of Leo selected for tolerance exhibited a twofold range in the rate required to reduce shoot weight 50% (I 50 s from 0.6 to 1.2 kg/ha glyphosate). Plants regenerated from tolerant callus had tolerance up to 66% greater than plants regenerated from unselected callus. Transgressive segregation for glyphosate tolerance was observed in the selfed progeny of two regenerated plants that both had I 50 s of 0.7 kg/ha glyphosate. The selfed progeny ranged from highly tolerant (I 50 of 1.5 kg/ha) to susceptible (I 50 of 0.5 kg/ha). Spray retention, 14 C-glyphosate absorption and translocation did not account for the differential tolerance of nine plants that were evaluated from the three sources. The specific activity of 5-enolpyruvylshikimate 3-phosphate (EPSP) synthase ranged from 1.3 to 3.5 nmol/min sm-bullet mg among the nine plants and was positively correlated with glyphosate tolerance. Leo birdsfoot trefoil was found to have significant variation in glyphosate tolerance which made it possible to initiate a recurrent selection program to select for glyphosate tolerance in birdsfoot trefoil. Two cycles of selection for glyphosate tolerance were practiced in three birdsfoot trefoil populations, Leo, Norcen, and MU-81

  12. 78 FR 25396 - Glyphosate; Pesticide Tolerances

    Science.gov (United States)

    2013-05-01

    ... found no systemic effects in any of the parameters examined (body weight, food consumption, clinical... evidence of carcinogenicity was found in mice or rats. In a chronic toxicity study in dogs, no systemic... chromatography (HPLC)) is available to enforce the tolerance expression. The method may be requested from: Chief...

  13. Glyphosate

    NARCIS (Netherlands)

    A. Arcuri (Alessandra)

    2017-01-01

    markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the

  14. Novel AroA from Pseudomonas putida Confers Tobacco Plant with High Tolerance to Glyphosate

    Science.gov (United States)

    Yan, Hai-Qin; Chang, Su-Hua; Tian, Zhe-Xian; Zhang, Le; Sun, Yi-Cheng; Li, Yan; Wang, Jing; Wang, Yi-Ping

    2011-01-01

    Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, also designated as AroA), a key enzyme in the aromatic amino acid biosynthesis pathway in microorganisms and plants. Previously, we reported that a novel AroA (PpAroA1) from Pseudomonas putida had high tolerance to glyphosate, with little homology to class I or class II glyphosate-tolerant AroA. In this study, the coding sequence of PpAroA1 was optimized for tobacco. For maturation of the enzyme in chloroplast, a chloroplast transit peptide coding sequence was fused in frame with the optimized aroA gene (PparoA1optimized) at the 5′ end. The PparoA1optimized gene was introduced into the tobacco (Nicotiana tabacum L. cv. W38) genome via Agrobacterium-mediated transformation. The transformed explants were first screened in shoot induction medium containing kanamycin. Then glyphosate tolerance was assayed in putative transgenic plants and its T1 progeny. Our results show that the PpAroA1 from Pseudomonas putida can efficiently confer tobacco plants with high glyphosate tolerance. Transgenic tobacco overexpressing the PparoA1optimized gene exhibit high tolerance to glyphosate, which suggest that the novel PpAroA1 is a new and good candidate applied in transgenic crops with glyphosate tolerance in future. PMID:21611121

  15. Glyphosate

    OpenAIRE

    Arcuri, Alessandra

    2017-01-01

    markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the substance is carcinogenic to humans and toxic for the environment. The controversy took a sharp legal turn when, in March 2015, the International Agency for Research on Cancer (IARC), which is the ...

  16. Simulating changes in cropping practises in conventional and glyphosate-tolerant maize. I. Effects on weeds.

    Science.gov (United States)

    Colbach, Nathalie; Fernier, Alice; Le Corre, Valérie; Messéan, Antoine; Darmency, Henri

    2017-04-01

    Herbicide-tolerant (HT) crops such as those tolerant to glyphosate simplify weed management and make it more efficient, at least at short-term. Overreliance on the same herbicide though leads to the spread of resistant weeds. Here, the objective was to evaluate, with simulations, the impact on the advent of glyphosate resistance in weeds of modifications in agricultural practises resulting from introducing HT maize into cropping systems. First, we included a single-gene herbicide resistance submodel in the existing multispecific FLORSYS model. Then, we (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, (2) compared these systems in terms of glyphosate resistance, (3) identified pertinent cultural practises influencing glyphosate resistance, and (4) investigated correlations between cultural practises and species traits, using RLQ analyses. The simulation study showed that, during the analysed 28 years, (1) glyphosate spraying only results in glyphosate resistance in weeds when combined with other cultural factors favouring weed infestation, particularly no till; (2) pre-sowing glyphosate applications select more for herbicide resistance than post-sowing applications on HT crops; and (3) glyphosate spraying selects more for species traits avoiding exposure to the herbicide (e.g. delayed early growth, small leaf area) or compensating for fitness costs (e.g. high harvest index) than for actual resistance to glyphosate, (4) actual resistance is most frequent in species that do not avoid glyphosate, either via plant size or timing, and/or in less competitive species, (5) in case of efficient weed control measures, actual resistance proliferates best in outcrossing species. An advice table was built, with the quantitative, synthetic ranking of the crop management effects in terms of glyphosate-resistance management, identifying the optimal choices for each management technique.

  17. Tolerance of Glyphosate-Resistant Maize to Glyphosate Plus MCPA Amine Is Influenced by Dose and Timing

    Directory of Open Access Journals (Sweden)

    Nader Soltani

    2015-01-01

    Full Text Available There is little information on tolerance of glyphosate-resistant maize to glyphosate plus MCPA amine as influenced by dose and timing under Ontario environmental conditions. A total of seven field trials were conducted at various locations in Ontario, Canada, in 2011–2013 to evaluate tolerance of field maize to tank mixes of glyphosate (900 g a.e./ha plus MCPA amine (79, 158, 315, 630, 1260, 2520, or 5040 g a.e./ha at either the 4- or 8-leaf stage. The predicted dose of MCPA amine that caused 5, 10, and 20% injury was 339, 751, and 1914 g a.e./ha when applied to 4-leaf maize but only 64, 140, and 344 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% reduction in shoot dry weight of maize was 488, 844, and 1971 g a.e./ha when applied to 4-leaf maize and only 14, 136, and 616 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% yield reduction was 2557, 4247, and >5040 g a.e./ha when applied to 4-leaf maize and 184, 441, and 1245 g a.e./ha when applied to 8-leaf maize, respectively. Based on these results, glyphosate plus MCPA amine applied at the manufacturer’s recommended dose of 630 g a.e./ha applied to 4-leaf maize has potential to cause injury but the injury is transient with no significant reduction in yield. However, when glyphosate plus MCPA amine is applied to 8-leaf maize it has the potential to cause significant injury and yield loss in maize.

  18. A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Gaoyi Cao

    Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

  19. Comparative Metabolomic Analyses of Ipomoea lacunosa Biotypes with Contrasting Glyphosate Tolerance Captures Herbicide-Induced Differential Perturbations in Cellular Physiology.

    Science.gov (United States)

    Maroli, Amith S; Nandula, Vijay K; Duke, Stephen O; Gerard, Patrick; Tharayil, Nishanth

    2018-02-28

    Glyphosate-tolerant Ipomoea lacunosa is emerging as a problematic weed in the southeastern United States. Metabolomic profiling was conducted to examine the innate physiology and the glyphosate induced perturbations in two biotypes of I. lacunosa (WAS and QUI) that had contrasting glyphosate tolerance. Compared to the less tolerant QUI-biotype, the innate metabolism of the more tolerant WAS-biotype was characterized by a higher abundance of amino acids, and pyruvate; whereas the sugar profile of the QUI biotype was dominated by the transport sugar sucrose. Glyphosate application (80 g ae/ha) caused similar shikimate accumulation in both biotypes. Compared to QUI, in WAS, the content of aromatic amino acids was less affected by glyphosate treatment, and the content of Ala, Val, Ile, and Pro increased. However, the total sugars decreased by ∼75% in WAS, compared to ∼50% decrease in QUI. The innate, higher proportional abundance, of the transport-sugar sucrose in QUI coud partly explain the higher translocation and greater sensitivity of this biotype to glyphosate. The decrease in sugars, accompanied by an increase in amino acids could delay feedback regulation of upstream enzymes of the shikimate acid pathway in WAS, which could contribute to a greater glyphosate tolerance. Our study, through a metabolomics approach, provides complementary data that elucidates the cellular physiology of herbicide tolerance in Ipomoea lacunosa biotypes.

  20. Limited uptake, translocation and enhanced metabolic degradation contribute to glyphosate tolerance in Mucuna pruriens var. utilis plants.

    Science.gov (United States)

    Rojano-Delgado, Antonia María; Cruz-Hipolito, Hugo; De Prado, Rafael; Luque de Castro, María Dolores; Franco, Antonio Rodríguez

    2012-01-01

    Velvet bean (Mucuna pruriens, Fabaceae) plants exhibits an innate, very high resistance (i.e., tolerance) to glyphosate similar to that of plants which have acquired resistance to this herbicide as a trait. We analyzed the uptake of [(14)C]-glyphosate by leaves and its translocation to meristematic tissues, and used scanning electron micrographs to further analyze the cuticle and 3D capillary electrophoresis to investigate a putative metabolism capable of degrading the herbicide. Velvet bean exhibited limited uptake of glyphosate and impaired translocation of the compound to meristematic tissues. Also, for the first time in a higher plant, two concurrent pathways capable of degrading glyphosate to AMPA, Pi, glyoxylate, sarcosine and formaldehyde as end products were identified. Based on the results, the innate tolerance of velvet bean to glyphosate is possibly a result of the combined action of the previous three traits, namely: limited uptake, impaired translocation and enhanced degradation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Intellectual property rights related to the genetically modified glyphosate tolerant soybeans in Brazil.

    Science.gov (United States)

    Rodrigues, Roberta L; Lage, Celso L S; Vasconcellos, Alexandre G

    2011-06-01

    The present work analyzes the different modalities of protection of the intellectual creations in the biotechnology agricultural field. Regarding the Brazilian legislations related to the theme (the Industrial Property Law - no. 9. 279/96 and the Plant Variety Protection Law - no. 9. 456/97), and based in the international treaties signed by Brazil, the present work points to the inclusions of each of them, as well as to their interfaces using as reference the case study of glyphosate tolerant genetically modified soybean. For this case study, Monsanto's pipelines patents were searched and used to analyze the limits of patent protection in respect to others related to the Intellectual Property (IP) laws. Thus, it was possible to elucidate the complex scenario of the Intellectual Property of the glyphosate tolerant soybeans, since for the farmer it is hard to correlate the royalties payment with the IP enterprise's rights.

  2. Tolerância do Tifton 85 (Cynodon spp. e da Brachiaria brizantha ao glyphosate Tifton 85 (Cynodon spp. and Brachiaria brizantha tolerance to glyphosate

    Directory of Open Access Journals (Sweden)

    M.V. Santos

    2008-06-01

    Full Text Available Objetivou-se avaliar a tolerância de Tifton 85 e Brachiaria brizantha ao glyphosate e verificar o controle de B. brizantha em área de pastagem de Tifton 85 já estabelecida. O delineamento experimental foi em blocos casualizados, com quatro repetições, em que se testaram as doses: 0, 720, 1.440, 2.160 e 2.880 g ha-1 de glyphosate. Cada parcela possuía dimensões de 3,5 m de comprimento por 3,0 m de largura, totalizando 10,5 m², com área útil de 7,5 m ². A eficiência do herbicida no controle de B. brizantha e o nível de intoxicação nas plantas de Tifton 85 foram avaliados 15, 30 e 60 dias após aplicação (DAA, mediante escala de 0 a 100, em que 0 é ausência de controle e/ou intoxicação e 100, controle total ou morte das plantas. Para avaliação da produção e do potencial de rebrota das forrageiras, as plantas de ambas as espécies foram colhidas aos 300 DAA e secas em estufa. Observou-se controle acima de 90% das plantas de B. brizantha a partir das doses de 1.473,75 e 1.721,25 g ha-1 de glyphosate, aos 30 e 60 DAA, respectivamente. As porcentagens de intoxicação das plantas de Tifton 85, referente a estas doses de controle de B. brizantha, foram, respectivamente, de 24,90 e 4,13% aos 30 e 60 DAA. Além disso, aos 60 DAA, para a maior dose avaliada (2.880 g ha-1 de glyphosate foi observada intoxicação das plantas de Tifton 85 de apenas 18,22%. Aos 300 DAA, observou-se ausência de produção de massa seca de B. brizantha a partir da dose de 2.160 g ha-1 do herbicida, devido ao eficiente controle. Os resultados evidenciam maior tolerância das plantas de Tifton 85 ao glyphosate em relação às plantas de B. brizantha, possibilitando o controle desta espécie em pastagem estabelecida de Tifton 85, sem causar danos à forrageira cultivada.This study aimed to evaluate Tifton 85 and Brachiaria brizantha tolerance glyphosate and verity Brachiaria brizantha control in an established Tifton 85 pasture area. Rates of 0; 720; 1

  3. WEED CONTROL IN GENETICALLY MODIFIED GLYPHOSATE-TOLERANT SOYBEAN MANEJO DE PLANTAS DANINHAS EM SOJA GENETICAMENTE MODIFICADA TOLERANTE AO GLYPHOSATE

    Directory of Open Access Journals (Sweden)

    Júlio Cezar Durigan

    2011-04-01

    Full Text Available The transgenic production systems, as well as conventional systems, require, in addition to chemical control, the adoption of other weed management strategies. This study was developed to evaluate the weed chemical control in glyphosate tolerant soybean, associated to cover crops cultivated in the autumn/winter. The experiment was carried out under field conditions at the FCAV/Unesp, Jaboticabal, São Paulo State, Brazil. A randomized split-plot block design was used, with four replications. St. Lucia Grass (Brachiaria brizantha ‘Marandu’, forage millet (Pennisetum americanum ‘BN2’, and a treatment with spontaneous growth vegetation were evaluated for plots, and, for subplots, the herbicides glyphosate, chlorimuron - ethyl plus lactofen, and fluazifop-p-butyl, in a sequential spraying, and two controls without any application. Grass cover contributed to the chemical control, suppressing weeds, and the single application of 720 g a.e. ha-1 of glyphosate, independently of the cover crop cultivated in the autumn/winter, was sufficient for adequately controlling Acanthospermum hispidum, Alternanthera tenella, Amaranthus sp., Bidens pilosa, Xanthium strumarium, Cenchrus echinatus, Digitaria sp., and Eleusine indica, with results similar to the treatment (chlorimuron-ethyl + lactofen + fluazifop-p-buthyl. When compared to the weeded control, the herbicides did not affect plants height, dry matter of the aerial parts, mass of 100 grains, and grain yield. Soybean plants grown over St. Lucia Grass and forage millet presented a higher height, however, no other feature was influenced by the cover crop.

    KEY-WORDS: Brachiaria brizantha; Pennisetum americanum; no-tillage; Roundup Ready; spontaneous vegetation.

    Os sistemas de produção transgênicos, assim como os

  4. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  5. Gene flow from GM glyphosate-tolerant to conventional soybeans under field conditions in Japan.

    Science.gov (United States)

    Yoshimura, Yasuyuki; Matsuo, Kazuhito; Yasuda, Koji

    2006-01-01

    Natural out-crossing rates were evaluated for conventional soybeans (Glycine max (L.) Merr.) cultivated adjacent to genetically modified (GM) glyphosate-tolerant soybeans under field conditions during a four-year period in Japan. A total of 107 846 progeny of 2772 plants harvested from conventional varieties were screened for glyphosate herbicide tolerance. The highest out-crossing rates, 0.19% in 2001 and 0.16% in 2002, were observed in adjacent rows 0.7 m from the pollen source. The highest rate in 2004 was 0.052%, which was observed at 2.1 m. No out-crossing was observed in the rows 10.5 m from the pollen source over the four-year period. The farthest distances between receptor and pollen source at which out-crossing was observed were 7 m in 2001, 2.8 m in 2002, and 3.5 m in 2004. The greatest airborne pollen density during the flowering period, determined by Durham pollen samplers located between the rows of each variety, was 0.368 grains.cm(-2).day(-1), with the average value at 0.18 grains.cm(-2).day(-1), indicating that the possibility of out-crossing by wind is minimal. Thrips species and predatory Hemiptera visited the soybean flowers more frequently during the four-year period than any other common pollinators, such as bees.

  6. BRS 369RF and BRS 370RF: Glyphosate tolerant, high-yielding upland cotton cultivars for central Brazilian savanna

    Directory of Open Access Journals (Sweden)

    Camilo de Lelis Morello

    2015-12-01

    Full Text Available BRS 369RF and BRS 370RF were developed by the EMBRAPA as a part of efforts to create high-yielding germplasm with combinations of transgenic traits. BRS 369RF and BRS 370RF are midseason cultivars and have yield stability, adaptation to the central Brazilian savanna, good fiber quality and tolerance to glyphosate herbicide.

  7. Global Expression Patterns of Three Festuca Species Exposed to Different Doses of Glyphosate Using the Affymetrix GeneChip Wheat Genome Array

    Directory of Open Access Journals (Sweden)

    Ozge Cebeci

    2009-01-01

    Full Text Available Glyphosate has been shown to act as an inhibitor of an aromatic amino acid biosynthetic pathway, while other pathways that may be affected by glyphosate are not known. Cross species hybridizations can provide a tool for elucidating biological pathways conserved among organisms. Comparative genome analyses have indicated a high level of colinearity among grass species and Festuca, on which we focus here, and showed rearrangements common to the Pooideae family. Based on sequence conservation among grass species, we selected the Affymetrix GeneChip Wheat Genome Array as a tool for the analysis of expression profiles of three Festuca (fescue species with distinctly different tolerances to varying levels of glyphosate. Differences in transcript expression were recorded upon foliar glyphosate application at 1.58 mM and 6.32 mM, representing 5% and 20%, respectively, of the recommended rate. Differences highlighted categories of general metabolic processes, such as photosynthesis, protein synthesis, stress responses, and a larger number of transcripts responded to 20% glyphosate application. Differential expression of genes encoding proteins involved in the shikimic acid pathway could not be identified by cross hybridization. Microarray data were confirmed by RT-PCR and qRT-PCR analyses. This is the first report to analyze the potential of cross species hybridization in Fescue species and the data and analyses will help extend our knowledge on the cellular processes affected by glyphosate.

  8. Características da epiderme foliar de eucalipto e seu envolvimento com a tolerância ao glyphosate Characteristics of eucalypt leaf epidermis and its role in glyphosate tolerance

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2006-09-01

    Full Text Available Em áreas de reflorestamento, a deriva do glyphosate causa injúrias nas plantas de eucalipto. Trabalhos preliminares de pesquisa e observações de campo apontam para uma tolerância diferencial ao glyphosate entre os genótipos cultivados. Nesse contexto, objetivou-se estudar as estruturas anatômicas da epiderme foliar de cinco espécies de eucalipto, correlacionando com a tolerância ao glyphosate em deriva simulada. Utilizou-se o esquema fatorial, sendo cinco espécies (Eucalyptus urophylla, E. grandis, E. pellita, E. resinifera e E. saligna e cinco subdoses (0; 43,2; 86,4; 172,8 e 345,6 g e.a. ha-1 de glyphosate, simulando uma deriva. Imediatamente antes da aplicação do herbicida, coletaram-se folhas, totalmente expandidas, para análise anatômica da superfície epidérmica segundo metodologia de dissociação. Entre as espécies estudadas, E. resinifera mostrou-se mais tolerante à deriva de glyphosate, apresentando os menores valores de porcentagem de intoxicação aos 45 dias após aplicação, não sendo encontrada diferença entre as demais espécies. As cinco espécies apresentam folhas glabras, anfiestomáticas, com estômatos do tipo anomocítico e cutícula proeminente. Apesar de presentes em ambas as faces, os estômatos são raros na face adaxial, apresentando baixo índice e densidade estomática. Os maiores valores para índice estomático foram observados em E. resinifera, enquanto E. saligna apresentou a maior densidade estomática. Cavidades subepidérmicas evidenciadas na superfície pelas células de cobertura estão presentes nas cinco espécies, com maior densidade em E. pellita. Houve alta correlação entre a porcentagem de intoxicação por glyphosate e o número de células epidérmicas da superfície adaxial, indicando envolvimento desta característica com a tolerância diferencial ao herbicida. Estudos sobre absorção, translocação e metabolismo do glyphosate em eucalipto devem ser realizados para elucidar

  9. Evaluation of Turf-type Interspecific Hybrids of Meadow Fescue with Perennial Ryegrass for Improved Stress Tolerance

    Czech Academy of Sciences Publication Activity Database

    Barnes, B.D.; Kopecký, David; Lukaszewski, A.J.; Baird, J. H.

    2014-01-01

    Roč. 54, č. 1 (2014), s. 355-365 ISSN 0011-183X R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : LOLIUM-FESTUCA COMPLEX * TALL FESCUE * INTERGENERIC HYBRIDS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.575, year: 2014

  10. Intellectual property rights related to the genetically modified glyphosate tolerant soybeans in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta L Rodrigues

    2011-06-01

    Full Text Available The present work analyzes the different modalities of protection of the intellectual creations in the biotechnology agricultural field. Regarding the Brazilian legislations related to the theme (the Industrial Property Law - no. 9. 279/96 and the Plant Variety Protection Law - no. 9. 456/97, and based in the international treaties signed by Brazil, the present work points to the inclusions of each of them, as well as to their interfaces using as reference the case study of glyphosate tolerant genetically modified soybean. For this case study, Monsanto's pipelines patents were searched and used to analyze the limits of patent protection in respect to others related to the Intellectual Property (IP laws. Thus, it was possible to elucidate the complex scenario of the Intellectual Property of the glyphosate tolerant soybeans, since for the farmer it is hard to correlate the royalties payment with the IP enterprise's rightsO presente trabalho analisa as diferentes modalidades de proteção das criações intelectuais no campo da biotecnologia agrícola. A partir das leis Brasileiras relacionadas ao tema (Lei da Propriedade Industrial - nº 9.279/96 e Lei da Proteção de Cultivares - nº 9.456/97, e com base nos tratados internacionais assinados pelo Brasil, o presente trabalho aponta as inclusões de cada uma, assim como, suas interfaces usando como referência o estudo de caso da soja geneticamente modificada para tolerância ao glifosato. Para este caso, patentes pipelines da Monsanto foram buscadas e usadas para analisar os limites de proteção das patentes frente às outras leis de Propriedade Intelectual (PI relacionadas. Assim, foi possível elucidar o cenário complexo da Propriedade Intelectual das sojas tolerantes ao glifosato, já que para o agricultor não é fácil correlacionar o pagamento dos royalties com os direitos de PI da empresa

  11. Managing the tall fescue-fungal endophyte symbiosis for optimum forage-animal production

    Science.gov (United States)

    Alkaloids produced by the fungal endophyte (Neotyphodium coenophialum) that infects tall fescue [Lolium arundinaceum (Schreb.) Darbysh.] are a paradox to cattle production. While certain alkaloids impart tall fescue with tolerances to environmental stresses, such as moisture, heat, and herbivory, e...

  12. Transgenic rice expressing a codon-modified synthetic CP4-EPSPS confers tolerance to broad-spectrum herbicide, glyphosate.

    Science.gov (United States)

    Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla

    2015-05-01

    Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.

  13. Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

    Science.gov (United States)

    Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

    2017-04-01

    Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

  14. Weeds and ground-dwelling predators′ response to two different weed management systems in glyphosate-tolerant cotton: A farm-scale study

    Science.gov (United States)

    Farinós, Gema P.; Gómez, Pablo; Gutiérrez, Elena; Sánchez, Francisco Javier; Escorial, María Concepción; Ortego, Félix; Chueca, María Cristina; Castañera, Pedro

    2018-01-01

    The use of glyphosate, as a post-emergence broad-spectrum herbicide in genetically modified glyphosate-tolerant (GT) cotton, supposes a big change in weed management programs with respect to a conventional regime. Thus, alterations in arable flora and arthropod fauna must be considered when evaluating their potential impacts. A 3-year farm-scale study was conducted in a 2-ha GT cotton crop, in southern Spain, to compare the effects of conventional and glyphosate herbicide regimes on weed abundance and diversity and their consequences for ground-dwelling predators. Surveys reveal that weed density was relatively low within all treatments with a few dominant species, with significantly higher weed densities and modifications of the floristic composition in glyphosate-treated plots that led to an increase in the abundance of Portulaca oleracea and to a reduction in plant diversity. The activity-density of the main predatory arthropod taxa (spiders, ground beetles, rove beetles and earwigs) varied among years, but no significant differences were obtained between conventional and glyphosate herbicide regimes. However, significant differences between treatments were obtained for ground beetles species richness and diversity, being higher under the glyphosate herbicide regime, and a positive correlation with weed density could be established for both parameters. The implications of these findings to weed control in GT cotton are discussed. PMID:29351549

  15. Weeds and ground-dwelling predators' response to two different weed management systems in glyphosate-tolerant cotton: A farm-scale study.

    Science.gov (United States)

    García-Ruiz, Esteban; Loureiro, Íñigo; Farinós, Gema P; Gómez, Pablo; Gutiérrez, Elena; Sánchez, Francisco Javier; Escorial, María Concepción; Ortego, Félix; Chueca, María Cristina; Castañera, Pedro

    2018-01-01

    The use of glyphosate, as a post-emergence broad-spectrum herbicide in genetically modified glyphosate-tolerant (GT) cotton, supposes a big change in weed management programs with respect to a conventional regime. Thus, alterations in arable flora and arthropod fauna must be considered when evaluating their potential impacts. A 3-year farm-scale study was conducted in a 2-ha GT cotton crop, in southern Spain, to compare the effects of conventional and glyphosate herbicide regimes on weed abundance and diversity and their consequences for ground-dwelling predators. Surveys reveal that weed density was relatively low within all treatments with a few dominant species, with significantly higher weed densities and modifications of the floristic composition in glyphosate-treated plots that led to an increase in the abundance of Portulaca oleracea and to a reduction in plant diversity. The activity-density of the main predatory arthropod taxa (spiders, ground beetles, rove beetles and earwigs) varied among years, but no significant differences were obtained between conventional and glyphosate herbicide regimes. However, significant differences between treatments were obtained for ground beetles species richness and diversity, being higher under the glyphosate herbicide regime, and a positive correlation with weed density could be established for both parameters. The implications of these findings to weed control in GT cotton are discussed.

  16. Glyphosate-tolerant soybeans remain compositionally equivalent to conventional soybeans (Glycine max L.) during three years of field testing.

    Science.gov (United States)

    McCann, Melinda C; Liu, Keshun; Trujillo, William A; Dobert, Raymond C

    2005-06-29

    Previous studies have shown that the composition of glyphosate-tolerant soybeans (GTS) and selected processed fractions was substantially equivalent to that of conventional soybeans over a wide range of analytes. This study was designed to determine if the composition of GTS remains substantially equivalent to conventional soybeans over the course of several years and when introduced into multiple genetic backgrounds. Soybean seed samples of both GTS and conventional varieties were harvested during 2000, 2001, and 2002 and analyzed for the levels of proximates, lectin, trypsin inhibitor, and isoflavones. The measured analytes are representative of the basic nutritional and biologically active components in soybeans. Results show a similar range of natural variability for the GTS soybeans as well as conventional soybeans. It was concluded that the composition of commercial GTS over the three years of breeding into multiple varieties remains equivalent to that of conventional soybeans.

  17. On glyphosate

    Directory of Open Access Journals (Sweden)

    Tamas Komives

    2016-11-01

    Full Text Available This Editorial briefly discusses the current issues surrounding glyphosate - the most controversial pesticide active ingredient of our time. The paper pays special attention to the effects of glyphosate on plant-pathogen interactions.

  18. Assessing the effects of cultivating genetically modified glyphosate-tolerant varieties of soybeans (Glycine max (L.) Merr.) on populations of field arthropods.

    Science.gov (United States)

    Imura, Osamu; Shi, Kun; Iimura, Keiji; Takamizo, Tadashi

    2010-01-01

    We assessed the effects of cultivating two genetically modified (GM) glyphosate-tolerant soybean varieties (Glycine max (L.) Merr.) derived from Event 40-3-2 and a Japanese conventional variety on arthropods under field conditions, with weed control using glyphosate and conventional weed control for two years. Plant height and dry weight of the conventional variety were significantly larger than those of the GM varieties, but the GM varieties bore more pods than the conventional variety. We found arthropods of nine taxonomic orders (Araneae, Acari, Thysanoptera, Homoptera, Heteroptera, Coleoptera, Diptera, Lepidoptera, and Hymenoptera) on the plants. The arthropod incidence (number per plant unit weight pooled for each taxonomic order) on the soybean stems and leaves generally did not differ significantly between the GM and conventional varieties. However, the incidence of Thysanoptera and total incidence (all orders combined) were greater on the GM variety in the second year. The weed control regimes had no significant influence on the arthropod incidence on the soybean stems and leaves. The number of flower-inhabiting Thysanoptera (the dominant arthropod in the flowers) was not significantly different between the GM and conventional varieties. Asphondylia yushimai (Diptera, Cecidomyiidae) was more numerous on the pods of the GM variety in both years. Neither the soybean variety nor the weed control regime significantly affected the density of soil macro-organisms. However, the glyphosate weed control affected arthropods between the rows of plants by decreasing the abundances of Homoptera, Heteroptera, Coleoptera and Lepidoptera, and diversity of arthropods. © ISBR, EDP Sciences, 2011.

  19. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Glyphosate Oxidoreductase GOX or... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.524 Glyphosate... Glyphosate Oxidoreductase GOX or GOXv247 enzyme in all plants are exempt from the requirement of a tolerance...

  20. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  1. Comparison of the forage and grain composition from insect-protected and glyphosate-tolerant MON 88017 corn to conventional corn (Zea mays L.).

    Science.gov (United States)

    McCann, Melinda C; Trujillo, William A; Riordan, Susan G; Sorbet, Roy; Bogdanova, Natalia N; Sidhu, Ravinder S

    2007-05-16

    The next generation of biotechnology-derived products with the combined benefit of herbicide tolerance and insect protection (MON 88017) was developed to withstand feeding damage caused by the coleopteran pest corn rootworm and over-the-top applications of glyphosate, the active ingredient in Roundup herbicides. As a part of a larger safety and characterization assessment, MON 88017 was grown under field conditions at geographically diverse locations within the United States and Argentina during the 2002 and 2003-2004 field seasons, respectively, along with a near-isogenic control and other conventional corn hybrids for compositional assessment. Field trials were conducted using a randomized complete block design with three replication blocks at each site. Corn forage samples were harvested at the late dough/early dent stage, ground, and analyzed for the concentration of proximate constituents, fibers, and minerals. Samples of mature grain were harvested, ground, and analyzed for the concentration of proximate constituents, fiber, minerals, amino acids, fatty acids, vitamins, antinutrients, and secondary metabolites. The results showed that the forage and grain from MON 88017 are compositionally equivalent to forage and grain from control and conventional corn hybrids.

  2. Split application of glyphosate in herbicide-tolerant maize provides efficient weed control and favors beneficial epigeic arthropods

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Zdeňka; Skoková Habuštová, Oxana; Holec, J.; Holec, M.; Boháč, J.; Jursík, M.; Soukup, J.; Sehnal, František

    2018-01-01

    Roč. 251, JAN 01 (2018), s. 171-179 ISSN 0167-8809 Grant - others:GA ČR(CZ) L200961652 Institutional support: RVO:60077344 Keywords : herbicide-tolerant maize * weed management * conventional tillage Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection OBOR OECD: Agronomy, plant breeding and plant protection Impact factor: 4.099, year: 2016 http://www.sciencedirect.com/science/article/pii/S0167880917304188

  3. Environmental and health effects of the herbicide glyphosate.

    Science.gov (United States)

    Van Bruggen, A H C; He, M M; Shin, K; Mai, V; Jeong, K C; Finckh, M R; Morris, J G

    2018-03-01

    The herbicide glyphosate, N-(phosphonomethyl) glycine, has been used extensively in the past 40years, under the assumption that side effects were minimal. However, in recent years, concerns have increased worldwide about the potential wide ranging direct and indirect health effects of the large scale use of glyphosate. In 2015, the World Health Organization reclassified glyphosate as probably carcinogenic to humans. A detailed overview is given of the scientific literature on the movement and residues of glyphosate and its breakdown product aminomethyl phosphonic acid (AMPA) in soil and water, their toxicity to macro- and microorganisms, their effects on microbial compositions and potential indirect effects on plant, animal and human health. Although the acute toxic effects of glyphosate and AMPA on mammals are low, there are animal data raising the possibility of health effects associated with chronic, ultra-low doses related to accumulation of these compounds in the environment. Intensive glyphosate use has led to the selection of glyphosate-resistant weeds and microorganisms. Shifts in microbial compositions due to selective pressure by glyphosate may have contributed to the proliferation of plant and animal pathogens. Research on a link between glyphosate and antibiotic resistance is still scarce but we hypothesize that the selection pressure for glyphosate-resistance in bacteria could lead to shifts in microbiome composition and increases in antibiotic resistance to clinically important antimicrobial agents. We recommend interdisciplinary research on the associations between low level chronic glyphosate exposure, distortions in microbial communities, expansion of antibiotic resistance and the emergence of animal, human and plant diseases. Independent research is needed to revisit the tolerance thresholds for glyphosate residues in water, food and animal feed taking all possible health risks into account. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Glyphosate sustainability in South American cropping systems.

    Science.gov (United States)

    Christoffoleti, Pedro J; Galli, Antonio J B; Carvalho, Saul J P; Moreira, Murilo S; Nicolai, Marcelo; Foloni, Luiz L; Martins, Bianca A B; Ribeiro, Daniela N

    2008-04-01

    South America represents about 12% of the global land area, and Brazil roughly corresponds to 47% of that. The major sustainable agricultural system in South America is based on a no-tillage cropping system, which is a worldwide adopted agricultural conservation system. Societal benefits of conservation systems in agriculture include greater use of conservation tillage, which reduces soil erosion and associated loading of pesticides, nutrients and sediments into the environment. However, overreliance on glyphosate and simpler cropping systems has resulted in the selection of tolerant weed species through weed shifts (WSs) and evolution of herbicide-resistant weed (HRW) biotypes to glyphosate. It is a challenge in South America to design herbicide- and non-herbicide-based strategies that effectively delay and/or manage evolution of HRWs and WSs to weeds tolerant to glyphosate in cropping systems based on recurrent glyphosate application, such as those used with glyphosate-resistant soybeans. The objectives of this paper are (i) to provide an overview of some factors that influence WSs and HRWs to glyphosate in South America, especially in Brazil, Argentina and Paraguay soybean cropped areas; (ii) to discuss the viability of using crop rotation and/or cover crops that might be integrated with forage crops in an economically and environmentally sustainable system; and (iii) to summarize the results of a survey of the perceptions of Brazilian farmers to problems with WSs and HRWs to glyphosate, and the level of adoption of good agricultural practices in order to prevent or manage it. Copyright (c) 2008 Society of Chemical Industry.

  5. Application of biotechnology in genetics and breeding of tall fescue

    International Nuclear Information System (INIS)

    Huang Xin; Ye Hongxia; Shu Xiaoli; Wu Dianxing

    2008-01-01

    Tall fescue (Festuca arundinacea Schred.) is an important lawn and pasture grass in agriculture, animal husbandy and lawn industry. The historical and present situations of tall fescue breeding were briefly introduced, and advances in the researches of molecular biology and germplasm enhancement by biotechnology in tall fescue were reviewed in the paper, which would provide the references for tall fescue breeding by biotechnology. (authors)

  6. Genotypic evaluation of tall fescue dihaploids by capillary electrophoresis

    Science.gov (United States)

    Recent innovations in tall fescue breeding and selection allow for the generation of dihaploid tall fescue lines. During the dihaploid generation process, two possible products can be generated. These being tall fescue hybrids generated from outcrossing and homozygous dihaploid tall fescue lines. As...

  7. Response of Pennsylvania native plant species to dicamba and/or glyphosate

    Science.gov (United States)

    Weeds may become resistant to intensive and extensive use of specific herbicides associated with the growth of herbicide tolerant crops, e.g., the use of glyphosate for weed control with glyphosate tolerant soybeans. To counter this resistance, crops modified to contain genes for...

  8. Tall fescue ergot alkaloids are vasoactive in equine vasculature

    Science.gov (United States)

    Mares grazing endophyte-infected (Epichloë coenophiala) tall fescue (Lolium arundinaceum) typically exhibit reproductive dysfunction rather than problems associated with peripheral vasoconstriction as a primary sign of the fescue toxicosis syndrome. Research using Doppler ultrasonography demonstrate...

  9. Aldo-keto reductase enzymes detoxify glyphosate and improve herbicide resistance in plants.

    Science.gov (United States)

    Vemanna, Ramu S; Vennapusa, Amaranatha Reddy; Easwaran, Murugesh; Chandrashekar, Babitha K; Rao, Hanumantha; Ghanti, Kirankumar; Sudhakar, Chinta; Mysore, Kirankumar S; Makarla, Udayakumar

    2017-07-01

    In recent years, concerns about the use of glyphosate-resistant crops have increased because of glyphosate residual levels in plants and development of herbicide-resistant weeds. In spite of identifying glyphosate-detoxifying genes from microorganisms, the plant mechanism to detoxify glyphosate has not been studied. We characterized an aldo-keto reductase gene from Pseudomonas (PsAKR1) and rice (OsAKR1) and showed, by docking studies, both PsAKR1 and OsAKR1 can efficiently bind to glyphosate. Silencing AKR1 homologues in rice and Nicotiana benthamiana or mutation of AKR1 in yeast and Arabidopsis showed increased sensitivity to glyphosate. External application of AKR proteins rescued glyphosate-mediated cucumber seedling growth inhibition. Regeneration of tobacco transgenic lines expressing PsAKR1 or OsAKRI on glyphosate suggests that AKR can be used as selectable marker to develop transgenic crops. PsAKR1- or OsAKRI-expressing tobacco and rice transgenic plants showed improved tolerance to glyphosate with reduced accumulation of shikimic acid without affecting the normal photosynthetic rates. These results suggested that AKR1 when overexpressed detoxifies glyphosate in planta. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

    Science.gov (United States)

    Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

    2017-08-01

    Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Glyphosate em mistura com herbicidas alternativos para o manejo de plantas daninhas Glyphosate combined with alternative herbicides for vegetation management

    Directory of Open Access Journals (Sweden)

    P.A. Monquero

    2001-12-01

    Full Text Available O uso intensivo de glyphosate como herbicida não-seletivo tem selecionado espécies de plantas daninhas tolerantes. Dessa forma, é importante que sejam estudadas misturas de tanque com herbicidas de mecanismos de ação alternativos e que apresentem efeitos sinergísticos ou aditivos. Por essa razão, foi instalado um experimento inteiramente casualizado, composto por 13 tratamentos e 4 repetições, em casa de vegetação da Universidade de São Paulo - ESALQ/USP, Piracicaba-SP, com as plantas daninhas Richardia brasiliensis, Commelina benghalensis, Amaranthus hybridus, Galinsoga parviflora e Ipomoea grandifolia em misturas de tanque dos herbicidas chlorimuron-ethyl, sulfentrazone, carfentrazone, bentazon ou flumioxazin com glyphosate. As interações foram aditivas para as plantas daninhas I. grandifolia e C. benghalensis, e os herbicidas flumioxazin, sulfentrazone e carfentrazone aplicados isoladamente e em mistura com glyphosate foram os que proporcionaram os melhores níveis de controle. A interação de glyphosate com sulfentrazone foi antagônica em R. brasiliensis; a mistura de glyphosate com os demais herbicidas estudados foi aditiva, sendo os tratamentos com mistura de glyphosate e chlorimuron-ethyl ou flumioxazin os mais eficazes. Em A. hybridus, os tratamentos que apresentaram melhores níveis de controle foram o glyphosate e carfentrazone, aplicados isoladamente, e a mistura de glyphosate com flumioxazin, sulfentrazone, chlorimuron-ethyl e bentazon, sendo estes interações aditivas. No caso de G. parviflora, os tratamentos com flumioxazin e sulfentrazone apresentaram controle total, o mesmo acontecendo com as misturas de glyphosate com carfentrazone, flumioxazin, sulfentrazone, chlorimuron-ethyl ou bentazon.The intensive use of glyphosate as a non-selective herbicide for weed vegetation management has selected some tolerant weed species. Thus, it is important to study the synergistic or antagonic or additive effects of tank

  12. Glyphosate biodegradation and potential soil bioremediation by Bacillus subtilis strain Bs-15.

    Science.gov (United States)

    Yu, X M; Yu, T; Yin, G H; Dong, Q L; An, M; Wang, H R; Ai, C X

    2015-11-23

    Glyphosate and glyphosate-containing herbicides have an adverse effect on mammals, humans, and soil microbial ecosystems. Therefore, it is important to develop methods for enhancing glyphosate degradation in soil through bioremediation. We investigated the potential of glyphosate degradation and bioremediation in soil by Bacillus subtilis Bs-15. Bs-15 grew well at high concentrations of glyphosate; the maximum concentration tolerated by Bs-15 reached 40,000 mg/L. The optimal conditions for bacterial growth and glyphosate degradation were less than 10,000 mg/L glyphosate, with a temperature of 35°C and a pH of 8.0. Optimal fermentation occurred at 180 rpm for 60 h with an inoculum ratio of 4%. Bs-15 degraded 17.65% (12 h) to 66.97% (96 h) of glyphosate in sterile soil and 19.01% (12 h) to 71.57% (96 h) in unsterilized soil. Using a BIOLOG ECO plate test, we observed no significant difference in average well color development values between the soil inoculated with Bs-15 and the control soil before 72 h, although there was a significant difference (P bioremediation of glyphosate-contaminated soils.

  13. Kernel compositions of glyphosate-tolerant and corn rootworm-protected MON 88017 sweet corn and insect-protected MON 89034 sweet corn are equivalent to that of conventional sweet corn (Zea mays).

    Science.gov (United States)

    Curran, Kassie L; Festa, Adam R; Goddard, Scott D; Harrigan, George G; Taylor, Mary L

    2015-03-25

    Monsanto Co. has developed two sweet corn hybrids, MON 88017 and MON 89034, that contain biotechnology-derived (biotech) traits designed to enhance sustainability and improve agronomic practices. MON 88017 confers benefits of glyphosate tolerance and protection against corn rootworm. MON 89034 provides protection against European corn borer and other lepidopteran insect pests. The purpose of this assessment was to compare the kernel compositions of MON 88017 and MON 89034 sweet corn with that of a conventional control that has a genetic background similar to the biotech sweet corn but does not express the biotechnology-derived traits. The sweet corn samples were grown at five replicated sites in the United States during the 2010 growing season and the conventional hybrid and 17 reference hybrids were grown concurrently to provide an estimate of natural variability for all assessed components. The compositional analysis included proximates, fibers, amino acids, sugars, vitamins, minerals, and selected metabolites. Results highlighted that MON 88017 and MON 89034 sweet corns were compositionally equivalent to the conventional control and that levels of the components essential to the desired properties of sweet corn, such as sugars and vitamins, were more affected by growing environment than the biotech traits. In summary, the benefits of biotech traits can be incorporated into sweet corn with no adverse effects on nutritional quality.

  14. Recent advances in glyphosate biodegradation.

    Science.gov (United States)

    Zhan, Hui; Feng, Yanmei; Fan, Xinghui; Chen, Shaohua

    2018-06-01

    Glyphosate has emerged as the most widespread herbicide to control annual and perennial weeds. Massive use of glyphosate for decades has resulted in its ubiquitous presence in the environment, and poses a threat to humans and ecosystem. Different approaches such as adsorption, photocatalytic degradation, and microbial degradation have been studied to break down glyphosate in the environment. Among these, microbial degradation is the most effective and eco-friendly method. During its degradation, various microorganisms can use glyphosate as a sole source of phosphorus, carbon, and nitrogen. Major glyphosate degradation pathways and its metabolites have been frequently investigated, but the related enzymes and genes have been rarely studied. There are many reviews about the toxicity and fate of glyphosate and its major metabolite, aminomethylphosphonic acid. However, there is lack of reviews on biodegradation and bioremediation of glyphosate. The aims of this review are to summarize the microbial degradation of glyphosate and discuss the potential of glyphosate-degrading microorganisms to bioremediate glyphosate-contaminated environments. This review will provide an instructive direction to apply glyphosate-degrading microorganisms in the environment for bioremediation.

  15. Secondary effects of glyphosate on plants

    Science.gov (United States)

    Glyphosate is a unique herbicide with interesting secondary effects. Unfortunately, some have assumed that the secondary effects that occur in glyphosate-susceptible plants treated with glyphosate, such as altered mineral nutrition, reduced phenolic compound production and pathogen resistance, also ...

  16. Seedling Performance Associated with Live or Herbicide Treated Tall Fescue

    Directory of Open Access Journals (Sweden)

    Jonathan J. Halvorson

    2015-01-01

    Full Text Available Tall fescue is an important forage grass which can host systemic fungal endophytes. The association of host grass and endophyte is known to influence herbivore behavior and host plant competition for resources. Establishing legumes into existing tall fescue sods is a desirable means to acquire nitrogen and enhance the nutritive value of forage for livestock production. Competition from existing tall fescue typically must be controlled to ensure interseeding success. We used a soil-on-agar method to determine if soil from intact, living (L, or an herbicide killed (K tall fescue sward influenced germination and seedling growth of three cultivars of tall fescue (E+, MaxQ, and E− or legumes (alfalfa, red clover, and white clover. After 30 days, seedlings were larger and present in greater numbers when grown in L soil rather than K soil. Root growth of legumes (especially white clover and tall fescue (especially MaxQ were not as vigorous in K soil as L soil. While shoot biomass was similar for all cultivars of tall fescue in L soil, MaxQ produced less herbage when grown in K soil. Our data suggest establishing legumes or fescue cultivars may not be improved by first killing the existing fescue sod and seedling performance can exhibit significant interseasonal variation, related only to soil conditions.

  17. Identifying Chloris Species from Cuban Citrus Orchards and Determining Their Glyphosate-Resistance Status

    Directory of Open Access Journals (Sweden)

    Enzo R. Bracamonte

    2017-11-01

    Full Text Available The Chloris genus is a C4 photosynthetic species mainly distributed in tropical and subtropical regions. Populations of three Chloris species occurring in citrus orchards from central Cuba, under long history glyphosate-based weed management, were studied for glyphosate-resistant status by characterizing their herbicide resistance/tolerance mechanisms. Morphological and molecular analyses allowed these species to be identified as C. ciliata Sw., Chloris elata Desv., and Chloris barbata Sw. Based on the glyphosate rate that causes 50% mortality of the treated plants, glyphosate resistance (R was confirmed only in C. elata, The R population was 6.1-fold more resistant compared to the susceptible (S population. In addition, R plants of C. elata accumulated 4.6-fold less shikimate after glyphosate application than S plants. Meanwhile, populations of C. barbata and C. ciliata with or without glyphosate application histories showed similar LD50 values and shikimic acid accumulation rates, demonstrating that resistance to glyphosate have not evolved in these species. Plants of R and S populations of C. elata differed in 14C-glyphosate absorption and translocation. The R population exhibited 27.3-fold greater 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS activity than the S population due to a target site mutation corresponding to a Pro-106-Ser substitution found in the EPSPS gene. These reports show the innate tolerance to glyphosate of C. barbata and C. ciliata, and confirm the resistance of C. elata to this herbicide, showing that both non-target site and target-site mechanisms are involved in its resistance to glyphosate. This is the first case of herbicide resistance in Cuba.

  18. Effects of glyphosate-based herbicides on survival, development and growth of invasive snail (Pomacea canaliculata).

    Science.gov (United States)

    Xu, Yanggui; Li, Adela Jing; Li, Kaibin; Qin, Junhao; Li, Huashou

    2017-12-01

    This study tests the hypotheses that whether environmental relevance of glyphosate would help control spread of the invasive snail Pomacea canaliculata, or benefit its population growth worldwide. Our results showed that glyphosate induced acute toxicity to the snail only at high concentrations (96h LC50 at 175mg/L) unlikely to occur in the environment. Long-term exposures to glyphosate at sublethal levels (20 and 120mg/L) caused inhibition of food intake, limitation of growth performance and alterations in metabolic profiles of the snail. It is worth noting that glyphosate at 2mg/L benefited growth performance in P. canaliculata. Chronic exposures of glyphosate significantly enhanced overall metabolic rate and altered catabolism from protein to carbohydrate/lipid mode. Cellular responses in enzyme activities showed that the exposed snails could increase tolerance by their defense system against glyphosate-induced oxidative stress, and adjustment of metabolism to mitigate energy crisis. Our study displayed that sublethal concentrations of glyphosate might be helpful in control of the invasive species by food intake, growth performance and metabolic interruption; whether environmental relevance of glyphosate (≤2mg/L) benefits population growth of P. canaliculata is still inconclusive, which requires further field study. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Water use efficiency by coffee arabica after glyphosate application

    Directory of Open Access Journals (Sweden)

    Felipe Paolinelli de Carvalho

    2014-07-01

    Full Text Available Many coffee growers apply glyphosate in directed applications, but some phytotoxicity has been noted. It is believed some herbicides can exert a direct or indirect negative effect on photosynthesis by reducing the metabolic rate in a way that can affect the water use efficiency. The objective of this study was to investigate the variables related to water use among coffee cultivars subjected to the application of glyphosate and the effects of each dose. The experiment was conducted in a greenhouse using three varieties of coffee (Coffea arabica, Acaiá (MG-6851, Catucaí Amarelo (2SL and Topázio (MG-1190, and three doses of glyphosate (0.0, 115.2 and 460.8 g acid equivalent ha-1, in a factorial 3 x 3 design. At 15 days after application, a reduction in stomatal conductance was observed, and smaller transpiration rate and water use efficiency were found in the fourth leaf at 15 days after application. There was a decrease in the transpiration rate at 45 DAA, with the Acaiá cultivar showing reductions with 115.2 g ha-1. There was transitory reduction in water use efficiency with glyphosate application, but can affect the growth and production. The Acaiá cultivar showed the highest tolerance to glyphosate because the water use efficiency after herbicide application.

  20. Tall Fescue Alkaloids Bind Serotonin Receptors in Cattle

    Science.gov (United States)

    The serotonin (5HT) receptor 5HT2A is involved in the tall fescue alkaloid-induced vascular contraction in the bovine periphery. This was determined by evaluating the contractile responses of lateral saphenous veins biopsied from cattle grazing different tall fescue/endophyte combinations. The contr...

  1. Survey of ABC transporter and metallothionein genes expressions in tall fescue inoculated with Funneliformis intraradices under Nickel toxicity

    Directory of Open Access Journals (Sweden)

    Massomeh Rafiei-Demneh

    2016-09-01

    Full Text Available In plants, there are complex network of transport, chelation, and sequestration processes that functions in maintaining concentrations of essential metal ions in different cellular compartments, thus minimizing the damage caused by entry of non-essential metal ions into the cytosol. In the presence of toxic ones, arbuscular mycorrhizal (AM fungi are able to alleviate metal toxicity in the plant. In this study the effect of an arbuscular mycorrhizal fungi Funneliformis intraradices on growth, Nickel tolerance, and ABC transporter and metallothionein expression in leaves and roots of tall fescue (Festuca arundinacea plants cultivated in Ni polluted soil were evaluated. The fungi infected (M+ and uninfected (M- fescue plants were cultivated in soil under different Ni concentrations (0, 30, 90 and 180 ppm for 3 months. Results demonstrated the positive effect of fungi colonization on the increase in growth and reduction in Ni uptake (90 and 180 ppm and Ni translocation from roots to shoot of tall fescue under Ni stress. The results also demonstrated that the level of ABC transporterand metallothionein transcripts accumulation in roots was considerably higher for both M- and M+ plants compared to the control. Also, M+ plants showed less ABC and MET expression compared to the M- plants. These results demonstrated the importance of mycorrhizal colonization of F. intraradices in reduction of Ni transport from root to shoot of tall fescue which alleviates Ni-induced stress.

  2. Glyphosate resistance: state of knowledge

    Science.gov (United States)

    Sammons, Robert Douglas; Gaines, Todd A

    2014-01-01

    Studies of mechanisms of resistance to glyphosate have increased current understanding of herbicide resistance mechanisms. Thus far, single-codon non-synonymous mutations of EPSPS (5-enolypyruvylshikimate-3-phosphate synthase) have been rare and, relative to other herbicide mode of action target-site mutations, unconventionally weak in magnitude for resistance to glyphosate. However, it is possible that weeds will emerge with non-synonymous mutations of two codons of EPSPS to produce an enzyme endowing greater resistance to glyphosate. Today, target-gene duplication is a common glyphosate resistance mechanism and could become a fundamental process for developing any resistance trait. Based on competition and substrate selectivity studies in several species, rapid vacuole sequestration of glyphosate occurs via a transporter mechanism. Conversely, as the chloroplast requires transporters for uptake of important metabolites, transporters associated with the two plastid membranes may separately, or together, successfully block glyphosate delivery. A model based on finite glyphosate dose and limiting time required for chloroplast loading sets the stage for understanding how uniquely different mechanisms can contribute to overall glyphosate resistance. PMID:25180399

  3. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

  4. Characterization of bacterial functional groups and microbial activity in microcosms with glyphosate application

    Science.gov (United States)

    Moyano, Sofia; Bonetto, Mariana; Baigorria, Tomas; Pegoraro, Vanesa; Ortiz, Jimena; Faggioli, Valeria; Conde, Belen; Cazorla, Cristian; Boccolini, Monica

    2017-04-01

    Glyphosate is a worldwide used herbicide as c. 90% of transgenic crops are tolerant to it. Microbial degradation of glyphosate molecule in soil is considered the most important process that determines its persistence in the environment. However, the impact of this herbicide on target groups of soil biota remains poorly understood. Our objective was to characterize the abundance of bacterial groups and global microbial activity, under controlled conditions with application of increasing doses of glyphosate. A bioassay was carried out in microcosms using an agricultural soil (Typic Argiudoll) with registered history of glyphosate application from National Institute of Agricultural Technology (INTA, EEA Marcos Juarez, Argentina). Glyphosate of commercial formulation (74.7%) was used and the following treatments were evaluated: Soil without glyphosate (control), and Soil with doses equivalent to 1.12 and 11.2 kg ai ha-1. Microbiological parameters were estimated at 3, 7, 14 and 21 days after herbicide application by counting heterotrophic, cellulolytic, nitrogen fixing (N), and nitrifying bacteria; and fluorescein diacetate hydrolysis (FDA), microbial respiration (MR) and microbial biomass (C-BM). The N cycle related bacteria showed greater sensitivity to glyphosate with significant increases in abundance. On the other hand the C cycle parameters were strongly conditioned by the time elapsed since the application of the herbicide, as did the MR. The FDA declined with the highest dose, while the C-BM was not affected. Therefore, we conclude that in the studied experimental conditions glyphosate stimulated bacterial growth (i.e. target abundances) representing a source of N, C and nutrients. On the other hand, enzymatic activity (FDA) decreased when glyphosate was applied in the highest dose, whereas, it had no effect on the MR nor C-BM, which could be attributable to the organic matter content of the soil. However, future research in field conditions is necessary, for

  5. The Alleviation of Heat Damage to Photosystem II and Enzymatic Antioxidants by Exogenous Spermidine in Tall Fescue

    Directory of Open Access Journals (Sweden)

    Liang Zhang

    2017-10-01

    Full Text Available Tall fescue (Festuca arundinacea Schreb is a typical cool-season grass that is widely used in turf and pasture. However, high temperature as an abiotic stress seriously affects its utilization. The objective of this study was to explore the effect of spermidine (Spd on heat stress response of tall fescue. The samples were exposed to 22°C (normal condition or 44°C (heat stress for 4 h. The results showed that exogenous Spd partially improved the quality of tall fescue leaves under normal temperature conditions. Nevertheless, after heat stress treatment, exogenous Spd significantly decreased the electrolyte leakage of tall fescue leaves. Spd also profoundly reduced the H2O2 and O2⋅- content and increased antioxidant enzymes activities. In addition, PAs can also regulate antioxidant enzymes activities including SOD, POD, and APX which could help to scavenge ROS. Moreover, application of Spd could also remarkably increase the chlorophyll content and had a positive effect on the chlorophyll α fluorescence transients under high temperature. The Spd reagent enhanced the performance of photosystem II (PSII as observed by the JIP-test. Under heat stress, the Spd profoundly improved the partial potentials at the steps of energy bifurcations (PIABS and PItotal and the quantum yields and efficiencies (φP0, δR0, φR0, and γRC. Exogenous Spd could also reduce the specific energy fluxes per QA- reducing PSII reaction center (RC (TP0/RC and ET0/RC. Additionally, exogenous Spd improved the expression level of psbA and psbB, which encoded the proteins of PSII core reaction center complex. We infer that PAs can stabilize the structure of nucleic acids and protect RNA from the degradation of ribonuclease. In brief, our study indicates that exogenous Spd enhances the heat tolerance of tall fescue by maintaining cell membrane stability, increasing antioxidant enzymes activities, improving PSII, and relevant gene expression.

  6. The Alleviation of Heat Damage to Photosystem II and Enzymatic Antioxidants by Exogenous Spermidine in Tall Fescue.

    Science.gov (United States)

    Zhang, Liang; Hu, Tao; Amombo, Erick; Wang, Guangyang; Xie, Yan; Fu, Jinmin

    2017-01-01

    Tall fescue ( Festuca arundinacea Schreb) is a typical cool-season grass that is widely used in turf and pasture. However, high temperature as an abiotic stress seriously affects its utilization. The objective of this study was to explore the effect of spermidine (Spd) on heat stress response of tall fescue. The samples were exposed to 22°C (normal condition) or 44°C (heat stress) for 4 h. The results showed that exogenous Spd partially improved the quality of tall fescue leaves under normal temperature conditions. Nevertheless, after heat stress treatment, exogenous Spd significantly decreased the electrolyte leakage of tall fescue leaves. Spd also profoundly reduced the H 2 O 2 and O 2 ⋅- content and increased antioxidant enzymes activities. In addition, PAs can also regulate antioxidant enzymes activities including SOD, POD, and APX which could help to scavenge ROS. Moreover, application of Spd could also remarkably increase the chlorophyll content and had a positive effect on the chlorophyll α fluorescence transients under high temperature. The Spd reagent enhanced the performance of photosystem II (PSII) as observed by the JIP-test. Under heat stress, the Spd profoundly improved the partial potentials at the steps of energy bifurcations (PI ABS and PI total ) and the quantum yields and efficiencies (φP 0 , δR 0 , φR 0 , and γRC). Exogenous Spd could also reduce the specific energy fluxes per Q A - reducing PSII reaction center (RC) (TP 0 /RC and ET 0 /RC). Additionally, exogenous Spd improved the expression level of psbA and psbB , which encoded the proteins of PSII core reaction center complex. We infer that PAs can stabilize the structure of nucleic acids and protect RNA from the degradation of ribonuclease. In brief, our study indicates that exogenous Spd enhances the heat tolerance of tall fescue by maintaining cell membrane stability, increasing antioxidant enzymes activities, improving PSII, and relevant gene expression.

  7. Safety assessment and feeding value for pigs, poultry and ruminant animals of pest protected (Bt plants and herbicide tolerant (glyphosate, glufosinate plants: interpretation of experimental results observed worldwide on GM plants

    Directory of Open Access Journals (Sweden)

    Aimé Aumaitre

    2010-01-01

    Full Text Available New varieties of plants resistant to pests and/or tolerant to specific herbicides such as maize, soybean, cotton, sugarbeets, canola, have been recently developed by using genetic transformation (GT. These plants contain detectable specificactive recombinant DNA (rDNA and their derived protein. Since they have not been selected for a modification oftheir chemical composition, they can be considered as substantially equivalent to their parents or to commercial varietiesfor their content in nutrients and anti-nutritional factors. However, insect protected maize is less contaminated by mycotoxinsthan its parental counterpart conferring a higher degree of safety to animal feeds. The new feeds, grain and derivatives,and whole plants have been intensively tested in vivo up to 216 days for their safety and their nutritional equivalencefor monogastric farm animals (pig, poultry and ruminants (dairy cows, steers, lambs. The present article is basedon the interpretation and the summary of the scientific results published in original reviewed journals either as full papers(33 or as abstracts (33 available through September 2003. For the duration of the experiments adapted to the species,feed intake, weight gain, milk yield and nutritional equivalence expressed as feed conversion and/or digestibility of nutrientshave never been affected by feeding animals diets containing GT plants. In addition, in all the experimental animals,the body and carcass composition, the composition of milk and animal tissues, as well as the sensory properties of meatare not modified by the use of feeds derived from GT plants. Furthermore, the health of animals, their physiological characteristicsand the survival rate are also not affected.The presence of rDNA and derived proteins can be recognized and quantified in feeds in the case of glyphosate resistant soybeanand canola and in the case of insect protected maize. However, rDNA has never been recovered either in milk, or in

  8. The need for independent research on the health effects of glyphosate-based herbicides.

    Science.gov (United States)

    Landrigan, Philip J; Belpoggi, Fiorella

    2018-05-29

    Glyphosate, formulated as Roundup, is the world's most widely used herbicide. Glyphosate is used extensively on genetically modified (GM) food crops designed to tolerate the herbicide, and global use is increasing rapidly. Two recent reviews of glyphosate's health hazards report conflicting results. An independent review by the International Agency for Research on Cancer (IARC) found that glyphosate is a "probable human carcinogen". A review by the European Food Safety Agency (EFSA) found no evidence of carcinogenic hazard. These differing findings have produced regulatory uncertainty. Reflecting this regulatory uncertainty, the European Commission on November 27 2017, extended authorization for glyphosate for another 5 years, while the European Parliament opposed this decision and issued a call that pesticide approvals be based on peer-reviewed studies by independent scientists rather than on the current system that relies on proprietary industry studies. The Ramazzini Institute has initiated a pilot study of glyphosate's health hazards that will be followed by an integrated experimental research project. This evaluation will be independent of industry support and entirely sponsored by worldwide crowdfunding. The aim of the Ramazzini Institute project is to explore comprehensively the effects of exposures to glyphosate-based herbicides at current real-world levels on several toxicological endpoints, including carcinogenicity, long-term toxicity, neurotoxicity, endocrine disrupting effects, prenatal developmental toxicity, the microbiome and multi-generational effects.

  9. Does glyphosate cause cancer?

    OpenAIRE

    German Federal Institute for Risk Assessment

    2015-01-01

    In its recent evaluation from March 2015, the International Agency for Cancer Research (IARC), as the specialized cancer agency of the World Health Organization (WHO), came to the conclusion that glyphosate should now be classified as a carcinogenic substance in Group 2A (probably carcinogenic to humans), based on “limited evidence” in human-experiments and ”sufficient evidence” in animal-experiments. This classification was pub-lished in a short report in the "Lancet" journal on 20 March 201...

  10. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    is linked to a different set of circumstances than the ones suggested by existing models in contemporary democratic theory. Reorienting the discussion of tolerance, the book raises the question of how to disclose new possibilities within our given context of affect and perception. Once we move away from......Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated...... by the desire to experiment and to become otherwise. The objective is to discuss what gets lost, conceptually as well as politically, when we neglect the subsistence of active tolerance within other practices of tolerance, and to develop a theory of active tolerance in which tolerance's mobilizing character...

  11. Effects of the herbicide glyphosate on non-target plant native species from Chaco forest (Argentina).

    Science.gov (United States)

    Florencia, Ferreira María; Carolina, Torres; Enzo, Bracamonte; Leonardo, Galetto

    2017-10-01

    Agriculture based on transgenic crops has expanded in Argentina into areas formerly occupied by Chaco forest. Even though glyphosate is the herbicide most widely used in the world, increasing evidence indicates severe ecotoxicological effects on non-target organisms as native plants. The aim of this work is to determine glyphosate effects on 23 native species present in the remaining Chaco forests immersed in agricultural matrices. This is a laboratory/greenhouse approach studying acute effects on seedlings after 21 days. A gradient of glyphosate rates (525, 1050, 2100, 4200, and 8400g ai/Ha; recommended field application rate (RFAR) = 2100g ai/Ha) was applied on four-week seedlings cultivated in a greenhouse and response variables (phytotoxicity, growth reduction, and sensitivity to the herbicide) were measured. This gradient of herbicide rates covers realistic rates of glyphosate applications in the crop field and also those that can reach vegetation of forest relicts by off-target drift and overspray. Testing was performed following guidelines for vegetative vigour (post-germination spray). All species showed lethal or sublethal effects after the application of the 25% of RFAR (50% of species showed severe phytotoxicity or death and 70% of species showed growth reduction). The results showed a gradient of sensitivity to glyphosate by which some of the studied species are very sensitive to glyphosate and seedlings died with 25% of RFAR while other species can be classified as herbicide-tolerant. Thus, the vegetation present in the forest relicts could be strongly affected by glyphosate application on crops. Lethal and sublethal effects of glyphosate on non-target plants could promote both the loss of biodiversity in native forest relicts immersed in the agroecosystems and the selection of new crop weeds considering that some biotypes are continuously exposed to low doses of glyphosate. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated by the d...... these alternatives by returning to the notion of tolerance as the endurance of pain, linking this notion to exemplars and theories relevant to the politics of multiculturalism, religious freedom, and free speech....

  13. Chemical composition and nutritive value of irrigated tall fescue ...

    African Journals Online (AJOL)

    in ruminant feeds may be in the form of simple organic compounds or inorganic compounds .... Other researchers (Blaser et al., 1969) have found that cows grazing tall fescue without ... Official methods of analysis (13th edn.). Association of.

  14. Factors affecting the fate and transport of glyphosate and AMPA into surface waters of agricultural watersheds in the United States and Europe

    Science.gov (United States)

    Coupe, R.; Kalkhoff, S.; Capel, P.; Gregoire, C.

    2012-04-01

    Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used extensively in almost all agricultural and urban areas of the United States and Europe. Although, glyphosate is used widely throughout the world in the production of many crops, it is predominately used in the United States on soybeans, corn, potatoes, and cotton that have been genetically modified to be tolerant to glyphosate. From 1992 to 2007, the agricultural use of glyphosate has increased from less than 10,000 Mg to more than 80,000 Mg, respectively. The greatest areal use is in the midwestern United States where glyphosate is applied on transgenic corn and soybeans. Because of the difficulty and expense in analyzing for glyphosate and AMPA (aminomethylphosphonic acid, a primary glyphosate degradate) in water, there have been only small scale studies on the fate and transport of glyphosate. The characterization of the transport of glyphosate and AMPA on a watershed scale is lacking. Glyphosate and AMPA were frequently detected in the surface waters of 4 agricultural watersheds in studies conducted by the U.S. Geological Survey in the United States and at the Laboratory of Hydrology and Geochemistry of Strasbourg. Two of these basins were located in the midwestern United States where the major crops are corn and soybean, the third is located the lower Mississippi River Basin where the major crops are soybean, corn, rice, and cotton, and the fourth was located near Strasbourg, France where the use of glyphosate was on a vineyard. The load as a percent of use ranged from 0.009 to 0.86 percent and could be related to 3 factors: source strength, hydrology, and flowpath. Glyphosate use in a watershed results in some occurrence in surface water at the part per billion level; however, those watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff, and a flowpath that does not include transport through the soil.

  15. A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

    Directory of Open Access Journals (Sweden)

    Ri-He Peng

    Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

  16. Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Baerson, Scott R; Rodriguez, Damian J; Tran, Minhtien; Feng, Yongmei; Biest, Nancy A; Dill, Gerald M

    2002-07-01

    The spontaneous occurrence of resistance to the herbicide glyphosate in weed species has been an extremely infrequent event, despite over 20 years of extensive use. Recently, a glyphosate-resistant biotype of goosegrass (Eleusine indica) was identified in Malaysia exhibiting an LD(50) value approximately 2- to 4-fold greater than the sensitive biotype collected from the same region. A comparison of the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity by glyphosate in extracts prepared from the resistant (R) and sensitive (S) biotypes revealed an approximately 5-fold higher IC(50)(glyphosate) for the (R) biotype. Sequence comparisons of the predicted EPSPS mature protein coding regions from both biotypes revealed four single-nucleotide differences, two of which result in amino acid changes. One of these changes, a proline to serine substitution at position 106 in the (R) biotype, corresponds to a substitution previously identified in a glyphosate-insensitive EPSPS enzyme from Salmonella typhimurium. Kinetic data generated for the recombinant enzymes suggests that the second substitution identified in the (R) EPSPS does not contribute significantly to its reduced glyphosate sensitivity. Escherichia coli aroA- (EPSPS deficient) strains expressing the mature EPSPS enzyme from the (R) biotype exhibited an approximately 3-fold increase in glyphosate tolerance relative to strains expressing the mature EPSPS from the (S) biotype. These results provide the first evidence for an altered EPSPS enzyme as an underlying component of evolved glyphosate resistance in any plant species.

  17. Consumption of Endophyte Infected Fescue During Gestation in Beef Cows

    OpenAIRE

    Oliver, Katherine Rene

    2016-01-01

    Tall fescue is a widely grown, cool season grass prevalent in the eastern United States that is known for its resistance to abiotic and biotic stresses. A main reason for tall fescue's resistance to these stresses is attributed to the presence of a fungal endophyte. Unfortunately, this endophyte also adversely affects cattle production. Cows consuming the ergot alkaloids produced by these endophytes can exhibit decreased feed intake, growth performance, organ vasoconstriction, and increased...

  18. THE REMOVAL OF GLYPHOSATE FROM DRINKING WATER

    Science.gov (United States)

    The effectiveness of granulated activated carbon (GAC), packed activated carbon (PAC), conventional treatment, membranes, and oxidation for removing glyphosate from natural waters is evaluated. Results indicate that GAC and PAC are not effective in removing glyphosate, while oxid...

  19. 75 FR 24969 - Glyphosate From China

    Science.gov (United States)

    2010-05-06

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Notice of withdrawal of petition in... investigation concerning glyphosate from China (investigation No. 731-TA-1178 (Preliminary)) is discontinued...

  20. 75 FR 17768 - Glyphosate From China

    Science.gov (United States)

    2010-04-07

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Institution of antidumping investigation... States is materially retarded, by reason of imports from China of glyphosate, provided for in subheadings...

  1. Herbicide Glyphosate Impact to Earthworm (E. fetida

    Directory of Open Access Journals (Sweden)

    Greta Dajoraitė

    2016-10-01

    Full Text Available Glyphosate is a broad spectrum weed resistant herbicide. Glyphosate may pose negative impact on land ecosystems because of wide broad usage and hydrofilic characteristic. The aim of this study was to investigate negative effects of glyphosate on soil invertebrate organisms (earthworm Eisenia fetida. The duration of experiment was 8 weeks. The range of the test concentrations of glyphosate were: 0,1, 1, 5, 10, 20 mg/kg. To investigate the glyphosate impact on earthworm Eisenia fetida the following endpoints were measured: survival, reproduction and weight. The exposure to 20 mg/kg glyphosate has led to the 100% mortality of earthworms. Glyphosate has led to decreased E. fetida reproduction, the cocoons were observed only in the lowest concentration (0,1 mg/kg. In general: long-term glyphosate toxicity to earthworms (E. fetida may be significant.

  2. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  3. [Poisonings with the herbicides glyphosate and glyphosate-trimesium].

    Science.gov (United States)

    Mortensen, O S; Sørensen, F W; Gregersen, M; Jensen, K

    2000-08-28

    Generally the herbicide glyphosate is considered harmless to humans. Glyphosate-trimesium is labelled harmful (Xn), whereas glyphosate-isopropylamine carries no warning sign. As cases of serious poisoning have emerged contacts to the Poison Information Centre have been reviewed. The persons exposed were mainly smaller children and adults 20 to 59 years of age. Oral exposure was recorded in 47 persons, inhalation exposure in 24 and topical contact in 42. About one fourth of the exposed persons were asymptomatic. Most of the symptomatic poisonings demonstrated complaints from the mouth, the gastrointestinal tract and the airways. Eleven patients were admitted to hospital. Two died, one of them having ingested the isopropylamine salt, the other the trimesium salt. Death ensued quickly in the latter patient. A similar fate was observed in a child--not included in the present material--who had also ingested the trimesium compound.

  4. Glyphosate catabolism by Pseudomonas sp

    International Nuclear Information System (INIS)

    Shinabarger, D.L.

    1986-01-01

    The pathway for the degradation of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. PG2982 has been determined using metabolic radiolabeling experiments. Radiorespirometry experiments utilizing [3- 14 C] glyphosate revealed that approximately 50-59% of the C3 carbon was oxidized to CO 2 . Fractionation of stationary phase cells labeled with [3- 14 C]glyphosate revealed that from 45-47% of the assimilated C3 carbon is distributed to proteins and that amino acids methionine and serine are highly labeled. The nucleic acid bases adenine and guanine received 90% of the C3 label that was incorporated into nucleic acids, and the only pyrimidine base labeled was thymine. Pulse labeling of PG2982 cells with [3- 14 C]glyphosate revealed that [3- 14 C]sarcosine is an intermediate in glyphosate degradation. Examination of crude extracts prepared from PG2982 cells revealed the presence of an enzyme that oxidizes sarcosine to glycine and formaldehyde. These results indicate that the first step in glyphosate degradation by PG2982 is cleavage of the carbon-phosphorus bond, resulting in the release of sarcosine and a phosphate group. The phosphate group is utilized as a source of phosphorus, and the sarcosine is degraded to glycine and formaldehyde. Phosphonate utilization by Pseudomonas sp. PG2982 was investigated. Each of the ten phosphonates tested were utilized as a sole source of phosphorus by PG2982. Representative compounds tested included alkylphosphonates, 1-amino-substituted alkylphosphonates, amino-terminal phosphonates, and an arylphosphonate. PG2982 cultures degraded phenylphosphonate to benzene and produced methane from methylphosphonate. The data indicate that PG2982 is capable of cleaving the carbon-phosphorus bond of several structurally different phosphonates

  5. 76 FR 5780 - Determination of Regulated Status of Alfalfa Genetically Engineered for Tolerance to the...

    Science.gov (United States)

    2011-02-02

    ...] Determination of Regulated Status of Alfalfa Genetically Engineered for Tolerance to the Herbicide Glyphosate... decision and determination on the petition regarding the regulated status of alfalfa genetically engineered... regulated status of alfalfa genetically engineered for tolerance to the herbicide glyphosate based on an...

  6. Error-prone PCR mutation of Ls-EPSPS gene from Liriope spicata conferring to its enhanced glyphosate-resistance.

    Science.gov (United States)

    Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng

    2017-09-01

    Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Concerns over use of glyphosate-based herbicides and risks associated with exposures: a consensus statement.

    Science.gov (United States)

    Myers, John Peterson; Antoniou, Michael N; Blumberg, Bruce; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vandenberg, Laura N; Vom Saal, Frederick S; Welshons, Wade V; Benbrook, Charles M

    2016-02-17

    The broad-spectrum herbicide glyphosate (common trade name "Roundup") was first sold to farmers in 1974. Since the late 1970s, the volume of glyphosate-based herbicides (GBHs) applied has increased approximately 100-fold. Further increases in the volume applied are likely due to more and higher rates of application in response to the widespread emergence of glyphosate-resistant weeds and new, pre-harvest, dessicant use patterns. GBHs were developed to replace or reduce reliance on herbicides causing well-documented problems associated with drift and crop damage, slipping efficacy, and human health risks. Initial industry toxicity testing suggested that GBHs posed relatively low risks to non-target species, including mammals, leading regulatory authorities worldwide to set high acceptable exposure limits. To accommodate changes in GBH use patterns associated with genetically engineered, herbicide-tolerant crops, regulators have dramatically increased tolerance levels in maize, oilseed (soybeans and canola), and alfalfa crops and related livestock feeds. Animal and epidemiology studies published in the last decade, however, point to the need for a fresh look at glyphosate toxicity. Furthermore, the World Health Organization's International Agency for Research on Cancer recently concluded that glyphosate is "probably carcinogenic to humans." In response to changing GBH use patterns and advances in scientific understanding of their potential hazards, we have produced a Statement of Concern drawing on emerging science relevant to the safety of GBHs. Our Statement of Concern considers current published literature describing GBH uses, mechanisms of action, toxicity in laboratory animals, and epidemiological studies. It also examines the derivation of current human safety standards. We conclude that: (1) GBHs are the most heavily applied herbicide in the world and usage continues to rise; (2) Worldwide, GBHs often contaminate drinking water sources, precipitation, and air

  8. Response of Pennsylvania native plant species, corn and soybean to tank mixes of dicamba and glyphosate

    Science.gov (United States)

    Crops such as soybean are being genetically modified to be tolerant to multiple herbicides, such as dicamba and glyphosate, in order to allow treatment with several herbicides to control the development of herbicide resistance in weeds. However, with increased use of multiple-he...

  9. GLYPHOSATE REMOVAL FROM DRINKING WATER

    Science.gov (United States)

    Activated-carbon, oxidation, conventional-treatment, filtration, and membrane studies are conducted to determine which process is best suited to remove the herbicide glyphosate from potable water. Both bench-scale and pilot-scale studies are completed. Computer models are used ...

  10. Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance1

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.

    2015-01-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039

  11. Evolution of a double amino acid substitution in the 5-enolpyruvylshikimate-3-phosphate synthase in Eleusine indica conferring high-level glyphosate resistance.

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B

    2015-04-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.

  12. A glyphosate micro-emulsion formulation displays teratogenicity in Xenopus laevis.

    Science.gov (United States)

    Bonfanti, Patrizia; Saibene, M; Bacchetta, R; Mantecca, P; Colombo, A

    2018-02-01

    Glyphosate is the active ingredient in broad-spectrum herbicide formulations used in agriculture, domestic area and aquatic weed control worldwide. Its market is growing steadily concurrently with the cultivation of glyphosate-tolerant transgenic crops and emergence of weeds less sensitive to glyphosate. Ephemeral and lentic waters near to agricultural lands, representing favorite habitats for amphibian reproduction and early life-stage development, may thus be contaminated by glyphosate based herbicides (GBHs) residues. Previous studies on larval anuran species highlighted increased mortality and growth effects after exposure to different GBHs in comparison to glyphosate itself, mainly because of the surfactants such as polyethoxylated tallow amine present in the formulations. Nevertheless, these conclusions are not completely fulfilled when the early development, characterized by primary organogenesis events, is considered. In this study, we compare the embryotoxicity of Roundup ® Power 2.0, a new GBH formulation currently authorized in Italy, with that of technical grade glyphosate using the Frog Embryo Teratogenesis Assay-Xenopus (FETAX). Our results evidenced that glyphosate was not embryolethal and only at the highest concentration (50 mg a.e./L) caused edemas. Conversely, Roundup ® Power 2.0 exhibited a 96 h LC50 of 24.78 mg a.e./L and a 96 h EC50 of 7.8 mg a.e./L. A Teratogenic Index of 3.4 was derived, pointing out the high teratogenic potential of the Roundup ® Power 2.0. Specific concentration-dependent abnormal phenotypes, such as craniofacial alterations, microphthalmia, narrow eyes and forebrain regionalization defects were evidenced by gross malformation screening and histopathological analysis. These phenotypes are coherent with those evidenced in Xenopus laevis embryos injected with glyphosate, allowing us to hypothesize that the teratogenicity observed for Roundup ® Power 2.0 may be related to the improved efficacy in delivering

  13. The history and current status of glyphosate.

    Science.gov (United States)

    Duke, Stephen O

    2018-05-01

    Glyphosate is the only herbicide to target the enzyme 5-enolpyruvyl-3-shikimate phosphate synthase (EPSPS). It is a high use rate, non-selective herbicide that translocates primarily to metabolic sinks, killing meristematic tissues away from the application site. Its phloem-mobile properties and slow action in killing weeds allow the herbicide to move throughout the plant to kill all meristems, making it effective for perennial weed control. Since commercialization in 1974, its use has grown to dominate the herbicide market. Much of its use is on transgenic, glyphosate-resistant crops (GRCs), which have been the dominant transgenic crops worldwide. GRCs with glyphosate provided the most effective and inexpensive weed management technology in history for a decade or more. However, as a consequence of the rapid increase in glyphosate-resistant (GR) weeds, the effectiveness of glyphosate use in GRCs is declining. Critics have claimed that glyphosate-treated GRCs have altered mineral nutrition and increased susceptibility to plant pathogens because of glyphosate's ability to chelate divalent metal cations, but the complete resistance of GRCs to glyphosate indicates that chelating metal cations do not contribute to the herbicidal activity or significantly affect mineral nutrition. The rates of increases in yields of maize, soybean, and cotton in the USA have been unchanged after high adoption rates of GRCs. Glyphosate is toxic to some plant pathogens, and thereby can act as a fungicide in GRCs. Ultra-low doses of glyphosate stimulate plant growth in glyphosate-susceptible plants by unknown mechanisms. Despite rapid and widespread increases in GR weeds, glyphosate use has not decreased. However, as GR weeds increase, adoption of alternative technologies will eventually lead to decreased use. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in

  14. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

    Science.gov (United States)

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

    2013-01-01

    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  15. Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

    Directory of Open Access Journals (Sweden)

    Tao Zhan

    Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

  16. Lead Accumulation by Tall Fescue (Festuca arundinacea Schreb. Grown on a Lead-Contaminated Soil

    Directory of Open Access Journals (Sweden)

    D. Gilliard

    2005-08-01

    Full Text Available Phytoextraction is gaining acceptance as a cost-effective and environmentally friendly phytoremediation strategy for reducing toxic metal levels from contaminated soils. Cognizant of the potential of this phytoremediation technique as an alternative to expensive engineering-based remediation technologies, experiments were conducted to evaluate the suitability of some plants as phytoextraction species. From one of our preliminary studies, we found that tall fescue (Festuca arundinacea Schreb. cv. Spirit can tolerate and accumulate significant amounts of lead (Pb in its shoots when grown in Pb-amended sand. To further evaluate the suitability of tall fescue as one of the potential crop rotation species for phytoextraction, a study was conducted to determine whether the addition of ethylenediaminetetraacetic acid (EDTA alone or in combination with acetic acid can further enhance the shoot uptake of Pb. Seeds were planted in 3.8 L plastic pots containing top soil, peat, and sand (4:2:1, v:v:v spiked with various levels (0,1000, 2000 mg Pb/kg dry soil of lead. At six weeks after planting, aqueous solutions (0, 5 mmol/kg dry soil of EDTA and acetic acid (5 mmol/kg dry soil were applied to the root zone, and all plants were harvested a week later. Results revealed that tall fescue was relatively tolerant to moderate levels of Pb as shown by non-significant differences in root and shoot biomass among treatments. An exception to this trend however, was the slight reduction in root and shoot biomass of plants exposed to the highest Pb level in combination with the two chelates. Root Pb concentration increased with increasing level of soil-applied Pb. Further increases in root Pb concentrations were attributed to chelate amendments. Translocation index, which is a measure of the partitioning of the metal to the shoots, was significantly enhanced with chelate addition especially when both EDTA and acetic acid were used. Chelate-induced increases in

  17. Overview of glyphosate-resistant weeds worldwide.

    Science.gov (United States)

    Heap, Ian; Duke, Stephen O

    2018-05-01

    Glyphosate is the most widely used and successful herbicide discovered to date, but its utility is now threatened by the occurrence of several glyphosate-resistant weed species. Glyphosate resistance first appeared in Lolium rigidum in an apple orchard in Australia in 1996, ironically the year that the first glyphosate-resistant crop (soybean) was introduced in the USA. Thirty-eight weed species have now evolved resistance to glyphosate, distributed across 37 countries and in 34 different crops and six non-crop situations. Although glyphosate-resistant weeds have been identified in orchards, vineyards, plantations, cereals, fallow and non-crop situations, it is the glyphosate-resistant weeds in glyphosate-resistant crop systems that dominate the area infested and growing economic impact. Glyphosate-resistant weeds present the greatest threat to sustained weed control in major agronomic crops because this herbicide is used to control weeds with resistance to herbicides with other sites of action, and no new herbicide sites of action have been introduced for over 30 years. Industry has responded by developing herbicide resistance traits in major crops that allow existing herbicides to be used in a new way. However, over reliance on these traits will result in multiple-resistance in weeds. Weed control in major crops is at a precarious point, where we must maintain the utility of the herbicides we have until we can transition to new weed management technologies. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Micromorfologia foliar na análise da fitotoxidez por glyphosate em Eucalyptus grandis Leaf micromorphology in the analysis of glyphosate toxicity in Eucalyptus grandis

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2009-01-01

    Full Text Available Foram avaliados os efeitos da deriva de formulações comerciais de glyphosate sobre a superfície foliar e o crescimento de clones de eucalipto. Mudas de seis clones foram submetidas a 129,6 g ha-1 de glyphosate das formulações comerciais Scout®, Roundup NA®, Roundup transorb® e Zapp QI®. Entre os clones não foram identificadas diferenças quanto à tolerância ao glyphosate. Plantas expostas à deriva simulada de Roundup transorb® e Zapp QI® apresentaram, respectivamente, a maior e menor porcentagem de intoxicação. Observou-se menor massa seca em plantas expostas ao glyphosate, independentemente da formulação, e menor altura naquelas expostas ao Scout® e ao Roundup transorb®. As características quantitativas da superfície foliar não foram afetadas pelo glyphosate. As alterações micromorfológicas ocorreram na ausência de danos visíveis e foram observadas em ambas as faces da epiderme, em todos os clones avaliados. Danos como erosão e aspecto amorfo das ceras epicuticulares e infestação por hifas fúngicas ocorreram, independentemente da formulação utilizada. A avaliação anatômica da superfície foliar foi relevante para descrição e interpretação dos danos causados pelo glyphosate. Os dados de crescimento e de intoxicação indicam o Zapp QI® como a formulação de menor risco para a cultura do eucalipto quanto aos efeitos indesejáveis da deriva.The effects of commercial glyphosate drift on the leaf surface and growth of eucalypt clones were evaluated. Seedlings of six clones were submitted to 129.6 g ha-1 sub-rate of commercial glyphosate formulations Scout®, Roundup NA®, Roundup transorb® and Zapp QI®. No differences in tolerance to glyphosate were observed among the clones. Plants exposed to simulated drift of Roundup transorb® and Zapp QI® presented the highest and lowest intoxication percentages, respectively. Plants exposed to glyphosate reduced dry biomass, regardless of the formulation, and also

  19. What fescue toxicosis is really doing inside your animals

    Science.gov (United States)

    Plantings of tall fescue were numerous in Kentucky during the 1940s and 1950s after the cultivar, ‘Kentucky 31’, was released. Its hardiness and adaptability resulted in the grass spreading over much of the middle and upper southeastern USA. Cases of severe lameness and sloughing of hoofs, tails, a...

  20. Chemical composition and nutritive value of irrigated tall fescue ...

    African Journals Online (AJOL)

    Chemical composition and nutritive value of irrigated tall fescue pasture for dairy cows. TJ Dugmore, KP Walsh, Sally J. Morning, CI MacDonald. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO ...

  1. Notice of release of Syn1 Tall Fescue

    Science.gov (United States)

    The Agricultural Research Service, U.S. Department of Agriculture announces the release of Syn1 tall fescue [Festuca arundinacea (syn., Lolium arundinaceum Darbyshire; Schedonorus phoenix (Scop.) Holub)] (PI xxxx, PI xxxx) germplasm developed by Dr. Bryan K. Kindiger at the USDA-ARS Grazinglands Res...

  2. Exogenous Application of Citric Acid Ameliorates the Adverse Effect of Heat Stress in Tall Fescue (Lolium arundinaceum)

    Science.gov (United States)

    Hu, Longxing; Zhang, Zhifei; Xiang, Zuoxiang; Yang, Zhijian

    2016-01-01

    Citric acid may be involved in plant response to high temperature. The objective of this study was to investigate whether exogenous citric acid could improve heat tolerance in a cool-season turfgrass species, tall fescue (Lolium arundinaceum), and to determine the physiological mechanisms of citric acid effects on heat stress tolerance. The grasses were subjected to four citric acid levels (0, 0.2, 2, and 20 mM) and two temperature levels (25/20 and 35/30 ± 0.5°C, day/night) treatments in growth chambers. Heat stress increased an electrolyte leakage (EL) and malonaldehyde (MDA) content, while reduced plant growth, chlorophyll (Chl) content, photochemical efficiency (Fv/Fm), root activity and antioxidant enzyme activities (superoxide dismutase, SOD; catalase, CAT; peroxidase, POD). External citric acid alleviated the detrimental effects of heat stress on tall fescue, which was evidenced by decreased EL and MDA content, and improved plant growth under stress conditions. Additionally, the reduction in Chl content, Fv/Fm, SOD, POD, CAT and root activity were ameliorated in citric acid treated plants under heat stressed conditions. High temperature induced the expression of heat shock protein (HSP) genes, which exhibited greater expression levels after citric acid treatment under heat stress. These results suggest that exogenous citric acid application may alleviate growth and physiological damage caused by high temperature. In addition, the exogenously applied citric acid might be responsible for maintaining membrane stability, root activity, and activation of antioxidant response and HSP genes which could contribute to the protective roles of citric acid in tall fescue responses to heat stress. PMID:26925085

  3. Exogenous Application of Citric Acid Ameliorates the Adverse Effect of Heat Stress in Tall Fescue (Lolium arundinaceum).

    Science.gov (United States)

    Hu, Longxing; Zhang, Zhifei; Xiang, Zuoxiang; Yang, Zhijian

    2016-01-01

    Citric acid may be involved in plant response to high temperature. The objective of this study was to investigate whether exogenous citric acid could improve heat tolerance in a cool-season turfgrass species, tall fescue (Lolium arundinaceum), and to determine the physiological mechanisms of citric acid effects on heat stress tolerance. The grasses were subjected to four citric acid levels (0, 0.2, 2, and 20 mM) and two temperature levels (25/20 and 35/30 ± 0.5°C, day/night) treatments in growth chambers. Heat stress increased an electrolyte leakage (EL) and malonaldehyde (MDA) content, while reduced plant growth, chlorophyll (Chl) content, photochemical efficiency (Fv/Fm), root activity and antioxidant enzyme activities (superoxide dismutase, SOD; catalase, CAT; peroxidase, POD). External citric acid alleviated the detrimental effects of heat stress on tall fescue, which was evidenced by decreased EL and MDA content, and improved plant growth under stress conditions. Additionally, the reduction in Chl content, Fv/Fm, SOD, POD, CAT and root activity were ameliorated in citric acid treated plants under heat stressed conditions. High temperature induced the expression of heat shock protein (HSP) genes, which exhibited greater expression levels after citric acid treatment under heat stress. These results suggest that exogenous citric acid application may alleviate growth and physiological damage caused by high temperature. In addition, the exogenously applied citric acid might be responsible for maintaining membrane stability, root activity, and activation of antioxidant response and HSP genes which could contribute to the protective roles of citric acid in tall fescue responses to heat stress.

  4. Exogenous Application of Citric Acid Ameliorates the Adverse Effect of Heat Stress in Tall Fescue (Festuca arundinacea

    Directory of Open Access Journals (Sweden)

    Longxing eHu

    2016-02-01

    Full Text Available Citric acid may be involved in plant response to high temperature. The objective of this study was to investigate whether exogenous citric acid could improve heat tolerance in a cool‐season turfgrass species, tall fescue (Lolium arundinaceum, and to determine the physiological mechanisms of citric acid effects on heat stress tolerance. The grasses were subjected to four citric acid levels (0, 0.2, 2 and 20 mM and two temperature levels (25/20 and 35/30 ± 0.5 ̊C, day/night treatments in growth chambers. Heat stress increased an electrolyte leakage (EL and malonaldehyde (MDA content, while reduced plant growth, chlorophyll (Chl content, photochemical efficiency (Fv/Fm, root activity and antioxidant enzyme activities (superoxide dismutase, SOD; catalase, CAT; peroxidase, POD. External citric acid alleviated the detrimental effects of heat stress on tall fescue, which was evidenced by decreased EL and MDA content, and improved plant growth under stress conditions. Additionally, the reduction in Chl content, Fv/Fm, SOD, POD, CAT and root activity were ameliorated in citric acid treated plants under heat stressed conditions. High temperature induced the expression of heat shock protein (HSP genes, which exhibited greater expression levels after citric acid treatment under heat stress. These results suggest that exogenous citric acid application may alleviate growth and physiological damage caused by high temperature. In addition, the exogenously applied citric acid might be responsible for maintaining membrane stability, root activity, and activation of antioxidant response and HSP genes which could contribute to the protective roles of citric acid in tall fescue responses to heat stress.

  5. Glyphosate-Degrading Microorganisms from Industrial Activated Sludge

    OpenAIRE

    Balthazor, Terry M.; Hallas, Laurence E.

    1986-01-01

    A plating medium was developed to isolate N-phosphonomethylglycine (glyphosate)-degrading microorganisms, with glyphosate as the sole phosphorus source. Two industrial biosystems treating glyphosate wastes contained elevated microbial counts on the medium. One purified isolate metabolized glyphosate to aminomethylphosphonic acid, mineralizing this accumulating intermediate during log growth. This microorganism has been identified as a Flavobacterium species.

  6. Molecular characterisation and interpretation of genetic diversity within globally distributed germplasm collections of tall fescue (Festuca arundinacea Schreb.) and meadow fescue (F. pratensis Huds.).

    Science.gov (United States)

    Hand, Melanie L; Cogan, Noel O I; Forster, John W

    2012-04-01

    Allohexaploid tall fescue (Festuca arundinacea Schreb. syn. Lolium arundinaceum [Schreb.] Darbysh.) is an agriculturally important grass cultivated for pasture and turf world-wide. Genetic improvement of tall fescue could benefit from the use of non-domesticated germplasm to diversify breeding populations through the incorporation of novel and superior allele content. However, such potential germplasm must first be characterised, as three major morphotypes (Continental, Mediterranean and rhizomatous) with varying degrees of hybrid interfertility are commonly described within this species. As hexaploid tall fescue is also a member of a polyploid species complex that contains tetraploid, octoploid and decaploid taxa, it is also possible that germplasm collections may have inadvertently sampled some of these sub-species. In this study, 1,040 accessions from the publicly available United States Department of Agriculture tall fescue and meadow fescue germplasm collections were investigated. Sequence of the chloroplast genome-located matK gene and the nuclear ribosomal DNA internal transcribed spacer (rDNA ITS) permitted attribution of accessions to the three previously known morphotypes and also revealed the presence of tall fescue sub-species of varying ploidy levels, as well as other closely related species. The majority of accessions were, however, identified as Continental hexaploid tall fescue. Analysis using 34 simple sequence repeat markers was able to further investigate the level of genetic diversity within each hexaploid tall fescue morphotype group. At least two genetically distinct sub-groups of Continental hexaploid tall fescue were identified which are probably associated with palaeogeographic range expansion of this morphotype. This work has comprehensively characterised a large and complex germplasm collection and has identified genetically diverse accessions which may potentially contribute valuable alleles at agronomic loci for tall fescue cultivar

  7. 150 ACUTE TOXICITY OF GLYPHOSATE ON CLARIAS ...

    African Journals Online (AJOL)

    The effects of glyphosate on mortality rate and behavioural responses of Clarias gariepinus fingerlings were investigated under laboratory conditions for 96 hours exposure period. The lethal concentration (LC50) value of glyphosate on fingerlings of Clarias gariepinus was 0.0018 ml/l for 96 hours of exposure.

  8. Effect of glyphosate on wheat quality characteristics

    Science.gov (United States)

    Glyphosate is the most widely used herbicide in the world. It is a non-selective, broad spectrum, post-emergence herbicide, and therefore controls a wide range of different species. Although glyphosate is effective in weed control, side effects of this herbicide on the crop itself, micro and macro o...

  9. Determination of glyphosate by high performance liquid ...

    African Journals Online (AJOL)

    The aim of this study was to design a glyphosate analysis method. This molecule is an organic pollutant from water and soil. We have developed a chromatographic method with phenylisothiocyanate. This molecule has allowed obtaining an intermediate molecule with the glyphosate being easily detectable in ...

  10. Glyphosate-resistant goosegrass from Mississippi

    Science.gov (United States)

    A glyphosate resistant population of goosegrass (Eleusine indica (L.) Gaertn.) was documented near Stoneville, Mississippi, USA, in an area which had received multiple applications of glyphosate each year for the previous eleven years. Resistance ratios based on dose response growth reduction assays...

  11. Glyphosate: too much of a good thing?

    Directory of Open Access Journals (Sweden)

    Marek eCuhra

    2016-04-01

    Full Text Available Although previously accepted as the less toxic alternative, with low impact on animals, farmers as well as consumers who are exposed to residues in food, glyphosate chemicals are now increasingly controversial as new evidence from research is emerging. We argue that specific aspects of the history, chemistry and safety of glyphosate and glyphosate-based herbicides should be thoroughly considered in present and future re-evaluations of these dominant agrochemicals:· Glyphosate is not a single chemical, it is a family of compounds with different chemical, physical and toxicological properties.· Glyphosate is increasingly recognized as having more profound toxicological effects than assumed from previous assessments.· Global use of glyphosate is continuously increasing and residues are detected in food, feed and drinking water. Thus, consumers are increasingly exposed to higher levels of glyphosate residues, and from an increasing number of sources.· Glyphosate regulation is predominantly still based on primary safety-assessment testing in various indicator organisms. However, archive studies indicate fraud and misbehavior committed by the commercial laboratories providing such research.We see emerging evidences from studies in test-animals, ecosystems indicators and studies in human health, which justify stricter regulatory measures. This implies revising glyphosate residue definitions and lowering Maximum Residue Limits (MRLs permissible in biological material intended for food and feed, as well as strengthening environmental criteria such as accepted residue concentrations in surface waters.It seems that although recent research indicates that glyphosates are less harmless than previously assumed and have complex toxicological potential, still regulatory authorities accept industry demands for approving higher levels of these residues in food and feed.

  12. Bermudagrass (Cynodon spp) dose-response relationships with clethodim, glufosinate and glyphosate.

    Science.gov (United States)

    Webster, Theodore M; Hanna, Wayne W; Mullinix, Benjamin G

    2004-12-01

    Greenhouse studies were conducted to evaluate the sensitivity of three commercial cultivars, eight experimental cultivars and common bermudagrass to clethodim, glufosinate and glyphosate. Each herbicide was applied at eight doses. Data were regressed on herbicide dose using a log-logistic curve (R2 = 0.56-0.95 for clethodim, R2 = 0.60-0.94 for glufosinate, and R2 = 0.70-0.96 for glyphosate). The herbicide rate that elicited a 50% plant response (I50) in the bermudagrass cultivars ranged from 0.04 to 0.19 kg ha(-1) clethodim, 0.19 to 1.33 kg ha(-1) glufosinate and 0.34 to 1.14 kg ha(-1) glyphosate. Relative to other cultivars, common bermudagrass was intermediate in its response to clethodim and among the most tolerant cultivars to glufosinate and glyphosate. TifSport was relatively tolerant to clethodim and glufosinate compared with other cultivars, but relatively sensitive to glyphosate. One cultivar, 94-437, was consistently among the most sensitive cultivars to each of the herbicides. While there were differential herbicide tolerances among the tested bermudagrass cultivars, there did not appear to be any naturally occurring herbicide resistance that could be commercially utilized. However, research indicated that breeding efforts should target herbicide resistance that is at least four times the registered use rate. Also, TifSport and Tifway have been identified as suitable representatives of triploid hybrid bermudagrass cultivars to be used to evaluate the success of turfgrass renovation programs. 2004 Society of Chemical Industry.

  13. Seedling Establishment of Tall Fescue Exposed to Long-Term Starvation Stress

    Czech Academy of Sciences Publication Activity Database

    Pompeiano, Antonio; Damiani, C. R.; Stefanini, S.; Vernieri, S.; Reyes, T. H.; Volterrani, M.; Guglielminetti, L.

    2016-01-01

    Roč. 11, č. 11 (2016), č. článku e0166131. E-ISSN 1932-6203 Institutional support: RVO:67179843 Keywords : seedling * Tall fescue * Tall fescue exposed * starvation Subject RIV: EH - Ecology, Behaviour Impact factor: 2.806, year: 2016

  14. Cluster fescue (Festuca paradoxa Desv.): A multipurpose native cool-season grass

    Science.gov (United States)

    Nadia E. Navarrete-Tindall; J.W. Van Sambeek; R.A. Pierce

    2005-01-01

    Native cool-season grasses (NCSG) are adapted to a wide range of habitats and environmental conditions, and cluster fescue (Festuca paradoxa Desv.) is no exception. Cluster fescue can be found in unplowed upland prairies, prairie draws, savannas, forest openings, and glades (Aiken et al. 1996). Although its range includes 23 states in the continental...

  15. Incidence of viruses in fescue (Festuca sp.) seed production fields in the Willamette Valley in 2016

    Science.gov (United States)

    Tall Fescue seed production fields of Western Oregon were sampled and tested for the presence or absence of three viruses, Barley yellow dwarf virus (BYDV) -MAV and -PAV, and Cereal yellow dwarf virus (CYDV). There was no BYDV-MAV detected in any of the Fescue seed fields. The BYDV-PAV occurred in ...

  16. Soil Organic Carbon Fractions Differ in Two Contrasting Tall Fescue Systems

    Science.gov (United States)

    The value of tall fescue (Festuca arundinacea Schreb.) for C sequestration in addition to forage production and soil conservation is of current interest. However, studies relating to the impacts of endophyte infected (E+) and endophyte free (E-) tall fescue on soil organic matter fractions are few....

  17. Identification of geneticaly modified soybean seeds resistant to glyphosate

    Directory of Open Access Journals (Sweden)

    Tillmann Maria Ângela André

    2004-01-01

    Full Text Available Advances in genetic engineering permit the modification of plants to be tolerant to certain herbicides that are usually not selective. For practical and commercial purposes, it is important to be able to detect the presence or absence of these traits in genotypes. The objective of this research was to develop a procedure for identifying genetically modified soybean (Glycine max L. Merr. with resistance to the herbicide glyphosate. Two studies were conducted based on germination test. In the first study, soybean seeds were pre-imbibed in paper towel with the herbicide solutions, then transferred to moist paper towel for the germination test. In the second study, seeds were placed directly in herbicide solutions in plastic cups and tested for germination using the paper towel method. Eight soybean genotypes were compared: four Roundup Ready, that contained the gene resistant to the herbicide (G99-G725, Prichard RR, G99-G6682, and H7242 RR and four non-transgenic parental cultivars (Boggs, Haskell, Benning, and Prichard. In the first study, the seeds were imbibed for 16 hours at 25°C in herbicide concentrations between 0.0 and 1.5% of the glyphosate active ingredient. In the second, seeds were subjected to concentrations between 0.0 and 0.48%, for one hour, at 30°C. The evaluation parameters were: germination, hypocotyl length, root length and total length of the seedlings. Both methods are efficient in identifying glyphosate-resistant soybean genotypes. It is possible to identify the genetically modified soybean genotypes after three days, by imbibing the seed in 0.12% herbicide solution, and after six days if the substrate is pre-imbibed in a 0.6% herbicide solution. The resistance trait was identified in all cultivars, independent of the initial physiological quality of the seed.

  18. [Glyphosate--a non-toxic pesticide?].

    Science.gov (United States)

    Pieniazek, Danuta; Bukowska, Bozena; Duda, Wirgiliusz

    2003-01-01

    Glyphosate is currently the most commonly applied herbicide and its use is still growing. Nowadays, over 50 commercial preparations containing this compound are used, and these formulations are much more toxic than their active compound, glyphosate, owing to the presence of many surfactants and carrier compounds. Toxicological investigations provide evidence that glyphosate is an extremely "safe" herbicide for animals. This is why its use in agriculture is universal. In June 1991, the Environmental Protection Agency (EPA) categorized this compound into class E (according to EPA there are five categories of carcinogenicity), which means that it is probably not carcinogenic to humans. Unfortunately, the study carried out by Swedish oncologists in 2001 showed that glyphosate may induce cancer of the lymphatic system. The results of the Swedish study have changed our opinion about "safety" of this herbicide. Investigations concerning both its accumulation and toxic effect in animals and plants are now under way in many laboratories.

  19. Electrochemical degradation and mineralization of glyphosate herbicide.

    Science.gov (United States)

    Tran, Nam; Drogui, Patrick; Doan, Tuan Linh; Le, Thanh Son; Nguyen, Hoai Chau

    2017-12-01

    The presence of herbicide is a concern for both human and ecological health. Glyphosate is occasionally detected as water contaminants in agriculture areas where the herbicide is used extensively. The removal of glyphosate in synthetic solution using advanced oxidation process is a possible approach for remediation of contaminated waters. The ability of electrochemical oxidation for the degradation and mineralization of glyphosate herbicide was investigated using Ti/PbO 2 anode. The current intensity, treatment time, initial concentration and pH of solution are the influent parameters on the degradation efficiency. An experimental design methodology was applied to determine the optimal condition (in terms of cost/effectiveness) based on response surface methodology. Glyphosate concentration (C 0  = 16.9 mg L -1 ) decreased up to 0.6 mg L -1 when the optimal conditions were imposed (current intensity of 4.77 A and treatment time of 173 min). The removal efficiencies of glyphosate and total organic carbon were 95 ± 16% and 90.31%, respectively. This work demonstrates that electrochemical oxidation is a promising process for degradation and mineralization of glyphosate.

  20. EPA's evaluation of the carcinogenic potential of glyphosate

    Science.gov (United States)

    Recently, several international agencies have evaluated the carcinogenic potential of glyphosate. In March 2015, the International Agency for Research on Cancer (IARC), a subdivision of the World Health Organization (WHO), determined that glyphosate was a probable carcinogen (gro...

  1. Fate of the herbicides glyphosate, glufosinate-ammonium, phenmedipham, ethofumesate and metamitron in two Finnish arable soils.

    Science.gov (United States)

    Laitinen, Pirkko; Siimes, Katri; Eronen, Liisa; Rämö, Sari; Welling, Leena; Oinonen, Seija; Mattsoff, Leona; Ruohonen-Lehto, Marja

    2006-06-01

    The fate of five herbicides (glyphosate, glufosinate-ammonium, phenmedipham, ethofumesate and metamitron) was studied in two Finnish sugar beet fields for 26 months. Soil types were sandy loam and clay. Two different herbicide-tolerant sugar beet cultivars and three different herbicide application schedules were used. Meteorological data were collected throughout the study and soil properties were thoroughly analysed. An extensive data set of herbicide residue concentrations in soil was collected. Five different soil depths were sampled. The study was carried out using common Finnish agricultural practices and represents typical sugar beet cultivation conditions in Finland. The overall observed order of persistence was ethofumesate > glyphosate > phenmedipham > metamitron > glufosinate-ammonium. Only ethofumesate and glyphosate persisted until the subsequent spring. Seasonal variation in herbicide dissipation was very high and dissipation ceased almost completely during winter. During the 2 year experiment no indication of potential groundwater pollution risk was obtained, but herbicides may cause surface water pollution. Copyright (c) 2006 Society of Chemical Industry

  2. Glyphosate-Resistant and Conventional Canola (Brassica napus L.) Responses to Glyphosate and Aminomethylphosphonic Acid (AMPA) Treatment.

    Science.gov (United States)

    Corrêa, Elza Alves; Dayan, Franck E; Owens, Daniel K; Rimando, Agnes M; Duke, Stephen O

    2016-05-11

    Glyphosate-resistant (GR) canola contains two transgenes that impart resistance to the herbicide glyphosate: (1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and (2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshikimic acid-3-phosphate synthase. The objectives of this research were to determine the phytotoxicity of AMPA to canola, the relative metabolism of glyphosate to AMPA in GR and conventional non-GR (NGR) canola, and AMPA pool sizes in glyphosate-treated GR canola. AMPA applied at 1.0 kg ha(-1) was not phytotoxic to GR or NGR. At this AMPA application rate, NGR canola accumulated a higher concentration of AMPA in its tissues than GR canola. At rates of 1 and 3.33 kg ae ha(-1) of glyphosate, GR canola growth was stimulated. This stimulatory effect is similar to that of much lower doses of glyphosate on NGR canola. Both shikimate and AMPA accumulated in tissues of these glyphosate-treated plants. In a separate experiment in which young GR and NGR canola plants were treated with non-phytotoxic levels of [(14)C]-glyphosate, very little glyphosate was metabolized in NGR plants, whereas most of the glyphosate was metabolized to AMPA in GR plants at 7 days after application. Untreated leaves of GR plants accumulated only metabolites (mostly AMPA) of glyphosate, indicating that GOX activity is very high in the youngest leaves. These data indicate that more glyphosate is transformed to AMPA rapidly in GR canola and that the accumulated AMPA is not toxic to the canola plant.

  3. Location, Root Proximity, and Glyphosate-use History Modulate the Effects of Glyphosate on Fungal Community Networks of Wheat

    Science.gov (United States)

    Glyphosate is the most-used herbicide worldwide and an essential tool for weed control in no-till cropping systems. However, concerns have been raised regarding the long-term effects of glyphosate on soil microbial communities. We examined the impact of repeated glyphosate application on bulk and rh...

  4. Photosynthate partitioning in basal zones of tall fescue leaf blades

    International Nuclear Information System (INIS)

    Allard, G.; Nelson, C.J.

    1991-01-01

    Elongating grass leaves have successive zones of cell division, cell elongation, and cell maturation in the basal portion of the blade and are a strong sink for photosynthate. Our objective was to determine dry matter (DM) deposition and partitioning in basal zones of elongating tall fescue (Festuca arundinacea Schreb.) leaf blades. Vegetative tall fescue plants were grown in continuous light (350 micromoles per square meter per second photosynthetic photon flux density) to obtain a constant spatial distribution of elongation growth with time. Content and net deposition rates of water-soluble carbohydrates (WSC) and DM along elongating leaf blades were determined. These data were compared with accumulation of 14 C in the basal zones following leaf-labeling with 14 CO 2 . Net deposition of DM was highest in the active cell elongation zone, due mainly to deposition of WSC. The maturation zone, just distal to the elongation zone, accounted for 22% of total net deposition of DM in elongating leaves. However, the spatial profile of 14 C accumulation suggested that the elongation zone and the maturation zone were sinks of equal strength. WSC-free DM accounted for 55% of the total net DM deposition in elongating leaf blades, but only 10% of incoming 14 C-photosynthate accumulated in the water-insoluble fraction (WIF ∼ WSC-free DM) after 2 hours. In the maturation zone, more WSC was used for synthesis of WSC-free DM than was imported as recent photosynthate

  5. Glyphosate-Resistant Goosegrass from Mississippi

    Directory of Open Access Journals (Sweden)

    Vijay K. Nandula

    2013-05-01

    Full Text Available A suspected glyphosate-resistant goosegrass [Eleusine indica (L. Gaertn.] population, found in Washington County, Mississippi, was studied to determine the level of resistance and whether the resistance was due to a point mutation, as was previously identified in a Malaysian population. Whole plant dose response assays indicated a two- to four-fold increase in resistance to glyphosate. Leaf disc bioassays based on a glyphosate-dependent increase in shikimate levels indicated a five- to eight-fold increase in resistance. Sequence comparisons of messenger RNA for epsps, the gene encoding the enzyme 5-enolpyruvylshikimate-3-phosphate synthase, from resistant and sensitive goosegrass, revealed a cytosine to thymine nucleotide change at position 319 in the resistant accessions. This single nucleotide polymorphism causes a proline to serine amino acid substitution at position 106 in 5-enolpyruvylshikimate-3-phosphate synthase. A real-time polymerase chain reaction assay using DNA probes specific for the nucleotide change at position 319 was developed to detect this polymorphism. Goosegrass from 42 locations were screened, and the results indicated that glyphosate-resistant goosegrass remained localized to where it was discovered. Pendimethalin, s-metolachlor, clethodim, paraquat and fluazifop controlled resistant goosegrass 93% to 100%, indicating that several control options for glyphosate-resistant goosegrass are available.

  6. Resposta de varjão (Parkia multijuga a subdoses de glyphosate Response of varjão (Parkia multijuga seedlings to reduced glyphosate rates

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2006-09-01

    Full Text Available O consumo de madeira no Brasil e no mundo apresenta demanda crescente. Em confronto com a pressão ambientalista de manutenção das florestas nativas, há necessidade de se estabelecerem áreas de reflorestamento para suprir o aumento da demanda de madeira, com a utilização de formas de manejo e tratos culturais que permitam o pleno crescimento das essências florestais. Um dos principais problemas do manejo de reflorestamento é a interferência das plantas daninhas após o plantio das mudas no campo, sendo o uso de herbicidas a principal forma de manejo. Este trabalho teve o objetivo de avaliar a eficiência de doses crescentes de glyphosate em mudas de varjão em condições de ambiente protegido. Foram avaliadas as doses de 0, 90, 180, 360 e 720 g ha-1 de glyphosate em plantas com quatro meses de idade, observando a intoxicação das plantas, altura, diâmetro do caule e número de folhas. O varjão, nas condições do experimento, apresentou tolerância e recuperação ao glyphosate até a dose de 360 g ha-1. Doses superiores a esta retardaram o crescimento da planta. O prejuízo causado pela deriva de glyphosate nessas plantas foi diretamente proporcional ao aumento da dose. Os sintomas evoluíram para queda de folhas, comprometendo o crescimento das plantas.Wood consumption has significantly increased in Brazil and worldwide.The environmental pressure to preserve native forest led to the need to establish reforestation areas to meet the increasing wood demand by applying cultural practices and management allowing a total growth of forest trees. One of the main problems in reforestation management is weed competition after seedling planting, with herbicide use being the main form of management. The objective of this work was to evaluate the phytotoxic effect of increasing rates of glyphosate on Varjão seedlings, under greenhouse conditions. Concentrations of 90, 180, 360 and 720 g ha-1 of glyphosate were evaluated in four

  7. Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses.

    Directory of Open Access Journals (Sweden)

    Zhimin Yang

    Full Text Available Tall fescue (Festuca arundinacea Schreb. is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanisms of grass stress tolerance due to its superior drought and heat tolerance among cool-season species. Selection of suitable reference genes for quantification of target gene expression is important for the discovery of molecular mechanisms underlying improved growth traits and stress tolerance. The stability of nine potential reference genes (ACT, TUB, EF1a, GAPDH, SAND, CACS, F-box, PEPKR1 and TIP41 was evaluated using four programs, GeNorm, NormFinder, BestKeeper, and RefFinder. The combinations of SAND and TUB or TIP41 and TUB were most stably expressed in salt-treated roots or leaves. The combinations of GAPDH with TIP41 or TUB were stable in roots and leaves under drought stress. TIP41 and PEPKR1 exhibited stable expression in cold-treated roots, and the combination of F-box, TIP41 and TUB was also stable in cold-treated leaves. CACS and TUB were the two most stable reference genes in heat-stressed roots. TIP41 combined with TUB and ACT was stably expressed in heat-stressed leaves. Finally, quantitative real-time polymerase chain reaction (qRT-PCR assays of the target gene FaWRKY1 using the identified most stable reference genes confirmed the reliability of selected reference genes. The selection of suitable reference genes in tall fescue will allow for more accurate identification of stress-tolerance genes and molecular mechanisms conferring stress tolerance in this stress-tolerant species.

  8. Bulls grazing Kentucky 31 tall fescue exhibit impaired growth, semen quality, and decreased semen freezing potential

    Science.gov (United States)

    Serum prolactin (PRL) and testosterone concentrations, body weight, body composition, semen quality, and semen freezing potential for bulls grazing the toxic tall fescue (Lolium arundinaceum [Schreb.] Darbysh. ¼ Schedonorous arundinaceum [Schreb.] Dumort.) cultivar Kentucky 31 (E+) compared with a n...

  9. Alkaloids May Not be Responsible for Endophyte Associated Reductions in Tall Fescue Decomposition Rates

    Science.gov (United States)

    1. Fungal endophyte - grass symbioses can have dramatic ecological effects, altering individual plant physiology, plant and animal community structure and function, and ecosystem processes such as litter decomposition and nutrient cycling. 2. Within the tall fescue (Schedonorus arundinaceus) - funga...

  10. Nutrition and In Vitro Digestibility of Tall Fescue for White-Tailed Deer, May Through November

    Science.gov (United States)

    G.E. Probasco; A.J. Bjugstad

    1978-01-01

    Describes a study of the nutritive quality and digestibility of ferilized and unfertilized tall fescue in spring, summer, and fall. The grass may be most valuable as food in early spring and late fall, and on unfertilized sites.

  11. A Simple Tall Fescue Seed Extraction and Partial Purification of Ergovaline

    Science.gov (United States)

    There are several substances present in the tall fescue/endophyte association (Lolium arundinaceum /Neotyphodium coenophialum) that have biological activity. These include the pyrrolizidine and ergot alkaloids plus peramine. Of these compounds only the ergot alkaloids have significant mammalian to...

  12. Resposta de diferentes populações de Digitaria insularis ao herbicida glyphosate Response of different Digitaria insularis populations to glyphosate

    Directory of Open Access Journals (Sweden)

    N.M Correia

    2010-12-01

    Full Text Available Objetivou-se com estse trabalho avaliar o controle químico de diferentes populações de capim-amargoso (Digitaria insularis pelo herbicida glyphosate por meio de curva de dose-resposta, além de propor tratamentos alternativos para as populações mais tolerantes. O delineamento experimental foi o de blocos ao acaso, com quatro repetições, em esquema fatorial 5 x 9. As sementes de capim-amargoso foram coletadas em cinco locais: área de produção de grãos da Fazenda de Ensino, Pesquisa e Produção da UNESP, Jaboticabal (SP; área de produção comercial de grãos, localizada nos municípios de Campo Florido-MG e Rio Verde-GO; pomar de laranja, localizado no município de Matão (SP; e área não agrícola sem histórico da aplicação de glyphosate (Jaboticabal-SP. O glyphosate (0D, 1/4D, 1/2D, D, 2D, 4D e 8D, em que D é a dose recomendada de 1,5 kg ha-1 de equivalente ácido e as suas associações [glyphosate + fluazifop-p-butil (1,5 + 0,25 kg ha-1 e glyphosate (1,5 kg ha-1 com sequencial de diuron + paraquat (0,20 + 0,40 kg ha-1 + 0,2% de surfatante] foram pulverizados em plantas de sete a oito perfilhos e altura média de 20 cm. As populações de capim-amargoso de Campo Florido e Rio Verde foram consideradas suscetíveis; as de Jaboticabal e Matão, tolerantes; e a da área não agrícola, de sensibilidade intermediária. A associação de glyphosate ao fluazifop ou a sua aplicação com sequencial de diuron + paraquat foram eficazes no controle das populações mais tolerantes de capim-amargoso.The objective of this study was to evaluate the chemical control of different sourgrass (Digitaria insularis populations by the herbicide glyphosate through dose-response curves, besides considering alternative treatments to control tolerant populations. A randomized block design was used with four replications, in a factorial scheme (5 x 9. Sourgrass seeds were colleted from five locations: a grain production area located at the educational

  13. The use of BMED for glyphosate recovery from glyphosate neutralization liquor in view of zero discharge.

    Science.gov (United States)

    Shen, Jiangnan; Huang, Jie; Liu, Lifen; Ye, Wenyuan; Lin, Jiuyang; Van der Bruggen, Bart

    2013-09-15

    Alkaline glyphosate neutralization liquors containing a high salinity pose a severe environmental pollution problem by the pesticide industry. However, there is a high potential for glyphosate recovery due to the high concentration of glyphosate in the neutralization liquors. In the study, a three-compartment bipolar membrane electrodialysis (BMED) process was applied on pilot scale for the recovery of glyphosate and the production of base/acid with high concentration in view of zero discharge of wastewater. The experimental results demonstrate that BMED can remove 99.0% of NaCl from the feed solution and transform this fraction into HCl and NaOH with high concentration and purity. This is recycled for the hydrolysis reaction of the intermediate product generated by the means of the Mannich reaction of paraformaldehyde, glycine and dimethylphosphite catalyzed by triethylamine in the presence of HCl and reclamation of the triethylamine catalyst during the production process of glyphosate. The recovery of glyphosate in the feed solution was over 96%, which is acceptable for industrial production. The current efficiency for producing NaOH with a concentration of 2.0 mol L(-1) is above 67% and the corresponding energy consumption is 2.97 kWh kg(-1) at a current density of 60 mA cm(-2). The current efficiency increases and energy consumption decreases as the current density decreases, to 87.13% and 2.37 kWh kg(-1), respectively, at a current density of 30 mA cm(-2). Thus, BMED has a high potential for desalination of glyphosate neutralization liquor and glyphosate recovery, aiming at zero discharge and resource recycling in industrial application. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Effects of glyphosate on the mineral content of glyphosate-resistant soybeans (Glycine max).

    Science.gov (United States)

    Duke, Stephen O; Reddy, Krishna N; Bu, Kaixuan; Cizdziel, James V

    2012-07-11

    There are conflicting claims as to whether treatment with glyphosate adversely affects mineral nutrition of glyphosate-resistant (GR) crops. Those who have made claims of adverse effects have argued links between reduced Mn and diseases in these crops. This article describes experiments designed to determine the effects of a recommended rate (0.86 kg ha(-1)) of glyphosate applied once or twice on the mineral content of young and mature leaves, as well as in seeds produced by GR soybeans (Glycine max) in both the greenhouse and field using inductively coupled plasma mass spectrometry (ICP-MS). In the greenhouse, there were no effects of either one application (at 3 weeks after planting, WAP) or two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves sampled at 6, 9, and 12 WAP and in harvested seed. Se concentrations were too low for accurate detection in leaves, but there was also no effect of glyphosate applications on Se in the seeds. In the field study, there were no effects of two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves at either 9 or 12 WAP. There was also no effect on Se in the seeds. There was no difference in yield between control and glyphosate-treated GR soybeans in the field. The results indicate that glyphosate does not influence mineral nutrition of GR soybean at recommended rates for weed management in the field. Furthermore, the field studies confirm the results of greenhouse studies.

  15. Glyphosate resistance in Ambrosia trifida: Part 1. Novel rapid cell death response to glyphosate.

    Science.gov (United States)

    Van Horn, Christopher R; Moretti, Marcelo L; Robertson, Renae R; Segobye, Kabelo; Weller, Stephen C; Young, Bryan G; Johnson, William G; Schulz, Burkhard; Green, Amanda C; Jeffery, Taylor; Lespérance, Mackenzie A; Tardif, François J; Sikkema, Peter H; Hall, J Christopher; McLean, Michael D; Lawton, Mark B; Sammons, R Douglas; Wang, Dafu; Westra, Philip; Gaines, Todd A

    2018-05-01

    Glyphosate-resistant (GR) Ambrosia trifida is now present in the midwestern United States and in southwestern Ontario, Canada. Two distinct GR phenotypes are known, including a rapid response (GR RR) phenotype, which exhibits cell death within hours after treatment, and a non-rapid response (GR NRR) phenotype. The mechanisms of resistance in both GR RR and GR NRR remain unknown. Here, we present a description of the RR phenotype and an investigation of target-site mechanisms on multiple A. trifida accessions. Glyphosate resistance was confirmed in several accessions, and whole-plant levels of resistance ranged from 2.3- to 7.5-fold compared with glyphosate-susceptible (GS) accessions. The two GR phenotypes displayed similar levels of resistance, despite having dramatically different phenotypic responses to glyphosate. Glyphosate resistance was not associated with mutations in EPSPS sequence, increased EPSPS copy number, EPSPS quantity, or EPSPS activity. These encompassing results suggest that resistance to glyphosate in these GR RR A. trifida accessions is not conferred by a target-site resistance mechanism. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. Interação de glyphosate com carfentrazone-ethyl Glyphosate - carfentrazone-ethyl interaction

    Directory of Open Access Journals (Sweden)

    R.C. Werlang

    2002-04-01

    Full Text Available Foi conduzido um experimento em condições controladas para determinar a interação do carfentrazone-ethyl em mistura no tanque com o herbicida glyphosate, no controle de seis espécies de plantas daninhas. Glyphosate aplicado isoladamente na dose de 720 g ha-1 foi eficaz no controle de Amaranthus hybridus (100%, Desmodium tortuosum (100%, Bidens pilosa (99%, Eleusine indica (96%, Digitaria horizontalis (100% e Commelina benghalensis (93% aos 21 DAA. Carfentrazone-ethyl aplicado isoladamente controlou eficazmente C. benghalensis. As misturas de glyphosate nas doses de 252 e 720 g ha-1 com carfentrazone-ethyl nas doses de 15 e 30 g ha¹ demonstraram efeito aditivo no controle de A. hybridus, D. tortuosum e Bidens pilosa, à exceção das misturas de glyphosate na dose de 252 g ha-1 com as doses de 15 e 30 g ha-1 de carfentrazone-ethyl, que proporcionam efeito sinergístico no controle de D. tortuosum. A adição das duas doses de carfentrazone-ethyl antagonizou o efeito de glyphosate na menor dose (252 g ha-1 no controle de E. indica, apresentando, no entanto, efeito aditivo com o glyphosate na maior dose (720 g ha-1. Já para D. horizontalis, as misturas de carfentrazone-ethyl com glyphosate na menor dose (252 g ha-1 apresentaram efeito sinergístico no controle dessa espécie, demonstrando, ainda, efeito aditivo na mistura com glyphosate na dose de 720 g ha-1. A mistura de carfentrazone-ethyl com glyphosate proporcionou efeito aditivo no controle de C. benghalensis, independentemente das combinações de doses avaliadas. Os resultados deste experimento indicam que carfentrazone-ethyl apresenta comportamento diferenciado quanto à interação com glyphosate, dependendo da espécie de planta daninha e da dose dos herbicidas utilizados na mistura em tanque, sendo complementar na mistura em tanque com glyphosate, pois demonstrou efeito antagônico em poucas das combinações estudadas, prevalecendo seu efeito aditivo na mistura com glyphosate, no

  17. Glyphosate: cancerous or not? Perspectives from both ends of the debate

    Directory of Open Access Journals (Sweden)

    Syeda Aamna Hassan

    2017-08-01

    Full Text Available Glyphosate is non-selective herbicide. Studies published in the last decade, point towards glyphosate toxicity. Shikimic acid pathway for the biosynthesis of folates and aromatic amino acids is inhibited by glyphosate. Glyphosate carcinogenicity is still considered to be a controversial issue. The World Health Organizations’ International Agency recently concluded that glyphosate is “probably carcinogenic to humans.” Some researchers believed that glyphosate is not linked with carcinogenicity.

  18. Mechanism of Resistance to Glyphosate in Lolium perenne from Argentina

    Directory of Open Access Journals (Sweden)

    Marcos Yanniccari

    2017-10-01

    Full Text Available In Argentina, glyphosate resistance was reported in a Lolium perenne population after 12 years of successful herbicide use. The aim of the current paper was to put in evidence for the mechanism of glyphosate resistance of this weed. Susceptible leaves treated with different doses of glyphosate and incubated in vitro showed an accumulation of shikimic acid of around three to five times the basal level, while no changes were detected in leaves of glyphosate-resistant plants. The resistance mechanism prevents shikimate accumulation in leaves, even under such tissue-isolation conditions. The activity of the glyphosate target enzyme (EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase was quantified at different herbicide concentrations. EPSPS from resistant plants showed no difference in glyphosate-sensitivity compared to EPSPS from susceptible plants, and, accordingly, no amino acid substitution causing mutations associated with resistance were found. While the glyphosate target enzymes were equally sensitive, the basal EPSPS activity in glyphosate resistant plants was approximately 3-fold higher than the EPSPS activity in susceptible plants. This increased EPSPS activity in glyphosate resistant plants was associated with a 15-fold higher expression of EPSPS compared with susceptible plants. Therefore, the over-expression of EPSPS appears to be the main mechanism responsible for resistance to glyphosate. This mechanism has a constitutive character and has important effects on plant fitness, as recently reported.

  19. Glyphosate induces human breast cancer cells growth via estrogen receptors.

    Science.gov (United States)

    Thongprakaisang, Siriporn; Thiantanawat, Apinya; Rangkadilok, Nuchanart; Suriyo, Tawit; Satayavivad, Jutamaad

    2013-09-01

    Glyphosate is an active ingredient of the most widely used herbicide and it is believed to be less toxic than other pesticides. However, several recent studies showed its potential adverse health effects to humans as it may be an endocrine disruptor. This study focuses on the effects of pure glyphosate on estrogen receptors (ERs) mediated transcriptional activity and their expressions. Glyphosate exerted proliferative effects only in human hormone-dependent breast cancer, T47D cells, but not in hormone-independent breast cancer, MDA-MB231 cells, at 10⁻¹² to 10⁻⁶M in estrogen withdrawal condition. The proliferative concentrations of glyphosate that induced the activation of estrogen response element (ERE) transcription activity were 5-13 fold of control in T47D-KBluc cells and this activation was inhibited by an estrogen antagonist, ICI 182780, indicating that the estrogenic activity of glyphosate was mediated via ERs. Furthermore, glyphosate also altered both ERα and β expression. These results indicated that low and environmentally relevant concentrations of glyphosate possessed estrogenic activity. Glyphosate-based herbicides are widely used for soybean cultivation, and our results also found that there was an additive estrogenic effect between glyphosate and genistein, a phytoestrogen in soybeans. However, these additive effects of glyphosate contamination in soybeans need further animal study. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Haematogical changes induced by subchronic glyphosate exposure ...

    African Journals Online (AJOL)

    The aim of this study was to determine the haematological changes induced by subchronic glyphosate exposure in Wistar rats and the ameliorative effect of zinc. Sixty adult male and female Wistar rats were used for the study. Twelve of them were used for the LD50 which was evaluated to be 3750 mg kg-1 with clinical ...

  1. 75 FR 20862 - Glyphosate From China

    Science.gov (United States)

    2010-04-21

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject investigation. DATES: Effective Date: April 16, 2010. FOR FURTHER INFORMATION CONTACT: Amy Sherman (202-205-3289...

  2. Adjuvants for single droplet application of glyphosate

    DEFF Research Database (Denmark)

    Mathiassen, Solvejg Kopp; Kudsk, Per; Lund, Ivar

    2016-01-01

    Retention and biological activity of droplets of glyphosate deposited onto plant leaves using a Drop on Demand inkjet printer application system, was examined on pot-grown Brassica napus, Solanum nigrum, Chenopodium album, Silene noctiflora and Echinocloa crus-galli plants. Retention was measured...

  3. Flow Injection Spectrophotometric Determination of Glyphosate ...

    African Journals Online (AJOL)

    NICOLAAS

    limits and causes digestive tract irritation, eyes and skin irrita- tion, low blood ... techniques, mostly chromatographic, have been developed for ... enhanced photochemically induced fluorescence (MEPIF) .... with glyphosate on the same field or in the nearby fields. .... At 700 µL sample volume two peaks near to each.

  4. Manejo de Conyza bonariensis resistente ao herbicida glyphosate Management of Glyphosate-resistant Conyza bonariensis

    Directory of Open Access Journals (Sweden)

    J.M. Paula

    2011-03-01

    Full Text Available C. bonariensis (Conyza bonariensis é uma planta daninha da família Asteraceae, amplamente distribuída no Brasil, com presença marcante nos Estados do Rio Grande do Sul e do Paraná. Biótipos de C. bonariensis resistentes ao glyphosate foram identificados nos Estados do Rio Grande do Sul, Paraná e São Paulo. O objetivo deste trabalho foi avaliar o efeito de diferentes manejos de inverno e na pré-semeadura da soja sobre a população de plantas de C. bonariensis resistente ao herbicida glyphosate. Os resultados evidenciaram que a população de C. bonariensis é maior em áreas mantidas sem cultivo (pousio do que naquelas áreas cultivadas com trigo ou aveia-preta durante o inverno. Observou-se que o trigo e a aveia-preta exercem efeito supressor sobre a população de C. bonariensis, proporcionando maior facilidade de controle com herbicida na pré-semeadura da cultura usada em sucessão. O controle de C. bonariensis resistente ao herbicida glyphosate foi satisfatório quando se utilizaram herbicidas pós-emergentes na cultura do trigo e glyphosate + 2,4-D ou glyphosate + diuron + paraquat na pré-semeadura da soja.Horseweed (Conyza bonariensis, which belongs to the Asteraceae family, is a weed species widely spread in Brazil. Horseweed biotypes resistant to glyphosate, the main herbicide used in Roundup Ready soybean fields, were identified in the states of Rio Grande do Sul and Parana. The aim of this study was to evaluate the effect of different winter and pre-sowing management techniques on soybean plant population of C. bonariensis resistant to glyphosate. The results showed that the population of C. bonariensis is larger in areas maintained fallow than in areas planted with wheat or oats during the winter. Wheat and oats were found to exert a suppressive effect on the population of C. bonariensis, providing greater ease of control with herbicide before seeding in the culture used in succession. The control of glyphosate-resistant C

  5. Stress memory induced rearrangements of HSP transcription, photosystem II photochemistry and metabolism of tall fescue (Festuca arundinacea Schreb. in response to high-temperature stress

    Directory of Open Access Journals (Sweden)

    Tao eHu

    2015-06-01

    Full Text Available When plants are pre-exposed to stress, they can produce some stable signals and physiological reactions that may be carried forward as ‘stress memory’. However, there is insufficient information about is known about plants’ stress memory responses mechanisms. Here, two tall fescue genotypes, heat-tolerant PI 574522 and heat-sensitive PI 512315, were subjected to recurring high-temperature pre-acclimation treatment. Two heat shock protein (HSP genes, LMW-HSP and HMW-HSP, exhibited transcriptional memory for their higher transcript abundance during one or more subsequent stresses (S2, S3, S4 relative to the first stress (S1, and basal transcript levels during the recovery states (R1, R2 and R3. Activated transcriptional memory from two trainable genes could persist up to 4 days, and induce higher thermotolerance in tall fescue. This was confirmed by greater turf quality and lower electrolyte leakage. Pre-acclimation treatment inhibited the decline at steps of O-J-I-P and energy transport fluxes in active Photosystem II reaction center (PSII RC for both tall fescue genotypes. The heat stress memory was associated with major shifts in leaf metabolite profiles. Furthermore, there was an exclusive increase in leaf organic acids (citric acid, malic acid, tris phosphoric acid, threonic acid, sugars (sucrose, glucose, idose, allose, talose, glucoheptose, tagatose, psicose, amino acids (serine, proline, pyroglutamic acid, glycine, alanine and one fatty acid (butanoic acid in pre-acclimated plants. These discoveries involved in transcriptional memory, PSII RC energy transport and metabolite profiles could provide new insights into the plant high–temperature response process.

  6. Sensibilidade de estirpes de Bradyrhizobium ao glyphosate

    Directory of Open Access Journals (Sweden)

    Rodrigo Josemar Seminoti Jacques

    2010-02-01

    Full Text Available A aplicação do glyphosate sobre a soja resistente a este herbicida pode causar prejuízos à simbiose com o rizóbio. O objetivo deste trabalho foi avaliar a sensibilidade ao herbicida glyphosate de três estirpes de Bradyrhizobium recomendadas para a produção de inoculantes de sementes de soja no Brasil. Avaliou-se o efeito das concentrações de 0,0; 5,4; 10,8; 21,6 e 43,2 µg L-1 do ingrediente ativo do glyphosate [N-(fosfonometil glicina] no meio YM líquido sobre o crescimento de B. japonicum (estirpe SEMIA 5079 e de B. elkanii (estirpe SEMIA 5019 e estirpe SEMIA 587, por meio de leituras das densidades óticas e geração de curvas de crescimento. As reduções de crescimento na presença da menor concentração do glyphosate foram de 18% para SEMIA 5079, 29% para SEMIA 5019 e de 35% para SEMIA 587, sendo, de modo geral, quanto maior a concentração do herbicida no meio de cultura maior a inibição do crescimen­to. As estirpes apresentaram sensibilidade diferencial somente às concentrações mais baixas do glyphosate; nesse caso, foi possível determinar a seguinte ordem de sensibilidade: SEMIA 587 > SEMIA 5019 > SEMIA 5079. Essa sensibilidade diferencial é dependente da concentração do herbicida, pois na presença de 43,2 µg L-1 todas as estirpes tiveram seu crescimento severamente reduzido, não havendo diferença entre elas.

  7. Differential response of two sourgrass populations to glyphosate

    Directory of Open Access Journals (Sweden)

    São Paulo State University, Jaboticabal, SP, Brazil

    2013-02-01

    Full Text Available The repetitive use of glyphosate may cause increase on the resistance of sourgrass (Digitaria insularis through mechanisms of natural selection. The aim of this study was to verify the response of two populations of sourgrass (one collected from nonagricultural area and the other one from area suspected of glyphosate resistance to increasing doses of glyphosate. The experimental design was completely randomized with four repetitions. For both populations, glyphosate was sprayed at 10 doses (0D, D/16, D/8, D/4, D/2, D, 2D, 4D, 8D, and 16D; so that D is the dose of 1.08 kg e.a. ha-1. The treatments were sprayed when the plants had shown 3-5 tillers. The population collected in the nonagricultural area was slightly more sensible to the herbicide glyphosate than the population originated from an area where the herbicide application is common, not indicating glyphosate resistance.

  8. Foliar Desiccators Glyphosate, Carfentrazone, and Paraquat Affect the Technological and Chemical Properties of Cowpea Grains.

    Science.gov (United States)

    Lindemann, Igor da Silva; Lang, Gustavo Heinrich; Hoffmann, Jessica Fernanda; Rombaldi, Cesar Valmor; de Oliveira, Maurício; Elias, Moacir Cardoso; Vanier, Nathan Levien

    2017-08-16

    The effects of the use of glyphosate (GLY), glyphosate plus carfentrazone (GLY/CAR), and paraquat (PAR) as plant desiccators on the technological and chemical properties of cowpea grains were investigated. All studied desiccants provided lower cooking time to freshly harvested cowpea. However, the coat color of PAR- and GLY/CAR-treated cowpea was reddish in comparison to the control treatment. Principal component analysis (PCA) from liquid chromatography-mass spectrometry (LC-MS) data sets showed a clear distinction among cowpea from the different treatments. Catechin-3-glucoside and epicatechin significantly contributed for discriminating GLY-treated cowpea, while citric acid was responsible for discriminating GLY/CAR-treated cowpea. Quercetin derivative and gluconic acid were responsible for discriminating control treatment. Residual glyphosate and paraquat content was higher than the maximum limits allowed by Codex Alimentarius and the European Union Commission. Improvements in the technological and chemical properties of cowpea may not be overlapped by the risks that those desiccants exhibit when exceeding the maximum limits of tolerance in food.

  9. Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines

    OpenAIRE

    Gasnier, C?line; Benachour, Nora; Clair, Emilie; Travert, Carine; Langlois, Fr?d?ric; Laurant, Claire; Decroix-Laporte, C?cile; S?ralini, Gilles-Eric

    2010-01-01

    Abstract Background Worldwide used pesticides containing different adjuvants like Roundup formulations, which are glyphosate-based herbicides, can provoke some in vivo toxicity and in human cells. These pesticides are commonly found in the environment, surface waters and as food residues of Roundup tolerant genetically modified plants. In order to know their effects on cells from liver, a major detoxification organ, we have studied their mechanism of action and possible protection by precise ...

  10. MORPHOLOGICAL AND PHYSIOLOGICAL CHANGES ON Schizolobium parahybaVAR .Amazonicum(HUBER EX DUCKE BARNEBY PLANTS INTOXICATED BY GLYPHOSATE

    Directory of Open Access Journals (Sweden)

    Kaléo Dias Pereira

    2017-06-01

    Full Text Available The objective of this study was to evaluate the morphological and physiological changes in paricá plants (Schizolobium parahyba var. amazonicum intoxicated by glyphosate. The experiment was conducted in a protected environment using paricá plants during their planting stage, which were intoxicated with increasing doses of glyphosate: 0 (control; 43.2; 86.2; 129.6 and 172.8 g.ha-1. At 7 and 21 days after the application of the herbicide, the photosynthesis, transpiration, stomatal conductance and leaf temperature were measured. The visual intoxication degree and the growth of the shoot and the root of the plants were evaluated 21 days after the application. Paricá shows symptoms of visual intoxication characterized by chlorosis/winding, evolving to necrosis/abscission of the youngest leaflets. The growth of the stem and the roots of the intoxicated plants is preserved; however, an expressive leaf loss occurs, and paricá may have adaptation mechanisms to tolerate the action of the herbicide molecule. The photosynthesis decrease promoted by an indirect action of glyphosate represents the main reduction on the growth of plants. The decrease on the stomatal conductance, which was the most sensitive physiological variable to glyphosate, resulted in lower transpiration rates, which, consequently, caused increases on the leaf temperature.

  11. Lack of glyphosate resistance gene transfer from Roundup Ready soybean to Bradyrhizobium japonicum under field and laboratory conditions.

    Science.gov (United States)

    Isaza, Laura Arango; Opelt, Katja; Wagner, Tobias; Mattes, Elke; Bieber, Evi; Hatley, Elwood O; Roth, Greg; Sanjuán, Juan; Fischer, Hans-Martin; Sandermann, Heinrich; Hartmann, Anton; Ernst, Dieter

    2011-01-01

    A field study was conducted at the Russell E. Larson Agricultural Research Center to determine the effect of transgenic glyphosate-resistant soybean in combination with herbicide (Roundup) application on its endosymbiont Bradyrhizobium japonicum. DNA of bacteroids from isolated nodules was analysed for the presence of the transgenic 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) DNA sequence using polymerase chain reaction (PCR). To further assess the likelihood that the EPSPS gene may be transferred from the Roundup Ready (RR) soybean to B. japonicum, we have examined the natural transformation efficiency of B. japonicum strain 110spc4. Analyses of nodules showed the presence of the transgenic EPSPS DNA sequence. In bacteroids that were isolated from nodules of transgenic soybean plants and then cultivated in the presence of glyphosate this sequence could not be detected. This indicates that no stable horizontal gene transfer (HGT) of the EPSPS gene had occurred under field conditions. Under laboratory conditions, no natural transformation was detected in B. japonicum strain 110spc4 in the presence of various amounts of recombinant plasmid DNA. Our results indicate that no natural competence state exists in B. japonicum 110spc4. Results from field and laboratory studies indicate the lack of functional transfer of the CP4-EPSPS gene from glyphosate-tolerant soybean treated with glyphosate to root-associated B. japonicum.

  12. Glyphosate, a chelating agent-relevant for ecological risk assessment?

    Science.gov (United States)

    Mertens, Martha; Höss, Sebastian; Neumann, Günter; Afzal, Joshua; Reichenbecher, Wolfram

    2018-02-01

    Glyphosate-based herbicides (GBHs), consisting of glyphosate and formulants, are the most frequently applied herbicides worldwide. The declared active ingredient glyphosate does not only inhibit the EPSPS but is also a chelating agent that binds macro- and micronutrients, essential for many plant processes and pathogen resistance. GBH treatment may thus impede uptake and availability of macro- and micronutrients in plants. The present study investigated whether this characteristic of glyphosate could contribute to adverse effects of GBH application in the environment and to human health. According to the results, it has not been fully elucidated whether the chelating activity of glyphosate contributes to the toxic effects on plants and potentially on plant-microorganism interactions, e.g., nitrogen fixation of leguminous plants. It is also still open whether the chelating property of glyphosate is involved in the toxic effects on organisms other than plants, described in many papers. By changing the availability of essential as well as toxic metals that are bound to soil particles, the herbicide might also impact soil life, although the occurrence of natural chelators with considerably higher chelating potentials makes an additional impact of glyphosate for most metals less likely. Further research should elucidate the role of glyphosate (and GBH) as a chelator, in particular, as this is a non-specific property potentially affecting many organisms and processes. In the process of reevaluation of glyphosate its chelating activity has hardly been discussed.

  13. Implication of Legal References on Technological Dissemination: A Study on Transgenic Soybeans Resistant to Glyphosate Herbicide in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Rodrigues

    2013-04-01

    Full Text Available The following paper aims at establishing a connection between the evolution of legal landmarks related to soybeans tolerant to glyphosate-based herbicide in Brazil and the planting growth of this transgenic soybean in Brazil, in order to determine the role that such soybeans play in today's domestic agricultural scenario. To do so, a study of Brazilian laws that protect intellectual creations was carried out (Industrial Property Law - Law number 9.279/96 and the Plant Protection Law – Law number 9.456/97, the Law on Biosafety – Law number 11105 / 05 – and the Law on Brazilian Seeds and Seedlings - Law number 10.711/03, in order to delimit the matter protected by each of those laws while establishing its interfaces. Regarding planting, the Biosafety Law of 2005 corresponds to the fourth law which deals with soybeans tolerant to glyphosate-based herbicide and ensures that those previously registered may be marketed without limitation per crop. In order to estimate the space that soybean seeds tolerant to glyphosate-based herbicide began to occupy in the Brazilian market, in the 2008/2009 harvest, compared to the other not genetically modified soybeans, a search in the Ministry of Agriculture´s database was done (http://www.agricultura.gov.br through the available records of certified, non-certified and basic seeds.

  14. Alterations in serotonin receptor-induced contractility of bovine lateral saphenous vein in cattle grazing endophyte-infected tall fescue

    Science.gov (United States)

    As part of a large 2-year study documenting the physiologic impact of grazing endophyte-infected tall fescue on growing cattle, 2 experiments were conducted to characterize and evaluate the effects of grazing 2 levels of toxic endophyte-infected tall fescue pastures on vascular contractility and ser...

  15. Formulants of glyphosate-based herbicides have more deleterious impact than glyphosate on TM4 Sertoli cells.

    Science.gov (United States)

    Vanlaeys, Alison; Dubuisson, Florine; Seralini, Gilles-Eric; Travert, Carine

    2018-05-15

    Roundup and Glyphogan are glyphosate-based herbicides containing the same concentration of glyphosate and confidential formulants. Formulants are declared as inert diluents but some are more toxic than glyphosate, such as the family of polyethoxylated alkylamines (POEA). We tested glyphosate alone, glyphosate-based herbicide formulations and POEA on the immature mouse Sertoli cell line (TM4), at concentrations ranging from environmental to agricultural-use levels. Our results show that formulations of glyphosate-based herbicides induce TM4 mitochondrial dysfunction (like glyphosate, but to a lesser extent), disruption of cell detoxification systems, lipid droplet accumulation and mortality at sub-agricultural doses. Formulants, especially those present in Glyphogan, are more deleterious than glyphosate and thus should be considered as active principles of these pesticides. Lipid droplet accumulation after acute exposure to POEA suggests the rapid penetration and accumulation of formulants, leading to mortality after 24 h. As Sertoli cells are essential for testicular development and normal onset of spermatogenesis, disturbance of their function by glyphosate-based herbicides could contribute to disruption of reproductive function demonstrated in mammals exposed to these pesticides at a prepubertal stage of development. Copyright © 2017. Published by Elsevier Ltd.

  16. Impacts of Repeated Glyphosate Use on Wheat-Associated Bacteria Are Small and Depend on Glyphosate Use History.

    Science.gov (United States)

    Schlatter, Daniel C; Yin, Chuntao; Hulbert, Scot; Burke, Ian; Paulitz, Timothy

    2017-11-15

    Glyphosate is the most widely used herbicide worldwide and a critical tool for weed control in no-till cropping systems. However, there are concerns about the nontarget impacts of long-term glyphosate use on soil microbial communities. We investigated the impacts of repeated glyphosate treatments on bacterial communities in the soil and rhizosphere of wheat in soils with and without long-term history of glyphosate use. We cycled wheat in the greenhouse using soils from 4 paired fields under no-till (20+-year history of glyphosate) or no history of use. At each cycle, we terminated plants with glyphosate (2× the field rate) or by removing the crowns, and soil and rhizosphere bacterial communities were characterized. Location, cropping history, year, and proximity to the roots had much stronger effects on bacterial communities than did glyphosate, which only explained 2 to 5% of the variation. Less than 1% of all taxa were impacted by glyphosate, more in soils with a long history of use, and more increased than decreased in relative abundance. Glyphosate had minimal impacts on soil and rhizosphere bacteria of wheat, although dying roots after glyphosate application may provide a "greenbridge" favoring some copiotrophic taxa. IMPORTANCE Glyphosate (Roundup) is the most widely used herbicide in the world and the foundation of Roundup Ready soybeans, corn, and the no-till cropping system. However, there have been recent concerns about nontarget impacts of glyphosate on soil microbes. Using next-generation sequencing methods and glyphosate treatments of wheat plants, we described the bacterial communities in the soil and rhizosphere of wheat grown in Pacific Northwest soils across multiple years, different locations, and soils with different histories of glyphosate use. The effects of glyphosate were subtle and much less than those of drivers such as location and cropping systems. Only a small percentage of the bacterial groups were influenced by glyphosate, and most of

  17. Relative effectiveness of sewage sludge as a nitrogen fertilizer for tall fescue

    Energy Technology Data Exchange (ETDEWEB)

    Kiemnec, G.L.; Jackson, T.L.; Hemphill, D.D. Jr.; Volk, V.V.

    Sewage sludge application rates on grasses are mainly determined by N availability and concentration of toxic metals in sludge. The exact availability of N in sludge is difficult to predict. A 3-yr study was conducted to determine which sludge rates would give yields of tall fescue (Festuca arundinacea Shreb. Alta) comparable to yields obtained from inorganic N application. Sludge and NH/sub 4/NO/sub 3/ were surface applied at annual rates of 0, 110, 220, 440, and 880 (sludge only) kg N/ha. Dry matter yield of tall fescue from sludge-treated soils was 36, 56, and 50% of that on NH/sub 4/NO/sub 3/-treated soils for 1976, 1977, and 1978, respectively. Sludge was 27, 41, and 44% as effective as NH/sub 4/NO/sub 3/ as a source of available N in 1976, 1977, and 1978, respectively. Ammonium-N in the sewage sludge apparently provided most of the available N for fescue growth. Concentrations of Zn, Cd, and Cu were higher and Mn lower in tall fescue grown on sludge-treated soil with NH/sub 4/NO/sub 3/ and usually increased toward the end of the growing season. However, plant concentrations of these heavy metals never reached toxic levels at any time. Sewage sludge was an effective and safe nutrient source for tall fescue.

  18. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate.

    Directory of Open Access Journals (Sweden)

    Cong Wang

    Full Text Available Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta. Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina regardless of DIP condition. Group V (Amphidinium carterae exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine

  19. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate

    Science.gov (United States)

    Wang, Cong; Lin, Xin; Li, Ling; Lin, Senjie

    2016-01-01

    Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta). Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP) conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum) could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella) could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana) and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina) regardless of DIP condition. Group V (Amphidinium carterae) exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine phytoplankton

  20. 40 CFR 180.364 - Glyphosate; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... Grain, cereal, group 15 except field corn, popcorn, rice, sweet corn, and wild rice 30 Grape 0.2 Grass..., grain 5.0 Rambutan 0.2 Rapeseed, seed 20 Rice, grain 0.1 Rice, wild, grain 0.1 Rose apple 0.2 Safflower, seed 85 Salal 0.2 Sapodilla 0.2 Sapote, black 0.2 Sapote, mamey 0.2 Sapote, white 0.2 Sesame, seed 0.1...

  1. Metallic complexes with glyphosate: a review

    OpenAIRE

    Coutinho, Cláudia F. B.; Mazo, Luiz Henrique

    2005-01-01

    We present studies involving metallic ions and the herbicide glyphosate. The metallic complexes of Cu(II), Zn(II), Mn(II), Ni(II), Cd(II), Pb(II), Cr(III), Fe(III), Co(III), ammonium, sodium, Ag(I), alkaline earth metals and of some lanthanides ions are described. The complexes are discussed in terms of their synthesis, identification, stability and structural properties, based on data from the current literature.

  2. Metallic complexes with glyphosate: a review

    International Nuclear Information System (INIS)

    Coutinho, Claudia F.B.; Mazo, Luiz Henrique

    2005-01-01

    We present studies involving metallic ions and the herbicide glyphosate. The metallic complexes of Cu(II), Zn(II), Mn(II), Ni(II), Cd(II), Pb(II), Cr(III), Fe(III), Co(III), ammonium, sodium, Ag(I), alkaline earth metals and of some lanthanides ions are described. The complexes are discussed in terms of their synthesis, identification, stability and structural properties, based on data from the current literature. (author)

  3. Glyphosate rodent carcinogenicity bioassay expert panel review.

    Science.gov (United States)

    Williams, Gary M; Berry, Colin; Burns, Michele; de Camargo, Joao Lauro Viana; Greim, Helmut

    2016-09-01

    Glyphosate has been rigorously and extensively tested for carcinogenicity by administration to mice (five studies) and to rats (nine studies). Most authorities have concluded that the evidence does not indicate a cancer risk to humans. The International Agency for Research on Cancer (IARC), however, evaluated some of the available data and concluded that glyphosate probably is carcinogenic to humans. The expert panel convened by Intertek assessed the findings used by IARC, as well as the full body of evidence and found the following: (1) the renal neoplastic effects in males of one mouse study are not associated with glyphosate exposure, because they lack statistical significance, strength, consistency, specificity, lack a dose-response pattern, plausibility, and coherence; (2) the strength of association of liver hemangiosarcomas in a different mouse study is absent, lacking consistency, and a dose-response effect and having in high dose males only a significant incidence increase which is within the historical control range; (3) pancreatic islet-cell adenomas (non-significant incidence increase), in two studies of male SD rats did not progress to carcinomas and lacked a dose-response pattern (the highest incidence is in the low dose followed by the high dose); (4) in one of two studies, a non-significant positive trend in the incidence of hepatocellular adenomas in male rats did not lead to progression to carcinomas; (5) in one of two studies, the non-significant positive trend in the incidence of thyroid C-cell adenomas in female rats was not present and there was no progression of adenomas to carcinomas at the end of the study. Application of criteria for causality considerations to the above mentioned tumor types and given the overall weight-of-evidence (WoE), the expert panel concluded that glyphosate is not a carcinogen in laboratory animals.

  4. Effects of selected combinations of tall fescue alkaloids on the vasoconstrictive capacity of fescue-naive bovine lateral saphenous veins.

    Science.gov (United States)

    Klotz, J L; Kirch, B H; Aiken, G E; Bush, L P; Strickland, J R

    2008-04-01

    Vasoconstriction is a response associated with consumption of toxic endophyte-infected tall fescue. It is not known if endophyte-produced alkaloids act alone or collectively in mediating the response. Therefore, the objective of this study was to examine the vasoconstrictive potentials of selected ergot alkaloids, individually or in paired combinations, using bovine lateral saphenous veins biopsied from fescue-naïve cattle. Segments (2 to 3 cm) of vein were surgically biopsied from healthy crossbred yearling heifers (n = 22; 330 +/- 8 kg of BW). Veins were trimmed of excess fat and connective tissue, sliced into 2- to 3-mm sections, and suspended in a myograph chamber containing 5 mL of oxygenated Krebs-Henseleit buffer (95% O(2)/5% CO(2); pH = 7.4; 37 degrees C). Increasing doses of ergovaline, lysergic acid, and N-acetylloline individually or in combination were evaluated. Contractile data were normalized as a percentage of the contractile response induced by a reference dose of norepinephrine (1 x 10(- 4) M). Increasing concentrations of lysergic acid did not result in an appreciable contractile response until the addition of 1 x 10(- 4) M lysergic acid. In contrast, the vascular response to increasing concentrations of ergovaline was apparent at 1 x 10(- 8) M and increased to a maximum of 104.2 +/- 6.0% with the addition of 1 x 10(- 4) M ergovaline. The presence of N-acetylloline did not alter the onset or magnitude of vascular response to either lysergic acid or ergovaline. The presence of 1 x 10(- 5) M lysergic acid with increasing concentrations of N-acetylloline and ergovaline generated an increased contractile response during the initial additions compared with the responses of N-acetylloline and ergovaline alone. In the presence of 1 x 10(- 7) M ergovaline, the contractile response increased with increasing concentrations of N-acetylloline and lysergic acid. Neither N-acetylloline nor lysergic acid elicited an intense contractile response individually

  5. Glyphosate accumulation, translocation, and biological effects in Coffea arabica after single and multiple exposures

    DEFF Research Database (Denmark)

    Schrübbers, Lars Christoph; Valverde, Bernal E.; Strobel, Bjarne W.

    2016-01-01

    In perennial crops like coffee, glyphosate drift exposure can occur multiple times during its commercial life span. Due to limited glyphosate degradation in higher plants, a potential accumulation of glyphosate could lead to increased biological effects with increased exposure frequency....... In this study, we investigated glyphosate translocation over time, and its concentration and biological effects after single and multiple simulated spray-drift exposures. Additionally, shikimic acid/glyphosate ratios were used as biomarkers for glyphosate binding to its target enzyme.Four weeks after...... the exposure, glyphosate was continuously translocated. Shikimic acid levels were lin-ear correlated with glyphosate levels. After two months, however, glyphosate appeared to have reduced activity. In the greenhouse, multiple applications resulted in higher internal glyphosate concentrations.The time...

  6. The effect of glyphosate application on soil microbial activities in ...

    African Journals Online (AJOL)

    In this study, glyphosate effects as N, P and C nutrient sources on microbial population and the effect of different concentration of it on dehydrogenease activity and soil respiration were investigated. The results show that in a soil with a long historical use of glyphosate (soil 1), the hetrotrophic bacterial population was ...

  7. Dissipation of glyphosate from grapevine soils in Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Norma J. Salazar López

    2016-10-01

    Full Text Available Grapevine is one of the important crops in Sonora, due to revenue generation from its export to foreign countries. Among the most widely used herbicides for this crop is glyphosate, which is considered moderately toxic and persistent. The present research evaluates the dissipation of glyphosate in grapevine planted soil at three depths (5, 30 and 60 cm. Sampling was carried out before glyphosate application, and 5, 10, 18, 27, and 65 days after. Glyphosate was extracted from soil samples using ammonium hydroxide. The derivate extracts were partitioned with dichloromethane and analyzed using gas chromatography with pulsed flame photometric detector (PFPD. The results showed that average glyphosate residues are significantly greater at 5 cm (0.09 mg kg-1 than the other depths (30 and 60 cm, having a difference of 0.078 mg kg-1 between them (P < 0.03. Glyphosate concentration time profiles were similar; it reached maximum soil concentration in a range of 10 to 18 days after application. The half-life of glyphosate in soil has an average of 39 days at all depths. Our data suggests that the release in soil of glyphosate applied to weeds delays its transference to soil by 14 days, and extends residue half life to 55 days after application. These results could be the basis for further research, including more environmental parameters that could affect the dissipation or degradation process in soil.

  8. Physiological responses to glyphosate are dependent on Eucalyptus urograndis genotype

    Science.gov (United States)

    Two experiments were conducted to evaluate the response of Eucalyptus urograndis genotypes (C219 and GG100) to glyphosate in growth chambers. As glyphosate dose increased (18 up to 720 g ae ha-1), CO2 assimilation rate, transpiration rate, and stomatal conductance decreased fastest and strongest in ...

  9. Uses of glyphosate in German arable farming – operational aspects

    Directory of Open Access Journals (Sweden)

    Wiese, Armin

    2016-02-01

    Full Text Available Glyphosate is the most frequently used herbicide active ingredient in Germany. Studies regarding its usage in non-GMO arable farming are still rare even though it plays an important role in several agronomic situations. Therefore, we conducted a comprehensive survey, which was carried out among conventional German farms in Winter 2014/2015. Based on the results of this survey we analyzed via cluster analysis how types of farms differ in terms of glyphosate usage. An illustration of seven clusters allows deep insights into arable farm structures. The farm types can be distinguished regarding their tillage system and similar to this differentiation also concerning their intensity of glyphosate application. Furthermore, it becomes obvious that farm clusters with a higher level of glyphosate usage are characterized by a lower number of labourers per hectare, more arable land and/or enhanced cover cropping. Moreover, groups of farmers who rely more on glyphosate are more likely to state that they need glyphosate for herbicide resistance management. Farmers’ assessments of the economic importance of glyphosate usage vary depending on the type of farm. By means of the farm clusters, the most important situations of glyphosate usage can be further analyzed economically and scenarios for impact assessments can be made.

  10. Effects of additives on glyphosate activity in purple nutsedge

    International Nuclear Information System (INIS)

    Rungsit Suwanketnikom

    1998-01-01

    Effects of additives on 14 C-glyphosate penetration into purple nutsedge leaves were examined in the laboratory and efficacy of glyphosate for purple nutsedge control was studied in the greenhouse and field. The addition of (NH 4 ) 2 SO 4 at 1.0% (v/v) + diesel oil at 1,0% (v/v) + Tendal at 1.0% (v/v) increased 14 C-glyphosate penetration into nutsedge leaves more than the addition of either one alone. (NH 4 ) 2 SO 4 at 1.0% + diesel oil at 1.0% + Tendal at 0.12 or 0.25% increased the phytotoxicity of glyphosate at 0.5 and 0.75 kg, a.e./ha on nutsedge plants in the greenhouse but not in the field. Additives did not enhance glyphosate activity by reducing the number of nutsedae tubers. (author)

  11. Molecular basis of glyphosate resistance: Different approaches through protein engineering

    Science.gov (United States)

    Pollegioni, Loredano; Schonbrunn, Ernst; Siehl, Daniel

    2011-01-01

    Glyphosate (N-phosphonomethyl-glycine) is the most-used herbicide in the world: glyphosate-based formulations exhibit broad-spectrum herbicidal activity with minimal human and environmental toxicity. The extraordinary success of this simple small molecule is mainly due to the high specificity of glyphosate towards the plant enzyme enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway leading to biosynthesis of aromatic amino acids. Starting in 1996, transgenic glyphosate-resistant plants were introduced thus allowing the application of the herbicide to the crop (post-emergence) to remove emerged weeds without crop damage. This review focuses on the evolution of mechanisms of resistance to glyphosate as obtained through natural diversity, the gene shuffling approach to molecular evolution, and a rational, structure-based approach to protein engineering. In addition, we offer rationale for the means by which the modifications made have had their intended effect. PMID:21668647

  12. Overexpression AtNHX1 confers salt-tolerance of transgenic tall ...

    African Journals Online (AJOL)

    Saline soil is a serious problem worldwide, and it is necessary to improve the salt tolerance of plants so as to avoid the progressive deterioration of saline soil. Here we report that over-expression of AtNHX1 improves salt tolerance in transgenic tall fescue. The AtNHX1 gene driven with CaMV35S promoter was constructed ...

  13. DISPERSION OF GLYPHOSATE IN SOILS UNDERGOING EROSION

    Directory of Open Access Journals (Sweden)

    Gorana Todorovic Rampazzo

    2010-08-01

    Full Text Available Different physical, chemical and biological processes influence the behaviour of organic contaminants in soils. A better understanding of the organic pollutant behaviour in soils would improve the environmental protection. One possible way for better attenuation of the risk of pollution in agriculture can be achieved through ta better-specified pesticide management based on the adaptation of the pesticide type and application rates to the specific environmental characteristics of the area of application. Nowadays, one of the actually most applied herbicide world wide is glyphosate. Glyphosate is highly water soluble and traces have been found in surface and groundwater systems. For a better understanding of the natural influence of erosion processes on glyphosate behaviour and dispersion under heavy rain conditions after application in the field, two erosion simulation experiments were conducted on two different locations in Austria with completely different soil types in September 2008. The results of the experiments showed that under normal practical conditions (e.g. no rainfall is expected immediatly after application, the potential adsorption capacity of the Kirchberg soil (Stagnic Cambisol, with about 16.000 ppm Fe-oxides is confirmed compared to the low adsorption Chernosem soil (about 8.000 ppm pedogenic Fe-oxides.  Considering the enormous difference in the run-off amounts between the two sites Pixendorf and Kirchberg soils it can be concluded how important the soil structural conditions and vegetation type and cover are for the risks of erosion and, as a consequence, pollution of neighbouring waters. In the rainfall experiments under comparable simulation conditions, the amount of run-off was about 10 times higher at Kirchberg, owing to its better infiltration rate, than at the Pixendorf site. Moreover, the total loss of glyphosate (NT+CT through run-off at the Kirchberg site was more than double that at Pixendorf, which confirms the

  14. Subtle impacts of repeated glyphosate use on wheat-associated bacteria are small and depend on glyphosate use history

    Science.gov (United States)

    Glyphosate (Roundup) is the most widely used herbicide in the world and a critical tool for weed control in no-till wheat cropping systems. However, there are persistent concerns about non-target impacts of long-term glyphosate use on soil communities. We investigated the impacts of repeated glyphos...

  15. Lack of transgene and glyphosate effects on yield, and mineral and amino acid content of glyphosate-resistant soybean.

    Science.gov (United States)

    Duke, Stephen O; Rimando, Agnes M; Reddy, Krishna N; Cizdziel, James V; Bellaloui, Nacer; Shaw, David R; Williams, Martin M; Maul, Jude E

    2018-05-01

    There has been controversy as to whether the glyphosate resistance gene and/or glyphosate applied to glyphosate-resistant (GR) soybean affect the content of cationic minerals (especially Mg, Mn and Fe), yield and amino acid content of GR soybean. A two-year field study (2013 and 2014) examined these questions at sites in Mississippi, USA. There were no effects of glyphosate, the GR transgene or field crop history (for a field with both no history of glyphosate use versus one with a long history of glyphosate use) on grain yield. Furthermore, these factors had no consistent effects on measured mineral (Al, As, Ba, Cd, Ca, Co, Cr, Cs, Cu, Fe, Ga, K, Li, Mg, Mn, Ni, Pb, Rb, Se, Sr, Tl, U, V, Zn) content of leaves or harvested seed. Effects on minerals were small and inconsistent between years, treatments and mineral, and appeared to be random false positives. No notable effects on free or protein amino acids of the seed were measured, although glyphosate and its degradation product, aminomethylphosphonic acid (AMPA), were found in the seed in concentrations consistent with previous studies. Neither glyphosate nor the GR transgene affect the content of the minerals measured in leaves and seed, harvested seed amino acid composition, or yield of GR soybean. Furthermore, soils with a legacy of GR crops have no effects on these parameters in soybean. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. Impact of glyphosate resistant corn, glyphosate applications, and tillage on soil nutrient ratios, exoenzyme activities, and nutrient acquisition ratios

    Science.gov (United States)

    We report results of the last two years of a 7-year (2008-2014) field experiment designed to test the null hypothesis that applications of glyphosate on glyphosate resistant corn (Zea mays L.) as a routine weed control practice under both conventional and reduced tillage practices would have no effe...

  17. Genotoxicity Expert Panel review: weight of evidence evaluation of the genotoxicity of glyphosate, glyphosate-based formulations, and aminomethylphosphonic acid.

    Science.gov (United States)

    Brusick, David; Aardema, Marilyn; Kier, Larry; Kirkland, David; Williams, Gary

    2016-09-01

    In 2015, the International Agency for Research on Cancer (IARC) published a monograph concluding there was strong evidence for genotoxicity of glyphosate and glyphosate formulations and moderate evidence for genotoxicity of the metabolite aminomethylphosphonic acid (AMPA). These conclusions contradicted earlier extensive reviews supporting the lack of genotoxicity of glyphosate and glyphosate formulations. The IARC Monograph concluded there was strong evidence of induction of oxidative stress by glyphosate, glyphosate formulations, and AMPA. The Expert Panel reviewed the genotoxicity and oxidative stress data considered in the IARC Monograph, together with other available data not considered by IARC. The Expert Panel defined and used a weight of evidence (WoE) approach that included ranking of studies and endpoints by the strength of their linkage to events associated with carcinogenic mechanisms. Importantly, the Expert Panel concluded that there was sufficient information available from a very large number of regulatory genotoxicity studies that should have been considered by IARC. The WoE approach, the inclusion of all relevant regulatory studies, and some differences in interpretation of individual studies led to significantly different conclusions by the Expert Panel compared with the IARC Monograph. The Expert Panel concluded that glyphosate, glyphosate formulations, and AMPA do not pose a genotoxic hazard and the data do not support the IARC Monograph genotoxicity evaluation. With respect to carcinogenicity classification and mechanism, the Expert Panel concluded that evidence relating to an oxidative stress mechanism of carcinogenicity was largely unconvincing and that the data profiles were not consistent with the characteristics of genotoxic carcinogens.

  18. Lethal and sublethal effects of glyphosate (roundup active) to embryos of colombian anurans

    International Nuclear Information System (INIS)

    Triana Velasquez, Teofila Maria; Montes Rojas, Claudia; Bernal Bautista, Manuel Hernando

    2013-01-01

    Glyphosate is an herbicide widely used in agriculture, which may affect non-target species. the aim of this study was to determine the lethal (median lethal concentration - LC 5 0) and sublethal effects (changes on body size and development) of glyphosate (roundup active) to embryos of four anuran species, exposed during 96 hours under laboratory and microcosm tests. under laboratory conditions, engystomops pustulosus was the most tolerant species (LC 5 0 = 3033,18 ?g a.e./L) and rhinella marina was the most sensitive (lc50 = 1421,46 ?g a.e./L), which also showed a delayed development and significantly reduced body size. The other species had an intermediate LC50 (Rhinella humboldti = 2899.54 ?g a.e./L; hypsiboas crepitans = 2151,88 ?g a.e./L). In all cases, the laboratory LC 5 0 was lower than the concentration used in field (5392.92 ?g a.e./L), indicating a high toxic effect. In the microcosm tests, embryos of e. pustulosus were the most tolerant (LC 5 0 = 19,41 kg a.e./ha), while R. humboldti were the most sensitive (LC 5 0 = 10,61 kg a.e./ha). In this case, all four study species had a higher LC 5 0 than the concentration sprayed in field (3,69 kg a.e./ ha), so a lower lethal effect, and there were no significant differences in body size and development. This result shows that the glyphosate, as the commercial presentation roundup active, produce a moderate mortality on anuran embryos.

  19. Glyphosate in Irish adults - A pilot study in 2017.

    Science.gov (United States)

    Connolly, Alison; Leahy, Michelle; Jones, Kate; Kenny, Laura; Coggins, Marie A

    2018-05-02

    Glyphosate is the highest volume herbicide used globally and has recently been classified as a 2 A 'probably carcinogenic to humans' by the International Agency for Research on Cancer (IARC). There is limited data to evaluate the public health impacts from glyphosate exposure. The objective of this study is to conduct an exploratory glyphosate exposure assessment study among Irish adults, who were non-occupational users of glyphosate. A convenient sampling method was used, collecting one first morning void spot urine sample from each participant. A biomonitoring survey involving the collection and analysis of 20 ml spot urine samples from 50 Irish adults was conducted in June 2017. Participants completed a short questionnaire to collect information on demographics, dietary habits and lifestyle. Glyphosate was extracted using solid phase extraction (SPE) and analysed by liquid chromatography tandem mass spectrometry (LC-MC/MS). Of the 50 urine samples analysed, 10 (20%) contained detectable levels of glyphosate (0.80-1.35 µg L -1 ). Exposure concentrations are higher than those reported in comparable studies of European and American adults. Glyphosate was detectable in 20% of the samples collected from Irish adults. The low proportion of detectable glyphosate levels could be due to lower localised use of pesticides, having a small sample size or the higher analytical detection limit used in this study (0.5 µg L -1 ), which could underestimate the true exposure and warrants further investigation. Given the widespread use of glyphosate, further information on population exposure is required to advance our understanding of the relationship between chronic low dose exposure to glyphosate and human health risk. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

    2018-07-01

    The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

  1. Growth and metabolism of growing beef calves fed tall fescue haylage supplemented with protein and(or) energy.

    Science.gov (United States)

    Smith, W L; Gay, N; Boling, J A; Muntifering, R B

    1987-10-01

    Endophyte (Acremonium coenophialum)-infected Kentucky 31 tall fescue was fertilized in mid-August, stockpiled, harvested November 4 to 6 and stored in a concrete stave silo. Ninety-six growing calves (189 kg) were assigned to the following treatments (24 calves/treatment): 1) corn silage (CS) plus .4 kg/d of soybean meal (SBM; 2) fescue haylage plus .4 kg/d of SBM; 3) fescue haylage plus 1.6 kg/d of corn and 4) fescue haylage plus 1.6 kg/d of corn and .4 kg/d of SBM. Daily gains and dry matter (DM) intakes during the 91-d trial were .52, 4.58; .51, 5.22; .59, 6.06; and .63, 6.18 kg for treatments 1 through 4, respectively. Daily gains of calves fed corn silage plus SBM and fescue haylage plus SBM were not different (P greater than .05). However, a difference (P less than .05) existed between treatments 1 and 2 vs 3 and 4. Feed conversion was improved (P less than .05) in calves fed corn silage. Calves in a metabolism trial were fed either 1) 6.2 kg November-ensiled fescue haylage or 2) 6.2 kg November-ensiled fescue haylage plus 1.6 kg/d of corn. Digestibility of DM, N-free extract (NFE) and TDN did not differ (P greater than .05) between treatments. Ether extract digestibility was greater (P less than .05) for the added corn diet, while that of CP was greater (P less than .05) for the fescue haylage diet. Nitrogen retained was higher (P less than .05) for calves fed added corn. A follow-up trial with 96 growing calves (190 kg) compared September- and November-harvested fescue haylages supplemented with either 1.3 or 2.6 kg corn/d.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Differential acclimation of enzymatic antioxidant metabolism and photosystem II photochemistry in tall fescue under drought and heat and the combined stresses

    Directory of Open Access Journals (Sweden)

    Aoyue eBi

    2016-04-01

    Full Text Available Quality inferiority in cool-season turfgrass due to drought, heat and a combination of both stresses is predicted to be more prevalent in the future. Understanding the various response to heat and drought stress will assist in the selection and breeding of tolerant grass varieties. The objective of this study was to investigate the behavior of antioxidant metabolism and photosystem II (PSII photochemistry in two tall fescue genotypes (PI 234881 and PI 578718 with various thermotolerance capacities. Wide variations were found between heat-tolerant PI 578718 and heat-sensitive PI 234881 for leaf relative water content, malondialdehyde and electrolyte leakage under drought, high-temperature or a combination of both stresses. The sensitivity of PI 234881 exposed to combined stresses was associated with lower superoxide dismutase activity and higher H2O2 accumulation than that in PI 578718. Various antioxidant enzymes displayed positive correlation with chlorophyll content, but negative with membrane injury index at most of the stages in both tall fescue genotypes. The JIP-test analysis in PI 578718 indicated a significant improvement in ABS/RC, TR0/RC, RE0/RC, RE0/ABS values as compared to the control regime, which indicated that PI 578718 had a high potential to protect the PSII system under drought and high temperature stress. And the PS II photochemistry in PI 234881 was damaged significantly compared with PI578718. Moreover, quantitative RT-PCR revealed that heat and drought stresses deduced the gene expression of psbB and psbC, but induced the expression of psbA. These findings to some extent confirmed that the various adaptations of physiological traits may contribute to breeding in cold-season turfgrass in response to drought, high-temperature and a combination of both stresses.

  3. Effect of management factors on tiller dynamics in tall fescue: tiller ...

    African Journals Online (AJOL)

    The effect of plant density (row spacing/seeding rate), nitrogen (N) fertilization, cultivar choice and close-down date on tiller initiation in tall fescue (Festuca arundinacea Schreb.), managed for seed production, was examined over two years. In the first season, tiller studies were conducted on eight individual plants in each ...

  4. Differential effects of citric acid on cadmium uptake and accumulation between tall fescue and Kentucky bluegrass.

    Science.gov (United States)

    Wang, ShuTing; Dong, Qin; Wang, ZhaoLong

    2017-11-01

    Organic acids play an important role in cadmium availability, uptake, translocation, and detoxification. A sand culture experiment was designed to investigate the effects of citric acid on Cd uptake, translocation, and accumulation in tall fescue and Kentucky bluegrass. The results showed that two grass species presented different Cd chemical forms, organic acid components and amount in roots. The dormant Cd accumulated in roots of tall fescue was the pectate- and protein- integrated form, which contributed by 84.85%. However, in Kentucky bluegrass, the pectate- and protein- integrated Cd was only contributed by 35.78%, and the higher proportion of Cd form was the water soluble Cd-organic acid complexes. In tall fescue, citric acid dramatically enhanced 2.8 fold of Cd uptake, 3 fold of root Cd accumulation, and 2.3 fold of shoot Cd accumulation. In Kentucky bluegrass, citric acid promoted Cd accumulation in roots, but significantly decreased Cd accumulation in shoots. These results suggested that the enhancements of citric acid on Cd uptake, translocation, and accumulation in tall fescue was associated with its promotion of organic acids and the water soluble Cd-organic acid complexes in roots. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Alteration of fasting heat production during fescue toxicosis in Holstein steers

    Science.gov (United States)

    This study was designed to examine alteration of fasting heat production (FHP) during fescue toxicosis. Six ruminally cannulated Holstein steers (BW=348 ±13 kg) were weight-matched into pairs and utilized in a two period crossover design experiment. Each period consisted of two temperature segments,...

  6. Vasoconstriction in horses caused by endophyte-infected tall fescue seed is detected with Doppler ultrasonography

    Science.gov (United States)

    The hypotheses that endophyte (Neotyphodium coenophialum)-infected tall fescue (TF) seed causes vasoconstriction in horses in vivo and that ground seed would cause more pronounced vasoconstriction than whole seed were tested. Ten horses each received 1 of 3 treatments: endophyte-free ground (E–G; n ...

  7. Modelling of seed yield and its components in tall fescue (Festuca ...

    African Journals Online (AJOL)

    AJL

    2011-10-03

    Oct 3, 2011 ... number spikelet -1 (Y4), seed weight (Y5), and the seed yield (Z) of tall fescue were determined in field experiments from 2003 to .... the time of fertilisation (X1), the quantity of irrigation (X2), the amount of N applied (X3), the ...... certain agronomical traits in soybean [Glycine max (L.) Merr.]. Afr. J. Biotechnol.

  8. Uptake of 137Cs from coniferous forest soil by sheep's fescue in pot experiment

    International Nuclear Information System (INIS)

    Fawaris, B. H.; Johanson, K. J.

    1994-01-01

    The uptake of Chernobyl fallout radiocaesium ( 137 Cs) from forest soils with low nutrients, high organic matter content, and acidic pH were examined in pot experiments. Results of sheep's fescue (Festuca ovina) two harvests after growing period of 13 weeks each, showed a slight variation in the 137 Cs uptake. Transfer factor (TF) for 137 Cs based upon soil-to-plant relationships calculated, (Bqkg -1 plant DW/Bqkg -1 soil DW). The ranges were from 0.03 to 3.43 with a mean of 0.34 ± 0.31 for first cut and from 0.03 to 2.28 with a mean of 0.36 ± 0.33 for second cut. Variation in the uptake of 137 Cs by sheep's fescue grass might be due to the influence of soil pH and OM % in conjunction with soil moisture. The effect of potassium (K + ), stable caesium (Cs + ), and ammonium (NH 4 + ) that were added as chlorides on 137 Cs uptake by sheep's fescue were also tested in pot experiment under the same conditions of previous set-up. Results from three harvests after growing period of 13 weeks each, demonstrated that K + reduced the uptake of 137 Cs. In contrast the addition of both stable Cs + and NH 4 + found to enhance 137 Cs uptake by sheep's fescue. (author)

  9. Effect of grazing seedhead-suppressed tall fescue pasture on the vasoactivity of serotonin receptors

    Science.gov (United States)

    Previous research has demonstrated that exposure to ergot alkaloids reduces vasoactivity of serotonin (5HT) receptors. Chemical suppression of tall fescue seedhead production is a tool to reduce the level of exposure to ergot alkaloids by a grazing animal. Therefore, the objective was to evaluate co...

  10. Climate change and Epichloë coenophiala association modify belowground fungal symbioses of tall fescue host

    Science.gov (United States)

    Human alteration of symbiont genetics among aboveground endophytic Epichloë coenophiala strains within tall fescue (Schedonorus arundinaceus) has led to widespread deployment of novel grass-endophyte combinations, yet little is known about their ecological consequences. In this study, clone pairs (e...

  11. Effects of Tall Fescue Forage Mass on Steer Ingestive Behavior and Performance

    Science.gov (United States)

    Tall fescue [Lolium arundinaceum (Schreb.) Darbysh] is a well adapted perennial pasture species utilized across the north-south transition zone of the United States and in similar environments worldwide. This 3-yr trial evaluated the influence of three forage masses (FM) on steer and pasture respons...

  12. Uptake, Translocation, Metabolism, and Distribution of Glyphosate in Nontarget Tea Plant (Camellia sinensis L.).

    Science.gov (United States)

    Tong, Mengmeng; Gao, Wanjun; Jiao, Weiting; Zhou, Jie; Li, Yeyun; He, Lili; Hou, Ruyan

    2017-09-06

    The uptake, translocation, metabolism, and distribution behavior of glyphosate in nontarget tea plant were investigated. The negative effects appeared to grown tea saplings when the nutrient solution contained glyphosate above 200 mg L -1 . Glyphosate was highest in the roots of the tea plant, where it was also metabolized to aminomethyl phosphonic acid (AMPA). The glyphosate and AMPA in the roots were transported through the xylem or phloem to the stems and leaves. The amount of AMPA in the entire tea plant was less than 6.0% of the amount of glyphosate. The glyphosate level in fresh tea shoots was less than that in mature leaves at each day. These results indicated that free glyphosate in the soil can be continuously absorbed by, metabolized in, and transported from the roots of the tea tree into edible leaves, and therefore, free glyphosate residues in the soil should be controlled to produce teas free of glyphosate.

  13. Genetically Modified Herbicide-Tolerant Crops, Weeds, and Herbicides: Overview and Impact

    Science.gov (United States)

    Bonny, Sylvie

    2016-01-01

    Genetically modified (GM) crops have been and continue to be a subject of controversy despite their rapid adoption by farmers where approved. For the last two decades, an important matter of debate has been their impact on pesticide use, particularly for herbicide-tolerant (HT) crops. Some claim that these crops bring about a decrease in herbicide use, while others claim the opposite. In fact, since 1996, most cultivated GMOs have been GMHT crops, which involve the use of an associated herbicide, generally glyphosate. In their very first years of adoption, HT crops often led to some decrease in herbicide use. However, the repetition of glyphosate-tolerant crops and of glyphosate only applications in the same fields without sufficient alternation and herbicide diversity has contributed to the appearance of glyphosate-resistant weeds. These weeds have resulted in a rise in the use of glyphosate and other herbicides. This article explores this situation and the impacts of herbicide-resistant weeds, using an interdisciplinary approach and drawing on recent data. The paper analyzes the spread of GMHT crops worldwide and their consequences on herbicide use in the USA in particular. It then addresses the global development of glyphosate-resistant weeds and their impact, particularly focusing on the USA. Finally, the last section explores how industry, farmers, and weed scientists are coping with the spread of resistant weeds. The concluding comments deal more widely with trends in GM crops.

  14. Degradation of 14C-glyphosate in compost amended soils.

    Science.gov (United States)

    Alexa, E; Bragea, M; Sumalan, R; Negrea, M; Lazureanu, A

    2009-01-01

    Glyphosate (N-phosphonomethyl-glycine), the active ingredient in several herbicide formulations, is a non-selective, post-emergent herbicide used in a variety of crop and non-crop situations. Glyphosate is a non-volatile herbicide that is relatively immobile in soil. Its degradation is due to microbiological processes and most laboratory studies have been conducted with 14C-glyphosate with the rate of 14CO2 evolution being used as an indication of herbicide breakdown. In this paper we have studied the glyphosate degradation in compost amendment soils using Scientilator Liquid TRIATHLER and Glyphosate-phosphonomethyl-14C-labeled with specific activity 2,2mCi/mmol. Four types of soils have been taken under study: Black Chernozem, Vertisol, Gleysol and Phaeozem with different characteristics. For the each type of soil have been realized four experimental variants (glyphosate blind sample with 1,5 ppm, concentration, autoclaved soil, soil with glyphosate and addition of compost in field concentration of 40 t/ha, respectively 60 t/ha. The mineralization curves of 14CO2 accumulated were compared during of 40 days. All the mineralization curves for the soils exhibited same patterns, with only two phases, the initial rapid phase of degradation, for about 20 days, attributed to microbial action on the free glyphosate and the second slow phase, when the curves attained plateaus. Compost applied with different concentrations to Vertisol and Black Chernozem did not appear to stimulate the microbial degradation of glyphosate. In Gleysol and Phaeozem with lower humus content, the mineralization curve of 14C indicate the increase degradation capacity, expressed as accumulated 14CO2 as % total 14C, with the increase of compost concentration.

  15. Glyphosate and aminomethylphosphonic acid are not detectable in human milk.

    Science.gov (United States)

    McGuire, Michelle K; McGuire, Mark A; Price, William J; Shafii, Bahman; Carrothers, Janae M; Lackey, Kimberly A; Goldstein, Daniel A; Jensen, Pamela K; Vicini, John L

    2016-05-01

    Although animal studies have shown that exposure to glyphosate (a commonly used herbicide) does not result in glyphosate bioaccumulation in tissues, to our knowledge there are no published data on whether it is detectable in human milk and therefore consumed by breastfed infants. We sought to determine whether glyphosate and its metabolite aminomethylphosphonic acid (AMPA) could be detected in milk and urine produced by lactating women and, if so, to quantify typical consumption by breastfed infants. We collected milk (n = 41) and urine (n = 40) samples from healthy lactating women living in and around Moscow, Idaho and Pullman, Washington. Milk and urine samples were analyzed for glyphosate and AMPA with the use of highly sensitive liquid chromatography-tandem mass spectrometry methods validated for and optimized to each sample matrix. Our milk assay, which was sensitive down to 1 μg/L for both analytes, detected neither glyphosate nor AMPA in any milk sample. Mean ± SD glyphosate and AMPA concentrations in urine were 0.28 ± 0.38 and 0.30 ± 0.33 μg/L, respectively. Because of the complex nature of milk matrixes, these samples required more dilution before analysis than did urine, thus decreasing the sensitivity of the assay in milk compared with urine. No difference was found in urine glyphosate and AMPA concentrations between subjects consuming organic compared with conventionally grown foods or between women living on or near a farm/ranch and those living in an urban or suburban nonfarming area. Our data provide evidence that glyphosate and AMPA are not detectable in milk produced by women living in this region of the US Pacific Northwest. By extension, our results therefore suggest that dietary glyphosate exposure is not a health concern for breastfed infants. This study was registered at clinicaltrials.gov as NCT02670278. © 2016 American Society for Nutrition.

  16. The herbicide Glyphosate affects nitrification in the Elbe estuary, Germany

    Science.gov (United States)

    Sanders, Tina; Lassen, Stephan

    2015-04-01

    The Elbe River is one of the biggest European rivers discharging into the North Sea. It also transports high amounts of nutrients and pollutants like pesticides. Important source regions of both nutrients and pollutants are located within the river catchment, which is dominated by agricultural land-use. From these agricultural soils, pesticides can be carried via the river and estuary into the North Sea. Glyphosate (N-(phosphonomethyl) glycine) is the most commonly used herbicide worldwide and mainly used to regulate unwanted plant growth and for the expedition of crop ripening. In Germany, ~ 6000 tons of glyphosate are applied yearly in agriculture and private use. Glyphosate is degradable by microorganisms and has a half-life in water of 35 to 60 days. This herbicide specifically inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), an enzyme that catalyzes the biosynthesis of essential aromatic amino acids in plants, fungi, and bacteria. Nitrifying bacteria, which play an important role in the internal nitrogen cycling in the Elbe estuary, also possess this enzyme. The aim of our study was to quantify the concentration of glyphosate in water and sediment samples of the Elbe to get an overview about relevant environmental levels and to assess the impact of glyphosate on inhibition of nitrifying activities. To quantify the effect of glyphosate on nitrification activity, natural samples as well as pure cultures of Nitrosomonas europea (strain Nm50) were incubated with different concentrations of glyphosate over a period of some weeks. The nitrifying activity was determined according to changes of the nitrite and nitrate concentration as well as the cell number. Glyphosate was detectable in water and sediment samples in the Elbe estuary with up to 5 ppb mainly in the Port of Hamburg region. In both incubation experiments an inhibiting effect of glyphosate on nitrification could be shown. The incubated natural water sample was affected by a glyphosate

  17. Characterization of Epichloë coenophiala within the U.S.: are all tall fescue endophytes created equal?

    Science.gov (United States)

    Young, Carolyn; Charlton, Nikki; Takach, Johanna; Swoboda, Ginger; Trammell, Michael; Huhman, David; Hopkins, Andrew

    2014-11-01

    Tall fescue (Lolium arundinaceum) is a valuable and broadly adapted forage grass that occupies approximately 14 million hectares across the United States. A native to Europe, tall fescue was likely introduced into the U.S. around the late 1800’s. Much of the success of tall fescue can be attributed to Epichloë coenophiala (formerly Neotyphodium coenophialum) a seed borne symbiont that aids in host persistence. Epichloë species are capable of producing a range of alkaloids (ergot alkaloids, indole-diterpenes, lolines and peramine) that provide protection to the plant host from herbivory. Unfortunately, most tall fescue within the U.S., commonly referred to as KY31, harbors the endophyte E. coenophiala that causes toxicity to grazing livestock due to the production of ergot alkaloids. Molecular analyses of tall fescue endophytes have identified four independent associations, representing tall fescue with E. coenophiala, Epichloë sp. FaTG-2, Epichloë sp. FaTG-3 or Epichloë sp. FaTG-4. Each of these Epichloë species can be further distinguished based on genetic variation that equates to differences in the alkaloid gene loci. Tall fescue samples were evaluated using markers to SSR and alkaloid biosynthesis genes to determine endophyte strain variation present within continental U.S. Samples represented seed and tillers from the Suiter farm (Menifee County, KY), which is considered the originating site of KY31, as well as plant samples collected from 14 states, breeder’s seed and plant introduction lines (National Plant Germplasm System, NPGS). This study revealed two prominent E. coenophiala genotypes based on presence of alkaloid biosynthesis genes and SSR markers and provides insight into endophyte variation within continental U.S. across historical and current tall fescue samples.

  18. Efeitos de diferentes formulações comerciais de glyphosate sobre estirpes de Bradyrhizobium Effects of different glyphosate commercial formulations on Bradyrhizobium strains

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2004-06-01

    the strains were inoculated in yeast extract manitol (YM. Herbicide effect on the growth of the Bradyrhizobium strains was assessed by optic density reading in a spectrophotometer. Twenty seven treatments arranged in a factorial design were evaluated and consisted of one strain of B. japonicum: SEMIA 5079; and two strains of B. elkanii: SEMIA 5019 and SEMIA 587, under the effect of nine glyphosate formulations: Zapp QI®, Roundup®, Roundup Multiação®, Roundup Transorb®, Roundup WG®, Trop®, Agrisato®, technical glyphosate [N-(phosphonomethyl glycine] and control without herbicide addition (as the strain control treatment, with six replications. A growth curve was established for each strain. It could be observed that the different glyphosate formulations Zapp Qi, Roundup, Roundup Multiação, Roundup transorb, Roundup WG, Trop and Agrisato caused differentiated effects on the strains of Bradyrhizobium SEMIA 5019, SEMIA 5079 and SEMIA 587. It was verified that the Zapp Qi formulation was the least toxic to the strains. The highest toxicity was observed for Roundup Transorb, which reduced growth over 94% for all the strains assessed. Correlation was not observed among the type of salt, isopropylamine, ammonium or potassic, present in the formulation herbicides, and the toxicity degree to the strains. The strain SEMIA 587 was the least tolerant to most formulations while SEMIA 5019 was the most sensitive to the control treatment N- (phosphonomethyl glycine, without salts or other additives.

  19. The effect of glyphosate application on soil microbial activities in ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... bacterial populations in the presence of glyphosate as P source was significantly (p<0.01) higher than N ... bes by transferring hydrogen or electrons from substrates .... of utilizing GP as carbon or other nutrient sources.

  20. Biodegradation of glyphosate herbicide in vitro using bacterial ...

    African Journals Online (AJOL)

    USER

    2010-06-28

    Jun 28, 2010 ... Full Length Research Paper ... Glyphosate is a compound used as herbicide in the control and/or killing of grasses and herbaceous plants. ... Because of its toxicity to non-target organisms, there is need to decontaminate.

  1. Removal of glyphosate herbicide from water using biopolymer membranes.

    Science.gov (United States)

    Carneiro, Rafael T A; Taketa, Thiago B; Gomes Neto, Reginaldo J; Oliveira, Jhones L; Campos, Estefânia V R; de Moraes, Mariana A; da Silva, Camila M G; Beppu, Marisa M; Fraceto, Leonardo F

    2015-03-15

    Enormous amounts of pesticides are manufactured and used worldwide, some of which reach soils and aquatic systems. Glyphosate is a non-selective herbicide that is effective against all types of weeds and has been used for many years. It can therefore be found as a contaminant in water, and procedures are required for its removal. This work investigates the use of biopolymeric membranes prepared with chitosan (CS), alginate (AG), and a chitosan/alginate combination (CS/AG) for the adsorption of glyphosate present in water samples. The adsorption of glyphosate by the different membranes was investigated using the pseudo-first order and pseudo-second order kinetic models, as well as the Langmuir and Freundlich isotherm models. The membranes were characterized regarding membrane solubility, swelling, mechanical, chemical and morphological properties. The results of kinetics experiments showed that adsorption equilibrium was reached within 4 h and that the CS membrane presented the best adsorption (10.88 mg of glyphosate/g of membrane), followed by the CS/AG bilayer (8.70 mg of glyphosate/g of membrane). The AG membrane did not show any adsorption capacity for this herbicide. The pseudo-second order model provided good fits to the glyphosate adsorption data on CS and CS/AG membranes, with high correlation coefficient values. Glyphosate adsorption by the membranes could be fitted by the Freundlich isotherm model. There was a high affinity between glyphosate and the CS membrane and moderate affinity in the case of the CS/AG membrane. Physico-chemical characterization of the membranes showed low values of solubility in water, indicating that the membranes are stable and not soluble in water. The SEM and AFM analysis showed evidence of the presence of glyphosate on CS membranes and on chitosan face on CS/AG membranes. The results showed that the glyphosate herbicide can be adsorbed by chitosan membranes and the proposed membrane-based methodology was successfully used to

  2. Pool of resistance mechanisms to glyphosate in Digitaria insularis.

    Science.gov (United States)

    de Carvalho, Leonardo Bianco; Alves, Pedro Luis da Costa Aguiar; González-Torralva, Fidel; Cruz-Hipolito, Hugo Enrique; Rojano-Delgado, Antonia María; De Prado, Rafael; Gil-Humanes, Javier; Barro, Francisco; de Castro, María Dolores Luque

    2012-01-18

    Digitaria insularis biotypes resistant to glyphosate have been detected in Brazil. Studies were carried out in controlled conditions to determine the role of absorption, translocation, metabolism, and gene mutation as mechanisms of glyphosate resistance in D. insularis. The susceptible biotype absorbed at least 12% more (14)C-glyphosate up to 48 h after treatment (HAT) than resistant biotypes. High differential (14)C-glyphosate translocation was observed at 12 HAT, so that >70% of the absorbed herbicide remained in the treated leaf in resistant biotypes, whereas 42% remained in the susceptible biotype at 96 HAT. Glyphosate was degraded to aminomethylphosphonic acid (AMPA), glyoxylate, and sarcosine by >90% in resistant biotypes, whereas a small amount of herbicide (up to 11%) was degraded by the susceptible biotype up to 168 HAT. Two amino acid changes were found at positions 182 and 310 in EPSPS, consisting of a proline to threonine and a tyrosine to cysteine substitution, respectively, in resistant biotypes. Therefore, absorption, translocation, metabolism, and gene mutation play an important role in the D. insularis glyphosate resistance.

  3. Root-Zone Glyphosate Exposure Adversely Affects Two Ditch Species

    Directory of Open Access Journals (Sweden)

    Lyndsay E. Saunders

    2013-12-01

    Full Text Available Glyphosate, one of the most applied herbicides globally, has been extensively studied for its effects on non-target organisms. In the field, following precipitation, glyphosate runs off into agricultural ditches where it infiltrates into the soil and thus may encounter the roots of vegetation. These edge-of-field ditches share many characteristics with wetlands, including the ability to reduce loads of anthropogenic chemicals through uptake, transformation, and retention. Different species within the ditches may have a differential sensitivity to exposure of the root zone to glyphosate, contributing to patterns of abundance of ruderal species. The present laboratory experiment investigated whether two species commonly found in agricultural ditches in southcentral United States were affected by root zone glyphosate in a dose-dependent manner, with the objective of identifying a sublethal concentration threshold. The root zone of individuals of Polygonum hydropiperoides and Panicum hemitomon were exposed to four concentrations of glyphosate. Leaf chlorophyll content was measured, and the ratio of aboveground biomass to belowground biomass and survival were quantified. The findings from this study showed that root zone glyphosate exposure negatively affected both species including dose-dependent reductions in chlorophyll content. P. hydropiperdoides showed the greatest negative response, with decreased belowground biomass allocation and total mortality at the highest concentrations tested.

  4. A glyphosate-based pesticide impinges on transcription

    International Nuclear Information System (INIS)

    Marc, Julie; Le Breton, Magali; Cormier, Patrick; Morales, Julia; Belle, Robert; Mulner-Lorillon, Odile

    2005-01-01

    Widely spread chemicals used for human benefits may exert adverse effects on health or the environment, the identification of which are a major challenge. The early development of the sea urchin constitutes an appropriate model for the identification of undesirable cellular and molecular targets of pollutants. The widespread glyphosate-based pesticide affected sea urchin development by impeding the hatching process at millimolar range concentration of glyphosate. Glyphosate, the active herbicide ingredient of Roundup, by itself delayed hatching as judged from the comparable effect of different commercial glyphosate-based pesticides and from the effect of pure glyphosate addition to a threshold concentration of Roundup. The surfactant polyoxyethylene amine (POEA), the major component of commercial Roundup, was found to be highly toxic to the embryos when tested alone and therefore could contribute to the inhibition of hatching. Hatching, a landmark of early development, is a transcription-dependent process. Correlatively, the herbicide inhibited the global transcription, which follows fertilization at the 16-cell stage. Transcription inhibition was dose-dependent in the millimolar glyphosate range concentration. A 1257-bp fragment of the hatching enzyme transcript from Sphaerechinus granularis was cloned and sequenced; its transcription was delayed by 2 h in the pesticide-treated embryos. Because transcription is a fundamental basic biological process, the pesticide may be of health concern by inhalation near herbicide spraying at a concentration 25 times the adverse transcription concentration in the sprayed microdroplets

  5. Epidemiologic studies of glyphosate and cancer: a review.

    Science.gov (United States)

    Mink, Pamela J; Mandel, Jack S; Sceurman, Bonnielin K; Lundin, Jessica I

    2012-08-01

    The United States Environmental Protection Agency and other regulatory agencies around the world have registered glyphosate as a broad-spectrum herbicide for use on multiple food and non-food use crops. Glyphosate is widely considered by regulatory authorities and scientific bodies to have no carcinogenic potential, based primarily on results of carcinogenicity studies of rats and mice. To examine potential cancer risks in humans, we reviewed the epidemiologic literature to evaluate whether exposure to glyphosate is associated causally with cancer risk in humans. We also reviewed relevant methodological and biomonitoring studies of glyphosate. Seven cohort studies and fourteen case-control studies examined the association between glyphosate and one or more cancer outcomes. Our review found no consistent pattern of positive associations indicating a causal relationship between total cancer (in adults or children) or any site-specific cancer and exposure to glyphosate. Data from biomonitoring studies underscore the importance of exposure assessment in epidemiologic studies, and indicate that studies should incorporate not only duration and frequency of pesticide use, but also type of pesticide formulation. Because generic exposure assessments likely lead to exposure misclassification, it is recommended that exposure algorithms be validated with biomonitoring data. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Glyphosate Effects on Plant Mineral Nutrition, Crop Rhizosphere Microbiota, and Plant Disease in Glyphosate-Resistant Crops

    Science.gov (United States)

    2012-01-01

    Claims have been made recently that glyphosate-resistant (GR) crops sometimes have mineral deficiencies and increased plant disease. This review evaluates the literature that is germane to these claims. Our conclusions are: (1) although there is conflicting literature on the effects of glyphosate on mineral nutrition on GR crops, most of the literature indicates that mineral nutrition in GR crops is not affected by either the GR trait or by application of glyphosate; (2) most of the available data support the view that neither the GR transgenes nor glyphosate use in GR crops increases crop disease; and (3) yield data on GR crops do not support the hypotheses that there are substantive mineral nutrition or disease problems that are specific to GR crops. PMID:23013354

  7. The effect of Saccharomyces cerevisiae on the stability of the herbicide glyphosate during bread leavening.

    Science.gov (United States)

    Low, F L; Shaw, I C; Gerrard, J A

    2005-01-01

    To investigate the ability of baker's yeast (Saccharomyces cerevisiae) to degrade the herbicide glyphosate during the fermentation cycle of the breadmaking process. Aqueous glyphosate was added to bread ingredients and kneaded by commercially available breadmaking equipment into dough cultures. Cultures were incubated in the breadmaker throughout the fermentation cycle. The recovery of glyphosate levels following fermentation was determined, thus allowing an estimation of glyphosate degradation by yeast. It was shown, for the first time, that S. cerevisiae plays a role in metabolizing glyphosate during the fermentation stages of breadmaking. Approximately 21% was degraded within 1 h. As a result of projected increases in the glyphosate use on wheat and the role of bread as a dietary staple, this may contribute to more informed decisions being made relating to the use of glyphosate on glyphosate-resistant wheat, from a public health/regulatory perspective.

  8. Compositional differences in soybeans on the market: glyphosate accumulates in Roundup Ready GM soybeans.

    Science.gov (United States)

    Bøhn, T; Cuhra, M; Traavik, T; Sanden, M; Fagan, J; Primicerio, R

    2014-06-15

    This article describes the nutrient and elemental composition, including residues of herbicides and pesticides, of 31 soybean batches from Iowa, USA. The soy samples were grouped into three different categories: (i) genetically modified, glyphosate-tolerant soy (GM-soy); (ii) unmodified soy cultivated using a conventional "chemical" cultivation regime; and (iii) unmodified soy cultivated using an organic cultivation regime. Organic soybeans showed the healthiest nutritional profile with more sugars, such as glucose, fructose, sucrose and maltose, significantly more total protein, zinc and less fibre than both conventional and GM-soy. Organic soybeans also contained less total saturated fat and total omega-6 fatty acids than both conventional and GM-soy. GM-soy contained high residues of glyphosate and AMPA (mean 3.3 and 5.7 mg/kg, respectively). Conventional and organic soybean batches contained none of these agrochemicals. Using 35 different nutritional and elemental variables to characterise each soy sample, we were able to discriminate GM, conventional and organic soybeans without exception, demonstrating "substantial non-equivalence" in compositional characteristics for 'ready-to-market' soybeans. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Carfentrazone-ethyl, isolado e associado a duas formulações de glyphosate no controle de duas espécies de trapoeraba Carfentrazone-ethyl isolated and in mixture with two glyphosate formulations on the control of two dayflower species

    Directory of Open Access Journals (Sweden)

    C.P. Ronchi

    2002-04-01

    parte aérea provocada pelos herbicidas.This research was conducted to evaluate the effectiveness of carfentrazone-ethyl, isolated and in mixture with to glyphosate or glyphosate-potassium salt, on controlling two dayflower species, Commelina diffusa and C. benghalensis. These species were grown from stem segments in 12 L pots filled with soil, during 120 days. A complete randomized block design with four replicates was performed for each species. The treatments were carfentrazone-ethyl (0, 10, 20, 30, 40 and 50 g ha-1, isolated and in mixture with glyphosate or glyphosate-potassium salt, these being applied at doses of 720 g ha-1. The percentages of weed control and shoot fresh weight (SFW were evaluated. C. diffusa was more tolerant to carfentrazone-ethyl alone or combined with both glyphosate and glyphosate-potassium salt than C. benghalensis. Both glyphosate and glyphosate-potassium salt were inefficient (control below 30% when applied isolated, regardless of the species. The efficiency of controlling herbicide mixtures was greater than their single applications, except for the carfentrazone-ethyl in doses above 30 g ha-1, with C. benghalensis, in which control was similar to the employed mixtures. Despite the reasonable control (from 71 to 80% for C. diffusa and the very good control (above 81% for C. benghalensis, obtained with carfentrazone-ethyl + glyphosate or carfentrazone-ethyl + glyphosate-potassium salt mixtures, a sole application did not decisively control Commelina spp. In effect, recovery of plants as seen through SFW evaluation took place irrespective of the species; moreover, for C. benghalensis, reinfestation from underground seeds that became viable after the shoot's death, due to herbicide application, was also found.

  10. Performance, forage utilization, and ergovaline consumption by beef cows grazing endophyte fungus-infected tall fescue, endophyte fungus-free tall fescue, or orchardgrass pastures.

    Science.gov (United States)

    Peters, C W; Grigsby, K N; Aldrich, C G; Paterson, J A; Lipsey, R J; Kerley, M S; Garner, G B

    1992-05-01

    Two 120-d trials (May to September, 1988 and 1989) determined the effects of grazing tall fescue (two varieties) or orchardgrass on forage intake and performance by beef cows. Each summer, 48 cow-calf pairs grazed endophyte-infected Kentucky-31 tall fescue (KY-31), endophyte-free Mozark tall fescue (MOZARK), or Hallmark orchardgrass (OG) pastures (16 pairs/treatment). Forage OM intakes and digestibilities were determined during June and August each year. Cow and calf BW and milk production were determined every 28 d. During June of both years, OM intakes did not differ (P greater than .10) among treatments. During August of 1988, intakes were 18% lower (P less than .05) by KY-31 cows (1.6% of BW) than by MOZARK or OG cows (average 1.95% of BW); however, no differences (P greater than .10) were measured in August of 1989. Estimates of ergovaline consumption during June from KY-31 were between 4.2 (1988) and 6.0 mg/d (1989), whereas August estimates were between 1.1 (1988) and 2.8 mg/d (1989). Ergovaline in MOZARK estrusa was below detection limits, except in August of 1989. Cows that grazed KY-31 lost three times (P less than .01) more BW than cows that grazed MOZARK or OG (42 vs 9 and 13 kg, respectively). Milk production by KY-31 cows was 25% lower (P less than .01) than that by cows that grazed MOZARK or OG (6.0 vs average of 8.0 kg/d). Similarly, slower (P less than .01) calf gains were noted for KY-31 than for MOZARK or OG (.72 vs .89 and .88 kg/d, respectively). Cows grazing KY-31 experienced accelerated BW loss and reduced milk production and weaned lighter calves than did cows grazing MOZARK or OG. Decreased performance was not explained by consistently reduced forage intakes; hence, altered nutrient utilization was suspected.

  11. Degradation of the Phosphonate Herbicide Glyphosate by Arthrobacter atrocyaneus ATCC 13752

    OpenAIRE

    Pipke, Rüdiger; Amrhein, Nikolaus

    1988-01-01

    Of nine authentic Arthrobacter strains tested, only A. atrocyaneus ATCC 13752 was capable of using the herbicide glyphosate [N-(phosphonomethyl)glycine] as its sole source of phosphorus. Contrary to the previously isolated Arthrobacter sp. strain GLP-1, which degrades glyphosate via sarcosine, A. atrocyaneus metabolized glyphosate to aminomethylphosphonic acid. The carbon of aminomethylphosphonic acid was entirely converted to CO2. This is the first report on glyphosate degradation by a bacte...

  12. Integrating soil conservation practices and glyphosate-resistant crops: impacts on soil.

    Science.gov (United States)

    Locke, Martin A; Zablotowicz, Robert M; Reddy, Krishna N

    2008-04-01

    Conservation practices often associated with glyphosate-resistant crops, e.g. limited tillage and crop cover, improve soil conditions, but only limited research has evaluated their effects on soil in combination with glyphosate-resistant crops. It is assumed that conservation practices have similar benefits to soil whether or not glyphosate-resistant crops are used. This paper reviews the impact on soil of conservation practices and glyphosate-resistant crops, and presents data from a Mississippi field trial comparing glyphosate-resistant and non-glyphosate-resistant maize (Zea mays L.) and cotton (Gossypium hirsutum L.) under limited tillage management. Results from the reduced-tillage study indicate differences in soil biological and chemical properties owing to glyphosate-resistant crops. Under continuous glyphosate-resistant maize, soils maintained greater soil organic carbon and nitrogen as compared with continuous non-glyphosate-resistant maize, but no differences were measured in continuous cotton or in cotton rotated with maize. Soil microbial community structure based on total fatty acid methyl ester analysis indicated a significant effect of glyphosate-resistant crop following 5 years of continuous glyphosate-resistant crop as compared with the non-glyphosate-resistant crop system. Results from this study, as well as the literature review, indicate differences attributable to the interaction of conservation practices and glyphosate-resistant crop, but many are transient and benign for the soil ecosystem. Glyphosate use may result in minor effects on soil biological/chemical properties. However, enhanced organic carbon and plant residues in surface soils under conservation practices may buffer potential effects of glyphosate. Long-term field research established under various cropping systems and ecological regions is needed for critical assessment of glyphosate-resistant crop and conservation practice interactions. Copyright (c) 2008 by John Wiley & Sons

  13. Agronomic Evaluation and Genetic Variation of Tunisian Tall Fescue (Festuca arundinacea Schreb.

    Directory of Open Access Journals (Sweden)

    N. Chtourou-Ghorbel

    2011-01-01

    Full Text Available Nine important agronomic traits were used to assess the genetic diversity of Tunisian tall fescue and to investigate the extent of genotype X environment (GE interaction and its implications for breeding programs. These traits were studied for three consecutive years in thirty-five spontaneous populations and three cultivars. Panicle size contributed to seeds production, while the plant height at harvest and dry matter yield were selected for forage performance. Analysis of variance demonstrated that population attitude depended on the year and environmental conditions. Principal component analysis revealed significant similarities among some spontaneous populations and cultivars. The relationship between environmental conditions and agronomic traits revealed the influence of altitude, soil texture and minimum temperature on forage production, seed yield, and the architecture of plants, respectively. In addition, the local adapted ecotypes originating from Bizerte, Sidi Nsir, and Rass Rajel attained greater agronomic potentialities than control cultivars and were of considerable economic interest for the improvement of Tunisian tall fescue.

  14. Phytotoxicity of glyphosate in the germination of and its effect on germinated seedlings

    Directory of Open Access Journals (Sweden)

    Subinoy Mondal

    2017-08-01

    Full Text Available The present study evaluated the effects of glyphosate on Pisum sativum germination as well as its effect on the physiology and biochemistry of germinated seedlings. Different physico-chemical biomarkers, viz., chlorophyll, root and shoot length, total protein and soluble sugar, along with sodium and potassium concentration, were investigated in germinated seedlings at different glyphosate concentrations. This study reports the influence of different concentrations of glyphosate on pea seeds and seedlings. Physicochemical biomarkers were significantly changed by glyphosate exposure after 15 days. The germination of seedlings under control conditions (0 mg/L was 100% after 3 days of treatment but at 3 and 4 mg/L glyphosate, germination was reduced to 55 and 40%, respectively. Physiological parameters like root and shoot length decreased monotonically with increasing glyphosate concentration, at 14 days of observation. Average root and shoot length (n=30 in three replicates were reduced to 14.7 and 17.6%, respectively, at 4 mg/L glyphosate. Leaf chlorophyll content also decreased, with a similar trend to root and shoot length, but the protein content initially decreased and then increased with an increase in glyphosate concentration to 3 mg/L. The study suggests that glyphosate reduces the soluble sugar content significantly, by 21.6% (v/v. But internal sodium and potassium tissue concentrations were significantly altered by glyphosate exposure with increasing concentrations of glyphosate. Biochemical and physiological analysis also supports the inhibitory effect of glyphosate on seed germination and biochemical effects on seedlings.

  15. Utilization of glyphosate as phosphate source: biochemistry and genetics of bacterial carbon-phosphorous lyase

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Zechel, David L; Jochimsen, Bjarne

    2014-01-01

    After several decades of use of glyphosate, the active ingredient in weed killers such as Roundup, in fields, forests, and gardens, the biochemical pathway of transformation of glyphosate phosphorus to a useful phosphorus source for microorganisms has been disclosed. Glyphosate is a member of a l...

  16. Early detection of crop injury from herbicide glyphosate by leaf biochemical parameter inversion

    Science.gov (United States)

    Early detection of crop injury from glyphosate is of significant importance in crop management. In this paper, we attempt to detect glyphosate-induced crop injury by PROSPECT (leaf optical PROperty SPECTra model) inversion through leaf hyperspectral reflectance measurements for non-Glyphosate-Resist...

  17. Pentobarbital Sleep Time in Mouse Lines Selected for Resistance and Susceptibility to Fescue Toxicosis

    OpenAIRE

    Arthur, Kimberly Ann

    2002-01-01

    In previous work with mouse lines selected for resistance (R) and susceptibility (S) to fescue toxicosis, R mice had higher activities of Phase II liver enzymes glutathione S-transferase and uridine diphosphate glucuronosyl-transferase than S mice. Objectives of this study were: 1. to determine whether selection for toxicosis response had also caused divergence between lines in hepatic Phase I enzyme activity (as assessed by sleep time following sodium pentobarbital anesthesia), 2. to determi...

  18. Facts and Fallacies in the Debate on Glyphosate Toxicity

    Directory of Open Access Journals (Sweden)

    Robin Mesnage

    2017-11-01

    Full Text Available The safety profile of the herbicide glyphosate and its commercial formulations is controversial. Reviews have been published by individuals who are consultants and employees of companies commercializing glyphosate-based herbicides in support of glyphosate’s reapproval by regulatory agencies. These authors conclude that glyphosate is safe at levels below regulatory permissible limits. In contrast, reviews conducted by academic scientists independent of industry report toxic effects below regulatory limits, as well as shortcomings of the current regulatory evaluation of risks associated with glyphosate exposures. Two authors in particular (Samsel and Seneff have published a series of commentaries proposing that long-term exposure to glyphosate is responsible for many chronic diseases (including cancers, diabetes, neuropathies, obesity, asthma, infections, osteoporosis, infertility, and birth defects. The aim of this review is to examine the evidential basis for these claimed negative health effects and the mechanisms that are alleged to be at their basis. We found that these authors inappropriately employ a deductive reasoning approach based on syllogism. We found that their conclusions are not supported by the available scientific evidence. Thus, the mechanisms and vast range of conditions proposed to result from glyphosate toxicity presented by Samsel and Seneff in their commentaries are at best unsubstantiated theories, speculations, or simply incorrect. This misrepresentation of glyphosate’s toxicity misleads the public, the scientific community, and regulators. Although evidence exists that glyphosate-based herbicides are toxic below regulatory set safety limits, the arguments of Samsel and Seneff largely serve to distract rather than to give a rational direction to much needed future research investigating the toxicity of these pesticides, especially at levels of ingestion that are typical for human populations.

  19. Facts and Fallacies in the Debate on Glyphosate Toxicity

    Science.gov (United States)

    Mesnage, Robin; Antoniou, Michael N.

    2017-01-01

    The safety profile of the herbicide glyphosate and its commercial formulations is controversial. Reviews have been published by individuals who are consultants and employees of companies commercializing glyphosate-based herbicides in support of glyphosate’s reapproval by regulatory agencies. These authors conclude that glyphosate is safe at levels below regulatory permissible limits. In contrast, reviews conducted by academic scientists independent of industry report toxic effects below regulatory limits, as well as shortcomings of the current regulatory evaluation of risks associated with glyphosate exposures. Two authors in particular (Samsel and Seneff) have published a series of commentaries proposing that long-term exposure to glyphosate is responsible for many chronic diseases (including cancers, diabetes, neuropathies, obesity, asthma, infections, osteoporosis, infertility, and birth defects). The aim of this review is to examine the evidential basis for these claimed negative health effects and the mechanisms that are alleged to be at their basis. We found that these authors inappropriately employ a deductive reasoning approach based on syllogism. We found that their conclusions are not supported by the available scientific evidence. Thus, the mechanisms and vast range of conditions proposed to result from glyphosate toxicity presented by Samsel and Seneff in their commentaries are at best unsubstantiated theories, speculations, or simply incorrect. This misrepresentation of glyphosate’s toxicity misleads the public, the scientific community, and regulators. Although evidence exists that glyphosate-based herbicides are toxic below regulatory set safety limits, the arguments of Samsel and Seneff largely serve to distract rather than to give a rational direction to much needed future research investigating the toxicity of these pesticides, especially at levels of ingestion that are typical for human populations. PMID:29226121

  20. Resposta de cultivares de algodoeiro a subdoses de glyphosate Response of cotton cultivars to reduced rates of glyphosate

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2005-12-01

    Full Text Available Avaliou-se a resposta de nove cultivares de algodoeiro, de importância econômica no Estado do Mato Grosso, quanto à intoxicação causada por subdoses de glyphosate. Os cultivares de algodoeiro utilizados foram Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal, BRS Facual, Antares e Coodetec 407. As plantas foram cultivadas em tubetes preenchidos com substrato de solo e mantidas em casa telada, tendo recebido a aplicação do glyphosate aos 20 dias após a emergência, época em que apresentavam quatro folhas verdadeiras. As subdoses de glyphosate, simulando deriva, foram de 270 e 540 g ha-1. Também foi utilizada testemunha, sem aplicação do herbicida, para efeito de comparação. Foram realizadas avaliações semanais até 42 dias após a aplicação dos tratamentos (DAA, período em que também foi tomada a altura das plantas. Os sintomas visuais de intoxicação iniciaram-se aos 3 DAA, caracterizados pelo amarelecimento das pontas das folhas mais novas, seguido de murchamento do ápice das plantas. Na dose de 270 g ha-1 esses sintomas foram de baixa intensidade, mas a 540 g ha-1 causaram, na maioria dos casos, toxidez "preocupante" a "muito alta". Os cultivares BRS Facual e FM 986 mostraram-se os mais suscetíveis. A altura das plantas foi mais afetada quando se aplicou a menor dose de glyphosate. Houve recuperação de todos os cultivares tratados com 270 g ha-1 de glyphosate até os 42 DAA. Quando tratados com 540 g ha-1 de glyphosate, os cultivares Fabrika, Coodetec 407, BRS-Facual e ITA-90 foram mais sensíveis, apresentando redução de altura entre 84 e 90% aos 42 DAA. Os cultivares menos sensíveis na dose de 270 g ha-1 de glyphosate não foram os mesmos para a dose de 540 g ha-1.The response of nine cotton cultivars economically important in the state of Mato Grosso was evaluated in relation to the toxicity caused by reduced rates of glyphosate. The cotton cultivars used were Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal

  1. Genome-wide SNP identification in multiple morphotypes of allohexaploid tall fescue (Festuca arundinacea Schreb

    Directory of Open Access Journals (Sweden)

    Hand Melanie L

    2012-06-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs provide essential tools for the advancement of research in plant genomics, and the development of SNP resources for many species has been accelerated by the capabilities of second-generation sequencing technologies. The current study aimed to develop and use a novel bioinformatic pipeline to generate a comprehensive collection of SNP markers within the agriculturally important pasture grass tall fescue; an outbreeding allopolyploid species displaying three distinct morphotypes: Continental, Mediterranean and rhizomatous. Results A bioinformatic pipeline was developed that successfully identified SNPs within genotypes from distinct tall fescue morphotypes, following the sequencing of 414 polymerase chain reaction (PCR – generated amplicons using 454 GS FLX technology. Equivalent amplicon sets were derived from representative genotypes of each morphotype, including six Continental, five Mediterranean and one rhizomatous. A total of 8,584 and 2,292 SNPs were identified with high confidence within the Continental and Mediterranean morphotypes respectively. The success of the bioinformatic approach was demonstrated through validation (at a rate of 70% of a subset of 141 SNPs using both SNaPshot™ and GoldenGate™ assay chemistries. Furthermore, the quantitative genotyping capability of the GoldenGate™ assay revealed that approximately 30% of the putative SNPs were accessible to co-dominant scoring, despite the hexaploid genome structure. The sub-genome-specific origin of each SNP validated from Continental tall fescue was predicted using a phylogenetic approach based on comparison with orthologous sequences from predicted progenitor species. Conclusions Using the appropriate bioinformatic approach, amplicon resequencing based on 454 GS FLX technology is an effective method for the identification of polymorphic SNPs within the genomes of Continental and Mediterranean tall fescue. The

  2. Evaluating blood perfusion of the corpus luteum in beef cows during fescue toxicosis.

    Science.gov (United States)

    Cline, G F; Muth-Spurlock, A M; Voelz, B E; Lemley, C O; Larson, J E

    2016-01-01

    The aim of this study was to determine if fescue toxicosis altered blood perfusion in the corpus luteum (CL) and peripheral concentrations of progesterone in cattle. The estrous cycles of 36 nonpregnant Angus or Charolais cows were synchronized in 2 replicates using the CO-Synch+CIDR protocol. Seven days after initiation of the protocol, cows were assigned (d 0) to 1 of 2 dietary treatments: 2.5 kg of 1) Kentucky-31 endophyte-infected (KY31; = 14) or 2) MaxQ novel endophyte (MaxQ; = 12) tall fescue seed. On d 7, ovaries were examined using ultrasonography, and only cows that had 1 CL present remained on the study ( = 26). Images of blood perfusion of CL, blood samples, rectal temperatures, and blood pressure of tails were collected on d 10, 13, 15, and 18. Images of CL blood perfusion were analyzed using ImageJ software for pixel density, and scored visually (0 to 9 with 0 = no perfusion, 9 = complete perfusion) by 2 independent technicians. The MIXED procedure of SAS was used with day as a repeated measure. Least squares means and SEM are reported. Cows receiving KY31 had greater rectal temperatures ( 0.003; 38.76 ± 0.08°C) than those receiving MaxQ (38.44 ± 0.08°C), providing evidence that the cows treated with KY31 were influenced by fescue toxicosis. Pulse pressure and mean arterial pressure were decreased ( cows receiving KY31 (55.26 ± 2.81 and 80.06 ± 2.72 mmHg, respectively) than MaxQ (66.58 ± 3.03 and 91.38 ± 2.93 mmHg, respectively). Concentrations of progesterone were similar ( = 0.54) between cows receiving KY31 (6.04 ± 0.53 ng/mL) or MaxQ (6.36 ± 0.63 ng/mL). Pixel densities ( = 0.14) and visual perfusion scores were similar ( = 0.11) between cows receiving KY31 (1477.20 ± 655.62 pixels and 2.23 ± 0.34, respectively) or MaxQ (2934.70 ± 718.20 pixels and 3.00 ± 0.36, respectively). Mean CL volume was similar ( 0.95) between treatments. In conclusion, blood perfusion of CL or peripheral concentrations of progesterone were not altered at the

  3. Cellular composition and expression of potential stem cell markers in mammary tissue of cows consuming endophyte-infected fescue seed during the dry period and early lactation

    Science.gov (United States)

    We evaluated the impact of consuming endophyte-infected fescue during late pregnancy on parameters of mammary development in Holstein cows. Cows (N = 16) were fed 10% of their ration as tall fescue seed that was free from (CON) or infected with endophyte (INF) from 90d before expected calving until ...

  4. Effects of source and level of dietary energy supplementation on in vitro digestibility and methane production from tall fescue-based diets

    Science.gov (United States)

    There is a lack of information about the effect of different sources, levels, and the mixtures of energy supplements commonly fed to cattle grazing tall fescue. Therefore, the objective of this study was to evaluate different common energy sources for beef cattle grazing tall fescue using an in vitr...

  5. DIFFERENTIAL RESPONSE OF CLONES OF EUCALYPT TO GLYPHOSATE1

    Directory of Open Access Journals (Sweden)

    Leonardo Bianco de Carvalho

    2015-02-01

    Full Text Available Weed control is commonly performed by the inter-row mechanical weeding associated to intrarow glyphosate directed spraying, causing a risk for drift or accidental herbicide application, that can affect the crop of interest. The objective was to evaluate the response of clones C219, GG100, I144, and I224 of eucalypt (Eucalyptus grandis x E. urophylla to glyphosate doses of 0, 18, 36, 72, 180, 360, and 720 g of acid equivalent per hectare. The clones showed different growth patterns with regard to height, leaf number, stem dry weight, relative growth rate, net assimilation rate, and relative leaf growth rate. The clones I144 and GG100 were more susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 113.4 and 119.6 g acid equivalent per hectare, respectively. The clones C219 and I224 were less susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 237.5 and 313.5 g acid equivalent per hectare, respectively. Eucalyptus clones respond differently to glyphosate exposure, so that among I224, C219, GG100, and I144, the susceptibility to the herbicide is increasing.

  6. Herbicide-resistant weed management: focus on glyphosate.

    Science.gov (United States)

    Beckie, Hugh J

    2011-09-01

    This review focuses on proactive and reactive management of glyphosate-resistant (GR) weeds. Glyphosate resistance in weeds has evolved under recurrent glyphosate usage, with little or no diversity in weed management practices. The main herbicide strategy for proactively or reactively managing GR weeds is to supplement glyphosate with herbicides of alternative modes of action and with soil-residual activity. These herbicides can be applied in sequences or mixtures. Proactive or reactive GR weed management can be aided by crop cultivars with alternative single or stacked herbicide-resistance traits, which will become increasingly available to growers in the future. Many growers with GR weeds continue to use glyphosate because of its economical broad-spectrum weed control. Government farm policies, pesticide regulatory policies and industry actions should encourage growers to adopt a more proactive approach to GR weed management by providing the best information and training on management practices, information on the benefits of proactive management and voluntary incentives, as appropriate. Results from recent surveys in the United States indicate that such a change in grower attitudes may be occurring because of enhanced awareness of the benefits of proactive management and the relative cost of the reactive management of GR weeds. Copyright © 2011 Society of Chemical Industry.

  7. Eficácia de glyphosate em plantas de cobertura Efficacy of glyphosate in cover crops

    Directory of Open Access Journals (Sweden)

    P.C. Timossi

    2006-09-01

    Full Text Available Objetivou-se comparar a eficácia de três dosagens do herbicida glyphosate para a dessecação de Brachiaria decumbens, B. brizantha cv. Marandu e vegetação espontânea, visando a adoção do sistema plantio direto. Utilizou-se delineamento experimental de blocos ao acaso, num esquema fatorial 3 x 3, com quatro repetições. Testaram-se três tipos de cobertura vegetal e três dosagens de glyphosate (1,44, 2,16 e 2,88 kg ha-1. Aos 7, 14, 21 e 28 dias após a aplicação (DAA, foram feitas avaliações visuais da porcentagem de controle das coberturas vegetais e, aos 45 DAA, avaliações visuais da porcentagem de reinfestação da área. Conclui-se que, para as espécies que compunham a vegetação espontânea, o uso de 1,44 kg ha-1 proporcionou bom controle, sem no entanto evitar rebrotes de Digitaria insularis. Para as braquiárias, a mesma taxa de controle foi observada a partir de 2,16 kg ha-1. A camada de palha das braquiárias sobre o solo não foi capaz de suprimir a emergência de Cyperus rotundus, Alternanthera tenella, Raphanus raphanistrum, Bidens pilosa e Euphorbia heterophylla.This work aimed to compare rates of glyphosate to desiccate Brachiaria decumbens, B. brizantha cv. Marandu and spontaneous plants (weeds, aiming to adopt the no-tillage system. A randomized block experimental design in a factorial scheme was used (3x3, with four replications. The factors consisted of three species of cover crops and three rates of glyphosate (1.44, 2.16 and 2.88 kg ha-1. At 7, 14, 21 and 28 days after application of the herbicide, visual evaluations of the percentage of cover crop control were carried out and at 45 days of the reinfestation percentage of the area. It was concluded that the spontaneous plants presented a good control at 1.44 kg ha-1, without, however, preventing Digitaria insularis sprouts. The same control rate starting at 2.16 kg ha-1 was observed for the Brachiaria species. The straw layer of these cover crops on the soil

  8. How glyphosate affects plant disease development: it is more than enhanced susceptibility.

    Science.gov (United States)

    Hammerschmidt, Ray

    2018-05-01

    Glyphosate has been shown to affect the development of plant disease in several ways. Plants utilize phenolic and other shikimic acid pathway-derived compounds as part of their defense against pathogens, and glyphosate inhibits the biosynthesis of these compounds via its mode of action. Several studies have shown a correlation between enhanced disease and suppression of phenolic compound production after glyphosate. Glyphosate-resistant crop plants have also been studied for changes in resistance as a result of carrying the glyphosate resistance trait. The evidence indicates that neither the resistance trait nor application of glyphosate to glyphosate-resistant plants increases susceptibility to disease. The only exceptions to this are cases where glyphosate has been shown to reduce rust diseases on glyphosate-resistant crops, supporting a fungicidal role for this chemical. Finally, glyphosate treatment of weeds or volunteer crops can cause a temporary increase in soil-borne pathogens that may result in disease development if crops are planted too soon after glyphosate application. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  9. High permeation rates in liposome systems explain rapid glyphosate biodegradation associated with strong isotope fractionation.

    Science.gov (United States)

    Ehrl, Benno; Mogusu, Emmanuel O; Kim, Kyoungtea; Hofstetter, Heike; Pedersen, Joel A; Elsner, Martin

    2018-05-23

    Bacterial uptake of charged organic pollutants such as the widely used herbicide glyphosate is typically attributed to active transporters, whereas passive membrane permeation as an uptake pathway is usually neglected. For 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) liposomes, pH-dependent membrane permeation coefficients (Papp) of glyphosate, determined by nuclear magnetic resonance (NMR) spectroscopy, varied from Papp(pH 7.0) = 3.7 (+/-0.3) × 10-7 m∙s-1 to Papp(pH 4.1) = 4.2 (+/-0.1) × 10-6 m∙s-1. This surprisingly rapid membrane permeation depended on glyphosate speciation and was, at physiological pH, in the range of polar, non-charged molecules suggesting that passive membrane permeation is a potential uptake pathway during glyphosate biodegradation. To test this hypothesis, a Gram-negative glyphosate degrader, Ochrobactrum sp. FrEM, was isolated from glyphosate-treated soil and glyphosate permeation rates inferred from the liposome model were compared to bacterial degradation rates. Estimated maximum permeation rates were, indeed, two orders of magnitudes higher than glyphosate degradation rates. Moreover, biodegradation of millimolar glyphosate concentrations gave rise to pronounced carbon isotope fractionation with an apparent kinetic isotope effect of AKIEcarbon= 1.014 ± 0.003. This value is consistent with unmasked enzymatic isotope fractionation demonstrating that glyphosate biodegradation was little mass transfer-limited and glyphosate exchange across the cell membrane was rapid relative to enzymatic turnover.

  10. Acute toxicity and sublethal effects of the mixture glyphosate (Roundup® Active and Cosmo-Flux®411F to anuran embryos and tadpoles of four Colombian species

    Directory of Open Access Journals (Sweden)

    Liliana Marcela Henao Muñoz

    2015-03-01

    Full Text Available Glyphosate is the most widely used herbicide in the world with application in agriculture, forestry, industrial weed control, garden and aquatic environments. However, its use is highly controversial for the possible impact on not-target organisms, such as amphibians, which are vanishing at an alarming and rapid rate. Due to the high solubility in water and ionic nature, the glyphosate requires of surfactants to increase activity. In addition, for the control of coca (Erythroxylum coca and agricultural weeds in Colombia, formulated glyphosate is mixed and sprayed with the adjuvant Cosmo-Flux®411F to increase the penetration and activity of the herbicide. This study evaluates the acute toxic and sublethal effects (embryonic development, tadpole body size, tadpole swimming performance of the mixture of the formulated glyphosate Roundup® Active and Cosmo-Flux®411F to anuran embryos and tadpoles of four Colombian species under 96h laboratory standard tests and microcosms, which are more similar to field conditions as they include soil, sand and macrophytes. In the laboratory, embryos and tadpoles of Engystomops pustulosus were the most tolerant (LC50=3 904µg a.e./L; LC50=2 799µg a.e./L, respectively, while embryos and tadpoles of Hypsiboas crepitans (LC50=2 203µg a.e./L; LC50=1 424µg a.e./L, respectively were the most sensitive. R. humboldti and R. marina presented an intermediate toxicity. Embryos were significantly more tolerant to the mixture than tadpoles, which could be likely attributed to the exclusion of chemicals by the embryonic membranes and the lack of organs, such as gills, which are sensitive to surfactants. Sublethal effects were observed for the tadpole body size, but not for the embryonic development and tadpole swimming performance. In microcosms, no toxicity (LC50 could not be estimated, or sublethal responses were observed at concentrations up to fourfold (14.76kg glyphosate a.e./ha the highest field application rate of 3

  11. Glyphosate e adubação foliar com manganês na cultura da soja transgênica Glyphosate and foliar fertilization using manganese in transgenic soybean crop

    Directory of Open Access Journals (Sweden)

    N.M. Correia

    2009-01-01

    Full Text Available Com base na hipótese de que a soja transgênica tolerante ao glyphosate necessitaria da adição complementar de manganês devido a alterações na absorção e no metabolismo do elemento pelas plantas, objetivou-se estudar a interação da soja transgênica pulverizada com glyphosate e a adubação foliar com manganês. Foi desenvolvido experimento em campo, no ano agrícola 2007/2008, na Fazenda de Ensino, Pesquisa e Produção da UNESP, campus de Jaboticabal, SP. O delineamento experimental foi o de blocos ao acaso, no esquema fatorial 4 x 4, com quatro repetições. Foram avaliados quatro manejos de plantas daninhas [glyphosate (p.c. Roundup Ready a 0,72 e 1,20 kg ha-1 de equivalente ácido, fluazifop-p-butyl + fomesafen (p.c. Fusiflex a 0,25 + 0,25 kg ha-1 e testemunha capinada, sem herbicida] e quatro doses (0, 42, 84 e 126 g ha-1 de manganês em aplicação foliar na soja. Os tratamentos estudados não alteraram significativamente a produtividade de grãos, os teores de manganês no solo, a altura e a matéria seca das plantas de soja. Apenas a mistura fluazifop-p-butyl mais fomesafen ocasionou injúrias visuais nas plantas, porém os sintomas ficaram restritos às folhas que interceptaram o jato de pulverização. Para massa de 100 grãos, os herbicidas estudados não diferiram da testemunha; no entanto, as plantas tratadas com 0,72 kg ha-1 de glyphosate apresentaram menor massa de grãos. A aplicação de manganês não influenciou os teores do elemento nas plantas tratadas com glyphosate e naquelas sem herbicida. Portanto, o glyphosate não prejudicou a absorção ou o metabolismo do manganês pela planta, e o crescimento e desenvolvimento das plantas tratadas foram estatisticamente similares aos das não tratadas com herbicidas.Based on the hypothesis that glyphosate-tolerant transgenic soybean would need a manganese complementation due to alterations in the absorption and metabolism of this element by the plants, this work aimed to

  12. Glyphosate Use and Cancer Incidence in the Agricultural Health Study.

    Science.gov (United States)

    Andreotti, Gabriella; Koutros, Stella; Hofmann, Jonathan N; Sandler, Dale P; Lubin, Jay H; Lynch, Charles F; Lerro, Catherine C; De Roos, Anneclaire J; Parks, Christine G; Alavanja, Michael C; Silverman, Debra T; Beane Freeman, Laura E

    2018-05-01

    Glyphosate is the most commonly used herbicide worldwide, with both residential and agricultural uses. In 2015, the International Agency for Research on Cancer classified glyphosate as "probably carcinogenic to humans," noting strong mechanistic evidence and positive associations for non-Hodgkin lymphoma (NHL) in some epidemiologic studies. A previous evaluation in the Agricultural Health Study (AHS) with follow-up through 2001 found no statistically significant associations with glyphosate use and cancer at any site. The AHS is a prospective cohort of licensed pesticide applicators from North Carolina and Iowa. Here, we updated the previous evaluation of glyphosate with cancer incidence from registry linkages through 2012 (North Carolina)/2013 (Iowa). Lifetime days and intensity-weighted lifetime days of glyphosate use were based on self-reported information from enrollment (1993-1997) and follow-up questionnaires (1999-2005). We estimated incidence rate ratios (RRs) and 95% confidence intervals (CIs) using Poisson regression, controlling for potential confounders, including use of other pesticides. All statistical tests were two-sided. Among 54 251 applicators, 44 932 (82.8%) used glyphosate, including 5779 incident cancer cases (79.3% of all cases). In unlagged analyses, glyphosate was not statistically significantly associated with cancer at any site. However, among applicators in the highest exposure quartile, there was an increased risk of acute myeloid leukemia (AML) compared with never users (RR = 2.44, 95% CI = 0.94 to 6.32, Ptrend = .11), though this association was not statistically significant. Results for AML were similar with a five-year (RRQuartile 4 = 2.32, 95% CI = 0.98 to 5.51, Ptrend = .07) and 20-year exposure lag (RRTertile 3 = 2.04, 95% CI = 1.05 to 3.97, Ptrend = .04). In this large, prospective cohort study, no association was apparent between glyphosate and any solid tumors or lymphoid malignancies overall, including NHL and

  13. Intermolecular interaction studies of glyphosate with water

    Science.gov (United States)

    Manon, Priti; Juglan, K. C.; Kaur, Kirandeep; Sethi, Nidhi; Kaur, J. P.

    2017-07-01

    The density (ρ), viscosity (η) and ultrasonic velocity (U) of glyphosate with water have been measured on different ultrasonic frequency ranges from 1MHz, 2MHz, 3MHz & 5MHz by varying concentrations (0.05%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, & 0.40%) at 30°C. The specific gravity bottle, Ostwald's viscometer and quartz crystal interferometer were used to determine density (ρ), viscosity (η) and ultrasonic velocity (U). These three factors contribute in evaluating the other parameters as acoustic impedance (Z), adiabatic compressibility (β), relaxation time (τ), intermolecular free length (Lf), free volume (Vf), ultrasonic attenuation (α/f2), Rao's constant (R), Wada's constant (W) and relative strength (R). Solute-solvent interaction is confirmed by ultrasonic velocity and viscosity values, which increases with increase in concentration indicates stronger association between solute and solvent molecules. With rise in ultrasonic frequency the interaction between the solute and solvent particles decreases. The linear variations in Rao's constant and Wada's constant suggest the absence of complex formation.

  14. Photodegradation of glyphosate in the ferrioxalate system

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yong [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China); Wu Feng [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China)], E-mail: fengwu@whu.edu.cn; Lin Yixin; Deng Nansheng [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China); Bazhin, Nikolai; Glebov, Evgeni [Institute of Chemical Kinetics and Combustion, 3 Institutskaya St., Novosibirsk 630090 (Russian Federation)

    2007-09-05

    The photoinduced degradation of glyphosate (GLP) in the ferrioxalate system was investigated under irradiation with a 250 W metal halide lamp ({lambda} {>=} 365 nm). The efficiency of orthophosphates release, representing the photodegradation efficiency of GLP, increased with decreasing the initial concentrations of GLP and Fe(III)/oxalate ratios. At acidic pH value in the range of 3.5-5.0, higher efficiency of orthophosphates release up to 60.6% was achieved, while the efficiency dropped to 42.1% at pH 6.0. The photochemical process mainly involved the predominant species of iron(III), namely Fe(C{sub 2}O{sub 4}){sub 2}{sup -} and Fe(C{sub 2}O{sub 4}){sub 3}{sup 3-}, which lead to the formation of hydroxyl radicals in the presence of dissolved oxygen under UV-vis irradiation. Also, the complexation of GLP with Fe(III) obviously increased the light absorption of GLP and facilitated its degradation by direct photolysis. The ninhydrin test for primary amines showed that the GLP was attacked by hydroxyl radicals with C-N cleavage to yield aminomethylphosphonic acid (AMPA) and C-P cleavage to yield sarcosine. The photodegradation may be enhanced by the decomposition of reactive radicals produced through ligand-to-metal charge transfer (LMCT) of ferric-GLP complexes.

  15. Flora and Fauna in Roundup Tolerant Fodder Beet Fields

    DEFF Research Database (Denmark)

    Elmegaard, N.; Pedersen, Marianne Bruus

    English and Danish summary. Foreword: For demonstration purposes Monsanto, DLF-Trifolium, and Danisco Seed, in collaboration with The Danish Agricultural Advisory Centre, established field plots with glyphosate tolerant fodder beets on a number of farms all over Denmark in 1999 and 2000. The Nati......English and Danish summary. Foreword: For demonstration purposes Monsanto, DLF-Trifolium, and Danisco Seed, in collaboration with The Danish Agricultural Advisory Centre, established field plots with glyphosate tolerant fodder beets on a number of farms all over Denmark in 1999 and 2000...... tilfælde øges ved at reducere doseringen, uden at det går ud over roeudbyttet. Sprøjtning med insekticid forringer imidlertid vilkårene for faunaen og kan derved ophæve de fordele, der kan være ved dyrkning af RR-roer. Udenlandske undersøgelser tyder dog på, at der er mindre behov...

  16. Facilitated transport of diuron and glyphosate in high copper vineyard soils.

    Science.gov (United States)

    Dousset, Sylvie; Jacobson, Astrid R; Dessogne, Jean-Baptiste; Guichard, Nathalie; Baveye, Philippe C; Andreux, Francis

    2007-12-01

    The fate of organic herbicides applied to agricultural fields may be affected by other soil amendments, such as copper applied as a fungicide. The effect of copper on the leaching of diuron and glyphosate through a granitic and a calcareous soil was studied in the laboratory using sieved-soil columns. Each soil was enriched with copper sulfate to obtain soil copper concentrations of 125, 250, 500, and 1000 mg kg(-1). Glyphosate leaching was influenced by soil pH and copper concentration, whereas diuron leaching was not. In the calcareous soil, glyphosate leaching decreased as copper levels increased from 17 mg kg(-1) (background) to 500 mg kg(-1). In the granitic soil, glyphosate leaching increased as copper levels increased from 34 mg kg(-1) (background) to 500 mg kg(-1). The shapes of the copper elution curves in presence of glyphosate were similar to shapes of the glyphosate curves, suggesting the formation of Cu-glyphosate complexes that leach through the soil. Soil copper concentration does not influence diuron leaching. In contrast, increasing copper concentrations reduces glyphosate leaching through calcareous soils, and conversely, increases glyphosate leaching through granitic soils. Our findings suggest that the risk of groundwater contamination by glyphosate increases in granitic soils with elevated copper concentrations.

  17. Sorption and desorption of glyphosate in Mollisols and Ultisols soils of Argentina.

    Science.gov (United States)

    Gómez Ortiz, Ana Maria; Okada, Elena; Bedmar, Francisco; Costa, José Luis

    2017-10-01

    In Argentina, glyphosate use has increased exponentially in recent years as a result of the widespread adoption of no-till management combined with genetically modified glyphosate-resistant crops. This massive use of glyphosate has created concern about its potential environmental impact. Sorption-desorption of glyphosate was studied in 3 Argentinean soils with contrasting characteristics. Glyphosate sorption isotherms were modeled using the Freundlich equation to estimate the sorption coefficient (K f ). Glyphosate sorption was high, and the K f varied from 115.6 to 1612 mg 1-1/n L 1/n /kg. Cerro Azul soil had the highest glyphosate sorption capacity as a result of a combination of factors such as higher clay content, cation exchange capacity, total iron, and aluminum oxides, and lower available phosphorus and pH. Desorption isotherms were also modeled using the Freundlich equation. In general, desorption was very low (glyphosate strongly sorbs to the soils and that it is almost an irreversible process. Anguil soil had a significantly higher desorption coefficient (K fd ) than the other soils, associated with its lower clay content and higher pH and phosphorus. Glyphosate high sorption and low desorption to the studied soils may prevent groundwater contamination. However, it may also affect its bioavailability, increasing its persistence and favoring its accumulation in the environment. The results of the present study contribute to the knowledge and characterization of glyphosate retention in different soils. Environ Toxicol Chem 2017;36:2587-2592. © 2017 SETAC. © 2017 SETAC.

  18. Interactions of glyphosate use with farm characteristics and cropping patterns in Central Europe.

    Science.gov (United States)

    Wiese, Armin; Schulte, Michael; Theuvsen, Ludwig; Steinmann, Horst-Henning

    2018-05-01

    Although glyphosate is the most widely used herbicide in the European Union, little is known about the patterns of its usage in arable farming. Therefore, a nationwide survey of 2026 German farmers was analysed to obtain further knowledge about glyphosate applications in conventional European arable farming. Given its broad range of agri-environmental and farm-type conditions, Germany can be regarded as a suitable study region to represent Central European farming. The growing season 2013/2014 was set as a reference. Farmers who participated in the survey employ diverse patterns of glyphosate use. While 23% stated that they did not use glyphosate in the season in question, others applied glyphosate to their total arable area. However, most applications occurred on specific parts of the farm. Application patterns of oilseed rape, winter wheat, maize and sugar beet were studied in detail, and U-shaped distributions of glyphosate use intensity were observed. The effects of farm type and management practices on glyphosate use patterns were mixed in the various crops. Motivation for glyphosate use differs widely within the farming community. Agricultural researchers, extension services and policy makers are recommended to mitigate vulnerabilities associated with glyphosate use, such as routine spraying and practices that increase selection pressure for the evolution of glyphosate-resistant weeds. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  20. PVP capped silver nanocubes assisted removal of glyphosate from water-A photoluminescence study.

    Science.gov (United States)

    Sarkar, Sumit; Das, Ratan

    2017-10-05

    Glyphosate [N-phosphono-methylglycine (PMG)] is the most used herbicide worldwide and it has been reported very recently that Glyphosate is very harmful and can produce lots of diseases such as alzheimer and parkinson's disease, depression, cancer, infertility including genotoxic effects. As it is mostly present in stable water body and ground water system, its detection and removal is very important. Here, we have shown a fluorescence technique for the removal of glyphosate from water using chemically synthesized polyvinylpyrrolidone (PVP) silver nanocrystals. Transmission Electron Microscopy (TEM) study shows the average size of silver nanocrystals of 100nm approximately with a morphology of cubic shape. Glyphosate does not show absorption in the visible region. But both glyphosate and silver nanocrystals show strong fluorescence in the visible region. So, photoluminescence study has been successfully utilized to detect the glyphosate in water samples and on treating the glyphosate contaminated water sample with silver nanocrystals, the sample shows no emission peak of glyphosate at 458nm. Thus, this approach is a promising and very rapid method for the detection and removal of glyphosate from water samples on treatment with silver nanocubes. NMR spectra further confirms that the silver nanocrystals treated contaminated water samples are glyphosate free. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Toxicity assessment of glyphosate on honey bee (Apis mellifera) spermatozoa

    Science.gov (United States)

    During 2016-2017, 33.2% of managed honey bee colonies in the U.S. were lost due to Colony Collapse Disorder (CCD). Commonly used pesticides are among the suspected reasons for bee mortality. N-(phosphonomethyl)glycine (glyphosate) is a widely used herbicide in the U.S. and has previously been shown ...

  2. Glyphosate resistant weeds - a threat to conservation agriculture

    Science.gov (United States)

    Glyphosate-resistant weeds are now present throughout the Southeast. Hundreds of thousands of conservation tillage cotton acres, some currently under USDA Natural Resources Conservation Service (NRCS) conservation program contracts, are at risk of being converted to higher-intensity tillage systems....

  3. Mycostimulation in a glyphosate treated arable soil: implications on ...

    African Journals Online (AJOL)

    Mycostimulation in a glyphosate treated arable soil: implications on the yield and agronomic characters of Talinum fruticosum (L.) Juss. ... If properly managed and stimulated, fungi can contribute significantly to improving soil health, thus improving food security in a sustainable manner. Keywords: Mycoaugmentation ...

  4. Effects of glyphosate acid and the glyphosate-commercial formulation (Roundup) on Dimorphandra wilsonii seed germination: Interference of seed respiratory metabolism.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; da Silva Cruz, Fernanda Vieira; Bicalho, Elisa Monteze; Borges, Felipe Viègas; Fonseca, Marcia Bacelar; Juneau, Philippe; Garcia, Queila Souza

    2017-01-01

    Glyphosate-formulations are widely used in the Brazilian Cerrado (neotropical savanna) with little or no control, threatening population of the endangered species Dimorphandra wilsonii. We investigated the toxicity of different concentrations (0, 5, 25 and 50 mg l -1 ) of glyphosate acid and one of its formulations (Roundup ® ) on seed germination in D. wilsonii. Glyphosate acid and Roundup drastically decreased seed germination by decreasing seed respiration rates. The activation of antioxidant enzymes, ascorbate peroxidase and catalase assure no hydrogen peroxide accumulation in exposed seeds. Glyphosate acid and the Roundup-formulation negatively affected the activities of enzymes associated with the mitochondrial electron transport chain (ETC), with Complex III as its precise target. The toxicity of Roundup-formulation was greater than that of glyphosate acid due to its greater effects on respiration. The herbicide glyphosate must impair D. wilsonii seed germination by disrupting the mitochondrial ETC, resulting in decreased energy (ATP) production. Our results therefore indicate the importance of avoiding (or closely regulating) the use of glyphosate-based herbicides in natural Cerrado habitats of D. wilsonni as they are toxic to seed germination and therefore threaten conservation efforts. It will likewise be important to investigate the effects of glyphosate on the seeds of other species and to investigate the impacts of these pesticides elsewhere in the world. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Civility in scientific publishing: The glyphosate paper.

    Science.gov (United States)

    Blaylock, Russell Lane

    2015-01-01

    In recent years, we have witnessed a decline in civility in the public arena when various socially sensitive issues are being presented. Those of us engaged in the publishing of scientific papers and in our comments on these papers, need to be cognizant of the social graces, courteous demeanor, and chivalry. Debates are essential to our learning and in being able to ferret out the essentials of various scientific issues that are of value. Because of the amount of time and effort connected with analyzing the complex problems and the years invested in such endeavors, we often resort to the behavior, that is, contentious and at times even quite insulting to our opponents during our defense. This is the part of human nature but as civilized human beings, we must strive to maintain the courtesy and a calm demeanor during such discussions and debates. I have yielded to such temptations myself but am striving to repent of my sins. The medical and scientific history should have taught us that in defending our ideas we learn and sometimes come to the realization that our paradigm or hypothesis is wrong, either in part or whole. Such debates allow us to fine tune our ideas and correct our errors in thinking, which are easily, consciously, or subconsciously sublimated by our enthusiasm. The glyphosate papers presented ideas that, while well supported by the scientific studies and logical conclusions, also contained some possible errors in its suppositions. Dr. Miguel Faria challenged some of these concepts and was met with some degree of derision by one of the authors. This editorial comment is in response to these issues.

  6. Glyphosate, other herbicides, and transformation products in Midwestern streams, 2002

    Science.gov (United States)

    Battaglin, W.A.; Kolpin, D.W.; Scribner, E.A.; Kuivila, K.M.; Sandstrom, M.W.

    2005-01-01

    The use of glyphosate has increased rapidly, and there is limited understanding of its environmental fate. The objective of this study was to document the occurrence of glyphosate and the transformation product aminomethylphosphonic acid (AMPA) in Midwestern streams and to compare their occurrence with that of more commonly measured herbicides such as acetochlor, atrazine, and metolachlor. Water samples were collected at sites on 51 streams in nine Midwestern states in 2002 during three runoff events: after the application of pre-emergence herbicides, after the application of post-emergence herbicides, and during harvest season. All samples were analyzed for glyphosate and 20 other herbicides using gas chromatography/mass spectrometry or high performance liquid chromatography/mass spectrometry. The frequency of glyphosate and AMPA detection, range of concentrations in runoff samples, and ratios of AMPA to glyphosate concentrations did not vary throughout the growing season as substantially as for other herbicides like atrazine, probably because of different seasonal use patterns. Glyphosate was detected at or above 0.1 μg/1 in 35 percent of pre-emergence, 40 percent of post-emergence, and 31 percent of harvest season samples, with a maximum concentration of 8.7 μg/1. AMPA was detected at or above 0.1 μg/1 in 53 percent of pre-emergence, 83 percent of post-emergence, and 73 percent of harvest season samples, with a maximum concentration of 3.6 μg/1. Glyphosate was not detected at a concentration at or above the U.S. Environmental Protection Agency's maximum contamination level (MCL) of 700 μg/1 in any sample. Atrazine was detected at or above 0.1 μg/1 in 94 percent of pre-emergence, 96 percent of post-emergence, and 57 percent of harvest season samples, with a maximum concentration of 55 μg/1. Atrazine was detected at or above its MCL (3 μg/1) in 57 percent of pre-emergence and 33 percent of post-emergence samples

  7. Glyphosate in the general population and in applicators: a critical review of studies on exposures.

    Science.gov (United States)

    Solomon, Keith R

    2016-09-01

    The recent classification of glyphosate as a probable human carcinogen by the International Agency for Research on Cancer (IARC) was arrived at without a detailed assessment of exposure. Glyphosate is widely used as an herbicide, which might result in exposures of the general public and applicators. Exposures were estimated from information in the open literature and unpublished reports provided by Monsanto Company. Based on the maximum measured concentration in air, an exposure dose of 1.04 × 10  -   6  mg/kg body mass (b.m.)/d was estimated. Assuming consumption of surface water without treatment, the 90th centile measured concentration would result in a consumed dose of 2.25 × 10  -   5  mg/kg b.m./d. Estimates by the Food and Agriculture Organization of the United Nations (FAO) of consumed doses in food provided a median exposure of 0.005 mg/kg b.m./d (range 0.002-0.013). Based on tolerance levels, the conservative estimate by the US Environmental Protection Agency (US EPA) for exposure of the general population via food and water was 0.088 mg/kg b.m./d (range 0.058-0.23). For applicators, 90th centiles for systemic exposures based on biomonitoring and dosimetry (normalized for penetration through the skin) were 0.0014 and 0.021 mg/kg b.m./d, respectively. All of these exposures are less than the reference dose and the acceptable daily intakes proposed by several regulatory agencies, thus supporting a conclusion that even for these highly exposed populations the exposures were within regulatory limits.

  8. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    Directory of Open Access Journals (Sweden)

    Prata Fábio

    2003-01-01

    Full Text Available The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with KH2PO4 at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha-1 of P2O5, which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L-1, with a 14C radioactivity of 0.233 kBq mL-1. Four steps of the desorption procedure with CaCl2 0.01 mol L-1 and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L-1. Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm-3. Moreover, a small amount of applied glyphosate was extracted (<10%, and the extraction increased with increasing soil phosphorus content.

  9. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    International Nuclear Information System (INIS)

    Prata, Fabio; Cardinali, Vanessa Camponez do Brasil; Tornisielo, Valdemar Luiz; Regitano, Jussara Borges; Lavorenti, Arquimedes

    2003-01-01

    The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with Kh 2 PO 4 at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha -1 of P 2 O 5 , which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L -1 ), with a 14 C radioactivity of 0.233 kBq mL -1 . Four steps of the desorption procedures withCaCl 2 0.01 mol L -1 and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L -1 ). Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm -3 . Moreover, a small amount of applied glyphosate was extracted (<10%), and the extraction increased with increasing soil phosphorus content. (author)

  10. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    Energy Technology Data Exchange (ETDEWEB)

    Prata, Fabio [BIOAGRI Labs., Piracicaba, SP (Brazil). Div. de Quimica. Lab. de Radioquimica; Cardinali, Vanessa Camponez do Brasil; Tornisielo, Valdemar Luiz; Regitano, Jussara Borges [Sao Paulo Univ., Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz. Dept. de Ciencias Exatas; Lavorenti, Arquimedes [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil). Secao de Toxicologia

    2003-03-01

    The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with Kh{sub 2}PO{sub 4} at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha{sup -1} of P{sub 2}O{sub 5}, which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L{sup -1}), with a {sup 14}C radioactivity of 0.233 kBq mL{sup -1}. Four steps of the desorption procedures withCaCl{sub 2} 0.01 mol L{sup -1} and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L{sup -1}). Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm{sup -3}. Moreover, a small amount of applied glyphosate was extracted (<10%), and the extraction increased with increasing soil phosphorus content. (author)

  11. Germination test as a fast method to detect glyphosate-resistant sourgrass

    Directory of Open Access Journals (Sweden)

    Marcos Altomani Neves Dias

    2015-01-01

    Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

  12. Germination test as a fast method to detect glyphosate-resistant sourgrass

    Directory of Open Access Journals (Sweden)

    Marcos Altomani Neves Dias

    2015-09-01

    Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

  13. Remediation of PAH-contaminated soil by the combination of tall fescue, arbuscular mycorrhizal fungus and epigeic earthworms.

    Science.gov (United States)

    Lu, Yan-Fei; Lu, Mang

    2015-03-21

    A 120-day experiment was performed to investigate the effect of a multi-component bioremediation system consisting of tall fescue (Festuca arundinacea), arbuscular mycorrhizal fungus (AMF) (Glomus caledoniun L.), and epigeic earthworms (Eisenia foetida) for cleaning up polycyclic aromatic hydrocarbons (PAHs)-contaminated soil. Inoculation with AMF and/or earthworms increased plant yield and PAH accumulation in plants. However, PAH uptake by tall fescue accounted for a negligible portion of soil PAH removal. Mycorrhizal tall fescue significantly enhanced PAH dissipation, PAH degrader density and polyphenol oxidase activity in soil. The highest PAH dissipation (93.4%) was observed in the combination treatment: i.e., AMF+earthworms+tall fescue, in which the soil PAH concentration decreased from an initial value of 620 to 41 mg kg(-1) in 120 days. This concentration is below the threshold level required for Chinese soil PAH quality (45 mg kg(-1) dry weight) for residential use. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Insight into the genetic variability analysis and cultivar identification of tall fescue by using SSR markers.

    Science.gov (United States)

    Fu, Kaixin; Guo, Zhihui; Zhang, Xinquan; Fan, Yan; Wu, Wendan; Li, Daxu; Peng, Yan; Huang, Linkai; Sun, Ming; Bai, Shiqie; Ma, Xiao

    2016-01-01

    Genetic diversity of 19 forage-type and 2 turf-type cultivars of tall fescue ( Festuca arundinacea Schreb.) was revealed using SSR markers in an attempt to explore the genetic relationships among them, and examine potential use of SSR markers to identify cultivars by bulked samples. A total of 227 clear band was scored with 14 SSR primers and out of which 201 (88.6 %) were found polymorphic. The percentage of polymorphic bands (PPB) per primer pair varied from 62.5 to 100 % with an average of 86.9 %. The polymorphism information content (PIC) value ranged from 0.116 to 0.347 with an average of 0.257 and the highest PIC value (0.347) was noticed for primer NFA040 followed by NFA113 (0.346) whereas the highest discriminating power (D) of 1 was shown in NFA037 and LMgSSR02-01C. A Neighbor-joining dendrogram and the principal component analysis identified six major clusters and grouped the cultivars in agreement with their breeding histories. STRUCTURE analysis divided these cultivars into 3 sub-clades which correspond to distance based groupings. These findings indicates that SSR markers by bulking strategy are a useful tool to measure genetic diversity among tall fescue cultivars and could be used to supplement morphological data for plant variety protection.

  15. Phytotoxicity of glyphosate in the germination of Pisum sativum and its effect on germinated seedlings

    OpenAIRE

    Mondal, Subinoy; Kumar, Mousumi; Haque, Smaranya; Kundu, Debajyoti

    2017-01-01

    The present study evaluated the effects of glyphosate on Pisum sativum germination as well as its effect on the physiology and biochemistry of germinated seedlings. Different physico-chemical biomarkers, viz., chlorophyll, root and shoot length, total protein and soluble sugar, along with sodium and potassium concentration, were investigated in germinated seedlings at different glyphosate concentrations. This study reports the influence of different concentrations of glyphosate on pea seeds a...

  16. Effects of Formulated Glyphosate and Adjuvant Tank Mixes on Atomization from Aerial Application Flat Fan Nozzles

    Science.gov (United States)

    2012-01-01

    Bradley K. Fritz,1 W. Clint Hoffmann,1 and W. E. Bagley2 Effects of Formulated Glyphosate and Adjuvant Tank Mixes on Atomization from Aerial...Application Flat Fan Nozzles REFERENCE: Fritz, Bradley K., Hoffmann, W. Clint, and Bagley, W. E., “Effects of Formulated Glyphosate and Adjuvant Tank Mixes on...factors. Twelve spray-solution treatments were evaluated, ten of which contained a formulated glyphosate product and nine of these con- tained an

  17. Degradation of the Herbicide Glyphosate by Members of the Family Rhizobiaceae

    OpenAIRE

    Liu, C.-M.; McLean, P. A.; Sookdeo, C. C.; Cannon, F. C.

    1991-01-01

    Several strains of the family Rhizobiaceae were tested for their ability to degrade the phosphonate herbicide glyphosate (isopropylamine salt of N-phosphonomethylglycine). All organisms tested (seven Rhizobium meliloti strains, Rhizobium leguminosarum, Rhizobium galega, Rhizobium trifolii, Agrobacterium rhizogenes, and Agrobacterium tumefaciens) were able to grow on glyphosate as the sole source of phosphorus in the presence of the aromatic amino acids, although growth on glyphosate was not a...

  18. Glyphosate Shapes a Dinoflagellate-Associated Bacterial Community While Supporting Algal Growth as Sole Phosphorus Source

    Directory of Open Access Journals (Sweden)

    Cong Wang

    2017-12-01

    Full Text Available Glyphosate is a widely used herbicide that can potentially be a phosphorus (P source for phytoplankton and microbes when discharged into the coastal ocean. In contrast to bacteria, few eukaryotic phytoplankton species appear capable of directly utilizing glyphosate. In this study, we observed, after a long delay (>60 days, Prorocentrum donghaiense, a dinoflagellate known to cause major harmful algal blooms in the East China Sea, could grow in a medium with glyphosate as the sole P source; suggesting that P. donghaiense growth was through bacterial mediation. To understand how the bacteria community might respond to glyphosate, we analyzed the 16S rRNA genes of the microbial community present in P. donghaiense cultures when grown under lower (36 μM and higher (360 μM glyphosate concentrations. Based on both Sanger and Illumina high throughput sequencing, we obtained more than 55,323 good-quality sequences, which were classified into six phyla. As the concentration of glyphosate rose, our results showed a significant increase in the phyla Proteobacteria and Firmicutes and a decrease in the phylum Bacteroidetes. Further qPCR (Quantitative PCR analysis showed higher abundances of two specific phylotypes in the higher-glyphosate P. donghaiense cultures when compared to the lower-glyphosate and no-glyphosate cultures. Correspondingly, qPCR displayed the same trend for the abundance of a gammaproteobacterial type of phnJ, a gene encoding Alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase, which is responsible for phosphonate degradation. In addition, Tax4Fun analysis based on our 16S rRNA gene sequences results in higher predicted abundances of phosphonate metabolizing genes in glyphosate-treated cultures. This study demonstrates that glyphosate could selectively promote the growth of particular groups of bacteria within an algal culture and in glyphosate enriched coastal waters, this interaction may potentially further facilitate the growth of

  19. Cancer Incidence among Glyphosate-Exposed Pesticide Applicators in the Agricultural Health Study

    OpenAIRE

    De Roos, Anneclaire J.; Blair, Aaron; Rusiecki, Jennifer A.; Hoppin, Jane A.; Svec, Megan; Dosemeci, Mustafa; Sandler, Dale P.; Alavanja, Michael C.

    2004-01-01

    Glyphosate is a broad-spectrum herbicide that is one of the most frequently applied pesticides in the world. Although there has been little consistent evidence of genotoxicity or carcinogenicity from in vitro and animal studies, a few epidemiologic reports have indicated potential health effects of glyphosate. We evaluated associations between glyphosate exposure and cancer incidence in the Agricultural Health Study (AHS), a prospective cohort study of 57,311 licensed pesticide applicators in...

  20. EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia.

    Science.gov (United States)

    Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

    2018-05-01

    Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  1. Glyphosate Utilization as the Source of Carbon: Isolation and Identification of new Bacteria

    Directory of Open Access Journals (Sweden)

    M. Mohsen Nourouzi

    2011-01-01

    Full Text Available Mixed bacteria from oil palm plantation soil (OPS were isolated to investigate their ability to utilize glyphosate as carbon source. Results showed that approximately all of the glyphosate was converted to aminomethyl-phosphonic acid (AMPA (99.5%. It is worthy to note that mixed bacteria were able to degrade only 2% of AMPA to further metabolites. Two bacterial strains i.e. Stenotrophomonas maltophilia and Providencia alcalifaciens were obtained from enrichment culture. Bacterial isolates were cultured individually on glyphosate as a sole carbon source. It was observed that both isolates were able to convert glyphosate to AMPA.

  2. Differential effects of glyphosate and aminomethylphosphonic acid (AMPA) on photosynthesis and chlorophyll metabolism in willow plants.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Le Manac'h, Sarah Gingras; Maccario, Sophie; Labrecque, Michel; Lucotte, Marc; Juneau, Philippe

    2016-06-01

    We used a willow species (Salix miyabeana cultivar SX64) to examine the differential secondary-effects of glyphosate and aminomethylphosphonic acid (AMPA), the principal glyphosate by-product, on chlorophyll metabolism and photosynthesis. Willow plants were treated with different concentrations of glyphosate (equivalent to 0, 1.4, 2.1 and 2.8kgha(-1)) and AMPA (equivalent to 0, 0.28, 1.4 and 2.8kgha(-1)) and evaluations of pigment contents, chlorophyll fluorescence, and oxidative stress markers (hydrogen peroxide content and antioxidant enzyme activities) in leaves were performed after 12h of exposure. We observed that AMPA and glyphosate trigger different mechanisms leading to decreases in chlorophyll content and photosynthesis rates in willow plants. Both chemicals induced ROS accumulation in willow leaves although only glyphosate-induced oxidative damage through lipid peroxidation. By disturbing chlorophyll biosynthesis, AMPA induced decreases in chlorophyll contents, with consequent effects on photosynthesis. With glyphosate, ROS increases were higher than the ROS-sensitive threshold, provoking chlorophyll degradation (as seen by pheophytin accumulation) and invariable decreases in photosynthesis. Peroxide accumulation in both AMPA and glyphosate-treated plants was due to the inhibition of antioxidant enzyme activities. The different effects of glyphosate on chlorophyll contents and photosynthesis as described in the literature may be due to various glyphosate:AMPA ratios in those plants. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents

    OpenAIRE

    Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J. Christopher; Ugarte, Ricardo; Antoniou, Michael N.

    2017-01-01

    The safety, including endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBl...

  4. Glyphosate contaminated soil remediation by atmospheric pressure dielectric barrier discharge plasma and its residual toxicity evaluation.

    Science.gov (United States)

    Wang, Tiecheng; Ren, Jingyu; Qu, Guangzhou; Liang, Dongli; Hu, Shibin

    2016-12-15

    Glyphosate was one of the most widely used herbicides in the world. Remediation of glyphosate-contaminated soil was conducted using atmospheric pressure dielectric barrier discharge (DBD) plasma. The feasibility of glyphosate degradation in soil was explored, and the soil leachate toxicity after remediation was assessed via a seed germination test. The experimental results showed that approximately 93.9% of glyphosate was degraded within 45min of DBD plasma treatment with an energy yield of 0.47gkWh -1 , and the degradation process fitted the first-order kinetic model. Increasing the discharge voltage and decreasing the organic matter content of the soil were both found to facilitate glyphosate degradation. There existed appropriate soil moisture to realize high glyphosate degradation efficiency. Glyphosate mineralization was confirmed by changes of total organic carbon (TOC), chemical oxygen demand (COD), PO 4 3- and NO 3 - . The degradation intermediates including glycine, aminomethylphosphonic acid, acetic acid, formic acid, PO 4 3- and NO 3 - , CO 2 and CO were observed. A possible pathway for glyphosate degradation in the soil using this system was proposed. Based on the soil leachate toxicity test using wheat seed germination, the soil did not exhibit any hazardous effects following high-efficiency glyphosate degradation. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Kommentarer til opdateret risikovurdering og ansøgning. Gossypium hirsutum (281-24-236/3006-210-23), Insect resistance by Bt-toxin (lepidoptera) X Insect resistance by Bt-toxin (coleoptera); herbicide tolerance to glyphosate. Modtaget 03-04-2006, deadline 02-05-2006, svar 07-04-2006

    DEFF Research Database (Denmark)

    Kjellsson, Gøsta; Strandberg, Morten Tune; Christensen, Christian Dam

    2006-01-01

    tolerante over for insektangreb fra larver af forskellige sommerfuglearter. Desuden indeholder bomulden et gen, der gør den tolerant overfor glufosinat-ammonium herbicider. Bomulden søges kun godkendt til import af frø samt forarbejdning og anvendelse til dyrefoder og fødevarer, men ikke til dyrkning eller...

  6. Linkage Maps of a Mediterranean × Continental Tall Fescue Population and their Comparative Analysis with Other Poaceae Species

    Directory of Open Access Journals (Sweden)

    Ryan Dierking

    2015-03-01

    Full Text Available Temperate grasses belonging to the complex are important throughout the world in pasture and grassland agriculture. Tall fescue ( Schreb. is the predominant species in the United States, covering approximately 15 million ha. Tall fescue has distinctive morphotypes, two of which are Continental (summer active and Mediterranean (summer semidormant. This is the first report of a linkage map created for Mediterranean tall fescue, while updating the Continental map with additional simple sequence repeat and sequence-tagged site markers. Additionally, this is the first time that diversity arrays technology (DArT markers were used in the construction of a tall fescue map. The male parent (Continental, R43-64, map consisted of 594 markers arranged in 22 linkage groups (LGs and covered a total of 1577 cM. The female parent (Mediterranean, 103-2, map was shorter (1258 cM and consisted of only 208 markers arranged in 29 LGs. Marker densities for R43-64 and 103-2 were 2.65 and 6.08 cM per marker, respectively. When compared with the other Poaceae species, meadow fescue ( Huds., annual ryegrass ( Lam., perennial ryegrass ( L., (L. Beauv., and barley ( L., a total of 171 and 98 orthologous or homologous sequences, identified by DArT analysis, were identified in R43-64 and 103-2, respectively. By using genomic in situ hybridization, we aimed to identify potential progenitors of both morphotypes. However, no clear conclusion on genomic constitution was reached. These maps will aid in the search for quantitative trait loci of various traits as well as help define and distinguish genetic differences between the two morphotypes.

  7. Resource Limitations Influence Growth and Vigor of Idaho Fescue, a Common Understory Species in Pacific Northwest Ponderosa Pine Forests

    Directory of Open Access Journals (Sweden)

    Craig A. Carr

    2016-12-01

    Full Text Available Alterations in under-canopy resource availability associated with elevated ponderosa pine (Pinus ponderosa Dougl. abundance can negatively influence understory vegetation. Experimental evidence linking under-canopy resource availability and understory vegetation is scarce. Yet this information would be beneficial in developing management strategies to recover desired understory species. We tested the effects of varying nitrogen (N and light availability on Idaho fescue (Festuca idahoensis Elmer, the dominant understory species in ponderosa pine/Idaho fescue plant associations in eastern Oregon. In a greenhouse experiment, two levels of N (50 kg∙N∙ha−1 and 0 kg∙N∙ha−1 and shade (80% shade and 0% shade were applied in a split-plot design to individual potted plants grown in soil collected from high abundance pine stands. Plants grown in unshaded conditions produced greater root (p = 0.0027 and shoot (p = 0.0017 biomass and higher cover values (p = 0.0378 compared to those in the shaded treatments. The addition of N had little effect on plant growth (p = 0.1602, 0.5129, and 0.0853 for shoot biomass, root biomass, and cover, respectively, suggesting that soils in high-density ponderosa pine stands that lack understory vegetation were not N deficient and Idaho fescue plants grown in these soils were not N limited. Management activities that increase under-canopy light availability will promote the conditions necessary for Idaho fescue recovery. However, successful restoration may be constrained by a lack of residual fescue or the invasion of more competitive understory vegetation.

  8. Simulating changes in cropping practices in conventional and glyphosate-resistant maize. II. Weed impacts on crop production and biodiversity.

    Science.gov (United States)

    Colbach, Nathalie; Darmency, Henri; Fernier, Alice; Granger, Sylvie; Le Corre, Valérie; Messéan, Antoine

    2017-05-01

    Overreliance on the same herbicide mode of action leads to the spread of resistant weeds, which cancels the advantages of herbicide-tolerant (HT) crops. Here, the objective was to quantify, with simulations, the impact of glyphosate-resistant (GR) weeds on crop production and weed-related wild biodiversity in HT maize-based cropping systems differing in terms of management practices. We (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, with the weed dynamics model FLORSYS; (2) quantified how much the presence of GR weeds contributed to weed impacts on crop production and biodiversity; (3) determined the effect of cultural practices on the impact of GR weeds and (4) identified which species traits most influence weed-impact indicators. The simulation study showed that during the analysed 28 years, the advent of glyphosate resistance had little effect on plant biodiversity. Glyphosate-susceptible populations and species were replaced by GR ones. Including GR weeds only affected functional biodiversity (food offer for birds, bees and carabids) and weed harmfulness when weed effect was initially low; when weed effect was initially high, including GR weeds had little effect. The GR effect also depended on cultural practices, e.g. GR weeds were most detrimental for species equitability when maize was sown late. Species traits most harmful for crop production and most beneficial for biodiversity were identified, using RLQ analyses. None of the species presenting these traits belonged to a family for which glyphosate resistance was reported. An advice table was built; the effects of cultural practices on crop production and biodiversity were synthesized, explained, quantified and ranked, and the optimal choices for each management technique were identified.

  9. Glyphosate toxicity and carcinogenicity: a review of the scientific basis of the European Union assessment and its differences with IARC

    OpenAIRE

    Tarazona, Jose V.; Court-Marques, Daniele; Tiramani, Manuela; Reich, Hermine; Pfeil, Rudolf; Istace, Frederique; Crivellente, Federica

    2017-01-01

    Glyphosate is the most widely used herbicide worldwide. It is a broad spectrum herbicide and its agricultural uses increased considerably after the development of glyphosate-resistant genetically modified (GM) varieties. Since glyphosate was introduced in 1974, all regulatory assessments have established that glyphosate has low hazard potential to mammals, however, the International Agency for Research on Cancer (IARC) concluded in March 2015 that it is probably carcinogenic. The IARC conclus...

  10. Genotype x environment interactions in Angus, Brahman, and reciprocal cross cows and their calves grazing common bermudagrass and endophyte-infected tall fescue pastures.

    Science.gov (United States)

    Brown, M A; Brown, A H; Jackson, W G; Miesner, J R

    1997-04-01

    Reproductive and preweaning data on 233 Angus (A), Brahman (B), and reciprocal-cross cows (AB, BA) and 455 two- and three-breed cross calves managed on common bermudagrass or endophyte-infected tall fescue were used to evaluate the interaction of forage type with individual and maternal heterosis and maternal and grandmaternal breed effects. Cows were born from 1988 to 1991 and calves from 15 Polled Hereford sires were born from 1991 to 1994. Heterosis for calving rate was similar and important on both forages (P < .01), but maternal effects were small on each forage. Maternal heterosis for birth weight differed between common bermudagrass and tall fescue (P < .10) and grandmaternal effects were evident on bermudagrass (P < .05) but not tall fescue. Forage effects were generally substantial for 205-d weight, weaning hip height, and weaning weight:height ratio (P < .01), and maternal heterosis for these traits was larger on tall fescue than on common bermudagrass (P < .01). Grandmaternal effects were in favor of Angus for 205-d weight, hip height, and weight:height ratio on common bermudagrass (P < .05) but not on tall fescue. Heterosis for 205-d weight per cow exposed was substantial on both forages (P < .01) and was numerically larger on tall fescue than on bermudagrass, but maternal effects were not significant. These results suggest more advantage for Brahman-cross cows over purebreds on endophyte-infected tall fescue than a similar comparison on common bermudagrass. They also suggest an advantage for Angus in grandmaternal effects on bermudagrass but not tall fescue.

  11. Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean; Efeito de formulacoes na absorcao e translocacao do glyphosate em soja transgenica

    Energy Technology Data Exchange (ETDEWEB)

    Santos, J.B. [UNIVALE, Governador Valadares, MG (Brazil). FAAG. Agronomia]. E-mail: jbarbosa@univale.br; Ferreira, E.A.; Silva, A.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Fitotecnia]. E-mail: evanderalves@yahoo.com.br; aasilva@ufv.br; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral]. E-mail: jalves@ufv.br; Fialho, C.M.T. [Universidade Federal de Vicosa (UFV), MG (Brazil). Agronomia]. E-mail: cintiamtfialho@yahoo.com.br

    2007-07-01

    This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

  12. Yield of glyphosate-resistant sugar beets and efficiency of weed management systems with glyphosate and conventional herbicides under German and Polish crop production.

    Science.gov (United States)

    Nichterlein, Henrike; Matzk, Anja; Kordas, Leszek; Kraus, Josef; Stibbe, Carsten

    2013-08-01

    In sugar beet production, weed control is one of the most important and most expensive practices to ensure yield. Since glyphosate-resistant sugar beets are not yet approved for cultivation in the EU, little commercial experience exists with these sugar beets in Europe. Experimental field trials were conducted at five environments (Germany, Poland, 2010, 2011) to compare the effects of glyphosate with the effects of conventional weed control programs on the development of weeds, weed control efficiency and yield. The results show that the glyphosate weed control programs compared to the conventional methods decreased not only the number of herbicide applications but equally in magnitude decreased the dosage of active ingredients. The results also showed effective weed control with glyphosate when the weed covering was greater and sugar beets had a later growth stage of four true leaves. Glyphosate-resistant sugar beets applied with the glyphosate herbicide two or three times had an increase in white sugar yield from 4 to 18 % in comparison to the high dosage conventional herbicide systems. In summary, under glyphosate management sugar beets can positively contribute to the increasingly demanding requirements regarding efficient sugar beet cultivation and to the demands by society and politics to reduce the use of chemical plant protection products in the environment.

  13. Consequences of phosphate application on glyphosate uptake by roots: Impacts for environmental management practices.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Maccario, Sophie; Lucotte, Marc; Labrecque, Michel; Juneau, Philippe

    2015-12-15

    Phosphate (PO4(3-)) fertilization is a common practice in agricultural fields also targets for glyphosate application. Due to their chemical similarities, PO4(3-) and glyphosate compete for soil adsorbing sites, with PO4(3-) fertilization increasing glyphosate bioavailability in the soil solution. After PO4(3-) fertilization, its concentration will be elevated in the soil solution and both PO4(3-) and glyphosate will be readily available for runoff into aquatic ecosystems. In this context, man-made riparian buffer strips (RBS) at the interface of agricultural lands and waterways can be used as a green technology to mitigate water contamination. The plants used in RBS form a barrier to agricultural wastes that can limit runoff, and the ability of these plants to take up these compounds through their roots plays an important role in RBS efficacy. However, the implications of PO4(3-) for glyphosate uptake by roots are not yet clearly demonstrated. Here, we addressed this problem by hydroponically cultivating willow plants in nutrient solutions amended with glyphosate and different concentrations of PO4(3-), assuring full availability of both chemicals to the roots. Using a phosphate carrier inhibitor (phosphonophormic acid-PFA), we found that part of the glyphosate uptake is mediated by PO4(3-) transporters. We observed, however, that PO4(3-) increased glyphosate uptake by roots, an effect that was related to increased root cell membrane stability. Our results indicate that PO4(3-) has an important role in glyphosate physiological effects. Under agricultural conditions, PO4(3-) fertilization can amplify glyphosate efficiency by increasing its uptake by the roots of undesired plants. On the other hand, since simultaneous phosphate and glyphosate runoffs are common, non-target species found near agricultural fields can be affected. Copyright © 2015. Published by Elsevier B.V.

  14. Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance

    Science.gov (United States)

    Samsel, Anthony

    2013-01-01

    Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup®, is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of “ripening” sugar cane with glyphosate may explain the recent

  15. Circular RNA expression profiles in hippocampus from mice with perinatal glyphosate exposure.

    Science.gov (United States)

    Yu, Ning; Tong, Yun; Zhang, Danni; Zhao, Shanshan; Fan, Xinli; Wu, Lihui; Ji, Hua

    2018-05-19

    Glyphosate is the active ingredient in numerous herbicide formulations. The roles of glyphosate in embryo-toxicity and neurotoxicity have been reported in human and animal models. Recently, several studies have reported evidence linking neurodevelopmental disorders (NDDs) with gestational glyphosate exposure. However, the role of glyphosate in neuronal development is still not fully understood. Our previous study found that perinatal glyphosate exposure resulted in differential microRNA expression in the prefrontal cortex of mouse offspring. However, the mechanism of glyphosate-induced neurotoxicity in the developing brain is still not fully understood. Considering the pivotal role of Circular RNAs (circRNAs) in the regulation of gene expression, a circRNA microarray method was used in this study to investigate circRNA expression changes in the hippocampus of mice with perinatal glyphosate exposure. The circRNA microarrays revealed that 663 circRNAs were significantly altered in the perinatal glyphosate exposure group compared with the control group. Among them, 330 were significantly upregulated, and the other 333 were downregulated. Furthermore, the relative expression levels of mmu-circRNA-014015, mmu-circRNA-28128 and mmu-circRNA-29837 were verified using quantitative real-time polymerase chain reaction (qRT-PCR). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses demonstrated that stress-associated steroid metabolism pathways, such as aldosterone synthesis and secretion pathways, may be involved in the neurotoxicity of glyphosate. These results showed that circRNAs are aberrantly expressed in the hippocampus of mice with perinatal glyphosate exposure and play potential roles in glyphosate-induced neurotoxicity. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Research on the weed control degree and glyphosate soil biodegradation in apple plantations (Pioneer variety

    Directory of Open Access Journals (Sweden)

    Ersilia ALEXA

    2010-05-01

    Full Text Available In this study we follow control degree of glyphosate herbicide on weeds in apple plantations (Pioneer variety of the Research Station Timisoara. It was also followed glyphosate biodegradation capacity in the soil by determining the amount of CO2 released by the action of microorganisms on C14 glyphosate marked isotope. Laboratory analysis of glyphosate residues in soil was made using a Liquid Scintillation TRIATHLER. Glyphosate biodegradation ability in the presence of soil microorganisms is high, so glyphosate residues remaining in soil, in terms of its use in weed combating, are minimal. Study of glyphosate biodegradation capacity in the experimental field indicates that the CO2 fraction accumulated after 50 days is 28.02% for samples exposed in the experimental field. Weather conditions, especially temperature variations between day and night, influences the activity of soilmicroorganisms and affect biodegraded glyphosate percentage.Chemical method of weed control consisted in: herbicide used was Roundup 3 l/ha (glyphosate isopropyl amine salt 360 g/l and are based on chemical application on weeds, on the rows of trees, on their uptake and translocation in their organs having as principal scope the total destruction of weeds. The experimental results obtained reveal a weed combat degree of 82.98% , in the case of chemical variant, compared with control variant. The species combated mainly due to glyphosate herbicide, which is no longer found in the final mapping are: Capsella bursa-pastoris, Chenopodium album, Echinochloa crus-galli, Plantago major, Polygonum aviculare. Total combated weeds /m2 with glyphosate is 126.67.

  17. Possible effects of glyphosate on Mucorales abundance in the rumen of dairy cows in Germany.

    Science.gov (United States)

    Schrödl, Wieland; Krüger, Susanne; Konstantinova-Müller, Theodora; Shehata, Awad A; Rulff, Ramon; Krüger, Monika

    2014-12-01

    Glyphosate (N-phosphonomethyl glycine) is registered as a herbicide for many food and non-food crops, as well as non-crop areas where total vegetation control is desired. Glyphosate influences the soil mycobiota; however, the possible effect of glyphosate residues in animal feed (soybean, corn, etc.) on animal mycobiota is almost unknown. Accordingly, the present study was initiated to investigate the mycological characteristics of dairy cows in relationship to glyphosate concentrations in urine. A total of 258 dairy cows on 14 dairy farms in Germany were examined. Glyphosate was detected in urine using ELISA. The fungal profile was analyzed in rumen fluid samples using conventional microbiological culture techniques and differentiated by MALDI-TOF mass spectrometry. LPS-binding protein (LBP) and antibodies (IgG1, IgG2, IgA, and IgM) against fungi were determined in blood using ELISA. Different populations of Lichtheimia corymbifera, Lichtheimia ramosa, Mucor, and Rhizopus were detected. L. corymbifera and L. ramosa were significantly more abundant in animals containing high glyphosate (>40 ng/ml) concentrations in urine. There were no significant changes in IgG1 and IgG2 antibodies toward isolated fungi that were related to glyphosate concentration in urine; however, IgA antibodies against L. corymbifera and L. ramosa were significantly lower in the higher glyphosate groups. Moreover, a negative correlation between IgM antibodies against L. corymbifera, L. ramosa, and Rhizopus relative to glyphosate concentration in urine was observed. LBP also was significantly decreased in animals with higher concentrations of glyphosate in their urine. In conclusion, glyphosate appears to modulate the fungal community. The reduction of IgM antibodies and LBP indicates an influence on the innate immune system of animals.

  18. Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance.

    Science.gov (United States)

    Samsel, Anthony; Seneff, Stephanie

    2013-12-01

    Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup(®), is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of "ripening" sugar cane with glyphosate may explain the recent

  19. Exogenous Calcium Enhances the Photosystem II Photochemistry Response in Salt Stressed Tall Fescue.

    Science.gov (United States)

    Wang, Guangyang; Bi, Aoyue; Amombo, Erick; Li, Huiying; Zhang, Liang; Cheng, Cheng; Hu, Tao; Fu, Jinmin

    2017-01-01

    Calcium enhances turfgrass response to salt stress. However, little is known about PSII photochemical changes when exogenous calcium was applied in salinity-stressed turfgrass. Here, we probe into the rearrangements of PSII electron transport and endogenous ion accumulation in tall fescue ( Festuca arundinacea Schreber) treated with exogenous calcium under salt stress. Three-month-old seedlings of genotype "TF133" were subjected to the control (CK), salinity (S), salinity + calcium nitrate (SC), and salinity + ethylene glycol tetraacetic acid (SE). Calcium nitrate and ethylene glycol tetraacetic acid was used as exogenous calcium donor and calcium chelating agent respectively. At the end of a 5-day duration treatment, samples in SC regime had better photochemistry performance on several parameters than salinity only. Such as the Area (equal to the plastoquinone pool size), N (number of [Formula: see text] redox turnovers until F m is reached), ψE 0 , or δRo (Efficiencdy/probability with which a PSII trapped electron is transferred from Q A to Q B or PSI acceptors), ABS/RC (Absorbed photon flux per RC). All the above suggested that calcium enhanced the electron transfer of PSII (especially beyond [Formula: see text]) and prevented reaction centers from inactivation in salt-stressed tall fescue. Furthermore, both grass shoot and root tissues generally accumulated more C, N, Ca 2+ , and K + in the SC regime than S regime. Interrelated analysis indicated that ψE 0 , δRo, ABS/RC, C, and N content in shoots was highly correlated to each other and significantly positively related to Ca 2+ and K + content in roots. Besides, high salt increased ATP6E and CAMK2 transcription level in shoot at 1 and 5 day, respectively while exogenous calcium relieved it. In root, CAMK2 level was reduced by Salinity at 5 day and exogenous calcium recovered it. These observations involved in electron transport capacity and ion accumulation assist in understanding better the protective role

  20. Exogenous Calcium Enhances the Photosystem II Photochemistry Response in Salt Stressed Tall Fescue

    Directory of Open Access Journals (Sweden)

    Guangyang Wang

    2017-11-01

    Full Text Available Calcium enhances turfgrass response to salt stress. However, little is known about PSII photochemical changes when exogenous calcium was applied in salinity-stressed turfgrass. Here, we probe into the rearrangements of PSII electron transport and endogenous ion accumulation in tall fescue (Festuca arundinacea Schreber treated with exogenous calcium under salt stress. Three-month-old seedlings of genotype “TF133” were subjected to the control (CK, salinity (S, salinity + calcium nitrate (SC, and salinity + ethylene glycol tetraacetic acid (SE. Calcium nitrate and ethylene glycol tetraacetic acid was used as exogenous calcium donor and calcium chelating agent respectively. At the end of a 5-day duration treatment, samples in SC regime had better photochemistry performance on several parameters than salinity only. Such as the Area (equal to the plastoquinone pool size, N (number of QA- redox turnovers until Fm is reached, ψE0, or δRo (Efficiencdy/probability with which a PSII trapped electron is transferred from QA to QB or PSI acceptors, ABS/RC (Absorbed photon flux per RC. All the above suggested that calcium enhanced the electron transfer of PSII (especially beyond QA- and prevented reaction centers from inactivation in salt-stressed tall fescue. Furthermore, both grass shoot and root tissues generally accumulated more C, N, Ca2+, and K+ in the SC regime than S regime. Interrelated analysis indicated that ψE0, δRo, ABS/RC, C, and N content in shoots was highly correlated to each other and significantly positively related to Ca2+ and K+ content in roots. Besides, high salt increased ATP6E and CAMK2 transcription level in shoot at 1 and 5 day, respectively while exogenous calcium relieved it. In root, CAMK2 level was reduced by Salinity at 5 day and exogenous calcium recovered it. These observations involved in electron transport capacity and ion accumulation assist in understanding better the protective role of exogenous calcium in tall

  1. Stabilization of metals in acidic mine spoil with amendments and red fescue (Festuca rubra L.) growth.

    Science.gov (United States)

    Simon, László

    2005-12-01

    Stabilization of metals with amendments and red fescue (Festuca rubra, cv. Keszthelyi 2) growth was studied on an acidic and phytotoxic mine spoil (pH(KCl) 3.20-3.26; Cd 7.1 mg kg(-1), Cu 120 mg kg(-1), Pb 2154 mg kg(-1) and Zn 605 mg kg(-1)) from Gyöngyösoroszi, Hungary in a pot experiment. Raising the pH above 5.0 by lime (CaCO(3)), and supplementing with 40 mg kg(-1)nitrogen (NH(4)NO(3)) made this material suitable for plant growth. All cultures were limed with 0.5% (m/m) CaCO(3) (treatment 1), which was combined with 5% (m/m) municipal sewage sludge compost (treatment 2), 5% (m/m) peat (treatment 3), 7.5% (m/m) natural zeolite (clinoptilolite) (treatment 4), and 0.5 (m/m) KH(2)PO(4) (treatment 5). Treatments 1-5 were combined with each other (treatment 6). After 60 days of red fescue growth, pH of the limed mine spoil decreased in all cultures units. Application of peat caused the highest pH decrease (1.15), while decrease of pH was less than 0.23 in treatments 2, 5 or 6. Application of lime significantly reduced concentrations of metals in the 'plant available' fraction of mine spoil compared to non-limed mine spoil. Amendments added to limed mine spoil changed variously the ratio of Cd, Cu, Pb and Zn in exchangeable or 'plant available' fractions, differently influencing the phytoavailability of these metals. Most of the metals were captured in the roots of test plants. Treatment 2 caused the appearance of less Cd in shoots (spoil, however the application of 0.5 phosphate was less favourable. Liming, application of amendments and growth of red fescue can stabilize metals in acidic and phytotoxic mine spoil, and by phytostabilization they can reduce the risk of metal contamination of the food chain.

  2. DLLME-spectrophotometric determination of glyphosate residue in legumes.

    Science.gov (United States)

    Çetin, Emine; Şahan, Serkan; Ülgen, Ahmet; Şahin, Uğur

    2017-09-01

    A new separation and pre-concentration method for spectrophotometric determination of glyphosate herbicide was developed. Glyphosate was converted into dithiocarbamic acid with CS 2 , followed by copper in the presence of ammonia to promote complex formation. This complex was collected in a CH 2 Cl 2 organic drop and absorbance measured at 435nm. The analytical parameters, such as the amount of NH 3 , Cu(II) and CS 2 , type of extraction solutions, and the ratio of dispersive and organic liquids were optimized. The calibration curve was linear in the range 0.5-10mgl -1 . The limits of detection and quantification were calculated from 3s to 10s criterions as 0.21mgl -1 and 0.70mgl -1 , respectively. The developed method was applied to legume samples with the satisfactory recovery values of 98±4-102±3%. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Toxicity of roundup (a glyphosate product) to fingerlings of Clarias ...

    African Journals Online (AJOL)

    Acute static renewal bioassays were conducted on fingerling and adult of Clarias gariepinus (mean weight, 1.22 ± 0.6g; mean total length, 5.25 ± 1.25 cm) using the herbicide, Roundup (glyphosate). In the acute study, fingerlings were exposed in triplicate to 0.0, 14.0, 16.0, 18.0, 20.0 22.0, and 24.0 mg/l of the herbicide for ...

  4. Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex

    Directory of Open Access Journals (Sweden)

    Stewart Alan V

    2010-10-01

    Full Text Available Abstract Background The agriculturally important pasture grass tall fescue (Festuca arundinacea Schreb. syn. Lolium arundinaceum (Schreb. Darbysh. is an outbreeding allohexaploid, that may be more accurately described as a species complex consisting of three major (Continental, Mediterranean and rhizomatous morphotypes. Observation of hybrid infertility in some crossing combinations between morphotypes suggests the possibility of independent origins from different diploid progenitors. This study aims to clarify the evolutionary relationships between each tall fescue morphotype through phylogenetic analysis using two low-copy nuclear genes (encoding plastid acetyl-CoA carboxylase [Acc1] and centroradialis [CEN], the nuclear ribosomal DNA internal transcribed spacer (rDNA ITS and the chloroplast DNA (cpDNA genome-located matK gene. Other taxa within the closely related Lolium-Festuca species complex were also included in the study, to increase understanding of evolutionary processes in a taxonomic group characterised by multiple inter-specific hybridisation events. Results Putative homoeologous sequences from both nuclear genes were obtained from each polyploid species and compared to counterparts from 15 diploid taxa. Phylogenetic reconstruction confirmed F. pratensis and F. arundinacea var. glaucescens as probable progenitors to Continental tall fescue, and these species are also likely to be ancestral to the rhizomatous morphotype. However, these two morphotypes are sufficiently distinct to be located in separate clades based on the ITS-derived data set. All four of the generated data sets suggest independent evolution of the Mediterranean and Continental morphotypes, with minimal affinity between cognate sequence haplotypes. No obvious candidate progenitor species for Mediterranean tall fescues were identified, and only two putative sub-genome-specific haplotypes were identified for this morphotype. Conclusions This study describes the first

  5. Voltammetric Quantification of Paraquat and Glyphosate in Surface Waters

    Directory of Open Access Journals (Sweden)

    William Roberto Alza-Camacho

    2016-09-01

    Full Text Available The indiscriminate use of pesticides on crops has a negative environmental impact that affects organisms, soil and water resources, essential for life. Therefore, it is necessary to evaluate the residual effect of these substances in water sources. A simple, affordable and accessible electrochemical method for Paraquat and Glyphosate quantification in water was developed. The study was conducted using as supporting electrolyte Britton-Robinson buffer solution, working electrode of glassy carbon, Ag/AgCl as the reference electrode, and platinum as auxiliary electrode. Differential pulse voltammetry (VDP method for both compounds were validated. Linearity of the methods presented a correlation coefficient of 0.9949 and 0.9919 and the limits of detection and quantification were 130 and 190 mg/L for Paraquat and 40 and 50 mg/L for glyphosate. Comparison with the reference method showed that the electrochemical method provides superior results in quantification of analytes. Of the samples tested, a value of Paraquat was between 0,011 to 1,572 mg/L and for glyphosate it was between 0.201 to 2.777 mg/L, indicating that these compounds are present in water sources and that those may be causing serious problems to human health.

  6. [Mutual Effect on Determination of Gibberellins and Glyphosate in Groundwater by Spectrophotometry].

    Science.gov (United States)

    Zhang, Li; Chen, Liang; Liu, Fei

    2015-04-01

    In the present study, a spectrophotometry method for the simultaneous determination of gibberellins (GA3) and glyphosate in groundwater was established and optimized. In addition, the mutual effect on simultaneous determination of GA3 and glyphosate was studied. Based on the experiment, good linearity (R2 > 0.99) was obtained for GA3 in the range of 0-20 and 0-100 µg and for glyphosate in the range of 0-8 and 5-15 µg. The method's detection limit (MDL) of GA3 and glyphosate was 0.48 and 0.82 µg, respectively; and the recovery rates of 15 to 150 µg GA3 and 3 to 10 µg glyphosate in all samples at a spiked level were 71.3% ± 1.9% and 98.4% ± 8.1%, respectively. No obvious influence of glyphosate (0-100 mg · L(-1)) on the recovery rates of GA3 was observed, but the presence of glyphosate could cause slight determination precision decrease of GA3. Meanwhile, adding 2 mg · L(-1) GA3 can increase the recovery rate of glyphosate.

  7. Glyphosate: environmental contamination, toxicity and potential risks to human health via food contamination.

    Science.gov (United States)

    Bai, Shahla Hosseini; Ogbourne, Steven M

    2016-10-01

    Glyphosate has been the most widely used herbicide during the past three decades. The US Environmental Protection Agency (EPA) classifies glyphosate as 'practically non-toxic and not an irritant' under the acute toxicity classification system. This classification is based primarily on toxicity data and due to its unique mode of action via a biochemical pathway that only exists in a small number of organisms that utilise the shikimic acid pathway to produce amino acids, most of which are green plants. This classification is supported by the majority of scientific literature on the toxic effects of glyphosate. However, in 2005, the Food and Agriculture Organisation (FAO) reported that glyphosate and its major metabolite, aminomethylphosphonic acid (AMPA), are of potential toxicological concern, mainly as a result of accumulation of residues in the food chain. The FAO further states that the dietary risk of glyphosate and AMPA is unlikely if the maximum daily intake of 1 mg kg(-1) body weight (bw) is not exceeded. Research has now established that glyphosate can persist in the environment, and therefore, assessments of the health risks associated with glyphosate are more complicated than suggested by acute toxicity data that relate primarily to accidental high-rate exposure. We have used recent literature to assess the possible risks associated with the presence of glyphosate residues in food and the environment.

  8. Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

    Science.gov (United States)

    This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

  9. Glyphosate sorption/desorption on biochars - interactions of physical and chemical processes.

    Science.gov (United States)

    Hall, Kathleen E; Spokas, Kurt A; Gamiz, Beatriz; Cox, Lucia; Papiernik, Sharon K; Koskinen, William C

    2018-05-01

    Biochar, a carbon-rich product of biomass pyrolysis, could limit glyphosate transport in soil and remediate contaminated water. The present study investigates the sorption/desorption behavior of glyphosate on biochars prepared from different hardwoods at temperatures ranging from 350 to 900 °C to elucidate fundamental mechanisms. Glyphosate (1 mg L -1 ) sorption on biochars increased with pyrolysis temperature and was highest on 900 °C biochars; however, total sorption was low on a mass basis (glyphosate in soils, did not alter biochar sorption capacities. Glyphosate did not desorb from biochar with CaCl 2 solution; however, up to 86% of the bound glyphosate was released with a K 2 HPO 4 solution. Results from this study suggest a combined impact of surface chemistry and physical constraints on glyphosate sorption/desorption on biochar. Based on the observed phosphate-induced desorption of glyphosate, the addition of P-fertilizer to biochar-amended soils can remobilize the herbicide and damage non-target plants; therefore, improved understanding of this risk is necessary. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  10. Goss’s wilt incidence in sweet corn is independent of transgenic traits and glyphosate

    Science.gov (United States)

    Recently claims have been made that the use of glyphosate and transgenic crop traits increases the risk of plant diseases. Transgenic traits used widely for years in dent corn are now available in commercial sweet corn cultivars, specifically, the combination of glyphosate resistance (GR) and Lepid...

  11. Distribution of glyphosate and aminomethylphosphonic acid (AMPA) in Agricultural topsoils of the European Union

    NARCIS (Netherlands)

    Felix Da Graca Silva, V.A.; Montanarella, L.; Jones, Arwyn; Fernandez-Ugalde, Oihane; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2018-01-01

    Approval for glyphosate-based herbicides in the European Union (EU) is under intense debate due to concern about their effects on the environment and human health. The occurrence of glyphosate residues in European water bodies is rather well documented whereas only few, fragmented and outdated

  12. The different behaviors of glyphosate and AMPA in compost-amended soil.

    Science.gov (United States)

    Erban, Tomas; Stehlik, Martin; Sopko, Bruno; Markovic, Martin; Seifrtova, Marcela; Halesova, Tatana; Kovaricek, Pavel

    2018-05-04

    The broad-spectrum herbicide glyphosate is one of the most widely used pesticides. Both glyphosate and its major metabolite, aminomethylphosphonic acid (AMPA), persist in waters; thus, their environmental fates are of interest. We investigated the influence of compost dose, sampling depth, moisture and saturated hydraulic conductivity (K s ) on the persistence of these substances. The amounts of AMPA quantified by triple quadrupole liquid chromatography-mass spectrometry (LC-QqQ-MS/MS) using isotopically labeled extraction standards were higher than those of glyphosate and differed among the samples. Both glyphosate and AMPA showed gradually decreasing concentrations with soil depth, and bootstrapped ANOVA showed significant differences between the contents of glyphosate and AMPA and their behavior related to different compost dosages and sampling depths. However, the compost dose alone did not cause significant differences among samples. Bayesian statistics revealed that the amounts of glyphosate and AMPA were both dependent on the sampling depth and compost dose, but differences were found when considering the physical factors of K s and moisture. Glyphosate was influenced by moisture but not K s , whereas AMPA was influenced by K s but not moisture. Importantly, we found behavioral differences between glyphosate and its major metabolite, AMPA, related to the physical properties of K s and moisture. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Fate and transport of glyphosate and aminomethylphosphonic acid in surface waters of agricultural basins

    Science.gov (United States)

    Coupe, R.H.; Kalkhoff, S.J.; Capel, P.D.; Gregoire, C.

    2012-01-01

    Background: Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used widely throughout the world in the production of many crops and is heavily used on soybeans, corn and cotton. Glyphosate is used in almost all agricultural areas of the United States, and the agricultural use of glyphosate has increased from less than 10 000 Mg in 1992 to more than 80 000 Mg in 2007. The greatest intensity of glyphosate use is in the midwestern United States, where applications are predominantly to genetically modified corn and soybeans. In spite of the increase in usage across the United States, the characterization of the transport of glyphosate and its degradate aminomethylphosphonic acid (AMPA) on a watershed scale is lacking. Results: Glyphosate and AMPA were frequently detected in the surface waters of four agricultural basins. The frequency and magnitude of detections varied across basins, and the load, as a percentage of use, ranged from 0.009 to 0.86% and could be related to three general characteristics: source strength, rainfall runoff and flow route. Conclusions: Glyphosate use in a watershed results in some occurrence in surface water; however, the watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff and a flow route that does not include transport through the soil. ?? 2011 Society of Chemical Industry.

  14. Short-term transport of glyphosate with erosion in Chinese loess soil - a flume experiment

    NARCIS (Netherlands)

    Yang, X.; Wang, Fei; Martins Bento, Celia; Xue, Sha; Gai, L.; Dam, van R.C.J.; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2015-01-01

    Repeated applications of glyphosate may contaminate the soil and water and threaten their quality both within the environmental system and beyond it through water erosion related processes and leaching. In this study, we focused on the transport of glyphosate and its metabolite aminomethylphosphonic

  15. Annual glyphosate treatments alter growth of unaffected bentgrass (Agrostis weeds and plant community composition.

    Directory of Open Access Journals (Sweden)

    Collin W Ahrens

    Full Text Available Herbicide resistance is becoming more common in weed ecotypes and crop species including turfgrasses, but current gaps in knowledge limit predictive ecological risk assessments and risk management plans. This project examined the effect of annual glyphosate applications on the vegetative growth and reproductive potential of two weedy bentgrasses, creeping bentgrass (CB and redtop (RT, where the glyphosate resistance (GR trait was mimicked by covering the bentgrass plants during glyphosate application. Five field plots were studied in habitats commonly inhabited by weedy bentgrasses including an agricultural hayfield, natural meadow, and wasteland. Results showed that annual glyphosate treatment improved bentgrass survivorship, vegetative growth, and reproductive potential compared with bentgrass in unsprayed subplots. In the second year of growth, RT plants had an 86-fold increase in flower number in glyphosate-treated subplots versus controls, while CB plants had a 20-fold increase. At the end of the three year study, plant community composition had changed in glyphosate-treated subplots in hayfield and meadow plots compared to controls. Soils in subplots receiving glyphosate had higher nitrate concentrations than controls. This is the first study to mimic the GR trait in bentgrass plants with the goal of quantifying bentgrass response to glyphosate selection pressure and understanding the impacts on surrounding plant communities.

  16. Correlation of leaf damage with uptake and translocation of glyphosate in velvetleaf (Abutilon theophrasti)

    International Nuclear Information System (INIS)

    Feng, P.C.C.; Ryerse, J.S.; Sammons, R.D.

    1998-01-01

    Uptake and translocation of glyphosate in three commercial formulations were examined in velvetleaf, a dicotyledonous weed that is commonly treated with glyphosate. The formulations included Roundup(R) (MON35085), Roundup Ultra, and Touchdown(R) as sold in Canada. A minimal amount of 14C-glyphosate was spiked into a lethal rate of each formulation, and the short-term (3 to 72 h) uptake into the treated leaf and subsequent translocation into the plant were measured. Time-course studies showed very rapid uptake and translocation of glyphosate in the Ultra formulation. In comparison, the uptake and translocation of glyphosate in Touchdown was much slower but continued throughout the 72-h period. Glyphosate in the Roundup formulation showed intermediate uptake and translocation. Tissue necrosis at the application sites of Ultra and Roundup was visible within 24 h after treatment. Examinations using stereo and fluorescence microscopy revealed extensive cell death and tissue disruption. Tissue necrosis from Ultra and Roundup was also observed in blank formulations containing no glyphosate and therefore was likely caused by the surfactants. In contrast, the application sites of Touchdown produced little to no leaf damage. Our results demonstrated a direct correlation between tissue necrosis and rapid rates of glyphosate uptake and translocation. (author)

  17. Effects of glyphosate exposure on sperm concentration in rodents: A systematic review and meta-analysis.

    Science.gov (United States)

    Cai, Wenyan; Ji, Ying; Song, Xianping; Guo, Haoran; Han, Lei; Zhang, Feng; Liu, Xin; Zhang, Hengdong; Zhu, Baoli; Xu, Ming

    2017-10-01

    Correlation between exposure to glyphosate and sperm concentrations is important in reproductive toxicity risk assessment for male reproductive functions. Many studies have focused on reproductive toxicity on glyphosate, however, results are still controversial. We conducted a systematic review of epidemiological studies on the association between glyphosate exposure and sperm concentrations of rodents. The aim of this study is to explore the potential adverse effects of glyphosate on reproductive function of male rodents. Systematic and comprehensive literature search was performed in MEDLINE, TOXLINE, Embase, WANFANG and CNKI databases with different combinations of glyphosate exposure and sperm concentration. 8 studies were eventually identified and random-effect model was conducted. Heterogeneity among study results was calculated via chi-square tests. Ten independent experimental datasets from these eight studies were acquired to synthesize the random-effect model. A decrease in sperm concentrations was found with mean difference of sperm concentrations(MDsperm)=-2.774×10 6 /sperm/g/testis(95%CI=-0.969 to -4.579) in random-effect model after glyphosate exposure. There was also a significant decrease after fitting the random-effect model: MDsperm=-1.632×10 6 /sperm/g/testis (95%CI=-0.662 to -2.601). The results of meta-analysis support the hypothesis that glyphosate exposure decreased sperm concentration in rodents. Therefore, we conclude that glyphosate is toxic to male rodent's reproductive system. Copyright © 2017. Published by Elsevier B.V.

  18. Glyphosate resistance in common ragweed (Ambrosia artemisiifolia L.)from Mississippi, USA

    Science.gov (United States)

    Glyphosate is one of the most commonly used broad-spectrum herbicides over the last 40 years. Due to widespread adoption of glyphosate-resistant (GR) crop technology, especially, corn, cotton, and soybean, several weed species in agronomic situations have developed resistance to this herbicide. Rese...

  19. Plant growth responses of apple and pear trees to doses of glyphosate

    Science.gov (United States)

    Glyphosate is commonly used for intra-row weed management in perennial plantations, where unintended crop exposure to this herbicide can cause growth reduction. The objective of this research was to analyze the initial plant growth behavior of young apple and pear plants exposed to glyphosate. Glyph...

  20. Glyphosate sorption/desorption on biochars – Interactions of physical and chemical processes

    Science.gov (United States)

    BACKGROUND: Biochar, a carbon-rich product of biomass pyrolysis, could limit glyphosate transport in soil and remediate contaminated water. The present study investigates the sorption/desorption behavior of glyphosate on biochars prepared from different hardwoods at temperatures ranging from 350°C t...

  1. Decay characteristics and erosion-related transport of glyphosate in Chinese loess soil under field conditions

    NARCIS (Netherlands)

    Yang, X.; Wang, Fei; Martins Bento, Celia; Meng, L.; Dam, van R.C.J.; Mol, J.G.J.; Liu, Guobin; Ritsema, C.J.; Geissen, V.

    2015-01-01

    The decay characteristics and erosion-related transport of glyphosate and aminomethylphosphonic acid (AMPA) were monitored for 35 d at different slope gradients and rates of application in plots with loess soil on the Loess Plateau, China. The initial glyphosate decayed rapidly (half-life of 3.5 d)

  2. Biodegradation of glyphosate herbicide by Salinicoccus spp isolated from Qom Hoze-soltan lake, Iran

    Directory of Open Access Journals (Sweden)

    Yaser Sharifi

    2015-01-01

    Full Text Available Background: Glyphosate (N-phosphonomethyl Glycine is an organophosphorus pesticide with dangerous effects on the environment. In this study, the biodegradation of glyphosate herbicide by halophilic bacteria isolated from Qom Hoze-Soltan Lake has been investigated. Methods: After sampling and bacterial isolation, native halophilic strains grown in the presence of glyphosate at a wavelength of 660 nm and also the disappearance of the glyphosate in the plates at a wavelength of 220 nm were determined and the dominant bacteria were isolated. Biochemical, molecular (according to the 16S rRNA sequence, antibiotic, and the Minimum Inhibitory Concentration (MIC test was performed for the dominant bacteria. Analysis of the remaining glyphosate herbicide was performed by HPLC analysis after derivation with FMOC-Cl. Results: According to the results of the biochemical, antibiotic and molecular 16S rRNA tests, the native halophilic isolates with the ability to biodegrade glyphosate were gram positive cocci very similar to Salinicoccusspp. The results of HPLC showed that Salinicoccusspp is able to biodegrade glyphosate herbicide. Conclusion: The native bacteria in Qom Hoze-soltanlake, Iran can be used for biodegradation of glyphosate herbicide.

  3. Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study

    International Nuclear Information System (INIS)

    Cassigneul, A.; Benoit, P.; Bergheaud, V.; Dumeny, V.; Etiévant, V.; Goubard, Y.; Maylin, A.; Justes, E.; Alletto, L.

    2016-01-01

    The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of "1"4C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. "1"4C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH_4OH-soluble and non-extractable fractions was determined at 5 dates during a 20 °C/84-d period. The presence of CC extends "1"4C-glyphosate degradation half-life from 7 to 28 days depending on the CC. "1"4C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. - Highlights: • Glyphosate sorption on cover crop residues increases with their decomposition degree. • Glyphosate degradation and mineralization are lower in mulch than in soil. • Nonextractable residue formation is one of the main dissipation pathways of glyphosate in cover crop mulch.

  4. Glyphosate and AMPA distribution in wind-eroded sediment derived from loess soil

    NARCIS (Netherlands)

    Martins Bento, Celia; Goossens, Dirk; Rezaei, Mahrooz; Riksen, M.J.P.M.; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2017-01-01

    Glyphosate is one of the most used herbicides in agricultural lands worldwide. Wind-eroded sediment and dust, as an environmental transport pathway of glyphosate and of its main metabolite aminomethylphosphonic acid (AMPA), can result in environmental- and human exposure far beyond the agricultural

  5. UV-Vis Spectrophotometric Analysis and Quantification of Glyphosate for an Interdisciplinary Undergraduate Laboratory

    Science.gov (United States)

    Felton, Daniel E.; Ederer, Martina; Steffens, Timothy; Hartzell, Patricia L.; Waynant, Kristopher V.

    2018-01-01

    Glyphosate (N-(phosphonomethyl)glycine) is the most widely used herbicide on earth. A simple assay to quantify glyphosate concentrations in environmental samples was developed as part of an interdisciplinary effort linking introductory laboratory courses in chemistry, biology, and microbiology. In this 3 h laboratory experiment, students used…

  6. Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study

    Energy Technology Data Exchange (ETDEWEB)

    Cassigneul, A. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France); INRA, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Benoit, P.; Bergheaud, V.; Dumeny, V.; Etiévant, V. [INRA, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Goubard, Y. [AgroParisTech, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Maylin, A. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France); Justes, E. [INRA, UMR 1248 AGIR Auzeville — BP 52 627, 31 326, Castanet-Tolosan cedex (France); Alletto, L. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France)

    2016-03-01

    The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of {sup 14}C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. {sup 14}C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH{sub 4}OH-soluble and non-extractable fractions was determined at 5 dates during a 20 °C/84-d period. The presence of CC extends {sup 14}C-glyphosate degradation half-life from 7 to 28 days depending on the CC. {sup 14}C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. - Highlights: • Glyphosate sorption on cover crop residues increases with their decomposition degree. • Glyphosate degradation and mineralization are lower in mulch than in soil. • Nonextractable residue formation is one of the main dissipation pathways of glyphosate in cover crop mulch.

  7. Alteration of plant physiology by glyphosate and its by-product aminomethylphosphonic acid: an overview.

    Science.gov (United States)

    Gomes, Marcelo P; Smedbol, Elise; Chalifour, Annie; Hénault-Ethier, Louise; Labrecque, Michel; Lepage, Laurent; Lucotte, Marc; Juneau, Philippe

    2014-09-01

    It is generally claimed that glyphosate kills undesired plants by affecting the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme, disturbing the shikimate pathway. However, the mechanisms leading to plant death may also be related to secondary or indirect effects of glyphosate on plant physiology. Moreover, some plants can metabolize glyphosate to aminomethylphosphonic acid (AMPA) or be exposed to AMPA from different environmental matrices. AMPA is a recognized phytotoxin, and its co-occurrence with glyphosate could modify the effects of glyphosate on plant physiology. The present review provides an overall picture of alterations of plant physiology caused by environmental exposure to glyphosate and its metabolite AMPA, and summarizes their effects on several physiological processes. It particularly focuses on photosynthesis, from photochemical events to C assimilation and translocation, as well as oxidative stress. The effects of glyphosate and AMPA on several plant physiological processes have been linked, with the aim of better understanding their phytotoxicity and glyphosate herbicidal effects. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  8. Inheritance of Evolved Glyphosate Resistance in a North Carolina Palmer Amaranth (Amaranthus palmeri Biotype

    Directory of Open Access Journals (Sweden)

    Aman Chandi

    2012-01-01

    Full Text Available Inheritance of glyphosate resistance in a Palmer amaranth biotype from North Carolina was studied. Glyphosate rates for 50% survival of glyphosate-resistant (GR and glyphosate-susceptible (GS biotypes were 1288 and 58 g ha−1, respectively. These values for F1 progenies obtained from reciprocal crosses (GR×GS and GS×GR were 794 and 501 g ha−1, respectively. Dose response of F1 progenies indicated that resistance was not fully dominant over susceptibility. Lack of significant differences between dose responses for reciprocal F1 families suggested that genetic control of glyphosate resistance was governed by nuclear genome. Analysis of F1 backcross (BC1F1 families showed that 10 and 8 BC1F1 families out of 15 fitted monogenic inheritance at 2000 and 3000 g ha−1 glyphosate, respectively. These results indicate that inheritance of glyphosate resistance in this biotype is incompletely dominant, nuclear inherited, and might not be consistent with a single gene mechanism of inheritance. Relative 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS copy number varied from 22 to 63 across 10 individuals from resistant biotype. This suggested that variable EPSPS copy number in the parents might be influential in determining if inheritance of glyphosate resistance is monogenic or polygenic in this biotype.

  9. Glyphosate detection with ammonium nitrate and humic acids as potential interfering substances by pulsed voltammetry technique.

    Science.gov (United States)

    Martínez Gil, Pablo; Laguarda-Miro, Nicolas; Camino, Juan Soto; Peris, Rafael Masot

    2013-10-15

    Pulsed voltammetry has been used to detect and quantify glyphosate on buffered water in presence of ammonium nitrate and humic substances. Glyphosate is the most widely used herbicide active ingredient in the world. It is a non-selective broad spectrum herbicide but some of its health and environmental effects are still being discussed. Nowadays, glyphosate pollution in water is being monitored but quantification techniques are slow and expensive. Glyphosate wastes are often detected in countryside water bodies where organic substances and fertilizers (commonly based on ammonium nitrate) may also be present. Glyphosate also forms complexes with humic acids so these compounds have also been taken into consideration. The objective of this research is to study the interference of these common pollutants in glyphosate measurements by pulsed voltammetry. The statistical treatment of the voltammetric data obtained lets us discriminate glyphosate from the other studied compounds and a mathematical model has been built to quantify glyphosate concentrations in a buffer despite the presence of humic substances and ammonium nitrate. In this model, the coefficient of determination (R(2)) is 0.977 and the RMSEP value is 2.96 × 10(-5) so the model is considered statistically valid. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Improving hybrid seed production in corn with glyphosate-mediated male sterility.

    Science.gov (United States)

    Feng, Paul C C; Qi, Youlin; Chiu, Tommy; Stoecker, Martin A; Schuster, Christopher L; Johnson, Scott C; Fonseca, Augustine E; Huang, Jintai

    2014-02-01

    Hybrid corn varieties exhibit benefits associated with heterosis and account for most of the corn acreage in the USA. Hybrid seed corn is produced by crossing a female parent which is male-sterile and therefore incapable of self-pollination with a male parent as the pollen donor. The majority of hybrid seed corn is produced by mechanical detasseling which involves physically removing the tassel, a process that is laborious and costly. Glyphosate-resistant corn was developed via expression of a glyphosate insensitive 5-enolpyruvyl-shikimate 3-phosphate synthase enzyme (CP4-EPSPS). Experimentation with molecular expression elements resulted in selective reduction of CP4-EPSPS expression in male reproductive tissues. The resulting plant demonstrated sterile tassel following glyphosate application with little to no injury to the rest of the plant. Using (14)C-glyphosate as a marker, we also examined the translocation of glyphosate to the tassel via spray application in a track sprayer to simulate field application. The results allowed optimization of spray parameters such as dose, spray timing and target to maximize tassel delivery of glyphosate for efficient sterilization. The Roundup hybridization system (RHS) is a novel process for hybrid seed production based on glyphosate-mediated male sterility. RHS replaces mechanical detasseling with glyphosate spray and greatly simplifies the process of hybrid seed corn production. © 2013 Society of Chemical Industry.

  11. Glyphosate toxicity and the effects of long-term vegetation control on soil microbial communities

    Science.gov (United States)

    Matt D. Busse; Alice W. Ratcliff; Carol J. Stestak; Robert F. Powers

    2001-01-01

    We assessed the direct and indirect effect of the herbicide glyphosate on soil microbial communities from soil bioassays at glyphosate concentrations up to 100-fold greater than expected following a single field application. Indirect effects on microbial biomass, respiration, and metabolic diversity (Biolog and catabolic response profile) were compared seasonally after...

  12. Ruminal tryptophan-utilizing bacteria degrade ergovaline from tall fescue seed extract.

    Science.gov (United States)

    Harlow, B E; Goodman, J P; Lynn, B C; Flythe, M D; Ji, H; Aiken, G E

    2017-02-01

    The objectives of this study were to evaluate degradation of ergovaline in a tall fescue [ (Schreb.) Darbysh.] seed extract by rumen microbiota ex vivo and to identify specific bacteria capable of ergovaline degradation in vitro. Rumen cell suspensions were prepared by harvesting rumen fluid from fistulated wether goats ( = 3), straining, and differential centrifugation. Suspensions were dispensed into anaerobic tubes with added Trypticase with or without extract (∼10 μg kg ergovaline). Suspensions were incubated for 48 h at 39°C. Samples were collected at 0, 24, and 48 h for ergovaline analysis and enumeration of hyper-ammonia producing (HAB) and tryptophan-utilizing bacteria. Ergovaline values were analyzed by repeated measures using the mixed procedure of SAS. Enumeration data were log transformed for statistical analysis. When suspensions were incubated with extract, 11 to 15% of ergovaline disappearance was observed over 48 h ( = 0.02). After 24 h, suspensions with added extract had 10-fold less HAB than controls ( = 0.04), but treatments were similar by 48 h ( = 1.00). However, after 24 h and 48 h, suspensions with extract had 10-fold more tryptophan-utilizing bacteria ( rumen pure cultures ( JB1, B159, HD4, B, F, MD1, SR) were evaluated for the ability to degrade ergovaline in vitro. Pure culture cell suspensions were incubated as described above and samples were taken at 0 and 48 h for ergovaline analysis. Data were analyzed using the ANOVA procedure of SAS. All HAB, including the isolates, tested degraded ergovaline (54 to 75%; bacteria tested did not degrade ergovaline. The results of this study indicate which rumen bacteria may play an important role in ergovaline degradation and that microbiological strategies for controlling their activity could have ramifications for fescue toxicosis and other forms of ergotism in ruminants.

  13. Adsorção de glifosato sobre solos e minerais Adsorption of glyphosate on soils and minerals

    Directory of Open Access Journals (Sweden)

    Luís R. M. Toni

    2006-07-01

    Full Text Available Glyphosate, an enzyme inhibitor herbicide, has been widely used around the world in agriculture. Dr. John Franz from Monsanto Corporation (USA discovered glyphosate in 1970. It has been showed that glyphosate is strongly adsorbed by inorganic soil components especially aluminium and iron oxides, and the phosphate group is involved in this interaction. The inactivation of glyphosate in soils can last for days or even months depending on soil characteristics. The addition of phosphate from fertilizers can displace glyphosate from the soils and this could be the cause of decreased productivity of some crops.

  14. Influence of glyphosate in planktonic and biofilm growth of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Ilana Schneider Lima

    2014-09-01

    Full Text Available This study evaluated the impact of different concentrations of glyphosate (Rondup® on planktonic and biofilm growth of P. aeruginosa. Aerobic and anaerobic cultures of P. aeruginosa ATCC®15442 inoculated in MHB + glyphosate (0.845 ppm, 1.690 ppm, 8.45 ppm, 16.90 ppm, 84.50 ppm, 169 ppm, 845 ppm, and 1690 ppm and cultured in normoxia and anoxia, following their OD560nm every hour for 24 h. Biofilms of adapted cells were formed in the presence of glyphosate (0.845 to 1690 ppm in normoxia and anoxia for 36 h. Glyphosate at concentrations higher than 84.5 ppm reduces the cell density of planktonic aerobic cultures (p 0.05, and more pronounced over 169 ppm. Anaerobic biofilms have their growth more readily favored (p < 0.05, regardless of concentration. In a concentration-dependent manner, glyphosate interferes with the growth ability of P. aeruginosa ATCC®15442.

  15. Monitoring glyphosate and AMPA concentrations in wells and drains using the sorbicell passive sampler

    DEFF Research Database (Denmark)

    Vendelboe, Anders Lindblad; de Jonge, Hubert; Møldrup, Per

    2012-01-01

    Glyphosate is one of the world’s most extensively used weed control agents. Glyphosate, and its metabolite aminomethylphosphonic acid (AMPA), are suspected to be hazardous to human health and the aquatic environment. In Denmark, the extensive use has resulted in an increasing number of occurrences......Cell, will decrease the workload and number of samples freeing up funds for larger monitoring programs. When installed in a well the SorbiCell will continuously sample the water giving either a flux-weighed or time-weighted average measurement of the glyphosate/AMPA concentration throughout the sampling period....... It may therefore be possible to measure lower concentrations as the glyphosate/AMPA sorbed in the SorbiCell is an accumulated measurement. Also, glyphosate/AMPA associated with sudden flush events will be detected by the SorbiCells, while such events may pass between two consecutive grab samples...

  16. Is the growth stimulation by low doses of glyphosate sustained over time?

    International Nuclear Information System (INIS)

    Cedergreen, Nina

    2008-01-01

    The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha -1 , corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses -1 . This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time

  17. Is the growth stimulation by low doses of glyphosate sustained over time?

    Energy Technology Data Exchange (ETDEWEB)

    Cedergreen, Nina [Department of Agricultural Sciences, Faculty of Life Science, University of Copenhagen, Hojbakkegard Alle 13, 2630 Tastrup (Denmark)], E-mail: ncf@life.ku.dk

    2008-12-15

    The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha{sup -1}, corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses <60 g a.e. ha{sup -1}. This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time.

  18. On the International Agency for Research on Cancer classification of glyphosate as a probable human carcinogen.

    Science.gov (United States)

    Tarone, Robert E

    2018-01-01

    The recent classification by International Agency for Research on Cancer (IARC) of the herbicide glyphosate as a probable human carcinogen has generated considerable discussion. The classification is at variance with evaluations of the carcinogenic potential of glyphosate by several national and international regulatory bodies. The basis for the IARC classification is examined under the assumptions that the IARC criteria are reasonable and that the body of scientific studies determined by IARC staff to be relevant to the evaluation of glyphosate by the Monograph Working Group is sufficiently complete. It is shown that the classification of glyphosate as a probable human carcinogen was the result of a flawed and incomplete summary of the experimental evidence evaluated by the Working Group. Rational and effective cancer prevention activities depend on scientifically sound and unbiased assessments of the carcinogenic potential of suspected agents. Implications of the erroneous classification of glyphosate with respect to the IARC Monograph Working Group deliberative process are discussed.

  19. Changes in Amino Acid Profile in Roots of Glyphosate Resistant and Susceptible Soybean (Glycine max) Induced by Foliar Glyphosate Application.

    Science.gov (United States)

    Moldes, Carlos Alberto; Cantarelli, Miguel Angel; Camiña, José Manuel; Tsai, Siu Mui; Azevedo, Ricardo Antunes

    2017-10-11

    Amino acid profiles are useful to analyze the responses to glyphosate in susceptible and resistant soybean lines. Comparisons of profiles for 10 amino acids (Asp, Asn, Glu, Gln, Ser, His, Gly, Thr, Tyr, Leu) by HPLC in soybean roots were performed in two near isogenic pairs (four varieties). Foliar application of glyphosate was made to soybean plants after 5 weeks of seeding. Roots of four varieties were collected at 0 and 72 h after glyphosate application (AGA) for amino acid analysis by HPLC. Univariate analysis showed a significant increase of several amino acids in susceptible as well as resistant soybean lines; however, amino acids from the major pathways of carbon (C) and nitrogen (N) metabolism, such as Asp, Asn, Glu and Gln, and Ser, increased significantly in susceptible varieties at 72 h AGA. Multivariate analysis using principal component analysis (2D PCA and 3D PCA) allowed different groups to be identified and discriminated based on the soybean genetic origin, showing the amino acid responses on susceptible and resistant varieties. Based on the results, it is possible to infer that the increase of Asn, Asp, Glu, Gln, and Ser in susceptible varieties would be related to the deregulation of C and N metabolism, as well as changes in the growth mechanisms regulated by Ser.

  20. Effects of glyphosate and endosulfan on soil microorganisms in soybean crop Efeitos do endosulfan e glyphosate sobre microrganismos do solo na cultura da soja

    Directory of Open Access Journals (Sweden)

    J.L. Pereira

    2008-01-01

    Full Text Available Transgenic soybean, resistant to glyphosate, is the most dominant transgenic crop grown commercially in the world. Research works on herbicide and insecticide mixtures and their effects on microorganisms are rarely reported. This work aimed to study the impact of glyphosate, endosulfan and their mixtures on the microbial soil activity in soybean crop. The experiment was carried out in a complete randomized block design with four treatments and five replications. The treatments were glyphosate 480 SL [540 g of active ingredient (a.i. ha-1], endosulfan 350 EC (525 g a.i. ha-1, the glyphosate 480 SL [540 g of active ingredient (a.i. ha-1] mixed with endosulfan 350 EC (525 g a.i. ha-1 and the control. Microbial activity was evaluated five days after treatment application. Glyphosate application was not an impacting factor for soil CO2 production. Endosulfan application (alone or mixed with glyphosate suppressed CO2 production by microorganisms in the soil. Microbial biomass and microbial quotient were lower in the treatments using endosulfan alone and in those using endosulfan mixed with glyphosate than in the treatments using glyphosate alone and control.A soja resistente ao glyphosate é a cultura transgênica mais cultivada em todo o mundo. Pesquisas envolvendo o impacto de mistura de herbicidas e inseticidas e seus efeitos sobre microrganismos do solo são raramente reportadas. Este trabalho teve por objetivo avaliar o impacto do herbicida (glyphosate, do inseticida (endosulfan e da mistura de ambos sobre a atividade microbiana do solo na cultura da soja. O delineamento experimental foi em blocos casualizados, com quatro tratamentos e cinco repetições. Os tratamentos foram o herbicida glyphosate 480 SL [540 g de ingrediente ativo (i.a. ha-1], endosulfan 350 EC (525 g i.a. ha-1, a mistura de glyphosate 480 SL (540 g de i.a. ha-1 com endosulfan 350 EC (525 g i.a. ha-1 e a testemunha onde se aplicou água. A atividade microbiana foi avaliada aos

  1. Additive effects of the herbicide glyphosate and elevated temperature on the branched coral Acropora formosa in Nha Trang, Vietnam.

    Science.gov (United States)

    Amid, C; Olstedt, M; Gunnarsson, J S; Le Lan, H; Tran Thi Minh, H; Van den Brink, P J; Hellström, M; Tedengren, M

    2018-05-01

    The combined effects of the herbicide glyphosate and elevated temperature were studied on the tropical staghorn coral Acropora formosa, in Nha Trang bay, Vietnam. The corals were collected from two different reefs, one close to a polluted fish farm and one in a marine-protected area (MPA). In the laboratory, branches of the corals were exposed to the herbicide glyphosate at ambient (28 °C) and at 3 °C elevated water temperatures (31 °C). Effects of herbicide and elevated temperature were studied on coral bleaching using photography and digital image analysis (new colorimetric method developed here based on grayscale), chlorophyll a analysis, and symbiotic dinoflagellate (Symbiodinium, referred to as zooxanthellae) counts. All corals from the MPA started to bleach in the laboratory before they were exposed to the treatments, indicating that they were very sensitive, as opposed to the corals collected from the more polluted site, which were more tolerant and showed no bleaching response to temperature increase or herbicide alone. However, the combined exposure to the stressors resulted in significant loss of color, proportional to loss in chlorophyll a and zooxanthellae. The difference in sensitivity of the corals collected from the polluted site versus the MPA site could be explained by different symbiont types: the resilient type C3u and the stress-sensitive types C21 and C23, respectively. The additive effect of elevated temperatures and herbicides adds further weight to the notion that the bleaching of coral reefs is accelerated in the presence of multiple stressors. These results suggest that the corals in Nha Trang bay have adapted to the ongoing pollution to become more tolerant to anthropogenic stressors, and that multiple stressors hamper this resilience. The loss of color and decrease of chlorophyll a suggest that bleaching is related to concentration of chloro-pigments. The colorimetric method could be further fine-tuned and used as a precise, non

  2. Association Analysis of Simple Sequence Repeat (SSR Markers with Agronomic Traits in Tall Fescue (Festuca arundinacea Schreb..

    Directory of Open Access Journals (Sweden)

    Yanhong Lou

    Full Text Available Tall fescue is widely used in temperate regions throughout the world as a dominant forage grass as well as a turfgrass, in pastoral and turf industry. However, the utilization of tall fescue was limited because of its leaf roughness, poor regeneration ability and poor stress resistance. New cultivars were desirable in modern pastoral industries exceed the potential of existing cultivars. Therefore, well understanding the agronomic traits and describing germplasms would help to overcome these constraints, and morphological evaluation of tall fescue germplasm is the key component in selecting rational parents for hybridization breeding. However, describing the morphological traits of tall fescue germplasm is costly and time-consuming. Fortunately, biotechnology approaches can supplement conventional breeding efforts for tall fescue improvement. Association mapping, as a powerful approach to identify association between agronomic traits and molecular markers has been widely used for enhancing the utilization, conservation and management of the tall fescue germplasms. Therefore, in the present research, 115 tall fescue accessions from different origins (25 accessions are cultivars; 31 accessions from America; 32 accessions from European; 7 accessions from Africa; 20 accessions from Asia, were evaluated for agronomic traits and genetic diversity with 90 simple sequence repeat (SSR markers. The panel displayed significant variation in spike count per plant (SCP and spike weight (SW. However, BCS performed the lowest CV among all the observed agronomic traits. Three subpopulations were identified within the collections but no obvious relative kinship (K was found. The GLM model was used to describe the association between SSR and agronomic traits. Fifty-one SSR markers associated with agronomic traits were observed. Twelve single-associated markers were associated with PH; six single-associated markers were associated with BCS; eight single

  3. Laser-induced breakdown spectroscopy used to detect endophyte-mediated accumulation of metals by tall fescue

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Madhavi Z.; Stewart, Arthur J.; Gwinn, Kimberley D.; Waller, John C.

    2010-05-01

    Laser-induced breakdown spectroscopy (LIBS) was used to determine the impact of endophyte (Neotyphodium sp.) infection on elemental composition of tall fescue (Festuca arundinacea). Leaf material from endophyte-infected (E+) and endophyte-free (E-) tall fescue populations in established plots was examined. Leaf-tissue digestates were also tested for metals, by inductively coupled plasma (ICP) mass spectrometry (MS). Seven of eleven metals (Ca, Mg, Fe, Mn, Cu, Ni, and Zn) were measured by both techniques at concentrations great enough for a reliable comparison. Mg, Zn, and Cd, a toxic metal that can be present in forage, were readily detected by LIBS, even though Cd concentrations in the plants were below levels typically achieved using ICP MS detection. Implications of these results for research on forage analysis and phytoremediation are discussed.

  4. Alterations in serotonin receptor-induced contractility of bovine lateral saphenous vein in cattle grazing endophyte-infected tall fescue.

    Science.gov (United States)

    Klotz, J L; Brown, K R; Xue, Y; Matthews, J C; Boling, J A; Burris, W R; Bush, L P; Strickland, J R

    2012-02-01

    As part of a 2-yr study documenting the physiologic impact of grazing endophyte-infected tall fescue on growing cattle, 2 experiments were conducted to characterize and evaluate effects of grazing 2 levels of toxic endophyte-infected tall fescue pastures on vascular contractility and serotonin receptors. Experiment 1 examined vasoconstrictive activities of 5-hydroxytryptamine (5HT), α-methylserotonin (ME5HT; a 5HT(2) receptor agonist), d-lysergic acid (LSA), and ergovaline (ERV) on lateral saphenous veins collected from steers immediately removed from a high-endophyte-infected tall fescue pasture (HE) or a low-endophyte-infected mixed-grass (LE) pasture. Using the same pastures, Exp. 2 evaluated effects of grazing 2 levels of toxic endophyte-infected tall fescue on vasoconstrictive activities of (±)-1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane hydrochloride (DOI), BW 723C86 (BW7), CGS-12066A (CGS), and 5-carboxamidotryptamine hemiethanolate maleate (5CT), agonists for 5HT(2A),( 2B), 5HT(1B), and 5HT(7) receptors, respectively. One-half of the steers in Exp. 2 were slaughtered immediately after removal from pasture, and the other one-half were fed finishing diets for >91 d before slaughter. For Exp. 1, maximal contractile intensities were greater (P 91 d. Experiment 1 demonstrated that grazing of HE pastures for 89 to 105 d induces functional alterations in blood vessels, as evidenced by reduced contractile capacity and altered serotonergic receptor activity. Experiment 2 demonstrated that grazing HE pastures alters vascular responses, which may be mediated through altered serotonin receptor activities, and these alterations may be ameliorated by the removal of ergot alkaloid exposure as demonstrated by the absence of differences in finished steers.

  5. Assessment of the levels of N- (Phosphonomethyl) glycine glyphosate in selected glyphosate-based herbicides on the Ghanaian market

    International Nuclear Information System (INIS)

    Iddrisu, Adisatu

    2016-07-01

    Sixty one (61) samples of Glyphosate based herbicides were collected from the central commercial hub of Kumasi (Kejetia) and ware houses of importers in Ashanti and Greater Accra regions of Ghana and analyzed using high performance liquid chromatography (HPLC). Information about the efficacy of the numerous Glyphosate herbicides on the market was also collected by way of questionnaire. Results of the analysis indicated that only ten (16.4 %) out of the sixty one samples met the Environmental Protection Agency’s requirement of ±5 % of the stated active ingredient concentration and 51 samples representing 83.6 % were all out of the acceptable range. Active ingredient was either understated or overstated. About 21.6 % of the samples that failed to meet requirements were overstated and 78.4 % were understated. Apart from a few of the samples that had concentrations higher than stated label claims with 69 g/L (19.2 %) highest, most samples were generally lower than stated label claims. Some (G09, G18 and G44) samples contained virtually no active ingredient with shortfalls as high as 98.6%. Some of these shortfalls explained findings from the field investigations where some respondents complained of Glyphosate not being efficacious. Farmers may follow the application and safety instructions but this only holds true as long as the herbicides provide efficient control of weed. This can only be achieved with products of consistently high quality. This study also discovered that, there was no possibility of adulteration of the herbicide along the value chain as results for products picked from ware houses of importers did not differ much from those picked from the open market. Results from the other method employed in Glyphosate determination was UV/VIV spectroscopy, this method is simpler and faster and readily available in most laboratories in Ghana. Results from UV/VIS were comparable to that of the HPLC with generally lower values for UV/VIS readings. It is therefore

  6. Non-point source pollution of glyphosate and AMPA in a rural basin from the southeast Pampas, Argentina.

    Science.gov (United States)

    Okada, Elena; Pérez, Débora; De Gerónimo, Eduardo; Aparicio, Virginia; Massone, Héctor; Costa, José Luis

    2018-05-01

    We measured the occurrence and seasonal variations of glyphosate and its metabolite, aminomethylphosphonic acid (AMPA), in different environmental compartments within the limits of an agricultural basin. This topic is of high relevance since glyphosate is the most applied pesticide in agricultural systems worldwide. We were able to quantify the seasonal variations of glyphosate that result mainly from endo-drift inputs, that is, from direct spraying either onto genetically modified (GM) crops (i.e., soybean and maize) or onto weeds in no-till practices. We found that both glyphosate and AMPA accumulate in soil, but the metabolite accumulates to a greater extent due to its higher persistence. Knowing that glyphosate and AMPA were present in soils (> 93% of detection for both compounds), we aimed to study the dispersion to other environmental compartments (surface water, stream sediments, and groundwater), in order to establish the degree of non-point source pollution. Also, we assessed the relationship between the water-table depth and glyphosate and AMPA levels in groundwater. All of the studied compartments had variable levels of glyphosate and AMPA. The highest frequency of detections was found in the stream sediments samples (glyphosate 95%, AMPA 100%), followed by surface water (glyphosate 28%, AMPA 50%) and then groundwater (glyphosate 24%, AMPA 33%). Despite glyphosate being considered a molecule with low vertical mobility in soils, we found that its detection in groundwater was strongly associated with the month where glyphosate concentration in soil was the highest. However, we did not find a direct relation between groundwater table depth and glyphosate or AMPA detections. This is the first simultaneous study of glyphosate and AMPA seasonal variations in soil, groundwater, surface water, and sediments within a rural basin.

  7. Preliminary studies on allelopatic effect of some woody plants on seed germination of rye-grass and tall fescue.

    Science.gov (United States)

    Arouiee, H; Nazdar, T; Mousavi, A

    2010-11-01

    In order to investigation of allelopathic effects of some ornamental trees on seed germination of rye-grass (Lolium prenne) and tall fescue (Festuca arundinaceae), this experiment was conducted in a randomized complete block design with 3 replicates at the laboratory of Horticultural Sciences Department of Ferdowsi University of Mashhad, during 2008. In this research, we studied the effect of aqueous and hydro-alcoholic extracts of Afghanistan pine (Pinus eldarica), arizona cypress (Cupressus arizonica), black locust (Robinia psedue acacia) and box elder (Acer negundo) leaves that prepared in 1:5 ratio on seed germination percent and rate for two grasses. The results showed that all extracts decreased statistically seed germination in compared to control treatment. The highest germination percentage and germination rate of tested grass detected in control treatment. Hydro-alcoholic extracts of all woody plants (15, 30%) were completely inhibited seed germination of rye-grass and tall fescue. Also aqueous extract of arizona cypress was completely inhibited seed germination of tall fescue and had more inhibitory activity than other aqueous extracts on rye-grass. Between aqueous extracts, the highest and lowest seed germination of rye-grass was found in Afghanistan pine and arizona cypress, respectively.

  8. Improved forage digestibility of tall fescue (Festuca arundinacea) by transgenic down-regulation of cinnamyl alcohol dehydrogenase.

    Science.gov (United States)

    Chen, Lei; Auh, Chung-Kyoon; Dowling, Paul; Bell, Jeremey; Chen, Fang; Hopkins, Andrew; Dixon, Richard A; Wang, Zeng-Yu

    2003-11-01

    Lignification of cell walls during plant development has been identified as the major factor limiting forage digestibility and concomitantly animal productivity. cDNA sequences encoding a key lignin biosynthetic enzyme, cinnamyl alcohol dehydrogenase (CAD), were cloned from the widely grown monocotyledonous forage species tall fescue (Festuca arundinacea Schreb.). Recombinant tall fescue CAD expressed in E. coli exhibited the highest V(max)/K(m) values when coniferaldehyde and sinapaldehyde were used as substrates. Transgenic tall fescue plants carrying either sense or antisense CAD gene constructs were obtained by microprojectile bombardment of single genotype-derived embryogenic suspension cells. Severely reduced levels of mRNA transcripts and significantly reduced CAD enzymatic activities were found in two transgenic plants carrying sense and antisense CAD transgenes, respectively. These CAD down-regulated transgenic lines had significantly decreased lignin content and altered ratios of syringyl (S) to guaiacyl (G), G to p-hydroxyphenyl (H) and S to H units. No significant changes in cellulose, hemicellulose, neutral sugar composition, p-coumaric acid and ferulic acid levels were observed in the transgenic plants. Increases of in vitro dry matter digestibility of 7.2-9.5% were achieved in the CAD down-regulated lines, thus providing a novel germplasm to be used for the development of grass cultivars with improved forage quality.

  9. Glyphosate efficacy on sourgrass biotypes with suspected resistance collected in GR-crop fields

    Directory of Open Access Journals (Sweden)

    Hellen Martins da Silveira

    2017-11-01

    Full Text Available In Brazil, infestations of crop areas with glyphosate-resistant (GR sourgrass (Digitaria insularis (L. Fedde biotypes has risen significantly, increasing crop production costs. Glyphosate efficacy on three biotypes (GO, BA and MT of sourgrass with suspected resistance was evaluated. A susceptible biotype (MG was used as the control. The results confirmed that the MG and GO biotypes were susceptible to glyphosate (control > 90%. The MG biotype exhibited growth reduction and mortality by 50% (GR50 and LD50, respectively with mean glyphosate doses of 243.7 and 431.6 g ae ha-1. The resistance index of the biotypes with suspected resistance ranged from 2.8 to 6.1 in relation to GR50 and between 1.4 to 26.7 in relation to LD50. The glyphosate susceptibility ranking of the sourgrass biotypes was MG < GO < MT < BA. The MT and BA biotypes demonstrated high glyphosate resistance levels, and the GO biotype had a high potential to develop resistance. Farmers should avoid the application of glyphosate overdoses to minimize the selection pressure on weeds.

  10. Effects of glyphosate herbicide on the gastrointestinal microflora of Hawaiian green turtles (Chelonia mydas) Linnaeus.

    Science.gov (United States)

    Kittle, Ronald P; McDermid, Karla J; Muehlstein, Lisa; Balazs, George H

    2018-02-01

    In Hawaii, glyphosate-based herbicides frequently sprayed near shorelines may be affecting non-target marine species. Glyphosate inhibits aromatic amino acid biosynthesis (shikimate pathway), and is toxic to beneficial gut bacteria in cattle and chickens. Effects of glyphosate on gut bacteria in marine herbivorous turtles were assessed in vitro. When cultures of mixed bacterial communities from gastrointestinal tracts of freshly euthanized green turtles (Chelonia mydas), were exposed for 24h to six glyphosate concentrations (plus deionized water control), bacterial density was significantly lower at glyphosate concentrations≥2.2×10 -4 gL -1 (absorbance measured at 600nm wavelength). Using a modified Kirby-Bauer disk diffusion assay, the growth of four bacterial isolates (Pantoea, Proteus, Shigella, and Staphylococcus) was significantly inhibited by glyphosate concentrations≥1.76×10 -3 gL -1 . Reduced growth or lower survival of gut bacteria in green turtles exposed to glyphosate could have adverse effects on turtle digestion and overall health. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Glyphosate (Ab)sorption by Shoots and Rhizomes of Native versus Hybrid Cattail (Typha).

    Science.gov (United States)

    Zheng, Tianye; Sutton, Nora B; de Jager, Pim; Grosshans, Richard; Munira, Sirajum; Farenhorst, Annemieke

    2017-11-01

    Wetlands in the Prairie Pothole Region of North America are integrated with farmland and contain mixtures of herbicide contaminants. Passive nonfacilitated diffusion is how most herbicides can move across plant membranes, making this perhaps an important process by which herbicide contaminants are absorbed by wetland vegetation. Prairie wetlands are dominated by native cattail (Typha latifolia) and hybrid cattail (Typha x glauca). The objective of this batch equilibrium study was to compare glyphosate absorption by the shoots and rhizomes of native versus hybrid cattails. Although it has been previously reported for some pesticides that passive diffusion is greater for rhizome than shoot components, this is the first study to demonstrate that the absorption capacity of rhizomes is species dependent, with the glyphosate absorption being significantly greater for rhizomes than shoots in case of native cattails, but with no significant differences in glyphosate absorption between rhizomes and shoots in case of hybrid cattails. Most importantly, glyphosate absorption by native rhizomes far exceeded that of the absorption occurring for hybrid rhizomes, native shoots and hybrid shoots. Glyphosate has long been used to manage invasive hybrid cattails in wetlands in North America, but hybrid cattail expansions continue to occur. Since our results showed limited glyphosate absorption by hybrid shoots and rhizomes, this lack of sorption may partially explain the poorer ability of glyphosate to control hybrid cattails in wetlands.

  12. [Study of the effect of occupational exposure to glyphosate on hepatorenal function].

    Science.gov (United States)

    Zhang, F; Pan, L P; Ding, E M; Ge, Q J; Zhang, Z H; Xu, J N; Zhang, L; Zhu, B L

    2017-07-06

    Objective: To explore the effect of occupational exposure to glyphosate on hepatorenal function. Methods: 526 workers who were occupationally exposed to glyphosate from 5 glyphosate-producing factories were selected as cases; and another 442 administrative staffs who were not exposed to glyphosate were selected as controls from April to November, 2014. All the subjects accepted occupational health examination. The concentration level of glyphosate in the air of workshop was detected and the time weighted average concentration (TWA) was calculated. And analyze the difference of hepatorenal fuction between case group and control group. Result: The age of the subjects in the case and control groups were separately (35.6±10.3), (34.3±9.7) years old, with the length of working for (6.5±5.7), (7.7±6.8) years. The TWA of glyphosate in the case group was between Glyphosate can affect the hepatic and renal function among occupational exposure population, and there was an association between the effect and the exposure dose.

  13. Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean

    International Nuclear Information System (INIS)

    Santos, J.B.; Ferreira, E.A.; Silva, A.A.; Oliveira, J.A.; Fialho, C.M.T.

    2007-01-01

    This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

  14. Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon.

    Science.gov (United States)

    Barroso, Judit; Gourlie, Jennifer A; Lutcher, Larry K; Liu, Mingyang; Mallory-Smith, Carol A

    2018-05-01

    Farmers in the low-rainfall region of eastern Oregon rely on repeated applications of non-selective herbicides, predominately glyphosate, to control Salsola tragus in no-till fallow systems. Reports of poor glyphosate effectiveness have increased in recent years. Reduced efficacy is often attributed to dust, water stress, or generally poor growing conditions during application. Inadequate control also may be the result of the evolution of glyphosate resistance. Therefore, studies were undertaken to determine if glyphosate-resistant S. tragus populations occur in Oregon. Results from dose-response studies confirmed glyphosate resistance in three of 10 Oregon Salsola tragus populations. The ratio I 50R /I 50S from dose-response curves was, on average, 3.1 for the relative dry biomass per plant and 3.2 for the % of surviving plants per pot in these three populations. Plant mortality at recommended glyphosate doses for the resistant populations was less than 30% 3 weeks after treatment. Glyphosate resistance in S. tragus highlights the imperative need to diversify weed control strategies to preserve the longevity and sustainability of herbicides in semi-arid cropping systems of the Pacific Northwest. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. Is it time to reassess current safety standards for glyphosate-based herbicides?

    Science.gov (United States)

    Vandenberg, Laura N; Blumberg, Bruce; Antoniou, Michael N; Benbrook, Charles M; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vom Saal, Frederick S; Welshons, Wade V; Myers, John Peterson

    2017-06-01

    Use of glyphosate-based herbicides (GBHs) increased ∼100-fold from 1974 to 2014. Additional increases are expected due to widespread emergence of glyphosate-resistant weeds, increased application of GBHs, and preharvest uses of GBHs as desiccants. Current safety assessments rely heavily on studies conducted over 30 years ago. We have considered information on GBH use, exposures, mechanisms of action, toxicity and epidemiology. Human exposures to glyphosate are rising, and a number of in vitro and in vivo studies challenge the basis for the current safety assessment of glyphosate and GBHs. We conclude that current safety standards for GBHs are outdated and may fail to protect public health or the environment. To improve safety standards, the following are urgently needed: (1) human biomonitoring for glyphosate and its metabolites; (2) prioritisation of glyphosate and GBHs for hazard assessments, including toxicological studies that use state-of-the-art approaches; (3) epidemiological studies, especially of occupationally exposed agricultural workers, pregnant women and their children and (4) evaluations of GBHs in commercially used formulations, recognising that herbicide mixtures likely have effects that are not predicted by studying glyphosate alone. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  16. Transfer of glyphosate and its degradate AMPA to surface waters through urban sewerage systems.

    Science.gov (United States)

    Botta, Fabrizio; Lavison, Gwenaëlle; Couturier, Guillaume; Alliot, Fabrice; Moreau-Guigon, Elodie; Fauchon, Nils; Guery, Bénédicte; Chevreuil, Marc; Blanchoud, Hélène

    2009-09-01

    A study of glyphosate and aminomethyl phosphonic acid (AMPA) transfer in the Orge watershed (France) was carried out during 2007 and 2008. Water samples were collected in surface water, wastewater sewer, storm sewer and wastewater treatment plant (WWTP). These two molecules appeared to be the most frequently detected ones in the rivers and usually exceeded the European quality standard concentrations of 0.1microg L(-1) for drinking water. The annual glyphosate estimated load was 1.9 kg year(-1) upstream (agricultural zone) and 179.5 kg year(-1) at the catchment outlet (urban zone). This result suggests that the contamination of this basin by glyphosate is essentially from urban origin (road and railway applications). Glyphosate reached surface water prevalently through storm sewer during rainfall event. Maximum concentrations were detected in storm sewer just after a rainfall event (75-90 microg L(-1)). High concentrations of glyphosate in surface water during rainfall events reflected urban runoff impact. AMPA was always detected in the sewerage system. This molecule reached surface water mainly via WWTP effluent and also through storm sewer. Variations in concentrations of AMPA during hydrological episodes were minor compared to glyphosate variations. Our study highlights that AMPA and glyphosate origins in urban area are different. During dry period, detergent degradation seemed to be the major AMPA source in wastewater.

  17. Occurrence and fate of the herbicide glyphosate and its degradate aminomethylphosphonic acid in the atmosphere

    Science.gov (United States)

    Chang, Feng-Chih; Simcik, M.F.; Capel, P.D.

    2011-01-01

    This is the first report on the ambient levels of glyphosate, the most widely used herbicide in the United States, and its major degradation product, aminomethylphosphonic acid (AMPA), in air and rain. Concurrent, weekly integrated air particle and rain samples were collected during two growing seasons in agricultural areas in Mississippi and Iowa. Rain was also collected in Indiana in a preliminary phase of the study. The frequency of glyphosate detection ranged from 60 to 100% in both air and rain. The concentrations of glyphosate ranged from 3 and from <0.1 to 2.5 µg/L in air and rain samples, respectively. The frequency of detection and median and maximum concentrations of glyphosate in air were similar or greater to those of the other high-use herbicides observed in the Mississippi River basin, whereas its concentration in rain was greater than the other herbicides. It is not known what percentage of the applied glyphosate is introduced into the air, but it was estimated that up to 0.7% of application is removed from the air in rainfall. Glyphosate is efficiently removed from the air; it is estimated that an average of 97% of the glyphosate in the air is removed by a weekly rainfall ≥30 mm.

  18. Questions concerning the potential impact of glyphosate-based herbicides on amphibians.

    Science.gov (United States)

    Wagner, Norman; Reichenbecher, Wolfram; Teichmann, Hanka; Tappeser, Beatrix; Lötters, Stefan

    2013-08-01

    Use of glyphosate-based herbicides is increasing worldwide. The authors review the available data related to potential impacts of these herbicides on amphibians and conduct a qualitative meta-analysis. Because little is known about environmental concentrations of glyphosate in amphibian habitats and virtually nothing is known about environmental concentrations of the substances added to the herbicide formulations that mainly contribute to adverse effects, glyphosate levels can only be seen as approximations for contamination with glyphosate-based herbicides. The impact on amphibians depends on the herbicide formulation, with different sensitivity of taxa and life stages. Effects on development of larvae apparently are the most sensitive endpoints to study. As with other contaminants, costressors mainly increase adverse effects. If and how glyphosate-based herbicides and other pesticides contribute to amphibian decline is not answerable yet due to missing data on how natural populations are affected. Amphibian risk assessment can only be conducted case-specifically, with consideration of the particular herbicide formulation. The authors recommend better monitoring of both amphibian populations and contamination of habitats with glyphosate-based herbicides, not just glyphosate, and suggest including amphibians in standardized test batteries to study at least dermal administration. Copyright © 2013 SETAC.

  19. Circadian response of annual weeds to glyphosate and glufosinate.

    Science.gov (United States)

    Martinson, Krishona B; Sothern, Robert B; Koukkari, Willard L; Durgan, Beverly R; Gunsolus, Jeffrey L

    2002-03-01

    Five field experiments were conducted in 1998 and 1999 in Minnesota to examine the influence of time of day efficacy of glyphosate [N-(phosphonomethyl)glycine] and glufosinate [2-amino-4-(hydroxymethyl-phosphinyl)butanoic acid] applications on the control of annual weeds. Each experiment was designed to be a randomized complete block with four replications using plot sizes of 3 x 9 m. Glyphosate and glufosinate were applied at rates of 0.421 kg ae/ha and 0.292 kg ai/ha, respectively, with and without an additional adjuvant that consisted of 20% nonionic surfactant and 80% ammonium sulfate. All treatments were applied with water at 94 L/ha. Times of day for the application of herbicide were 06:00h, 09:00h, 12:00h, 15:00h, 18:00h, 21:00h, and 24:00h. Efficacy was evaluated 14 d after application by visual ratings. At 14 d, a circadian response to each herbicide was found, with greatest annual weed control observed with an application occurring between 09:00h and 18:00h and significantly less weed control observed with an application at 06:00h, 21:00h, or 24:00h. The addition of an adjuvant to both herbicides increased overall efficacy, but did not overcome the rhythmic time of day effect. Results of the multiple regression analysis showed that after environmental temperature, time of day was the second most important predictor of percent weed kill. Thus, circadian timing of herbicide application significantly influenced weed control with both glyphosate and glufosinate.

  20. Effect of glyphosate on the microbial activity of two Romanian soils.

    Science.gov (United States)

    Sumalan, R M; Alexa, E; Negrea, M; Sumalan, R L; Doncean, A; Pop, G

    2010-01-01

    Glyphosate applied to soils potentially affect microbial activity. A series of field and laboratory experiments assessed the effect of this herbicide on soil microorganisms. The aim of experiments was to evaluate the effect of glyphosate application on the soil microbial community structure, function and their activity. We studied "in vitro", changes in the microbial activity of typical Chernozem and Gleysol soils, with and without applied glyphosate. The herbicide was applied at a rate of 2, respectively 4 mg kg(-1) of soil and microbial activity were measured by fluorescein diacetate (FDA) hydrolysis. We found an increase of 9 to 13% in FDA hydrolyses in the presence of glyphosate in rate of 2 mg kg (-1) compared with the same type of soil which had never received herbicide. The double quantity of glyphosate decrease soil microbial activity; the amount of hydrolyzed fluorescein is lower than the addition of 2 ppm. The greater decrease was observed in the Gleysol type where the fluorescein hydrolyzed is with 4, 85% lower than version control without glyphosate. Chemical characters of soil, influence soil biological activity when herbicide is added. In Chemozem case, rich in humus, whose predominant micro flora is represented by actinomycetes through glyphosate treatment these organisms growths of as major producers of antibiotics actinomycetes determine an inhibitory effect on eubacteria and micromycetes growth, which is highlighted by estimating a relatively small number of them. After 10 days, once with decreasing of glyphosate content in soil, decreases the number of active actinomycetes, therefore we are witnessing to a numerical growth of bacterial population. In Gleysol type the indigenous micro flora is represented by eubacteria, so when the glyphosate is added it was registered a high growth of these organisms fraction.

  1. Effect of foliar treatments on distribution of 14C-glyphosate in Convolvulus arvensis L

    International Nuclear Information System (INIS)

    Lauridson, T.C.

    1986-01-01

    Field bindweed is a perennial weed which produces shoots from buds on its roots. Herbicides, such as glyphosate [N-(phosphonomethyl)glycine] used for control of field bindweed usually do not kill all shoot buds on the roots, thus field bindweed often reinfests areas within 3 to 6 weeks of treatment. This dissertation deals with the development of a technique to change glyphosate distribution in field bindweed roots and could result in less shoot regrowth after glyphosate application. In field studies eight plant growth regulators were applied in September, 3 days before 2.24 kg/ha of 2.4-D[(2,4-dichlorophenoxy) acetic acid] or 1.68 kg/ha of glyphosate. Eight months later, regrowth of shoots was least where glyphosate was applied at 0.028 kg/ha as a pretreatment, followed by a standard rate of 1.68 kg/ha. In subsequent greenhouse studies, typical patterns of shoot growth and 14 C-glyphosate distribution in isolated root sections taken from 15-week-old intact plants were determined. In subsequent growth chamber studies, plants were decapitated to observe the effect of shoot apical dominance on 14 C-glyphosate translocation. After 14 C-glyphosate was applied, intact plants had about twice as much 14 C in distal root sections as in proximal or middle root sections. Decapitated plants had more 14 C in proximal and middle root sections than in distal sections, and about twice as much 14 C was translocated to roots of decapitated plants than intact plants. Eight concentrations of 2,4,-D or glyphosate from 1 to 5000 ppm were applied in logarithmic series to 6-week old plants

  2. Phytoplankton growth and PSII efficiency sensitivity to a glyphosate-based herbicide (Factor 540®).

    Science.gov (United States)

    Smedbol, Élise; Lucotte, Marc; Labrecque, Michel; Lepage, Laurent; Juneau, Philippe

    2017-11-01

    The use of glyphosate-based herbicides in agriculture has increased steadily since the mid 90's and there is now evidence of glyphosate leaching and contamination of aquatic ecosystems. The aim of this study was to evaluate the effects of a glyphosate-based herbicide (Factor 540 ® ) on growth and photosynthetic capacity of algae and cyanobacteria. Six algal and three cyanobacterial species/strains, of three different taxonomic groups, were exposed to five glyphosate concentrations (10, 50, 100, 500 and 1000μgl -1 ) during 48h. All species have significant growth inhibition at concentrations varying between 50 and 500μgl -1 . The photosynthetic response, after glyphosate exposure, varied among species, but a general pattern has emerged. There was an increase in the amount of photons absorbed (ABS/RC), in dissipated (DI O /RC) and trapped (TR O /RC) energy in the photosystem II reaction centers, along with a decreased of the maximum photosystem II quantum yield (F V /F M ) and electron transport per reaction center (ET O /RC). The EC 50 and LOEC values for growth and photosynthesis were calculated and established that growth was the most affected parameter by glyphosate-based herbicide, while parameter TR O /RC was the least affected. All species showed reduced growth at glyphosate concentrations lower than the Canadian standard for the protection of aquatic life, set at 800μgl -1 or the American aquatic life benchmark for acute toxicity in non vascular plants of 12 100μgl -1 questioning the validity of these thresholds in assessing the risks related to the presence of glyphosate and glyphosate-based herbicides in aquatic systems. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  3. Cancer incidence among glyphosate-exposed pesticide applicators in the Agricultural Health Study.

    Science.gov (United States)

    De Roos, Anneclaire J; Blair, Aaron; Rusiecki, Jennifer A; Hoppin, Jane A; Svec, Megan; Dosemeci, Mustafa; Sandler, Dale P; Alavanja, Michael C

    2005-01-01

    Glyphosate is a broad-spectrum herbicide that is one of the most frequently applied pesticides in the world. Although there has been little consistent evidence of genotoxicity or carcinogenicity from in vitro and animal studies, a few epidemiologic reports have indicated potential health effects of glyphosate. We evaluated associations between glyphosate exposure and cancer incidence in the Agricultural Health Study (AHS), a prospective cohort study of 57,311 licensed pesticide applicators in Iowa and North Carolina. Detailed information on pesticide use and other factors was obtained from a self-administered questionnaire completed at time of enrollment (1993-1997). Among private and commercial applicators, 75.5% reported having ever used glyphosate, of which > 97% were men. In this analysis, glyphosate exposure was defined as a) ever personally mixed or applied products containing glyphosate; b) cumulative lifetime days of use, or "cumulative exposure days" (years of use times days/year); and c) intensity-weighted cumulative exposure days (years of use times days/year times estimated intensity level). Poisson regression was used to estimate exposure-response relations between glyphosate and incidence of all cancers combined and 12 relatively common cancer subtypes. Glyphosate exposure was not associated with cancer incidence overall or with most of the cancer subtypes we studied. There was a suggested association with multiple myeloma incidence that should be followed up as more cases occur in the AHS. Given the widespread use of glyphosate, future analyses of the AHS will allow further examination of long-term health effects, including less common cancers.

  4. Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents.

    Science.gov (United States)

    Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J Christopher; Ugarte, Ricardo; Antoniou, Michael N

    2017-10-01

    The safety, including the endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased the expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBluc cells, which was blocked by the estrogen antagonist ICI 182,780. Commercial GBH formulations or their adjuvants alone did not exhibit estrogenic effects in either assay. Transcriptomics analysis of MCF-7 cells treated with glyphosate revealed changes in gene expression reflective of hormone-induced cell proliferation but did not overlap with an ERα gene expression biomarker. Calculation of glyphosate binding energy to ERα predicts a weak and unstable interaction (-4.10 kcal mol -1 ) compared to estradiol (-25.79 kcal mol -1 ), which suggests that activation of this receptor by glyphosate is via a ligand-independent mechanism. Induction of ERE-luc expression by the PKA signalling activator IBMX shows that ERE-luc is responsive to ligand-independent activation, suggesting a possible mechanism of glyphosate-mediated activation. Our study reveals that glyphosate, but not other components present in GBHs, can activate ERα in vitro, albeit at relatively high concentrations. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

    Energy Technology Data Exchange (ETDEWEB)

    Albers, Christian N., E-mail: calbers@ruc.d [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark); Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Banta, Gary T. [Dept. of Environmental, Social and Spatial Change, Roskilde University, DK-4000 Roskilde (Denmark); Hansen, Poul Erik [Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Jacobsen, Ole S. [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark)

    2009-10-15

    Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, approx40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only approx10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

  6. The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

    International Nuclear Information System (INIS)

    Albers, Christian N.; Banta, Gary T.; Hansen, Poul Erik; Jacobsen, Ole S.

    2009-01-01

    Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, ∼40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only ∼10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

  7. Placental passage of benzoic acid, caffeine, and glyphosate in an ex vivo human perfusion system

    DEFF Research Database (Denmark)

    Mose, Tina; Kjaerstad, Mia Birkhoej; Mathiesen, Line

    2008-01-01

    group of compounds. Benzoic acid, caffeine, and glyphosate were chosen as model compounds because they are small molecules with large differences in physiochemical properties. Caffeine crossed the placenta by passive diffusion. The initial transfer rate of benzoic acid was more limited in the first part...... of the perfusion compared to caffeine, but reached the same steady-state level by the end of perfusion. The transfer of glyphosate was restricted throughout perfusion, with a lower permeation rate, and only around 15% glyphosate in maternal circulation crossed to the fetal circulation during the study period....

  8. Glyphosate Accumulation and Detrimental Effects on Coffea Arabica

    DEFF Research Database (Denmark)

    Schrübbers, Lars Christoph

    and the MS/MS system provided a limit of quantification (LOQ) below 0.1 mg/kg; the commonly used maximum residue limit (MRL) for glyphosate in plant derived food products. Glyphosate was found in all samples analyzed from different coffee fields, regardless of management practices. AMPA was not detected......Coffee is one of the most popular beverages worldwide and a highly traded commodity. In order to maintain a high yield of the perennial crop, weed competition for resources needs to be reduced. For this purpose herbicides are commonly applied, with glyphosate being one of the most prominent...

  9. Temporal Patterns of Glyphosate Leaching at a Loamy Agricultural Field in Denmark

    DEFF Research Database (Denmark)

    Nørgaard, Trine; Møldrup, Per; Olsen, Preben

    2013-01-01

    applications in combination with the effect of precipitation events, drain water runoff, soil water content at 25 cm soil depth, management, and particle leaching patterns, and compares this with monitored field-scale glyphosate and AMPA leaching to a tile drainage system. Preliminary findings indicate...... that there is an accumulation of glyphosate and AMPA in the soil after the successive applications of glyphosate, as the level of the peaking concentrations right after applications increases. Furthermore, large precipitation events with subsequent high drain water runoff together with management, especially plowing...

  10. Leaching of Glyphosate and Aminomethylphosphonic Acid from an Agricultural Field over a Twelve-Year Period

    DEFF Research Database (Denmark)

    Norgaard, Trine; Moldrup, Per; Ferré, Ty P A

    2014-01-01

    content at the time of application and the level of the groundwater table relative to the drain depth was essential for whether solutes were detected in the drainage runoff. We present a leaching risk chart to illustrate the dependence of glyphosate, AMPA, and soil particle leaching based on precipitation......, and particles. Glyphosate and AMPA leaching were highly event driven, controlled by the time and intensity of the first precipitation event after glyphosate application. A high similarity in time-accumulated curves for drainage and leached pesticide masses suggests near-constant drainage and leaching rates...

  11. Efecto de la dosis de glifosato sobre la biomasa de malezas de barbecho al estado vegetativo y reproductivo Glyphosate dose effect on weed biomass at the vegetative and reproductive stage

    Directory of Open Access Journals (Sweden)

    E. Puricelli

    2009-06-01

    Full Text Available Los experimentos se condujeron en el campo experimental de la Facultad de Ciencias Agrarias ubicado en Zavalla (Argentina durante 2005 y 2006. El objetivo de este trabajo fue estudiar la eficacia de glifosato aplicado al estado vegetativo y reproductivo de Convolvulus arvensis, Oenothera indecora, Iresine diffusa, Parietaria debilis, Rumex paraguayensis y Trifolium repens. El diseño del experimento fue completamente al azar con un arreglo factorial: año, especies, estado reproductivo y vegetativo y dosis de glifosato 48% (4X, 2X, 1X, 1/2X, 1/4X, 0X siendo X la dosis recomendada 1200 g i.a. ha-1. Se estableció la relación entre la dosis de glifosato y el control de la biomasa de las malezas a través de curvas de dosis respuesta con un modelo log-logístico. Se comparó el grado de tolerancia por medio de la DL50. En ambos estados de las malezas, la mayor DL50 obtenida para I. diffusa indica que de las especies estudiadas ésta es la más tolerante a glifosato. El número de especies tolerantes al glifosato es menor al estado vegetativo que al reproductivo.Experiments were conducted at the University of Rosario Experimental Farm, Zavalla in 2005 and 2006 to study the effect of glyphosate on the control of Convolvulus arvensis, Oenothera indecora, Iresine diffusa, Parietaria debilis, Rumex paraguayensis and Trifolium repens at the vegetative and reproductive stage. The experiments were established in a complete randomized design with the following factorial arrangement of treatments: year, species, vegetative and reproductive growth stages and glyphosate 48% (4X, 2X, 1X, 1/2X, 1/4X, 0X being 1X the recommended dose (1,200 g a.i. ha-1. The relationship between glyphosate dose and weed biomass control was established with a log-logistic model. The degree of tolerance was compared by LD50. In both stages, the higher LD50 was obtained for I. diffusa indicating that this is the species most tolerant to glyphosate among those studied. The number of

  12. Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines

    Directory of Open Access Journals (Sweden)

    Travert Carine

    2010-10-01

    Full Text Available Abstract Background Worldwide used pesticides containing different adjuvants like Roundup formulations, which are glyphosate-based herbicides, can provoke some in vivo toxicity and in human cells. These pesticides are commonly found in the environment, surface waters and as food residues of Roundup tolerant genetically modified plants. In order to know their effects on cells from liver, a major detoxification organ, we have studied their mechanism of action and possible protection by precise medicinal plant extracts called Dig1. Methods The cytotoxicity pathways of four formulations of glyphosate-based herbicides were studied using human hepatic cell lines HepG2 and Hep3B, known models to study xenobiotic effects. We monitored mitochondrial succinate dehydrogenase activity and caspases 3/7 for cell mortality and protection by Dig1, as well as cytochromes P450 1A1, 1A2, 3A4 and 2C9 and glutathione-S-transferase to approach the mechanism of actions. Results All the four Roundup formulations provoke liver cell death, with adjuvants having stronger effects than glyphosate alone. Hep3B are 3-5 times more sensitive over 48 h. Caspases 3/7 are greatly activated in HepG2 by Roundup at non-cytotoxic levels, and some apoptosis induction by Roundup is possible together with necrosis. CYP3A4 is specifically enhanced by Roundup at doses 400 times less than used in agriculture (2%. CYP1A2 is increased to a lesser extent together with glutathione-S-transferase (GST down-regulation. Dig 1, non cytotoxic and not inducing caspases by itself, is able to prevent Roundup-induced cell death in a time-dependant manner with an important efficiency of up to 89%, within 48 h. In addition, we evidenced that it prevents Caspases 3/7 activation and CYP3A4 enhancement, and not GST reduction, but in turn it slightly inhibited CYP2C9 when added before Roundup. Conclusion Roundup is able to provoke intracellular disruption in hepatic cell lines at different levels, but a

  13. Glyphosate behavior at soil and mineral-water interfaces

    International Nuclear Information System (INIS)

    Pessagno, Romina C.; Torres Sanchez, Rosa M.; Santos Afonso, Maria dos

    2008-01-01

    Adsorption isotherms and surface coverage of glyphosate, N-phosphonomethylglycine (PMG), in aqueous suspensions of three Argentine soils with different mineralogical composition were measured as a function of PMG concentration and pH. Zeta potential curves for PMG/soils system were also determined. Montmorillonite and soil sample surface charges were negative and increased as the amount of adsorbed PMG increased, showing that the surface complexes are more negative than those formed during the surface protonation. PMG adsorption on soils were described using Langmuir isotherms and the affinity constants, and the maximum surface coverage was estimated at pH 4 and 7 using a two-term Langmuir isotherm, the mineralogical composition percentages, and maximum surface coverage and Langmuir constants for pure minerals. The influence of organic matter (OM) and iron content of soils on the PMG adsorption was evaluated. The surface coverage of PMG decreased when the OM and iron content decreased for minerals and soils. - Adsorption isotherms, surface coverage and zeta potential curves of glyphosate in aqueous suspensions of montmorillonite and three Argentine soils were measured as a function of PMG concentration and pH

  14. Glyphosate behavior at soil and mineral-water interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Pessagno, Romina C. [INQUIMAE and Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria Pabellon II, (C1428EHA) Buenos Aires (Argentina)], E-mail: rpessagno@qi.fcen.uba.ar; Torres Sanchez, Rosa M. [CETMIC, CC 49, (B1896ZCA) M.B. Gonnet, Buenos Aires Province (Argentina)], E-mail: rosats@cetmic.unlp.edu.ar; Santos Afonso, Maria dos [INQUIMAE and Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria Pabellon II, (C1428EHA) Buenos Aires (Argentina)], E-mail: dosantos@qi.fcen.uba.ar

    2008-05-15

    Adsorption isotherms and surface coverage of glyphosate, N-phosphonomethylglycine (PMG), in aqueous suspensions of three Argentine soils with different mineralogical composition were measured as a function of PMG concentration and pH. Zeta potential curves for PMG/soils system were also determined. Montmorillonite and soil sample surface charges were negative and increased as the amount of adsorbed PMG increased, showing that the surface complexes are more negative than those formed during the surface protonation. PMG adsorption on soils were described using Langmuir isotherms and the affinity constants, and the maximum surface coverage was estimated at pH 4 and 7 using a two-term Langmuir isotherm, the mineralogical composition percentages, and maximum surface coverage and Langmuir constants for pure minerals. The influence of organic matter (OM) and iron content of soils on the PMG adsorption was evaluated. The surface coverage of PMG decreased when the OM and iron content decreased for minerals and soils. - Adsorption isotherms, surface coverage and zeta potential curves of glyphosate in aqueous suspensions of montmorillonite and three Argentine soils were measured as a function of PMG concentration and pH.

  15. Glyphosate: useful, dangerous? To license or to phase out?

    Directory of Open Access Journals (Sweden)

    Karl Ernst v. Mühlendahl, Matthias Otto

    2016-12-01

    Full Text Available Glyphosate, a herbicide blocking an enzyme essential for all plants, but not for animals and humans, has certain advantages as compared to other plant protection products. It is not persistent. Due to the production and application of more than 700.000 tons per year, large portions of mankind are exposed. The International Agency on Research on Cancer (IARC of the World Health Organisation (WHO has looked more closely on glyphosate and has classified it as “probably carcinogenic for humans (2A” The German Bundesamt für Risikobewertung (BfR and the European Food Safety Authority (EFSA have analysed the data and contradict the IARC classification. In this paper, the process of decision finding and essential arguments for the contradictory classification are commented. In the ensuing public discussions, conflicts could have been rationalized if the BfR and the EFSA had offered more transparency regarding their evaluation and had restricted their opinions and their proposals to their genuine task: to propose regulations concerning the risks (which follow from possible hazards.

  16. Differential content of glyphosate and its metabolites in Digitaria insularis biotypes

    Directory of Open Access Journals (Sweden)

    Leonardo Bianco de Carvalho

    2013-07-01

    Full Text Available Experiments were carried out in controlled conditions to analyze the role of metabolism of glyphosate in Digitaria insularis (sourgrass biotypes with differential response to the herbicide. Contents of glyphosate, aminomethylphosphonic acid (AMPA, glyoxylate, and sarcosine was detected in leaf tissues by using reversed-polarity capillarity electrophoresis. Glyphosate content in the A biotype increased from 19.7 up to 65.5 µg g fresh weight-1, whereas decreasing from 19.9 down to 5.0 µg g fresh weight-1 in the B biotype, from 48 up to 168 hours after treatment. At 168 hours after treatment, percentage of the sum of AMPA, glyoxylate, and sarcosine was > 56% in the B biotype, whereas a small percentage of metabolites (< 10% was found in the A biotype. Thus, the faster herbicide degradation in the B biotype is evidence that a differential metabolism of glyphosate can be conferring its lesser susceptibility to the herbicide.

  17. Glyphosate herbicide affects belowground interactions between earthworms and symbiotic mycorrhizal fungi in a model ecosystem

    Science.gov (United States)

    Zaller, Johann G.; Heigl, Florian; Ruess, Liliane; Grabmaier, Andrea

    2014-01-01

    Herbicides containing glyphosate are widely used in agriculture and private gardens, however, surprisingly little is known on potential side effects on non-target soil organisms. In a greenhouse experiment with white clover we investigated, to what extent a globally-used glyphosate herbicide affects interactions between essential soil organisms such as earthworms and arbuscular mycorrhizal fungi (AMF). We found that herbicides significantly decreased root mycorrhization, soil AMF spore biomass, vesicles and propagules. Herbicide application and earthworms increased soil hyphal biomass and tended to reduce soil water infiltration after a simulated heavy rainfall. Herbicide application in interaction with AMF led to slightly heavier but less active earthworms. Leaching of glyphosate after a simulated rainfall was substantial and altered by earthworms and AMF. These sizeable changes provide impetus for more general attention to side-effects of glyphosate-based herbicides on key soil organisms and their associated ecosystem services. PMID:25005713

  18. The effect of glyphosate on import into a sink leaf of sugar beet

    International Nuclear Information System (INIS)

    Shieh, Wenjang; Geiger, D.R.

    1990-01-01

    The basis for glyphosate inducted limitation of carbon import into developing leaves was studied in sugar beet. To separate the effects of the herbicide on export from those on import, glyphosate was supplied to a developing leaf from two exporting source leaves which fed the sink leaf. Carbon import into the sink leaf was determined by supplying 14 CO 2 to a third source leaf which also supplies carbon to the monitored sink leaf. Import into the sink leaf decreased within 2 to 3 h after glyphosate application, even though photosynthesis and export in the source leaf supplying 14 C were unaffected. Reduced import into the sink leaf was accompanied by increased import by the tap root. Elongation of the sink leaf was only slightly decreased following arrival of glyphosate. Photosynthesis by the sink leaf was not inhibited. The results to data support the view that import is slowed by the inhibition of synthesis of structural or storage compounds in the developing leaves

  19. Influence of palm oil on the efficacy of glyphosate in the control of Cyperus rotondus L

    International Nuclear Information System (INIS)

    Mohamad, R.B.; Dzolkhifli Omar

    1998-01-01

    The influence of the addition of palm oil to the formulation on the efficacy of glyphosate for the control of Cyperus rotundus was evaluated in the laboratory, glass-house and field. Triton X-100 failed to maintain a stable emulsion of palm oil in the formulation 10 minutes after mixing. In glass-house experiments adding mineral oil and palm oil to the glyphosate spray mixture did not increase the herbicidal efficacy. In general, glyphosate was more effective when sprayed at the volume application rate of 100 L/ha than at 400 L/ha. In contrast to the glass-house studies, in the field trial the addition of palm oil increased the efficacy of glyphosate. (author)

  20. Stimulation of bacteria and protists in rhizosphere of glyphosate-treated barley

    DEFF Research Database (Denmark)

    Imparato, Valentina; Santos, Susana; Johansen, Anders

    2016-01-01

    and protist communities to foliar application of glyphosate, we measured bacterial and protist abundance, diversity and physiological status, as well as soil organic carbon. Foliar application of glyphosate doubled bacterial abundance of the culturable fraction present in the rhizosphere compared to the other...... treatments with no effect on total abundance. Also the abundance of culturable protists increased as an effect of glyphosate and the bacterial genetic diversity as revealed by 16S rDNA DGGE analysis was affected. Overall, the results indicate that when barley leaves are treated with glyphosate......, the availability of organic carbon in the rhizosphere of the dying roots is altered, which in turn may alter the bacterial and protist communities and their interactions. This can have implications for general soil carbon turnover processes and CO2 release in arable systems....

  1. Potential use of Lemna minor for the phytoremediation of isoproturon and glyphosate.

    Science.gov (United States)

    Dosnon-Olette, Rachel; Couderchet, Michel; Oturan, Mehmet A; Oturan, Nihal; Eullaffroy, Philippe

    2011-07-01

    Pesticides are being detected in water bodies on an increasingly frequent basis. The present study focused on toxicity and phytoremediation potential of aquatic plants to remove phytosanitary products from contaminated water. We investigated the capacity of Lemna minor (L. minor) to eliminate two herbicides isoproturon and glyphosate from their medium. Since phytoremediation relies on healthy plants, pesticide toxicity was evaluated by exposing plants to 5 concentrations (0-20 microg L(-1) for isoproturon and 0-120 microg L(-1) for glyphosate) in culture media for 4 d using growth rate and chlorophyll a fluorescence as endpoints. At exposure concentrations of 10 microg x L(-1) for isoproturon and 80 microg x L(-1) for glyphosate, effects on growth rate and chlorophyll fluorescence were minor (isoproturon and glyphosate, respectively.

  2. Glyphosate-Induced Specific and Widespread Perturbations in the Metabolome of Soil Pseudomonas Species

    Directory of Open Access Journals (Sweden)

    Ludmilla Aristilde

    2017-06-01

    Full Text Available Previous studies have reported adverse effects of glyphosate on crop-beneficial soil bacterial species, including several soil Pseudomonas species. Of particular interest is the elucidation of the metabolic consequences of glyphosate toxicity in these species. Here we investigated the growth and metabolic responses of soil Pseudomonas species grown on succinate, a common root exudate, and glyphosate at different concentrations. We conducted our experiments with one agricultural soil isolate, P. fluorescens RA12, and three model species, P. putida KT2440, P. putida S12, and P. protegens Pf-5. Our results demonstrated both species- and strain-dependent growth responses to glyphosate. Following exposure to a range of glyphosate concentrations (up to 5 mM, the growth rate of both P. protegens Pf-5 and P. fluorescens RA12 remained unchanged whereas the two P. putida strains exhibited from 0 to 100% growth inhibition. We employed a 13C-assisted metabolomics approach using liquid chromatography-mass spectrometry to monitor disruptions in metabolic homeostasis and fluxes. Profiling of the whole-cell metabolome captured deviations in metabolite levels involved in the tricarboxylic acid cycle, ribonucleotide biosynthesis, and protein biosynthesis. Altered metabolite levels specifically in the biosynthetic pathway of aromatic amino acids (AAs, the target of toxicity for glyphosate in plants, implied the same toxicity target in the soil bacterium. Kinetic flux experiments with 13C-labeled succinate revealed that biosynthetic fluxes of the aromatic AAs were not inhibited in P. fluorescens Pf-5 in the presence of low and high glyphosate doses but these fluxes were inhibited by up to 60% in P. putida KT2440, even at sub-lethal glyphosate exposure. Notably, the greatest inhibition was found for the aromatic AA tryptophan, an important precursor to secondary metabolites. When the growth medium was supplemented with aromatic AAs, P. putida S12 exposed to a lethal

  3. Glyphosate and AMPA in U.S. streams, groundwater, precipitation and soils

    Science.gov (United States)

    Battaglin, William A.; Meyer, Michael T.; Kuivila, Kathryn; Dietze, Julie E.

    2014-01-01

    Herbicides containing glyphosate are used in more than 130 countries on more than 100 crops. In the United States (U.S.), agricultural use of glyphosate [N-(phosphonomethyl)glycine] has increased from less than 10,000 metric tons per year (active ingredient) in 1993 to more than 70,000 metric tons per year in 2006. In 2006, glyphosate accounted for about 20 percent of all herbicide use (by weight of active ingredient). Glyphosate formulations such as Roundup® are used in homes and in agriculture. Part of the reason for the popularity of glyphosate is the perception that it is an “environmentally benign” herbicide that has low toxicity and little mobility or persistence in the environment. The U.S. Geological Survey developed an analytical method using liquid chromatography/tandem mass spectrometry that can detect small amounts of glyphosate and its primary degradation product aminomethylphosphonic acid (AMPA) in water and sediment. Results from more than 2,000 samples collected from locations distributed across the U.S. indicate that glyphosate is more mobile and occurs more widely in the environment than was previously thought. Glyphosate and AMPA were detected (reporting limits between 0.1 and 0.02 micrograms per liter) in samples collected from surface water, groundwater, rainfall, soil water, and soil, at concentrations from less than 0.1 to more than 100 micrograms per liter. Glyphosate was detected more frequently in rain (86%), ditches and drains (71%), and soil (63%); and less frequently in groundwater (3%) and large rivers (18%). AMPA was detected more frequently in rain (86%), soil (82%), and large rivers (78%); and less frequently in groundwater (8%) and wetlands or vernal pools (37%). Most observed concentrations of glyphosate were well below levels of concern for humans or wildlife, and none exceeded the U.S. Environmental Protection Agency’s Maximum Contaminant Level of 700 micrograms per liter. However, the ecosystem effects of chronic low

  4. Effect of surfactants on the penetration of 14C-glyphosate in Cyperus rotundus in Pakistani agroclimatic conditions

    International Nuclear Information System (INIS)

    Jamil Qureshi, M.; Anwarul Haq; Uzma Maqbool

    1998-01-01

    The penetration of 14 C-glyphosate was studied in Cyperus rotundus with three nonionic surfactants. Among the three surfactants Synperonic A20 was more effective than A2 and A7 in enhancing penetration of glyphosate 24 hours after treatment both in dry and wet seasons. The addition of diesel oil to Synperonic A20 further increased penetration of glyphosate in both seasons. (author)

  5. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    OpenAIRE

    Gris,Cristiane Fortes; Pinho,Edila Vilela de Resende Von; Carvalho,Maria Laene de Moreira; Diniz,Rafael Parreira; Andrade,Thaís de

    2013-01-01

    Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the muni...

  6. Glyphosate and glufosinate-ammonium runoff from a corn-growing area in Italy

    OpenAIRE

    Screpanti , Claudio; Accinelli , Cesare; Vicari , Alberto; Catizone , Pietro

    2005-01-01

    International audience; The main objective of this experiment was to estimate field-scale runoff losses of glyphosate and glufosinate-ammonium under natural rainfall conditions. Investigations were carried out at the Runoff Monitoring Station of the University of Bologna (Italy). Glyphosate and glufosinate-ammonium were applied as pre-emergence herbicides on 350-m2 field plots characterized by a uniform slope of 15%. Field plots were cultivated with corn. The persistence and sorption isotherm...

  7. Agricultural impacts of glyphosate-resistant soybean cultivation in South America.

    Science.gov (United States)

    Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B

    2011-06-08

    In the 2009/2010 growing season, Brazil was the second largest world soybean producer, followed by Argentina. Glyphosate-resistant soybeans (GRS) are being cultivated in most of the soybean area in South America. Overall, the GRS system is beneficial to the environment when compared to conventional soybean. GRS resulted in a significant shift toward no-tillage practices in Brazil and Argentina, but weed resistance may reduce this trend. Probably the highest agricultural risk in adopting GRS in Brazil and South America is related to weed resistance due to use of glyphosate. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. Five weed species, in order of importance, Conyza bonariensis (L.) Cronquist, Conyza canadensis (L.) Cronquist, Lolium multiflorum Lam., Digitaria insularis (L.) Mez ex Ekman, and Euphorbia heterophylla L., have evolved resistance to glyphosate in GRS in Brazil. Conyza spp. are the most difficult to control. A glyphosate-resistant biotype of Sorghum halepense L. has evolved in GRS in Argentina and one of D. insularis in Paraguay. The following actions are proposed to minimize weed resistance problem: (a) rotation of GRS with conventional soybeans in order to rotate herbicide modes of action; (b) avoidance of lower than recommended glyphosate rates; (c) keeping soil covered with a crop or legume at intercrop intervals; (d) keeping machinery free of weed seeds; and (d) use of a preplant nonselective herbicide plus residuals to eliminate early weed interference with the crop and to minimize escapes from later applications of glyphosate due to natural resistance of older weeds and/or incomplete glyphosate coverage.

  8. Evaluation of genetic damage induced by glyphosate isopropylamine salt using Tradescantia bioassays

    OpenAIRE

    Alvarez-Moya, Carlos; Reynoso Silva, Mónica; Villalobos Arámbula, Alma Rosa; Islas Sandoval, Alfonso; Castañeda Vasquez, Hugo; González Montes, Rosa María

    2010-01-01

    Glyphosate is noted for being non-toxic in fishes, birds and mammals (including humans). Nevertheless, the degree of genotoxicity is seriously controversial. In this work, various concentrations of a glyphosate isopropylamine salt were tested using two methods of genotoxicity assaying, viz., the pink mutation assay with Tradescantia (4430) and the comet assay with nuclei from staminal cells of the same plant. Staminal nuclei were studied in two different forms, namely nuclei from exposed plan...

  9. Epidemiological studies on glyphosate - No new findings for the European risk assessment

    OpenAIRE

    German Federal Institute for Risk Assessment

    2016-01-01

    The assessment of epidemiological studies on the health effects of glyphosate is currently being discussed in the media. In this context, BfR evaluated a so-called expert opinion on epidemiological studies prepared by non-government organisations and concludes that no new findings are being reported for the joint European assessment of the active substance glyphosate. The accusations brought forth in the so-called expert opinion of scientific deception by the assessment authorities are c...

  10. Nitrogen loss in Brachiaria decumbens after application of glyphosate or glufosinate-ammonium

    OpenAIRE

    Damin,Virginia; Franco,Henrique Coutinho Junqueira; Moraes,Milton Ferreira; Franco,Ademir; Trivelin,Paulo Cesar Ocheuze

    2008-01-01

    Nitrogen losses from the soil-plant system may be influenced by herbicide applications. In order to evaluate N loss in brachiaria (Brachiaria decumbens) after application of the herbicides glyphosate and glufosinate-ammonium, an experiment was carried out in a greenhouse as a completely randomized design, with three treatments and six replicates. Treatments were as follows: i) desiccation of brachiaria-plants with glyphosate; ii) desiccation of brachiaria-plants with glufosinate-ammonium; and...

  11. Clastogenic Effects of Glyphosate in Bone Marrow Cells of Swiss Albino Mice

    International Nuclear Information System (INIS)

    Prasad, S.; Srivastava, S.; Singh, M.; Shukla, Y.

    2009-01-01

    Glyphosate (N-(phosphonomethyl) glycine, C 3 H 8 NO 5 P), a herbicide, used to control unwanted annual and perennial plants all over the world. Nevertheless, occupational and environmental exposure to pesticides can pose a threat to nontarget species including human beings. Therefore, in the present study, genotoxic effects of the herbicide glyphosate were analyzed by measuring chromosomal aberrations (CAs) and micronuclei (MN) in bone marrow cells of Swiss albino mice. A single dose of glyphosate was given intraperitoneally (i.p) to the animals at a concentration of 25 and 50 mg/kg b.wt. Animals of positive control group were injected i.p. benzo(a)pyrene (100 mg/kg b.wt., once only), whereas, animals of control (vehicle) group were injected i.p. dimethyl sulfoxide (0.2 mL). Animals from all the groups were sacrificed at sampling times of 24, 48, and 72 hours and their bone marrow was analyzed for cytogenetic and chromosomal damage. Glyphosate treatment significantly increases CAs and MN induction at both treatments and time compared with the vehicle control (P<.05). The cytotoxic effects of glyphosate were also evident, as observed by significant decrease in mitotic index (MI). The present results indicate that glyphosate is clastogenic and cytotoxic to mouse bone marrow.

  12. Adsorption-desorption, mobility and degradation of 14C-Glyphosate in two soil series

    International Nuclear Information System (INIS)

    Ismail, B. S.; Zaifah Abdul Kadir; Khairiah Jusoh; Nashriyah Mat

    2002-01-01

    The adsorption desorption and degradation of glyphosate (Roundup) have been studied using 14 C glyphosate in two soils, namely Serdang Series and Sungai Buloh Series. The percentage of adsorption was not significantly different (p 14 C- glyphosate was detected in 0-10 cm zone of the two soils studied. However, in Sungai Buloh Series, a significant amount of 14 C-glyphosate was detected in the 10-20 cm zone. A small amount of 14 C radioactivity was also detected in the leachate of the two soils. The percentage of degradation in the Sungai Buloh and Serdang Series soils was higher at 10 μg/ml and 50 μg/ml, concentration, respectively. At 50 μg/ml concentration the Sungai Buloh Series soil showed higher glyphosate residue (83%) as compared to Serdang Series (48%). In contrast, the glyphosate residue was found to be higher in the Serdang Series (73916) as compared to the Sungai Buloh Series (30%) at 10 μg/ml concentration. (Author)

  13. Effect of light conditions and chemical characteristics of water on dissipation of glyphosate in aqueous medium.

    Science.gov (United States)

    Yadav, Veena; Kaur, Pervinder; Kaur, Paawan

    2017-11-06

    The present study was conducted to determine the effect of light conditions and chemical properties of water on dissipation of glyphosate. The residues of glyphosate and aminomethylphosphonic acid (AMPA) were quantified using fluorescence spectrophotometer after derivatization with 9-fluoroenylmethoxycarbonyl chloride (FMOC-Cl) and orthopthaldehyde (OPA). Average percent recoveries of glyphosate and AMPA from distilled, tap, and ground water ranged from 87.5 to 94.9, 87.3 to 93.7, and 80.6 to 92.0, respectively, with relative standard deviation less than 10%. The limit of detection and limit of quantification of glyphosate and AMPA from different water matrices ranged from 0.001 to 0.03 μg mL -1 and 0.003 to 0.01 μg mL -1 , respectively. The dissipation of glyphosate followed the first-order kinetics, and half-life varied from 1.56 to 14.47 and 13.14 to 42.38 days under UV and sunlight, respectively. The pH and electrical conductivity (EC) of water has differential influence on dissipation of glyphosate, and it increased with increase in pH and EC.

  14. Analysis of glyphosate residues in cereals using liquid chromatography-mass spectrometry (LC-MS/MS)

    DEFF Research Database (Denmark)

    Granby, Kit; Johannesen, S.; Gabrielsen, Martin Vahl

    2003-01-01

    A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean-up) in ser......A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean...... monitored m/z 168--> 150 (glyphosate) and 170-->152 (internal standard 2- 13 (CN)-N-15-glyphosate) for quantification. The mean recovery was 85% ( n =32) at spiking levels from 0.03 to 0.33 mg kg(-1) . From 1998 to 2001, from the analysis of about 50 samples per annum, a reduction in the glyphosate residues...... was observed owing to a Danish trade decision not to use grain with glyphosate residues for milling or bread production....

  15. Characterization of Eleusine indica with gene mutation or amplification in EPSPS to glyphosate.

    Science.gov (United States)

    Chen, Jingchao; Jiang, Cuilan; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Huimin; Zhao, Dandan; Zhang, Chaoxian

    2017-11-01

    The evolution of weed-resistant species threatens the sustainable use of glyphosate, which is the most important herbicide widely used in agriculture worldwide. Moreover, the high glyphosate resistance (>180-fold based on LD 50 ) of Eleusine indica found in Malaysia, which carries a double mutation in its 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), made the control of this species more difficult. By contrast, the same species carrying the same double mutation in EPSPS (T102I+P106S) but found in China only shows a resistance level of not more than 14-fold based on GR 50 . The resistance level of this population is four times higher than that of the population carrying a single mutation (P106L). Although the members of this population survive under a high glyphosate dosage of 10,080gaeha -1 , their growth was significantly inhibited by glyphosate under the recommend dose (840gaeha -1 ), where in the fresh weight was 85.4% of the control. EPSPS expression, relative copy number, and EPSPS activity in this population were similar to those of the susceptible population. In addition, the expression of two glutathione transferase (GST) genes (GST-U8 and GST-23) and the enzyme activity of the GST in this population did not significantly differ from those of the susceptible population. This finding is important in elucidating the resistance of the naturally evolved glyphosate-resistant (GR) weed species carrying a double mutation in EPSPS to glyphosate. Copyright © 2017. Published by Elsevier Inc.

  16. Glyphosate-based herbicides toxicity on life history parameters of zoophytophagous Podisus nigrispinus (Heteroptera: Pentatomidae).

    Science.gov (United States)

    C Zanuncio, José; C Lacerda, Mabio; Alcántara-de la Cruz, Ricardo; P Brügger, Bruno; Pereira, Alexandre I A; F Wilcken, Carlos; E Serrão, José; S Sediyama, Carlos

    2018-01-01

    The increase of agricultural areas with glyphosate-resistant (GR) crops, and use of this herbicide in Brazil, makes necessary to assess its impacts on non-target organisms. The objective was to evaluate the development, reproduction and life table parameters of Podisus nigrispinus (Heteroptera: Pentatomidae) reared on GR-soybean plants treated with glyphosate formulations (Zapp-Qi, Roundup-Transorb-R and Roundup-Original) at the recommended field dose (720g acid equivalent ha -1 ). Glyphosate formulations had no affect on nymph and adult weight of this predator. Fourth instar stage was shortest with Zapp Qi. Egg-adult period was similar between treatments (26 days) with a survival over 90%. Zapp-Qi and Roundup-Transorb-R (potassium-salt: K-salt) reduced the egg, posture and nymph number per female, and the longevity and oviposition periods of this predator. Podisus nigrispinus net reproductive rate was highest in GR-soybean plants treated with Roundup-Original (isopropylamine-salt: IPA-salt). However, the duration of one generation, intrinsic and finite increase rates, and time to duplicate the population, were similar between treatments. Glyphosate toxicity on P. nigrispinus depends of the glyphosate salt type. IPA-salt was least harmless to this predator. Formulations based on K-salt altered its reproductive parameters, however, the development and population dynamic were not affect. Therefore, these glyphosate formulations are compatible with the predator P. nigrispinus with GR-soybean crop. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Occurrence of glyphosate and AMPA residues in soy-based infant formula sold in Brazil.

    Science.gov (United States)

    Rodrigues, Nadia Regina; de Souza, Ana Paula Ferreira

    2018-04-01

    Glyphosate is an herbicide widely used in the world, being applied in several crops, among them soybeans. Recently, glyphosate and its metabolite aminomethylphosphonic acid (AMPA) have been identified as possible contributors to the emergence of various diseases such as autism, Parkinson's and Alzheimer's diseases, as well as cancer. The child population-consuming cereal-based foods is the most exposed to the effects of pesticides because of their developmental phase and they have a higher food intake per kilogram of body weight than adults. The presence of glyphosate and AMPA residues in soy-based infant formulas was evaluated during the years 2012-2017, totalising 105 analyses carried out on 10 commercial brands from different batches. Glyphosate and AMPA were determined by liquid chromatography with fluorescence detection after derivatisation reaction. The method was validated and showed accuracy and precision with a limit of quantification (LOQ) of 0.02 mg kg -1 . Among those samples that contained levels above the LOQ, the variation of glyphosate residues was from 0.03 mg kg -1 to 1.08 mg kg -1 and for AMPA residues was from 0.02 mg kg -1 to 0.17 mg kg -1 . This is the first scientific communication about glyphosate and AMPA contamination in soy-based infant formula in Brazil, The study was conducted under good laboratory practice (GLP) and supported by good scientific practice.

  18. Review of potential environmental impacts of transgenic glyphosate-resistant soybean in Brazil.

    Science.gov (United States)

    Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B; Spadotto, Claudio A

    2007-01-01

    Transgenic glyphosate-resistant soybeans (GRS) have been commercialized and grown extensively in the Western Hemisphere, including Brazil. Worldwide, several studies have shown that previous and potential effects of glyphosate on contamination of soil, water, and air are minimal, compared to those caused by the herbicides that they replace when GRS are adopted. In the USA and Argentina, the advent of glyphosate-resistant soybeans resulted in a significant shift to reduced- and no-tillage practices, thereby significantly reducing environmental degradation by agriculture. Similar shifts in tillage practiced with GRS might be expected in Brazil. Transgenes encoding glyphosate resistance in soybeans are highly unlikely to be a risk to wild plant species in Brazil. Soybean is almost completely self-pollinated and is a non-native species in Brazil, without wild relatives, making introgression of transgenes from GRS virtually impossible. Probably the highest agricultural risk in adopting GRS in Brazil is related to weed resistance. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. These include Chamaesyce hirta (erva-de-Santa-Luzia), Commelina benghalensis (trapoeraba), Spermacoce latifolia (erva-quente), Richardia brasiliensis (poaia-branca), and Ipomoea spp. (corda-de-viola). Four weed species, Conyza bonariensis, Conyza Canadensis (buva), Lolium multiflorum (azevem), and Euphorbia heterophylla (amendoim bravo), have evolved resistance to glyphosate in GRS in Brazil and have great potential to become problems.

  19. Target-site mutations conferring resistance to glyphosate in feathertop Rhodes grass (Chloris virgata) populations in Australia.

    Science.gov (United States)

    Ngo, The D; Krishnan, Mahima; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

    2018-05-01

    Chloris virgata is a warm-season, C 4 , annual grass weed affecting field crops in northern Australia that has become an emerging weed in southern Australia. Four populations with suspected resistance to glyphosate were collected in South Australia, Queensland and New South Wales, Australia, and compared with one susceptible (S) population to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the rate of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in four populations of C. virgata (V12, V14.2, V14.16 and V15). GR plants were 2-9.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. GR and S plants did not differ in glyphosate absorption and translocation. Target-site EPSPS mutations corresponding to Pro-106-Leu (V14.2) and Pro-106-Ser (V15, V14.16 and V12) substitutions were found in GR populations. The population with Pro-106-Leu substitution was 2.9-4.9-fold more resistant than the three other populations with Pro-106-Ser substitution. This report confirms glyphosate resistance in C. virgata and shows that target-site EPSPS mutations confer resistance to glyphosate in this species. The evolution of glyphosate resistance in C. virgata highlights the need to identify alternative control tactics. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Optimum distribution between autumn-applied and spring-applied nitrogen in seed production of tall fescue (Festuca arundinacea Schreb.)

    DEFF Research Database (Denmark)

    Gislum, René; Deleuran, Lise Christina; Kristensen, Kristian

    2012-01-01

    The effect of different autumn and spring nitrogen (N) application rates on plant establishment, plant development, and seed yield were tested in a field experiment using tall fescue (Festuca arundinacea Schreb.). Results clearly showed that the optimum distribution of N between autumn and spring...... to achieve the highest seed yield and economical benefit was dependent on the choice of cover crops and location. The economically optimum N application rate was in the range from 44 to 73 kg ha−1 in autumn and 94 to 157 kg ha−1 in spring. The results are discussed in relation to Danish N regulations...... and plant establishment and development....

  1. Use of Fe/Al drinking water treatment residuals as amendments for enhancing the retention capacity of glyphosate in agricultural soils.

    Science.gov (United States)

    Zhao, Yuanyuan; Wendling, Laura A; Wang, Changhui; Pei, Yuansheng

    2015-08-01

    Fe/Al drinking water treatment residuals (WTRs), ubiquitous and non-hazardous by-products of drinking water purification, are cost-effective adsorbents for glyphosate. Given that repeated glyphosate applications could significantly decrease glyphosate retention by soils and that the adsorbed glyphosate is potentially mobile, high sorption capacity and stability of glyphosate in agricultural soils are needed to prevent pollution of water by glyphosate. Therefore, we investigated the feasibility of reusing Fe/Al WTR as a soil amendment to enhance the retention capacity of glyphosate in two agricultural soils. The results of batch experiments showed that the Fe/Al WTR amendment significantly enhanced the glyphosate sorption capacity of both soils (pretention capacity in soils. Copyright © 2015. Published by Elsevier B.V.

  2. Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos.

    Science.gov (United States)

    Akcha, F; Spagnol, C; Rouxel, J

    2012-01-15

    We investigated the effects of genotoxicant exposure in gametes and embryos to find a possible link between genotoxicity and reproduction/developmental impairment, and explore the impact of chemical genotoxicity on population dynamics. Our study focused on the genotoxic effects of two herbicides on oyster gametes and embryos: glyphosate (both as an active substance and in the Roundup formulation) and diuron. France is Europe's leading consumer of agrochemical substances and as such, contamination of France's coastal waters by pesticides is a major concern. Glyphosate and diuron are among the most frequently detected herbicides in oyster production areas; as oyster is a specie with external reproduction, its gametes and embryos are in direct contact with the surrounding waters and are hence particularly exposed to these potentially dangerous substances. In the course of this study, differences in genotoxic and embryotoxic responses were observed in the various experiments, possibly due to differences in pollutant sensitivity between the tested genitor lots. Glyphosate and Roundup had no effect on oyster development at the concentrations tested, whereas diuron significantly affected embryo-larval development from the lowest tested concentration of 0.05 μg L⁻¹, i.e. an environmentally realistic concentration. Diuron may therefore have a significant impact on oyster recruitment rates in the natural environment. Our spermiotoxicity study revealed none of the tested herbicides to be cytotoxic for oyster spermatozoa. However, the alkaline comet assay showed diuron to have a significant genotoxic effect on oyster spermatozoa at concentrations of 0.05 μg L⁻¹ upwards. Conversely, no effects due to diuron exposure were observed on sperm mitochondrial function or acrosomal membrane integrity. Although our initial results showed no negative effect on sperm function, the possible impact on fertilization rate and the consequences of the transmission of damaged DNA for

  3. Glyphosate and Roundup® alter morphology and behavior in zebrafish.

    Science.gov (United States)

    Bridi, Daiane; Altenhofen, Stefani; Gonzalez, Jonas Brum; Reolon, Gustavo Kellermann; Bonan, Carla Denise

    2017-12-01

    Glyphosate has become the most widely used herbicide in the world, due to the wide scale adoption of transgenic glyphosate resistant crops after its introduction in 1996. Glyphosate may be used alone, but it is commonly applied as an active ingredient of the herbicide Roundup ® . This pesticide contains several adjuvants, which may promote an unknown toxicity. The indiscriminate application poses numerous problems, both for the health of the applicators and consumers, and for the environment, contaminating the soil, water and leading to the death of plants and animals. Zebrafish (Danio rerio) is quickly gaining popularity in behavioral research, because of physiological similarity to mammals, sensitivity to pharmacological factors, robust performance, low cost, short spawning intervals, external fertilization, transparency of embryos through larval stages, and rapid development. The aim of this study was evaluate the effects of glyphosate and Roundup ® on behavioral and morphological parameters in zebrafish larvae and adults. Zebrafish larvae at 3days post-fertilization and adults were exposed to glyphosate (0.01, 0.065, and 0.5mg/L) or Roundup ® (0.01, 0.065, and 0.5mg/L) for 96h. Immediately after the exposure, we performed the analysis of locomotor activity, aversive behavior, and morphology for the larvae and exploratory behavior, aggression and inhibitory avoidance memory for adult zebrafish. In zebrafish larvae, there were significant differences in the locomotor activity and aversive behavior after glyphosate or Roundup ® exposure when compared to the control group. Our findings demonstrated that exposure to glyphosate at the concentration of 0.5mg/L, Roundup ® at 0.065 or 0.5mg/L reduced the distance traveled, the mean speed and the line crossings in adult zebrafish. A decreased ocular distance was observed for larvae exposed at 0.5mg/L of glyphosate. We verified that at 0.5mg/L of Roundup ® -treated adult zebrafish demonstrated a significant

  4. Supplemental protein and energy for beef cows consuming endophyte-infected tall fescue.

    Science.gov (United States)

    Forcherio, J C; Catlett, G E; Paterson, J A; Kerley, M S; Ellersieck, M R

    1995-11-01

    Effects of energy and protein supplementation of endophyte (Acremonium coenophialum)-infected (E+) and noninfected (E-) tall fescue (Festuca arundinacea Schreb.) on forage intake, digestibility, N flow to the small intestine, and cow-calf productivity was evaluated in two experiments. In Exp. 1, 10 ruminally and duodenally cannulated steers were fed either E- or E+ hay with four supplements or E- or E+ hay unsupplemented. Four supplements formulated with either cracked corn or soybean hulls with 100 or 200 g/d of ruminally undegraded intake protein (UIP) were compared. Levels of UIP were varied by adding soybean meal or blood meal. Hay OM intake was not affected (P > .20) by source of energy of level of UIP; however, intake of E- was greater (P .20) microbial efficiencies. In Exp. 2, 30 cows (average initial BW 459 +/- 26 kg) and their calves (average initial BW 74 +/- 5 kg and 74 +/- 5 d of age) grazed an 8.1-ha E+ pasture from late May to late July. Cows were individually fed supplements used in Exp. 1 each day. Cows that received cracked corn lost .10 kg/d when fed 100 g/d of UIP but gained .33 kg/d when fed 200 g/d. Cows fed soybean hulls and 100 g/d of UIP gained .07 kg/d, whereas cows provided 200 g/d lost .10 kg/d. Calves nursing cows supplemented with 100 g/d of UIP gained more (P milk consumption and slightly greater (P forage intake than calves nursing cows supplemented with 200 g/d of UIP.

  5. Crafting tolerance

    DEFF Research Database (Denmark)

    Kirchner, Antje; Freitag, Markus; Rapp, Carolin

    2011-01-01

    Ongoing changes in social structures, orientation, and value systems confront us with the growing necessity to address and understand transforming patterns of tolerance as well as specific aspects, such as social tolerance. Based on hierarchical analyses of the latest World Values Survey (2005......–08) and national statistics for 28 countries, we assess both individual and contextual aspects that influence an individual's perception of different social groupings. Using a social tolerance index that captures personal attitudes toward these groupings, we present an institutional theory of social tolerance. Our...

  6. Effects of interactions between Collembola and soil microbial community on the degradation of glyphosate-based herbicide

    Science.gov (United States)

    Wee, J.; Lee, Y. S.; Son, J.; Kim, Y.; Nam, T. H.; Cho, K.

    2017-12-01

    Glyphosate is the most widely used herbicide because of its broad spectrum activity and effectiveness, however, little is known about adverse effects on non-target species and their interactions. Therefore, in this study, we investigated the effects of glyphosate on interactions between Collembola and soil microbial community and the effect of Collembola on degradation of glyphosate. The experiment carried out in PS container filled with 30g of soil according to OECD 232 guidelines. Investigating the effects of soil microbial community and Collembola on degradation of glyphosate, we prepared defaunated field soil (only maintaining soil microbial community, sampling in May and September, 2016.) and autoclaved soil with 0, 10, 30 adults of Paronychiurus kimi (Collembola) respectively. Survived adults and hatched juveniles of P. kimi were counted after 28-day exposures in both soils spiked with 100 mg/kg of glyphosate. Glyphosate in soil of 7, 14, 21, 28 days after spiking of glyphosate based herbicide was analyzed by spectrophotometer (Jan et al., 2009). Also soil microbial community structure was investigated using phospholipid fatty acids (PLFAs) composition analysis of soils following the procedures given by the Sherlock Microbial Identification System (MIDI Inc., Newark, DE). Glyphosate (100mg/kg soil) has no effects on reproduction and survival of P. kimi in any soils. Also, glyphosate in soils with Collembola was more rapidly degraded. Rapid increase of soil microbial biomass(PLFAs) was shown in soil with Collembola addition. This result showed that glyphosate affected interactions between Collembola and soil microorganisms, and also soil microbial community affected by Collembola changed degradation of glyphosate.

  7. The fate of glyphosate in water hyacinth and its physiological and biochemical influences on growth of algae

    International Nuclear Information System (INIS)

    Tsai, Baolong.

    1989-01-01

    Absorption, translocation, distribution, exudation, and guttation of 14 C-glyphosate in water hyacinth (Eichhornia crassipes) were studied. Glyphosphate entered the plant by foliage and solution treatment. Plants were harvested and separated into the following parts: treated leaf blade, treated leaf petiole, young leaf blade, young leaf petiole, old leak blade, old leaf petiole, and root. Each part was extracted with methanol. Treated leaves, which exist only in foliage treatment, were washed with water and chloroform to remove the glyphosate residues. All 14 C counting was made by liquid scintillation spectrometry. Autoradiography was used to locate 14 C-glyphosate after foliage treatment. Results indicated that glyphosate can be absorbed from the leaf surface and translocated rapidly through phloem tissues into the whole plant body. The roots of water hyacinth absorbed glyphosate without vertical transport. Guttation of glyphosate occurred in treated leaf tips. Exudation of glyphosate from roots of water hyacinth occurred within 8 hr after foliage treatment. Chlorella vulgaris, Chlamydomonas reihardii, Anabaena cylindrica, and Chroococcus turgidus were used to explore the physiological and biochemical effects of glyphosate on algae. Spectrophotometric assays were performed for algal growth, chlorophyll, carotenoids, phycobiliprotein, carbohydrate, and protein. TLC procedures and an image analyzer were used to detect the metabolites of glyphosate inside algal cells. The common visible symptom of glyphosate toxicity in all algal cells were bleaching effect and reduction of contents of carbohydrate, protein, and pigments. The results highly suggested that glyphosate injured the algal cells by destruction of photosynthetic pigments and resulted in lowering the contents of carbohydrate and protein in algal cells

  8. The intensity of non-target site mechanisms influences the level of resistance of sourgrass to glyphosate

    Directory of Open Access Journals (Sweden)

    Flávia Regina da Costa

    2014-02-01

    Full Text Available Non-target site mechanisms are involved in the resistance of sourgrass (Digitaria insularis to glyphosate. Studies on the 14C-glyphosate absorption and translocation as well as the detection of glyphosate and its metabolites in sourgrass plants were carried out under controlled conditions to investigate if the differential response of resistant sourgrass biotypes (R1 and R2 is derived from the intensity of non-target site mechanisms involved in the resistance to glyphosate. Different pattern of absorption was observed between S (susceptible and R2 from 12 up to 48 hours after treatment with glyphosate (HAT, and between S and R1 just at 12 HAT. The initial difference in glyphosate absorption among the biotypes did not maintained at 96 HAT and afterwards. Smaller amount of herbicide left the treated leaf into the rest of shoot and roots in R2 (25% than in S (58% and R1 (52%. In addition, slight difference in glyphosate translocation was observed between S and R1. We found high percentage (81% of glyphosate in the S biotype up to 168 HAT, while just 44% and 2% of glyphosate was recovered from R1 and R2 plant tissues. In addition, high percentage of glyphosate metabolites was found in R2 (98% and R1 (56% biotypes, while a very low percentage (11% was found in the S biotype. As previous studies indicated resistant factors of 3.5 and 5.6 for R1 and R2, respectively, we conclude that the differential response of sourgrass biotypes is derived from the intensity of the non-target site mechanisms involved in the resistance to glyphosate.

  9. Influence of harvest managements on biomass nutrient concentrations and removal rates of festulolium and tall fescue from a poorly drained nutrient-rich fen peatland

    DEFF Research Database (Denmark)

    Kandel, Tanka; Elsgaard, Lars; Lærke, Poul Erik

    2017-01-01

    This study was designed to show the effects of harvest time and frequency on biomass nutrient concentrations (total ash, N, P, K, Ca, Mg, Fe, Mn, Cu and Zn) as well as total nutrient removal potential by festulolium and tall fescue cultivated on a nutrient-rich fen peatland. The harvest managemen...

  10. The Physiological, Morphological and Bio-Chemical Comparison of the Current Grass Shiraz City’s Green Space withTall Fescue (Festuca arundinacea Schreb

    Directory of Open Access Journals (Sweden)

    M. Zadehbagheri

    2016-02-01

    Full Text Available One of the main problems of Shiraz city’s green space is the change of color and visual quality of turf during cold months. Therefore, we aimed to evaluate tall fescue in order to find if it is suitable for replacement. This experiment was in the form of complete random blocks and it was done during two consecutive years. Each treatment had 4 repetitions. Data were analyzed using SPSS software, version 16.0, and the means were compared using t or LSD tests at a significance level of 5%. The results showed that tall fescue was superior to normal sport grass in cold months with respect to its chlorophyll, catalase, protein, prolin, and soluble sugar content, as well as its visual quality and root depth. Prolin fluctuations in tall fescue were very high which showed that these types of grass can increase the plant’s prolin content under stress. Therefore, there is a fivefold increase in the prolin content of the grass in cold months (cold tension compared to the beginning of spring (best condition for growth. However, this change does not exist in sport grass. Based on the obtained results we can conclude that tall fescue can resist environmental tension, especially coldness, using different mechanisms, and is a good substitute for normal sport grass.

  11. Acute exposure to ergot alkaloids from endophyte-infected tall fescue does not alter absorptive or barrier function of the isolated ruminal epithelium

    Science.gov (United States)

    Ergot alkaloids in endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have been shown to cause a reduction in blood flow to the rumen epithelium as well as a decrease in VFA absorption from the washed rumen of steers. Previous data also indicates that incubating an extr...

  12. Isolation of Burkholderia cepacia JB12 from lead- and cadmium-contaminated soil and its potential in promoting phytoremediation with tall fescue and red clover.

    Science.gov (United States)

    Jin, Zhong Min; Sha, Wei; Zhang, Yan Fu; Zhao, Jing; Ji, Hongyang

    2013-07-01

    Phytoremediation combined with suitable microorganisms and biodegradable chelating agents can be a means of reclaiming lands contaminated by toxic heavy metals. We investigated the ability of a lead- and cadmium-resistant bacterial strain (JB12) and the biodegradable chelator ethylenediamine-N,N'-disuccinic acid (EDDS) to improve absorption of these metals from soil by tall fescue and red clover. Strain JB12 was isolated from contaminated soil samples, analysed for lead and cadmium resistance, and identified as Burkholderia cepacia. Tall fescue and red clover were grown in pots to which we added JB12, (S,S)-EDDS, combined JB12 and EDDS, or water only. Compared with untreated plants, the biomass of plants treated with JB12 was significantly increased. Concentrations of lead and cadmium in JB12-treated plants increased significantly, with few exceptions. Plants treated with EDDS responded variably, but in those treated with combined EDDS and JB12, heavy metal concentrations increased significantly in tall fescue and in the aboveground parts of red clover. We conclude that JB12 is resistant to lead and cadmium. Its application to the soil improved the net uptake of these heavy metals by experimental plants. The potential for viable phytoremediation of lead- and cadmium-polluted soils with tall fescue and red clover combined with JB12 was further enhanced by the addition of EDDS.

  13. How planting configuration influences plant secondary metabolites and total N in tall fescue (Festuca arundinacea Schreb.), alfalfa (Medicago sativa L.) and birdsfoot trefoil (Lotus corniculatus L.)

    Science.gov (United States)

    Theories suggest that incorporating alfalfa (Medicago sativa L.; Alf) or birdsfoot trefoil (Lotus corniculatus L.; BFT) into endophyte-infected tall fescue (Festuca arundinaceas Schreb.; E+TF) pasturelands may improve livestock production. We investigated how planting configuration might influence p...

  14. Antagonism of lateral saphenous vein serotonin receptors from steers grazing endophyte-free, wild-type, or novel endophyte-infected tall fescue

    Science.gov (United States)

    Pharmacologic profiling of 5-hydroxytryptamine (5HT) receptors of bovine lateral saphenous vein has shown that cattle grazing endophyte-infected (Neotyphodium coenophialum) tall fescue (Lolium arundinaceum) have altered responses to ergovaline (ERV), 5HT, 5HT2A and 5HT7 agonists. To determine if 5HT...

  15. Infestation of tall fescue (Festuca arundinacea Schreb. with Neotyphodium coenophialum and its influence on growth of chosen microorganisms in vitro

    Directory of Open Access Journals (Sweden)

    Dariusz Pańka

    2012-12-01

    Full Text Available Occurrence of Neotyphodium coenophialum in tall fescue cultivars cultivated in Poland and determination an endophyte inhibition effect on mycelium growth of chosen microorganisms in vitro were investigated. Seventeen seed lots of 11 cultivars of tall fescue were examined. The endophyte mycelium was dyed with bengal rose and microscopically examined to detect N. coenophialum. Occurrence of endophyte was checked with PCR method. Influence of endophyte on growth of 15 microorganisms was established in the laboratory conditions on Petri dishes with PDA medium at 10, 20 and 30°C. Neotyphodium coenophialum occurred only in two seed lots, 'Barrocco' - 42% and Terros - 2%. Living mycelium of endophyte was isolated only from 'Barrocco'. The highest mycelium growth inhibition of Bipolaris sorokiniana, Fusarium avenaceum, F. equiseti, Microdochium nivale and Gaeumannomyces graminis by endophyte at 30°C was recorded. The highest width of growth inhibition zone (4mm was detected for the last pathogen. Mycelium growth of B. sorokiniana and M. nivale was not inhibited at 10°C, and for F. avenaceum at 10 and 20°C.

  16. Genomic and metabolic characterisation of alkaloid biosynthesis by asexual Epichloë fungal endophytes of tall fescue pasture grasses.

    Science.gov (United States)

    Ekanayake, Piyumi N; Kaur, Jatinder; Tian, Pei; Rochfort, Simone J; Guthridge, Kathryn M; Sawbridge, Timothy I; Spangenberg, German C; Forster, John W

    2017-06-01

    Symbiotic associations between tall fescue grasses and asexual Epichloë fungal endophytes exhibit biosynthesis of alkaloid compounds causing both beneficial and detrimental effects. Candidate novel endophytes with favourable chemotypic profiles have been identified in germplasm collections by screening for genetic diversity, followed by metabolite profile analysis in endogenous genetic backgrounds. A subset of candidates was subjected to genome survey sequencing to detect the presence or absence and structural status of known genes for biosynthesis of the major alkaloid classes. The capacity to produce specific metabolites was directly predictable from metabolic data. In addition, study of duplicated gene structure in heteroploid genomic constitutions provided further evidence for the origin of such endophytes. Selected strains were inoculated into meristem-derived callus cultures from specific tall fescue genotypes to perform isogenic comparisons of alkaloid profile in different host backgrounds, revealing evidence for host-specific quantitative control of metabolite production, consistent with previous studies. Certain strains were capable of both inoculation and formation of longer-term associations with a nonhost species, perennial ryegrass (Lolium perenne L.). Discovery and primary characterisation of novel endophytes by DNA analysis, followed by confirmatory metabolic studies, offers improvements of speed and efficiency and hence accelerated deployment in pasture grass improvement programs.

  17. The rise of glyphosate and new opportunities for biosentinel early-warning studies.

    Science.gov (United States)

    Kissane, Zoe; Shephard, Jill M

    2017-12-01

    Glyphosate has become the most commonly used herbicide worldwide and is reputedly environmentally benign, nontoxic, and safe for use near wildlife and humans. However, studies indicate its toxicity is underestimated and its persistence in the environment is greater than once thought. Its actions as a neurotoxin and endocrine disruptor indicate its potential to act in similar ways to persistent organic pollutants such as the organochlorines dichlorodiphenyltrichloroethane (DDT) and dioxin. Exposure to glyphosate and glyphosate-based herbicides for both wildlife and people is likely to be chronic and at sublethal levels, with multiple and ongoing exposure events occurring in urban and agricultural landscapes. Despite this, there has been little research on the impact of glyphosate on wildlife populations, and existing studies appear in the agricultural, toxicology, and water-chemistry literature that may have limited visibility among wildlife biologists. These studies clearly demonstrate a link between chronic exposure and neurotoxicity, endocrine disruption, cell damage, and immune suppression. There is a strong case for the recognition of glyphosate as an emerging organic contaminant and substantial potential exists for collaborative research among ecologists, toxicologists, and chemists to quantify the impact of glyphosate on wildlife and to evaluate the role of biosentinel species in a preemptive move to mitigate downstream impacts on people. There is scope to develop a decision framework to aid the choice of species to biomonitor and analysis methods based on the target contaminant, spatial and temporal extent of contamination, and perceived risk. Birds in particular offer considerable potential in this role because they span agricultural and urban environments, coastal, inland, and wetland ecosystems where glyphosate residues are known to be present. © 2017 Society for Conservation Biology.

  18. Photosynthesis and Rubisco kinetics in spring wheat and meadow fescue under conditions of simulated climate change with elevated CO2 and increased temperatures

    Directory of Open Access Journals (Sweden)

    K. HAKALA

    2008-12-01

    Full Text Available Spring wheat (Triticum aestivum L.cv.Polkkaand meadow fescue (Festuca pratensis Hudson cv. Kalevicwere grown in ambient and elevated (700 µl l -1 carbon dioxide concentration both at present ambient temperatures and at temperatures 3°C higher than at present simulating a future climate.The CO2 concentrations were elevated in large (3 m in diameteropen top chambers and the temperatures in a greenhouse built over the experimental field.The photosynthetic rate of both wheat and meadow fescue was 31 –37%higher in elevated carbon dioxide (eCO2 than in ambient CO 2 (aCO2 throughout the growing season.The enhancement in wheat photosynthesis in eCO2 declined 10 –13 days before yellow ripeness,at which point the rate of photosynthesis in both CO 2 treatments declined.The stomatal conductance of wheat and meadow fescue was 23–36% lower in eCO2 than in aCO2 .The amount and activity of ribulose-1,5-bisphosphate carboxylase-oxygenase (Rubisco in wheat were lower under conditions of eCO2 ,except at elevated temperatures in 1993 when there was a clear yield increase.There was no clear change in the amount and activity of Rubisco in meadow fescue under eCO2 at either elevated or ambient temperature.This suggests that adaptation to elevated CO2 at biochemical level occurs only when there is insufficient sink for photosynthetic products.While the sink size of wheat can be increased only by introducing new,more productive genotypes,the sink size of meadow fescue can be regulated by fitting the cutting schedule to growth.;

  19. Glyphosate and dicamba herbicide tank mixture effects on native plant and non-genetically engineered soybean seedlings

    Science.gov (United States)

    Weed species are becoming resistant to intensive and extensive use of specific herbicides associated with the production of herbicide resistant crops, e.g., the use of glyphosate for weed management with glyphosate resistant soybeans. To counter this resistance, crops engineered ...

  20. Bioaccumulation of glyphosate and its formulation Roundup Ultra in Lumbriculus variegatus and its effects on biotransformation and antioxidant enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Contardo-Jara, Valeska [Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Department of Inland Fisheries, Biochemical Regulation, Mueggelseedamm 301, 12587 Berlin (Germany)], E-mail: contardo@igb-berlin.de; Klingelmann, Eva [Technische Universitaet Berlin/Berlin Institute of Technology, Department of Ecology, Chair of Soil Protection, Salzufer 12, 10587 Berlin (Germany)], E-mail: eva.klingelmann@TU-Berlin.de; Wiegand, Claudia [Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Department of Inland Fisheries, Biochemical Regulation, Mueggelseedamm 301, 12587 Berlin (Germany); Humboldt University Berlin, Faculty of Biology, Unter den Linden 6, 10099 Berlin (Germany)], E-mail: cwiegand@igb-berlin.de

    2009-01-15

    The bioaccumulation potential of glyphosate and the formulation Roundup Ultra, as well as possible effects on biotransformation and antioxidant enzymes in Lumbriculus variegatus were compared by four days exposure to concentrations between 0.05 and 5 mg L{sup -1} pure glyphosate and its formulation. Bioaccumulation was determined using {sup 14}C labeled glyphosate. The bioaccumulation factor (BCF) varied between 1.4 and 5.9 for the different concentrations, and was higher than estimated from log P{sub ow}. Glyphosate and its surfactant POEA caused elevation of biotransformation enzyme soluble glutathione S-transferase at non-toxic concentrations. Membrane bound glutathione S-transferase activity was significantly elevated in Roundup Ultra exposed worms, compared to treatment with equal glyphosate concentrations, but did not significantly differ from the control. Antioxidant enzyme superoxide dismutase was significantly increased by glyphosate but in particular by Roundup Ultra exposure indicating oxidative stress. The results show that the formulation Roundup Ultra is of more ecotoxicological relevance than the glyphosate itself. - Roundup Ultra is of more ecotoxicological relevance than the active ingredient, glyphosate, to Lumbriculus variegatus regarding accumulation potential and enzymatic responses.

  1. Sources of aminomethylphosphonic acid (AMPA) in urban and rural catchments in Ontario, Canada: Glyphosate or phosphonates in wastewater?

    International Nuclear Information System (INIS)

    Struger, J.; Van Stempvoort, D.R.; Brown, S.J.

    2015-01-01

    Correlation analysis suggests that occurrences of AMPA in streams of southern Ontario are linked mainly to glyphosate in both urban and rural settings, rather than to wastewater sources, as some previous studies have suggested. For this analysis the artificial sweetener acesulfame was analyzed as a wastewater indicator in surface water samples collected from urban and rural settings in southern Ontario, Canada. This interpretation is supported by the concurrence of seasonal fluctuations of glyphosate and AMPA concentrations. Herbicide applications in larger urban centres and along major transportation corridors appear to be important sources of glyphosate and AMPA in surface water, in addition to uses of this herbicide in rural and mixed use areas. Fluctuations in concentrations of acesulfame and glyphosate residues were found to be related to hydrologic events. - Highlights: • Widespread occurrence of glyphosate and AMPA in surface waters of southern Ontario. • Linked to applications of glyphosate in urban and rural settings. • Supported by lack of correlation between AMPA and the wastewater tracer acesulfame. • Contrasts with view that AMPA found in the environment is derived from wastewater. • AMPA more persistent than glyphosate and both fluctuated with hydrological cycles. - The occurrence of AMPA in streams in southern Ontario is linked mainly to glyphosate rather than wastewater sources

  2. Bioaccumulation of glyphosate and its formulation Roundup Ultra in Lumbriculus variegatus and its effects on biotransformation and antioxidant enzymes

    International Nuclear Information System (INIS)

    Contardo-Jara, Valeska; Klingelmann, Eva; Wiegand, Claudia

    2009-01-01

    The bioaccumulation potential of glyphosate and the formulation Roundup Ultra, as well as possible effects on biotransformation and antioxidant enzymes in Lumbriculus variegatus were compared by four days exposure to concentrations between 0.05 and 5 mg L -1 pure glyphosate and its formulation. Bioaccumulation was determined using 14 C labeled glyphosate. The bioaccumulation factor (BCF) varied between 1.4 and 5.9 for the different concentrations, and was higher than estimated from log P ow . Glyphosate and its surfactant POEA caused elevation of biotransformation enzyme soluble glutathione S-transferase at non-toxic concentrations. Membrane bound glutathione S-transferase activity was significantly elevated in Roundup Ultra exposed worms, compared to treatment with equal glyphosate concentrations, but did not significantly differ from the control. Antioxidant enzyme superoxide dismutase was significantly increased by glyphosate but in particular by Roundup Ultra exposure indicating oxidative stress. The results show that the formulation Roundup Ultra is of more ecotoxicological relevance than the glyphosate itself. - Roundup Ultra is of more ecotoxicological relevance than the active ingredient, glyphosate, to Lumbriculus variegatus regarding accumulation potential and enzymatic responses

  3. Interactions of calcium ions with weakly acidic active ingredients slow cuticular penetration: a case study with glyphosate.

    Science.gov (United States)

    Schönherr, Jörg; Schreiber, Lukas

    2004-10-20

    Potassium and calcium salts of glyphosate were obtained by titrating glyphosate acid with the respective bases to pH 4.0, and rates of penetration of these salts across isolated astomatous cuticular membranes (CMs) were measured at 20 degrees C and 70, 80, 90, and 100% humidity. K-glyphosate exhibited first-order penetration kinetics, and rate constants (k) increased with increasing humidity. Ca-glyphosate penetrated only when the humidity above the salt residue was 100%. At 90% humidity and below, Ca-glyphosate formed a solid residue on the CMs and penetration was not measurable. With Ca-glyphosate, the k value at 100% humidity decreased with time and the initial rates were lower than for K-glyphosate by a factor of 3.68. After equimolar concentrations of ammonium oxalate were added to Ca-glyphosate, high penetration rates close to those measured with K-glyphosate were measured at all humidities. Adding ammonium sulfate or potassium carbonate also increased rates between 70 and 100% humidity, but they were not as high as with ammonium oxalate. The data indicate that at pH 4.0 one Ca2+ ion is bound to two glyphosate anions. This salt has its deliquescence point near 100% humidity. Therefore, it is a solid at lower humidity and does not penetrate. Its molecular weight is 1.82 times larger than that of K-glyphosate, and this greatly slows down rates of penetration, even at 100% humidity. The additives tested have low solubility products and form insoluble precipitates with Ca2+ ions, but only ammonium oxalate binds Ca2+ quantitatively. The resulting ammonium salt of glyphosate penetrates at 70-100% humidity and at rates comparable to K-glyphosate. The results contribute to a better understanding of the hard water antagonism observed with glyphosate. It is argued that other pesticides and hormones with carboxyl functions are likely to respond to Ca2+ ions in a similar fashion. In all of these cases, ammonium oxalate is expected to overcome hard water antagonism

  4. Global research production in glyphosate intoxication from 1978 to 2015: A bibliometric analysis.

    Science.gov (United States)

    Zyoud, S H; Waring, W S; Al-Jabi, S W; Sweileh, W M

    2017-10-01

    Glyphosate (N-phosphonomethylglycine) has been used as a broad-spectrum herbicide that has been widely used in the agricultural industry and also available for home use. The main aim of this study is to present a general overview of glyphosate intoxication-related publications from its introducing since the early 1970s using bibliometric technique. On June 23, 2016, a literature search of the Scopus database was performed. We then extracted and analyzed the data using well-established qualitative and quantitative bibliometric indices: Publication year, affiliation, document type, country name, subject category, journal name, publishing language, and collaboration and citation patterns. We recognized a total of 3735 publications on glyphosate published between 1973 and 2015. There were 875 publications related to glyphosate intoxication in the Scopus database published between 1978 and 2015. Articles (757) comprised 86.5% of the total publications, followed by reviews (41; 4.7%). Most publications were published in English (87.9%), followed by Portuguese (6.6%). The number of publications related to glyphosate intoxication increased from 44 in 1978-1987 up to 152 in 1996-2005 and then quadrupled in 2006-2015. The United States was the leading country with 180 documents representing 20.6%, followed by Brazil (120; 13.7%), Canada (78; 8.9%), Argentina (61; 7.0%), and France (57; 6.5%). The 85.6% of the publications was cited, and the average of citation per document was 17.13 with h-index of 55. Furthermore, the United States achieved the highest h-index of 33. Most of the global international collaborations are made with researchers from the United States, who collaborated with 23 countries/territories in 44 publications. The trends in global glyphosate-related research between 1978 and 2015 were evaluated by a bibliometric technique. Results showed that English was the leading publishing language, and the major publication type was original article. Findings showed

  5. Studies on transfer, bioaccumulation and disappearance of glyphosate in the aquatic ecosystem by utilizing 14C tracer technique

    International Nuclear Information System (INIS)

    Zhu Guonian; Guo Jiangfeng; Sun Jinhe

    2002-01-01

    Studies on transfer, bioaccumulation and disappearance of glyphosate in the aquatic environment were conducted with methods of model tests and outdoor trials in the aquatic ecosystem. The result showed that glyphosate transferred rapidly into sediment and hormwort (Ceratopyllum demersum L.) after applied; and then, it was taken up faster and accumulated more by topmouth gudgeon (Psudorasobora parva) 5-10 days after application. The partitioning coefficient (sediment-water) and bioconcentration factors of glyphosate were 8.59, 27.96 and 45.79, respectively, in day 20. The concentration of glyphosate residue in the aquatic ecosystem followed the order of topmouth gudgeon > hormwort > sediment > water. And it was also indicated that glyphosate transferred and disappeared extremely fast in both pond and river after application

  6. Indirect glyphosate detection based on ninhydrin reaction and surface-enhanced Raman scattering spectroscopy

    Science.gov (United States)

    Xu, Meng-Lei; Gao, Yu; Li, Yali; Li, Xueliang; Zhang, Huanjie; Han, Xiao Xia; Zhao, Bing; Su, Liang

    2018-05-01

    Glyphosate is one of the most commonly-used and non-selective herbicides in agriculture, which may directly pollute the environment and threaten human health. A simple and effective approach to assessment of its damage to the natural environment is thus quite necessary. However, traditional chromatography-based detection methods usually suffer from complex pretreatment procedures. Herein, we propose a simple and sensitive method for the determination of glyphosate by combining ninhydrin reaction and surface-enhanced Raman scattering (SERS) spectroscopy. The product (purple color dye, PD) of the ninhydrin reaction is found to SERS-active and directly correlate with the glyphosate concentration. The limit of detection of the proposed method for glyphosate is as low as 1.43 × 10- 8 mol·L- 1 with a relatively wider linear concentration range (1.0 × 10- 7-1.0 × 10- 4 mol·L- 1), which demonstrates its great potential in rapid, highly sensitive concentration determination of glyphosate in practical applications for safety assessment of food and environment.

  7. Metabolic profiling of goldfish (Carassius auratis) after long-term glyphosate-based herbicide exposure.

    Science.gov (United States)

    Li, Ming-Hui; Ruan, Ling-Yu; Zhou, Jin-Wei; Fu, Yong-Hong; Jiang, Lei; Zhao, He; Wang, Jun-Song

    2017-07-01

    Glyphosate is an efficient herbicide widely used worldwide. However, its toxicity to non-targeted organisms has not been fully elucidated. In this study, the toxicity of glyphosate-based herbicide was evaluated on goldfish (Carassius auratus) after long-term exposure. Tissues of brains, kidneys and livers were collected and submitted to NMR-based metabolomics analysis and histopathological inspection. Plasma was collected and the blood biochemical indexes of AST, ALT, BUN, CRE, LDH, SOD, GSH-Px, GR and MDA were measured. Long-term glyphosate exposure caused disorders of blood biochemical indexes and renal tissue injury in goldfish. Metabolomics analysis combined with correlation network analysis uncovered significant perturbations in oxidative stress, energy metabolism, amino acids metabolism and nucleosides metabolism in glyphosate dosed fish, which provide new clues to the toxicity of glyphosate. This integrated metabolomics approach showed its applicability in discovering the toxic mechanisms of pesticides, which provided new strategy for the assessment of the environmental risk of herbicides to non-target organisms. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

    Science.gov (United States)

    Sharkhuu, Altanbadralt; Narasimhan, Meena L; Merzaban, Jasmeen S; Bressan, Ray A; Weller, Steve; Gehring, Chris

    2014-01-01

    Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide. PMID:24654847

  9. Utilization of Glyphosate as Phosphate Source: Biochemistry and Genetics of Bacterial Carbon-Phosphorus Lyase

    Science.gov (United States)

    Zechel, David L.; Jochimsen, Bjarne

    2014-01-01

    SUMMARY After several decades of use of glyphosate, the active ingredient in weed killers such as Roundup, in fields, forests, and gardens, the biochemical pathway of transformation of glyphosate phosphorus to a useful phosphorus source for microorganisms has been disclosed. Glyphosate is a member of a large group of chemicals, phosphonic acids or phosphonates, which are characterized by a carbon-phosphorus bond. This is in contrast to the general phosphorus compounds utilized and metabolized by microorganisms. Here phosphorus is found as phosphoric acid or phosphate ion, phosphoric acid esters, or phosphoric acid anhydrides. The latter compounds contain phosphorus that is bound only to oxygen. Hydrolytic, oxidative, and radical-based mechanisms for carbon-phosphorus bond cleavage have been described. This review deals with the radical-based mechanism employed by the carbon-phosphorus lyase of the carbon-phosphorus lyase pathway, which involves reactions for activation of phosphonate, carbon-phosphorus bond cleavage, and further chemical transformation before a useful phosphate ion is generated in a series of seven or eight enzyme-catalyzed reactions. The phn genes, encoding the enzymes for this pathway, are widespread among bacterial species. The processes are described with emphasis on glyphosate as a substrate. Additionally, the catabolism of glyphosate is intimately connected with that of aminomethylphosphonate, which is also treated in this review. Results of physiological and genetic analyses are combined with those of bioinformatics analyses. PMID:24600043

  10. Pouteria torta: a native species of the Brazilian Cerrado as a bioindicator of glyphosate action

    Directory of Open Access Journals (Sweden)

    P. F. Batista

    2017-10-01

    Full Text Available Abstract In Brazil, the expansion of agricultural activity and the associated indiscriminate use of herbicides such as glyphosate is directly related to the loss of biodiversity in the Cerrado. The identification of plant species as bioindicators of herbicide action, especially species native to the area, can help in monitoring the impacts of xenobiotics in the remaining Cerrado. Thus, this study was designed to evaluate the possible use of the native Cerrado species Pouteria torta as a bioindicator of glyphosate action via changes in physiological performance. At 16 months after sowing, the effect of glyphosate was evaluated by applying the following doses: 0 (control, 25, 50, 100, 200, 400, 800, and 1200 g a.e. ha-1. In response to glyphosate, P. torta exhibited reductions in photosynthesis and chloroplastid pigment content, as well as accumulation of shikimic acid and the occurrence of chlorosis and necrosis. These changes demonstrate the high sensitivity of P. torta to glyphosate and its potential for use as a bioindicator of this herbicide.

  11. Effects of the herbicide glyphosate on the uptake of 239Pu and 241Am to vegetation

    International Nuclear Information System (INIS)

    Nisbet, A.F.; Shaw, S.

    1990-01-01

    Glyphosate (n-phosphonomethyl glycine) is a broad spectrum herbicide widely used in lowland agriculture, forestry and improved upland pastures. Although its metal chelating properties are well established, its interaction with radionuclides remains unknown. A pot experiment was conducted to determine the effect of soil applications of glyphosate on the uptake of 239 Pu and 241 Am to peas and carrots grown in loam, peat and sand soils. Soil-to-plant transfer factors were calculated for treated and untreated soils at harvest. The most marked effect was an increase in 241 Am uptake to crops grown in loam soil. Supplementary laboratory batch experiments were conducted by shaking radiolabelled soil and its associated soil solution with glyphosate. The activity concentration of 241 Am increased ten fold in the liquid phase of loam soils treated with glyphosate. It is postulated that this 241 Am desorption could have been mediated by the formation of a stable Am-glyphosate complex which was subsequently more available for crop uptake than Am alone. (author)

  12. A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

    KAUST Repository

    Sharkhuu, Altanbadralt

    2014-06-01

    Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

  13. A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

    KAUST Repository

    Sharkhuu, Altanbadralt; Narasimhan, Meena L.; Merzaban, Jasmeen; Bressan, Ray A.; Weller, Steve; Gehring, Christoph A

    2014-01-01

    Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

  14. Epidemiologic studies of glyphosate and non-cancer health outcomes: a review.

    Science.gov (United States)

    Mink, Pamela J; Mandel, Jack S; Lundin, Jessica I; Sceurman, Bonnielin K

    2011-11-01

    The United States (US) Environmental Protection Agency (EPA) and other regulatory agencies around the world have registered glyphosate as a broad-spectrum herbicide for use on multiple food and non-food use crops. To examine potential health risks in humans, we searched and reviewed the literature to evaluate whether exposure to glyphosate is associated causally with non-cancer health risks in humans. We also reviewed biomonitoring studies of glyphosate to allow for a more comprehensive discussion of issues related to exposure assessment and misclassification. Cohort, case-control and cross-sectional studies on glyphosate and non-cancer outcomes evaluated a variety of endpoints, including non-cancer respiratory conditions, diabetes, myocardial infarction, reproductive and developmental outcomes, rheumatoid arthritis, thyroid disease, and Parkinson's disease. Our review found no evidence of a consistent pattern of positive associations indicating a causal relationship between any disease and exposure to glyphosate. Most reported associations were weak and not significantly different from 1.0. Because accurate exposure measurement is crucial for valid results, it is recommended that pesticide-specific exposure algorithms be developed and validated. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Assessment of toxicity of a glyphosate-based formulation using bacterial systems in lake water.

    Science.gov (United States)

    Amorós, I; Alonso, J L; Romaguera, S; Carrasco, J M

    2007-05-01

    A new Aeromonas bioassay is described to assess the potential harmful effects of the glyphosate-based herbicide, Roundup, in the Albufera lake, a protected area near Valencia. Viability markers as membrane integrity, culturability and beta-galactosidase production of Aeromonas caviae were studied to determine the influence of the herbicide in the bacterial cells. Data from the multifactor analysis of variance test showed no significant differences (P>0.05) between A. caviae counts of viability markers at the studied concentrations (0, 50 and 100 mg l-1 of glyphosate). The effects of Roundup on microbial biota present in the lake were assessed by measuring the number of indigenous mesophilic Aeromonas in presence of different amounts of the herbicide at 0, 50 and 100 mg l-1 of glyphosate. In samples containing 50 and 100 mg l-1 of glyphosate a significant (PAlbufera lake water to Microtox luminescent bacterium (Vibrio fischeri) also was determined. The EC50 values obtained were 36.4 mg l-1 and 64.0 mgl-1 of glyphosate respectively. The acidity (pH 4.5) of the herbicide formulation was the responsible of the observed toxicity.

  16. Differential microRNA expression in the prefrontal cortex of mouse offspring induced by glyphosate exposure during pregnancy and lactation.

    Science.gov (United States)

    Ji, Hua; Xu, Linhao; Wang, Zheng; Fan, Xinli; Wu, Lihui

    2018-03-01

    Glyphosate is the active ingredient in numerous herbicide formulations. The role of glyphosate in neurotoxicity has been reported in human and animal models. However, the detailed mechanism of the role of glyphosate in neuronal development remains unknown. Recently, several studies have reported evidence linking neurodevelopmental disorders (NDDs) with gestational glyphosate exposure. The current group previously identified microRNAs (miRNAs) that are associated with the etiology of NDDs, but their expression levels in the developing brain following glyphosate exposure have not been characterized. In the present study, miRNA expression patterns were evaluated in the prefrontal cortex (PFC) of 28 postnatal day mouse offspring following glyphosate exposure during pregnancy and lactation. An miRNA microarray detected 55 upregulated and 19 downregulated miRNAs in the PFC of mouse offspring, and 20 selected deregulated miRNAs were further evaluated by quantitative polymerase chain reaction (PCR). A total of 11 targets of these selected deregulated miRNAs were analyzed using bioinformatics. Gene Ontology (GO) terms associated with the relevant miRNAs included neurogenesis (GO:0050769), neuron differentiation (GO:0030182) and brain development (GO:0007420). The genes Cdkn1a, Numbl, Notch1, Fosl1 and Lef1 are involved in the Wnt and Notch signaling pathways, which are closely associated with neural development. PCR arrays for the mouse Wnt and Notch signaling pathways were used to validate the effects of glyphosate on the expression pattern of genes involved in the Wnt and Notch pathways. Nr4a2 and Wnt7b were downregulated, while Dkk1, Dixdc1, Runx1, Shh, Lef-1 and Axin2 were upregulated in the PFC of mice offspring following glyphosate exposure during pregnancy and lactation. These results indicated abnormalities of the Wnt/β-catenin and Notch pathways. These findings may be of particular interest for understanding the mechanism of glyphosate-induced neurotoxicity, as

  17. The role of L-type amino acid transporters in the uptake of glyphosate across mammalian epithelial tissues.

    Science.gov (United States)

    Xu, Jiaqiang; Li, Gao; Wang, Zhuoyi; Si, Luqin; He, Sijie; Cai, Jialing; Huang, Jiangeng; Donovan, Maureen D

    2016-02-01

    Glyphosate is one of the most commonly used herbicides worldwide due to its broad spectrum of activity and reported low toxicity to humans. Glyphosate has an amino acid-like structure that is highly polar and shows low bioavailability following oral ingestion and low systemic toxicity following intravenous exposures. Spray applications of glyphosate in agricultural or residential settings can result in topical or inhalation exposures to the herbicide. Limited systemic exposure to glyphosate occurs following skin contact, and pulmonary exposure has also been reported to be low. The results of nasal inhalation exposures, however, have not been evaluated. To investigate the mechanisms of glyphosate absorption across epithelial tissues, the permeation of glyphosate across Caco-2 cells, a gastrointestinal epithelium model, was compared with permeation across nasal respiratory and olfactory tissues excised from cows. Saturable glyphosate uptake was seen in all three tissues, indicating the activity of epithelial transporters. The uptake was shown to be ATP and Na(+) independent, and glyphosate permeability could be significantly reduced by the inclusion of competitive amino acids or specific LAT1/LAT2 transporter inhibitors. The pattern of inhibition of glyphosate permeability across Caco-2 and nasal mucosal tissues suggests that LAT1/2 play major roles in the transport of this amino-acid-like herbicide. Enhanced uptake into the epithelial cells at barrier mucosae, including the respiratory and gastrointestinal tracts, may result in more significant local and systemic effects than predicted from glyphosate's passive permeability, and enhanced uptake by the olfactory mucosa may result in further CNS disposition, potentially increasing the risk for brain-related toxicities. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. First confirmation and characterization of target and non-target site resistance to glyphosate in Palmer amaranth (Amaranthus palmeri) from Mexico.

    Science.gov (United States)

    Dominguez-Valenzuela, Jose Alfredo; Gherekhloo, Javid; Fernández-Moreno, Pablo Tomás; Cruz-Hipolito, Hugo Enrique; Alcántara-de la Cruz, Ricardo; Sánchez-González, Eduardo; De Prado, Rafael

    2017-06-01

    Following the introduction of glyphosate-resistant (GR)-cotton crops in Mexico, farmers have relied upon glyphosate as being the only herbicide for in-season weed control. Continuous use of glyphosate within the same year and over multiple successive years has resulted in the selection of glyphosate resistance in Palmer amaranth (Amarantus palmeri). Dose-response assays confirmed resistance in seven different accessions. The resistance ratio based on GR 50 values (50% growth reduction) varied between 12 and 83. At 1000 μM glyphosate, shikimic acid accumulation in the S-accession was 30- to 2-fold higher at compared to R-accessions. At 96 h after treatment, 35-44% and 61% of applied 14 C-glyphosate was taken up by leaves of plants from R- and S-accessions, respectively. At this time, a significantly higher proportion of the glyphosate absorbed remained in the treated leaf of R-plants (55-69%) compared to S-plants (36%). Glyphosate metabolism was low and did not differ between resistant and susceptible plants. Glyphosate was differentially metabolized to AMPA and glyoxylate in plants of R- and S-accessions, although it was low in both accessions (glyphosate collected from GR-cotton crops from Mexico. This is the first study demonstrating glyphosate-resistance in Palmer amaranth from Mexico. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Om tolerance

    DEFF Research Database (Denmark)

    Huggler, Jørgen

    2007-01-01

    Begrebet tolerance og dets betydninger diskuteres med henblik på en tydeliggørelse af begrebets forbindelse med stat, religion, ytringsfrihed, skeptisk erkendelsesteori, antropologi og pædagogik.......Begrebet tolerance og dets betydninger diskuteres med henblik på en tydeliggørelse af begrebets forbindelse med stat, religion, ytringsfrihed, skeptisk erkendelsesteori, antropologi og pædagogik....

  20. Spectroscopic Detection of Glyphosate in Water Assisted by Laser-Ablated Silver Nanoparticles

    Science.gov (United States)

    De Góes, Rafael Eleodoro; Muller, Marcia; Fabris, José Luís

    2017-01-01

    Glyphosate is one of the most widely used herbicides in the world. Its safety for both human health and aquatic biomes is a subject of wide debate. There are limits to glyphosate’s presence in bodies of water, and it is usually detected through complex analytical procedures. In this work, the presence of glyphosate is detected directly through optical interrogation of aqueous solution. For this purpose, silver nanoparticles were produced by pulsed laser ablation in liquids. Limits of detection of 0.9 mg/L and 3.2 mg/L were obtained with UV-Vis extinction and Surface Enhanced Raman spectroscopies, respectively. The sensing mechanism was evaluated in the presence of potential interferents as well as with commercial glyphosate-based herbicides. PMID:28445394

  1. Biomonitoring of Danish school children and mothers including biomarkers of PBDE and glyphosate

    DEFF Research Database (Denmark)

    Knudsen, Lisbeth E.; Hansen, Pernille Winton; Mizrak, Seher

    2017-01-01

    Danish school children aged 6–11 years and their mothers from rural and urban areas in autumn 2011. Some – but not all – results were published; however, the concurrence of the chemicals has not been assessed. Methods: The measured concentrations of polybrominated diphenyl ethers (PBDEs) and glyphosate...... is assessed to complete the investigation of all 66 chemicals in DEMOCOPHES. The concentrations of PBDEs were measured in plasma samples of 143 mothers and 116 children. Glyphosate was measured in a subsample of 27 urine samples. Previously assessed chemicals were polychlorinated biphenyls (PCBs...... the concentrations of the different environmental chemicals. investigated by correlation analysis. Results: PBDE47 was found in relatively high levels compared with previous Danish results in both mothers and children, with a significantly higher level in the children compared to their mothers. Glyphosate...

  2. Low glyphosate rates do not affect Citrus limonia (L.) Osbeck seedlings.

    Science.gov (United States)

    Gravena, Renan; Victoria Filho, Ricardo; Alves, Pedro Luis Ca; Mazzafera, Paulo; Gravena, Adriana R

    2009-04-01

    Glyphosate is used to control weeds in citrus orchards, and accidental spraying or wind drift onto the seedlings may cause growth arrest owing to metabolism disturbance. Two experiments were carried out to investigate the effect of non-lethal rates (0, 180, 360 and 720 g AI ha(-1)) of glyphosate on four-month-old 'Cravo' lime, Citrus limonia (L.) Osbeck, seedlings. Photosynthesis and the concentrations of shikimic acid, total free amino acids and phenolic acids were evaluated. Only transitory effects were observed in the contents of shikimate and total free amino acids. No visual effects were observed. The present study showed that glyphosate at non-lethal rates, which is very usual when accidental spraying or wind drift occurs in citrus orchard, did not cause severe metabolic damage in 'Cravo' lime seedlings. Copyright (c) 2009 Society of Chemical Industry.

  3. Deriva simulada de formulações comerciais de glyphosate sobre maracujazeiro amarelo Drift simulation of glyphosate commercial formulations on yellow passion fruit growth

    Directory of Open Access Journals (Sweden)

    A. Wagner Júnior

    2008-01-01

    Full Text Available Objetivou-se com este trabalho avaliar os efeitos da deriva de formulações comerciais de glyphosate no desenvolvimento de plantas jovens de maracujazeiro amarelo. O trabalho foi realizado em casa de vegetação do Departamento de Fitotecnia da Universidade Federal de Viçosa, durante o período de março a abril de 2007. Foi utilizado o delineamento experimental de blocos casualizados, em esquema fatorial 3 x 4 + 1, em que três foram as formulações de glyphosate e cinco foram as doses utilizadas acrescidas de testemunha sem herbicida. O trabalho foi conduzido com cinco repetições, sendo cada planta considerada como parcela experimental. As formulações comerciais aplicadas foram Roundup Transorb®, Roundup Original® e Zapp QI®, utilizando-se as seguintes doses (g e.a ha-1: 43,2; 86,4; 172,8; e 345,6 g ha-1. Aos 28 dias após a aplicação (DAA, avaliaram-se os comprimentos da parte aérea, da raiz e total (cm; o diâmetro do caule (mm; o número de folhas e de ramificações primárias; a massa seca da parte aérea e da raiz das plantas (g; e a área foliar por planta (cm². Aos 7, 14 e 28 DAA, avaliou-se, visualmente, a porcentagem de intoxicação das plantas. O glyphosate em deriva simulada, independentemente das formulações utilizadas, ocasionou injúrias no maracujazeiro amarelo, acarretando redução no crescimento e desenvolvimento das plantas. As formulações Roundup Transorb® e Roundup Original® foram mais prejudiciais às plantas que o Zapp Qi®. O maracujazeiro amarelo mostrou-se suscetível à deriva, devendo o glyphosate ser usado com cuidado, de maneira a atingir somente as plantas daninhas a serem controladas.The aim of this work was to evaluate the effects of drift simulation of commercial formulations of glyphosate on the growth of young plants of yellow passion fruit. The work was carried out at the Plant Science Department of the Universidade Federal de Viçosa (MG, Brazil, from March to April 2007. The

  4. Disposition and metabolism of glyphosate in the Sprague Dawley rat following oral administration

    International Nuclear Information System (INIS)

    Brewster, D.W.; Warren, J.A.; Hopkins, W.E.

    1991-01-01

    Five groups of male SD rats were administered 14 C-labelled glyphosate, (N-[(phosphonomethyl)glycine]) by gavage at a dose level of 10 mg/kg. Animals were killed 2, 6.3, 28, 96 and 168 hours after dosing and the amount of glyphosate-derived material in various organs and excreta were determined. In addition, the metabolic profile in tissues containing > 1% of the administered dose was evaluated. Approximately 93% of the body burden 2 hours after administration was associated with the GI contents and small intestinal tissue. The total body burden 7 days after administration was ∼1% of the dose. Only the kidneys, small intestine, colon, bone, GI contents, residual carcass contained > 1% of the dose 6 hours after administration and the metabolic profiles of these tissues indicated that ∼100% of the body burden was present as unmetabolized parent material. Glyphosate was rapidly eliminated from these tissues with halflives ranging from 20 to 90 hours. A minor metabolite comprising < 0.1% of the dose was detected in the GI contents and colon tissue of 3 animals. Less than 40% of the administered dose was absorbed from the gut and glyphosate was rapidly eliminated from the body with urine and feces being equally important routes of elimination. The whole body halflife was approximately 52 hours. The results from this study indicate that no toxic metabolites of glyphosate were produced, as there was little evidence of metabolism, and essentially 100% of the body burden was parent glyphosate with no significant persistence of accumulated material

  5. Investigating the mechanisms of glyphosate resistance in goosegrass (Eleusine indica (L.) Gaertn.) by RNA sequencing technology.

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Xu; Zhang, Chaoxian

    2017-01-01

    Glyphosate is an important non-selective herbicide that is in common use worldwide. However, evolved glyphosate-resistant (GR) weeds significantly affect crop yields. Unfortunately, the mechanisms underlying resistance in GR weeds, such as goosegrass (Eleusine indica (L.) Gaertn.), an annual weed found worldwide, have not been fully elucidated. In this study, transcriptome analysis was conducted to further assess the potential mechanisms of glyphosate resistance in goosegrass. The RNA sequencing libraries generated 24 597 462 clean reads. De novo assembly analysis produced 48 852 UniGenes with an average length of 847 bp. All UniGenes were annotated using seven databases. Sixteen candidate differentially expressed genes selected by digital gene expression analysis were validated by quantitative real-time PCR (qRT-PCR). Among these UniGenes, the EPSPS and PFK genes were constitutively up-regulated in resistant (R) individuals and showed a higher copy number than that in susceptible (S) individuals. The expressions of four UniGenes relevant to photosynthesis were inhibited by glyphosate in S individuals, and this toxic response was confirmed by gas exchange analysis. Two UniGenes annotated as glutathione transferase (GST) were constitutively up-regulated in R individuals, and were induced by glyphosate both in R and S. In addition, the GST activities in R individuals were higher than in S. Our research confirmed that two UniGenes (PFK, EPSPS) were strongly associated with target resistance, and two GST-annotated UniGenes may play a role in metabolic glyphosate resistance in goosegrass. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  6. Chemical control of different Digitaria insularis populations and management of a glyphosate-resistant population

    OpenAIRE

    CORREIA,N.M.; ACRA,L.T.; BALIEIRO,G.

    2015-01-01

    This study aimed to control different populations of Digitaria insularisby glyphosate herbicide, isolated and mixed, besides the combination of methods (chemical and mechanical) to manage resistant adult plants. Three experiments were conducted, one in pots which were maintained under non-controlled conditions and two under field conditions. In the experiment in pots, twelve populations of D. insularis were sprayed with isolated glyphosate (1.44 and 2.16 kg a.e. ha-1) and mixed (1.44 and 2.16...

  7. Researches concerning the influence of inorganic substratum over glyphosate mineralization capacity in soil

    Directory of Open Access Journals (Sweden)

    Monica NEGREA

    2009-05-01

    Full Text Available The object of this work was to study the dynamic of glyphosate mineralization in different agricultural soils characteristic to the west part of Romania: Black Chernozem, Typical Gleysol, Phaeozom and Slight Vertisol with moderate carbonatation. The degradation experiment was conducted under controlled laboratory conditions using Glyphosatephosphonomethyl- 14C-labeled with specific activity 2,2mCi/mmol. The experimental results indicated that the dynamic of glyphosate mineralization until the stage CO2 in present of inorganic compounds is different for each soil, the mineralization of the herbicide is important in the first days of incubation and then decreases with time until the end of experimentation.

  8. Controle de plantas daninhas na cultura de soja resistente ao glyphosate

    Directory of Open Access Journals (Sweden)

    Núbia Maria Correia

    2010-01-01

    Full Text Available O objetivo da pesquisa foi avaliar o controle de plantas daninhas em área cultivada com soja resistente ao herbicida glyphosate, sem a utilização de práticas complementares de manejo de plantas daninhas. Foram desenvolvidos experimentos, em condições de campo, nos anos agrícolas 2005/2006 e 2006/2007 em Jaboticabal (SP. Foram avaliadas duas cultivares de soja resistentes ao glyphosate (CD 214 RR e M-SOY 8008 RR, oito tratamentos de herbicidas (glyphosate, em aplicação única, nas doses de 0,48; 0,72; 0,96 e 1,20 kg ha-1 de equivalente ácido, associadas ou não a aplicação sequencial na dose de 0,48 kg ha-1, além de duas testemunhas, uma capinada e outra mantida infestada. As cultivares de soja influenciaram na infestação das espécies de plantas daninhas na área. Sem a aplicação de glyphosate, houve o predomínio de X. strumarium na área, desfavorecendo a ocorrência de outras espécies. Quando utilizado glyphosate, independentemente da dose, a infestação contabilizada aos 35 e 40 dias após a primeira aplicação, no primeiro e segundo ano, respectivamente, foi baixa. O controle de plantas daninhas na cultura da soja transgênica é diretamente influenciado pela dose de glyphosate, havendo controle satisfatório com a aplicação única de 0,96 kg ha-1 ou a sequencial de 0,48 + 0,48 kg ha-1 de glyphosate. Em situação de menor infestação (2006/2007, a aplicação única de 0,48 kg ha-1 de glyphosate é suficiente para o controle das plantas daninhas. As cultivares de soja transgênica CD 214 RR e M-SOY 8008 RR influenciam diferencialmente a dinâmica das espécies de plantas daninhas, sendo o controle químico mais efetivo na situação de cultivo de M-SOY 8008 RR, em que houve menor diversidade e desenvolvimento das plantas daninhas.

  9. Coca and poppy eradication in Colombia: environmental and human health assessment of aerially applied glyphosate.

    Science.gov (United States)

    Solomon, Keith R; Anadón, Arturo; Carrasquilla, Gabriel; Cerdeira, Antonio L; Marshall, Jon; Sanin, Luz-Helena

    2007-01-01

    The production of coca and poppy as well as the processing and production of cocaine and heroin involve significant environmental impacts. Both coca and poppy are grown intensively in a process that involves the clearing of land in remote areas, the planting of the crop, and protection against pests such as weeds, insects, and pathogens. The aerial spray program to control coca and poppy production in Colombia with the herbicide glyphosate is conducted with modern state-of-the-art aircraft and spray equipment. As a result of the use of best available spray and navigation technology, the likelihood of accidental off-target spraying is small and is estimated to be less than 1% of the total area sprayed. Estimated exposures in humans resulting from direct overspray, contact with treated foliage after reentry to fields, inhalation, diet, and drinking water were small and infrequent. Analyses of surface waters in five watersheds showed that, on most occasions, glyphosate was not present at measurable concentrations; only two samples had residues just above the method detection limit of 25 microg/L. Concentrations of glyphosate in air were predicted to be very small because of negligible volatility. Glyphosate in soils that are directly sprayed will be tightly bound and biologically unavailable and have no residual activity. Concentrations of glyphosate plus Cosmo-Flux will be relatively large in shallow surface waters that are directly oversprayed (maximum instantaneous concentration of 1,229microgAE/L in water 30cm deep); however, no information was available on the number of fields in close proximity to surface waters, and thus it was not possible to estimate the likelihood of such contamination. The formulation used in Colombia, a mixture of glyphosate and Cosmo-Flux, has low toxicity to mammals by all routes of exposure, although some temporary eye irritation may occur. Published epidemiological studies have not suggested a strong or consistent linkage between

  10. Identification of regulated genes conferring resistance to high concentrations of glyphosate in a new strain of Enterobacter.

    Science.gov (United States)

    Fei, Yun-Yan; Gai, Jun-Yi; Zhao, Tuan-Jie

    2013-12-01

    Glyphosate is a widely used herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity. Most plants and microbes are sensitive to glyphosate. However, transgenic-resistant crops that contain a modified epsps obtained from the resistant microbes have been commercially successful and therefore, new resistance genes and their adaptive regulatory mechanisms are of great interest. In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  11. Influence of glyphosate and its formulation (Roundup[reg]) on the toxicity and bioavailability of metals to Ceriodaphnia dubia

    Energy Technology Data Exchange (ETDEWEB)

    Tsui, Martin T.K. [Department of Biology, Chinese University of Hong Kong, Shatin, New Territories, Hong Kong (China); Department of Biology, Hong Kong University of Science and Technology (HKUST), Clear Water Bay, Kowloon, Hong Kong (China); Wang Wenxiong [Department of Biology, The Hong Kong University of Science and Technology (HKUST), Clear Water Bay, Kowloon, Hong Kong (China); Chu, L.M. [Department of Biology, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong (China)]. E-mail: leemanchu@cuhk.edu.hk

    2005-11-15

    This study examined the toxicological interaction between glyphosate (or its formulation, Roundup[reg]) and several heavy metals to a freshwater cladoceran, Ceriodaphnia dubia. We demonstrated that all binary combinations of Roundup[reg] and metals (Cd, Cu, Cr, Ni, Pb, Se and Zn) exhibited 'less than additive' mixture toxicity, with 48-h LC50 toxic unit>1. Addition of glyphosate alone could significantly reduce the acute toxicity of Ag, Cd, Cr, Cu, Ni, Pb and Zn (but not Hg and Se). The ratio between glyphosate and metal ions was important in determining the mitigation of metal toxicity by glyphosate. A bioaccumulation study showed that in the presence of glyphosate the uptake of some metals (e.g. Ag) was halted but that of others (e.g. Hg) was increased significantly. Therefore, our study strongly suggests that glyphosate and its commercial formulations can control the toxicity as well as the bioavailability of heavy metals in aquatic ecosystems where both groups of chemicals can co-occur. - Glyphosate can control the toxicity and bioavailability of many heavy metals in the aquatic environment.

  12. DNA damage and methylation induced by glyphosate in human peripheral blood mononuclear cells (in vitro study).

    Science.gov (United States)

    Kwiatkowska, Marta; Reszka, Edyta; Woźniak, Katarzyna; Jabłońska, Ewa; Michałowicz, Jaromir; Bukowska, Bożena

    2017-07-01

    Glyphosate is a very important herbicide that is widely used in the agriculture, and thus the exposure of humans to this substance and its metabolites has been noted. The purpose of this study was to assess DNA damage (determination of single and double strand-breaks by the comet assay) as well as to evaluate DNA methylation (global DNA methylation and methylation of p16 (CDKN2A) and p53 (TP53) promoter regions) in human peripheral blood mononuclear cells (PBMCs) exposed to glyphosate. PBMCs were incubated with the compound studied at concentrations ranging from 0.1 to 10 mM for 24 h. The study has shown that glyphosate induced DNA lesions, which were effectively repaired. However, PBMCs were unable to repair completely DNA damage induced by glyphosate. We also observed a decrease in global DNA methylation level at 0.25 mM of glyphosate. Glyphosate at 0.25 mM and 0.5 mM increased p53 promoter methylation, while it did not induce statistically significant changes in methylation of p16 promoter. To sum up, we have shown for the first time that glyphosate (at high concentrations from 0.5 to 10 mM) may induce DNA damage in leucocytes such as PBMCs and cause DNA methylation in human cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. What do farmers' weed control decisions imply about glyphosate resistance? Evidence from surveys of US corn fields.

    Science.gov (United States)

    Wechsler, Seth J; McFadden, Jonathan R; Smith, David J

    2018-05-01

    The first case of glyphosate-resistant weeds in the United States was documented in 1998, 2 years after the commercialization of genetically engineered herbicide-resistant (HR) corn and soybeans. Currently, over 15 glyphosate-resistant weed species affect US crop production areas. These weeds have the potential to reduce yields, increase costs, and lower farm profitability. The objective of our study is to develop a behavioral model of farmers' weed management decisions and use it to analyze weed resistance to glyphosate in US corn farms. On average, we find that weed control increased US corn yields by 3700 kg ha -1 (worth approximately $US 255 ha -1 ) in 2005 and 3500 kg ha -1 (worth approximately $US 575 ha -1 ) in 2010. If glyphosate resistant weeds were absent, glyphosate killed approximately 99% of weeds, on average, when applied at the label rate in HR production systems. Average control was dramatically lower in states where glyphosate resistance was widespread. We find that glyphosate resistance had a significant impact on weed control costs and corn yields of US farmers in 2005 and 2010. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  14. Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

    Science.gov (United States)

    Zhang, Chun; Feng, Li; Tian, Xing-Shan

    2018-04-26

    The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

  15. Effects of low concentrations of glyphosate-based herbicide factor 540® on an agricultural stream freshwater phytoplankton community.

    Science.gov (United States)

    Smedbol, Élise; Gomes, Marcelo Pedrosa; Paquet, Serge; Labrecque, Michel; Lepage, Laurent; Lucotte, Marc; Juneau, Philippe

    2018-02-01

    Residual glyphosate from glyphosate based herbicides (GBH) are ubiquitously detected in streams draining agricultural fields, and may affect phytoplankton communities present in these ecosystems. Here, the effects of the exposure (96 h) of a phytoplankton community collected in an agricultural stream to various glyphosate concentrations (1, 5, 10, 50, 100, 500 and 1000 μg l -1 ) of Factor 540 ® GBH were investigated. The lowest GBH concentration of 1 μg l -1 reduced chlorophyll a and carotenoid contents. Low glyphosate concentrations, such as 5 and 10 μg l -1 , promoted changes in the community's structure and reduced the diversity of the main algal species. At glyphosate concentrations ranging from 50 to 1000 μg l -1 , the phytoplankton community's composition was modified and new main species appeared. The highest glyphosate concentrations (500 and 1000 μg l -1 ) affected the shikimate content, the lipid peroxidation and the activity of antioxidant enzymes (superoxide dismutase, catalase and ascorbate peroxidase). These results indicate that GBH can modify structural and functional properties of freshwater phytoplankton communities living in streams located in agricultural areas at glyphosate concentrations much inferior to the 800 μg l -1 threshold set by the Canadian guidelines for the protection of aquatic life. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  16. Influence of glyphosate and its formulation (Roundup[reg]) on the toxicity and bioavailability of metals to Ceriodaphnia dubia

    International Nuclear Information System (INIS)

    Tsui, Martin T.K.; Wang Wenxiong; Chu, L.M.

    2005-01-01

    This study examined the toxicological interaction between glyphosate (or its formulation, Roundup[reg]) and several heavy metals to a freshwater cladoceran, Ceriodaphnia dubia. We demonstrated that all binary combinations of Roundup[reg] and metals (Cd, Cu, Cr, Ni, Pb, Se and Zn) exhibited 'less than additive' mixture toxicity, with 48-h LC50 toxic unit>1. Addition of glyphosate alone could significantly reduce the acute toxicity of Ag, Cd, Cr, Cu, Ni, Pb and Zn (but not Hg and Se). The ratio between glyphosate and metal ions was important in determining the mitigation of metal toxicity by glyphosate. A bioaccumulation study showed that in the presence of glyphosate the uptake of some metals (e.g. Ag) was halted but that of others (e.g. Hg) was increased significantly. Therefore, our study strongly suggests that glyphosate and its commercial formulations can control the toxicity as well as the bioavailability of heavy metals in aquatic ecosystems where both groups of chemicals can co-occur. - Glyphosate can control the toxicity and bioavailability of many heavy metals in the aquatic environment

  17. Impact of a commercial glyphosate formulation on adsorption of Cd(II) and Pb(II) ions on paddy soil.

    Science.gov (United States)

    Divisekara, T; Navaratne, A N; Abeysekara, A S K

    2018-05-01

    Use of glyphosate as a weedicide on rice cultivation has been a controversial issue in Sri Lanka, due to the hypothesis that the metal complexes of commercial glyphosate is one of the causative factors of Chronic Kidney Disease of unknown aetiology (CKDu) prevalent in some parts of Sri Lanka. The effect of commercial glyphosate on the adsorption and desorption of Cd(II) and Pb(II) ions on selective paddy soil studied using batch experiments, over a wide concentration range, indicates that the Langmuir adsorption isotherm model is obeyed at low initial metal ion concentrations while the Freundlich adsorption isotherm model obeys at high metal ion concentrations in the presence and absence of glyphosate. For all cases, adsorption of both Cd(II) and Pb(II) ions obeys pseudo second order kinetics, suggesting that initial adsorption is a chemisorption process. In the presence of glyphosate formulation, the extent of adsorption of Cd(II) and Pb(II) ions on soil is decreased, while their desorption is increased at high concentrations of glyphosate. Low concentrations of glyphosate formulation do not significantly affect the desorption of metal ions from soil. Reduction of adsorption leads to enhance the concentration of Cd(II) and Pb(II) ions in the aqueous phase when in contact with soil. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Evaluation of carcinogenic potential of the herbicide glyphosate, drawing on tumor incidence data from fourteen chronic/carcinogenicity rodent studies.

    Science.gov (United States)

    Greim, Helmut; Saltmiras, David; Mostert, Volker; Strupp, Christian

    2015-03-01

    Abstract Glyphosate, an herbicidal derivative of the amino acid glycine, was introduced to agriculture in the 1970s. Glyphosate targets and blocks a plant metabolic pathway not found in animals, the shikimate pathway, required for the synthesis of aromatic amino acids in plants. After almost forty years of commercial use, and multiple regulatory approvals including toxicology evaluations, literature reviews, and numerous human health risk assessments, the clear and consistent conclusions are that glyphosate is of low toxicological concern, and no concerns exist with respect to glyphosate use and cancer in humans. This manuscript discusses the basis for these conclusions. Most toxicological studies informing regulatory evaluations are of commercial interest and are proprietary in nature. Given the widespread attention to this molecule, the authors gained access to carcinogenicity data submitted to regulatory agencies and present overviews of each study, followed by a weight of evidence evaluation of tumor incidence data. Fourteen carcinogenicity studies (nine rat and five mouse) are evaluated for their individual reliability, and select neoplasms are identified for further evaluation across the data base. The original tumor incidence data from study reports are presented in the online data supplement. There was no evidence of a carcinogenic effect related to glyphosate treatment. The lack of a plausible mechanism, along with published epidemiology studies, which fail to demonstrate clear, statistically significant, unbiased and non-confounded associations between glyphosate and cancer of any single etiology, and a compelling weight of evidence, support the conclusion that glyphosate does not present concern with respect to carcinogenic potential in humans.

  19. The pattern of shikimate pathway and phenylpropanoids after inhibition by glyphosate or quinate feeding in pea roots.

    Science.gov (United States)

    Zabalza, Ana; Orcaray, Luis; Fernández-Escalada, Manuel; Zulet-González, Ainhoa; Royuela, Mercedes

    2017-09-01

    The shikimate pathway is a metabolic route for the biosynthesis of aromatic amino acids (AAAs) (i.e. phenylalanine, tyrosine, and tryptophan). A key enzyme of shikimate pathway (5-enolpyruvylshikimate-3-phosphate synthase, EPSPS) is the target of the widely used herbicide glyphosate. Quinate is a compound synthesized in plants through a side branch of the shikimate pathway. Glyphosate provokes quinate accumulation and exogenous quinate application to plants shows a potential role of quinate in the toxicity of the herbicide glyphosate. Based on this, we hypothesized that the role of quinate accumulation in the toxicity of the glyphosate would be mediated by a deregulation of the shikimate pathway. In this study the effect of the glyphosate and of the exogenous quinate was evaluated in roots of pea plants by analyzing the time course of a full metabolic map of several metabolites of shikimate and phenylpropanoid pathways. Glyphosate application induced an increase of the 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (DAHPS, first enzyme of the shikimate pathway) protein and accumulation of metabolites upstream of the enzyme EPSPS. No common effects on the metabolites and regulation of shikimate pathway were detected between quinate and glyphosate treatments, supporting that the importance of quinate in the mode of action of glyphosate is not mediated by a common alteration of the regulation of the shikimate pathway. Contrary to glyphosate, the exogenous quinate supplied was probably incorporated into the main trunk from the branch pathway and accumulated in the final products, such as lignin, concomitant with a decrease in the amount of DAHPS protein. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. A review of the carcinogenic potential of glyphosate by four independent expert panels and comparison to the IARC assessment.

    Science.gov (United States)

    Williams, Gary M; Aardema, Marilyn; Acquavella, John; Berry, Sir Colin; Brusick, David; Burns, Michele M; de Camargo, Joao Lauro Viana; Garabrant, David; Greim, Helmut A; Kier, Larry D; Kirkland, David J; Marsh, Gary; Solomon, Keith R; Sorahan, Tom; Roberts, Ashley; Weed, Douglas L

    2016-09-01

    The International Agency for Research on Cancer (IARC) published a monograph in 2015 concluding that glyphosate is "probably carcinogenic to humans" (Group 2A) based on limited evidence in humans and sufficient evidence in experimental animals. It was also concluded that there was strong evidence of genotoxicity and oxidative stress. Four Expert Panels have been convened for the purpose of conducting a detailed critique of the evidence in light of IARC's assessment and to review all relevant information pertaining to glyphosate exposure, animal carcinogenicity, genotoxicity, and epidemiologic studies. Two of the Panels (animal bioassay and genetic toxicology) also provided a critique of the IARC position with respect to conclusions made in these areas. The incidences of neoplasms in the animal bioassays were found not to be associated with glyphosate exposure on the basis that they lacked statistical strength, were inconsistent across studies, lacked dose-response relationships, were not associated with preneoplasia, and/or were not plausible from a mechanistic perspective. The overall weight of evidence from the genetic toxicology data supports a conclusion that glyphosate (including GBFs and AMPA) does not pose a genotoxic hazard and therefore, should not be considered support for the classification of glyphosate as a genotoxic carcinogen. The assessment of the epidemiological data found that the data do not support a causal relationship between glyphosate exposure and non-Hodgkin's lymphoma while the data were judged to be too sparse to assess a potential relationship between glyphosate exposure and multiple myeloma. As a result, following the review of the totality of the evidence, the Panels concluded that the data do not support IARC's conclusion that glyphosate is a "probable human carcinogen" and, consistent with previous regulatory assessments, further concluded that glyphosate is unlikely to pose a carcinogenic risk to humans.

  1. Occurrence and levels of glyphosate and AMPA in shallow lakes from the Pampean and Patagonian regions of Argentina.

    Science.gov (United States)

    Castro Berman, M; Marino, D J G; Quiroga, María Victoria; Zagarese, Horacio

    2018-06-01

    Glyphosate (N-(phosphonomethyl)glycine) is a broad-spectrum systemic herbicide used to kill weeds that compete with commercial crops. In Argentina, the use of glyphosate-based herbicides increased dramatically (up to ∼200,000 tons on 2012) since the introduction of glyphosate-resistant crops, such as transgenic soy and resistant corn, and the adoption of non-till practices in the 1990's. Sallow lakes within the Pampa region may be potentially impacted by continuous herbicide usage. We surveyed 52 shallow lakes from the Pampa region (Buenos Aires Province, Argentina) to assess the occurrence and concentrations of glyphosate and its main degradation product (AMPA). For comparison, we also sampled 24 shallow lakes from an area with no agricultural use of glyphosate (Northern Patagonia). Glyphosate and AMPA were analyzed by UPLC-MS/MS ESI (±) in lake water, suspended particulate matter (SPM), and sediment samples. Within the Pampa region, glyphosate residues were detected in >40% of samples. Glyphosate residues were detected more frequently in sediment and surface water than in SPM samples. The mean (maximum) concentrations of glyphosate were 2.11 (4.52) μg l -1 for surface water; 0.10 (0.13) μg l -1 for SPM and 10.47 (20.34) μg kg -1 for sediment samples, respectively. Whereas, mean (maximum) concentrations of AMPA were 0.84 and (0.90) μg l -1 for surface water; 0.07 (0.07) μg l -1 for SPM; and 22.53 (32.89) μg kg -1 for sediment samples. The herbicide was not detected in samples from the Patagonian region. To our knowledge, this is the first study reporting the occurrence and concentrations of the herbicide in freshwater lakes of Argentina. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Towards Tolerance

    NARCIS (Netherlands)

    Lisette Kuyper; Jurjen Iedema; Saskia Keuzenkamp

    2013-01-01

    Across Europe, public attitudes towards lesbian, gay and bisexual (LGB) individuals range from broad tolerance to widespread rejection. Attitudes towards homosexuality are more than mere individual opinions, but form part of the social and political structures which foster or hinder the equality

  3. Intolerant tolerance.

    Science.gov (United States)

    Khushf, G

    1994-04-01

    The Hyde Amendment and Roman Catholic attempts to put restrictions on Title X funding have been criticized for being intolerant. However, such criticism fails to appreciate that there are two competing notions of tolerance, one focusing on the limits of state force and accepting pluralism as unavoidable, and the other focusing on the limits of knowledge and advancing pluralism as a good. These two types of tolerance, illustrated in the writings of John Locke and J.S. Mill, each involve an intolerance. In a pluralistic context where the free exercise of religion is respected, John Locke's account of tolerance is preferable. However, it (in a reconstructed form) leads to a minimal state. Positive entitlements to benefits like artificial contraception or nontherapeutic abortions can legitimately be resisted, because an intolerance has already been shown with respect to those that consider the benefit immoral, since their resources have been coopted by taxation to advance an end that is contrary to their own. There is a sliding scale from tolerance (viewed as forbearance) to the affirmation of communal integrity, and this scale maps on to the continuum from negative to positive rights.

  4. In situ phytoremediation of PAH-contaminated soil by intercropping alfalfa (Medicago sativa L.) with tall fescue (Festuca arundinacea Schreb.) and associated soil microbial activity

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Mingming; Fu, Dengqiang; Teng, Ying; Shen, Yuanyuan; Luo, Yongming; Li, Zhengao [Chinese Academy of Sciences, Nanjing (China). Key Laboratory of Soil Environment and Pollution Remediation; Christie, Peter [Agri-Food and Biosciences Institute, Belfast (United Kingdom). Agri-Environment Branch

    2011-09-15

    Purpose: A 7-month field experiment was conducted to investigate the polycyclic aromatic hydrocarbon (PAH) remediation potential of two plant species and changes in counts of soil PAH-degrading bacteria and microbial activity. Materials and methods: Alfalfa and tall fescue were grown in monoculture and intercropped for 7 months in contaminated field soil. Soil and plant samples were analyzed for PAHs. Plant biomass, densities of PAH-degradation soil bacteria, soil microbial biomass C and N, enzyme activities, and the physiological profile of the soil microbial community were determined. Results and discussion: Average removal percentage of total PAHs in intercropping (30.5%) was significantly higher than in monoculture (19.9%) or unplanted soil (-0.6%). About 7.5% of 3-ring, 12.3% of 4-ring, and 17.2% of 5(+6)-ring PAHs were removed from the soil by alfalfa, with corresponding values of 25.1%, 10.4%, and 30.1% for tall fescue. Intercropping significantly enhanced the remediation efficiency. About 18.9% of 3-ring, 30.9% of 4-ring, and 33.4% of 5(+6)-ring PAHs were removed by the intercropping system. Higher counts of soil culturable PAH-degrading bacteria and elevated microbial biomass and enzyme activities were found after intercropping. Soil from intercropping showed significantly higher (p < 0.05) average well-color development obtained by the BIOLOG Ecoplate assay and Shannon-Weaver index compared with monoculture. Conclusions: Cropping promoted the dissipation of soil PAHs. Tall fescue gave greater removal of soil PAHs than alfalfa, and intercropping was more effective than monoculture. Intercropping of alfalfa and tall fescue may be a promising in situ bioremediation strategy for PAH-contaminated soils. (orig.)

  5. Glyphosate epidemiology expert panel review: a weight of evidence systematic review of the relationship between glyphosate exposure and non-Hodgkin's lymphoma or multiple myeloma.

    Science.gov (United States)

    Acquavella, John; Garabrant, David; Marsh, Gary; Sorahan, Tom; Weed, Douglas L

    2016-09-01

    We conducted a systematic review of the epidemiologic literature for glyphosate focusing on non-Hodgkin's lymphoma (NHL) and multiple myeloma (MM) - two cancers that were the focus of a recent review by an International Agency for Research on Cancer Working Group. Our approach was consistent with Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines for systematic reviews. We evaluated each relevant study according to a priori criteria for study quality: adequacy of study size, likelihood of confounding, potential for other biases and adequacy of the statistical analyses. Our evaluation included seven unique studies for NHL and four for MM, all but one of which were case control studies for each cancer. For NHL, the case-control studies were all limited by the potential for recall bias and the lack of adequate multivariate adjustment for multiple pesticide and other farming exposures. Only the Agricultural Health (cohort) Study met our a priori quality standards and this study found no evidence of an association between glyphosate and NHL. For MM, the case control studies shared the same limitations as noted for the NHL case-control studies and, in aggregate, the data were too sparse to enable an informed causal judgment. Overall, our review did not find support in the epidemiologic literature for a causal association between glyphosate and NHL or MM.

  6. An assessment of the acute dietary exposure to glyphosate using deterministic and probabilistic methods.

    Science.gov (United States)

    Stephenson, C L; Harris, C A; Clarke, R

    2018-02-01

    Use of glyphosate in crop production can lead to residues of the active substance and related metabolites in food. Glyphosate has never been considered acutely toxic; however, in 2015 the European Food Safety Authority (EFSA) proposed an acute reference dose (ARfD). This differs from the Joint FAO/WHO Meeting on Pesticide Residues (JMPR) who in 2016, in line with their existing position, concluded that an ARfD was not necessary for glyphosate. This paper makes a comprehensive assessment of short-term dietary exposure to glyphosate from potentially treated crops grown in the EU and imported third-country food sources. European Union and global deterministic models were used to make estimates of short-term dietary exposure (generally defined as up to 24 h). Estimates were refined using food-processing information, residues monitoring data, national dietary exposure models, and basic probabilistic approaches to estimating dietary exposure. Calculated exposures levels were compared to the ARfD, considered to be the amount of a substance that can be consumed in a single meal, or 24-h period, without appreciable health risk. Acute dietary intakes were Probabilistic exposure estimates showed that the acute intake on no person-days exceeded 10% of the ARfD, even for the pessimistic scenario.

  7. EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

    Science.gov (United States)

    Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

    2016-08-12

    Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance.

  8. Approche expérimentale de l'utilisation de glyphosate dans le ...

    African Journals Online (AJOL)

    Approche expérimentale de l'utilisation de glyphosate dans le contrôle de Melaleuca quinquenervia (Myrtaceae), une espèce envahissante dans la réserve communautaire de la forêt d'Analalava-Foulpointe (Madagascar)

  9. Chopper GEN2 + Glyphosate efficacy for height classes of hardwood sprouts recolonizing six clearcut pine sites

    Science.gov (United States)

    Jimmie Yeiser; Andrew Ezell

    2015-01-01

    The purpose of this study was to assess sprout size as a determinant of subsequent control by a standard, single rate of imazapyr +glyphosate applied during site preparation. All study sites were in the hilly upper coastal plain of Mississippi (Winston or Oktibbeha Counties) or Louisiana (Sabine or Winn Parishes) and supported loblolly pine (Pinus taeda L.) plantations...

  10. Effect of 2,4-D and atrazine when applied with glyphosate ripener

    Science.gov (United States)

    Management of late-season morningglory infestations in sugarcane is accomplished with aerial applications of the postemergence herbicides 2,4-D, dicamba, or atrazine. Likewise, the aerial application of glyphosate prior to harvest to improve stalk sucrose levels is a common practice for many Louisia...

  11. Changes in microbial community structure following herbicide (glyphosate) additions to forest soils

    Science.gov (United States)

    Alice W. Ratcliff; Matt D. Busse; Carol J. Shestak

    2006-01-01

    Glyphosate applied at the recommended field rate to a clay loam and a sandy loam forest soil resulted in few changes in microbial community structure. Total and culturable bacteria, fungal hyphal length, bacterial:fungal biomass, carbon utilization profiles (BIOLOG), and bacterial and fungal phospholipid fatty acids (PLFA) were unaffected 1, 3, 7, or 30 days...

  12. Effects of increasing use of trifluralin and glyphosate on the microbial activity of a lea soil

    International Nuclear Information System (INIS)

    Barros, Edna Santos de; Monteiro, Regina Teresa Rosim; Peixoto, Maria de Fatima da Silva Pinto; Fay, Elizabeth Francisconi

    1997-01-01

    This work considers the importance of the glyphosate and trifluralin, which are the most used herbicides by the brazilian plantations, applying approximately fifteen and nine millions of liters by crop, respectively, for the evaluation of the increasing use of these herbicides effects on the microbial activity of a lea soil which are used for beans cultivation

  13. 2,4-D and Glyphosate affect aquatic biofilm accrual, gross primary production, and community respiration

    Directory of Open Access Journals (Sweden)

    Lawton E. Shaw

    2016-10-01

    Full Text Available 2,4-Dichlorophenoxyacetic acid (2,4-D and glyphosate are widely used agricultural herbicides commonly found in surface waters near cultivated land. Field experiments were conducted to determine the effects of 2,4-D and glyphosate on biofilms in a pond next to agricultural land in Athabasca, Alberta. Contaminant-exposure substrates (CES consisted of GF/C glass fiber or a cellulose filter paper substrates placed on specimen jars filled with agar that contained low levels of nitrogen and phosphorus, and different concentrations (15, 9.0, 1.5 mM of either 2,4-D or glyphosate. Nutrients and herbicide diffused freely through the agar to the substrate surface. CES arrays were deployed 15 cm below the water surface for 22 days, after which biofilms were collected and biomass (chlorophyll a, autotroph gross primary production (GPP, and heterotroph community respiration (CR were measured. 2,4-D (15 mM caused significant decreases in rates of biomass accrual (−22%, GPP (−34%, and CR(−63%. Glyphosate (15 mM also caused significant decreases in rates of biomass accrual (−50%, GPP (−67%, and CR (−47%. For the contaminant concentrations used, mean flux rates are estimated to be between 50–700 ng cm−2 min−1.

  14. Use of Glyphosate and Imazapyr for Cogongrass (Imperata cylindrica) management in southern pine forests

    Science.gov (United States)

    Patrick J. Minogue; James H. Miller; Dwight K. Lauer

    2012-01-01

    Cogongrass (Imperata cylindrica [L.] P. Beauv. var. major [Nees] C.E. Hubb) is one of the most invasive perennial grasses worldwide and has progressively infested managed and natural habitats in the mid-South over the past 100 years. To extend past research toward the goal of eradication on forested sites, we tested the most effective herbicides (glyphosate and...

  15. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    Directory of Open Access Journals (Sweden)

    Cristiane Fortes Gris

    2013-04-01

    Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.

  16. Effects of cattle grazing, glyphosate, and prescribed burning on fountaingrass fuel loading in Hawai`i

    Science.gov (United States)

    J.M. Castillo; G. Enriques; M. Nakahara; D. Weise; L. Ford; R. Moraga; R. Vihnanek

    2007-01-01

    Crimson fountaingrass (Pennisetum setaceum) is a nonnative invasive grass that has occupied a significant portion of the western side of the island of Hawai`i. As a result, several fires in excess of 4,049 ha have occurred in the area over the past 20 y. We are studying the effectiveness of cattle grazing, aerial application of glyphosate herbicide, and prescribed...

  17. Severe adverse effects related to dermal exposure to a glyphosate-surfactant herbicide

    DEFF Research Database (Denmark)

    Mariager, T P; Madsen, P V; Ebbehøj, N E

    2013-01-01

    This is a case of severe chemical burns following prolonged accidental exposure to a glyphosate-surfactant herbicide. The patient developed local swelling, bullae and exuding wounds. Neurological impairment followed affecting finger flexion and sensation with reduced nerve conduction. Imaging rev...

  18. Ascorbic Acid Alleviates Damage from Heat Stress in the Photosystem II of Tall Fescue in Both the Photochemical and Thermal Phases

    Directory of Open Access Journals (Sweden)

    Ke Chen

    2017-08-01

    Full Text Available L-Ascorbate (Asc plays important roles in plant development, hormone signaling, the cell cycle and cellular redox system, etc. The higher content of Asc in plant chloroplasts indicates its important role in the photosystem. The objective of this study was to study the roles of Asc in tall fescue leaves against heat stress. After a heat stress treatment, we observed a lower value of the maximum quantum yield for primary photochemistry (φPo, which reflects the inhibited activity of the photochemical phase of photosystem II (PSII. Moreover, we observed a higher value of efficiency of electron transfer from QB to photosystem I acceptors (δR0, which reflects elevated activity of the thermal phase of the photosystem of the tall fescue. The addition of Asc facilitate the behavior of the photochemical phase of the PSII by lowering the ROS content as well as that of the alternative electron donor to provide electron to the tyrosine residue of the D1 protein. Additionally, exogenous Asc reduces the activity of the thermal phase of the photosystem, which could contribute to the limitation of energy input into the photosystem in tall fescue against heat stress. Synthesis of the Asc increased under heat stress treatment. However, under heat stress this regulation does not occur at the transcription level and requires further study.

  19. Co-biosorption of copper and glyphosate by Ulva lactuca.

    Science.gov (United States)

    Trinelli, María Alcira; Areco, María Mar; Afonso, María dos Santos

    2013-05-01

    This study investigated the adsorption of glyphosate (PMG) onto the green algae Ulva lactuca. PMG was not adsorbed by U. lactuca but PMG was adsorbed when the process was mediated by Cu(II) with molar ratios Cu(II):PMG≥1.5:1. U. lactuca was characterized by water adsorption surface area, FTIR, SEM and EDS. The Langmuir and Freundlich models were applied. Results showed that the biosorption processes for copper and PMG in the presence of copper were described described by the Langmuir model (qmax=0.85±0.09 mmol g(-1), KL=0.55±0.14 l mmol(-1) and qmax=3.65±0.46 mmol g(-1), KL=0.103±0.03 l mmol(-1), respectively). Copper adsorption was greater in the presence of PMG than in the absence of the pesticide and the adsorption can only be represented by the Freundlich model (KF=0.08±0.01, 1/n=1.86±0.07). In all cases studied, the maximum metal uptake (qmax) increased with increasing pH. Surface complexes with a stoichiometry ranging from ≡Cu-PMG-Cu to ≡Cu-PMG-Cu3 are suggested as reaction products of the process. Due to the increasing amounts of PMG applied in Argentina, natural reservoirs present considerable amounts of this herbicide. The value of this work resides in using U. lactuca, a marine seaweed commonly found along coastlines all over the world, as a biosorbent for PMG. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Suscetibilidade de duas Gramas-boiadeiras a diferentes formulações de glyphosate

    Directory of Open Access Journals (Sweden)

    Ananda Scherner

    2014-03-01

    Full Text Available A utilização do herbicida glyphosate para o controle químico das espécies de gramas-boiadeiras nas lavouras orizícolas não tem se mostrado eficiente. Nesse contexto, a investigação do controle dessas espécies com o glyphosate torna-se de fundamental importância, uma vez que não estão disponíveis no mercado herbicidas seletivos para o controle dessas em pós-emergência na cultura do arroz irrigado. Em vista do exposto, o objetivo do presente estudo foi avaliar a suscetibilidade das gramas-boiadeiras a diferentes formulações de glyphosate. Foram conduzidos dois experimentos em casa de vegetação em esquema fatorial. No primeiro experimento, o fator A constituiu-se de duas formulações de glyphosate (sal potássico e isopropilamina e o fator B de nove doses dos herbicidas (zero; 175; 350; 700; 1400; 2800; 5600; 11200; 22400g e.a. ha-1. No segundo experimento, o fator A constituiu-se de duas espécies de gramas-boiadeiras (Leersia hexandra e Luziola peruviana, o fator B de três formulações do glyphosate (sal amônio, potássico e isopropilamina e o fator C de nove doses dos herbicidas (zero; 87,5; 175; 350; 700; 1400; 2800; 5600; 11200g e.a. ha-1. Com base nos resultados obtidos, foi possível observar que as espécies apresentaram diferença de suscetibilidade ao herbicida glyphosate. Além disso, Leersia hexandra foi mais sensível em comparação a Luziola peruviana. As formulações de glyphosate influenciaram na suscetibilidade das espécies ao controle, sendo que, Roundup Transorb R® e Roundup Ultra® proporcionam melhor controle das espécies de gramas-boiadeiras.

  1. Manejo de Conyza bonariensis resistente ao glyphosate: coberturas de inverno e herbicidas em pré-semeadura da soja Management of glyphosate resistant Conyza bonariensis: winter cover crops and herbicides in soybean pre-seeding

    Directory of Open Access Journals (Sweden)

    F.P. Lamego

    2013-06-01

    Full Text Available Conyza bonariensis tornou-se a principal planta daninha da cultura da soja no Sul do Brasil, em decorrência da evolução para resistência ao herbicida glyphosate. O objetivo deste trabalho foi avaliar o efeito de diferentes coberturas de inverno e da associação de manejo de dessecação pré-semeadura da soja, visando ao controle de C. bonariensis resistente ao glyphosate. Um experimento foi conduzido em campo, na safra 2010/2011. Os tratamentos foram conduzidos em esquema de parcelas subdivididas, em que as coberturas de inverno foram alocadas nas parcelas principais: aveia-preta, nabo, ervilhaca, azevém, trigo e pousio. Nas subparcelas, foram alocados os tratamentos de manejo de dessecação pré-semeadura da soja: glyphosate (720 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha‑1 e roçada. O nabo foi a espécie de cobertura que produziu o maior volume de massa seca durante o inverno, enquanto a ervilhaca foi a que apresentou maior efeito supressor sobre a germinação e o desenvolvimento inicial de C. bonariensis. Associações de glyphosate com 2,4-D ou chlorimuron-ethyl, seguidas da aplicação sequencial de paraquat + diuron, causaram maior redução na infestação de C. bonariensis.Conyza bonariensis became the main weed in soybean crop in Southern Brazil, as a consequence of the evolution of resistance to the herbicide glyphosate. The objective of this work was to evaluate the effect of different winter cover crops and the association of burn-down herbicides on the control of glyphosate-resistant C. bonariensis. A field experiment was conducted in the 2010/2011 season. The treatments were arranged in a split-plot scheme, with the winter

  2. Glyphosate Dissipation in Different Soils Under No-Till and Conventional Till

    Science.gov (United States)

    Okada, Elena; Costa, Jose Luis; Francisco, Bedmar

    2017-04-01

    Glyphosate is the most used herbicide in Argentina, accounting for 62% of the commercialized pesticides in the market. It is used as a weed controller in chemical fallow under no-till systems, and it is also applied in various genetically modified crops (e.g. soybean, corn, cotton). Though it has a high solubility in water, it tends to adsorb and accumulate in agricultural soils. The description of glyphosate biodegradation in soils with a long term history under agricultural practices is of interest. The main objectives of this work were to compare the dissipation of glyphosate and the accumulation of its metabolite aminomethylphosphonic acid (AMPA) over time in three soils from Argentina. The studied soils belong to areas of high agronomic land use and different edaphoclimatic conditions, situated in Manfredi (MAN), Pergamino (PER) and Paraná (PAR). Soil samples were taken from long-term field trials with a history of more than 16 years under no-till and conventional tillage management. To study glyphosate dissipation in soil under controlled laboratory conditions, 400 g of dry soil sample were placed in 1.5 L flasks. A dose corresponding to 6 L ha-1 of commercial glyphosate ATANOR II® (35.6 % a.i.) was applied on day 0. The dose applied was equivalent to a final concentration in soil of 4000 μg Kg-1 of active ingredient. The moisture of the soil samples was kept at 60 % of the field capacity. Samples were incubated in the dark at a constant temperature of 22°C ± 1°C. A sub-sample of 5 g was taken from each flask at day 0 (after application), 1, 3, 7, 15, 20, 28, 44 and 62. Glyphosate and AMPA in soil samples was extracted with a strong basic solution (100 mM Na2B4O7•10H2O/ 100 mM K3PO4, pH=9) and then derivitazed with FMOC-Cl. Detection and quantification of the compounds was performed by ultra-performance liquid chromatography coupled with a mass spectrometer (UPLC MS/MS). The results showed that forty percent of the applied glyphosate was degraded

  3. Agricultural non-point source pollution of glyphosate and AMPA at a catchment scale

    Science.gov (United States)

    Okada, Elena; Perez, Debora; De Geronimo, Eduardo; Aparicio, Virginia; Costa, Jose Luis

    2017-04-01

    Information on the actual input of pesticides into the environment is crucial for proper risk assessment and the design of risk reduction measures. The Crespo basin is found within the Balcarce County, located south-east of the Buenos Aires Province. The whole basin has an area of approximately 490 km2 and the river has a length of 65 km. This study focuses on the upper basin of the Crespo stream, covering an area of 226 km2 in which 94.7% of the land is under agricultural production representing a highly productive area, characteristic of the Austral Pampas region. In this study we evaluated the levels of glyphosate and its metabolite aminomethylphosphonic acid (AMPA) in soils; and the non-point source pollution of surface waters, stream sediments and groundwater, over a period of one year. Stream water samples were taken monthly using propylene bottles, from the center of the bridge. If present, sediment samples from the first 5 cm were collected using cylinder samplers. Groundwater samples were taken from windmills or electric pumps from different farms every two months. At the same time, composite soil samples (at 5 cm depth) were taken from an agricultural plot of each farm. Samples were analyzed for detection and quantification of glyphosate and AMPA using ultra-performance liquid chromatography coupled to a mass spectrometer (UPLC-MS/MS). The limit of detection (LD) in the soil samples was 0.5 μg Kg-1 and the limit of quantification (LQ) was 3 μg Kg-1, both for glyphosate and AMPA. In water samples the LD was 0.1 μg L-1 and the LQ was 0.5 μg L-1. The results showed that the herbicide dispersed into all the studied environmental compartments. Glyphosate and AMPA residues were detected in 34 and 54% of the stream water samples, respectively. Sediment samples had a higher detection frequency (>96%) than water samples, and there was no relationship between the presence in surface water with the detection in sediment samples. The presence in sediment samples

  4. A model based on spectrofluorimetry to study the interaction between glyphosate and serum albumin of Salminus brasiliensis

    Science.gov (United States)

    Escobar, Marta Araujo Cyrino; Cortez, Celia Martins; Silva, Dilson; Neto, Jayme da Cunha Bastos

    2017-11-01

    The aim of this work is to initiate an investigation on the albumin of Salminus brasiliensis (gold fish) as a biomarker of environmental actions of glyphosate. We started using a mathematical-computational model based on spectrofluorimetric measurements to study the interaction of glyphosate with gold fish albumin and human serum albumin. Salminus brasiliensis is a migratory freshwater fish species found in southern and central-western Brazil, mainly in the Prata river basin, where most of soybean plantations are set. Glyphosate is a very used herbicide in this type of crop. Differently from the organophosphorate methyl parathion, glyphosate does not form complex with HSA, and the quenching constants estimated for its binding with gold fish albumin at 20 °C and 25 °C is 1.3(± 0.3) × 104 / M e 2.5 (± 0.3) × 104 / M, respectively.

  5. Salt Tolerance

    OpenAIRE

    Xiong, Liming; Zhu, Jian-Kang

    2002-01-01

    Studying salt stress is an important means to the understanding of plant ion homeostasis and osmo-balance. Salt stress research also benefits agriculture because soil salinity significantly limits plant productivity on agricultural lands. Decades of physiological and molecular studies have generated a large body of literature regarding potential salt tolerance determinants. Recent advances in applying molecular genetic analysis and genomics tools in the model plant Arabidopsis thaliana are sh...

  6. Does nitrogen fertilization history affects short-term microbial responses and chemical properties of soils submitted to different glyphosate concentrations?

    Directory of Open Access Journals (Sweden)

    Elodie Nivelle

    Full Text Available The use of nitrogen (N fertilizer and glyphosate-based herbicides is increasing worldwide, with agriculture holding the largest market share. The agronomic and socioeconomic utilities of glyphosate are well established; however, our knowledge of the potential effects of glyphosate applied in the presence or absence of long-term N fertilization on microbial functional activities and the availability of soil nutrients remains limited. Using an ex situ approach with soils that did (N+ or did not (N0 receive synthetic N fertilization for 6 years, we assessed the impact of different rates (no glyphosate, CK; field rate, FR; 100 × field rate, 100FR of glyphosate application on biological and chemical parameters. We observed that, after immediate application (1 day, the highest dose of glyphosate (100FR negatively affected the alkaline phosphatase (AlP activity in soils without N fertilization history and decreased the cation exchange capacity (CEC in N0 compared to CK and FR treatments with N+. Conversely, the 100FR application increased nitrate (NO3- and available phosphorus (PO43- regardless of N fertilization history. Then, after 8 and 15 days, the N+\\100FR and N+\\FR treatments exhibited the lowest values for dehydrogenase (DH and AlP activities, respectively, while urease (URE activity was mainly affected by N fertilization. After 15 days and irrespective of N fertilization history, the FR glyphosate application negatively affected the degradation of carbon substrates by microbial communities (expressed as the average well color development, AWCD. By contrast, the 100FR treatment positively affected AWCD, increasing PO43- by 5 and 16% and NO3- by 126 and 119% in the N+ and N0 treatments, respectively. In addition, the 100FR treatment resulted in an increase in the average net nitrification rate. Principal component analysis revealed that the 100FR glyphosate treatment selected microbial communities that were able to metabolize amine substrates

  7. Effects of supplementing endophyte-infected tall fescue with sainfoin and polyethylene glycol on the physiology and ingestive behavior of sheep.

    Science.gov (United States)

    Catanese, F; Distel, R A; Villalba, J J

    2014-02-01

    Tannins in sainfoin (Onobrychis viciifolia) may bind to alkaloids in endophyte-infected tall fescue [E+; Lolium arundinaceum (Schreb.) Darbysh.] and attenuate toxicosis. If so, supplementing E+ with sainfoin will increase use of E+ by sheep, and polyethylene glycol (PEG)-a polymer that selectively binds to tannins-will reduce such response. To test these predictions, thirty-six 2-mo-old lambs were randomly assigned to 3 treatments (12 lambs/treatment). During exposure, all lambs were individually penned and fed E+ supplemented with beet pulp (CTRL), fresh-cut sainfoin and beet pulp (SAIN), or fresh-cut sainfoin plus PEG mixed in beet pulp (SAIN+PEG). Feed intake was measured daily. Rectal temperatures and jugular blood samples were taken at the beginning and end of exposure. After exposure, all lambs were offered choices between endophyte-free tall fescue (E-) and orchardgrass, and preference for E- was assessed. Then, all lambs were allowed to graze a choice of E+ and sainfoin or a monoculture of E+. The foraging behavior of lambs was recorded. When sainfoin was in mid-vegetative stage, lambs in SAIN ingested more E+ than lambs in CTRL (P = 0.05), but no differences were detected between lambs in SAIN+PEG and CTRL (P = 0.12). Sainfoin supplementation improved some physiological parameters indicative of fescue toxicosis. Lambs in SAIN had lower rectal temperatures (P = 0.02), greater numbers of leukocytes (P 0.05). On the other hand, when they grazed on a monoculture of E+, lambs in SAIN+PEG showed greater acceptance of E+ than lambs in SAIN or in CTRL (P < 0.05). In summary, sainfoin supplementation alleviated several of the classic signs of fescue toxicosis and increased intake of endophyte-infected tall fescue. Tannins in sainfoin partially accounted for this benefit since feeding a polymer that selectively binds to tannins (PEG) attenuated some these responses. However, sainfoin supplementation during initial exposure to E+ did not lead to an increased

  8. Variabilidade genética e sensibilidade de acessos de Pistia stratiotes ao herbicida glyphosate Genetic variability and sensitivity of Pistia stratiotes accesses to glyphosate

    Directory of Open Access Journals (Sweden)

    E.A.S. Cícero

    2007-09-01

    Full Text Available A alface-d'água (Pistia stratiotes é uma das principais entre as macrófitas aquáticas que causam problemas em corpos hídricos no Brasil e são consideradas como plantas daninhas. O presente trabalho foi realizado com os objetivos de conhecer melhor a variabilidade genética dessa macrófita e relacionar essa variabilidade com a resposta à aplicação do herbicida glyphosate. Para isso, foram coletados indivíduos em 12 corpos hídricos em diferentes cidades do território nacional (Americana, Cambaratiba, Curitiba, Itapura, Jaboticabal, Lagoa Santa, Piraí, Rio Grande, Rubinéia, Salto Grande, Santa Gertrudes e Três Lagoas. Os acessos foram caracterizados pelo uso de marcadores RAPD (DNA Polimórfico Amplificado ao Acaso, que permitiram, com o auxílio de iniciadores aleatórios, a caracterização dos locos polimórficos identificados por uma matriz de ausência e presença de bandas. Utilizando essa matriz, a análise de agrupamento permitiu nítida classificação dos acessos em três grupos com diferenças genéticas entre eles. Um ensaio de controle químico, com plantas mantidas em vasos plásticos (5 L e pulverizadas com o herbicida glyphosate nas concentrações de 0,0, 0,6, 1,2, 1,8 e 2,4 kg ha-1, identificou, utilizando avaliações aos 7, 14 e 21 dias após aplicação, que as duas maiores doses promoveram melhor efeito herbicida. Foi verificado também que os acessos de Curitiba e Cambaratiba apresentaram menor suscetibilidade ao herbicida glyphosate. Não houve correspondência entre a estrutura de grupos dos acessos pela análise multivariada de agrupamento com a técnica RAPD e a suscetibilidade da alface-d'água ao glyphosate.Water lettuce (Pistia stratiotes is one the most important macrophytes, classified as weed and causing serious problems in watercourses in Brazil. The aim of this research was to evaluate the genetic variability of water lettuce and its relationship with this plant's susceptibility to glyphosate

  9. Effects of EPSPS Copy Number Variation (CNV and Glyphosate Application on the Aromatic and Branched Chain Amino Acid Synthesis Pathways in Amaranthus palmeri

    Directory of Open Access Journals (Sweden)

    Manuel Fernández-Escalada

    2017-11-01

    Full Text Available A key enzyme of the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19, is the known target of the widely used herbicide glyphosate. Glyphosate resistance in Amaranthus palmeri, one of the most troublesome weeds in agriculture, has evolved through increased EPSPS gene copy number. The aim of this work was to study the pleiotropic effects of (i EPSPS increased transcript abundance due to gene copy number variation (CNV and of (ii glyphosate application on the aromatic amino acid (AAA and branched chain amino acid (BCAA synthesis pathways. Hydroponically grown glyphosate sensitive (GS and glyphosate resistant (GR plants were treated with glyphosate 3 days after treatment. In absence of glyphosate treatment, high EPSPS gene copy number had only a subtle effect on transcriptional regulation of AAA and BCAA pathway genes. In contrast, glyphosate treatment provoked a general accumulation of the transcripts corresponding to genes of the AAA pathway leading to synthesis of chorismate in both GS and GR. After chorismate, anthranilate synthase transcript abundance was higher while chorismate mutase transcription showed a small decrease in GR and remained stable in GS, suggesting a regulatory branch point in the pathway that favors synthesis toward tryptophan over phenylalanine and tyrosine after glyphosate treatment. This was confirmed by studying enzyme activities in vitro and amino acid analysis. Importantly, this upregulation was glyphosate dose dependent and was observed similarly in both GS and GR populations. Glyphosate treatment also had a slight effect on the expression of BCAA genes but no general effect on the pathway could be observed. Taken together, our observations suggest that the high CNV of EPSPS in A. palmeri GR populations has no major pleiotropic effect on the expression of AAA biosynthetic genes, even in response to glyphosate treatment. This finding supports the idea that the fitness cost associated

  10. Misturas em tanque com glyphosate para o controle de trapoeraba, erva-de-touro e capim-carrapicho em soja RR®

    Directory of Open Access Journals (Sweden)

    Cleber Daniel de Goes Maciel

    2011-02-01

    Full Text Available O uso de misturas de glyphosate, em tanque, para manejo de espécies de plantas daninhas de difícil controle tem sido prática comum entre os agricultores brasileiros. Desta forma, este trabalho teve como objetivo avaliar a eficácia e seletividade de misturas, em tanque, de herbicidas com glyphosate para o controle de trapoeraba (Commelina benghalensis L., erva-de-touro (Tridax procumbens L. e capim-carrapicho (Cenchrus echinatus L. na cultura da soja RR®. O experimento foi conduzido em Maracaí, São Paulo, no período de novembro de 2006 a março de 2007, utilizando-se o cultivar CD-214RR® e delineamento experimental de blocos ao acaso, com 21 tratamentos e quatro repetições. Os tratamentos foram constituídos da aplicação de: glyphosate (180; 360; 540 e 720 g ha-1; glyphosate em sequencial (180/360; 360/360 e 540/360 g ha-1; glyphosate + chlorimuron-ethyl 360+10; 540+10; 360+5/ 360+5 g ha-1; glyphosate + lactofen (360+120; 540+120; 360+60/ 360+60 g ha-1; glyphosate + cloransulam-methyl (360+30; 540+30; 360+16,9/ 360+12,9 g ha-1; glyphosate + carfentrazone (360+4 g ha-1; glyphosate + imazethapyr (360+50 g ha-1; glyphosate + imazethapyr (177,8+30 g ha-1 e testemunhas capinada e sem capina. Apesar da similaridade de produtividade de grãos entre os tratamentos com glyphosate isolado e sequencial, nas doses 540, 720 e 540/ 360 g ha-1, as misturas em tanque com chlorimuron-ethyl, cloransulam-methyl, lactofen e imazethapyr favoreceram o controle de espécies de plantas daninhas tolerantes ao glyphosate como C. benghalensis e T. procumbens.

  11. Dosage du glyphosate par HPLC après extraction et dérivation à l'O ...

    African Journals Online (AJOL)

    Le glyphosate, premier herbicide utilisé au monde est une molécule difficile à quantifier par la chromatographie en phase liquide à haute performance (HPLC), eu égard à l'absence de chromophore dans sa structure. La chimie analytique est donc à la recherche perpétuelle de méthodes de détermination du glyphosate ...

  12. Sorption and desorption of glyphosate, MCPA and tetracycline and their mixtures in soil as influenced by phosphate.

    Science.gov (United States)

    Munira, Sirajum; Farenhorst, Annemieke

    2017-12-02

    Phosphate fertilizers and herbicides such as glyphosate and MCPA are commonly applied to agricultural land, and antibiotics such as tetracycline have been detected in soils following the application of livestock manures and biosolids to agricultural land. Utilizing a range of batch equilibrium experiments, this research examined the competitive sorption interactions of these chemicals in soil. Soil samples (0-15 cm) collected from long-term experimental plots contained Olsen P concentrations in the typical (13 to 20 mg kg -1 ) and elevated (81 to 99 mg kg -1 ) range of build-up phosphate in agricultural soils. The elevated Olsen P concentrations in field soils significantly reduced glyphosate sorption up to 50%, but had no significant impact on MCPA and tetracycline sorption. Fresh phosphate additions in the laboratory, introduced to soil prior to, or at the same time with the other chemical applications, had a greater impact on reducing glyphosate sorption (up to 45%) than on reducing tetracycline (up to 13%) and MCPA (up to 8%) sorption. The impact of fresh phosphate additions on the desorption of these three chemicals was also statistically significant, but numerically very small namely glyphosate and tetracycline and 3% for MCPA. The presence of MCPA significantly reduced sorption and increased desorption of glyphosate, but only when MCPA was present at concentrations much greater than environmentally relevant and there was no phosphate added to the MCPA solution. Tetracycline addition had no significant effect on glyphosate sorption and desorption in soil. For the four chemicals studied, we conclude that when mixtures of phosphate, herbicides and antibiotics are present in soil, the greatest influence of their competitive interactions is phosphate decreasing glyphosate sorption and the presence of phosphate in solution lessens the potential impact of MCPA on glyphosate sorption. The presence of chemical mixtures in soil solution has an overall greater impact

  13. EMERGÊNCIA E ESTABELECIMENTO DE PLANTAS CULTIVADAS APÓS APLICAÇÃO DE GLYPHOSATE

    OpenAIRE

    BELUCI, Lucas Ribeiro; AZANIA, Carlos Alberto Mathias; VITORINO, Renan; AZANIA, Andrea Padua; GARCIA, Julio César; SILVA, Danilo Manoel da

    2014-01-01

    The research aimed to study the effect glyphosate doses, used in the sugarcane chemical destruction, on the emergence and early development of soybean, corn and peanut, sown in succession. An experiment was conducted for each crop in pots using a randomized design with treatments arranged in a 2 x 6 factorial and four replications with seeding times (1 and 12 days after application) and glyphosate doses (0, 1440, 2160, 2880, 3600 and 4320 g ha-1). The experimental units consisted of plast...

  14. Evaluation of carcinogenic potential of the herbicide glyphosate, drawing on tumor incidence data from fourteen chronic/carcinogenicity rodent studies

    OpenAIRE

    Greim, Helmut; Saltmiras, David; Mostert, Volker; Strupp, Christian

    2015-01-01

    Abstract Glyphosate, an herbicidal derivative of the amino acid glycine, was introduced to agriculture in the 1970s. Glyphosate targets and blocks a plant metabolic pathway not found in animals, the shikimate pathway, required for the synthesis of aromatic amino acids in plants. After almost forty years of commercial use, and multiple regulatory approvals including toxicology evaluations, literature reviews, and numerous human health risk assessments, the clear and consistent conclusions are ...

  15. The use of environmental metabolomics to determine glyphosate level of exposure in rapeseed (Brassica napus L.) seedlings

    International Nuclear Information System (INIS)

    Petersen, Iben Lykke; Tomasi, Giorgio; Sorensen, Hilmer; Boll, Esther S.; Hansen, Hans Christian Bruun; Christensen, Jan H.

    2011-01-01

    Metabolic profiling in plants can be used to differentiate between treatments and to search for biomarkers for exposure. A methodology for processing Ultra-High-Performance Liquid Chromatography-Diode-Array-Detection data is devised. This methodology includes a scheme for selecting informative wavelengths, baseline removal, retention time alignment, selection of relevant retention times, and principal component analysis (PCA). Plant crude extracts from rapeseed seedling exposed to sublethal concentrations of glyphosate are used as a study case. Through this approach, plants exposed to concentrations down to 5 μM could be distinguished from the controls. The compounds responsible for this differentiation were partially identified and were different from those specific for high exposure samples, which suggests that two different responses to glyphosate are elicited in rapeseed depending on the level of exposure. The PCA loadings indicate that a combination of other metabolites could be more sensitive than the response of shikimate to detect glyphosate exposure. - Highlights: → A method for processing UHPLC-DAD data for plant metabolic profiling is devised. → The metabolic profiling approach is more sensitive to glyphosate exposure than shikimate. → Plants exposed to concentrations down to 5 μM can be distinguished from the controls. → Two different responses to glyphosate may be elicited in rapeseed depending on the level of exposure. - A novel untargeted environmental metabololomic approach is used to detect low-level glyphosate exposure of rapeseed seedlings.

  16. The use of environmental metabolomics to determine glyphosate level of exposure in rapeseed (Brassica napus L.) seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, Iben Lykke; Tomasi, Giorgio; Sorensen, Hilmer; Boll, Esther S.; Hansen, Hans Christian Bruun [Department of Basic Sciences and Environment, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C (Denmark); Christensen, Jan H., E-mail: jch@life.ku.dk [Department of Basic Sciences and Environment, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C (Denmark)

    2011-10-15

    Metabolic profiling in plants can be used to differentiate between treatments and to search for biomarkers for exposure. A methodology for processing Ultra-High-Performance Liquid Chromatography-Diode-Array-Detection data is devised. This methodology includes a scheme for selecting informative wavelengths, baseline removal, retention time alignment, selection of relevant retention times, and principal component analysis (PCA). Plant crude extracts from rapeseed seedling exposed to sublethal concentrations of glyphosate are used as a study case. Through this approach, plants exposed to concentrations down to 5 {mu}M could be distinguished from the controls. The compounds responsible for this differentiation were partially identified and were different from those specific for high exposure samples, which suggests that two different responses to glyphosate are elicited in rapeseed depending on the level of exposure. The PCA loadings indicate that a combination of other metabolites could be more sensitive than the response of shikimate to detect glyphosate exposure. - Highlights: > A method for processing UHPLC-DAD data for plant metabolic profiling is devised. > The metabolic profiling approach is more sensitive to glyphosate exposure than shikimate. > Plants exposed to concentrations down to 5 {mu}M can be distinguished from the controls. > Two different responses to glyphosate may be elicited in rapeseed depending on the level of exposure. - A novel untargeted environmental metabololomic approach is used to detect low-level glyphosate exposure of rapeseed seedlings.

  17. Low doses of glyphosate enhance growth, CO2 assimilation, stomatal conductance and transpiration in sugarcane and eucalyptus.

    Science.gov (United States)

    Nascentes, Renan F; Carbonari, Caio A; Simões, Plinio S; Brunelli, Marcela C; Velini, Edivaldo D; Duke, Stephen O

    2018-05-01

    Sublethal doses of herbicides can enhance plant growth and stimulate other process, an effect known as hormesis. The magnitude of hormesis is dependent on the plant species, the herbicide and its dose, plant development stage and environmental parameters. Glyphosate hormesis is well established, but relatively little is known of the mechanism of this phenomenon. The objective of this study was to determine if low doses of glyphosate that cause growth stimulation in sugarcane and eucalyptus concomitantly stimulate CO 2 assimilation. Shoot dry weight in both species increased at both 40 and 60 days after application of 6.2 to 20.2 g a.e. ha -1 glyphosate. The level of enhanced shoot dry weight was 11 to 37%, depending on the time after treatment and the species. Concomitantly, CO 2 assimilation, stomatal conductance and transpiration were increased by glyphosate doses similar to those that caused growth increases. Glyphosate applied at low doses increased the dry weight of sugarcane and eucalyptus plants in all experiments. This hormetic effect was related to low dose effects on CO 2 assimilation rate, stomatal conductance and transpiration rate, indicating that low glyphosate doses enhance photosynthesis of plants. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Photocatalytic mineralization of glyphosate in a small-scale plug flow simulation reactor by UV/TiO2.

    Science.gov (United States)

    Chen, Jian Q; Hu, Zhi J; Wang, Nan X

    2012-01-01

    The present work involves the photocatalytic mineralization of glyphosate on a plug flow reactor by UV/TiO(2). The effect of catalyst loading shows an optimal value (0.4 g L(-1)) which is necessary to mineralize glyphosate. The kinetic rate of glyphosate mineralization decreases with the increasing initial concentration of glyphosate, and the data can be described using the first-order model. An alkaline environment is conducive to glyphosate mineralization. The mineralization efficiency increases with elevated flow rate to 114 mL min(-1), which is followed by a decrease with a further increase in flow rate due to the reduction of the residence time. The presence of external oxidants (K(2)S(2)O(8), H(2)O(2) and KBrO(3)) and photosencitizer (humic acid) can significantly enhance glyphosate mineralization. Photocatalysis oxidation ability of the three studied oxidants decrease in the order of: S(2)O(8)(2-) > BrO(3)(-) > H(2)O(2). Finally, the Langmuir-Hinshelwood (L-H) model was used to rationalize the mechanisms of reactions occurring on TiO(2) surfaces and L-H model constants were also determined. Copyright © Taylor & Francis Group, LLC

  19. Glyphosate toxicity and carcinogenicity: a review of the scientific basis of the European Union assessment and its differences with IARC.

    Science.gov (United States)

    Tarazona, Jose V; Court-Marques, Daniele; Tiramani, Manuela; Reich, Hermine; Pfeil, Rudolf; Istace, Frederique; Crivellente, Federica

    2017-08-01

    Glyphosate is the most widely used herbicide worldwide. It is a broad spectrum herbicide and its agricultural uses increased considerably after the development of glyphosate-resistant genetically modified (GM) varieties. Since glyphosate was introduced in 1974, all regulatory assessments have established that glyphosate has low hazard potential to mammals, however, the International Agency for Research on Cancer (IARC) concluded in March 2015 that it is probably carcinogenic. The IARC conclusion was not confirmed by the EU assessment or the recent joint WHO/FAO evaluation, both using additional evidence. Glyphosate is not the first topic of disagreement between IARC and regulatory evaluations, but has received greater attention. This review presents the scientific basis of the glyphosate health assessment conducted within the European Union (EU) renewal process, and explains the differences in the carcinogenicity assessment with IARC. Use of different data sets, particularly on long-term toxicity/carcinogenicity in rodents, could partially explain the divergent views; but methodological differences in the evaluation of the available evidence have been identified. The EU assessment did not identify a carcinogenicity hazard, revised the toxicological profile proposing new toxicological reference values, and conducted a risk assessment for some representatives uses. Two complementary exposure assessments, human-biomonitoring and food-residues-monitoring, suggests that actual exposure levels are below these reference values and do not represent a public concern.

  20. Optimization of liquid-state fermentation conditions for the glyphosate degradation enzyme production of strain Aspergillus oryzae by ultraviolet mutagenesis.

    Science.gov (United States)

    Fu, Gui-Ming; Li, Ru-Yi; Li, Kai-Min; Hu, Ming; Yuan, Xiao-Qiang; Li, Bin; Wang, Feng-Xue; Liu, Cheng-Mei; Wan, Yin

    2016-11-16

    This study aimed to obtain strains with high glyphosate-degrading ability and improve the ability of glyphosate degradation enzyme by the optimization of fermentation conditions. Spore from Aspergillus oryzae A-F02 was subjected to ultraviolet mutagenesis. Single-factor experiment and response surface methodology were used to optimize glyphosate degradation enzyme production from mutant strain by liquid-state fermentation. Four mutant strains were obtained and named as FUJX 001, FUJX 002, FUJX 003, and FUJX 004, in which FUJX 001 gave the highest total enzyme activity. Starch concentration at 0.56%, GP concentration at 1,370 mg/l, initial pH at 6.8, and temperature at 30°C were the optimum conditions for the improved glyphosate degradation endoenzyme production of A. oryzae FUJX 001. Under these conditions, the experimental endoenzyme activity was 784.15 U/100 ml fermentation liquor. The result (784.15 U/100 ml fermentation liquor) was approximately 14-fold higher than that of the original strain. The result highlights the potential of glyphosate degradation enzyme to degrade glyphosate.

  1. Infectious Tolerance

    OpenAIRE

    Jonuleit, Helmut; Schmitt, Edgar; Kakirman, Hacer; Stassen, Michael; Knop, Jürgen; Enk, Alexander H.

    2002-01-01

    Regulatory CD4+CD25+ T cells (Treg) are mandatory for maintaining immunologic self-tolerance. We demonstrate that the cell-cell contact–mediated suppression of conventional CD4+ T cells by human CD25+ Treg cells is fixation resistant, independent from membrane-bound TGF-β but requires activation and protein synthesis of CD25+ Treg cells. Coactivation of CD25+ Treg cells with Treg cell–depleted CD4+ T cells results in anergized CD4+ T cells that in turn inhibit the activation of conventional, ...

  2. Fitness Outcomes Related to Glyphosate Resistance in Kochia (Kochia scoparia: What Life History Stage to Examine?

    Directory of Open Access Journals (Sweden)

    Omobolanle Adewale Osipitan

    2017-06-01

    Full Text Available A fast-spreading weed, kochia (Kochia scoparia, has developed resistance to the widely-used herbicide, glyphosate. Understanding the relationship between the occurrence of glyphosate resistance caused by multiple EPSPS gene copies and kochia fitness may suggest a more effective way of controlling kochia. A study was conducted to assess fitness cost of glyphosate resistance compared to susceptibility in kochia populations at different life history stages, that is rate of seed germination, increase in plant height, days to flowering, biomass accumulation at maturity, and fecundity. Six kochia populations from Scott, Finney, Thomas, Phillips, Wallace, and Wichita counties in western Kansas were characterized for resistance to field-use rate of glyphosate and with an in vivo shikimate accumulation assay. Seed germination was determined in growth chambers at three constant temperatures (5, 10, and 15 C while vegetative growth and fecundity responses were evaluated in a field study using a target-neighborhood competition design in 2014 and 2015. One target plant from each of the six kochia populations was surrounded by neighboring kochia densities equivalent to 10 (low, 35 (moderate, or 70 (high kochia plants m−2. In 2015, neighboring corn densities equivalent to 10 and 35 plants m−2 were also evaluated. Treatments were arranged in a randomized complete block design with at least 7 replications. Three kochia populations were classified as glyphosate-resistant (GR [Scott (SC-R, Finney (FN-R, and Thomas (TH-R] and three populations were classified as glyphosate-susceptible (GS [Phillips (PH-S, Wallace (WA-S and Wichita (WI-S]. Of the life history stages measured, fitness differences between the GR and GS kochia populations were consistently found in their germination characteristics. The GR kochia showed reduced seed longevity, slower germination rate, and less total germination than the GS kochia. In the field, increases in plant height, biomass

  3. Glyphosate and adverse pregnancy outcomes, a systematic review of observational studies

    Directory of Open Access Journals (Sweden)

    Jessica S. A. de Araujo

    2016-06-01

    Full Text Available Abstract Background A study in frog and chicken embryos, and reports of a high incidence of birth defects in regions of intensive GM-soy planting have raised concerns on the teratogenic potential of glyphosate-based herbicides. These public concerns prompted us to conduct a systematic review of the epidemiological studies testing hypotheses of associations between glyphosate exposure and adverse pregnancy outcomes including birth defects. Methods A systematic and comprehensive literature search was performed in MEDLINE, TOXLINE, Bireme-BVS and SCOPUS databases using different combinations of exposure and outcome terms. A case–control study on the association between pesticides and congenital malformations in areas of extensive GM soy crops in South America, and reports on the occurrence of birth defects in these regions were reviewed as well. Results The search found ten studies testing associations between glyphosate and birth defects, abortions, pre-term deliveries, small for gestational date births, childhood diseases or altered sex ratios. Two additional studies examined changes of time-to-pregnancy in glyphosate-exposed populations. Except for an excess of Attention Deficit Hyperactivity Disorder - ADHD (OR = 3.6, 1.3-9.6 among children born to glyphosate appliers, no significant associations between this herbicide and adverse pregnancy outcomes were described. Evidence that in South American regions of intensive GM-soy planting incidence of birth defects is high remains elusive. Conclusions Current epidemiological evidence, albeit limited to a few studies using non-quantitative and indirect estimates and dichotomous analysis of exposures, does not lend support to public concerns that glyphosate-based pesticides might pose developmental risks to the unborn child. Nonetheless, owing to methodological limitations of existing analytical observational studies, and particularly to a lack of a direct measurement (urine and/or blood levels

  4. Identificação de biótipos de azevém (Lolium multiflorum resistentes ao herbicida glyphosate em pomares de maçã Identification of glyphosate-resistant ryegrass (Lolium multiflorum biotypes in apple orchards

    Directory of Open Access Journals (Sweden)

    L. Vargas

    2004-12-01

    Full Text Available O glyphosate é um herbicida de amplo espectro utilizado há mais de 15 anos em pomares de maçã na região de Vacaria-RS, para manejo da vegetação nas linhas da cultura. São realizadas, em geral, três a quatro aplicações por ciclo e a dose normalmente utilizada é de 720 a 1.080 g e.a. ha-1 de glyphosate (2 a 3 L ha-1 do produto comercial. O azevém (Lolium multiflorum é uma planta daninha comum em pomares e, tradicionalmente, sensível ao glyphosate. Entretanto, nos últimos anos a ocorrência de plantas de azevém que, após receberem o tratamento com glyphosate, não manifestam sintomas significativos de toxicidade sugere que elas adquiriram resistência ao produto. Assim, com o objetivo de avaliar a resposta de uma população de plantas de azevém ao glyphosate, foram realizados três experimentos: um em campo e dois em casa de vegetação. No experimento em campo os tratamentos avaliados constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880, 5.760 e 11.520 g e.a. ha-1, e os herbicidas paraquat, glufosinate, haloxyfop e diclofop foram empregados como produtos-padrão, aplicados em dois estádios vegetativos do azevém. No experimento em casa de vegetação, os tratamentos constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880 e 5.760 g e.a. ha-1 mais os herbicidas testemunhas, aplicados sobre plantas do biótipo considerado resistente e de um sensível. No segundo experimento realizado em casa de vegetação foram avaliados tratamentos contendo glyphosate (720, 1.440, 2.880, 720 + 720 e 720 + 1.440 g e.a. ha-1, em aplicações únicas e seqüenciais, mais os herbicidas paraquat, glufosinate, haloxyfop, clethodim, sethoxydim, diclofop, fenoxaprop, fluazifop, paraquat + diuron, atrazine + simazine, trifluralin e metolachlor. A toxicidade dos tratamentos herbicidas foi avaliada aos 15, 30 e 45 DAT (dias após tratamento. Os resultados obtidos nos experimentos em campo e em casa de vegetação, de forma

  5. Infectious Tolerance

    Science.gov (United States)

    Jonuleit, Helmut; Schmitt, Edgar; Kakirman, Hacer; Stassen, Michael; Knop, Jürgen; Enk, Alexander H.

    2002-01-01

    Regulatory CD4+CD25+ T cells (Treg) are mandatory for maintaining immunologic self-tolerance. We demonstrate that the cell-cell contact–mediated suppression of conventional CD4+ T cells by human CD25+ Treg cells is fixation resistant, independent from membrane-bound TGF-β but requires activation and protein synthesis of CD25+ Treg cells. Coactivation of CD25+ Treg cells with Treg cell–depleted CD4+ T cells results in anergized CD4+ T cells that in turn inhibit the activation of conventional, freshly isolated CD4+ T helper (Th) cells. This infectious suppressive activity, transferred from CD25+ Treg cells via cell contact, is cell contact–independent and partially mediated by soluble transforming growth factor (TGF)-β. The induction of suppressive properties in conventional CD4+ Th cells represents a mechanism underlying the phenomenon of infectious tolerance. This explains previously published conflicting data on the role of TGF-β in CD25+ Treg cell–induced immunosuppression. PMID:12119350

  6. Reduced absorption of glyphosate and decreased translocation of dicamba contribute to poor control of kochia (Kochia scoparia) at high temperature.

    Science.gov (United States)

    Ou, Junjun; Stahlman, Phillip W; Jugulam, Mithila

    2018-05-01

    Plant growth temperature is one of the important factors that can influence postemergent herbicide efficacy and impact weed control. Control of kochia (Kochia scoparia), a major broadleaf weed throughout the North American Great Plains, often is unsatisfactory when either glyphosate or dicamba are applied on hot summer days. We tested effects of plant growth temperature on glyphosate and dicamba phytotoxicity on two Kansas kochia populations (P1 and P2) grown under the following three day/night (d/n) temperature regimes: T1, 17.5/7.5°C; T2, 25/15°C; and T3, 32.5/22.5°C. Visual injury and above-ground dry biomass data from herbicide dose-response experiments indicated greater susceptibility to both glyphosate and dicamba when kochia was grown under the two cooler temperature regimes, i.e. T1 and T2. At T1, the ED 50 of P1 and P2 kochia were 39 and 36 g ha -1 of glyphosate and 52 and 105 g ha -1 of dicamba, respectively. In comparison, at T3 the ED 50 increased to 173 and 186 g ha -1 for glyphosate and 106 and 410 g ha -1 for dicamba, respectively, for P1 and P2. We also investigated the physiological basis of decreased glyphosate and dicamba efficacy under elevated temperatures. Kochia absorbed more glyphosate at T1 and T2 compared to T3. Conversely, there was more dicamba translocated towards meristems at T1 and T2, compared to T3. Reduced efficacy of dicamba or glyphosate to control kochia under elevated temperatures can be attributed to decreased absorption and translocation of glyphosate and dicamba, respectively. Therefore, it is recommended to apply glyphosate or dicamba when the temperature is low (e.g. d/n temperature at 25/15°C) and seedlings are small (less than 12 cm) to maximize kochia control. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  7. Extractable trace elements and sodium in Illinois coal-cleaning wastes: correlation with concentrations in tall fescue

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, B.G.

    1983-07-01

    Trace element concentrations in shoots of tall fescue (Festuca arundinacea Schreb.) were correlated with extractable element concentrations in five southern Illinois coal-cleaning wastes limed to pH 6.5, in a greenhouse study to determine applicability of soil tests to coal-waste evaluation. There was little or no correlation between shoot concentrations of Fe, and Fe extracted from the wastes by dilute acid (r equals 0.60), DTPA at pH 6.4 (r equals 0.47) or DTPA at pH 8.4 (r equals -0.17). The corresponding r values for Mn were 0.94, 0.97, and 0.96; for Zn, 0.96, 0.96, and 0.88; and for Cu, 0.67, 0.90, and 0.88, respectively. Shoot B correlated well with hot water-soluble B(r equals 0.96) and acid-soluble B(r equals 0.91). Correlations for shoot Na were also good with water-soluble Na and acid-soluble Na (r equals 0.96 in both cases). Concentrations of Al, As, Cd, Ni, Pb, and Se in the shoots were well below reported upper critical levels, and similar to concentrations in the grass grown on a silt loam under the same greenhouse conditions. 21 references.

  8. Prediction of the glyphosate sorption coefficient across two loamy agricultural fields

    DEFF Research Database (Denmark)

    Paradelo Pérez, Marcos; Norgaard, Trine; Moldrup, Per

    2015-01-01

    , suggesting that different properties control glyphosate sorption in different locations and at different scales of analysis. Better predictions were obtained for the best-four set for the field in Estrup (R2 = 0.87) and for both fields (R2 = 0.70), while the field in Silstrup showed a lower predictability (R......2 = 0.36). Possibly, the low predictability for the field in Silstrup originated from opposing gradients in clay and oxalate-extractable Fe across the field. Also, whereas a lower clay content in Estrup may be the limiting variable for glyphosate sorption, the field in Silstrup has a higher clay...... sorption coefficient, Kd, from easily measurable soil properties in two loamy, agricultural fields in Denmark: Estrup and Silstrup. Forty-five soil samples in Estrup and 65 in Silstrup were collected fromthe surface in a rectangular grid of 15 × 15-mfromeach field, and selected soil properties...

  9. Can Simple Soil Parameters Explain Field-Scale Variations in Glyphosate-, Bromoxyniloctanoate-, Diflufenican-, and Bentazone Mineralization?

    DEFF Research Database (Denmark)

    Norgaard, Trine; de Jonge, Lis Wollesen; Møldrup, Per

    2015-01-01

    The large spatial heterogeneity in soil physico-chemical and microbial parameters challenges our ability to predict and model pesticide leaching from agricultural land. Microbial mineralization of pesticides is an important process with respect to pesticide leaching since mineralization...... is the major process for the complete degradation of pesticides without generation of metabolites. The aim of our study was to determine field-scale variation in the potential for mineralization of the herbicides glyphosate, bromoxyniloctanoate, diflufenican, and bentazone and to investigate whether....... The mineralization potentials for glyphosate and bentazone were compared with 9-years leaching data from two horizontal wells 3.5 m below the field. The field-scale leaching patterns, however, could not be explained by the pesticide mineralization data. Instead, field-scale pesticide leaching may have been governed...

  10. Soil Properties Control Glyphosate Sorption in Soils Amended with Birch Wood Biochar

    DEFF Research Database (Denmark)

    Kahawaththa Gamage, Inoka Damayanthi Kumari; Moldrup, Per; Paradelo, Marcos

    2016-01-01

    Abstract Despite a contemporary interest in biochar application to agricultural fields to improve soil quality and long-term carbon sequestration, a number of potential side effects of biochar incorporation in field soils remain poorly understood, e.g., in relation to interactions...... with agrochemicals such as pesticides. In a fieldbased study at two experimental sites in Denmark (sandy loam soils at Risoe and Kalundborg), we investigated the influence of birch wood biochar with respect to application rate, aging (7–19 months), and physico- chemical soil properties on the sorption coefficient......, Kd (L kg−1), of the herbicide glyphosate. We measured Kd in equilibrium batch sorption experiments with triplicate soil samples from 20 field plots that received biochar at different application rates (0 to 100 Mg ha−1). The results showed that pure biochar had a lower glyphosate Kd value as compared...

  11. Science and Glyphosate: Questioning Orders. An Investigation in the Press in the Argentine Context

    Directory of Open Access Journals (Sweden)

    María Paula Blois

    2016-06-01

    Full Text Available In April 2009, the embryologist Andrés Carrasco made public in the newspaper Página 12 a research conducted in his laboratory on the damage caused by glyphosate, a key input for GMOs based agriculture. Released in the press before being subjected to peer review, research caused approvals and disproofs. Focusing on the actions of this embryologist and some events that took place following the publication in the newspaper, this work research the place of scientist that produced scientific knowledge while questioning his own role and his science. Pointing out that the study on glyphosate, the publication in the press and the question of the meaning of science that this scientist arises with insistence are part of the questioning of an order of things, concludes with a series of reflections about the possibility and type of questioning and possible changes